Energy Technology Data Exchange (ETDEWEB)
Bateman, Nicholas W. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Shoji, Yutaka [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids 49503, MI (United States); Conrads, Kelly A.; Stroop, Kevin D. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); Hamilton, Chad A. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Gynecologic Oncology Service, Department of Obstetrics and Gynecology, Walter Reed National Military Medical Center, 8901 Wisconsin Ave, MD, Bethesda, 20889 (United States); Department of Obstetrics and Gynecology, Uniformed Services University of the Health Sciences, Bethesda 20814, MD (United States); Darcy, Kathleen M. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Maxwell, George L. [Department of Obstetrics and Gynecology, Inova Fairfax Hospital, Falls Church, VA 22042 (United States); Risinger, John I. [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids 49503, MI (United States); and others
2016-01-01
AT-rich interactive domain-containing protein 1A (ARID1A) is a recently identified nuclear tumor suppressor frequently altered in solid tumor malignancies. We have identified a bipartite-like nuclear localization sequence (NLS) that contributes to nuclear import of ARID1A not previously described. We functionally confirm activity using GFP constructs fused with wild-type or mutant NLS sequences. We further show that cyto-nuclear localized, bipartite NLS mutant ARID1A exhibits greater stability than nuclear-localized, wild-type ARID1A. Identification of this undescribed functional NLS within ARID1A contributes vital insights to rationalize the impact of ARID1A missense mutations observed in patient tumors. - Highlights: • We have identified a bipartite nuclear localization sequence (NLS) in ARID1A. • Confirmation of the NLS was performed using GFP constructs. • NLS mutant ARID1A exhibits greater stability than wild-type ARID1A.
International Nuclear Information System (INIS)
Myre, Michael A.; O'Day, Danton H.
2005-01-01
Nucleomorphin is a novel nuclear calmodulin (CaM)-binding protein (CaMBP) containing an extensive DEED (glu/asp repeat) domain that regulates nuclear number. GFP-constructs of the 38 kDa NumA1 isoform localize as intranuclear patches adjacent to the inner nuclear membrane. The translocation of CaMBPs into nuclei has previously been shown by others to be mediated by both classic nuclear localization sequences (NLSs) and CaM-binding domains (CaMBDs). Here we show that NumA1 possesses a CaMBD ( 171 EDVSRFIKGKLLQKQQKIYKDLERF 195 ) containing both calcium-dependent-binding motifs and an IQ-like motif for calcium-independent binding. GFP-constructs containing only NumA1 residues 1-129, lacking the DEED and CaMBDs, still localized as patches at the internal periphery of nuclei thus ruling out a direct role for the CaMBD in nuclear import. These constructs contained the amino acid residues 48 KKSYQDPEIIAHSRPRK 64 that include both a putative bipartite and classical NLS. GFP-bipartite NLS constructs localized uniformly within nuclei but not as patches. As with previous work, removal of the DEED domain resulted in highly multinucleate cells. However as shown here, multinuclearity only occurred when the NLS was present allowing the protein to enter nuclei. Site-directed mutation analysis in which the NLS was changed to 48 EF 49 abolished the stability of the GFP fusion at the protein but not RNA level preventing subcellular analyses. Cells transfected with the 48 EF 49 construct exhibited slowed growth when compared to parental AX3 cells and other GFP-NumA1 deletion mutants. In addition to identifying an NLS that is sufficient for nuclear translocation of nucleomorphin and ruling out CaM-binding in this event, this work shows that the nuclear localization of NumA1 is crucial to its ability to regulate nuclear number in Dictyostelium
Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel
2012-01-01
Nuclear myosin I (NM1) was the first molecular motor identified in the cell nucleus. Together with nuclear actin, they participate in crucial nuclear events such as transcription, chromatin movements, and chromatin remodeling. NM1 is an isoform of myosin 1c (Myo1c) that was identified earlier and is known to act in the cytoplasm. NM1 differs from the "cytoplasmic" myosin 1c only by additional 16 amino acids at the N-terminus of the molecule. This amino acid stretch was therefore suggested to direct NM1 into the nucleus. We investigated the mechanism of nuclear import of NM1 in detail. Using over-expressed GFP chimeras encoding for truncated NM1 mutants, we identified a specific sequence that is necessary for its import to the nucleus. This novel nuclear localization sequence is placed within calmodulin-binding motif of NM1, thus it is present also in the Myo1c. We confirmed the presence of both isoforms in the nucleus by transfection of tagged NM1 and Myo1c constructs into cultured cells, and also by showing the presence of the endogenous Myo1c in purified nuclei of cells derived from knock-out mice lacking NM1. Using pull-down and co-immunoprecipitation assays we identified importin beta, importin 5 and importin 7 as nuclear transport receptors that bind NM1. Since the NLS sequence of NM1 lies within the region that also binds calmodulin we tested the influence of calmodulin on the localization of NM1. The presence of elevated levels of calmodulin interfered with nuclear localization of tagged NM1. We have shown that the novel specific NLS brings to the cell nucleus not only the "nuclear" isoform of myosin I (NM1 protein) but also its "cytoplasmic" isoform (Myo1c protein). This opens a new field for exploring functions of this molecular motor in nuclear processes, and for exploring the signals between cytoplasm and the nucleus.
Directory of Open Access Journals (Sweden)
Yuta eKimura
2014-02-01
Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.
Directory of Open Access Journals (Sweden)
Caitlin L Rowe
Full Text Available Rabies virus P-protein is expressed as five isoforms (P1-P5 which undergo nucleocytoplasmic trafficking important to roles in immune evasion. Although nuclear import of P3 is known to be mediated by an importin (IMP-recognised nuclear localization sequence in the N-terminal region (N-NLS, the mechanisms underlying nuclear import of other P isoforms in which the N-NLS is inactive or has been deleted have remained unresolved. Based on the previous observation that mutation of basic residues K214/R260 of the P-protein C-terminal domain (P-CTD can result in nuclear exclusion of P3, we used live cell imaging, protein interaction analysis and in vitro nuclear transport assays to examine in detail the nuclear trafficking properties of this domain. We find that the effect of mutation of K214/R260 on P3 is largely dependent on nuclear export, suggesting that nuclear exclusion of mutated P3 involves the P-CTD-localized nuclear export sequence (C-NES. However, assays using cells in which nuclear export is pharmacologically inhibited indicate that these mutations significantly inhibit P3 nuclear accumulation and, importantly, prevent nuclear accumulation of P1, suggestive of effects on NLS-mediated import activity in these isoforms. Consistent with this, molecular binding and transport assays indicate that the P-CTD mediates IMPα2/IMPβ1-dependent nuclear import by conferring direct binding to the IMPα2/IMPβ1 heterodimer, as well as to a truncated form of IMPα2 lacking the IMPβ-binding autoinhibitory domain (ΔIBB-IMPα2, and IMPβ1 alone. These properties are all dependent on K214 and R260. This provides the first evidence that P-CTD contains a genuine IMP-binding NLS, and establishes the mechanism by which P-protein isoforms other than P3 can be imported to the nucleus. These data underpin a refined model for P-protein trafficking that involves the concerted action of multiple NESs and IMP-binding NLSs, and highlight the intricate regulation of P
Energy Technology Data Exchange (ETDEWEB)
Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia); Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Dietzgen, Ralf G. [Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia)
2015-09-15
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.
International Nuclear Information System (INIS)
Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.
2015-01-01
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses
Cell density-dependent nuclear/cytoplasmic localization of NORPEG (RAI14) protein
International Nuclear Information System (INIS)
Kutty, R. Krishnan; Chen, Shanyi; Samuel, William; Vijayasarathy, Camasamudram; Duncan, Todd; Tsai, Jen-Yue; Fariss, Robert N.; Carper, Deborah; Jaworski, Cynthia; Wiggert, Barbara
2006-01-01
NORPEG (RAI14), a developmentally regulated gene induced by retinoic acid, encodes a 980 amino acid (aa) residue protein containing six ankyrin repeats and a long coiled-coil domain [Kutty et al., J. Biol. Chem. 276 (2001), pp. 2831-2840]. We have expressed aa residues 1-287 of NORPEG and used the recombinant protein to produce an anti-NORPEG polyclonal antibody. Confocal immunofluorescence analysis showed that the subcellular localization of NORPEG in retinal pigment epithelial (ARPE-19) cells varies with cell density, with predominantly nuclear localization in nonconfluent cells, but a cytoplasmic localization, reminiscent of cytoskeleton, in confluent cultures. Interestingly, an evolutionarily conserved putative monopartite nuclear localization signal (P 27 KKRKAP 276 ) was identified by analyzing the sequences of NORPEG and its orthologs. GFP-NORPEG (2-287 aa), a fusion protein containing this signal, was indeed localized to nuclei when expressed in ARPE-19 or COS-7 cells. Deletion and mutation analysis indicated that the identified nuclear localization sequence is indispensable for nuclear targeting
Characterization of a nuclear localization signal in the foot-and-mouth disease virus polymerase
International Nuclear Information System (INIS)
Sanchez-Aparicio, Maria Teresa; Rosas, Maria Flora; Sobrino, Francisco
2013-01-01
We have experimentally tested whether the MRKTKLAPT sequence in FMDV 3D protein (residues 16 to 24) can act as a nuclear localization signal (NLS). Mutants with substitutions in two basic residues within this sequence, K18E and K20E, were generated. A decreased nuclear localization was observed in transiently expressed 3D and its precursor 3CD, suggesting a role of K18 and K20 in nuclear targeting. Fusion of MRKTKLAPT to the green fluorescence protein (GFP) increased the nuclear localization of GFP, which was not observed when GFP was fused to the 3D mutated sequences. These results indicate that the sequence MRKTKLAPT can be functionally considered as a NLS. When introduced in a FMDV full length RNA replacements K18E and K20E led to production of revertant viruses that replaced the acidic residues introduced (E) by K, suggesting that the presence of lysins at positions 18 and 20 of 3D is essential for virus multiplication. - Highlights: • The FMDV 3D polymerase contains a nuclear localization signal. • Replacements K18E and K20E decrease nuclear localization of 3D and its precursor 3CD. • Fusion of the MRKTKLAPT 3D motif to GFP increases the nuclear localization of GFP. • Replacements K18E and K20E abolish the ability of MRKTKLAPT to relocate GFP. • RNAs harboring replacements K18E and K20E lead to recovery of revertant FMDVs
Characterization of a nuclear localization signal in the foot-and-mouth disease virus polymerase
Energy Technology Data Exchange (ETDEWEB)
Sanchez-Aparicio, Maria Teresa; Rosas, Maria Flora [Centro de Biología Molecular, “Severo Ochoa” (CSIC-UAM), Cantoblanco 28049, Madrid (Spain); Sobrino, Francisco, E-mail: fsobrino@cbm.uam.es [Centro de Biología Molecular, “Severo Ochoa” (CSIC-UAM), Cantoblanco 28049, Madrid (Spain); Centro de Investigación en Sanidad Animal, INIA, Valdeolmos, 28130 Madrid (Spain)
2013-09-15
We have experimentally tested whether the MRKTKLAPT sequence in FMDV 3D protein (residues 16 to 24) can act as a nuclear localization signal (NLS). Mutants with substitutions in two basic residues within this sequence, K18E and K20E, were generated. A decreased nuclear localization was observed in transiently expressed 3D and its precursor 3CD, suggesting a role of K18 and K20 in nuclear targeting. Fusion of MRKTKLAPT to the green fluorescence protein (GFP) increased the nuclear localization of GFP, which was not observed when GFP was fused to the 3D mutated sequences. These results indicate that the sequence MRKTKLAPT can be functionally considered as a NLS. When introduced in a FMDV full length RNA replacements K18E and K20E led to production of revertant viruses that replaced the acidic residues introduced (E) by K, suggesting that the presence of lysins at positions 18 and 20 of 3D is essential for virus multiplication. - Highlights: • The FMDV 3D polymerase contains a nuclear localization signal. • Replacements K18E and K20E decrease nuclear localization of 3D and its precursor 3CD. • Fusion of the MRKTKLAPT 3D motif to GFP increases the nuclear localization of GFP. • Replacements K18E and K20E abolish the ability of MRKTKLAPT to relocate GFP. • RNAs harboring replacements K18E and K20E lead to recovery of revertant FMDVs.
Dissection of a nuclear localization signal.
Hodel, M R; Corbett, A H; Hodel, A E
2001-01-12
The regulated process of protein import into the nucleus of a eukaryotic cell is mediated by specific nuclear localization signals (NLSs) that are recognized by protein import receptors. This study seeks to decipher the energetic details of NLS recognition by the receptor importin alpha through quantitative analysis of variant NLSs. The relative importance of each residue in two monopartite NLS sequences was determined using an alanine scanning approach. These measurements yield an energetic definition of a monopartite NLS sequence where a required lysine residue is followed by two other basic residues in the sequence K(K/R)X(K/R). In addition, the energetic contributions of the second basic cluster in a bipartite NLS ( approximately 3 kcal/mol) as well as the energy of inhibition of the importin alpha importin beta-binding domain ( approximately 3 kcal/mol) were also measured. These data allow the generation of an energetic scale of nuclear localization sequences based on a peptide's affinity for the importin alpha-importin beta complex. On this scale, a functional NLS has a binding constant of approximately 10 nm, whereas a nonfunctional NLS has a 100-fold weaker affinity of 1 microm. Further correlation between the current in vitro data and in vivo function will provide the foundation for a comprehensive quantitative model of protein import.
The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.
Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves
2017-08-21
Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Efficient and dynamic nuclear localization of green fluorescent protein via RNA binding
Energy Technology Data Exchange (ETDEWEB)
Kitamura, Akira; Nakayama, Yusaku; Kinjo, Masataka, E-mail: kinjo@sci.hokudai.ac.jp
2015-07-31
Classical nuclear localization signal (NLS) sequences have been used for artificial localization of green fluorescent protein (GFP) in the nucleus as a positioning marker or for measurement of the nuclear-cytoplasmic shuttling rate in living cells. However, the detailed mechanism of nuclear retention of GFP-NLS remains unclear. Here, we show that a candidate mechanism for the strong nuclear retention of GFP-NLS is via the RNA-binding ability of the NLS sequence. GFP tagged with a classical NLS derived from Simian virus 40 (GFP-NLS{sup SV40}) localized not only in the nucleoplasm, but also to the nucleolus, the nuclear subdomain in which ribosome biogenesis takes place. GFP-NLS{sup SV40} in the nucleolus was mobile, and intriguingly, the diffusion coefficient, which indicates the speed of diffusing molecules, was 1.5-fold slower than in the nucleoplasm. Fluorescence correlation spectroscopy (FCS) analysis showed that GFP-NLS{sup SV40} formed oligomers via RNA binding, the estimated molecular weight of which was larger than the limit for passive nuclear export into the cytoplasm. These findings suggest that the nuclear localization of GFP-NLS{sup SV40} likely results from oligomerization mediated via RNA binding. The analytical technique used here can be applied for elucidating the details of other nuclear localization mechanisms, including those of several types of nuclear proteins. In addition, GFP-NLS{sup SV40} can be used as an excellent marker for studying both the nucleoplasm and nucleolus in living cells. - Highlights: • Nuclear localization signal-tagged GFP (GFP-NLS) showed clear nuclear localization. • The GFP-NLS dynamically localized not only in the nucleoplasm, but also to the nucleolus. • The nuclear localization of GFP-NLS results from transient oligomerization mediated via RNA binding. • Our NLS-tagging procedure is ideal for use in artificial sequestration of proteins in the nucleus.
Efficient and dynamic nuclear localization of green fluorescent protein via RNA binding
International Nuclear Information System (INIS)
Kitamura, Akira; Nakayama, Yusaku; Kinjo, Masataka
2015-01-01
Classical nuclear localization signal (NLS) sequences have been used for artificial localization of green fluorescent protein (GFP) in the nucleus as a positioning marker or for measurement of the nuclear-cytoplasmic shuttling rate in living cells. However, the detailed mechanism of nuclear retention of GFP-NLS remains unclear. Here, we show that a candidate mechanism for the strong nuclear retention of GFP-NLS is via the RNA-binding ability of the NLS sequence. GFP tagged with a classical NLS derived from Simian virus 40 (GFP-NLS SV40 ) localized not only in the nucleoplasm, but also to the nucleolus, the nuclear subdomain in which ribosome biogenesis takes place. GFP-NLS SV40 in the nucleolus was mobile, and intriguingly, the diffusion coefficient, which indicates the speed of diffusing molecules, was 1.5-fold slower than in the nucleoplasm. Fluorescence correlation spectroscopy (FCS) analysis showed that GFP-NLS SV40 formed oligomers via RNA binding, the estimated molecular weight of which was larger than the limit for passive nuclear export into the cytoplasm. These findings suggest that the nuclear localization of GFP-NLS SV40 likely results from oligomerization mediated via RNA binding. The analytical technique used here can be applied for elucidating the details of other nuclear localization mechanisms, including those of several types of nuclear proteins. In addition, GFP-NLS SV40 can be used as an excellent marker for studying both the nucleoplasm and nucleolus in living cells. - Highlights: • Nuclear localization signal-tagged GFP (GFP-NLS) showed clear nuclear localization. • The GFP-NLS dynamically localized not only in the nucleoplasm, but also to the nucleolus. • The nuclear localization of GFP-NLS results from transient oligomerization mediated via RNA binding. • Our NLS-tagging procedure is ideal for use in artificial sequestration of proteins in the nucleus
Energy Technology Data Exchange (ETDEWEB)
Tannukit, Sissada [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States); Crabb, Tara L.; Hertel, Klemens J. [Department of Microbiology and Molecular Genetics, University of California Irvine, Irvine, CA 92697-4025 (United States); Wen, Xin [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States); Jans, David A. [Department of Biochemistry and Molecular Biology, Nuclear Signalling Laboratory, Monash University, Clayton, Victoria 3800 (Australia); Paine, Michael L., E-mail: paine@usc.edu [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States)
2009-12-18
Tuftelin-interacting protein 11 (TFIP11) is a protein component of the spliceosome complex that promotes the release of the lariat-intron during late-stage splicing through a direct recruitment and interaction with DHX15/PRP43. Expression of TFIP11 is essential for cell and organismal survival. TFIP11 contains a G-patch domain, a signature motif of RNA-processing proteins that is responsible for TFIP11-DHX15 interactions. No other functional domains within TFIP11 have been described. TFIP11 is localized to distinct speckled regions within the cell nucleus, although excluded from the nucleolus. In this study sequential C-terminal deletions and mutational analyses have identified two novel protein elements in mouse TFIP11. The first domain covers amino acids 701-706 (VKDKFN) and is an atypical nuclear localization signal (NLS). The second domain is contained within amino acids 711-735 and defines TFIP11's distinct speckled nuclear localization. The identification of a novel TFIP11 nuclear speckle-targeting sequence (TFIP11-STS) suggests that this domain directly interacts with additional spliceosomal components. These data help define the mechanism of nuclear/nuclear speckle localization of the splicing factor TFIP11, with implications for it's function.
NLSdb-major update for database of nuclear localization signals and nuclear export signals.
Bernhofer, Michael; Goldberg, Tatyana; Wolf, Silvana; Ahmed, Mohamed; Zaugg, Julian; Boden, Mikael; Rost, Burkhard
2018-01-04
NLSdb is a database collecting nuclear export signals (NES) and nuclear localization signals (NLS) along with experimentally annotated nuclear and non-nuclear proteins. NES and NLS are short sequence motifs related to protein transport out of and into the nucleus. The updated NLSdb now contains 2253 NLS and introduces 398 NES. The potential sets of novel NES and NLS have been generated by a simple 'in silico mutagenesis' protocol. We started with motifs annotated by experiments. In step 1, we increased specificity such that no known non-nuclear protein matched the refined motif. In step 2, we increased the sensitivity trying to match several different families with a motif. We then iterated over steps 1 and 2. The final set of 2253 NLS motifs matched 35% of 8421 experimentally verified nuclear proteins (up from 21% for the previous version) and none of 18 278 non-nuclear proteins. We updated the web interface providing multiple options to search protein sequences for NES and NLS motifs, and to evaluate your own signal sequences. NLSdb can be accessed via Rostlab services at: https://rostlab.org/services/nlsdb/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma
International Nuclear Information System (INIS)
Nakamura, Tomoyuki; Sato, Yuko; Watanabe, Daisuke; Ito, Hideki; Shimonohara, Nozomi; Tsuji, Takahiro; Nakajima, Noriko; Suzuki, Yoshio; Matsuo, Koma; Nakagawa, Hidemi; Sata, Tetsutaro; Katano, Harutaka
2010-01-01
To clarify whether mutations in the large T gene encoded by Merkel cell polyomavirus affect the expression and function of large T antigen in Merkel cell carcinoma cases, we investigated the expression of large T antigen in vitro and in vivo. Immunohistochemistry using a rabbit polyclonal antibody revealed that large T antigen was expressed in the nuclei of Merkel cell carcinoma cells with Merkel cell polyomavirus infection. Deletion mutant analyses identified an Arg-Lys-Arg-Lys sequence (amino acids 277-280) as a nuclear localization signal in large T antigen. Sequence analyses revealed that there were no mutations in the nuclear localization signal in any of the eleven Merkel cell polyomavirus strains examined. Furthermore, stop codons were not observed in the upstream of the nuclear localization signal in any of the Merkel cell carcinoma cases examined. These data suggest that the nuclear localization signal is highly conserved and functional in Merkel cell carcinoma cases.
Energy Technology Data Exchange (ETDEWEB)
Takeda, A.A.S.; Fontes, M.R.M. [UNESP, Universidade Estadual Paulista, Botucatu, SP (Brazil); Yang, S.N.Y. [University of Melbourne, Melbourne (Australia); Harris, J.M. [Queensland University of Technology, Brisbane (Australia); Jans, D.A. [Monash University, Clayton (Australia); Kobe, B. [University of Queensland, Brisbane, QU (Australia)
2012-07-01
Full text: Importin-{alpha} (Imp{alpha}) plays a role in the classical nuclear import pathway, binding to cargo proteins with activities in the nucleus. Different Imp{alpha} paralogs responsible for specific cargos can be found in a single organism. The cargos contain nuclear localization sequences (NLSs), which are characterized by one or two clusters of basic amino acids (monopartite and bipartite NLSs, respectively). In this work we present the crystal structure of Imp{alpha} from M. musculus (residues 70-529, lacking the auto inhibitory domain) bound to a NLS peptide (pepTM). The peptide corresponds to the optimal sequence obtained by an oriented peptide library experiment designed to probe the specificity of the major NLS binding site. The peptide library used five degenerate positions and identified the sequence KKKRR as the optimal sequence for binding to this site for mouse Imp{alpha} (70-529). The protein was obtained using an E. coli expression system and purified by affinity chromatography followed by an ion exchange chromatography. A single crystal of Imp{alpha} -pepTM complex was grown by the hanging drop method. The data were collected using the Synchrotron Radiation Source LNLS, Brazil and processed to 2.3. Molecular replacement techniques were used to determine the crystal structure. Electron density corresponding to the peptide was present in both major and minor binding sites The peptide is bound to Imp{alpha} similar as the simian virus 40 (SV40) large tumour (T)-antigen NLS. Binding assays confirmed that the peptide bound to Imp{alpha} with low nM affinities. This is the first time that structural information has been linked to an oriented peptide library screening approach for importin-{alpha}; the results will contribute to understanding of the sequence determinants of classical NLSs, and may help identify as yet unidentified classical NLSs in novel proteins. (author)
Directory of Open Access Journals (Sweden)
Panté Nelly
2009-06-01
Full Text Available Abstract Background Early in infection, the genome of the influenza A virus, consisting of eight complexes of RNA and proteins (termed viral ribonucleoproteins; vRNPs, enters the nucleus of infected cells for replication. Incoming vRNPs are imported into the nucleus of infected cells using at least two nuclear localization sequences on nucleoprotein (NP; NLS1 at the N terminus, and NLS2 in the middle of the protein. Progeny vRNP assembly occurs in the nucleus, and later in infection, these are exported from the nucleus to the cytoplasm. Nuclear-exported vRNPs are different from incoming vRNPs in that they are prevented from re-entering the nucleus. Why nuclear-exported vRNPs do not re-enter the nucleus is unknown. Results To test our hypothesis that the exposure of NLSs on the vRNP regulates the directionality of the nuclear transport of the influenza vRNPs, we immunolabeled the two NLSs of NP (NLS1 and NLS2 and analyzed their surface accessibility in cells infected with the influenza A virus. We found that the NLS1 epitope on NP was exposed throughout the infected cells, but the NLS2 epitope on NP was only exposed in the nucleus of the infected cells. Addition of the nuclear export inhibitor leptomycin B further revealed that NLS1 is no longer exposed in cytoplasmic NP and vRNPs that have already undergone nuclear export. Similar immunolabeling studies in the presence of leptomycin B and with cells transfected with the cDNA of NP revealed that the NLS1 on NP is hidden in nuclear exported-NP. Conclusion NLS1 mediates the nuclear import of newly-synthesized NP and incoming vRNPs. This NLS becomes hidden on nuclear-exported NP and nuclear-exported vRNPs. Thus the selective exposure of the NLS1 constitutes a critical mechanism to regulate the directionality of the nuclear transport of vRNPs during the influenza A viral life cycle.
International Nuclear Information System (INIS)
Li, Yong-Yong; Li, Lan; Dong, Hai-Qing; Cai, Xiao-Jun; Ren, Tian-Bin
2013-01-01
PKKKRKV (Pro-Lys-Lys-Lys-Arg-Lys-Val, PV7), a seven amino acid peptide, has emerged as one of the primary nuclear localization signals that can be targeted into cell nucleus via the nuclear import machinery. Taking advantage of chemical diversity and biological activities of this short peptide sequence, in this study, Pluronic F127 nanomicelles engineered with nuclear localized functionality were successfully developed for intracellular drug delivery. These nanomicelles with the size ∼ 100 nm were self-assembled from F127 polymer that was flanked with two PV7 sequences at its both terminal ends. Hydrophobic anticancer drug doxorubicin (DOX) with inherent fluorescence was chosen as the model drug, which was found to be efficiently encapsulated into nanomicelles with the encapsulation efficiency at 72.68%. In comparison with the non-functionalized namomicelles, the microscopic observation reveals that PV7 functionalized nanomicelles display a higher cellular uptake, especially into the nucleus of HepG2 cells, due to the nuclear localization signal effects. Both cytotoxicity and apoptosis studies show that the DOX-loaded nanomicelles were more potent than drug nanomicelles without nuclear targeting functionality. It was thus concluded that PV7 functionalized nanomicelles could be a potentially alternative vehicle for nuclear targeting drug delivery. - Highlights: ► A new nuclear targeted drug delivery system based on micelles is developed. ► This micellar system features a core-shell structure with the size peaked at 100 nm. ► PV7, a short peptide sequence, is adopted as a nuclear targeting ligand. ► PV7 functionalized drug loaded micelles are more potent in killing tumor cells
Nuclear localization of Schizosaccharomyces pombe Mcm2/Cdc19p requires MCM complex assembly.
Pasion, S G; Forsburg, S L
1999-12-01
The minichromosome maintenance (MCM) proteins MCM2-MCM7 are conserved eukaryotic replication factors that assemble in a heterohexameric complex. In fission yeast, these proteins are nuclear throughout the cell cycle. In studying the mechanism that regulates assembly of the MCM complex, we analyzed the cis and trans elements required for nuclear localization of a single subunit, Mcm2p. Mutation of any single mcm gene leads to redistribution of wild-type MCM subunits to the cytoplasm, and this redistribution depends on an active nuclear export system. We identified the nuclear localization signal sequences of Mcm2p and showed that these are required for nuclear targeting of other MCM subunits. In turn, Mcm2p must associate with other MCM proteins for its proper localization; nuclear localization of MCM proteins thus requires assembly of MCM proteins in a complex. We suggest that coupling complex assembly to nuclear targeting and retention ensures that only intact heterohexameric MCM complexes remain nuclear.
Baculovirus LEF-11 nuclear localization signal is important for viral DNA replication.
Chen, Tingting; Dong, Zhanqi; Hu, Nan; Hu, Zhigang; Dong, Feifan; Jiang, Yaming; Li, Jun; Chen, Peng; Lu, Cheng; Pan, Minhui
2017-06-15
Baculovirus LEF-11 is a small nuclear protein that is involved in viral late gene transcription and DNA replication. However, the characteristics of its nuclear localization signal and its impact on viral DNA replication are unknown. In the present study, systemic bioinformatics analysis showed that the baculovirus LEF-11 contains monopartite and bipartite classical nuclear localization signal sequences (cNLSs), which were also detected in a few alphabaculovirus species. Localization of representative LEF-11 proteins of four baculovirus genera indicated that the nuclear localization characteristics of baculovirus LEF-11 coincided with the predicted results. Moreover, Bombyx mori nucleopolyhedrovirus (BmNPV) LEF-11 could be transported into the nucleus during viral infection in the absence of a cNLSs. Further investigations demonstrated that the NLS of BmNPV LEF-11 is important for viral DNA replication. The findings of the present study indicate that the characteristics of the baculovirus LEF-11 protein and the NLS is essential to virus DNA replication and nuclear transport mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.
Role of zinc finger structure in nuclear localization of transcription factor Sp1
International Nuclear Information System (INIS)
Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji; Kuwahara, Jun
2009-01-01
Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.
Honda, Akinobu; Chigwechokha, Petros Kingstone; Kamada-Futagami, Yuko; Komatsu, Masaharu; Shiozaki, Kazuhiro
2018-06-01
Sialidase catalyzes the removal of sialic acids from glycoconjugates. Different from Neu1 and Neu3 sialidases, Neu4 enzymatic properties such as substrate specificity and subcellular localization are not well-conserved among vertebrates. In fish only zebrafish and medaka neu4 genes have been cloned and their polypeptides have been characterized so far. Thus, characterization of Neu4 from other fish species is necessary to evaluate Neu4 physiological functions. Here, Nile tilapia was chosen for the characterization of Neu4 polypeptide considering that it is one of the major cultured fish all over the world and that its genomic sequences are now available. Coding DNA sequence of tilapia Neu4 was identified as 1,497 bp and its recombinant protein showed broad substrate specificity and optimal sialidase enzyme activity pH at 4.0. Neu4 activity was sustained even in neutral and alkali pH. Interestingly, immunofluorescence analysis revealed that major subcellular localization of tilapia Neu4 was nuclear, quite distinct from zebrafish (ER) and medaka Neu4 (lysosome). Bioinformatic analysis showed the existence of putative nuclear localization signal (NLS) in tilapia Neu4. In general, it is known that importin families bind to several proteins via NLS and transfer them into nucleus. Therefore, to determine the involvement of putative NLS in Neu4 nuclear localization, Neu4 mutant deleting NLS was constructed and expressed in cultured cells. As a result, NLS deletion significantly diminished the nuclear localization. Furthermore, treatment of importazole, interrupter of binding importin β and RanGTP, significantly suppressed Neu4 nuclear localization. In summary, tilapia Neu4 is a unique sialidase localized at nucleus and its transport system into nucleus is regulated by importin. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Serotype-specific Differences in Dengue Virus Non-structural Protein 5 Nuclear Localization*
Hannemann, Holger; Sung, Po-Yu; Chiu, Han-Chen; Yousuf, Amjad; Bird, Jim; Lim, Siew Pheng; Davidson, Andrew D.
2013-01-01
The four serotypes of dengue virus (DENV-1 to -4) cause the most important arthropod-borne viral disease of humans. DENV non-structural protein 5 (NS5) contains enzymatic activities required for capping and replication of the viral RNA genome that occurs in the host cytoplasm. However, previous studies have shown that DENV-2 NS5 accumulates in the nucleus during infection. In this study, we examined the nuclear localization of NS5 for all four DENV serotypes. We demonstrate for the first time that there are serotypic differences in NS5 nuclear localization. Whereas the DENV-2 and -3 proteins accumulate in the nucleus, DENV-1 and -4 NS5 are predominantly if not exclusively localized to the cytoplasm. Comparative studies on the DENV-2 and -4 NS5 proteins revealed that the difference in DENV-4 NS5 nuclear localization was not due to rapid nuclear export but rather the lack of a functional nuclear localization sequence. Interaction studies using DENV-2 and -4 NS5 and human importin-α isoforms failed to identify an interaction that supported the differential nuclear localization of NS5. siRNA knockdown of the human importin-α isoform KPNA2, corresponding to the murine importin-α isoform previously shown to bind to DENV-2 NS5, did not substantially affect DENV-2 NS5 nuclear localization, whereas knockdown of importin-β did. The serotypic differences in NS5 nuclear localization did not correlate with differences in IL-8 gene expression. The results show that NS5 nuclear localization is not strictly required for virus replication but is more likely to have an auxiliary function in the life cycle of specific DENV serotypes. PMID:23770669
Serotype-specific differences in dengue virus non-structural protein 5 nuclear localization.
Hannemann, Holger; Sung, Po-Yu; Chiu, Han-Chen; Yousuf, Amjad; Bird, Jim; Lim, Siew Pheng; Davidson, Andrew D
2013-08-02
The four serotypes of dengue virus (DENV-1 to -4) cause the most important arthropod-borne viral disease of humans. DENV non-structural protein 5 (NS5) contains enzymatic activities required for capping and replication of the viral RNA genome that occurs in the host cytoplasm. However, previous studies have shown that DENV-2 NS5 accumulates in the nucleus during infection. In this study, we examined the nuclear localization of NS5 for all four DENV serotypes. We demonstrate for the first time that there are serotypic differences in NS5 nuclear localization. Whereas the DENV-2 and -3 proteins accumulate in the nucleus, DENV-1 and -4 NS5 are predominantly if not exclusively localized to the cytoplasm. Comparative studies on the DENV-2 and -4 NS5 proteins revealed that the difference in DENV-4 NS5 nuclear localization was not due to rapid nuclear export but rather the lack of a functional nuclear localization sequence. Interaction studies using DENV-2 and -4 NS5 and human importin-α isoforms failed to identify an interaction that supported the differential nuclear localization of NS5. siRNA knockdown of the human importin-α isoform KPNA2, corresponding to the murine importin-α isoform previously shown to bind to DENV-2 NS5, did not substantially affect DENV-2 NS5 nuclear localization, whereas knockdown of importin-β did. The serotypic differences in NS5 nuclear localization did not correlate with differences in IL-8 gene expression. The results show that NS5 nuclear localization is not strictly required for virus replication but is more likely to have an auxiliary function in the life cycle of specific DENV serotypes.
Identification of a functional nuclear localization signal within the human USP22 protein
International Nuclear Information System (INIS)
Xiong, Jianjun; Wang, Yaqin; Gong, Zhen; Liu, Jianyun; Li, Weidong
2014-01-01
Highlights: • USP22 was accumulated in nucleus. • We identified of a functional USP22 NLS. • The KRRK amino acid residues are indispensable in NLS. • The KRRK motif is conserved in USP22 homologues. - Abstract: Ubiquitin-specific processing enzyme 22 (USP22), a member of the deubiquitinase family, is over-expressed in most human cancers and has been implicated in tumorigenesis. Because it is an enzymatic subunit of the human SAGA transcriptional cofactor, USP22 deubiquitylates histone H2A and H2B in the nucleus, thus participating in gene regulation and cell-cycle progression. However, the mechanisms regulating its nuclear translocation have not yet been elucidated. It was here demonstrated that USP22 is imported into the nucleus through a mechanism mediated by nuclear localization signal (NLS). The bipartite NLS sequence KRELELLKHNPKRRKIT (aa152–168), was identified as the functional NLS for its nuclear localization. Furthermore, a short cluster of basic amino acid residues KRRK within this bipartite NLS plays the primary role in nuclear localization and is evolutionarily conserved in USP22 homologues. In the present study, a functional NLS and the minimal sequences required for the active targeting of USP22 to the nucleus were identified. These findings may provide a molecular basis for the mechanism underlying USP22 nuclear trafficking and function
Identification of a functional nuclear localization signal within the human USP22 protein
Energy Technology Data Exchange (ETDEWEB)
Xiong, Jianjun [Key Laboratory of Jiangxi Province for the Systems Bio-Medicine, Jiujiang, Jiangxi Province 332000 (China); College of Basic Medical Science, Jiujiang University, Jiujiang, Jiangxi Province 332000 (China); Wang, Yaqin [Reproductive Medical Center, Renmin Hospital of Wuhan University, Wuhan, Hubei Province 430060 (China); Gong, Zhen [Key Laboratory of Jiangxi Province for the Systems Bio-Medicine, Jiujiang, Jiangxi Province 332000 (China); Liu, Jianyun [College of Basic Medical Science, Jiujiang University, Jiujiang, Jiangxi Province 332000 (China); Li, Weidong, E-mail: lwd626518@163.com [College of Basic Medical Science, Jiujiang University, Jiujiang, Jiangxi Province 332000 (China)
2014-06-20
Highlights: • USP22 was accumulated in nucleus. • We identified of a functional USP22 NLS. • The KRRK amino acid residues are indispensable in NLS. • The KRRK motif is conserved in USP22 homologues. - Abstract: Ubiquitin-specific processing enzyme 22 (USP22), a member of the deubiquitinase family, is over-expressed in most human cancers and has been implicated in tumorigenesis. Because it is an enzymatic subunit of the human SAGA transcriptional cofactor, USP22 deubiquitylates histone H2A and H2B in the nucleus, thus participating in gene regulation and cell-cycle progression. However, the mechanisms regulating its nuclear translocation have not yet been elucidated. It was here demonstrated that USP22 is imported into the nucleus through a mechanism mediated by nuclear localization signal (NLS). The bipartite NLS sequence KRELELLKHNPKRRKIT (aa152–168), was identified as the functional NLS for its nuclear localization. Furthermore, a short cluster of basic amino acid residues KRRK within this bipartite NLS plays the primary role in nuclear localization and is evolutionarily conserved in USP22 homologues. In the present study, a functional NLS and the minimal sequences required for the active targeting of USP22 to the nucleus were identified. These findings may provide a molecular basis for the mechanism underlying USP22 nuclear trafficking and function.
Identification of essential sequences for cellular localization in BRMS1 metastasis suppressor.
Directory of Open Access Journals (Sweden)
José Rivera
Full Text Available BACKGROUND: Breast cancer metastasis suppressor 1 (BRMS1 reduces the number and the size of secondary tumours in a mouse model without affecting the growth of the primary foci upon its re-expression. Knockdown of BRMS1 expression associates with metastasis. The molecular details on BRMS1 mechanism of action include its ability to function as a transcriptional co-repressor and consistently BRMS1 has been described as a predominantly nuclear protein. Since cellular distribution could represent a potential mechanism of regulation, we wanted to characterize BRMS1 sequence motifs that might regulate its cellular distribution. According to its amino acids sequence, BRMS1 contain two putative nuclear localization signals, however none of them has been proved to work so far. METHODOLOGY/PRINCIPAL FINDINGS: By using well known in vivo assays to detect both nuclear import and export signal, we have characterized, in the present study, one functional nuclear localisation signal as necessary and sufficient to promote nuclear transport. Additionally, the outcome of a directed yeast two-hybrid assay identify importin alpha6 as a specific partner of BRMS1 thus speculating that BRMS1 nuclear import could be specifically mediated by the reported nuclear transporter. Besides, the combination of a computational searching approach along the utilization of a nuclear export assay, identified a functional motif within the BRMS1 sequence responsible for its nuclear export, that resulted not affected by the highly specific CRM1 inhibitor Leptomycin-B. Interspecies heterokaryon assay demonstrate the capability of BRMS1 to shuttle between the nuclear and cytosolic compartments CONCLUSIONS/SIGNIFICANCE: Our results show for the first time that BRMS1 contains both nuclear import and export signals enabling its nucleo-cytoplasmic shuttling. These findings contributes new data for the understanding of the BRMS1 functions and allow us to speculate that this phenomenon could
Analysis of the nuclear localization signal of TRF1 in non-small cell lung cancer
Directory of Open Access Journals (Sweden)
HU JIAN
2009-01-01
Full Text Available Several studies revealed a similar down-regulation of telomeric repeat binding factor 1 (TRF1 in tumors. We have previously reported the TRFl expression levels were down-regulation in non-small cell lung cancer (NSCLC. The regulation of TRFl localization is proposed to be important for the function and expression. The nuclear localization signal (NLS and nuclear export signal (NES are often important clues to localization of protein. The objective of the present study was to investigate the NLS and NES of TRFl in NSCLC patients. Thirty (30 patients with NSCLCs had undergone radical operations in The First Affiliated Hospital, College of Medicine, Zhejiang University. DNA sequences of NLSs and NESs were amplified by PCR. The PCR products were analyzed by DNA sequencing. There were four NLSs of the TRFl protein, including two monopartite and two bipartite NLSs. The NLSs sequences were included in 337KKERRVGTPQSTKKKKESRR356. The exon 8 and exon 9 of TRFl DNA were covered the NLS sequences. The sequences of predicted NESs were 11WMLDFLCLSL86 and 174NLLKLQALAV183, respectively. The exon 1, exon 3 and exon 4 of TRFl were covered the NES sequences. In NSCLCs, there was no a mutation, deletion, or substitution in NLS and NES of TRFl. We conclude that the NLS and NES sequences in NSCLCs patients did not have mutations. Down-expression of TRFl does not indicate gene mutation of NLS and NES in NSCLCs.
International Nuclear Information System (INIS)
Zheng Chunfu; Brownlie, Robert; Babiuk, Lorne A.; Hurk, Sylvia van Drunen Littel-van den
2004-01-01
Bovine herpesvirus-1 (BHV-1) VP8 is found in the nucleus immediately after infection. Transient expression of VP8 fused to yellow fluorescent protein (YFP) in COS-7 cells confirmed the nuclear localization of VP8 in the absence of other viral proteins. VP8 has four putative nuclear localization signals (NLS). Deletion of pat4 ( 51 RRPR 54 ) or pat7 ( 48 PRVRRPR 54 ) NLS2 abrogated nuclear accumulation, whereas deletion of 48 PRV 50 did not, so pat4 NLS2 is critical for nuclear localization of VP8. Furthermore, NLS1 ( 11 RRPRR 15 ), pat4 NLS2, and pat7 NLS2 were all capable of transporting the majority of YFP to the nucleus. Finally, a 12-amino-acid peptide with the sequence RRPRRPRVRRPR directed all of YFP into the nucleus, suggesting that reiteration of the RRPR motif makes the nuclear localization more efficient. Heterokaryon assays demonstrated that VP8 is also capable of shuttling between the nucleus and cytoplasm of the cell. Deletion mutant analysis revealed that this property is attributed to a leucine-rich nuclear export sequence (NES) consisting of amino acids 485 LSAYLTLFVAL 495 . This leucine-rich NES caused transport of YFP to the cytoplasm. These results demonstrate that VP8 shuttles between the nucleus and cytoplasm
Localization of nuclear power plant technology
International Nuclear Information System (INIS)
Stiteler, F.Z.; Rudek, T.G.
1998-01-01
Asia, and particularly China, has an enormous need for power and must deal with the practicalities of building large base load units. In China, as in other countries, there are limitations on the use of large quantities of fossil fuel. This raises the possibility of turning to nuclear power to satisfy their energy needs. Other issues tend to point to the nuclear option for these growing economies, including economic considerations, environmental concerns, energy independence and raising the technological capabilities of the country. When a country embarks on a nuclear power program with the intention of localizing the technology, a long-term commitment is necessary to achieve this objective. Localization of nuclear technology is not a new phenomenon. The nature of the industry from the early beginnings has always involved transfer of technology when a new country initiated a nuclear power construction program. In fact, most previous experiences with this localization process involved heavy governmental, political and financial support to drive the success of the program. Because of this strong governmental support, only the receiving nation's companies were generally allowed to participate in the local business operations of the technology recipient. What is new and different today is the retreat from heavy financial support by the receiving country's government. This change has created a strong emphasis on cost-effectiveness in the technology transfer process and opportunities for foreign companies to participate in local business activities. ABB is a world-wide company with two parent companies that have been very active over many years in establishing cost-justified local operations throughout the world. Today, ABB has become the largest electrical engineering company in the world with respected local operations in nearly every country. Lessons learned by ABB in their world-wide localization initiatives are being applied to the challenge of cost
Directory of Open Access Journals (Sweden)
Allen C T Teng
Full Text Available Interferon regulatory factor 2 binding protein 2 (IRF2BP2 is a muscle-enriched transcription factor required to activate vascular endothelial growth factor-A (VEGFA expression in muscle. IRF2BP2 is found in the nucleus of cardiac and skeletal muscle cells. During the process of skeletal muscle differentiation, some IRF2BP2 becomes relocated to the cytoplasm, although the functional significance of this relocation and the mechanisms that control nucleocytoplasmic localization of IRF2BP2 are not yet known.Here, by fusing IRF2BP2 to green fluorescent protein and testing a series of deletion and site-directed mutagenesis constructs, we mapped the nuclear localization signal (NLS to an evolutionarily conserved sequence (354ARKRKPSP(361 in IRF2BP2. This sequence corresponds to a classical nuclear localization motif bearing positively charged arginine and lysine residues. Substitution of arginine and lysine with negatively charged aspartic acid residues blocked nuclear localization. However, these residues were not sufficient because nuclear targeting of IRF2BP2 also required phosphorylation of serine 360 (S360. Many large-scale phosphopeptide proteomic studies had reported previously that serine 360 of IRF2BP2 is phosphorylated in numerous human cell types. Alanine substitution at this site abolished IRF2BP2 nuclear localization in C(2C(12 myoblasts and CV1 cells. In contrast, substituting serine 360 with aspartic acid forced nuclear retention and prevented cytoplasmic redistribution in differentiated C(2C(12 muscle cells. As for the effects of these mutations on VEGFA promoter activity, the S360A mutation interfered with VEGFA activation, as expected. Surprisingly, the S360D mutation also interfered with VEGFA activation, suggesting that this mutation, while enforcing nuclear entry, may disrupt an essential activation function of IRF2BP2.Nuclear localization of IRF2BP2 depends on phosphorylation near a conserved NLS. Changes in phosphorylation status
International Nuclear Information System (INIS)
Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim
2005-01-01
Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs
International Nuclear Information System (INIS)
Au, Victoria; Yu Mei; Carstens, Eric B.
2009-01-01
The baculovirus Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) single-stranded DNA binding protein LEF-3 is a multi-functional protein that is required to transport the helicase protein P143 into the nucleus of infected cells where they function to replicate viral DNA. The N-terminal 56 amino acid region of LEF-3 is required for nuclear transport. In this report, we analyzed the effect of site-specific mutagenesis of LEF-3 on its intracellular distribution. Fluorescence microscopy of expression plasmid-transfected cells demonstrated that the residues 28 to 32 formed the core nuclear localization signal, but other adjacent positively-charged residues augmented these sequences. Comparison with other group I Alphabaculoviruses suggested that this core region functionally duplicated residues including 18 and 19. This was demonstrated by the loss of nuclear localization when the equivalent residues (18 to 20) in Choristoneura fumiferana nucleopolyhedrovirus (CfMNPV) LEF-3 were mutated. The AcMNPV LEF-3 nuclear localization domain was also shown to drive nuclear transport in mammalian cells indicating that the protein nuclear import systems in insect and mammalian cells are conserved. We also demonstrated by mutagenesis that two conserved cysteine residues located at 82 and 106 were not essential for nuclear localization or for interaction with P143. However, by using a modified construct of P143 that localized on its own to the nucleus, we demonstrated that a functional nuclear localization domain on LEF-3 was required for interaction between LEF-3 and P143
Eigenimage filtering of nuclear medicine image sequences
International Nuclear Information System (INIS)
Windham, J.P.; Froelich, J.W.; Abd-Allah, M.
1985-01-01
In many nuclear medicine imaging sequences the localization of radioactivity in organs other than the target organ interferes with imaging of the desired anatomical structure or physiological process. A filtering technique has been developed which suppresses the interfering process while enhancing the desired process. This technique requires the identification of temporal sequential signatures for both the interfering and desired processes. These signatures are placed in the form of signature vectors. Signature matrices, M/sub D/ and M/sub U/, are formed by taking the outer product expansion of the temporal signature vectors for the desired and interfering processes respectively. By using the transformation from the simultaneous diagonalization of these two signature matrices a weighting vector is obtained. The technique is shown to maximize the projection of the desired process while minimizing the interfering process based upon an extension of Rayleigh's Principle. The technique is demonstrated for first pass renal and cardiac flow studies. This filter offers a potential for simplifying and extending the accuracy of diagnostic nuclear medicine procedures
International Nuclear Information System (INIS)
Kakuk, Annamaria; Friedlaender, Elza; Vereb, Gyoergy; Lisboa, Duarte; Bagossi, Peter; Toth, Gabor; Gergely, Pal; Vereb, Gyoergy
2008-01-01
PI4K230, an isoform of phosphatidylinositol 4-kinase, known primarily as a cytoplasmic membrane-bound enzyme, was detected recently also in the nucleolus of several cells. Here we provide mechanistic insight on the targeting function of its putative nuclear localization signal (NLS) sequences using molecular modeling, digitonin-permeabilized HeLa cells and binding to various importins. The synthetic sequence 916 NFNHIHKRIRRVADKYLSG 934 comprising a putative monopartite NLS (NLS1), targeted covalently bound fluorescent BSA to the nucleoplasm via classical importin α/β mechanism employing importins α1 and α3 but not α5. This transport was inhibited by wheat germ agglutinin and GTPγS. The sequence 1414 SKKTNRGSQLHKYYMKRRTL 1433 , a putative bipartite NLS (NLS2) proved ineffective in nuclear targeting if conjugated to fluorescently labeled BSA. Nonetheless, NLS2 or either of its basic clusters directed to the nucleolus soybean trypsin inhibitor that can pass the nuclear pore complex passively; moreover, an expressed 58 kDa fragment of PI4K230 (AA1166-1667) comprising NLS2 was also imported into the nucleus by import factors of reticulocyte lysate or by importin α1/β or α3/β complexes and localized to the nucleolus. We conclude that the putative bipartite NLS itself is a nucleolar targeting signal, and for nuclear import PI4K230 requires a larger sequence around it or, alternatively, the monopartite NLS
International Nuclear Information System (INIS)
Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D.; Mymryk, Joe S.
2014-01-01
The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situated between residues 258 and 263 ( 258 RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP 289 ). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved
Localization and indigenization of China nuclear power industry
International Nuclear Information System (INIS)
Zhang Xingfa
2009-01-01
It points out that China needs to develop nuclear power to solve the shortage of energy source. Localization and independence is the key for the development of nuclear power industry. Localized and independent nuclear power possesses economical competitiveness. China has the condition and capability to realize localization and independence of nuclear power industry. Technology introduction, adaptation and assimilation can enhance the R and D capability of China's nuclear power industry, and speed up the process of localization and independence. (authors)
International Nuclear Information System (INIS)
Parreiras-e-Silva, Lucas T.; Gomes, Marcelo D.; Oliveira, Eduardo B.; Costa-Neto, Claudio M.
2007-01-01
The eukaryotic translation initiation factor 5A (eIF5A) is a ubiquitous protein of eukaryotic and archaeal organisms which undergoes hypusination, a unique post-translational modification. We have generated a polyclonal antibody against murine eIF5A, which in immunocytochemical assays in B16-F10 cells revealed that the endogenous protein is preferentially localized to the nuclear region. We therefore analyzed possible structural features present in eIF5A proteins that could be responsible for that characteristic. Multiple sequence alignment analysis of eIF5A proteins from different eukaryotic and archaeal organisms showed that the former sequences have an extended N-terminal segment. We have then performed in silico prediction analyses and constructed different truncated forms of murine eIF5A to verify any possible role that the N-terminal extension might have in determining the subcellular localization of the eIF5A in eukaryotic organisms. Our results indicate that the N-terminal extension of the eukaryotic eIF5A contributes in signaling this protein to nuclear localization, despite of bearing no structural similarity with classical nuclear localization signals
Comparison of methods for genomic localization of gene trap sequences
Directory of Open Access Journals (Sweden)
Ferrin Thomas E
2006-09-01
Full Text Available Abstract Background Gene knockouts in a model organism such as mouse provide a valuable resource for the study of basic biology and human disease. Determining which gene has been inactivated by an untargeted gene trapping event poses a challenging annotation problem because gene trap sequence tags, which represent sequence near the vector insertion site of a trapped gene, are typically short and often contain unresolved residues. To understand better the localization of these sequences on the mouse genome, we compared stand-alone versions of the alignment programs BLAT, SSAHA, and MegaBLAST. A set of 3,369 sequence tags was aligned to build 34 of the mouse genome using default parameters for each algorithm. Known genome coordinates for the cognate set of full-length genes (1,659 sequences were used to evaluate localization results. Results In general, all three programs performed well in terms of localizing sequences to a general region of the genome, with only relatively subtle errors identified for a small proportion of the sequence tags. However, large differences in performance were noted with regard to correctly identifying exon boundaries. BLAT correctly identified the vast majority of exon boundaries, while SSAHA and MegaBLAST missed the majority of exon boundaries. SSAHA consistently reported the fewest false positives and is the fastest algorithm. MegaBLAST was comparable to BLAT in speed, but was the most susceptible to localizing sequence tags incorrectly to pseudogenes. Conclusion The differences in performance for sequence tags and full-length reference sequences were surprisingly small. Characteristic variations in localization results for each program were noted that affect the localization of sequence at exon boundaries, in particular.
DEFF Research Database (Denmark)
Nyakaana, S; Arctander, P; Siegismund, H R
2002-01-01
Two hundred and thirty-six mitochondrial DNA nucleotide sequences were used in combination with polymorphism at four nuclear microsatellite loci to assess the amount and distribution of genetic variation within and between African savannah elephants. They were sampled from 11 localities in easter...
Energy Technology Data Exchange (ETDEWEB)
Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D. [Department of Microbiology and Immunology, The University of Western Ontario, A4-833 London Regional Cancer Centre, 800 Commissioners Road E., London, Ontario, N6A 4L6 Canada (Canada); Mymryk, Joe S., E-mail: jmymryk@uwo.ca [Department of Microbiology and Immunology, The University of Western Ontario, A4-833 London Regional Cancer Centre, 800 Commissioners Road E., London, Ontario, N6A 4L6 Canada (Canada); Department of Oncology, The University of Western Ontario, London Regional Cancer Centre, Ontario (Canada)
2014-11-15
The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situated between residues 258 and 263 ({sup 258}RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP{sup 289}). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved.
Generalized locally Toeplitz sequences theory and applications
Garoni, Carlo
2017-01-01
Based on their research experience, the authors propose a reference textbook in two volumes on the theory of generalized locally Toeplitz sequences and their applications. This first volume focuses on the univariate version of the theory and the related applications in the unidimensional setting, while the second volume, which addresses the multivariate case, is mainly devoted to concrete PDE applications. This book systematically develops the theory of generalized locally Toeplitz (GLT) sequences and presents some of its main applications, with a particular focus on the numerical discretization of differential equations (DEs). It is the first book to address the relatively new field of GLT sequences, which occur in numerous scientific applications and are especially dominant in the context of DE discretizations. Written for applied mathematicians, engineers, physicists, and scientists who (perhaps unknowingly) encounter GLT sequences in their research, it is also of interest to those working in the fields of...
Schuster, W; Brennicke, A
1987-01-01
We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433
Wang, Shunfang; Liu, Shuhui
2015-12-19
An effective representation of a protein sequence plays a crucial role in protein sub-nuclear localization. The existing representations, such as dipeptide composition (DipC), pseudo-amino acid composition (PseAAC) and position specific scoring matrix (PSSM), are insufficient to represent protein sequence due to their single perspectives. Thus, this paper proposes two fusion feature representations of DipPSSM and PseAAPSSM to integrate PSSM with DipC and PseAAC, respectively. When constructing each fusion representation, we introduce the balance factors to value the importance of its components. The optimal values of the balance factors are sought by genetic algorithm. Due to the high dimensionality of the proposed representations, linear discriminant analysis (LDA) is used to find its important low dimensional structure, which is essential for classification and location prediction. The numerical experiments on two public datasets with KNN classifier and cross-validation tests showed that in terms of the common indexes of sensitivity, specificity, accuracy and MCC, the proposed fusing representations outperform the traditional representations in protein sub-nuclear localization, and the representation treated by LDA outperforms the untreated one.
New nuclear plant development - balancing localization with competitiveness
International Nuclear Information System (INIS)
Caplan, M.; Thompson, T.S.
2014-01-01
Nuclear power plants are large infrastructure projects that require government support and approval. This paper will highlight and contrast the larger, mostly government-desired, nuclear program localization objectives with the more utility-specific requirements for successful project implementation. Governments are concerned about sustainable industrial development, particularly manufacturing, and job creation while utilities are focused on delivering reliable electricity to consumers at the lowest cost. Numerous countries emphasize local content as a key requirement when procuring a station. For countries like China and Korea that have large programs, their strategy has been to localize to the point of having their own indigenous design. However, developing a workable localization strategy that truly benefits the local economy for others including existing nuclear markets like Canada, the UK, South Africa and Brazil as well as in newly developing markets such as Vietnam and Malaysia is more challenging. These countries may not look to indigenize a new design, rather they would localize elements of the nuclear program that best fit their strengths. The paper will discuss the issues related to developing successful localization and industrialization strategies in a changing nuclear world. (author)
New nuclear plant development - balancing localization with competitiveness
Energy Technology Data Exchange (ETDEWEB)
Caplan, M.; Thompson, T.S. [MZ Consulting Inc., ON (Canada)
2014-07-01
Nuclear power plants are large infrastructure projects that require government support and approval. This paper will highlight and contrast the larger, mostly government-desired, nuclear program localization objectives with the more utility-specific requirements for successful project implementation. Governments are concerned about sustainable industrial development, particularly manufacturing, and job creation while utilities are focused on delivering reliable electricity to consumers at the lowest cost. Numerous countries emphasize local content as a key requirement when procuring a station. For countries like China and Korea that have large programs, their strategy has been to localize to the point of having their own indigenous design. However, developing a workable localization strategy that truly benefits the local economy for others including existing nuclear markets like Canada, the UK, South Africa and Brazil as well as in newly developing markets such as Vietnam and Malaysia is more challenging. These countries may not look to indigenize a new design, rather they would localize elements of the nuclear program that best fit their strengths. The paper will discuss the issues related to developing successful localization and industrialization strategies in a changing nuclear world. (author)
Local competence building and public information in European nuclear territories
International Nuclear Information System (INIS)
Martell, Meritxell; Vila D'Abadal, Maria
2010-01-01
Opinion polls and case study analysis show that there is a strong public demand for more participation in decision-making processes relating to the environment and nuclear issues specifically (IGNA, 2007; EC DG TREN 2008). In this regard, the implementation of transparency and participation at local level in municipalities hosting nuclear facilities is being claimed by local representatives over Europe. The pilot project 'Local Competence Building and Public Information in European Nuclear Territories' (2007-2008) was promoted by the Group of European Municipalities with Nuclear Facilities (GMF) and partly financed by the Directorate General for Energy and Transport (DG TREN). The project aims at supporting the European Commission (EC) in the process of harmonising national practices in the field of governance in nuclear territories. The objectives of this pilot project were two-fold: firstly, to identify local good practices at European level with regards to governance in the nuclear field and, secondly, to provide a methodological framework to recommend good practices and establish a set of indicators. The results of the project are briefly explained under the five dimensions of local governance on nuclear matters: access to environmental information, participation, access to justice, competence building and local development. Firstly, access to information on nuclear issues is broadly acknowledged by local representatives to be of relevant importance in increasing public knowledge on nuclear issues, especially on nuclear safety and radiation protection. Secondly, most local representatives feel that the current participatory level on nuclear issues in municipalities is too low and they would appreciate a greater involvement of local communities in decision-making processes on nuclear issues through local commissions or other mechanisms. Thirdly, according to local authorities, access to justice should be provided not only for the public but also for themselves
Directory of Open Access Journals (Sweden)
Shunfang Wang
2015-12-01
Full Text Available An effective representation of a protein sequence plays a crucial role in protein sub-nuclear localization. The existing representations, such as dipeptide composition (DipC, pseudo-amino acid composition (PseAAC and position specific scoring matrix (PSSM, are insufficient to represent protein sequence due to their single perspectives. Thus, this paper proposes two fusion feature representations of DipPSSM and PseAAPSSM to integrate PSSM with DipC and PseAAC, respectively. When constructing each fusion representation, we introduce the balance factors to value the importance of its components. The optimal values of the balance factors are sought by genetic algorithm. Due to the high dimensionality of the proposed representations, linear discriminant analysis (LDA is used to find its important low dimensional structure, which is essential for classification and location prediction. The numerical experiments on two public datasets with KNN classifier and cross-validation tests showed that in terms of the common indexes of sensitivity, specificity, accuracy and MCC, the proposed fusing representations outperform the traditional representations in protein sub-nuclear localization, and the representation treated by LDA outperforms the untreated one.
The role of nuclear localization signal in parvovirus life cycle.
Liu, Peng; Chen, Shun; Wang, Mingshu; Cheng, Anchun
2017-04-14
Parvoviruses are small, non-enveloped viruses with an approximately 5.0 kb, single-stranded DNA genome. Usually, the parvovirus capsid gene contains one or more nuclear localization signals (NLSs), which are required for guiding the virus particle into the nucleus through the nuclear pore. However, several classical NLSs (cNLSs) and non-classical NLSs (ncNLSs) have been identified in non-structural genes, and the ncNLSs can also target non-structural proteins into the nucleus. In this review, we have summarized recent research findings on parvovirus NLSs. The capsid protein of the adeno-associated virus has four potential nuclear localization sequences, named basic region 1 (BR), BR2, BR3 and BR4. BR3 was identified as an NLS by fusing it with green fluorescent protein. Moreover, BR3 and BR4 are required for infectivity and virion assembly. In Protoparvovirus, the canine parvovirus has a common cNLS located in the VP1 unique region, similar to parvovirus minute virus of mice (MVM) and porcine parvovirus. Moreover, an ncNLS is found in the C-terminal region of MVM VP1/2. Parvovirus B19 also contains an ncNLS in the C-terminal region of VP1/2, which is essential for the nuclear transport of VP1/VP2. Approximately 1 or 2 cNLSs and 1 ncNLS have been reported in the non-structural protein of bocaviruses. Understanding the role of the NLS in the process of parvovirus infection and its mechanism of nuclear transport will contribute to the development of therapeutic vaccines and novel antiviral medicines.
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%
DEFF Research Database (Denmark)
Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.
2005-01-01
detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...
Visual Localization across Seasons Using Sequence Matching Based on Multi-Feature Combination.
Qiao, Yongliang
2017-10-25
Visual localization is widely used in autonomous navigation system and Advanced Driver Assistance Systems (ADAS). However, visual-based localization in seasonal changing situations is one of the most challenging topics in computer vision and the intelligent vehicle community. The difficulty of this task is related to the strong appearance changes that occur in scenes due to weather or season changes. In this paper, a place recognition based visual localization method is proposed, which realizes the localization by identifying previously visited places using the sequence matching method. It operates by matching query image sequences to an image database acquired previously (video acquired during traveling period). In this method, in order to improve matching accuracy, multi-feature is constructed by combining a global GIST descriptor and local binary feature CSLBP (Center-symmetric local binary patterns) to represent image sequence. Then, similarity measurement according to Chi-square distance is used for effective sequences matching. For experimental evaluation, the relationship between image sequence length and sequences matching performance is studied. To show its effectiveness, the proposed method is tested and evaluated in four seasons outdoor environments. The results have shown improved precision-recall performance against the state-of-the-art SeqSLAM algorithm.
Local society and nuclear power stations
International Nuclear Information System (INIS)
1984-02-01
This report was made by the expert committee on region investigation, Japan Atomic Industrial Forum Inc., in fiscal years 1981 and 1982 in order to grasp the social economic influence exerted on regions by the location of nuclear power stations and the actual state of the change due to it, and to search for the way the promotion of local community should be. The influence and the effect were measured in the regions around the Fukushima No. 1 Nuclear Power Station of Tokyo Electric Power Co., Inc., the Mihama Power Station of Kansai Electric Power Co., Inc., and the Genkai Nuclear Power Station of Kyushu Electric Power Co., Inc. The fundamental recognition in this discussion, the policy of locating nuclear power stations and the management of regions, the viewpoint and way of thinking in the investigation of the regions where nuclear power stations are located, the actual state of social economic impact due to the location of nuclear power stations, the connected mechanism accompanying the location of nuclear power stations, and the location of nuclear power stations and the acceleration of planning for regional promotion are reported. In order to economically generate electric power, the rationalization in the location of nuclear power stations is necessary, and the concrete concept of building up local community must be decided. (Kako, I.)
The local community and the nuclear waste
International Nuclear Information System (INIS)
Lidskog, R.
1998-01-01
In this book social and political scientists discuss different aspects of the selection of a site for disposal of the Swedish nuclear waste. Special attention is given to the preliminary studies that have been performed at a few localities. The authors study the chain of events after a community is proposed for a site study. What powers are set in motion? How do different groups act in order to support or stop the study? Which is the role played by political parties, local environmentalist movements, media and experts? Why is there a forceful opposition in one community and not in another? Why does one local government invite the nuclear waste company to perform the study, while another refuses? The role of the local government has become crucial, since the nuclear waste company have chosen to perform studies only in municipalities that show a positive interest
International Nuclear Information System (INIS)
Lin, W.-L.; Chien, M.-S.; Du, Y.-W.; Wu, P.-C.; Huang Chienjin
2009-01-01
Porcine circovirus type 2 possesses a circular, single-stranded DNA genome that requires the replication protein (Rep) for virus replication. To characterize the DNA binding potential and the significant region that confers the nuclear localization of the Rep protein, the defined coding regions of rep gene were cloned and expressed. All of the recombinant proteins except for the N-terminal 110 residues deletion mutant could bind to the double-stranded minimal binding site of replication origin (ori). In addition, the N-terminal deletion mutant lacking 110 residues exhibited mainly cytoplasmic staining in the transfected cells in contrast to the others, which localized dominantly in the nucleus, suggesting that this N-terminal domain is essential for nuclear localization. Furthermore, a series of green fluorescence proteins (GFP) containing potential nuclear localization signal (NLS) sequences were tested for their cellular distribution. The ability of the utmost 20 residues of the N-terminal region to target the GFP to the nucleus confirmed its role as a functional NLS.
Hu, Youna; Willer, Cristen; Zhan, Xiaowei; Kang, Hyun Min; Abecasis, Gonçalo R.
2013-01-01
Estimates of the ancestry of specific chromosomal regions in admixed individuals are useful for studies of human evolutionary history and for genetic association studies. Previously, this ancestry inference relied on high-quality genotypes from genome-wide association study (GWAS) arrays. These high-quality genotypes are not always available when samples are exome sequenced, and exome sequencing is the strategy of choice for many ongoing genetic studies. Here we show that off-target reads generated during exome-sequencing experiments can be combined with on-target reads to accurately estimate the ancestry of each chromosomal segment in an admixed individual. To reconstruct local ancestry, our method SEQMIX models aligned bases directly instead of relying on hard genotype calls. We evaluate the accuracy of our method through simulations and analysis of samples sequenced by the 1000 Genomes Project and the NHLBI Grand Opportunity Exome Sequencing Project. In African Americans, we show that local-ancestry estimates derived by our method are very similar to those derived with Illumina’s Omni 2.5M genotyping array and much improved in relation to estimates that use only exome genotypes and ignore off-target sequencing reads. Software implementing this method, SEQMIX, can be applied to analysis of human population history or used for genetic association studies in admixed individuals. PMID:24210252
Visual Localization across Seasons Using Sequence Matching Based on Multi-Feature Combination
Directory of Open Access Journals (Sweden)
Yongliang Qiao
2017-10-01
Full Text Available Visual localization is widely used in autonomous navigation system and Advanced Driver Assistance Systems (ADAS. However, visual-based localization in seasonal changing situations is one of the most challenging topics in computer vision and the intelligent vehicle community. The difficulty of this task is related to the strong appearance changes that occur in scenes due to weather or season changes. In this paper, a place recognition based visual localization method is proposed, which realizes the localization by identifying previously visited places using the sequence matching method. It operates by matching query image sequences to an image database acquired previously (video acquired during traveling period. In this method, in order to improve matching accuracy, multi-feature is constructed by combining a global GIST descriptor and local binary feature CSLBP (Center-symmetric local binary patterns to represent image sequence. Then, similarity measurement according to Chi-square distance is used for effective sequences matching. For experimental evaluation, the relationship between image sequence length and sequences matching performance is studied. To show its effectiveness, the proposed method is tested and evaluated in four seasons outdoor environments. The results have shown improved precision–recall performance against the state-of-the-art SeqSLAM algorithm.
International Nuclear Information System (INIS)
Inagaki, Yuichi; Mitsutake, Susumu; Igarashi, Yasuyuki
2006-01-01
Retinitis pigmentosa (RP) is a genetically heterogeneous disease characterized by degeneration of the retina. A mutation in a new ceramide kinase (CERK) homologous gene, named CERK-like protein (CERKL), was found to cause autosomal recessive retinitis pigmentosa (RP26). Here, we show a point mutation of one of two putative nuclear localization signal (NLS) sequences inhibited the nuclear localization of the protein. Furthermore, the tetra-GFP-tagged NLS, which cannot passively enter the nucleus, was observed not only in the nucleus but also in the nucleolus. Our results provide First evidence of the active nuclear import of CERKL and suggest that the identified NLS might be responsible for nucleolar retention of the protein. As recent studies have shown other RP-related proteins are localized in the nucleus or the nucleolus, our identification of NLS in CERKL suggests that CERKL likely plays important roles for retinal functions in the nucleus and the nucleolus
Directory of Open Access Journals (Sweden)
Valovka Taras
2008-07-01
Full Text Available Abstract Background The enzymes responsible for the synthesis of poly-ADP-ribose are named poly-ADP-ribose polymerases (PARP. PARP-2 is a nuclear protein, which regulates a variety of cellular functions that are mainly controlled by protein-protein interactions. A previously described non-conventional bipartite nuclear localization sequence (NLS lies in the amino-terminal DNA binding domain of PARP-2 between amino acids 1–69; however, this targeting sequence has not been experimentally examined or validated. Results Using a site-directed mutagenesis approach, we found that lysines 19 and 20, located within a previously described bipartite NLS, are not required for nuclear localization of PARP-2. In contrast, lysine 36, which is located within a predicted classical monopartite NLS, was required for PARP-2 nuclear localization. While wild type PARP-2 interacted with importin α3 and to a very weak extent with importin α1 and importin α5, the mutant PARP-2 (K36R did not interact with importin α3, providing a molecular explanation why PARP-2 (K36R is not targeted to the nucleus. Conclusion Our results provide strong evidence that lysine 36 of PARP-2 is a critical residue for proper nuclear targeting of PARP-2 and consequently for the execution of its biological functions.
Topology of genes and nontranscribed sequences in human interphase nuclei
International Nuclear Information System (INIS)
Scheuermann, Markus O.; Tajbakhsh, Jian; Kurz, Anette; Saracoglu, Kaan; Eils, Roland; Lichter, Peter
2004-01-01
Knowledge about the functional impact of the topological organization of DNA sequences within interphase chromosome territories is still sparse. Of the few analyzed single copy genomic DNA sequences, the majority had been found to localize preferentially at the chromosome periphery or to loop out from chromosome territories. By means of dual-color fluorescence in situ hybridization (FISH), immunolabeling, confocal microscopy, and three-dimensional (3D) image analysis, we analyzed the intraterritorial and nuclear localization of 10 genomic fragments of different sequence classes in four different human cell types. The localization of three muscle-specific genes FLNA, NEB, and TTN, the oncogene BCL2, the tumor suppressor gene MADH4, and five putatively nontranscribed genomic sequences was predominantly in the periphery of the respective chromosome territories, independent from transcriptional status and from GC content. In interphase nuclei, the noncoding sequences were only rarely found associated with heterochromatic sites marked by the satellite III DNA D1Z1 or clusters of mammalian heterochromatin proteins (HP1α, HP1β, HP1γ). However, the nontranscribed sequences were found predominantly at the nuclear periphery or at the nucleoli, whereas genes tended to localize on chromosome surfaces exposed to the nuclear interior
International Nuclear Information System (INIS)
Fujita, Akiko; Sato, Chihiro; Kitajima, Ken.
2007-01-01
The CMP-sialic acid synthetase (CSS) catalyzes the activation of sialic acid (Sia) to CMP-Sia which is a donor substrate of sialyltransferases. The vertebrate CSSs are usually localized in nucleus due to the nuclear localization signal (NLS) on the molecule. In this study, we first point out that a small, but significant population of the mouse CMP-sialic acid synthetase (mCSS) is also present in cytoplasm, though mostly in nucleus. As a mechanism for the localization in cytoplasm, we first identified two nuclear export signals (NESs) in mCSS, based on the localization studies of the potential NES-deleted mCSS mutants as well as the potential NES-tagged eGFP proteins. These two NESs are conserved among mammalian and fish CSSs, but not present in the bacterial or insect CSS. These results suggest that the intracellular localization of vertebrate CSSs is regulated by not only the NLS, but also the NES sequences
Energy Technology Data Exchange (ETDEWEB)
Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)
2012-10-25
The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.
International Nuclear Information System (INIS)
Kim, Seongman; Chul Ahn, Byung; O’Callaghan, Dennis J.; Kim, Seong Kee
2012-01-01
The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)–UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.
Complex Sequencing Problems and Local Search Heuristics
Brucker, P.; Hurink, Johann L.; Osman, I.H.; Kelly, J.P.
1996-01-01
Many problems can be formulated as complex sequencing problems. We will present problems in flexible manufacturing that have such a formulation and apply local search methods like iterative improvement, simulated annealing and tabu search to solve these problems. Computational results are reported.
A Local Poisson Graphical Model for inferring networks from sequencing data.
Allen, Genevera I; Liu, Zhandong
2013-09-01
Gaussian graphical models, a class of undirected graphs or Markov Networks, are often used to infer gene networks based on microarray expression data. Many scientists, however, have begun using high-throughput sequencing technologies such as RNA-sequencing or next generation sequencing to measure gene expression. As the resulting data consists of counts of sequencing reads for each gene, Gaussian graphical models are not optimal for this discrete data. In this paper, we propose a novel method for inferring gene networks from sequencing data: the Local Poisson Graphical Model. Our model assumes a Local Markov property where each variable conditional on all other variables is Poisson distributed. We develop a neighborhood selection algorithm to fit our model locally by performing a series of l1 penalized Poisson, or log-linear, regressions. This yields a fast parallel algorithm for estimating networks from next generation sequencing data. In simulations, we illustrate the effectiveness of our methods for recovering network structure from count data. A case study on breast cancer microRNAs (miRNAs), a novel application of graphical models, finds known regulators of breast cancer genes and discovers novel miRNA clusters and hubs that are targets for future research.
Cellular stress stimulates nuclear localization signal (NLS) independent nuclear transport of MRJ
Andrews, Joel F.; Sykora, Landon J.; Barik-Letostak, Tiasha; Menezes, Mitchell E.; Mitra, Aparna; Barik, Sailen; Shevde, Lalita A.; Samant, Rajeev S.
2012-01-01
HSP40 family member MRJ (DNAJB6) has been in the spot light for its relevance to Huntington’s, Parkinson’s diseases, limb-girdle muscular dystrophy, placental development, neural stem cells, cell cycle and malignancies such as breast cancer and melanoma. This gene has two spliced variants coding for 2 distinct proteins with significant homology. However, MRJ(L) (large variant) is predominantly localized to the nucleus whereas MRJ(S) (small variant) is predominantly cytoplasmic. Interestingly MRJ(S) translocates to the nucleus in response to heat shock. The classical heat shock proteins respond to crises (stress) by increasing the number of molecules, usually by transcriptional up-regulation. Our studies imply that a quick increase in the molar concentration of MRJ in the nuclear compartment is a novel method by which MRJ responds to stress. We found that MRJ(S) shows NLS (nuclear localization signal) independent nuclear localization in response to heat shock and hypoxia. The specificity of this response is realized due to lack of such response by MRJ(S) when challenged by other stressors, such as some cytokines or UV light. Deletion analysis has allowed us to narrow down on a 20 amino acid stretch at the C-terminal region of MRJ(S) as a potential stress sensing region. Functional studies indicated that constitutive nuclear localization of MRJ(S) promoted attributes of malignancy such as proliferation and invasiveness overall indicating distinct phenotypic characteristics of nuclear MRJ(S). PMID:22504047
Cellular stress stimulates nuclear localization signal (NLS) independent nuclear transport of MRJ
International Nuclear Information System (INIS)
Andrews, Joel F.; Sykora, Landon J.; Barik Letostak, Tiasha; Menezes, Mitchell E.; Mitra, Aparna; Barik, Sailen; Shevde, Lalita A.; Samant, Rajeev S.
2012-01-01
HSP40 family member MRJ (DNAJB6) has been in the spot light for its relevance to Huntington's, Parkinson's diseases, limb-girdle muscular dystrophy, placental development, neural stem cells, cell cycle and malignancies such as breast cancer and melanoma. This gene has two spliced variants coding for 2 distinct proteins with significant homology. However, MRJ(L) (large variant) is predominantly localized to the nucleus whereas MRJ(S) (small variant) is predominantly cytoplasmic. Interestingly MRJ(S) translocates to the nucleus in response to heat shock. The classical heat shock proteins respond to crises (stress) by increasing the number of molecules, usually by transcriptional up-regulation. Our studies imply that a quick increase in the molar concentration of MRJ in the nuclear compartment is a novel method by which MRJ responds to stress. We found that MRJ(S) shows NLS (nuclear localization signal) independent nuclear localization in response to heat shock and hypoxia. The specificity of this response is realized due to lack of such response by MRJ(S) when challenged by other stressors, such as some cytokines or UV light. Deletion analysis has allowed us to narrow down on a 20 amino acid stretch at the C-terminal region of MRJ(S) as a potential stress sensing region. Functional studies indicated that constitutive nuclear localization of MRJ(S) promoted attributes of malignancy such as proliferation and invasiveness overall indicating distinct phenotypic characteristics of nuclear MRJ(S).
Cellular stress stimulates nuclear localization signal (NLS) independent nuclear transport of MRJ
Energy Technology Data Exchange (ETDEWEB)
Andrews, Joel F.; Sykora, Landon J.; Barik Letostak, Tiasha; Menezes, Mitchell E.; Mitra, Aparna [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States); Barik, Sailen [Center for Gene Regulation in Health and Disease, Department of Biological, Geological, and Environmental Sciences, College of Science, Cleveland State University, Cleveland, OH (United States); Shevde, Lalita A. [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States); Samant, Rajeev S., E-mail: rsamant@usouthal.edu [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States)
2012-06-10
HSP40 family member MRJ (DNAJB6) has been in the spot light for its relevance to Huntington's, Parkinson's diseases, limb-girdle muscular dystrophy, placental development, neural stem cells, cell cycle and malignancies such as breast cancer and melanoma. This gene has two spliced variants coding for 2 distinct proteins with significant homology. However, MRJ(L) (large variant) is predominantly localized to the nucleus whereas MRJ(S) (small variant) is predominantly cytoplasmic. Interestingly MRJ(S) translocates to the nucleus in response to heat shock. The classical heat shock proteins respond to crises (stress) by increasing the number of molecules, usually by transcriptional up-regulation. Our studies imply that a quick increase in the molar concentration of MRJ in the nuclear compartment is a novel method by which MRJ responds to stress. We found that MRJ(S) shows NLS (nuclear localization signal) independent nuclear localization in response to heat shock and hypoxia. The specificity of this response is realized due to lack of such response by MRJ(S) when challenged by other stressors, such as some cytokines or UV light. Deletion analysis has allowed us to narrow down on a 20 amino acid stretch at the C-terminal region of MRJ(S) as a potential stress sensing region. Functional studies indicated that constitutive nuclear localization of MRJ(S) promoted attributes of malignancy such as proliferation and invasiveness overall indicating distinct phenotypic characteristics of nuclear MRJ(S).
Cellular stress stimulates nuclear localization signal (NLS) independent nuclear transport of MRJ
Energy Technology Data Exchange (ETDEWEB)
Andrews, Joel F.; Sykora, Landon J.; Barik Letostak, Tiasha; Menezes, Mitchell E.; Mitra, Aparna [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States); Barik, Sailen [Center for Gene Regulation in Health and Disease, Department of Biological, Geological, and Environmental Sciences, College of Science, Cleveland State University, Cleveland, OH (United States); Shevde, Lalita A. [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States); Samant, Rajeev S., E-mail: rsamant@usouthal.edu [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States)
2012-06-10
HSP40 family member MRJ (DNAJB6) has been in the spot light for its relevance to Huntington's, Parkinson's diseases, limb-girdle muscular dystrophy, placental development, neural stem cells, cell cycle and malignancies such as breast cancer and melanoma. This gene has two spliced variants coding for 2 distinct proteins with significant homology. However, MRJ(L) (large variant) is predominantly localized to the nucleus whereas MRJ(S) (small variant) is predominantly cytoplasmic. Interestingly MRJ(S) translocates to the nucleus in response to heat shock. The classical heat shock proteins respond to crises (stress) by increasing the number of molecules, usually by transcriptional up-regulation. Our studies imply that a quick increase in the molar concentration of MRJ in the nuclear compartment is a novel method by which MRJ responds to stress. We found that MRJ(S) shows NLS (nuclear localization signal) independent nuclear localization in response to heat shock and hypoxia. The specificity of this response is realized due to lack of such response by MRJ(S) when challenged by other stressors, such as some cytokines or UV light. Deletion analysis has allowed us to narrow down on a 20 amino acid stretch at the C-terminal region of MRJ(S) as a potential stress sensing region. Functional studies indicated that constitutive nuclear localization of MRJ(S) promoted attributes of malignancy such as proliferation and invasiveness overall indicating distinct phenotypic characteristics of nuclear MRJ(S).
Local-area networks in nuclear physics (survey)
International Nuclear Information System (INIS)
Foteev, V.A.
1987-01-01
The design fundamentals, comparative characteristics, and possibilities of local-area networks as applied to physics experiments are examined. The example of Ethernet is used to explain the operation of local networks, and the results of a study of their functional characteristics are presented. Examples of operational local networks in nuclear physics research and atomic engineering are given: the Japan Research Institute of Atomic Energy, the University of California, and Los Alamos National Laboratory; atomic power plant control in Japan; DECnet and Fastbus; network developments at the Siberian Branch of the Academy of Sciences of the USSR and at the Laboratory of Neutron Physics of the Joint Institute for Nuclear Research; and others. It is shown that local networks are important means that considerably increase productivity in data processing
Hou, Qiang; Hou, Shaohua; Chen, Qing; Jia, Hong; Xin, Ting; Jiang, Yitong; Guo, Xiaoyu; Zhu, Hongfei
2018-02-15
The open reading frame 2 (ORF2) of Porcine circovirus type 2 (PCV2) encodes the major Capsid (Cap) protein, which self-assembles into virus-like particle (VLP) of similar morphology to the PCV2 virion and accumulates in the nucleus through the N-terminal arginine-rich nuclear localization signal (NLS). In this study, PCV2 Cap protein and its derivates were expressed via the baculovirus expression system, and the cellular localization of the recombinant proteins were investigated using anti-Cap mAb by imaging flow cytometry. Analysis of subcellular localization of Cap protein and its variants demonstrated that NLS mediated Cap protein nuclear export as well as nuclear import, and a phosphorylation site (S17) was identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in the NLS domain to regulate Cap protein nuclear export. Phosphorylation of NLS regulating the PCV2 Cap protein nuclear export was also demonstrated in PK15 cells by fluorescence microscopy. Moreover, the influence of Rep and Rep' protein on Cap protein subcellular localization was investigated in PK15 cells. Phosphorylation of NLS regulating Cap protein nuclear export provides more detailed knowledge of the PCV2 viral life cycle. Copyright © 2018 Elsevier B.V. All rights reserved.
Nuclear localization of SNARK; its impact on gene expression
International Nuclear Information System (INIS)
Kuga, Wataru; Tsuchihara, Katsuya; Ogura, Tsutomu; Kanehara, Sakyo; Saito, Marie; Suzuki, Atsushi; Esumi, Hiroyasu
2008-01-01
SNARK, a member of the AMPK-related kinases, has been involved in the cellular stress responses but its precise mechanisms remain unclear. Subcellular localization of SNARK protein was identified. Unlike cytoplasmic localizing AMPKα, SNARK was predominantly localized in the nucleus. SNARK was constitutively distributed in the nucleus even when SNARK was activated by metabolic stimuli such as AICAR and glucose-deprivation. Conserved nuclear localization signal (NLS) was identified at the N-terminal portion ( 68 KKAR 71 ). Deletion and point mutation of this part resulted in the cytoplasmic translocation of mutant proteins. Furthermore, GFP fused with the SNARK fragment containing 68 KKAR 71 translocated to the nucleus. A microarray analysis revealed that the nuclear localizing SNARK altered transcriptome profiles and a considerable part of these alterations were canceled by the mutation of NLS, suggesting the ability of SNARK to modulate gene expression dependent on its nuclear localization.
Initial operations in local nuclear emergency response headquarter
International Nuclear Information System (INIS)
2012-06-01
As a result of the Fukushima nuclear accident due to the Great East Japan Earthquake and the tsunami that occurred thereafter, local nuclear emergency response headquarters (local headquarters) was set up at off-site center (OFC). However, several obstacles such as the collapse of means of communication resulting from severed communication lines, food and fuel shortage resulting from stagnant physical distribution, and increasing radiation dose around the center significantly restricted originally intended operation of local headquarters. In such severe situation, the personnel gathered at the OFC from the government, local public bodies and electric companies from March 11 to 15 acted without sufficient food, sleep or rest and did all they could against successively occurring unexpected challenges by using limited means of communication. However, issues requiring further consideration were activities of each functional group, location of OFC and the functions of equipment, machines and materials and reflecting the consideration results into future protective measures and revision of the manual for nuclear emergency response were greatly important. This report described investigated results on initial operations in local headquarters such as situation of activities conducted by local headquarters and operations at functional groups. (T. Tanaka)
Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A
2013-03-11
The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.
The effects of the nuclear disaster at Fukushima Daiichi Nuclear Power Station on local governments
International Nuclear Information System (INIS)
Nakamura, Makoto; Dake, Kinji
2012-01-01
All Japan council of local governments with atomic power stations consisted of 24 reactor site and 6 neighboring local governments to solve reactor site related problems. Nuclear disaster at Fukushima Daiichi Nuclear Power Station affected member local governments to be forced in severe conditions such as 'removal of administrative function' or 'refuge over a wide district beyond local government area', not imagined before. The council set up working group for thirteen local governments themselves to investigate this disaster and find safety and prevention of disaster measures to be deployed in nuclear administration, which published report in March 2012. This article described outline of investigation and derived problems and direction of their solution. Main items were related with communication, resident evacuation, prevention of disaster system, and management of refuge site. (T. Tanaka)
Enhanced Methods for Local Ancestry Assignment in Sequenced Admixed Individuals
Brown, Robert; Pasaniuc, Bogdan
2014-01-01
Inferring the ancestry at each locus in the genome of recently admixed individuals (e.g., Latino Americans) plays a major role in medical and population genetic inferences, ranging from finding disease-risk loci, to inferring recombination rates, to mapping missing contigs in the human genome. Although many methods for local ancestry inference have been proposed, most are designed for use with genotyping arrays and fail to make use of the full spectrum of data available from sequencing. In addition, current haplotype-based approaches are very computationally demanding, requiring large computational time for moderately large sample sizes. Here we present new methods for local ancestry inference that leverage continent-specific variants (CSVs) to attain increased performance over existing approaches in sequenced admixed genomes. A key feature of our approach is that it incorporates the admixed genomes themselves jointly with public datasets, such as 1000 Genomes, to improve the accuracy of CSV calling. We use simulations to show that our approach attains accuracy similar to widely used computationally intensive haplotype-based approaches with large decreases in runtime. Most importantly, we show that our method recovers comparable local ancestries, as the 1000 Genomes consensus local ancestry calls in the real admixed individuals from the 1000 Genomes Project. We extend our approach to account for low-coverage sequencing and show that accurate local ancestry inference can be attained at low sequencing coverage. Finally, we generalize CSVs to sub-continental population-specific variants (sCSVs) and show that in some cases it is possible to determine the sub-continental ancestry for short chromosomal segments on the basis of sCSVs. PMID:24743331
Iwamoto, Masaaki; Mori, Chie; Osakada, Hiroko; Koujin, Takako; Hiraoka, Yasushi; Haraguchi, Tokuko
2018-06-08
Ciliated protozoa possess two morphologically and functionally distinct nuclei: a macronucleus (MAC) and a micronucleus (MIC). The MAC is transcriptionally active and functions in all cellular events. The MIC is transcriptionally inactive during cell growth, but functions in meiotic events to produce progeny nuclei. Thus, these two nuclei must be distinguished by the nuclear proteins required for their distinct functions during cellular events such as cell proliferation and meiosis. To understand the mechanism of the nuclear transport specific to either MAC or MIC, we identified specific nuclear localization signals (NLSs) in two MAC- and MIC-specific nuclear proteins, macronuclear histone H1 and micronuclear linker histone-like protein (Mlh1), respectively. By expressing GFP-fused fragments of these proteins in Tetrahymena thermophila cells, two distinct regions in macronuclear histone H1 protein were assigned as independent MAC-specific NLSs and two distinct regions in Mlh1 protein were assigned as independent MIC-specific NLSs. These NLSs contain several essential lysine residues responsible for the MAC- and MIC-specific nuclear transport, but neither contains any consensus sequence with known monopartite or bipartite NLSs in other model organisms. Our findings contribute to understanding how specific nuclear targeting is achieved to perform distinct nuclear functions in binucleated ciliates. © 2018 The Authors. Genes to Cells published by Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
(Brassicaceae) based on nuclear ribosomal ITS DNA sequences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...
On the Ideal Convergence of Double Sequences in Locally Solid Riesz Spaces
Directory of Open Access Journals (Sweden)
A. Alotaibi
2014-01-01
Full Text Available The aim of this paper is to define the notions of ideal convergence, I-bounded for double sequences in setting of locally solid Riesz spaces and study some results related to these notions. We also define the notion of I*-convergence for double sequences in locally solid Riesz spaces and establish its relationship with ideal convergence.
Nuclear technologies for local energy systems
International Nuclear Information System (INIS)
McDonnell, F.N.; Lynch, G.F.
1990-03-01
If nuclear energy is to realize its full potential as a safe and cost-effective alternative to fossil fuels, applications beyond those that are currently being serviced by large, central nuclear power stations must be identified and appropriate reactors developed. The Canadian program on reactor systems for local energy supply is at the forefront of these developments. This program emphasizes design simplicity, low power density and fuel rating, reliance on natural processes, passive systems, and reduced reliance on operator action. The first product, the SLOWPOKE Energy System, is a 10 MW heat source specifically designed to provide hot water to satisfy the needs of local heating systems for building complexes, institutions and municipal district heating systems. A demonstration heating reactor has been constructed at the Whiteshell Nuclear Research Establishment in Manitoba and has been undergoing an extensive test program since first operation in 1987 July. Based on the knowledge learned from the design, construction, licensing and operational testing of this facility, the design of the 10 MW commercial-size unit is well advanced, and Atomic Energy of Canada Limited is prepared to commit the construction of the first commercial unit. Although the technical demonstration of the concept is important, it is recognized that another crucial element is the public and regulatory acceptance of small nuclear systems in urban areas. The decision by a community to commit the construction of a SLOWPOKE Energy System brings to a sharp focus the current public apprehension about nuclear technologies
Understanding local residents of Korea using nuclear effective safety
International Nuclear Information System (INIS)
Chung, Yun Hyung; Lee, Gey Hwi; Hah, Yeonhee; Kim, Beom Jun
2010-01-01
The risk perception gap between experts and lay people is based on the use of different concept on risk. It is getting increasingly important for nuclear practitioners to understand the lay people's subjective perception on nuclear safety. We proposed the nuclear effective safety index (NESI) which is based on data of the public survey of local inhabitants. We extracted the four factors for effective safety indicators; communication, trust, plant emergency response capability, and personal emergency coping skills. The latest NESI was 41.54, which was increased from 38.22 but still low. The three-year data of NESI showed the differences between genders and between sites as well as trend. The survey of antecedents of effective safety showed some meaningful events and profound differences between plant employees and local inhabitants. The NESI can be utilized as useful communication tool between the local inhabitants and nuclear practitioners. (authors)
Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-10-01
Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All
Myosin-1C uses a novel phosphoinositide-dependent pathway for nuclear localization.
Nevzorov, Ilja; Sidorenko, Ekaterina; Wang, Weihuan; Zhao, Hongxia; Vartiainen, Maria K
2018-02-01
Accurate control of macromolecule transport between nucleus and cytoplasm underlines several essential biological processes, including gene expression. According to the canonical model, nuclear import of soluble proteins is based on nuclear localization signals and transport factors. We challenge this view by showing that nuclear localization of the actin-dependent motor protein Myosin-1C (Myo1C) resembles the diffusion-retention mechanism utilized by inner nuclear membrane proteins. We show that Myo1C constantly shuttles in and out of the nucleus and that its nuclear localization does not require soluble factors, but is dependent on phosphoinositide binding. Nuclear import of Myo1C is preceded by its interaction with the endoplasmic reticulum, and phosphoinositide binding is specifically required for nuclear import, but not nuclear retention, of Myo1C. Our results therefore demonstrate, for the first time, that membrane association and binding to nuclear partners is sufficient to drive nuclear localization of also soluble proteins, opening new perspectives to evolution of cellular protein sorting mechanisms. © 2018 The Authors. Published under the terms of the CC BY NC ND 4.0 license.
Nuclear pore complex protein mediated nuclear localization of dicer protein in human cells.
Directory of Open Access Journals (Sweden)
Yoshinari Ando
Full Text Available Human DICER1 protein cleaves double-stranded RNA into small sizes, a crucial step in production of single-stranded RNAs which are mediating factors of cytoplasmic RNA interference. Here, we clearly demonstrate that human DICER1 protein localizes not only to the cytoplasm but also to the nucleoplasm. We also find that human DICER1 protein associates with the NUP153 protein, one component of the nuclear pore complex. This association is detected predominantly in the cytoplasm but is also clearly distinguishable at the nuclear periphery. Additional characterization of the NUP153-DICER1 association suggests NUP153 plays a crucial role in the nuclear localization of the DICER1 protein.
Local economic impact of nuclear power
International Nuclear Information System (INIS)
Shurcliff, A.W.
1977-01-01
The local economic impact of nuclear installations is examined and the conclusion reached that much of the subsequent area growth may be coincidental to the facility. Nuclear siting criteria favor proximity to a regional power grid, abundant water for cooling, and extensive vacant land with a major access road. These criteria coincide with the characteristics of commuter suburbs, centers for retirement, and recreation areas. Clustering of nuclear units introduces an extraordinary level of new construction, office requirements, and capital. Economic changes will occur at the start and completion of the construction stage and at the time of decommissioning the facility. Past experiences are detailed in terms of employment, payroll, housing, public services, and procurement. When construction is completed, employment falls to a relatively low level. Proximity to the plant offers no advantage in terms of local power rates. While nuclear facilities do not preclude other development in the area, there are restrictions on access, regulatory agencies may reject absorbing the cost of public use as a business expense in the rate structure, and security measures may constrain public use. There is pressure for tax equalization laws to compensate communities for the loss of potential property tax revenues. Some agencies (e.g., the Tennessee Valley Authority) make in-lieu-of-tax payments, while some plants have produced tax benefits large enough to effect significant public improvements. 8 references
NLStradamus: a simple Hidden Markov Model for nuclear localization signal prediction
Directory of Open Access Journals (Sweden)
Provart Nicholas
2009-06-01
Full Text Available Abstract Background Nuclear localization signals (NLSs are stretches of residues within a protein that are important for the regulated nuclear import of the protein. Of the many import pathways that exist in yeast, the best characterized is termed the 'classical' NLS pathway. The classical NLS contains specific patterns of basic residues and computational methods have been designed to predict the location of these motifs on proteins. The consensus sequences, or patterns, for the other import pathways are less well-understood. Results In this paper, we present an analysis of characterized NLSs in yeast, and find, despite the large number of nuclear import pathways, that NLSs seem to show similar patterns of amino acid residues. We test current prediction methods and observe a low true positive rate. We therefore suggest an approach using hidden Markov models (HMMs to predict novel NLSs in proteins. We show that our method is able to consistently find 37% of the NLSs with a low false positive rate and that our method retains its true positive rate outside of the yeast data set used for the training parameters. Conclusion Our implementation of this model, NLStradamus, is made available at: http://www.moseslab.csb.utoronto.ca/NLStradamus/
Parasail: SIMD C library for global, semi-global, and local pairwise sequence alignments.
Daily, Jeff
2016-02-10
Sequence alignment algorithms are a key component of many bioinformatics applications. Though various fast Smith-Waterman local sequence alignment implementations have been developed for x86 CPUs, most are embedded into larger database search tools. In addition, fast implementations of Needleman-Wunsch global sequence alignment and its semi-global variants are not as widespread. This article presents the first software library for local, global, and semi-global pairwise intra-sequence alignments and improves the performance of previous intra-sequence implementations. A faster intra-sequence local pairwise alignment implementation is described and benchmarked, including new global and semi-global variants. Using a 375 residue query sequence a speed of 136 billion cell updates per second (GCUPS) was achieved on a dual Intel Xeon E5-2670 24-core processor system, the highest reported for an implementation based on Farrar's 'striped' approach. Rognes's SWIPE optimal database search application is still generally the fastest available at 1.2 to at best 2.4 times faster than Parasail for sequences shorter than 500 amino acids. However, Parasail was faster for longer sequences. For global alignments, Parasail's prefix scan implementation is generally the fastest, faster even than Farrar's 'striped' approach, however the opal library is faster for single-threaded applications. The software library is designed for 64 bit Linux, OS X, or Windows on processors with SSE2, SSE41, or AVX2. Source code is available from https://github.com/jeffdaily/parasail under the Battelle BSD-style license. Applications that require optimal alignment scores could benefit from the improved performance. For the first time, SIMD global, semi-global, and local alignments are available in a stand-alone C library.
Accident sequences simulated at the Juragua nuclear power plant
International Nuclear Information System (INIS)
Carbajo, J.J.
1998-01-01
Different hypothetical accident sequences have been simulated at Unit 1 of the Juragua nuclear power plant in Cuba, a plant with two VVER-440 V213 units under construction. The computer code MELCOR was employed for these simulations. The sequences simulated are: (1) a design-basis accident (DBA) large loss of coolant accident (LOCA) with the emergency core coolant system (ECCS) on, (2) a station blackout (SBO), (3) a small LOCA (SLOCA) concurrent with SBO, (4) a large LOCA (LLOCA) concurrent with SBO, and (5) a LLOCA concurrent with SBO and with the containment breached at time zero. Timings of important events and source term releases have been calculated for the different sequences analyzed. Under certain weather conditions, the fission products released from the severe accident sequences may travel to southern Florida
Complex programmable logic device based alarm sequencer for nuclear power plants
International Nuclear Information System (INIS)
Khedkar, Ravindra; Solomon, J. Selva; KrishnaKumar, B.
2001-01-01
Complex Programmable Logic Device based Alarm Sequencer is an instrument, which detects alarms, memorizes them and displays the sequences of occurrence of alarms. It caters to sixteen alarm signals and distinguishes the sequence among any two alarms with a time resolution of 1 ms. The system described has been designed for continuous operation in process plants, nuclear power plants etc. The system has been tested and found to be working satisfactorily. (author)
The local impacts of nuclear stations
International Nuclear Information System (INIS)
Gammon, K.M.
1981-01-01
The paper looks at the various non-radiological impacts of nuclear power stations on the environment which are grouped as ecological, amenity and socio-economic effects. The study and assessment of environment impacts are explained and comparisons made between those from nuclear and coal fired power stations. The prediction of future effects and judgement of their significance is difficult but is helped by the procedures evolved and by knowledge from the construction and operation of a large number of projects in physically different locations. Research is also needed into new issues and this must be recognised early. From experience of a number of nuclear stations it appears that the local impacts are acceptable provided care is taken. (author)
Image sequence analysis in nuclear medicine: (1) Parametric imaging using statistical modelling
International Nuclear Information System (INIS)
Liehn, J.C.; Hannequin, P.; Valeyre, J.
1989-01-01
This is a review of parametric imaging methods on Nuclear Medicine. A Parametric Image is an image in which each pixel value is a function of the value of the same pixel of an image sequence. The Local Model Method is the fitting of each pixel time activity curve by a model which parameter values form the Parametric Images. The Global Model Method is the modelling of the changes between two images. It is applied to image comparison. For both methods, the different models, the identification criterion, the optimization methods and the statistical properties of the images are discussed. The analysis of one or more Parametric Images is performed using 1D or 2D histograms. The statistically significant Parametric Images, (Images of significant Variances, Amplitudes and Differences) are also proposed [fr
Interactions of rat repetitive sequence MspI8 with nuclear matrix proteins during spermatogenesis
International Nuclear Information System (INIS)
Rogolinski, J.; Widlak, P.; Rzeszowska-Wolny, J.
1996-01-01
Using the Southwestern blot analysis we have studied the interactions between rat repetitive sequence MspI8 and the nuclear matrix proteins of rats testis cells. Starting from 2 weeks the young to adult animal showed differences in type of testis nuclear matrix proteins recognizing the MspI8 sequence. The same sets of nuclear matrix proteins were detected in some enriched in spermatocytes and spermatids and obtained after fractionation of cells of adult animal by the velocity sedimentation technique. (author). 21 refs, 5 figs
Energy Technology Data Exchange (ETDEWEB)
Lalime, Erin N.; Pekosz, Andrew, E-mail: apekosz@jhsph.edu
2014-06-15
The influenza A virus NS1 protein has a nuclear localization sequence (NLS) in the amino terminal region. This NLS overlaps sequences that are important for RNA binding as well as protein dimerization. To assess the significance of the NS1 NLS on influenza virus replication, the NLS amino acids were individually mutated to alanines and recombinant viruses encoding these mutations were rescued. Viruses containing NS1 proteins with mutations at R37, R38 and K41 displayed minimal changes in replication or NS1 protein nuclear localization. Recombinant viruses encoding NS1 R35A were not recovered but viruses containing second site mutations at position D39 in addition to the R35A mutation were isolated. The mutations at position 39 were shown to partially restore NS1 protein dimerization but had minimal effects on nuclear localization. These data indicate that the amino acids in the NS1 NLS region play a more important role in protein dimerization compared to nuclear localization. - Highlights: • Mutations were introduced into influenza NS1 NLS1. • NS1 R37A, R38A, K41A viruses had minimal changes in replication and NS1 localization. • Viruses from NS1 R35A rescue all contained additional mutations at D39. • NS1 R35A D39X mutations recover dimerization lost in NS1 R35A mutations. • These results reaffirm the importance of dimerization for NS1 protein function.
International Nuclear Information System (INIS)
Lalime, Erin N.; Pekosz, Andrew
2014-01-01
The influenza A virus NS1 protein has a nuclear localization sequence (NLS) in the amino terminal region. This NLS overlaps sequences that are important for RNA binding as well as protein dimerization. To assess the significance of the NS1 NLS on influenza virus replication, the NLS amino acids were individually mutated to alanines and recombinant viruses encoding these mutations were rescued. Viruses containing NS1 proteins with mutations at R37, R38 and K41 displayed minimal changes in replication or NS1 protein nuclear localization. Recombinant viruses encoding NS1 R35A were not recovered but viruses containing second site mutations at position D39 in addition to the R35A mutation were isolated. The mutations at position 39 were shown to partially restore NS1 protein dimerization but had minimal effects on nuclear localization. These data indicate that the amino acids in the NS1 NLS region play a more important role in protein dimerization compared to nuclear localization. - Highlights: • Mutations were introduced into influenza NS1 NLS1. • NS1 R37A, R38A, K41A viruses had minimal changes in replication and NS1 localization. • Viruses from NS1 R35A rescue all contained additional mutations at D39. • NS1 R35A D39X mutations recover dimerization lost in NS1 R35A mutations. • These results reaffirm the importance of dimerization for NS1 protein function
Energy Technology Data Exchange (ETDEWEB)
Marshall, Kris S.; Cohen, Michael J.; Fonseca, Greg J.; Todorovic, Biljana; King, Cason R. [Department of Microbiology and Immunology, Western University, London Regional Cancer Program, London, ON, Canada N6A 4L6 (Canada); Yousef, Ahmed F. [Department of Chemical and Environmental Engineering, Masdar Institute, Abu Dhabi (United Arab Emirates); Zhang, Zhiying [College of Animal Science and Technologies, Northwest A and F University, Yangling, Shaanxi 712100 (China); Mymryk, Joe S., E-mail: jmymryk@uwo.ca [Department of Microbiology and Immunology, Western University, London Regional Cancer Program, London, ON, Canada N6A 4L6 (Canada); Department of Oncology, Western University, London Regional Cancer Program, London, ON, Canada N6A 4L6 (Canada)
2014-04-15
The human adenovirus 5 (HAdV-5) E1A protein has a well defined canonical nuclear localization signal (NLS) located at its C-terminus. We used a genetic assay in the yeast Saccharomyces cerevisiae to demonstrate that the canonical NLS is present and functional in the E1A proteins of each of the six HAdV species. This assay also detects a previously described non-canonical NLS within conserved region 3 and a novel active NLS within the N-terminal/conserved region 1 portion of HAdV-5 E1A. These activities were also present in the E1A proteins of each of the other five HAdV species. These results demonstrate that, despite substantial differences in primary sequence, HAdV E1A proteins are remarkably consistent in that they contain one canonical and two non-canonical NLSs. By utilizing independent mechanisms, these multiple NLSs ensure nuclear localization of E1A in the infected cell. - Highlights: • HAdV E1A uses multiple mechanisms for nuclear import. • We identified an additional non-canonical NLS in the N-terminal/CR1 portion of E1A. • The new NLS does not contact importin-alpha directly. • All NLSs are functionally conserved in the E1A proteins of all 6 HAdV species.
Protein Sub-Nuclear Localization Prediction Using SVM and Pfam Domain Information
Kumar, Ravindra; Jain, Sohni; Kumari, Bandana; Kumar, Manish
2014-01-01
The nucleus is the largest and the highly organized organelle of eukaryotic cells. Within nucleus exist a number of pseudo-compartments, which are not separated by any membrane, yet each of them contains only a specific set of proteins. Understanding protein sub-nuclear localization can hence be an important step towards understanding biological functions of the nucleus. Here we have described a method, SubNucPred developed by us for predicting the sub-nuclear localization of proteins. This method predicts protein localization for 10 different sub-nuclear locations sequentially by combining presence or absence of unique Pfam domain and amino acid composition based SVM model. The prediction accuracy during leave-one-out cross-validation for centromeric proteins was 85.05%, for chromosomal proteins 76.85%, for nuclear speckle proteins 81.27%, for nucleolar proteins 81.79%, for nuclear envelope proteins 79.37%, for nuclear matrix proteins 77.78%, for nucleoplasm proteins 76.98%, for nuclear pore complex proteins 88.89%, for PML body proteins 75.40% and for telomeric proteins it was 83.33%. Comparison with other reported methods showed that SubNucPred performs better than existing methods. A web-server for predicting protein sub-nuclear localization named SubNucPred has been established at http://14.139.227.92/mkumar/subnucpred/. Standalone version of SubNucPred can also be downloaded from the web-server. PMID:24897370
Johansson, Bente Berg; Fjeld, Karianne; Solheim, Marie Holm; Shirakawa, Jun; Zhang, Enming; Keindl, Magdalena; Hu, Jiang; Lindqvist, Andreas; Døskeland, Anne; Mellgren, Gunnar; Flatmark, Torgeir; Njølstad, Pål Rasmus; Kulkarni, Rohit N; Wierup, Nils; Aukrust, Ingvild; Bjørkhaug, Lise
2017-10-15
The localization of glucokinase in pancreatic beta-cell nuclei is a controversial issue. Although previous reports suggest such a localization, the mechanism for its import has so far not been identified. Using immunofluorescence, subcellular fractionation and mass spectrometry, we present evidence in support of glucokinase localization in beta-cell nuclei of human and mouse pancreatic sections, as well as in human and mouse isolated islets, and murine MIN6 cells. We have identified a conserved, seven-residue nuclear localization signal ( 30 LKKVMRR 36 ) in the human enzyme. Substituting the residues KK 31,32 and RR 35,36 with AA led to a loss of its nuclear localization in transfected cells. Furthermore, our data indicates that SUMOylation of glucokinase modulates its nuclear import, while high glucose concentrations do not significantly alter the enzyme nuclear/cytosolic ratio. Thus, for the first time, we provide data in support of a nuclear import of glucokinase mediated by a redundant mechanism, involving a nuclear localization signal, and which is modulated by its SUMOylation. These findings add new knowledge to the functional role of glucokinase in the pancreatic beta-cell. Copyright © 2017 Elsevier B.V. All rights reserved.
The ANCLI White Paper on Local Governance of Nuclear Sites
International Nuclear Information System (INIS)
Delalonde, Jean-Claude; Demet, Michel; Gadbois, Serge; Heriard Dubreuil, Gilles
2006-01-01
The 1981 circular, 'Information Commissions attached to Power Stations', was an important regulatory step, which enabled local communities to come together to discuss nuclear issues with the site operators and official inspectorates. However the Local Information Commissions (CLI), have encountered numerous obstacles, both practical and legislative, in fulfilling their role as information providers and, particularly, as monitors. It is now acknowledged in France both by members of commissions at local level and by public authorities that CLI would benefit from a more statutory role in the decision-making process as well as from a specific legal statute associated with independent resources. The forthcoming Nuclear Safety and Transparency Bill should establish a new legal and institutional framework for local commissions. The National Association of CLI (ANCLI) gathers and represents the CLI at national level. In Spring 2005, in the perspective of the Nuclear Safety and Transparency bill, the ANCLI initiated a participatory process involving about 30 delegates from a dozen CLI (elected representatives, NGOs, local experts) in order to raise a common expertise and make recommendations on this new legal statute, on the basis of their own return of experience. The White Paper is structured around four main subject areas: Structure and status of CLIs, local powers; - Role of CLIs and ANCLI in the national and international decision-making process; Local communities' access to specialist expertise; and Waste management. The CLIs reaffirm their local powers and ability to best assure the continued monitoring of nuclear sites and any other nuclear issues in their area. In particular, this local authority allows them to balance different risks as well as political and economic decisions which have a bearing on their region's future. It implies a certain autonomy on the part of CLIs in the exercise of their scrutiny functions, evaluating all the factors impacting both on the
International Nuclear Information System (INIS)
Le Thanh Nhan
2003-08-01
Let (R,m) be a Noetherian local ring and M a finitely generated R-module. The two notions of generalized regular sequence and generalized depth are introduced as extensions of the known notions of regular sequence and depth respectively. Some properties of generalized regular sequence and generalized depth, which are closely related to that of regular sequence and depth, are given. If x 1 ,... ,x r is a generalized regular sequence of M then union n1,...,nr Ass M/(x 1 n 1 ,... ,x r n r )M is a finite set. Some finiteness properties for associated primes of local cohomology modules are presented. (author)
International Nuclear Information System (INIS)
Woodson, S.A.; Crothers, D.M.
1987-01-01
A series of bulge-containing and normal double-helical synthetic oligodeoxyribonucleotides, of sequence corresponding to a frame-shift mutational hot spot in the λ C/sub I/ gene, are compared by proton magnetic resonance spectroscopy at 500 MHz. The imino proton resonances are assigned by one-dimensional nuclear Overhauser effect spectroscopy. Nonselective T 1 inversion-recovery experiments are used to determine exchangeable proton lifetimes and to compare helix stability and dynamics of the three duplexes. An extra adenosine flanking the internal G-C base pairs has a strongly localized effect on helix stability, but the destabilizing effect of an extra cytidine in a C tract is delocalized over the entire G-C run. These data lead to the conclusion that the position of the bulge migrates along the run in the fast-exchange limit on the NMR time scale. Rapid migration of the bulge defect in homopolymeric sequences may help rationalize both frame-shift mutagenesis and translational frame shifting. The authors estimate that the unfavorable free energy of a localized bulge defect is 2.9-3.2 kcal/mol, in good agreement with earlier estimates for RNA helices
Exploring Localization in Nuclear Spin Chains
Wei, Ken Xuan; Ramanathan, Chandrasekhar; Cappellaro, Paola
2018-02-01
Characterizing out-of-equilibrium many-body dynamics is a complex but crucial task for quantum applications and understanding fundamental phenomena. A central question is the role of localization in quenching thermalization in many-body systems and whether such localization survives in the presence of interactions. Probing this question in real systems necessitates the development of an experimentally measurable metric that can distinguish between different types of localization. While it is known that the localized phase of interacting systems [many-body localization (MBL)] exhibits a long-time logarithmic growth in entanglement entropy that distinguishes it from the noninteracting case of Anderson localization (AL), entanglement entropy is difficult to measure experimentally. Here, we present a novel correlation metric, capable of distinguishing MBL from AL in high-temperature spin systems. We demonstrate the use of this metric to detect localization in a natural solid-state spin system using nuclear magnetic resonance (NMR). We engineer the natural Hamiltonian to controllably introduce disorder and interactions, and observe the emergence of localization. In particular, while our correlation metric saturates for AL, it slowly keeps increasing for MBL, demonstrating analogous features to entanglement entropy, as we show in simulations. Our results show that our NMR techniques, akin to measuring out-of-time correlations, are well suited for studying localization in spin systems.
International Nuclear Information System (INIS)
Mays, G.T.
1990-01-01
The U.S. Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedback of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrence of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objectives of SCSS, the information it contains, and the format and approach for constructing SCSS event sequences. Examples are presented demonstrating the use of SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted. Considerable experience has been gained in the areas of evolving and changing data requirements, staffing requirements, and quality control and quality assurance procedures for addressing consistency, software/hardware considerations for developing and maintaining a complex system, documentation requirements, and end-user needs. Two other approaches for constructing and evaluating event sequences are examined including the Accident Precursor Program (ASP) where sequences having the potential for core damage are identified and analyzed, and the Significant Event Compilation Tree
International Nuclear Information System (INIS)
Sugawara, Shin-etsu; Shiroyama, Hideaki
2011-01-01
This paper shows a comparative analysis between France and Japan on the way of the local governments' involvement in nuclear safety governance through some interviews. In France, a law came into force that requires related local governments to establish 'Commision Locale d'Information' (CLI), which means the local governments officially involve in nuclear regulatory activity. Meanwhile, in Japan, related local governments substantially involve in the operation of nuclear facilities through the 'safety agreements' in spite of the lack of legal authority. As a result of comparative analysis, we can point out some institutional input from French cases as follows: to clarify the local governments' roles in the nuclear regulation system, to establish the official channels of communication among nuclear utilities, national regulatory authorities and local governments, and to stipulate explicitly the transparency as a purpose of safety regulation. (author)
Nuclear targeting peptide scaffolds for lipofection of nondividing mammalian cells.
Subramanian, A; Ranganathan, P; Diamond, S L
1999-09-01
Lipofection of nondividing cells is inefficient because much of the transfected DNA is retained in endosomes, and that which escapes to the cytoplasm enters the nucleus at low rates. To improve the final rate-limiting step of nuclear import, we conjugated a nonclassical nuclear localization signal (NLS) containing the M9 sequence of heterogeneous nuclear ribonucleoprotein (hnRNP) A1, to a cationic peptide scaffold derived from a scrambled sequence of the SV40 T-antigen consensus NLS (ScT). The ScT was added to improve DNA binding of the M9 sequence. Lipofection of confluent endothelium with plasmid complexed with the M9-ScT conjugate resulted in 83% transfection and a 63-fold increase in marker gene expression. The M9-ScT conjugate localized fluorescent plasmid into the nucleus of permeabilized cells, and addition of the nuclear pore blocker wheat germ agglutinin prevented nuclear import. This method of gene transfer may lead to viral- and lipid-free transfection of nondividing cells.
The Political Styles of Local Anti-Nuclear Waste Movements in Finland
Energy Technology Data Exchange (ETDEWEB)
Kojo, Matti [Univ. of Tampere (Finland). Dept. of Political Science and International Relations
2001-07-01
This paper aims to analyse the political styles of local anti-nuclear waste movements in Finland. The main focus is on the tension between the environmental impact assessment process (EIA) and the activity of local opposing groups. According to the EIA Act the purpose of the EIA process is to provide information and opportunities for citizens to participate in planning. It therefore aims to enhance the transparency of the decision-making process. The Finnish nuclear waste company, Posiva Oy, made great efforts locally to create opportunities for participation, but was much criticised by local activists. My questions are the following: How did these local movements participate in Posiva's EIA process? What kind of local differences were there in participating and how can these differences be explained? And finally; what did the EIA process mean to the political styles of movements? EIA meant a temporary change in political style on local level. Firstly; because it brought science into local politics very clearly. Secondly EIA with the Nuclear Energy Act framed decision-making with a timetable, which Posiva emphasised when local groups wanted to make a decision immediately. Thirdly EIA enabled the problem to be defined according to local needs but on the other hand plan level EIA separated nuclear waste issue from the use of nuclear power. Fourthly dialogue in the EIA process favoured rational discourse. Although local views were heard, the process did try to teach the people how to speak with the decision-making system, in the system's language. Thus the purpose of EIA was to make the local discussion controllable. All the local groups, the Romuvaara, Kivetty and Loviisa Movements and the Friends of the Earth in Pori region, took part in EIA dialogue but the reactions were different. The Romuvaara Movement was very active in participating and succeeded in exploiting EIA locally whereas the Loviisa Movement tried to displace the whole process. The Loviisa
The Political Styles of Local Anti-Nuclear Waste Movements in Finland
International Nuclear Information System (INIS)
Kojo, Matti
2001-01-01
This paper aims to analyse the political styles of local anti-nuclear waste movements in Finland. The main focus is on the tension between the environmental impact assessment process (EIA) and the activity of local opposing groups. According to the EIA Act the purpose of the EIA process is to provide information and opportunities for citizens to participate in planning. It therefore aims to enhance the transparency of the decision-making process. The Finnish nuclear waste company, Posiva Oy, made great efforts locally to create opportunities for participation, but was much criticised by local activists. My questions are the following: How did these local movements participate in Posiva's EIA process? What kind of local differences were there in participating and how can these differences be explained? And finally; what did the EIA process mean to the political styles of movements? EIA meant a temporary change in political style on local level. Firstly; because it brought science into local politics very clearly. Secondly EIA with the Nuclear Energy Act framed decision-making with a timetable, which Posiva emphasised when local groups wanted to make a decision immediately. Thirdly EIA enabled the problem to be defined according to local needs but on the other hand plan level EIA separated nuclear waste issue from the use of nuclear power. Fourthly dialogue in the EIA process favoured rational discourse. Although local views were heard, the process did try to teach the people how to speak with the decision-making system, in the system's language. Thus the purpose of EIA was to make the local discussion controllable. All the local groups, the Romuvaara, Kivetty and Loviisa Movements and the Friends of the Earth in Pori region, took part in EIA dialogue but the reactions were different. The Romuvaara Movement was very active in participating and succeeded in exploiting EIA locally whereas the Loviisa Movement tried to displace the whole process. The Loviisa Movement
Nuclear data uncertainties for local power densities in the Martin-Hoogenboom benchmark
International Nuclear Information System (INIS)
Van der Marck, S.C.; Rochman, D.A.
2013-01-01
The recently developed method of fast Total Monte Carlo to propagate nuclear data uncertainties was applied to the Martin-Hoogenboom benchmark. This Martin- Hoogenboom benchmark prescribes that one calculates local pin powers (of light water cooled reactor) with a statistical uncertainty lower than 1% everywhere. Here we report, for the first time, an estimate of the nuclear data uncertainties for these local pin powers. For each of the more than 6 million local power tallies, the uncertainty due to nuclear data uncertainties was calculated, based on random variation of data for 235 U, 238 U, 239 Pu and H in H 2 O thermal scattering. In the center of the core region, the nuclear data uncertainty is 0.9%. Towards the edges of the core, this uncertainty increases to roughly 3%. The nuclear data uncertainties have been shown to be larger than the statistical uncertainties that the benchmark prescribes
Kesten, Dov; Horovitz-Fried, Miriam; Brutman-Barazani, Tamar; Sampson, Sanford R
2018-04-01
Insulin binding to its cell surface receptor (IR) activates a cascade of events leading to its biological effects. The Insulin-IR complex is rapidly internalized and then is either recycled back to the plasma membrane or sent to lysosomes for degradation. Although most of the receptor is recycled or degraded, a small amount may escape this pathway and migrate to the nucleus of the cell where it might be important in promulgation of receptor signals. In this study we explored the mechanism by which insulin induces IR translocation to the cell nucleus. Experiments were performed cultured L6 myoblasts, AML liver cells and 3T3-L1 adipocytes. Insulin treatment induced a rapid increase in nuclear IR protein levels within 2 to 5 min. Treatment with WGA, an inhibitor of nuclear import, reduced insulin-induced increases nuclear IR protein; IR was, however, translocated to a perinuclear location. Bioinformatics tools predicted a potential nuclear localization sequence (NLS) on IR. Immunofluorescence staining showed that a point mutation on the predicted NLS blocked insulin-induced IR nuclear translocation. In addition, blockade of nuclear IR activation in isolated nuclei by an IR blocking antibody abrogated insulin-induced increases in IR tyrosine phosphorylation and nuclear PKCδ levels. Furthermore, over expression of mutated IR reduced insulin-induced glucose uptake and PKB phosphorylation. When added to isolated nuclei, insulin induced IR phosphorylation but had no effect on nuclear IR protein levels. These results raise questions regarding the possible role of nuclear IR in IR signaling and insulin resistance. Copyright © 2018 Elsevier B.V. All rights reserved.
Nuclear localization of DMP1 proteins suggests a role in intracellular signaling
International Nuclear Information System (INIS)
Siyam, Arwa; Wang, Suzhen; Qin, Chunlin; Mues, Gabriele; Stevens, Roy; D’Souza, Rena N.; Lu, Yongbo
2012-01-01
Highlights: ► Nuclear localization of DMP1 in various cell lines. ► Non-synchronized cells show either nuclear or cytoplasmic localization of DMP1. ► Nuclear DMP1 is restricted to the nucleoplasm but absent in the nucleolus. -- Abstract: Dentin matrix protein 1 (DMP1) is highly expressed in odontoblasts and osteoblasts/osteocytes and plays an essential role in tooth and bone mineralization and phosphate homeostasis. It is debatable whether DMP1, in addition to its function in the extracellular matrix, can enter the nucleus and function as a transcription factor. To better understand its function, we examined the nuclear localization of endogenous and exogenous DMP1 in C3H10T1/2 mesenchymal cells, MC3T3-E1 preosteoblast cells and 17IIA11 odontoblast-like cells. RT-PCR analyses showed the expression of endogenous Dmp1 in all three cell lines, while Western-blot analysis detected a major DMP1 protein band corresponding to the 57 kDa C-terminal fragment generated by proteolytic processing of the secreted full-length DMP1. Immunofluorescent staining demonstrated that non-synchronized cells presented two subpopulations with either nuclear or cytoplasmic localization of endogenous DMP1. In addition, cells transfected with a construct expressing HA-tagged full-length DMP1 also showed either nuclear or cytoplasmic localization of the exogenous DMP1 when examined with an antibody against the HA tag. Furthermore, nuclear DMP1 was restricted to the nucleoplasm but was absent in the nucleolus. In conclusion, these findings suggest that, apart from its role as a constituent of dentin and bone matrix, DMP1 might play a regulatory role in the nucleus.
International Nuclear Information System (INIS)
Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.
2011-01-01
Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)
Dual localized mitochondrial and nuclear proteins as gene expression regulators in plants?
Directory of Open Access Journals (Sweden)
Philippe eGiegé
2012-09-01
Full Text Available Mitochondria heavily depend on the coordinated expression of both mitochondrial and nuclear genomes because some of their most significant activities are held by multi-subunit complexes composed of both mitochondrial and nuclear encoded proteins. Thus, precise communication and signaling pathways are believed to exist between the two compartments. Proteins dual localized to both mitochondria and the nucleus make excellent candidates for a potential involvement in the envisaged communication. Here, we review the identified instances of dual localized nucleo-mitochondrial proteins with an emphasis on plant proteins and discuss their functions, which are seemingly mostly related to gene expression regulation. We discuss whether dual localization could be achieved by dual targeting and / or by re-localization and try to apprehend the signals required for the respective processes. Finally, we propose that in some instances, dual localized mitochondrial and nuclear proteins might act as retrograde signaling molecules for mitochondrial biogenesis.
Directory of Open Access Journals (Sweden)
Mu Zhou
2015-09-01
Full Text Available Due to the wide deployment of wireless local area networks (WLAN, received signal strength (RSS-based indoor WLAN localization has attracted considerable attention in both academia and industry. In this paper, we propose a novel page rank-based indoor mapping and localization (PRIMAL by using the gene-sequenced unlabeled WLAN RSS for simultaneous localization and mapping (SLAM. Specifically, first of all, based on the observation of the motion patterns of the people in the target environment, we use the Allen logic to construct the mobility graph to characterize the connectivity among different areas of interest. Second, the concept of gene sequencing is utilized to assemble the sporadically-collected RSS sequences into a signal graph based on the transition relations among different RSS sequences. Third, we apply the graph drawing approach to exhibit both the mobility graph and signal graph in a more readable manner. Finally, the page rank (PR algorithm is proposed to construct the mapping from the signal graph into the mobility graph. The experimental results show that the proposed approach achieves satisfactory localization accuracy and meanwhile avoids the intensive time and labor cost involved in the conventional location fingerprinting-based indoor WLAN localization.
Zhou, Mu; Zhang, Qiao; Xu, Kunjie; Tian, Zengshan; Wang, Yanmeng; He, Wei
2015-09-25
Due to the wide deployment of wireless local area networks (WLAN), received signal strength (RSS)-based indoor WLAN localization has attracted considerable attention in both academia and industry. In this paper, we propose a novel page rank-based indoor mapping and localization (PRIMAL) by using the gene-sequenced unlabeled WLAN RSS for simultaneous localization and mapping (SLAM). Specifically, first of all, based on the observation of the motion patterns of the people in the target environment, we use the Allen logic to construct the mobility graph to characterize the connectivity among different areas of interest. Second, the concept of gene sequencing is utilized to assemble the sporadically-collected RSS sequences into a signal graph based on the transition relations among different RSS sequences. Third, we apply the graph drawing approach to exhibit both the mobility graph and signal graph in a more readable manner. Finally, the page rank (PR) algorithm is proposed to construct the mapping from the signal graph into the mobility graph. The experimental results show that the proposed approach achieves satisfactory localization accuracy and meanwhile avoids the intensive time and labor cost involved in the conventional location fingerprinting-based indoor WLAN localization.
Early localization of NPA58, a rat nuclear pore-associated protein
Indian Academy of Sciences (India)
We have studied the mitotic reassembly of the nuclear envelope, using antibodies to nuclear marker proteins and NPA58 in F-111 rat fibroblast cells. In earlier studies we have proposed that NPA58, a 58 kDa rat nuclear protein, is involved in nuclear protein import. In this report, NPA58 is shown to be localized on the ...
Study and realisation of a programmable generator of pulse sequences, for nuclear magnetic resonance
International Nuclear Information System (INIS)
Lambert, Daniel
1974-01-01
After having recalled the operation of pulse-based nuclear magnetic resonance and the use of pulse sequences in NMR-based measurements, and outlined the need for a pulse sequence generator, the author reports the design and realisation of such a device. He describes its general organisation with its base sequence, base clock, sequence start, duration, displays, data transfers, data processing, and signal distribution. He presents the chosen technology (ECL logics), the sequence base set, time bases, multiplexers, comparison sets, the distribution set, the sequence programming, the sampling and output set. He reports tests and the use of the so-designed generator [fr
The analysis of energy-time sequences in the nuclear power plants construction
International Nuclear Information System (INIS)
Milivojevic, S.; Jovanovic, V.; Riznic, J.
1983-01-01
The current nuclear energy development pose many problems; one of them is nuclear power plant construction. They are evaluated energy and time features of the construction and their relative ratios by the analysis of available data. The results point at the reached efficiency of the construction and, in the same time, they are the basis for real estimation of energy-time sequences of the construction in the future. (author)
Prm3p is a pheromone-induced peripheral nuclear envelope protein required for yeast nuclear fusion.
Shen, Shu; Tobery, Cynthia E; Rose, Mark D
2009-05-01
Nuclear membrane fusion is the last step in the mating pathway of the yeast Saccharomyces cerevisiae. We adapted a bioinformatics approach to identify putative pheromone-induced membrane proteins potentially required for nuclear membrane fusion. One protein, Prm3p, was found to be required for nuclear membrane fusion; disruption of PRM3 caused a strong bilateral defect, in which nuclear congression was completed but fusion did not occur. Prm3p was localized to the nuclear envelope in pheromone-responding cells, with significant colocalization with the spindle pole body in zygotes. A previous report, using a truncated protein, claimed that Prm3p is localized to the inner nuclear envelope. Based on biochemistry, immunoelectron microscopy and live cell microscopy, we find that functional Prm3p is a peripheral membrane protein exposed on the cytoplasmic face of the outer nuclear envelope. In support of this, mutations in a putative nuclear localization sequence had no effect on full-length protein function or localization. In contrast, point mutations and deletions in the highly conserved hydrophobic carboxy-terminal domain disrupted both protein function and localization. Genetic analysis, colocalization, and biochemical experiments indicate that Prm3p interacts directly with Kar5p, suggesting that nuclear membrane fusion is mediated by a protein complex.
Nuclear localization of DMP1 proteins suggests a role in intracellular signaling
Energy Technology Data Exchange (ETDEWEB)
Siyam, Arwa [Department of Biomedical Sciences, Baylor College of Dentistry, Texas A and M Health Science Center, 3302 Gaston Ave., Dallas, TX 75246-2013 (United States); Department of Endodontology, Kornberg School of Dentistry, Temple University, 3223 North Broad Street, Philadelphia, PA 19140-5007 (United States); Wang, Suzhen; Qin, Chunlin; Mues, Gabriele [Department of Biomedical Sciences, Baylor College of Dentistry, Texas A and M Health Science Center, 3302 Gaston Ave., Dallas, TX 75246-2013 (United States); Stevens, Roy [Department of Endodontology, Kornberg School of Dentistry, Temple University, 3223 North Broad Street, Philadelphia, PA 19140-5007 (United States); D' Souza, Rena N. [Department of Biomedical Sciences, Baylor College of Dentistry, Texas A and M Health Science Center, 3302 Gaston Ave., Dallas, TX 75246-2013 (United States); Lu, Yongbo, E-mail: ylu@bcd.tamhsc.edu [Department of Biomedical Sciences, Baylor College of Dentistry, Texas A and M Health Science Center, 3302 Gaston Ave., Dallas, TX 75246-2013 (United States)
2012-08-03
Highlights: Black-Right-Pointing-Pointer Nuclear localization of DMP1 in various cell lines. Black-Right-Pointing-Pointer Non-synchronized cells show either nuclear or cytoplasmic localization of DMP1. Black-Right-Pointing-Pointer Nuclear DMP1 is restricted to the nucleoplasm but absent in the nucleolus. -- Abstract: Dentin matrix protein 1 (DMP1) is highly expressed in odontoblasts and osteoblasts/osteocytes and plays an essential role in tooth and bone mineralization and phosphate homeostasis. It is debatable whether DMP1, in addition to its function in the extracellular matrix, can enter the nucleus and function as a transcription factor. To better understand its function, we examined the nuclear localization of endogenous and exogenous DMP1 in C3H10T1/2 mesenchymal cells, MC3T3-E1 preosteoblast cells and 17IIA11 odontoblast-like cells. RT-PCR analyses showed the expression of endogenous Dmp1 in all three cell lines, while Western-blot analysis detected a major DMP1 protein band corresponding to the 57 kDa C-terminal fragment generated by proteolytic processing of the secreted full-length DMP1. Immunofluorescent staining demonstrated that non-synchronized cells presented two subpopulations with either nuclear or cytoplasmic localization of endogenous DMP1. In addition, cells transfected with a construct expressing HA-tagged full-length DMP1 also showed either nuclear or cytoplasmic localization of the exogenous DMP1 when examined with an antibody against the HA tag. Furthermore, nuclear DMP1 was restricted to the nucleoplasm but was absent in the nucleolus. In conclusion, these findings suggest that, apart from its role as a constituent of dentin and bone matrix, DMP1 might play a regulatory role in the nucleus.
Reflections on the development of local suppliers for the Argentine nuclear industry
International Nuclear Information System (INIS)
Quilici, Domingo F.
2008-01-01
Argentina has given recently a new start to its nuclear power activities. Looking for background and experiences that can be useful under the new reality, the paper is a survey of the past development of local suppliers for the national nuclear industry. Based on the intention to answer the questions: Why so early it was decided to build a nuclear power plant? Why it was decided to buy it under a turnkey basis rather than developing an indigenous design? and what was the meaning of the 'opening of the technology package' at that time?, the paper describes the actions that led to the purchase of the Atucha I, Embalse and Atucha II nuclear power plants and how these decisions were implemented in order to maximize local participation and the technology transfer. It also analyzes the influence of the Argentine Nuclear Plan of the late seventies on the development of endogenous technology and describes the facts that helped to preserve until now the technological nuclear capabilities of the country in spite of the stopping of the Atucha II construction, and to create positive expectations regarding the revival of the local industry as a supplier of nuclear goods and services. (author) [es
Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-07-01
Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic
Application of local computer networks in nuclear-physical experiments and technology
International Nuclear Information System (INIS)
Foteev, V.A.
1986-01-01
The bases of construction, comparative performance and potentialities of local computer networks with respect to their application in physical experiments are considered. The principle of operation of local networks is shown on the basis of the Ethernet network and the results of analysis of their operating performance are given. The examples of operating local networks in the area of nuclear-physics research and nuclear technology are presented as follows: networks of Japan Atomic Energy Research Institute, California University and Los Alamos National Laboratory, network realization according to the DECnet and Fast-bus programs, home network configurations of the USSR Academy of Sciences and JINR Neutron Physical Laboratory etc. It is shown that local networks allows significantly raise productivity in the sphere of data processing
Local AREA networks in advanced nuclear reactors
International Nuclear Information System (INIS)
Bicknell, J.; Keats, A.B.
1984-01-01
The report assesses Local Area Network Communications with a view to their application in advanced nuclear reactor control and protection systems. Attention is focussed on commercially available techniques and systems for achieving the high reliability and availability required. A basis for evaluating network characteristics in terms of broadband or baseband type, medium, topology, node structure and access method is established. The reliability and availability of networks is then discussed. Several commercial networks are briefly assessed and a distinction made between general purpose networks and those suitable for process control. The communications requirements of nuclear reactor control and protection systems are compared with the facilities provided by current technology
International Nuclear Information System (INIS)
Neyton, Sophie; Lespinasse, Francoise; Lahaye, Francois; Staccini, Pascal; Paquis-Flucklinger, Veronique; Santucci-Darmanin, Sabine
2007-01-01
MSH4 and MSH5 are members of the MutS homolog family, a conserved group of proteins involved in DNA mismatch correction and homologous recombination. Although several studies have provided compelling evidences suggesting that MSH4 and MSH5 could act together in early and late stages of meiotic recombination, their precise roles are poorly understood and recent findings suggest that the human MSH4 protein may also exert a cytoplasmic function. Here we show that MSH4 is present in the cytoplasm and the nucleus of both testicular cells and transfected somatic cells. Confocal studies on transfected cells provide the first evidence that the subcellular localization of MSH4 is regulated, at least in part, by an active nuclear export pathway dependent on the exportin CRM1. We used deletion mapping and mutagenesis to define two functional nuclear export sequences within the C-terminal part of hMSH4 that mediate nuclear export through the CRM1 pathway. Our results suggest that CRM1 is also involved in MSH5 nuclear export. In addition, we demonstrate that dimerization of MSH4 and MSH5 facilitates their nuclear localization suggesting that dimerization may regulate the intracellular trafficking of these proteins. Our findings suggest that nucleocytoplasmic traffic may constitute a regulatory mechanism for MSH4 and MSH5 functions
Automatic start-up system of nuclear reactor based on sequence control technology
International Nuclear Information System (INIS)
Zhang Yao; Zhang Dafa; Peng Huaqing
2009-01-01
A conceptive design of an automatic start-up system based on the sequence control for the nuclear reactors is given in this paper, so as to solve the problems during the start-up process, such as the long operation time, low automatic control level and high accident rate. The start-up process and its requirements are analyzed in detail at first. Then,the principle, the architecture, the key technologies of the automatic start-up system of nuclear reactors are designed and discussed. With the designed system, the automatic start-up of the nuclear reactor can be realized,the work load of the operator can be reduced,and the safety and efficiency of the nuclear power plant during its start-up can be improved. (authors)
International Nuclear Information System (INIS)
Yap, J.T.; Chen, C.T.; Cooper, M.
1995-01-01
The authors have previously developed a knowledge-based method of factor analysis to analyze dynamic nuclear medicine image sequences. In this paper, the authors analyze dynamic PET cerebral glucose metabolism and neuroreceptor binding studies. These methods have shown the ability to reduce the dimensionality of the data, enhance the image quality of the sequence, and generate meaningful functional images and their corresponding physiological time functions. The new information produced by the factor analysis has now been used to improve the estimation of various physiological parameters. A principal component analysis (PCA) is first performed to identify statistically significant temporal variations and remove the uncorrelated variations (noise) due to Poisson counting statistics. The statistically significant principal components are then used to reconstruct a noise-reduced image sequence as well as provide an initial solution for the factor analysis. Prior knowledge such as the compartmental models or the requirement of positivity and simple structure can be used to constrain the analysis. These constraints are used to rotate the factors to the most physically and physiologically realistic solution. The final result is a small number of time functions (factors) representing the underlying physiological processes and their associated weighting images representing the spatial localization of these functions. Estimation of physiological parameters can then be performed using the noise-reduced image sequence generated from the statistically significant PCs and/or the final factor images and time functions. These results are compared to the parameter estimation using standard methods and the original raw image sequences. Graphical analysis was performed at the pixel level to generate comparable parametric images of the slope and intercept (influx constant and distribution volume)
HuR and GRSF1 modulate the nuclear export and mitochondrial localization of the lncRNA RMRP
Noh, Ji Heon; Kim, Kyoung Mi; Abdelmohsen, Kotb; Yoon, Je-Hyun; Panda, Amaresh C.; Munk, Rachel; Kim, Jiyoung; Curtis, Jessica; Moad, Christopher A.; Wohler, Christina M.; Indig, Fred E.; de Paula, Wilson; Dudekula, Dawood B.; De, Supriyo; Piao, Yulan; Yang, Xiaoling; Martindale, Jennifer L.; de Cabo, Rafael; Gorospe, Myriam
2016-01-01
Some mitochondrial long noncoding RNAs (lncRNAs) are encoded by nuclear DNA, but the mechanisms that mediate their transport to mitochondria are poorly characterized. Using affinity RNA pull-down followed by mass spectrometry analysis, we found two RNA-binding proteins (RBPs), HuR (human antigen R) and GRSF1 (G-rich RNA sequence-binding factor 1), that associated with the nuclear DNA-encoded lncRNA RMRP and mobilized it to mitochondria. In cultured human cells, HuR bound RMRP in the nucleus and mediated its CRM1 (chromosome region maintenance 1)-dependent export to the cytosol. After RMRP was imported into mitochondria, GRSF1 bound RMRP and increased its abundance in the matrix. Loss of GRSF1 lowered the mitochondrial levels of RMRP, in turn suppressing oxygen consumption rates and modestly reducing mitochondrial DNA replication priming. Our findings indicate that RBPs HuR and GRSF1 govern the cytoplasmic and mitochondrial localization of the lncRNA RMRP, which is encoded by nuclear DNA but has key functions in mitochondria. PMID:27198227
Assessing the fidelity of ancient DNA sequences amplified from nuclear genes
DEFF Research Database (Denmark)
Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.
2006-01-01
To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved...... in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nu...
Directory of Open Access Journals (Sweden)
Yu-Chieh Wu
Full Text Available BACKGROUND: Type I insulin-like growth factor receptor (IGF-1R and insulin receptor (INSR are highly homologous molecules, which can heterodimerize to form an IGF-1R/INSR hybrid (Hybrid-R. The presence and biological significance of the Hybrid-R in human corneal epithelium has not yet been established. In addition, while nuclear localization of IGF-1R was recently reported in cancer cells and human corneal epithelial cells, the function and profile of nuclear IGF-1R is unknown. In this study, we characterized the nuclear localization and function of the Hybrid-R and the role of IGF-1/IGF-1R and Hybrid-R signaling in the human corneal epithelium. METHODOLOGY/PRINCIPLE FINDINGS: IGF-1-mediated signaling and cell growth were examined in a human telomerized corneal epithelial (hTCEpi cell line using co-immunoprecipitation, immunoblotting and cell proliferation assays. The presence of Hybrid-R in hTCEpi and primary cultured human corneal epithelial cells was confirmed by immunofluorescence and reciprocal immunoprecipitation of whole cell lysates. We found that IGF-1 stimulated Akt and promoted cell growth through IGF-1R activation, which was independent of the Hybrid-R. The presence of Hybrid-R, but not IGF-1R/IGF-1R, was detected in nuclear extracts. Knockdown of INSR by small interfering RNA resulted in depletion of the INSR/INSR and preferential formation of Hybrid-R. Chromatin-immunoprecipitation sequencing assay with anti-IGF-1R or anti-INSR was subsequently performed to identify potential genomic targets responsible for critical homeostatic regulatory pathways. CONCLUSION/SIGNIFICANCE: In contrast to previous reports on nuclear localized IGF-1R, this is the first report identifying the nuclear localization of Hybrid-R in an epithelial cell line. The identification of a nuclear Hybrid-R and novel genomic targets suggests that IGF-1R traffics to the nucleus as an IGF-1R/INSR heterotetrameric complex to regulate corneal epithelial homeostatic
Directory of Open Access Journals (Sweden)
Zdepski Anna
2011-05-01
Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.
International Nuclear Information System (INIS)
Wanitchang, Asawin; Narkpuk, Jaraspim; Jongkaewwattana, Anan
2013-01-01
The nucleoprotein of influenza B virus (BNP) shares several characteristics with its influenza A virus counterpart (ANP), including localization in the host's nucleus. However, while the nuclear localization signal(s) (NLS) of ANP are well characterized, little is known about those of BNP. In this study, we showed that the fusion protein bearing the BNP N-terminus fused with GFP (N70–GFP) is exclusively nuclear, and identified a highly conserved KRXR motif spanning residues 44–47 as a putative NLS. In addition, we demonstrated that residues 3–15 of BNP, though not an NLS, are also crucial for nuclear import. Results from mutational analyses of N70–GFP and the full-length BNP suggest that this region may be required for protection of the N-terminus from proteolytic cleavage. Altogether, we propose that the N-terminal region of BNP contains the NLS and cleavage-protection motif, which together drive its nuclear localization. - Highlights: • The N-terminal region of BNP is required for nuclear accumulation. • The conserved motif at position 44–47 is a putative nuclear localization signal. • The first 15 amino acids of BNP may function as a cleavage-protection motif. • BNP may get access to the nucleus via a mechanism distinct from ANP
Energy Technology Data Exchange (ETDEWEB)
Wanitchang, Asawin; Narkpuk, Jaraspim; Jongkaewwattana, Anan, E-mail: anan.jon@biotec.or.th
2013-08-15
The nucleoprotein of influenza B virus (BNP) shares several characteristics with its influenza A virus counterpart (ANP), including localization in the host's nucleus. However, while the nuclear localization signal(s) (NLS) of ANP are well characterized, little is known about those of BNP. In this study, we showed that the fusion protein bearing the BNP N-terminus fused with GFP (N70–GFP) is exclusively nuclear, and identified a highly conserved KRXR motif spanning residues 44–47 as a putative NLS. In addition, we demonstrated that residues 3–15 of BNP, though not an NLS, are also crucial for nuclear import. Results from mutational analyses of N70–GFP and the full-length BNP suggest that this region may be required for protection of the N-terminus from proteolytic cleavage. Altogether, we propose that the N-terminal region of BNP contains the NLS and cleavage-protection motif, which together drive its nuclear localization. - Highlights: • The N-terminal region of BNP is required for nuclear accumulation. • The conserved motif at position 44–47 is a putative nuclear localization signal. • The first 15 amino acids of BNP may function as a cleavage-protection motif. • BNP may get access to the nucleus via a mechanism distinct from ANP.
International Nuclear Information System (INIS)
Mays, G.T.
1989-04-01
The US Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedstock of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrences of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objective SCSS, the information it contains, and the format and approach for constructuring SCSS event sequences. Examples are presented demonstrating the use SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted
Dynamic trafficking of STAT5 depends on an unconventional nuclear localization signal
Shin, Ha Youn; Reich, Nancy C.
2013-01-01
Summary Signal transducer and activator of transcription 5 (STAT5) is crucial for physiological processes that include hematopoiesis, liver metabolism and mammary gland development. However, aberrant continual activity of STAT5 has been causally linked to human leukemias and solid tumor formation. As a regulated transcription factor, precise cellular localization of STAT5 is essential. Conventional nuclear localization signals consist of short stretches of basic amino acids. In this study, we provide evidence that STAT5 nuclear import is dependent on an unconventional nuclear localization signal that functions within the conformation of an extensive coiled-coil domain. Both in vitro binding and in vivo functional assays reveal that STAT5 nuclear import is mediated by the importin-α3/β1 system independently of STAT5 activation by tyrosine phosphorylation. The integrity of the coiled-coil domain is essential for STAT5 transcriptional induction of the β-casein gene following prolactin stimulation as well as its ability to synergize with the glucocorticoid receptor. The glucocorticoid receptor accumulates in the nucleus in response to prolactin and this nuclear import is dependent on STAT5 nuclear import. STAT5 continually shuttles in and out of the nucleus and live cell imaging demonstrates that STAT5 nuclear export is mediated by both chromosome region maintenance 1 (Crm1)-dependent and Crm1-independent pathways. A Crm1-dependent nuclear export signal was identified within the STAT5 N-terminus. These findings provide insight into the fundamental mechanisms that regulate STAT5 nuclear trafficking and cooperation with the glucocorticoid receptor and provide a basis for clinical intervention of STAT5 function in disease. PMID:23704351
Jacobs, Susan C; Taylor, Adam; Herrero, Lara J; Mahalingam, Suresh; Fazakerley, John K
2017-10-20
Transmitted by mosquitoes; chikungunya virus (CHIKV) is responsible for frequent outbreaks of arthritic disease in humans. CHIKV is an arthritogenic alphavirus of the Togaviridae family. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleus. In encephalitic alphaviruses nuclear translocation induces host cell shut off; however, the role of capsid protein nuclear localisation in arthritogenic alphaviruses remains unclear. Using replicon systems, we investigated a nuclear export sequence (NES) in the N-terminal region of capsid protein; analogous to that found in encephalitic alphavirus capsid but uncharacterised in CHIKV. The chromosomal maintenance 1 (CRM1) export adaptor protein mediated CHIKV capsid protein export from the nucleus and a region within the N-terminal part of CHIKV capsid protein was required for active nuclear targeting. In contrast to encephalitic alphaviruses, CHIKV capsid protein did not inhibit host nuclear import; however, mutating the NES of capsid protein (∆NES) blocked host protein access to the nucleus. Interactions between capsid protein and the nucleus warrant further investigation.
International Nuclear Information System (INIS)
Rahman, M.A.; Islam, A.B.M.N.; Quaiyum, M.A.; Hasnat, K.A.; Hossain, M.
1983-01-01
The paper summarizes the overall experience of Bangladesh in planning for the introduction of its nuclear power programme. The basis for selection of the type of contract for the first nuclear power project of the country is explained. The paper then analyses the prospect of local participation in the construction of the first nuclear power station by detailing the local capabilities in fields such as civil works, civil works materials supply, electrical/mechanical supplies, mechanical fabrication/erection, transportation, etc. After analysing the domestic infrastructure, the problem areas are identified and measures necessary to improve the degree of local participation are described. (author)
International Nuclear Information System (INIS)
Van Den Durpel, Luc; Yacout, Abdellatif; Wade, Dave
2008-01-01
The world's future energy needs will require a mix of energy conversion technologies matched to the local energy market needs while also responding to both local and global socio-political concerns, e.g. energy security, environmental impact, safety and non-proliferation. There is growing recognition worldwide that nuclear energy should not only be part of the solution but maybe as well play a larger share in future's energy supply. The sustainability of future nuclear energy systems is hereby important and a variety of studies have already shown that sustainability of nuclear energy from a resource perspective is achievable via the nuclear fuel cycle though where economic sustainability is essentially defined by the nuclear power plants. The main challenge in deploying sustainable nuclear energy systems will be to find synergies between this local competitiveness of nuclear power plants and the global resource sustainability defined via the nuclear fuel cycle. Both may go hand-in-hand in the long-term but may need government guidance in starting the transition towards such future sustainable nuclear energy systems. (authors)
Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X
2017-10-01
The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.
Atypical nuclear localization of VIP receptors in glioma cell lines and patients
Energy Technology Data Exchange (ETDEWEB)
Barbarin, Alice; Séité, Paule [Equipe Récepteurs, Régulations et Cellules Tumorales, Université de Poitiers, PBS bât 36, 1 rue Georges Bonnet, TSA 51106, 86073 Poitiers Cedex 9 (France); Godet, Julie [Laboratoire d’anatomie et de cytologie pathologiques, CHU de Poitiers, 2 rue de la Milétrie, 86000 Poitiers (France); Bensalma, Souheyla; Muller, Jean-Marc [Equipe Récepteurs, Régulations et Cellules Tumorales, Université de Poitiers, PBS bât 36, 1 rue Georges Bonnet, TSA 51106, 86073 Poitiers Cedex 9 (France); Chadéneau, Corinne, E-mail: corinne.chadeneau@univ-poitiers.fr [Equipe Récepteurs, Régulations et Cellules Tumorales, Université de Poitiers, PBS bât 36, 1 rue Georges Bonnet, TSA 51106, 86073 Poitiers Cedex 9 (France)
2014-11-28
Highlights: • The VIP receptor VPAC1 contains a putative NLS signal. • VPAC1 is predominantly nuclear in GBM cell lines but not VPAC2. • Non-nuclear VPAC1/2 protein expression is correlated with glioma grade. • Nuclear VPAC1 is observed in 50% of stage IV glioma (GBM). - Abstract: An increasing number of G protein-coupled receptors, like receptors for vasoactive intestinal peptide (VIP), are found in cell nucleus. As VIP receptors are involved in the regulation of glioma cell proliferation and migration, we investigated the expression and the nuclear localization of the VIP receptors VPAC1 and VPAC2 in this cancer. First, by applying Western blot and immunofluorescence detection in three human glioblastoma (GBM) cell lines, we observed a strong nuclear staining for the VPAC1 receptor and a weak nuclear VPAC2 receptor staining. Second, immunohistochemical staining of VPAC1 and VPAC2 on tissue microarrays (TMA) showed that the two receptors were expressed in normal brain and glioma tissues. Expression in the non-nuclear compartment of the two receptors significantly increased with the grade of the tumors. Analysis of nuclear staining revealed a significant increase of VPAC1 staining with glioma grade, with up to 50% of GBM displaying strong VPAC1 nuclear staining, whereas nuclear VPAC2 staining remained marginal. The increase in VPAC receptor expression with glioma grades and the enhanced nuclear localization of the VPAC1 receptors in GBM might be of importance for glioma progression.
Maleki, Ehsan; Babashah, Hossein; Koohi, Somayyeh; Kavehvash, Zahra
2017-07-01
This paper presents an optical processing approach for exploring a large number of genome sequences. Specifically, we propose an optical correlator for global alignment and an extended moiré matching technique for local analysis of spatially coded DNA, whose output is fed to a novel three-dimensional artificial neural network for local DNA alignment. All-optical implementation of the proposed 3D artificial neural network is developed and its accuracy is verified in Zemax. Thanks to its parallel processing capability, the proposed structure performs local alignment of 4 million sequences of 150 base pairs in a few seconds, which is much faster than its electrical counterparts, such as the basic local alignment search tool.
Nuclear waste information in supplements of local newspapers
International Nuclear Information System (INIS)
Ryhaenen, Veijo
1995-01-01
Full text: The utility Teollisuuden Voima Oy (TVO) is conducting site investigations in Finland to select a final disposal site for spent nuclear fuel. Site selection studies, including deep drillings and other field investigations, have been carried out in different parts of the country since 1987. Now there are three areas in which detailed studies are continued. The programme aims at site selection in the year 2000. Before the construction of the final disposal facility can be started around the year 2010 a precondition in the Finnish legislation is that the council of the local municipality accepts the facility. Hence, an essential task is to distribute information of the studies and of the principles of final disposal to the local decision-makers and public. Information work has an important role already now in order to make people familiar with the long-term project and to build confidence on the safety of final disposal. TVO's information programme includes several types of actions to different target groups, such as press conferences, contact group meetings, open houses, exhibitions, lectures to different groups, visits to the drilling sites and to the existing nuclear waste facilities as well as use of various written material. In January 1994 a new method was applied in the distribution of TVO's written information directly to local public. Four-page supplements were prepared to the local newspapers to inform public of the stage of the site investigations and other topical issues. After that, new supplements have been published in six months intervals. Own supplements have been made for different municipalities in which the candidate areas are situated. The form of the supplement is same as that of the newspaper. As a matter of fact, TVO's information forms a special advertising section in a single issue of a newspaper. The topics handled in the supplements are for example present status of the local bedrock studies, other topical information of TVO
Memory-efficient dynamic programming backtrace and pairwise local sequence alignment.
Newberg, Lee A
2008-08-15
A backtrace through a dynamic programming algorithm's intermediate results in search of an optimal path, or to sample paths according to an implied probability distribution, or as the second stage of a forward-backward algorithm, is a task of fundamental importance in computational biology. When there is insufficient space to store all intermediate results in high-speed memory (e.g. cache) existing approaches store selected stages of the computation, and recompute missing values from these checkpoints on an as-needed basis. Here we present an optimal checkpointing strategy, and demonstrate its utility with pairwise local sequence alignment of sequences of length 10,000. Sample C++-code for optimal backtrace is available in the Supplementary Materials. Supplementary data is available at Bioinformatics online.
International Nuclear Information System (INIS)
Rowland, Raymond R.R.; Schneider, Paula; Fang Ying; Wootton, Sarah; Yoo, Dongwan; Benfield, David A.
2003-01-01
The nucleocapsid (N) protein of porcine reproductive and respiratory syndrome virus (PRRSV) is the principal component of the viral nucleocapsid and localizes to the nucleolus. Peptide sequence analysis of the N protein of several North American isolates identified two potential nuclear localization signal (NLS) sequences located at amino acids 10-13 and 41-42, which were labeled NLS-1 and NLS-2, respectively. Peptides containing NLS-1 or NLS-2 were sufficient to accumulate enhanced green fluorescent protein (EGFP) in the nucleus. The inactivation of NLS-1 by site-directed mutagenesis or the deletion of the first 14 amino acids did not affect N protein localization to the nucleolus. The substitution of key lysine residues with uncharged amino acids in NLS-2 blocked nuclear/nucleolar localization. Site-directed mutagenesis within NLS-2 identified the sequence, KKNKK, as forming the core localization domain within NLS-2. Using an in vitro pull-down assay, the N protein was able to bind importin-α, importin-β nuclear transport proteins. The localization pattern of N-EGFP fusion peptides represented by a series of deletions from the C- and N-terminal ends of the N protein identified a region covering amino acids 41-72, which contained a nucleolar localization signal (NoLS) sequence. The 41-72 N peptide when fused to EGFP mimicked the nucleolar-cytoplasmic distribution of native N. These results identify a single NLS involved in the transport of N from the cytoplasm and into nucleus. An additional peptide sequence, overlapping NLS-2, is involved in the further targeting of N to the nucleolus
Local bifurcation analysis in nuclear reactor dynamics by Sotomayor’s theorem
International Nuclear Information System (INIS)
Pirayesh, Behnam; Pazirandeh, Ali; Akbari, Monireh
2016-01-01
Highlights: • When the feedback reactivity is considered as a nonlinear function some complex behaviors may emerge in the system such as local bifurcation phenomenon. • The qualitative behaviors of a typical nuclear reactor near its equilibrium points have been studied analytically. • Comprehensive analytical bifurcation analyses presented in this paper are transcritical bifurcation, saddle- node bifurcation and pitchfork bifurcation. - Abstract: In this paper, a qualitative approach has been used to explore nuclear reactor behaviors with nonlinear feedback. First, a system of four dimensional ordinary differential equations governing the dynamics of a typical nuclear reactor is introduced. These four state variables are the relative power of the reactor, the relative concentration of delayed neutron precursors, the fuel temperature and the coolant temperature. Then, the qualitative behaviors of the dynamical system near its equilibria have been studied analytically by using local bifurcation theory and Sotomayor’s theorem. The results indicated that despite the uncertainty of the reactivity, we can analyze the qualitative behavior changes of the reactor from the bifurcation point of view. Notably, local bifurcations that were considered in this paper include transcritical bifurcation, saddle-node bifurcation and pitchfork bifurcation. The theoretical analysis showed that these three types of local bifurcations may occur in the four dimensional dynamical system. In addition, to confirm the analytical results the numerical simulations are given.
To put nuclear technical expertise at the service of local authorities
International Nuclear Information System (INIS)
Laffin, R.; Domeneghetti, B.
2016-01-01
The MARN (Mission of support for the management of the nuclear risk) was founded in 1995 to assure the interface between the actors of the nuclear world (nuclear power plant operators, ASN and IRSN) and official bodies at the national scale (ministry of interior) or local scale (prefecture). The MARN takes part in the definition of the crisis exercises and is in charge of organizing the simulation of the media pressure during the exercise. The MARN can also intervene in a real nuclear crisis and its work consists in putting into perspective the technical appreciations and recommendations of nuclear experts and to translate them into operational options for the Prefect. (A.C.)
The N-terminal 33 amino acid domain of Siva-1 is sufficient for nuclear localization
Energy Technology Data Exchange (ETDEWEB)
Chen, J.Y.; Yang, L.X. [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou (China); Huang, Z.F. [Institute of Human Virology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou (China); Department of Biochemistry, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou (China); Key Laboratory of Tropical Diseases Control, Sun Yat-sen University, Ministry of Education in China, Guangzhou (China)
2013-12-02
Siva-1 induces apoptosis in multiple pathological processes and plays an important role in the suppression of tumor metastasis, protein degradation, and other functions. Although many studies have demonstrated that Siva-1 functions in the cytoplasm, a few have found that Siva-1 can relocate to the nucleus. In this study, we found that the first 33 amino acid residues of Siva-1 are required for its nuclear localization. Further study demonstrated that the green fluorescent protein can be imported into the nucleus after fusion with these 33 amino acid residues. Other Siva-1 regions and domains showed less effect on Siva-1 nuclear localization. By site-mutagenesis of all of these 33 amino acid residues, we found that mutants of the first 1-18 amino acids affected Siva-1 nuclear compartmentalization but could not complete this localization independently. In summary, we demonstrated that the N-terminal 33 amino acid residues were sufficient for Siva-1 nuclear localization, but the mechanism of this translocation needs additional investigation.
The N-terminal 33 amino acid domain of Siva-1 is sufficient for nuclear localization
International Nuclear Information System (INIS)
Chen, J.Y.; Yang, L.X.; Huang, Z.F.
2013-01-01
Siva-1 induces apoptosis in multiple pathological processes and plays an important role in the suppression of tumor metastasis, protein degradation, and other functions. Although many studies have demonstrated that Siva-1 functions in the cytoplasm, a few have found that Siva-1 can relocate to the nucleus. In this study, we found that the first 33 amino acid residues of Siva-1 are required for its nuclear localization. Further study demonstrated that the green fluorescent protein can be imported into the nucleus after fusion with these 33 amino acid residues. Other Siva-1 regions and domains showed less effect on Siva-1 nuclear localization. By site-mutagenesis of all of these 33 amino acid residues, we found that mutants of the first 1-18 amino acids affected Siva-1 nuclear compartmentalization but could not complete this localization independently. In summary, we demonstrated that the N-terminal 33 amino acid residues were sufficient for Siva-1 nuclear localization, but the mechanism of this translocation needs additional investigation
Oksayan, Sibil; Wiltzer, Linda; Rowe, Caitlin L.; Blondel, Danielle; Jans, David A.; Moseley, Gregory W.
2012-01-01
Regulated nucleocytoplasmic transport of proteins is central to cellular function and dysfunction during processes such as viral infection. Active protein trafficking into and out of the nucleus is dependent on the presence within cargo proteins of intrinsic specific modular signals for nuclear import (nuclear localization signals, NLSs) and export (nuclear export signals, NESs). Rabies virus (RabV) phospho (P) protein, which is largely responsible for antagonising the host anti-viral response, is expressed as five isoforms (P1–P5). The subcellular trafficking of these isoforms is thought to depend on a balance between the activities of a dominant N-terminal NES (N-NES) and a distinct C-terminal NLS (C-NLS). Specifically, the N-NES-containing isoforms P1 and P2 are cytoplasmic, whereas the shorter P3–P5 isoforms, which lack the N-NES, are believed to be nuclear through the activity of the C-NLS. Here, we show for the first time that RabV P contains an additional strong NLS in the N-terminal region (N-NLS), which, intriguingly, overlaps with the N-NES. This arrangement represents a novel nuclear trafficking module where the N-NLS is inactive in P1 but becomes activated in P3, concomitant with truncation of the N-NES, to become the principal targeting signal conferring nuclear accumulation. Understanding this unique switch arrangement of overlapping, co-regulated NES/NLS sequences is vital to delineating the critical role of RabV P protein in viral infection. PMID:22700958
International Nuclear Information System (INIS)
Piccioli, Zachary; McKee, Courtney H.; Leszczynski, Anna; Onder, Zeynep; Hannah, Erin C.; Mamoor, Shahan; Crosby, Lauren; Moroianu, Junona
2010-01-01
We investigated the nuclear import of low risk HPV11 E7 protein using 1) transfection assays in HeLa cells with EGFP fusion plasmids containing 11E7 and its domains and 2) nuclear import assays in digitonin-permeabilized HeLa cells with GST fusion proteins containing 11E7 and its domains. The EGFP-11E7 and EGFP-11cE7 39-98 localized mostly to the nucleus. The GST-11E7 and GST-11cE7 39-98 were imported into the nuclei in the presence of either Ran-GDP or RanG19V-GTP mutant and in the absence of nuclear import receptors. This suggests that 11E7 enters the nucleus via a Ran-dependent pathway, independent of nuclear import receptors, mediated by a nuclear localization signal located in its C-terminal domain (cNLS). This cNLS contains the zinc binding domain consisting of two copies of Cys-X-X-Cys motif. Mutagenesis of Cys residues in these motifs changed the localization of the EGFP-11cE7/-11E7 mutants to cytoplasmic, suggesting that the zinc binding domain is essential for nuclear localization of 11E7.
Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip
International Nuclear Information System (INIS)
Andoh, Tomoko; Oshiro, Yukiko; Hayashi, Sachiko; Takeo, Hideki; Tani, Tokio
2006-01-01
Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization
Mapping the nuclear localization signal in the matrix protein of potato yellow dwarf virus.
Anderson, Gavin; Jang, Chanyong; Wang, Renyuan; Goodin, Michael
2018-05-01
The ability of the matrix (M) protein of potato yellow dwarf virus (PYDV) to remodel nuclear membranes is controlled by a di-leucine motif located at residues 223 and 224 of its primary structure. This function can be uncoupled from that of its nuclear localization signal (NLS), which is controlled primarily by lysine and arginine residues immediately downstream of the LL motif. In planta localization of green fluorescent protein fusions, bimolecular fluorescence complementation assays with nuclear import receptor importin-α1 and yeast-based nuclear import assays provided three independent experimental approaches to validate the authenticity of the M-NLS. The carboxy terminus of M is predicted to contain a nuclear export signal, which is belived to be functional, given the ability of M to bind the Arabidopsis nuclear export receptor 1 (XPO1). The nuclear shuttle activity of M has implications for the cell-to-cell movement of PYDV nucleocapsids, based upon its interaction with the N and Y proteins.
International Nuclear Information System (INIS)
Huerta B, A.; Aguilar T, O.; Nunez C, A.; Lopez M, R.
1994-01-01
The Level 1 results of Laguna Verde Nuclear Power Plant PRA are presented in the I nternal Event Analysis for Laguna Verde Unit 1 Nuclear Power Plant, CNSNS-TR 004, in five volumes. The reports are organized as follows: CNSNS-TR 004 Volume 1: Introduction and Methodology. CNSNS-TR4 Volume 2: Initiating Event and Accident Sequences. CNSNS-TR 004 Volume 3: System Analysis. CNSNS-TR 004 Volume 4: Accident Sequence Quantification and Results. CNSNS-TR 005 Volume 5: Appendices A, B and C. This volume presents the development of the dependent failure analysis, the treatment of the support system dependencies, the identification of the shared-components dependencies, and the treatment of the common cause failure. It is also presented the identification of the main human actions considered along with the possible recovery actions included. The development of the data base and the assumptions and limitations in the data base are also described in this volume. The accident sequences quantification process and the resolution of the core vulnerable sequences are presented. In this volume, the source and treatment of uncertainties associated with failure rates, component unavailabilities, initiating event frequencies, and human error probabilities are also presented. Finally, the main results and conclusions for the Internal Event Analysis for Laguna Verde Nuclear Power Plant are presented. The total core damage frequency calculated is 9.03x 10-5 per year for internal events. The most dominant accident sequences found are the transients involving the loss of offsite power, the station blackout accidents, and the anticipated transients without SCRAM (ATWS). (Author)
SCALCE: boosting sequence compression algorithms using locally consistent encoding.
Hach, Faraz; Numanagic, Ibrahim; Alkan, Can; Sahinalp, S Cenk
2012-12-01
The high throughput sequencing (HTS) platforms generate unprecedented amounts of data that introduce challenges for the computational infrastructure. Data management, storage and analysis have become major logistical obstacles for those adopting the new platforms. The requirement for large investment for this purpose almost signalled the end of the Sequence Read Archive hosted at the National Center for Biotechnology Information (NCBI), which holds most of the sequence data generated world wide. Currently, most HTS data are compressed through general purpose algorithms such as gzip. These algorithms are not designed for compressing data generated by the HTS platforms; for example, they do not take advantage of the specific nature of genomic sequence data, that is, limited alphabet size and high similarity among reads. Fast and efficient compression algorithms designed specifically for HTS data should be able to address some of the issues in data management, storage and communication. Such algorithms would also help with analysis provided they offer additional capabilities such as random access to any read and indexing for efficient sequence similarity search. Here we present SCALCE, a 'boosting' scheme based on Locally Consistent Parsing technique, which reorganizes the reads in a way that results in a higher compression speed and compression rate, independent of the compression algorithm in use and without using a reference genome. Our tests indicate that SCALCE can improve the compression rate achieved through gzip by a factor of 4.19-when the goal is to compress the reads alone. In fact, on SCALCE reordered reads, gzip running time can improve by a factor of 15.06 on a standard PC with a single core and 6 GB memory. Interestingly even the running time of SCALCE + gzip improves that of gzip alone by a factor of 2.09. When compared with the recently published BEETL, which aims to sort the (inverted) reads in lexicographic order for improving bzip2, SCALCE + gzip
Human factors review for nuclear power plant severe accident sequence analysis
International Nuclear Information System (INIS)
Krois, P.A.; Haas, P.M.
1985-01-01
The paper discusses work conducted to: (1) support the severe accident sequence analysis of a nuclear power plant transient based on an assessment of operator actions, and (2) develop a descriptive model of operator severe accident management. Operator actions during the transient are assessed using qualitative and quantitative methods. A function-oriented accident management model provides a structure for developing technical operator guidance on mitigating core damage preventing radiological release
Interleaved localized 1H/31P nuclear magnetic resonance spectroscopy of skeletal muscle
International Nuclear Information System (INIS)
Meyerspeer, M.
2005-09-01
Nuclear magnetic resonance (NMR) has been used as a spectroscopic method in physics and chemistry before it was developed to become a diagnostic imaging tool in medicine. When NMR spectroscopy is applied to human tissue, metabolism can be studied in normal physiological and pathological states in vivo. Metabolite concentrations and rates can be monitored dynamically and with localization of a defined region of interest. The 'window' which is opened for observation, i.e. which quantities are measured, depends on the nucleus used for RF excitation. Mechanisms of adenosine tri-phosphate (ATP) resynthesis, as a direct source of energy for muscle contraction, are phosphocreatine (PCr) splitting, glycolysis, beta-oxidation and, finally, oxidative phosphorylation. Whilst the dependency of these processes' fractional contribution to muscular energy supply on exercise type and duration is well known, quantitative models of the regulating mechanisms involved are still subject of current research. A large fraction of the established knowledge about metabolism is based on biochemical analysis of tissue acquired invasively (e.g. microdialysis and open-flow microperfusion) or representing averaged metabolic concentrations for the whole body (via serum metabolites or gas exchange analysis). Localized NMR spectroscopy, however, is capable of non-invasively acquiring time-resolved data from a defined volume of interest, in vivo. In contrast to the vast majority of MRS studies investigating metabolism, where spectra of a single nucleus (commonly 1 H, 31 P or 13 C) were acquired or several MR spectra with different nuclei were measured in separate experiments, this work opens an additional 'window' on muscle metabolism by interleaved localized acquisition of 1 H and 31 P NMR spectra from human calf muscle in vivo, during rest, exercise and recovery, in a single experiment. Using this technique, the time courses of the concentrations of phosphocreatine, inorganic phosphate (Pi), ATP
Severe accident sequences simulated at the Grand Gulf Nuclear Station
International Nuclear Information System (INIS)
Carbajo, J.J.
1999-01-01
Different severe accident sequences employing the MELCOR code, version 1.8.4 QK, have been simulated at the Grand Gulf Nuclear Station (Grand Gulf). The postulated severe accidents simulated are two low-pressure, short-term, station blackouts; two unmitigated small-break (SB) loss-of-coolant accidents (LOCAs) (SBLOCAs); and one unmitigated large LOCA (LLOCA). The purpose of this study was to calculate best-estimate timings of events and source terms for a wide range of severe accidents and to compare the plant response to these accidents
Directory of Open Access Journals (Sweden)
Kata Boras-Granic
Full Text Available Parathyroid hormone-related protein (PTHrP can be secreted from cells and interact with its receptor, the Type 1 PTH/PTHrP Receptor (PTHR1 in an autocrine, paracrine or endocrine fashion. PTHrP can also remain inside cells and be transported into the nucleus, where its functions are unclear, although recent experiments suggest that it may broadly regulate cell survival and senescence. Disruption of either the PTHrP or PTHR1 gene results in many abnormalities including a failure of embryonic mammary gland development in mice and in humans. In order to examine the potential functions of nuclear PTHrP in the breast, we examined mammary gland development in PTHrP (1-84 knock-in mice, which express a mutant form of PTHrP that lacks the C-terminus and nuclear localization signals and which can be secreted but cannot enter the nucleus. Interestingly, we found that PTHrP (1-84 knock-in mice had defects in mammary mesenchyme differentiation and mammary duct outgrowth that were nearly identical to those previously described in PTHrP-/- and PTHR1-/- mice. However, the mammary buds in PTHrP (1-84 knock-in mice had severe reductions in mutant PTHrP mRNA levels, suggesting that the developmental defects were due to insufficient production of PTHrP by mammary epithelial cells and not loss of PTHrP nuclear function. Examination of the effects of nuclear PTHrP in the mammary gland in vivo will require the development of alternative animal models.
Construction of a nuclear power station in one's locality: attitudes and salience
van der Pligt, J.; Eiser, J.R.; Spears, R.
1986-01-01
Examined the attitudes toward the building of a nuclear power station in one's locality by surveying 290 residents (mean age 47.5 yrs) of 3 small rural communities that were listed as possible locations for a new nuclear power station. Results show that a large majority of Ss opposed the building of
Rimm, David L.; Caca, Karel; Hu, Gang; Harrison, Frank B.; Fearon, Eric R.
1999-01-01
β-Catenin has a critical role in E-cadherin-mediated cell-cell adhesion, and it also functions as a downstream signaling molecule in the wnt pathway. Mutations in the putative glycogen synthase kinase 3β phosphorylation sites near the β-catenin amino terminus have been found in some cancers and cancer cell lines. The mutations render β-catenin resistant to regulation by a complex containing the glycogen synthase kinase 3β, adenomatous polyposis coli, and axin proteins. As a result, β-catenin accumulates in the cytosol and nucleus and activates T-cell factor/lymphoid enhancing factor transcription factors. Previously, 6 of 27 melanoma cell lines were found to have β-catenin exon 3 mutations affecting the N-terminal phosphorylation sites (Rubinfeld B, Robbins P, Elgamil M, Albert I, Porfiri E, Polakis P: Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 1997, 275:1790–1792). To assess the role of β-catenin defects in primary melanomas, we undertook immunohistochemical and DNA sequencing studies in 65 melanoma specimens. Nuclear and/or cytoplasmic localization of β-catenin, a potential indicator of wnt pathway activation, was seen focally within roughly one third of the tumors, though a clonal somatic mutation in β-catenin was found in only one case (codon 45 Ser→Pro). Our findings demonstrate that β-catenin mutations are rare in primary melanoma, in contrast to the situation in melanoma cell lines. Nonetheless, activation of β-catenin, as indicated by its nuclear and/or cytoplasmic localization, appears to be frequent in melanoma, and in some cases, it may reflect focal and transient activation of the wnt pathway within the tumor. PMID:10027390
Ma, H; Zhu, J; Maronski, M; Kotzbauer, P T; Lee, V M-Y; Dichter, M A; Diamond, S L
2002-01-01
Gene transfer into CNS is critical for potential therapeutic applications as well as for the study of the genetic basis of neural development and nerve function. Unfortunately, lipid-based gene transfer to CNS cells is extremely inefficient since the nucleus of these post-mitotic cells presents a significant barrier to transfection. We report the development of a simple and highly efficient lipofection method for primary embryonic rat hippocampal neurons (up to 25% transfection) that exploits the M9 sequence of the non-classical nuclear localization signal of heterogeneous nuclear ribonucleoprotein A1 for targeting beta(2)-karyopherin (transportin-1). M9-assistant lipofection resulted in 20-100-fold enhancement of transfection over lipofection alone for embryonic-derived retinal ganglion cells, rat pheochromocytoma (PC12) cells, embryonic rat ventral mesencephalon neurons, as well as the clinically relevant human NT2 cells or retinoic acid-differentiated NT2 neurons. This technique can facilitate the implementation of promoter construct experiments in post-mitotic cells, stable transformant generation, and dominant-negative mutant expression techniques in CNS cells.
Nuclear materials transportation workshops: USDOE outreach to local governments
International Nuclear Information System (INIS)
1987-01-01
To provide direct outreach to local governments, the Transportation Management Division of the United States Department of Energy asked the Urban Consortium and its Energy Task Force to assemble representatives for two workshops focusing on the transport of nuclear materials. The first session, for jurisdictions east of the Mississippi River, was held in New Orleans on May 5--6, 1988; the second was conducted on June 6--7, 1988 in Denver for jurisdictions to the west. Twenty local government professionals with management or operational responsibility for hazardous materials transportation within their jurisdictions were selected to attend each workshop. The discussions identified five major areas of concern to local government professionals; coordination; training; information resources; marking and placarding; and responder resources. Integrated federal, state, and local levels of government emerged as a priority coordination issue along with the need for expanded availability of training and training resources for first-reponders
Do nuclear collisions create a locally equilibrated quark-gluon plasma?
Energy Technology Data Exchange (ETDEWEB)
Romatschke, P. [University of Colorado at Boulder, Department of Physics, 390 UCB, Boulder, CO (United States); University of Colorado, Center for Theory of Quantum Matter, Boulder, CO (United States)
2017-01-15
Experimental results on azimuthal correlations in high energy nuclear collisions (nucleus-nucleus, proton-nucleus, and proton-proton) seem to be well described by viscous hydrodynamics. It is often argued that this agreement implies either local thermal equilibrium or at least local isotropy. In this note, I present arguments why this is not the case. Neither local near-equilibrium nor near-isotropy are required in order for hydrodynamics to offer a successful and accurate description of experimental results. However, I predict the breakdown of hydrodynamics at momenta of order seven times the temperature, corresponding to a smallest possible QCD liquid drop size of 0.15 fm. (orig.)
International Nuclear Information System (INIS)
Guo, Yue; Ren, Tao
2017-01-01
Many contributions have been made in the studies of the factors that influence public acceptance of nuclear power. However, previous studies seldom focused on nuclear power plants in the planning stage. Actually public perception is usually more sensitive at the preliminary planning stage of a nuclear power station. Mainly utilizing questionnaire survey and focus group methods, we have identified the factors that are correlated with local acceptance of planned nuclear power plants in China. We conducted our survey in two cities, Huludao, Liaoning province in northern China, and Shanwei, Guangdong province in southern China, where the local government was planning to build its first nuclear power plant. We find that people who live closer to the plant sites are less willing to accept nuclear power than those who live farther away. As for “surface psychology” factors, perceived benefits and risks significantly influence local acceptance. As for “deep psychology” factors, emotional identification and social trust can significantly influence local acceptance, while perceived knowledge cannot. When citizens are unfamiliar with nuclear power plants, they are more inclined to evaluate the benefits and risks through emotional identification and social trust, rather than through pure rational deduction based on concrete facts. - Highlights: • We focus on the local acceptance of nuclear power in the planning stages. • People who live closer to plant sites are less willing to accept nuclear power. • Perceived benefits and risks significantly influence local acceptance. • Emotional identification and trust can significantly influence local acceptance. • While perceived knowledge cannot significantly influence local acceptance.
International Nuclear Information System (INIS)
Morrone, Michele; Basta, Tania B.; Somerville, Jennifer
2012-01-01
There are several major federal nuclear facilities located in small towns and rural areas of the United States. While many of these facilities were developed in the 1950s to support national defense, in the 1960s and 1970s, some of these shifted their mission to focus on national energy infrastructure. Now, many of these facilities are in a clean-up phase, and local communities are becoming increasingly engaged in influencing decisions about the future of the sites. Communicating with the public in rural communities is challenging when it involves a complicated environmental issue that could have widespread economic impacts. The local media reflect public understanding, so getting a sense of how these media frame issues can be a crucial first step to developing an effective community engagement strategy. A media content analysis of one local newspaper was completed in relation to a major federal nuclear facility. The content analysis is compared to the results of a telephone survey in the region served by the paper and the results suggest that there is a relationship between how the facility is portrayed in local media and public concern. This study has important implications for other nuclear facilities because of the role of local citizens in decision-making. - Highlights: ► Decisions about federal nuclear facilities include local citizen participation. ► Local media can play an important role in public perception of environmental risk. ► Local print media rely on a limited number in of sources for their stories. ► Effective risk communication should begin by understanding local public concerns.
Nuclear localization of the dehydrin OpsDHN1 is determined by histidine-rich motif
Hernández-Sánchez, Itzell E.; Maruri-López, Israel; Ferrando, Alejandro; Carbonell, Juan; Graether, Steffen P.; Jiménez-Bremont, Juan F.
2015-01-01
The cactus OpsDHN1 dehydrin belongs to a large family of disordered and highly hydrophilic proteins known as Late Embryogenesis Abundant (LEA) proteins, which accumulate during the late stages of embryogenesis and in response to abiotic stresses. Herein, we present the in vivo OpsDHN1 subcellular localization by N-terminal GFP translational fusion; our results revealed a cytoplasmic and nuclear localization of the GFP::OpsDHN1 protein in Nicotiana benthamiana epidermal cells. In addition, dimer assembly of OpsDHN1 in planta using a Bimolecular Fluorescence Complementation (BiFC) approach was demonstrated. In order to understand the in vivo role of the histidine-rich motif, the OpsDHN1-ΔHis version was produced and assayed for its subcellular localization and dimer capability by GFP fusion and BiFC assays, respectively. We found that deletion of the OpsDHN1 histidine-rich motif restricted its localization to cytoplasm, but did not affect dimer formation. In addition, the deletion of the S-segment in the OpsDHN1 protein affected its nuclear localization. Our data suggest that the deletion of histidine-rich motif and S-segment show similar effects, preventing OpsDHN1 from getting into the nucleus. Based on these results, the histidine-rich motif is proposed as a targeting element for OpsDHN1 nuclear localization. PMID:26442018
Nuclear localization of the dehydrin OpsDHN1 is determined by histidine-rich motif
Directory of Open Access Journals (Sweden)
Itzell Euridice Hernández-Sánchez
2015-09-01
Full Text Available The cactus OpsDHN1 dehydrin belongs to a large family of disordered and highly hydrophilic proteins known as Late Embryogenesis Abundant (LEA proteins, which accumulate during the late stages of embryogenesis and in response to abiotic stresses. Herein, we present the in vivo OpsDHN1 subcellular localization by N-terminal GFP translational fusion; our results revealed a cytoplasmic and nuclear localization of the GFP::OpsDHN1 protein in Nicotiana benthamiana epidermal cells. In addition, dimer assembly of OpsDHN1 in planta using a Bimolecular Fluorescence Complementation (BiFC approach was demonstrated. In order to understand the in vivo role of the histidine-rich motif, the OpsDHN1-ΔHis version was produced and assayed for its subcellular localization and dimer capability by GFP fusion and BiFC assays, respectively. We found that deletion of the OpsDHN1 histidine-rich motif restricted its localization to cytoplasm, but did not affect dimer formation. In addition, the deletion of the S-segment in the OpsDHN1 protein affected its nuclear localization. Our data suggest that the deletion of histidine-rich motif and S-segment show similar effects, preventing OpsDHN1 from getting into the nucleus. Based on these results, the histidine rich motif is proposed as a targeting element for OpsDHN1 nuclear localization.
Directory of Open Access Journals (Sweden)
Nopporn Chutiwitoonchai
Full Text Available The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4 was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function
Canela-Pérez, Israel; López-Villaseñor, Imelda; Cevallos, Ana María; Hernández, Roberto
2018-03-01
Trypanosoma cruzi is the aetiologic agent of Chagas disease. Our research group studies ribosomal RNA (rRNA) gene transcription and nucleolus dynamics in this species of trypanosomes. RPA31 is an essential subunit of RNA polymerase I (Pol I) whose presence is apparently restricted to trypanosomes. Using fluorescent-tagged versions of this protein (TcRPA31-EGFP), we describe its nuclear distribution during growth and metacyclogenesis. Our findings indicate that TcRPA31-EGFP alters its nuclear presence from concentrated nucleolar localization in exponentially growing epimastigotes to a dispersed granular distribution in the nucleoplasm of stationary epimastigotes and metacyclic trypomastigotes. These changes likely reflect a structural redistribution of the Pol I transcription machinery in quiescent cellular stages where downregulation of rRNA synthesis is known to occur. In addition, and related to the nuclear internalization of this protein, the presence of a classical bipartite-type nuclear localization signal was identified towards its C-terminal end. The functionality of this motif was demonstrated by its partial or total deletion in recombinant versions of the tagged fluorescent protein. Moreover, ivermectin inhibited the nuclear localization of the labelled chimaera, suggesting the involvement of the importin α/β transport system.
Near, Thomas J; Dornburg, Alex; Friedman, Matt
2014-11-01
The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating
A study on the improvement of nuclear emergency countermeasure technology for local government
International Nuclear Information System (INIS)
Khang, Byung Oui; Lee, J. T.; Lee, G. Y.
2005-01-01
There were necessities of the establishment of the regional nuclear emergency plan on the nuclear disaster of nuclear facilities according to the 'nuclear facilities physical protection and emergency preparedness act' and the strengthening of the regional nuclear disaster management system to get confidence on the related national policy from the public and the defining and improving the relationship between local government and other organizations on responsibilities, authorities, duties and support. So, the project was started, the Results of the project are the establishment of Regional Nuclear Emergency Plan (Draft) connected to the national safety management basic plan and national radiological emergency plan which contains the description of the emergency preparedness to respond nuclear disaster and the duty description of related organizations to respond a nuclear disaster and several description of nuclear emergency preparedness. And this report describes the regional nuclear disaster countermeasure technology improvement and the emergency training, drill, exercise methodology
Local negotiation on compensation siting of the spent nuclear fuel repository in Finland
International Nuclear Information System (INIS)
Kojo, Matti
2007-01-01
The aim of the paper is to analyse the local negotiation process between the Municipality of Eurajoki and the nuclear power company Teollisuuden Voima (TVO) and the nuclear waste management company Posiva Oy. The aim of the negotiations was to find an acceptable form of compensation for siting a spent nuclear fuel repository in Olkiluoto, Finland. The paper includes background information on the siting process in Finland, the local political setting in the Municipality of Eurajoki and a description of the negotiation process. The analysis of the negotiations on compensation is important for better understanding the progress of the Finnish siting process. The paper describes the picture of the contest to host the spent nuclear fuel repository. It also provides more information on the relationship between the Municipality of Eurajoki and the power company TVO. The negotiations on compensation and the roles of various players in the negotiations have not been studied in detail because the minutes of the Vuojoki liaison group were not available before the decision of the Supreme Administrative Court in May 2006. (author)
Radiation doses to local populations near nuclear weapons test sites worldwide.
Simon, Steven L; Bouville, André
2002-05-01
Nuclear weapons testing was conducted in the atmosphere at numerous sites worldwide between 1946 and 1980, which resulted in exposures to local populations as a consequence of fallout of radioactive debris. The nuclear tests were conducted by five nations (United States, Soviet Union, United Kingdom, France, and China) primarily at 16 sites. The 16 testing sites, located in nine different countries on five continents (plus Oceania) contributed nearly all of the radioactive materials released to the environment by atmospheric testing; only small amounts were released at a fewother minor testing sites. The 16 sites discussed here are Nevada Test Site, USA (North American continent), Bikini and Enewetak, Marshall Islands (Oceania); Johnston Island, USA (Oceania), Christmas and Malden Island, Kiribati (Oceania); Emu Field, Maralinga, and Monte Bello Islands, Australia (Australian continent); Mururoa and Fangataufa, French Polynesia (Oceania), Reggane, Algeria (Africa), Novaya Zemlya and Kapustin Yar, Russia (Europe), Semipalatinsk, Kazakhstan (Asia), and Lop Nor, China (Asia). There were large differences in the numbers of tests conducted at each location and in the total explosive yields. Those factors, as well as differences in population density, lifestyle, environment, and climate at each site, led to large differences in the doses received by local populations. In general, the tests conducted earliest led to the highest individual and population exposures, although the amount of information available for a few of these sites is insufficient to provide any detailed evaluation of radiation exposures. The most comprehensive information for any site is for the Nevada Test Site. The disparities in available information add difficulty to determining the radiation exposures of local populations at each site. It is the goal of this paper to summarize the available information on external and internal doses received by the public living in the regions near each of the
Prediction of accident sequence probabilities in a nuclear power plant due to earthquake events
International Nuclear Information System (INIS)
Hudson, J.M.; Collins, J.D.
1980-01-01
This paper presents a methodology to predict accident probabilities in nuclear power plants subject to earthquakes. The resulting computer program accesses response data to compute component failure probabilities using fragility functions. Using logical failure definitions for systems, and the calculated component failure probabilities, initiating event and safety system failure probabilities are synthesized. The incorporation of accident sequence expressions allows the calculation of terminal event probabilities. Accident sequences, with their occurrence probabilities, are finally coupled to a specific release category. A unique aspect of the methodology is an analytical procedure for calculating top event probabilities based on the correlated failure of primary events
Energy Technology Data Exchange (ETDEWEB)
Sakamoto, Hikaru [Department of Bioproduction, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri-shi, Hokkaido 093-2422 (Japan); Sakata, Keiko; Kusumi, Kensuke [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Kojima, Mikiko; Sakakibara, Hitoshi [RIKEN Plant Science Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045 (Japan); Iba, Koh, E-mail: koibascb@kyushu-u.org [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)
2012-06-29
Highlights: Black-Right-Pointing-Pointer ITN1, a plasma membrane ankyrin protein, interacts with a nuclear DNA-binding protein RTV1. Black-Right-Pointing-Pointer The nuclear transport of RTV1 is partially inhibited by interaction with ITN1. Black-Right-Pointing-Pointer RTV1 can promote the nuclear localization of ITN1. Black-Right-Pointing-Pointer Both overexpression of RTV1 and the lack of ITN1 increase salicylic acids sensitivity in plants. -- Abstract: The increased tolerance to NaCl 1 (ITN1) protein is a plasma membrane (PM)-localized protein involved in responses to NaCl stress in Arabidopsis. The predicted structure of ITN1 is composed of multiple transmembrane regions and an ankyrin-repeat domain that is known to mediate protein-protein interactions. To elucidate the molecular functions of ITN1, we searched for interacting partners using a yeast two-hybrid assay, and a nuclear-localized DNA-binding protein, RTV1, was identified as a candidate. Bimolecular fluorescence complementation analysis revealed that RTV1 interacted with ITN1 at the PM and nuclei in vivo. RTV1 tagged with red fluorescent protein localized to nuclei and ITN1 tagged with green fluorescent protein localized to PM; however, both proteins localized to both nuclei and the PM when co-expressed. These findings suggest that RTV1 and ITN1 regulate the subcellular localization of each other.
Local nuclear slope and curvature in high energy pp and pp-bar elastic scattering
Energy Technology Data Exchange (ETDEWEB)
Desgrolard, P. [Lyon-1 Univ., 69 - Villeurbanne (France). Inst. de Physique Nucleaire; Kontros, J.; Lengyel, A.I. [Inst. of Electron Physics, Uzhgorod (Ukraine); Martynov, E.S. [National Academy of Sciences of Ukraine, Kiev (Ukraine). Bogolyubov Inst. for Theoretical Physics
1997-05-01
The local nuclear slope is reconstructed from the experimental angular distributions with a procedure that uses overlapping t-bins, for an energy that ranges from the ISR to the Sp-bar pS and the Tevatron. Predictions of several models of (p-bar,p) elastic scattering at high energy are tested. Only a model with two-components Pomeron and Odderon gives a satisfactory agreement with the (non fitted) slope data. The extreme sensitivity of the local nuclear curvature with the choice for a Pomeron model is emphasized. (author). 30 refs.
Phylogeny of holoparasitic Orobanche (Orobanchaceae) inferred from nuclear ITS sequences.
Schneeweiss, Gerald M; Colwell, Alison; Park, Jeong-Mi; Jang, Chang-Gee; Stuessy, Tod F
2004-02-01
Orobanche is the largest genus among the holoparasitic members of Orobanchaceae. We present the first molecular phylogenetic analysis (using nuclear ITS sequences) that includes members of all sections of Orobanche, Gymnocaulis, Myzorrhiza, Trionychon, and Orobanche. Orobanche is not monophyletic, but falls into two lineages: (1) the Orobanche group comprises Orobanche sect. Orobanche and the small Near Asian genus Diphelypaea and is characterized by a chromosome base number of x=19 and (2) the Phelipanche group contains Orobanche sects. Gymnocaulis, Myzorrhiza, and Trionychon and possesses a chromosome base number of x=12. The relationships between these two groups and to other genera such as Boschniakia or Cistanche remain unresolved. Within the Orobanche group, Orobanche macrolepis and Orobanche anatolica (including Orobanche colorata) constitute two phylogenetically distinct lineages. Intrasectional structurings proposed by some authors for O. sect. Orobanche are not confirmed by the molecular data. In most cases, intraspecific sequence divergence between accessions, if present, is negligible and not correlated with morphological or ecological traits. In a few cases, however, there is evidence for the presence of cryptic taxa.
Phylogeny of holoparasitic Orobanche (Orobanchaceae) inferred from nuclear ITS sequences
Schneeweiss, G.M.; Colwell, A.; Park, J.-M.; Jang, C.-G.; Stuessy, Tod F.
2004-01-01
Orobanche is the largest genus among the holoparasitic members of Orobanchaceae. We present the first molecular phylogenetic analysis (using nuclear ITS sequences) that includes members of all sections of Orobanche, Gymnocaulis, Myzorrhiza, Trionychon, and Orobanche. Orobanche is not monophyletic, but falls into two lineages: (1) the Orobanche group comprises Orobanche sect. Orobanche and the small Near Asian genus Diphelypaea and is characterized by a chromosome base number of x = 19 and (2) the Phelipanche group contains Orobanche sects. Gymnocaulis, Myzorrhiza, and Trionychon and possesses a chromosome base number of x = 12. The relationships between these two groups and to other genera such as Boschniakia or Cistanche remain unresolved. Within the Orobanche group, Orobanche macrolepis and Orobanche anatolica (including Orobanche colorata) constitute two phylogenetically distinct lineages. Intrasectional structurings proposed by some authors for O. sect. Orobanche are not confirmed by the molecular data. In most cases, intraspecific sequence divergence between accessions, if present, is negligible and not correlated with morphological or ecological traits. In a few cases, however, there is evidence for the presence of cryptic taxa. ?? 2003 Elsevier Science (USA). All rights reserved.
International Nuclear Information System (INIS)
Frantál, Bohumil; Malý, Jiří
2017-01-01
Rebuilding and upgrading of existing nuclear power plants represent a great energy policy challenge today. In this paper, factors that affect local community support for the rebuilding of an existing nuclear power plant are explored using a regression analysis model. It is based on a survey involving nearly 600 residents of twelve municipalities located in the vicinity of the Dukovany power plant in the Czech Republic. Nearly two thirds of local population support the rebuilding of the plant. The support for rebuilding is not directly affected by distance of residence from the power plant or perceptions of its local economic impacts, but is more influenced by general perceptions of pros of nuclear power. Work in the power plant, perception of nuclear power as a clean energy contributing to climate change mitigation and negative attitude to the renewable energy development are strongest predictors of the support. In terms of energy policy implications, it seems that the education of the public and awareness of nuclear power plants as a clean, safe and landscape compatible system of energy production are more important for increasing acceptance of rebuilding projects than spatial distribution of economic benefits to local communities. - Highlights: • Predictors of support for nuclear power plant (NPP) rebuilding are explored. • Support is not affected by distance or perception of local economic impacts. • Support is affected by general perceptions of pros of NPPs. • Support is determined by perception of NPPs as a clean energy. • Support is correlated with a negative attitude to renewable energy promotion.
Identification of signals that facilitate isoform specific nucleolar localization of myosin IC
Energy Technology Data Exchange (ETDEWEB)
Schwab, Ryan S.; Ihnatovych, Ivanna; Yunus, Sharifah Z.S.A.; Domaradzki, Tera [Department of Physiology and Biophysics, University at Buffalo—State University of New York, Buffalo, NY (United States); Hofmann, Wilma A., E-mail: whofmann@buffalo.edu [Department of Physiology and Biophysics, University at Buffalo—State University of New York, Buffalo, NY (United States)
2013-05-01
Myosin IC is a single headed member of the myosin superfamily that localizes to the cytoplasm and the nucleus, where it is involved in transcription by RNA polymerases I and II, intranuclear transport, and nuclear export. In mammalian cells, three isoforms of myosin IC are expressed that differ only in the addition of short isoform-specific N-terminal peptides. Despite the high sequence homology, the isoforms show differences in cellular distribution, in localization to nuclear substructures, and in their interaction with nuclear proteins through yet unknown mechanisms. In this study, we used EGFP-fusion constructs that express truncated or mutated versions of myosin IC isoforms to detect regions that are involved in isoform-specific localization. We identified two nucleolar localization signals (NoLS). One NoLS is located in the myosin IC isoform B specific N-terminal peptide, the second NoLS is located upstream of the neck region within the head domain. We demonstrate that both NoLS are functional and necessary for nucleolar localization of specifically myosin IC isoform B. Our data provide a first mechanistic explanation for the observed functional differences between the myosin IC isoforms and are an important step toward our understanding of the underlying mechanisms that regulate the various and distinct functions of myosin IC isoforms. - Highlights: ► Two NoLS have been identified in the myosin IC isoform B sequence. ► Both NoLS are necessary for myosin IC isoform B specific nucleolar localization. ► First mechanistic explanation of functional differences between the isoforms.
Kanhayuwa, Lakkhana; Coutts, Robert H A
2016-01-01
Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Zhang, Fang; White, Raymond L.; Neufeld, Kristi L.
2000-01-01
Mutation of the adenomatous polyposis coli (APC) gene is an early step in the development of colorectal carcinomas. APC protein is located in both the cytoplasm and the nucleus. The objective of this study was to define the nuclear localization signals (NLSs) in APC protein. APC contains two potential NLSs comprising amino acids 1767–1772 (NLS1APC) and 2048–2053 (NLS2APC). Both APC NLSs are well conserved among human, mouse, rat, and fly. NLS1APC and NLS2APC each w...
1. European conference on local democracies and nuclear power plants. Conference proceedings
International Nuclear Information System (INIS)
2000-01-01
The Group of European Municipalities with Nuclear Facilities (GMF) was constituted in 1999. Its basic objectives are to keep and strengthen the relations between municipalities with the aim of consolidating a European network of municipalities with common problems; and to participate in European forums on the future of nuclear energy, contributing and helping in decision making processes. The GMF wants to become a support element to the local authorities of nuclear areas in order to foster their participation in the decision making processes, working continuously in collaboration with other agents of the nuclear sector, especially with the authorities of the European Commission, assuming that its major contribution is the knowledge of the everyday territorial reality, as a fundamental element that should be born in mind in all defined policies, whether on european or national level. It is stated that the debate on the future of nuclear energy represents a new era for the municipalities with nuclear facilities across Europe and that international cooperation will open the way for a better use of nuclear energy in Europe
International Nuclear Information System (INIS)
Kondo, Shunsuke; Kuroki, Shinichi; Nakagiri, Yuko
2007-01-01
In November 2007, the Policy Evaluation Committee compiled the report, which evaluated the basic concepts of approaches to the coexistence of nuclear energy and people/local community, specified in the Framework for Nuclear Energy Policy. The report states that the 'concerned administrative bodies are carrying out measures related to the coexistence of nuclear energy and people/local communities in line with these basic concept' and summarizes fifteen proposals conductive to the betterment and improvement of these measures, which were classified as 1) secure transparency and promotion of mutual understanding with the public, 2) development and enrichment of learning opportunities and public participation, 3) relationship between the government and local governments and 4) coexistence with local residents. The Japan Atomic Energy Commission (JAEC) considers this report to be reasonable. This article presented an overview of this activity. (T. Tanaka)
Masoodi, Khalid Z; Xu, Yadong; Dar, Javid A; Eisermann, Kurtis; Pascal, Laura E; Parrinello, Erica; Ai, Junkui; Johnston, Paul A; Nelson, Joel B; Wipf, Peter; Wang, Zhou
2017-10-01
The androgen receptor (AR) is a ligand-dependent transcription factor that controls the expression of androgen-responsive genes. A key step in androgen action, which is amplified in castration-resistant prostate cancer (CRPC), is AR nuclear translocation. Small molecules capable of inhibiting AR nuclear localization could be developed as novel therapeutics for CRPC. We developed a high-throughput screen and identified two structurally-related pyrroloimidazoles that could block AR nuclear localization in CRPC cells. We show that these two small molecules, 3-(4-ethoxyphenyl)-6,7-dihydro-5 H -pyrrolo[1,2- a ]imidazole (EPPI) and 3-(4-chlorophenyl)-6,7-dihydro-5 H -pyrrolo[1,2- a ]imidazole (CPPI) can inhibit the nuclear localization and transcriptional activity of AR and reduce the proliferation of AR-positive but not AR-negative prostate cancer cell lines. EPPI and CPPI did not inhibit nuclear localization of the glucocorticoid receptor or the estrogen receptor, suggesting they selectively target AR. In LNCaP tumor xenografts, CPPI inhibited the proliferation of relapsed LNCaP tumors. These findings suggest that EPPI and CPPI could serve as lead structures for the development of therapeutic agents for CRPC. Mol Cancer Ther; 16(10); 2120-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Local anesthetics and nuclear medical bone images of the equine fore limb
International Nuclear Information System (INIS)
Gaughan, E.M.; Wallace, R.J.; Kallfelz, F.A.
1990-01-01
The effects of two local anesthetic agents on the diagnostic quality of nuclear medical bone images (NMBIs) of distal parts of the equine fore limb were investigated. Local effects on bone uptake of technetium 99m methylene diphosphonate (99mTc-MDP) 4 and 24 hours after perineural and intraarticular injection of mepivacaine hydrochloride and bupivacaine hydrochloride were evaluated in the carpal and metacarpophalangeal regions of 12 horses and ponies. Neither mepivacaine hydrochloride nor bupivacaine hydrochloride significantly altered the diagnostic quality of the NMBIs. The injection and subsequent action of local anesthetics do not appear to influence local bone uptake of 99mTc-MDP significantly
Meteor localization via statistical analysis of spatially temporal fluctuations in image sequences
Kukal, Jaromír.; Klimt, Martin; Šihlík, Jan; Fliegel, Karel
2015-09-01
Meteor detection is one of the most important procedures in astronomical imaging. Meteor path in Earth's atmosphere is traditionally reconstructed from double station video observation system generating 2D image sequences. However, the atmospheric turbulence and other factors cause spatially-temporal fluctuations of image background, which makes the localization of meteor path more difficult. Our approach is based on nonlinear preprocessing of image intensity using Box-Cox and logarithmic transform as its particular case. The transformed image sequences are then differentiated along discrete coordinates to obtain statistical description of sky background fluctuations, which can be modeled by multivariate normal distribution. After verification and hypothesis testing, we use the statistical model for outlier detection. Meanwhile the isolated outlier points are ignored, the compact cluster of outliers indicates the presence of meteoroids after ignition.
OCT despeckling via weighted nuclear norm constrained non-local low-rank representation
Tang, Chang; Zheng, Xiao; Cao, Lijuan
2017-10-01
As a non-invasive imaging modality, optical coherence tomography (OCT) plays an important role in medical sciences. However, OCT images are always corrupted by speckle noise, which can mask image features and pose significant challenges for medical analysis. In this work, we propose an OCT despeckling method by using non-local, low-rank representation with weighted nuclear norm constraint. Unlike previous non-local low-rank representation based OCT despeckling methods, we first generate a guidance image to improve the non-local group patches selection quality, then a low-rank optimization model with a weighted nuclear norm constraint is formulated to process the selected group patches. The corrupted probability of each pixel is also integrated into the model as a weight to regularize the representation error term. Note that each single patch might belong to several groups, hence different estimates of each patch are aggregated to obtain its final despeckled result. Both qualitative and quantitative experimental results on real OCT images show the superior performance of the proposed method compared with other state-of-the-art speckle removal techniques.
Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ
International Nuclear Information System (INIS)
Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang
2006-01-01
MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ
Energy Technology Data Exchange (ETDEWEB)
Bennett, Shauna M. [Cellular and Molecular Biology Program University of Michigan 1150W Medical Center Dr 5724 Medical Science Bldg II Ann Arbor, MI 48109 (United States); Zhao, Linbo [Doctoral Program in Cancer Biology Program University of Michigan 1150W Medical Center Dr 5724 Medical Science Bldg II Ann Arbor, MI 48109 (United States); Bosard, Catherine [Department of Microbiology and Immunology University of Michigan 1150W Medical Center Dr 5724 Medical Science Bldg II Ann Arbor, MI 48109 (United States); Imperiale, Michael J., E-mail: imperial@umich.edu [Cellular and Molecular Biology Program University of Michigan 1150W Medical Center Dr 5724 Medical Science Bldg II Ann Arbor, MI 48109 (United States); Doctoral Program in Cancer Biology Program University of Michigan 1150W Medical Center Dr 5724 Medical Science Bldg II Ann Arbor, MI 48109 (United States); Department of Microbiology and Immunology University of Michigan 1150W Medical Center Dr 5724 Medical Science Bldg II Ann Arbor, MI 48109 (United States)
2015-01-01
BK Polyomavirus (BKPyV) is a ubiquitous nonenveloped human virus that can cause severe disease in immunocompromised populations. After internalization into renal proximal tubule epithelial cells, BKPyV traffics through the ER and enters the cytosol. However, it is unclear how the virus enters the nucleus. In this study, we elucidate a role for the nuclear localization signal located on the minor capsid proteins VP2 and VP3 during infection. Site-directed mutagenesis of a single lysine in the basic region of the C-terminus of the minor capsid proteins abrogated their nuclear localization, and the analogous genomic mutation reduced infectivity. Additionally, through use of the inhibitor ivermectin and knockdown of importin β1, we found that the importin α/β pathway is involved during infection. Overall these data are the first to show the significance of the NLS of the BKPyV minor capsid proteins during infection in a natural host cell. - Highlights: • Polyomaviruses must deliver their genome to the nucleus to replicate. • The minor capsid proteins have a well-conserved nuclear localization signal. • Mutation of this NLS diminishes, but does not completely inhibit, infection.
International Nuclear Information System (INIS)
Bennett, Shauna M.; Zhao, Linbo; Bosard, Catherine; Imperiale, Michael J.
2015-01-01
BK Polyomavirus (BKPyV) is a ubiquitous nonenveloped human virus that can cause severe disease in immunocompromised populations. After internalization into renal proximal tubule epithelial cells, BKPyV traffics through the ER and enters the cytosol. However, it is unclear how the virus enters the nucleus. In this study, we elucidate a role for the nuclear localization signal located on the minor capsid proteins VP2 and VP3 during infection. Site-directed mutagenesis of a single lysine in the basic region of the C-terminus of the minor capsid proteins abrogated their nuclear localization, and the analogous genomic mutation reduced infectivity. Additionally, through use of the inhibitor ivermectin and knockdown of importin β1, we found that the importin α/β pathway is involved during infection. Overall these data are the first to show the significance of the NLS of the BKPyV minor capsid proteins during infection in a natural host cell. - Highlights: • Polyomaviruses must deliver their genome to the nucleus to replicate. • The minor capsid proteins have a well-conserved nuclear localization signal. • Mutation of this NLS diminishes, but does not completely inhibit, infection
Local environment of zirconium in nuclear gels studied by XAS
International Nuclear Information System (INIS)
Pelegrin, E.; Ildefonse, Ph.; Calas, G.; Ricol, St.; Flank, A.M.
1997-01-01
During lixiviation experiments, nuclear gels are formed and heavy metals are retained. In order to understand this retardation mechanisms, we performed an analysis of the local environment of Zr in parent glasses and derived alteration gels both at the Zr-L II,III , and Zr-K edges. Calibration of the method was conducted through the analysis of model compounds with known coordination number (CN): catapleite Na 2 ZrSi 3 O 9 ,2H 2 O (CN=6), baddeleyite ZrO 2 (CN=7) and zircon SiZrO 4 (CN=8). Nuclear glasses (R7T7, and a simplified nuclear glass V 1) and gels obtained at 90 deg C, with leaching times from 7 to 12 months and with solution renewal. were also investigated (GR7T7R and GV1). Zr-L II,III XANES spectra evidenced that zirconium is 6-fold coordinated in R7T7 and V1 nuclear glasses. For GR7T7R and GV1 gels, Zr local environment is significantly changed, and a mixture of CN (6 and 7J has been evidenced. Quantitative structural results were derived from EXAFS analysis at Zr-K edge. In parent glasses, derived Zr-O distance is 2.10±0.01 10 -10 m, and is in the range Zr-O distances for octahedral coordination in model compounds. In both gels studied, Zr-O distances increase significantly up to 2.15 ±0.01 10 -10 m. This distance is close to that known in baddeleyite (2,158 10 -10 m). A better understanding of the Zr retention mechanism has to be made by studying the second neighbors contributions. (authors)
Nuclear localization of the mitochondrial ncRNAs in normal and cancer cells.
Landerer, Eduardo; Villegas, Jaime; Burzio, Veronica A; Oliveira, Luciana; Villota, Claudio; Lopez, Constanza; Restovic, Franko; Martinez, Ronny; Castillo, Octavio; Burzio, Luis O
2011-08-01
We have previously shown a differential expression of a family of mitochondrial ncRNAs in normal and cancer cells. Normal proliferating cells and cancer cells express the sense mitochondrial ncRNA (SncmtRNA). In addition, while normal proliferating cells express two antisense mitochondrial ncRNAs (ASncmtRNAs-1 and -2), these transcripts seem to be universally down-regulated in cancer cells. In situ hybridization (ISH) of some normal and cancer tissues reveals nuclear localization of these transcripts suggesting that they are exported from mitochondria. FISH and confocal microscopy, in situ digestion with RNase previous to ISH and electron microscopy ISH was employed to confirm the extra-mitochondrial localization of the SncmtRNA and the ASncmtRNAs in normal proliferating and cancer cells of human and mouse. In normal human kidney and mouse testis the SncmtRNA and the ASncmtRNAs were found outside the organelle and especially localized in the nucleus associated to heterochromatin. In cancer cells, only the SncmtRNA was expressed and was found associated to heterochromatin and nucleoli. The ubiquitous localization of these mitochondrial transcripts in the nucleus suggests that they are new players in the mitochondrial-nuclear communication pathway or retrograde signaling. Down regulation of the ASncmtRNAs seems to be an important step on neoplastic transformation and cancer progression.
Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method
Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng
2013-01-01
To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123
The proteins of intra-nuclear bodies: a data-driven analysis of sequence, interaction and expression
Directory of Open Access Journals (Sweden)
Bodén Mikael
2010-04-01
Full Text Available Abstract Background Cajal bodies, nucleoli, PML nuclear bodies, and nuclear speckles are morpohologically distinct intra-nuclear structures that dynamically respond to cellular cues. Such nuclear bodies are hypothesized to play important regulatory roles, e.g. by sequestering and releasing transcription factors in a timely manner. While the nucleolus and nuclear speckles have received more attention experimentally, the PML nuclear body and the Cajal body are still incompletely characterized in terms of their roles and protein complement. Results By collating recent experimentally verified data, we find that almost 1000 proteins in the mouse nuclear proteome are known to associate with one or more of the nuclear bodies. Their gene ontology terms highlight their regulatory roles: splicing is confirmed to be a core activity of speckles and PML nuclear bodies house a range of proteins involved in DNA repair. We train support-vector machines to show that nuclear proteins contain discriminative sequence features that can be used to identify their intra-nuclear body associations. Prediction accuracy is highest for nucleoli and nuclear speckles. The trained models are also used to estimate the full protein complement of each nuclear body. Protein interactions are found primarily to link proteins in the nuclear speckles with proteins from other compartments. Cell cycle expression data provide support for increased activity in nucleoli, nuclear speckles and PML nuclear bodies especially during S and G2 phases. Conclusions The large-scale analysis of the mouse nuclear proteome sheds light on the functional organization of physically embodied intra-nuclear compartments. We observe partial support for the hypothesis that the physical organization of the nucleus mirrors functional modularity. However, we are unable to unambiguously identify proteins' intra-nuclear destination, suggesting that critical drivers behind of intra-nuclear translocation are yet to
What a nuclear power plant means for the local authority
International Nuclear Information System (INIS)
Christersson, B.
1977-01-01
The anthor, a senior public official in the local anthority district in which the Oskarshamn nuclear power plant is situated, gives a survey of the effects which the plant has had on the community. The background for its establiskment there, and the licensing procedures followed are presented. While no social problems have occurred, the large temporary labour force necessitated action by the local authority in the field of housing. The politically induced delays in starting on the third reactor have led to a surplus of housing. The plant has required special considerations due to safely to be made in the development plan for the aren. Environmental factors, mainly thermal effects of effluents in the coastal waters, have presented no problems, but investigations are continuling. The only negative effect is the heavy traffic on the local roads when major construction work is in progress. The plant has had positive effect on the employment and local financial situation. (JIW)
What a nuclear power plant means for the local authority
Energy Technology Data Exchange (ETDEWEB)
Christersson, B [Oskershamn Kommune (Sweden)
1977-11-29
The anthor, a senior public official in the local anthority district in which the Oskarshamn nuclear power plant is situated, gives a survey of the effects which the plant has had on the community. The background for its establishment there, and the licensing procedures followed are presented. While no social problems have occurred, the large temporary labour force necessitated action by the local authority in the field of housing. The politically induced delays in starting on the third reactor have led to a surplus of housing. The plant has required special considerations due to safely to be made in the development plan for the area. Environmental factors, mainly thermal effects of effluents in the coastal waters, have presented no problems, but investigations are continuing. The only negative effect is the heavy traffic on the local roads when major construction work is in progress. The plant has had positive effect on the employment and local financial situation.
Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores
2009-12-03
Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix
International Nuclear Information System (INIS)
Krauer, Kenia G.; Buck, Marion; Belzer, Deanna K.; Flanagan, James; Chojnowski, Grace M.; Sculley, Tom B.
2004-01-01
The Epstein-Barr virus nuclear antigen (EBNA)-6 protein is essential for Epstein-Barr virus (EBV)-induced immortalization of primary human B-lymphocytes in vitro. In this study, fusion proteins of EBNA-6 with green fluorescent protein (GFP) have been used to characterize its nuclear localization and organization within the nucleus. EBNA-6 associates with nuclear structures and in immunofluorescence demonstrate a punctate staining pattern. Herein, we show that the association of EBNA-6 with these nuclear structures was maintained throughout the cell cycle and with the use of GFP-E6 deletion mutants, that the region amino acids 733-808 of EBNA-6 contains a domain that can influence the association of EBNA-6 with these nuclear structures. Co-immunofluorescence and confocal analyses demonstrated that EBNA-6 and EBNA-3 co-localize in the nucleus of cells. Expression of EBNA-6, but not EBNA-3, caused a redistribution of nuclear survival of motor neurons protein (SMN) to the EBNA-6 containing nuclear structures resulting in co-localization of SMN with EBNA-6
Analysis of nuclear localization of interleukin-1 family cytokines by flow cytometry.
Ross, Ralf; Grimmel, Jan; Goedicke, Sybelle; Möbus, Anna M; Bulau, Ana-Maria; Bufler, Philip; Ali, Shafaqat; Martin, Michael U
2013-01-31
The dual function cytokines IL-1α, IL-33 and IL-37 are members of the IL-1 cytokine family. Besides of being able to bind to their cognate receptors on target cells, they can act intracellularly in the producing cell. All three are able to translocate to the nucleus and have been discussed to affect gene expression. In order to compare and quantitate nuclear translocation of these IL-1 family members we established a robust technique which enables to measure nuclear localization on a single cell level by flow cytometry. Vectors encoding fusion proteins of different IL-1 family members with enhanced green fluorescent protein were cloned and cell lines transiently transfected with these. Fluorescent fusion proteins in intact cells or in isolated nuclei were detected subsequently by fluorescence microscopy and flow cytometry, respectively. Depending on the cellular system, cells and nuclei were distinguishable by flow cytometry in forward scatter/sideward scatter. Fluorescent fusion proteins were detectable in isolated nuclei up to three days following preparation. Signal intensity of fusion proteins of IL-33 and IL-37 in isolated nuclei but not of IL-1α, was markedly increased by fixation with paraformaldehyde, directly following cell lysis, indicating that IL-1α binds stronger to nuclear structures than IL-33 and IL-37. Nuclear translocation of fluorescent IL-37 fusion proteins in a stably transfected RAW264.7 mouse macrophage cell line required stimulation with lipopolysaccharide. Applying this method we demonstrated that a prolonged lag phase of more than 15h before LPS-stimulated nuclear translocation was detected. In summary, we present a robust method to analyze and quantitate nuclear localization of IL-1 cytokine family members. Copyright © 2012 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Suarez, Patricia M [Comision Nacional de Energia Atomica, Ezeiza (Argentina). Centro Atomico Ezeiza; Pepe, Maria E [Comision Nacional de Energia Atomica, General San Martin (Argentina). Centro Atomico Constituyentes; Sbaffoni, Maria M [Comision Nacional de Energia Atomica, Buenos Aires (Argentina). Gerencia de Tecnologia
2000-07-01
A new On-line Nuclear Data Service was implemented at National Atomic Energy Commission (CNEA) Web-Site. The information usually issued by the Nuclear Data Section of IAEA (NDS-IAEA) on CD-ROM, as well as complementary libraries periodically downloaded from the a mirror server of NDS-IAEA Service located at IPEN, Brazil are available on the new CNEA Web page. In the site, users can find numerical data on neutron, charged-particle, and photonuclear reactions, nuclear structure, and decay data, with related bibliographic information. This data server is permanently maintained and updated by CNEA staff members. This crew also offers assistance on the use and retrieval of nuclear data to local users. (author)
Nuclear localization of human DNA mismatch repair protein exonuclease 1 (hEXO1)
DEFF Research Database (Denmark)
Knudsen, Nina Østergaard; Nielsen, Finn Cilius; Vinther, Lena
2007-01-01
interaction with hMLH1 and we show that defective nuclear localization of hEXO1 mutant proteins could be rescued by hMLH1 or hMSH2. Both hEXO1 and hMLH1 form complexes with the nuclear import factors importin beta/alpha1,3,7 whereas hMSH2 specifically recognizes importin beta/alpha3. Taken together, we infer...... that hEXO1, hMLH1 and hMSH2 form complexes and are imported to the nucleus together, and that redundant NLS import signals in the proteins may safeguard nuclear import and thereby MMR activity....
Directory of Open Access Journals (Sweden)
Lakkhana Kanhayuwa
Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.
Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K
2017-06-01
Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.
TRX-1 Regulates SKN-1 Nuclear Localization Cell Non-autonomously in Caenorhabditis elegans.
McCallum, Katie C; Liu, Bin; Fierro-González, Juan Carlos; Swoboda, Peter; Arur, Swathi; Miranda-Vizuete, Antonio; Garsin, Danielle A
2016-05-01
The Caenorhabditis elegans oxidative stress response transcription factor, SKN-1, is essential for the maintenance of redox homeostasis and is a functional ortholog of the Nrf family of transcription factors. The numerous levels of regulation that govern these transcription factors underscore their importance. Here, we add a thioredoxin, encoded by trx-1, to the expansive list of SKN-1 regulators. We report that loss of trx-1 promotes nuclear localization of intestinal SKN-1 in a redox-independent, cell non-autonomous fashion from the ASJ neurons. Furthermore, this regulation is not general to the thioredoxin family, as two other C. elegans thioredoxins, TRX-2 and TRX-3, do not play a role in this process. Moreover, TRX-1-dependent regulation requires signaling from the p38 MAPK-signaling pathway. However, while TRX-1 regulates SKN-1 nuclear localization, classical SKN-1 transcriptional activity associated with stress response remains largely unaffected. Interestingly, RNA-Seq analysis revealed that loss of trx-1 elicits a general, organism-wide down-regulation of several classes of genes; those encoding for collagens and lipid transport being most prevalent. Together, these results uncover a novel role for a thioredoxin in regulating intestinal SKN-1 nuclear localization in a cell non-autonomous manner, thereby contributing to the understanding of the processes involved in maintaining redox homeostasis throughout an organism. Copyright © 2016 by the Genetics Society of America.
International Nuclear Information System (INIS)
Li, Qiang; Kamemura, Kazuo
2014-01-01
Highlights: • The majority of EWS localizes stably in the cytosol in 3T3-L1 preadipocytes. • Adipogenic stimuli induce the nuclear localization of EWS. • Adipogenesis promotes O-GlcNAcylation of EWS. • O-GlcNAcylation stimulates the recruitment of EWS to the nuclear periphery. - Abstract: Although the Ewing sarcoma (EWS) proto-oncoprotein is found in the nucleus and cytosol and is associated with the cell membrane, the regulatory mechanisms of its subcellular localization are still unclear. Here we found that adipogenic stimuli induce the nuclear localization of EWS in 3T3-L1 cells. Tyrosine phosphorylation in the C-terminal PY-nuclear localization signal of EWS was negative throughout adipogenesis. Instead, an adipogenesis-dependent increase in O-linked β-N-acetylglucosamine (O-GlcNAc) glycosylation of EWS was observed. Pharmacological inactivation of O-GlcNAcase in preadipocytes promoted perinuclear localization of EWS. Our findings suggest that the nuclear localization of EWS is partly regulated by the glycosylation
Ligands specify estrogen receptor alpha nuclear localization and degradation
Directory of Open Access Journals (Sweden)
Caze-Subra Stéphanie
2010-12-01
Full Text Available Abstract Background The estrogen receptor alpha (ERα is found predominately in the nucleus, both in hormone stimulated and untreated cells. Intracellular distribution of the ERα changes in the presence of agonists but the impact of different antiestrogens on the fate of ERα is a matter of debate. Results A MCF-7 cell line stably expressing GFP-tagged human ERα (SK19 cell line was created to examine the localization of ligand-bound GFP-ERα. We combined digitonin-based cell fractionation analyses with fluorescence and immuno-electron microscopy to determine the intracellular distribution of ligand-bound ERα and/or GFP-ERα. Using fluorescence- and electron microscopy we demonstrate that both endogenous ERα and GFP-ERα form numerous nuclear focal accumulations upon addition of agonist, 17β-estradiol (E2, and pure antagonists (selective estrogen regulator disruptor; SERD, ICI 182,780 or RU58,668, while in the presence of partial antagonists (selective estrogen regulator modulator; SERM, 4-hydroxytamoxifen (OHT or RU39,411, diffuse nuclear staining persisted. Digitonin based cell fractionation analyses confirmed that endogenous ERα and GFP-ERα predominantly reside in the nuclear fraction. Overall ERα protein levels were reduced after estradiol treatment. In the presence of SERMs ERα was stabilized in the nuclear soluble fraction, while in the presence of SERDs protein levels decreased drastically and the remaining ERα was largely found in a nuclear insoluble fraction. mRNA levels of ESR1 were reduced compared to untreated cells in the presence of all ligands tested, including E2. E2 and SERDs induced ERα degradation occurred in distinct nuclear foci composed of ERα and the proteasome providing a simple explanation for ERα sequestration in the nucleus. Conclusions Our results indicate that chemical structure of ligands directly affect the nuclear fate and protein turnover of the estrogen receptor alpha independently of their impact on
Localization of nuclear retained mRNAs in Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Thomsen, Rune; Libri, Domenico; Boulay, Jocelyne
2003-01-01
site of transcription, and known S. cerevisiae nuclear structures such as the nucleolus and the nucleolar body. Our results show that retained SSA4 RNA localizes to an area in close proximity to the SSA4 locus. On deletion of Rrp6p and release from the genomic locus, heat shock mRNAs produced...
Localization of Vibrating Noise Sources in Nuclear Reactor Cores
International Nuclear Information System (INIS)
Hultqvist, Pontus
2004-09-01
In this thesis the possibility of locating vibrating noise sources in a nuclear reactor core from the neutron noise has been investigated using different localization methods. The influence of the vibrating noise source has been considered to be a small perturbation of the neutron flux inside the reactor. Linear perturbation theory has been used to construct the theoretical framework upon which the localization methods are based. Two different cases have been considered: one where a one-dimensional one-group model has been used and another where a two-dimensional two-energy group noise simulator has been used. In the first case only one localization method is able to determine the position with good accuracy. This localization method is based on finding roots of an equation and is sensitive to other perturbations of the neutron flux. It will therefore work better with the assistance of approximative methods that reconstruct the noise source to determine if the results are reliable or not. In the two-dimensional case the results are more promising. There are several different localization techniques that reproduce both the vibrating noise source position and the direction of vibration with enough precision. The approximate methods that reconstruct the noise source are substantially better and are able to support the root finding method in a more constructive way. By combining the methods, the results will be more reliable
Nuclear trafficking of the human cytomegalovirus pp71 (ppUL82) tegument protein
International Nuclear Information System (INIS)
Shen Weiping; Westgard, Elizabeth; Huang Liqun; Ward, Michael D.; Osborn, Jodi L.; Chau, Nha H.; Collins, Lindsay; Marcum, Benjamin; Koach, Margaret A.; Bibbs, Jennifer; Semmes, O. John; Kerry, Julie A.
2008-01-01
The human cytomegalovirus tegument protein pp71 localizes to the nucleus immediately upon infection, and functions to initiate viral gene expression. Analysis of a series of random insertion mutations revealed that sequences within the mid region (MR) of pp71 are important for localization to the nucleus. Fusion of MR sequences with eGFP revealed that amino acids 94 to 300 were sufficient to target proteins to the nucleus. Random substitution mutagenesis within this domain resulted in two double substitution mutants, pp71P203T/T223M and pp71T228M/L275Q, with a predominantly cytoplasmic localization. Disruption of nuclear targeting resulted in relocalization of the fusion proteins to a distinct perinuclear region. Using tandem mass spectrometry, we determined that threonine 223 can be phosphorylated. Mutation of this residue to a phosphomimetic amino acid resulted in abrogation of nuclear targeting. These results strongly suggest that the intracellular trafficking of pp71 is regulated by phosphorylation
Characterization of the nuclear localization signal of the hepatitis delta virus antigen
International Nuclear Information System (INIS)
Alves, Carolina; Freitas, Natalia; Cunha, Celso
2008-01-01
The delta antigen (HDAg) is the only protein encoded by the hepatitis delta virus (HDV) RNA genome. The HDAg contains an RNA binding domain, a dimerization domain, and a nuclear localization signal (NLS). The nuclear import of HDV RNPs is thought to be one of the first tasks of the HDAg during the HDV replication cycle. Using c-myc-PK fusions with several regions of the HDAg in transfection assays in Huh7 cells, we found that the HDAg NLS consists of a single stretch of 10 amino acids, EGAPPAKRAR, located in positions 66-75. Deletion and mutation analysis of this region showed that both the acidic glutamic acid residue at position 66 and the basic arginine residue at position 75 are essential for promoting nuclear import
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
International Nuclear Information System (INIS)
Groppo, Rachel; Brown, Bradley A.; Palmenberg, Ann C.
2011-01-01
Cardioviruses have a unique 2A protein (143 aa). During genome translation, the encephalomyocarditis virus (EMCV) 2A is released through a ribosome skipping event mitigated through C-terminal 2A sequences and by subsequent N-terminal reaction with viral 3C pro . Although viral replication is cytoplasmic, mature 2A accumulates in nucleoli shortly after infection. Some protein also transiently associates with cytoplasmic 40S ribosomal subunits, an activity contributing to inhibition of cellular cap-dependent translation. Cardiovirus sequences predict an eIF4E binding site (aa 126-134) and a nuclear localization signal (NLS, aa 91-102), within 2A, both of which are functional during EMCV infection. Point mutations preventing eIF4E:2A interactions gave small-plaque phenotype viruses, but still inhibited cellular cap-dependent translation. Deletions within the NLS motif relocalized 2A to the cytoplasm and abrogated the inhibition of cap-dependent translation. A fusion protein linking the 2A NLS to eGFP was sufficient to redirect the reporter to the nucleus but not into nucleoli.
Nuclear spins in nanostructures
International Nuclear Information System (INIS)
Coish, W.A.; Baugh, J.
2009-01-01
We review recent theoretical and experimental advances toward understanding the effects of nuclear spins in confined nanostructures. These systems, which include quantum dots, defect centers, and molecular magnets, are particularly interesting for their importance in quantum information processing devices, which aim to coherently manipulate single electron spins with high precision. On one hand, interactions between confined electron spins and a nuclear-spin environment provide a decoherence source for the electron, and on the other, a strong effective magnetic field that can be used to execute local coherent rotations. A great deal of effort has been directed toward understanding the details of the relevant decoherence processes and to find new methods to manipulate the coupled electron-nuclear system. A sequence of spectacular new results have provided understanding of spin-bath decoherence, nuclear spin diffusion, and preparation of the nuclear state through dynamic polarization and more general manipulation of the nuclear-spin density matrix through ''state narrowing.'' These results demonstrate the richness of this physical system and promise many new mysteries for the future. (Abstract Copyright [2009], Wiley Periodicals, Inc.)
Energy Technology Data Exchange (ETDEWEB)
Kawakatsu, Miho [Department of Stem Cell Biology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523 (Japan); Goto, Shinji, E-mail: sgoto@nagasaki-u.ac.jp [Department of Stem Cell Biology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523 (Japan); Yoshida, Takako; Urata, Yoshishige; Li, Tao-Sheng [Department of Stem Cell Biology, Atomic Bomb Disease Institute, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523 (Japan)
2011-08-12
Highlights: {yields} Nuclear translocation of GST{pi} is abrogated by the deletion of the last 16 amino acid residues in the carboxy-terminal region, indicating that residues 195-208 of GST{pi} are required for nuclear translocation. {yields} The lack of a contiguous stretch of positively charged amino acid residues within the carboxy-terminal region of GST{pi}, suggests that the nuclear translocation of GST{pi} is mediated by a non-classical nuclear localization signal. {yields} An in vitro transport assay shows that the nuclear translocation of GST{pi} is dependent on cytosolic factors and ATP. -- Abstract: Glutathione S-transferase {pi} (GST{pi}), a member of the GST family of multifunctional enzymes, is highly expressed in human placenta and involved in the protection of cellular components against electrophilic compounds or oxidative stress. We have recently found that GST{pi} is expressed in the cytoplasm, mitochondria, and nucleus in some cancer cells, and that the nuclear expression of GST{pi} appears to correlate with resistance to anti-cancer drugs. Although the mitochondrial targeting signal of GST{pi} was previously identified in the amino-terminal region, the mechanism of nuclear translocation remains completely unknown. In this study, we find that the region of GST{pi}195-208 is critical for nuclear translocation, which is mediated by a novel and non-classical nuclear localization signal. In addition, using an in vitro transport assay, we demonstrate that the nuclear translocation of GST{pi} depends on the cytosolic extract and ATP. Although further experiments are needed to understand in depth the precise mechanism of nuclear translocation of GST{pi}, our results may help to establish more efficient anti-cancer therapy, especially with respect to resistance to anti-cancer drugs.
International Nuclear Information System (INIS)
Paige, H.W.; Owens, J.E.
1984-01-01
On behalf of the United States Department of Energy (DOE), International Energy Associates Limited (IEAL) of Washington, D.C. has conducted surveys and analyses of fourteen countries' plans and approaches for dealing with the problems of obtaining local siting acceptance for nuclear waste management facilities. It was determined that the following elements of the formal systems generally facilitate and/or expedite waste management siting decisions: (1) a clear-cut pro-nuclear power position on the part of the government; (2) a willingness on the part of the central government to exert (with prudence and restraint) its pre-emptive rights in nuclear matters; (3) political structures in which the heads of regional or provincial governments are appointed by the central government; (4) national laws that link reactor licensing with a detailed plan for waste management; (5) an established and stable policy with regard to reprocessing. In contrast, it was determined that the following elements of the formal system generally hinder waste management siting activities: (1) historically strong local land used veto laws; (2) the use of national referenda for making nuclear decisions; (3) requirements for public hearings. The informal approaches fall into the following five categories: (1) political: e.g. assertion of will by political leaders, activities to enlist support of local politicians, activities to broaden involvement in decision-making; (2) economic: e.g. emphasis on normal benefits, provision for additional economic benefits; (3) siting: e.g. at or near existing nuclear facilities, on government or utility property, at multiple locations to spread the political burden; (4) timing: e.g. decoupling drilling activities from ultimate repository site decision, deliberate deferral to (long-range) future; (5) education: e.g. creation of special government programmes, enlisting of media support
Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang
2017-01-01
The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered.
Highly expressed loci are vulnerable to misleading ChIP localization of multiple unrelated proteins
Teytelman, L.; Thurtle, D.M.; Rine, J.; van Oudenaarden, A.
2013-01-01
Chromatin immunoprecipitation (ChIP) is the gold-standard technique for localizing nuclear proteins in the genome. We used ChIP, in combination with deep sequencing (Seq), to study the genome-wide distribution of the Silent information regulator (Sir) complex in Saccharomyces cerevisiae. We analyzed
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
Unattended nuclear systems for local energy supply
International Nuclear Information System (INIS)
Lynch, G.F.; Bancroft, A.R.; Hilborn, J.W.; McDougall, D.S.; Ohta, M.M.
1988-02-01
This paper describes recent developments in a small nuclear heat and electricity production system - the SLOWPOKE Energy System - that make it possible to locate the system close to the load, and that could have a major impact on local energy supply. The most important unique features arising from these developments are walk-away safety and the ability to operate in an unattended mode. Walk-away safety means that radiological protection is provided by intrinsic characteristics and does not depend on either engineered safety systems or operator intervention. This, in our view, is essential to public acceptance. The capability for unattended operation results from self-regulation; however, the performance can be remotely monitored. The SLOWPOKE Energy System consists of a water-filled pool, operating at atmospheric pressure, which cools and moderates a beryllium-reflected thermal reactor that is fuelled with 100 to 400 kg of low-enriched uranium. The pool water also provides shielding from radioactive materials trapped in the fuel. Heat is drawn from the pool and transferred either to a building hot-water distribution system or to an organic liquid which is converted to vapour to drive a turbine-generator unit. Heating loads between 2 qnd 10 MWt, and electrical loads up to 1 MWe can be satisfied. SLOWPOKE is a dramatic departure from conventional nuclear power reactors. Its nuclear heat source is intrinsically simple, having only one moving part: a solid neutron absorber which is slowly withdrawn from the reactor to balance the fuel burnup. Its power is self-regulated and excessive heat production cannot occur, even for the most severe combinations of system failure. Cooling of the fuel is assured by natural physical processes that do not depend on mechanical components such as pumps. These intrinsic characteristics assure public safety and ultra high reliability
Unattended nuclear systems for local energy supply
International Nuclear Information System (INIS)
Lynch, G.F.; Bancroft, A.R.; Hilborn, J.W.; McDougall, D.S.; Ohta, M.M.
1986-10-01
This paper describes recent developments in a small nuclear heat and electricity production system - the SLOWPOKE energy system - that make it possible to locate the system close to the load, and that could have a major impact on local energy supply. The most important unique features arising from these developments are walk-away safety and the ability to operate in an unattended mode. Walk-away safety means that radiological protection is provided by intrinsic characteristics and does not depend on either engineered safety systems or operator intervention. This, in our view, is essential to public acceptance. The capability for unattended operation results from self-regulation, however the performance can be remotely monitored. The SLOWPOKE energy system consists of a water-filled pool, operating at atmospheric pressure, which cools and moderates a beryllium-reflected thermal reactor that is fuelled with 100 to 400 kg of low enriched uranium. The pool water also provides shielding from radioactive materials trapped in the fuel. Heat is drawn from the pool and transferred either to a building hot-water distribution system or to an organic liquid which is converted to vapour to drive a turbine-generator unit. Heating loads between 2 and 10 MWt, and electrical loads up to 1 MWe can be satisfied. SLOWPOKE is a dramatic departure from conventional nuclear power reactors. Its nuclear heat source is intrinsically simple, having only one moving part: a solid neutron absorber which is slowly withdrawn from the reactor to balance the fuel burnup. Its power is self-regulated and excessive heat production cannot occur, even for the most severe combinations of system failure. Cooling of the fuel is assured by natural physical processes that do not depend on mechanical components such as pumps. These intrinsic characteristics assure public safety and ultra high reliability. (author)
Surface localization of the nuclear receptor CAR in influenza A virus-infected cells
International Nuclear Information System (INIS)
Takahashi, Tadanobu; Moriyama, Yusuke; Ikari, Akira; Sugatani, Junko; Suzuki, Takashi; Miwa, Masao
2008-01-01
Constitutive active/androstane receptor CAR is a member of the nuclear receptors which regulate transcription of xenobiotic metabolism enzymes. CAR is usually localized in the cytosol and nucleus. Here, we found that CAR was localized at the cell surface of influenza A virus (IAV)-infected cells. Additionally, we demonstrated that expression of a viral envelope glycoprotein, either hemagglutinin (HA) or neuraminidase (NA), but not viral nucleoprotein (NP), was responsible for this localization. This report is the first demonstration of CAR at the surface of tissue culture cells, and suggests that CAR may exert the IAV infection mechanism
Development of Necessary Technology for localizing of Nuclear Safety Grade I and C System
International Nuclear Information System (INIS)
Kwon, Kee Choon; Jang, Tong Il; Kim, Jung Tack
2010-08-01
Through KNICS and Nu-Tech 2012, a MMIS(Man-Machine Interface System) package for nuclear plants was localized and is expected to be applied to SUN 1,2 plants. This study is aimed to support the application of the MMIS package including the following technologies that meet strengthened regulation requirements and enhanced utility's performance requirements to nuclear plants. - Dedication to safety-grade computers and real time operating systems - The broadband communication network for safety information - Application of the automatic test for safety systems - Application of programmable logic controllers to nuclear plants - Development strategy for an integrated SW development tool for control device
Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25
International Nuclear Information System (INIS)
Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko; Sugiyama, Hironobu; Takahashi, Hisaaki; Tanaka, Junya
2006-01-01
Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, a cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25
INTERNATIONAL TECHNOLOGY TRANSFER AND LOCALIZATION: SUCCESS STORIES IN NUCLEAR BRANCH
Directory of Open Access Journals (Sweden)
Yulia V. Chernyakhovskaya
2016-01-01
Full Text Available countries are considering nuclear power industry development [2, p. 3; 3, p. 3; 4]. For newcomer-countries it is of great importance to stimulate the national industry through NPP projects implementation based on technology transfer and localization (TTL. The study and systematization of world experience is useful in purpose to elaborate the national industry development programs. Objectives. The aim of article is to determine success factors of TTL; tasks: 1 to study TTL international experience in the fi eld of nuclear power technologies; 2 on the ground of the world practice to analyze preconditions, contents, stages, arrangement modes, formats and results of TTL. Methods. The following methods are utilized in the study: analysis and synthesis including problem-chronological, cause and eff ect and logical analysis and historical-diachronic method (method of periodization. Results. The following conclusions presented below have been made on the basis of the three cases study related to nuclear industry development using TTL (France, South Korea and China. Conclusions. The TTL success factors includes: Government support that provides long-term governmental development plan of nuclear power and industry for nuclear power based on TTL, and an appropriate international cooperation (under favorable conditions of “NPP buyers market”; Complex approach to implementation of the national TTL program and NPP construction projects: signing of NPP construction contracts with vendors stipulating technology transfer; NPP designing and constructing should be performed jointly with training and transferring of technical documentation and software. Technology transfer cooperation should be implemented through the licenses agreements and setting up joint ventures; Public acceptance and support.
Energy Technology Data Exchange (ETDEWEB)
Fukuchi, Mikoto; Wanotayan, Rujira; Liu, Sicheng; Imamichi, Shoji; Sharma, Mukesh Kumar; Matsumoto, Yoshihisa, E-mail: yoshim@nr.titech.ac.jp
2015-06-12
XRCC4 and DNA Ligase IV (LIG4) cooperate to join two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). However, it is not fully understood how these proteins are localized to the nucleus. Here we created XRCC4{sup K271R} mutant, as Lys271 lies within the putative nuclear localization signal (NLS), and XRCC4{sup K210R} mutant, as Lys210 was reported to undergo SUMOylation, implicated in the nuclear localization of XRCC4. Wild-type and mutated XRCC4 with EGFP tag were introduced into HeLa cell, in which endogenous XRCC4 had been knocked down using siRNA directed to 3′-untranslated region, and tested for the nuclear localization function by fluorescence microscopy. XRCC4{sup K271R} was defective in the nuclear localization of itself and LIG4, whereas XRCC4{sup K210R} was competent for the nuclear localization with LIG4. To examine DSB repair function, wild-type and mutated XRCC4 were introduced into XRCC4-deficient M10. M10-XRCC4{sup K271R}, but not M10-XRCC4{sup K210R}, showed significantly reduced surviving fraction after 2 Gy γ-ray irradiation as compared to M10-XRCC4{sup WT}. The number of γ-H2AX foci remaining 2 h after 2 Gy γ-ray irradiation was significantly greater in M10-XRCC4{sup K271R} than in M10-XRCC4{sup WT}, whereas it was only marginally increased in M10-XRCC4{sup K210R} as compared to M10-XRCC4{sup WT}. The present results collectively indicated that Lys271, but not Lys210, of XRCC4 is required for the nuclear localization of XRCC4 and LIG4 and that the nuclear localizing ability is essential for DSB repair function of XRCC4. - Highlights: • XRCC4{sup K271R} is defective in the nuclear localization of itself and LIG4. • XRCC4{sup K210R} is competent for the nuclear localization of itself and LIG4. • XRCC4{sup K271R} is deficient in DSB repair function. • XRCC4{sup K210R} is mostly normal in DSB repair function.
Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2)
Energy Technology Data Exchange (ETDEWEB)
Schütz, Martin, E-mail: martin.schuetz@chemie.uni-regensburg.de [Institute of Physical and Theoretical Chemistry, University of Regensburg, Universitätsstraße 31, D-93040 Regensburg (Germany)
2015-06-07
We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a.
Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2).
Schütz, Martin
2015-06-07
We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a.
Oscillator strengths, first-order properties, and nuclear gradients for local ADC(2)
International Nuclear Information System (INIS)
Schütz, Martin
2015-01-01
We describe theory and implementation of oscillator strengths, orbital-relaxed first-order properties, and nuclear gradients for the local algebraic diagrammatic construction scheme through second order. The formalism is derived via time-dependent linear response theory based on a second-order unitary coupled cluster model. The implementation presented here is a modification of our previously developed algorithms for Laplace transform based local time-dependent coupled cluster linear response (CC2LR); the local approximations thus are state specific and adaptive. The symmetry of the Jacobian leads to considerable simplifications relative to the local CC2LR method; as a result, a gradient evaluation is about four times less expensive. Test calculations show that in geometry optimizations, usually very similar geometries are obtained as with the local CC2LR method (provided that a second-order method is applicable). As an exemplary application, we performed geometry optimizations on the low-lying singlet states of chlorophyllide a
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd
2017-01-01
Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...
International Nuclear Information System (INIS)
Patterson, Edward I.; Dombrovski, Andrew K.; Swarbrick, Crystall M.D.; Raidal, Shane R.; Forwood, Jade K.
2013-01-01
Highlights: •Circovirus capsid proteins contain large nuclear localization signals (NLS). •A method of nuclear import has not been elucidated. •Beak and feather disease virus (BFDV) capsid NLS was crystallized with importin α. •The structure showed BFDV NLS binding to the major site of importin α. •Result shows implications for mechanism of nuclear transport for all circoviruses. -- Abstract: Circoviruses represent a rapidly increasing genus of viruses that infect a variety of vertebrates. Replication requires shuttling viral molecules into the host cell nucleus, a process facilitated by capsid-associated protein (Cap). Whilst a nuclear localization signal (NLS) has been shown to mediate nuclear translocation, the mode of nuclear transport remains to be elucidated. To better understand this process, beak and feather disease virus (BFDV) Cap NLS was crystallized with nuclear import receptor importin-α (Impα). Diffraction yielded structural data to 2.9 Å resolution, and the binding site on both Impα and BFDV Cap NLS were well resolved. The binding mechanism for the major site is likely conserved across circoviruses as supported by the similarity of NLSs in circovirus Caps. This finding illuminates a crucial step for infection of host cells by this viral family, and provides a platform for rational drug design against the binding interface
Energy Technology Data Exchange (ETDEWEB)
Shiheido, Hirokazu, E-mail: shiheido@ak.med.kyoto-u.ac.jp; Shimizu, Jun
2015-02-20
BEN domain-containing protein 3 (BEND3) has recently been reported to function as a heterochromatin-associated protein in transcriptional repression in the nucleus. BEND3 should have nuclear localization signals (NLSs) to localize to the nucleus in light of its molecular weight, which is higher than that allowed to pass through nuclear pore complexes. We here analyzed the subcellular localization of deletion/site-directed mutants of human BEND3 by an immunofluorescence assay in an attempt to identify the amino acids essential for its nuclear localization. We found that three basic amino acid residues located in the N-terminal region of BEND3 (BEND3{sub 56–58}, KRK) are essential, suggesting that these residues play a role as a functional NLS. These results provide valuable information for progressing research on BEND3. - Highlights: • BEND3 localizes to the nucleus. • The N-terminal 60 amino acids region of BEND3 contains NLS. • Amino acids located between 56 and 58 of BEND3 (KRK) are part of NLS. • KRK motif is highly conserved among BEND3 homologs.
International Nuclear Information System (INIS)
Takahashi, Reiko; Nakagome, Yoshihiro
2004-01-01
For the purpose of comparing the mental attitudes toward nuclear power generation held by the public between localities containing nuclear installation sites and those of urban communities, a survey has been conducted by mail and by direct interviews. The survey conversed Fukushima, Niigata and Fukui Prefectures, representing the former group of localities, whereas Tokyo and Osaka, representing the latter. The mail survey revealed differences between the two groups of localities in their image of power and in their perception of its present status, as well as in their sense of values in daily life. The interview survey indicated that the factors behind the differences included regional characteristics such as temperaments of resident population, and effects on the private life style brought by nuclear installation. Narrowing down this gap of mental attitude between the two groups of localities should call indispensably for better mutual understanding. In bringing this about, consideration should be given to particular local characteristics, including popular mentality and personal view of life, as well as image and knowledge of energy sources held by the individuals. (author)
Targeting and tracing of specific DNA sequences with dTALEs in living cells
Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich
2014-01-01
Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation. PMID:24371265
Targeting and tracing of specific DNA sequences with dTALEs in living cells.
Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich
2014-04-01
Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation.
Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang
2017-01-01
The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered. PMID:28122062
Nuclear import of human MLH1, PMS2, and MutLalpha: redundancy is the key.
Leong, Vivian; Lorenowicz, Jessica; Kozij, Natalie; Guarné, Alba
2009-08-01
DNA mismatch repair maintains genomic stability by correcting errors that have escaped polymerase proofreading. Defects on mismatch repair genes lead to an increased mutation rate, microsatellite instability and predisposition to human non-polyposis colorectal cancer (HNPCC). Human MutLalpha is a heterodimer formed by the interaction of MLH1 and PMS2 that coordinates a series of key events in mismatch repair. It has been proposed that nuclear import of MutLalpha may be the first regulatory step on the activation of the mismatch repair pathway. Using confocal microscopy and mismatch repair deficient cells, we have identified the sequence determinants that drive nuclear import of human MLH1, PMS2, and MutLalpha. Transient transfection of the individual proteins reveals that MLH1 has a bipartite and PMS2 has a single monopartite nuclear localization signal. Although dimerization is not required for nuclear localization, the MutLalpha heterodimer is imported more efficiently than the MLH1 or PMS2 monomers. Interestingly, the bipartite localization signal of MLH1 can direct import of MutLalpha even when PMS2 encompasses a mutated localization signal. Hence we conclude that the presence of redundant nuclear localization signals guarantees nuclear transport of MutLalpha and, consequently, efficient mismatch repair.
Wiley, J C; Wailes, L A; Idzerda, R L; McKnight, G S
1999-03-05
Regulation of protein kinase A by subcellular localization may be critical to target catalytic subunits to specific substrates. We employed epitope-tagged catalytic subunit to correlate subcellular localization and gene-inducing activity in the presence of regulatory subunit or protein kinase inhibitor (PKI). Transiently expressed catalytic subunit distributed throughout the cell and induced gene expression. Co-expression of regulatory subunit or PKI blocked gene induction and prevented nuclear accumulation. A mutant PKI lacking the nuclear export signal blocked gene induction but not nuclear accumulation, demonstrating that nuclear export is not essential to inhibit gene induction. When the catalytic subunit was targeted to the nucleus with a nuclear localization signal, it was not sequestered in the cytoplasm by regulatory subunit, although its activity was completely inhibited. PKI redistributed the nuclear catalytic subunit to the cytoplasm and blocked gene induction, demonstrating that the nuclear export signal of PKI can override a strong nuclear localization signal. With increasing PKI, the export process appeared to saturate, resulting in the return of catalytic subunit to the nucleus. These results demonstrate that both the regulatory subunit and PKI are able to completely inhibit the gene-inducing activity of the catalytic subunit even when the catalytic subunit is forced to concentrate in the nuclear compartment.
Restoration of nuclear-import failure caused by triple A syndrome and oxidative stress
International Nuclear Information System (INIS)
Kiriyama, Takao; Hirano, Makito; Asai, Hirohide; Ikeda, Masanori; Furiya, Yoshiko; Ueno, Satoshi
2008-01-01
Triple A syndrome is an autosomal recessive neurological disease, mimicking motor neuron disease, and is caused by mutant ALADIN, a nuclear-pore complex component. We recently discovered that the pathogenesis involved impaired nuclear import of DNA repair proteins, including DNA ligase I and the cerebellar ataxia causative protein aprataxin. Such impairment was overcome by fusing classical nuclear localization signal (NLS) and 137-aa downstream sequence of XRCC1, designated stretched NLS (stNLS). We report here that the minimum essential sequence of stNLS (mstNLS) is residues 239-276, downsized by more than 100 aa. mstNLS enabled efficient nuclear import of DNA repair proteins in patient fibroblasts, functioned under oxidative stress, and reduced oxidative-stress-induced cell death, more effectively than stNLS. The stress-tolerability of mstNLS was also exerted in control fibroblasts and neuroblastoma cells. These findings may help develop treatments for currently intractable triple A syndrome and other oxidative-stress-related neurological diseases, and contribute to nuclear compartmentalization study
Nuclear transport of heat shock proteins in stressed cells
International Nuclear Information System (INIS)
Chughtai, Zahoor Saeed
2001-01-01
Nuclear import of proteins that are too large to passively enter the nucleus requires soluble factors, energy , and a nuclear localization signal (NLS). Nuclear protein transport can be regulated, and different forms of stress affect nucleocytoplasmic trafficking. As such, import of proteins containing a classical NLS is inhibited in starving yeast cells. In contrast, the heat shock protein hsp70 Ssa4p concentrates in nuclei upon starvation. Nuclear concentration of Ssa4p in starving cells is reversible, and transfer of nutrient-depleted cells to fresh medium induces Ssa4p nuclear export. This export reaction represents an active process that is sensitive to oxidative stress. Upon starvation, the N-terminal domain of Ssa4p mediates Ssa4p nuclear accumulation, and a short hydrophobic sequence, termed Star (for starvation), is sufficient to localize the reporter proteins green fluorescent protein or β-gaIactosidase to nuclei. To determine whether nuclear accumulation of Star-β-galactosidase depends on a specific nuclear carrier, I have analyzed its distribution in mutant yeast strains that carry a deletion of a single β-importin gene. With this assay I have identified Nmd5p as a β-importin required to concentrate Star-β-galactosidase in nuclei of stationary phase cells. (author)
Nuclear transport of heat shock proteins in stressed cells
Energy Technology Data Exchange (ETDEWEB)
Chughtai, Zahoor Saeed
2001-07-01
Nuclear import of proteins that are too large to passively enter the nucleus requires soluble factors, energy , and a nuclear localization signal (NLS). Nuclear protein transport can be regulated, and different forms of stress affect nucleocytoplasmic trafficking. As such, import of proteins containing a classical NLS is inhibited in starving yeast cells. In contrast, the heat shock protein hsp70 Ssa4p concentrates in nuclei upon starvation. Nuclear concentration of Ssa4p in starving cells is reversible, and transfer of nutrient-depleted cells to fresh medium induces Ssa4p nuclear export. This export reaction represents an active process that is sensitive to oxidative stress. Upon starvation, the N-terminal domain of Ssa4p mediates Ssa4p nuclear accumulation, and a short hydrophobic sequence, termed Star (for starvation), is sufficient to localize the reporter proteins green fluorescent protein or {beta}-gaIactosidase to nuclei. To determine whether nuclear accumulation of Star-{beta}-galactosidase depends on a specific nuclear carrier, I have analyzed its distribution in mutant yeast strains that carry a deletion of a single {beta}-importin gene. With this assay I have identified Nmd5p as a {beta}-importin required to concentrate Star-{beta}-galactosidase in nuclei of stationary phase cells. (author)
ON THE DEARTH OF COMPACT, MASSIVE, RED SEQUENCE GALAXIES IN THE LOCAL UNIVERSE
International Nuclear Information System (INIS)
Taylor, Edward N.; Franx, Marijn; Brinchmann, Jarle; Glazebrook, Karl; Van der Wel, Arjen; Van Dokkum, Pieter G
2010-01-01
We set out to test the claim that the recently identified population of compact, massive, and quiescent galaxies at z ∼ 2.3 must undergo significant size evolution to match the properties of galaxies found in the local universe. Using data from the Sloan Digital Sky Survey (SDSS; Data Release 7), we have conducted a search for local red sequence galaxies with sizes and masses comparable to those found at z ∼ 2.3. The SDSS spectroscopic target selection algorithm excludes high surface brightness objects; we show that this makes incompleteness a concern for such massive, compact galaxies, particularly for low redshifts (z ∼ * >10 10.7 M sun (∼5 x 10 10 M sun ) red sequence galaxies at 0.066 spec 5000. This result cannot be explained by incompleteness: in the 0.066 75% complete for galaxies with the sizes and masses seen at high redshift, although for the very smallest galaxies it may be as low as ∼20%. In order to confirm that the absence of such compact massive galaxies in SDSS is not produced by spectroscopic selection effects, we have also looked for such galaxies in the basic SDSS photometric catalog, using photometric redshifts. While we do find signs of a slight bias against massive, compact galaxies, this analysis suggests that the SDSS spectroscopic sample is missing at most a few objects in the regime we consider. Accepting the high-redshift results, it is clear that massive galaxies must undergo significant structural evolution over z ∼< 2 in order to match the population seen in the local universe. Our results suggest that a highly stochastic mechanism (e.g., major mergers) cannot be the primary driver of this strong size evolution.
International Nuclear Information System (INIS)
Soderberg, O.
1998-01-01
It is common knowledge that there are difficulties in convincing the general public and their democratically elected representatives that final disposal of spent nuclear fuel can be made in safe way. Special problems for the decision-makers are created by the demands put on today's generations to make a responsible risk assessment in a area with genuine uncertainties and characterised by any expressions of lack of confidence in social institutions. The current Swedish process for siting a deep repository for spent nuclear fuel has evolved during a period of many years, through inputs by the industry, Government, regulatory authorities and concerned municipalities. It is clear that the nuclear industry, represented by the Swedish Nuclear Fuel and Waste Management CO (SKB), has the full responsibility to find a solution to the waste management problem and to implement the solution - and to for this under the supervision of Government and regulating authorities. But, given the strong tradition of local self-government, the concerned municipalities, the local population in this process. this is simply the following fact: For people who have engaged themselves in local politics - and are prepared to take their responsibility for the well-being and development of their local community - the issue of a possible nuclear repository in the neighbourhood is difficult to handle. A relevant question is: Why should the nation as a whole expect these locally elected representatives to feel a responsibility for an issue of national importance? (author)
Scher, Howard I; Graf, Ryon P; Schreiber, Nicole A; McLaughlin, Brigit; Lu, David; Louw, Jessica; Danila, Daniel C; Dugan, Lyndsey; Johnson, Ann; Heller, Glenn; Fleisher, Martin; Dittamore, Ryan
2017-06-01
Circulating tumor cells (CTCs) expressing AR-V7 protein localized to the nucleus (nuclear-specific) identify metastatic castration-resistant prostate cancer (mCRPC) patients with improved overall survival (OS) on taxane therapy relative to the androgen receptor signaling inhibitors (ARSi) abiraterone acetate, enzalutamide, and apalutamide. To evaluate if expanding the positivity criteria to include both nuclear and cytoplasmic AR-V7 localization ("nuclear-agnostic") identifies more patients who would benefit from a taxane over an ARSi. The study used a cross-sectional cohort. Between December 2012 and March 2015, 193 pretherapy blood samples, 191 of which were evaluable, were collected and processed from 161 unique mCRPC patients before starting a new line of systemic therapy for disease progression at the Memorial Sloan Kettering Cancer Center. The association between two AR-V7 scoring criteria, post-therapy prostate-specific antigen (PSA) change (PTPC) and OS following ARSi or taxane treatment, was explored. One criterion required nuclear-specific AR-V7 localization, and the other required an AR-V7 signal but was agnostic to protein localization in CTCs. Correlation of AR-V7 status to PTPC and OS was investigated. Relationships with survival were analyzed using multivariable Cox regression and log-rank analyses. A total of 34 (18%) samples were AR-V7-positive using nuclear-specific criteria, and 56 (29%) were AR-V7-positive using nuclear-agnostic criteria. Following ARSi treatment, none of the 16 nuclear-specific AR-V7-positive samples and six of the 32 (19%) nuclear-agnostic AR-V7-positive samples had ≥50% PTPC at 12 weeks. The strongest baseline factor influencing OS was the interaction between the presence of nuclear-specific AR-V7-positive CTCs and treatment with a taxane (hazard ratio 0.24, 95% confidence interval 0.078-0.79; p=0.019). This interaction was not significant when nuclear-agnostic criteria were used. To reliably inform treatment selection
International Nuclear Information System (INIS)
Natacci, Faustina Beatriz; Correa, Francisco
2002-01-01
The analysis of accidental sequences associated with the Containment is one of the most important tasks during the development of the Probabilistic Safety Assessment (PSA) of nuclear plants mainly because of its importance on the mitigation of consequences of severe postulated accident initiating events. This paper presents a first approach of the Containment analysis of the INAP identifying failures and events that can compromise its performance, and outlining accidental sequences and Containment end states. The initial plant damage states, which are the input for this study, are based on the event trees developed in the PSA level 1 for the INAP. It should be emphasized that since this PSA is still in a preliminary stage it is subjected to further completion. Consequently, the Containment analysis shall also be revised in order to incorporate, in an extension as complete as possible, all initial plant damage states, the corresponding event trees, and the related Containment end states. Finally, it can be concluded that the evaluation of the qualitative analysis presented herein allows a concise and broad knowledge of the qualitative analysis presented herein allows a concise and broad knowledge of the development of accidental sequences related to the Containment of the INAP. (author)
International Nuclear Information System (INIS)
Asmolov, V.G.; Khakh, O.Ya.; Shashkov, M.G.
1993-01-01
The problem of beyond-design accidents at nuclear stations will not be solved unless a safety culture becomes a basic characteristic of all lines of activity. Only then can the danger of accidents as an objective feature of nuclear stations be eliminated by purposive skilled and responsible activities of those implementing safety. Nuclear-station safety is provided by the following interacting and complementary lines of activity: (1) the design and construction of nuclear stations by properly qualified design and building organizations; (2) monitoring and supervision of safety by special state bodies; (3) control of the station by the exploiting organization; and (4) scientific examination of safety within the above framework and by independent organizations. The distribution of the responsibilities, powers, and right in these lines should be defined by a law on atomic energy, but there is not such law in Russian. The beyond-design accident problem is a key one in nuclear station safety, as it clear from the serious experience with accidents and numerous probabilistic studies. There are four features of the state of this topic in Russia that are of major significance for managing accidents: the lack of an atomic energy law, the inadequacy of the technical standards, the lack of a verified program package for nuclear-station designs in order to calculate the beyond-design accidents and analyze risks, and a lack of approach by designers to such accidents on the basis of international recommendations. This paper gives a brief description of three-forming points in the scientific activity: the general concept of nuclear-station safety, methods of analyzing and providing accident management, and the sequence of actions developed by specialists at this institute in recent years
Relative source comparison of the NPE to underground nuclear explosions at local distances
Energy Technology Data Exchange (ETDEWEB)
Smith, A.T. [Lawrence Livermore National Lab., CA (United States)
1994-12-31
The Non-Proliferation Experiment (NPE) provides an opportunity to compare broadband characteristics of chemical to nuclear explosions at a group of local stations (4 to 40 km distant). The locations for these stations were established on bedrock to record a small partially decoupled nuclear explosion and two nearby nuclear experiments, all shots within {open_quotes}N{close_quotes} Tunnel on Rainier Mesa, Area 12. These sites were also occupied to record aftershocks from the Little Skull Mountain earthquake and chemical explosions from the USGS Sierra Experiment. To minimize calibration errors during this period, redundant instrumentation were used for each event. THe analysis emphasizes the source characteristics of the different explosions. The 300-lb chemical calibration explosion allows removal of path effects from each explosion. The NPE and nearby experiments produce very similar waveforms. The decoupled nuclear explosion and the 300-lb chemical calibration explosion show higher frequency content consistent with a higher corner frequency for the sources.
International Nuclear Information System (INIS)
Chino, Masamichi; Furuno, Akiko; Terada, Hiroaki; Kitabata, Hideyuki
2002-01-01
The increase of nuclear power plants in the Asian region necessitates the capability to predict long-range atmospheric dispersions of radionuclides and radiological impacts due to a nuclear accident. For this purpose, we have developed a computer-based emergency response system WSPEEDI. This paper aims to expanding the capability of WSPEEDI so that it can be applied to simultaneous multi-scale predictions of local and regional scales in the Asian region
Local policies around nuclear power plants in France
International Nuclear Information System (INIS)
Joffroy, D.
2000-01-01
Faced by the oil crisis, in 1973, France accelerated its program of building NPPs. The priority objective has been achieved: the rate of energy self sufficiency of France is almost 50%. The price of electricity is among the most stable and lowest in Europe. Nuclear energy is at the same time a good choice for environment meaning no emission of harmful gasses. In 1998, 57 PWR NPPs were in operation. Super Phenix fast-breeder (in Creys Malville) was shut down in 1998 by government decision. In order to achieve the public acceptance of nuclear power government has built in the following measures: tax provisions, land planning and employment based measures. Obligations imposed to the communities in France were concerned with security, information, health and safety issues. The municipalities with NPPs are still confronted with some problems as public acceptance, changes in local life, pressure of ecological political groups, security and health problems, preparation of crisis management, unemployment after the construction of the plant was finished, closure due to political decision, economic problems after the exploitation cycle is over, permanent control of the legislator. Respective associations were created to resolve these problems and avoid situations such as those arisen in Creys Malville
Localization of latency-associated nuclear antigen (LANA) on mitotic chromosomes
Energy Technology Data Exchange (ETDEWEB)
Rahayu, Retno; Ohsaki, Eriko [Division of Virology, Department of Microbiology and Immunology, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan); Omori, Hiroko [Central Instrumentation Laboratory Research Institute for Microbial Diseases (BIKEN), Osaka University, Osaka 565-0871 (Japan); Ueda, Keiji, E-mail: kueda@virus.med.osaka-u.ac.jp [Division of Virology, Department of Microbiology and Immunology, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan)
2016-09-15
In latent infection of Kaposi's sarcoma-associated herpesvirus (KSHV), viral gene expression is extremely limited and copy numbers of viral genomes remain constant. Latency-associated nuclear antigen (LANA) is known to have a role in maintaining viral genome copy numbers in growing cells. Several studies have shown that LANA is localized in particular regions on mitotic chromosomes, such as centromeres/pericentromeres. We independently examined the distinct localization of LANA on mitotic chromosomes during mitosis, using super-resolution laser confocal microscopy and correlative fluorescence microscopy–electron microscopy (FM-EM) analyses. We found that the majority of LANA were not localized at particular regions such as telomeres/peritelomeres, centromeres/pericentromeres, and cohesion sites, but at the bodies of condensed chromosomes. Thus, LANA may undergo various interactions with the host factors on the condensed chromosomes in order to tether the viral genome to mitotic chromosomes and realize faithful viral genome segregation during cell division. - Highlights: • This is the first report showing LANA dots on mitotic chromosomes by fluorescent microscopy followed by electron microscopy. • LANA dots localized randomly on condensed chromosomes other than centromere/pericentromere and telomere/peritelomre. • Cellular mitotic checkpoint should not be always involved in the segregation of KSHV genomes in the latency.
Localization of latency-associated nuclear antigen (LANA) on mitotic chromosomes
International Nuclear Information System (INIS)
Rahayu, Retno; Ohsaki, Eriko; Omori, Hiroko; Ueda, Keiji
2016-01-01
In latent infection of Kaposi's sarcoma-associated herpesvirus (KSHV), viral gene expression is extremely limited and copy numbers of viral genomes remain constant. Latency-associated nuclear antigen (LANA) is known to have a role in maintaining viral genome copy numbers in growing cells. Several studies have shown that LANA is localized in particular regions on mitotic chromosomes, such as centromeres/pericentromeres. We independently examined the distinct localization of LANA on mitotic chromosomes during mitosis, using super-resolution laser confocal microscopy and correlative fluorescence microscopy–electron microscopy (FM-EM) analyses. We found that the majority of LANA were not localized at particular regions such as telomeres/peritelomeres, centromeres/pericentromeres, and cohesion sites, but at the bodies of condensed chromosomes. Thus, LANA may undergo various interactions with the host factors on the condensed chromosomes in order to tether the viral genome to mitotic chromosomes and realize faithful viral genome segregation during cell division. - Highlights: • This is the first report showing LANA dots on mitotic chromosomes by fluorescent microscopy followed by electron microscopy. • LANA dots localized randomly on condensed chromosomes other than centromere/pericentromere and telomere/peritelomre. • Cellular mitotic checkpoint should not be always involved in the segregation of KSHV genomes in the latency.
Human tissue factor: cDNA sequence and chromosome localization of the gene
International Nuclear Information System (INIS)
Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.
1987-01-01
A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes
Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM
International Nuclear Information System (INIS)
Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim
2014-01-01
Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations
International Nuclear Information System (INIS)
Parmenter, A.; Jensen, M.; Crowe, R.; Raven, K.
2011-01-01
Ontario Power Generation (OPG) is proposing to develop a Deep Geologic Repository (DGR) for the long-term management of its Low and Intermediate Level Waste (L&ILW) at the Bruce nuclear site located in the Municipality of Kincardine, Ontario. A 4-year program of geoscientific studies to assess the suitability of the 850 m thick Palaeozoic age sedimentary sequence beneath the site to host the DGR was completed in 2010. The studies provide evidence of a geologic setting in which the DGR concept would be safely implemented at a nominal depth of 680 m within the argillaceous limestone of the Cobourg Formation. This paper describes the geologic framework of the Bruce nuclear site with a focus on illustrating the high degree of stratigraphic continuity and traceability at site-specific and regional scales within the Ordovician sediments proposed to host and enclose the DGR. As part of the site-specific studies, a program of deep drilling/coring (6 boreholes) and in-situ testing through the sedimentary sequence was completed from 4 drill sites situated beyond the DGR footprint, approximately 1 km apart. Core logging reveals that the stratigraphic sequence comprises 34 distinct bedrock formations/members/units consistent with the known regional stratigraphic framework. These layered sedimentary formations dip 0.6 o (~10 m/km) to the southwest with highly uniform thicknesses both at the site- and regional-scale, particularly, the Ordovician sediments, which vary on the order of metres. The occurrence of steeply-dipping faults within the sedimentary sequence is not revealed through surface outcrop fracture mapping, micro-seismic (M ≥ 1) monitoring, inclined borehole coring or intersection of hydrothermal type dolomitized reservoir systems. Potential fault structures, interpreted from a 2-D seismic survey, were targeted by angled boreholes which found no evidence for their existence. Formation specific continuity is also evidence by the lateral traceability of physical rock
International Nuclear Information System (INIS)
Kameda, Kazuhisa
2005-01-01
In order to support and ensure the nuclear emergency preparedness system and safety of residents in cities, towns and villages, NPO Nuclear Emergency Preparedness Support Center was established in May, 2003. 130 on-site training and education classes were held and above 2,000 participants attended to them for two years. Objects of the countermeasure of nuclear emergency preparedness in local area and residents, what is nuclear emergency for inhabitants, what is use of Table of International Nuclear Event Scale (INES)?, a use of INES, relation between INES level and the nuclear emergency preparedness system are discussed. (S.Y.)
Guo, Min; Yang, Ruifu; Huang, Chen; Liao, Qiwen; Fan, Guangyi; Sun, Chenghang; Lee, Simon Ming-Yuen
2017-04-04
The nuclear envelope is considered a key classification marker that distinguishes prokaryotes from eukaryotes. However, this marker does not apply to the family Planctomycetaceae, which has intracellular spaces divided by lipidic intracytoplasmic membranes (ICMs). Nuclear localization signal (NLS), a short stretch of amino acid sequence, destines to transport proteins from cytoplasm into nucleus, and is also associated with the development of nuclear envelope. We attempted to investigate the NLS motifs in Planctomycetaceae genomes to demonstrate the potential molecular transition in the development of intracellular membrane system. In this study, we identified NLS-like motifs that have the same amino acid compositions as experimentally identified NLSs in genomes of 11 representative species of family Planctomycetaceae. A total of 15 NLS types and 170 NLS-bearing proteins were detected in the 11 strains. To determine the molecular transformation, we compared NLS-bearing protein abundances in the 11 representative Planctomycetaceae genomes with them in genomes of 16 taxonomically varied microorganisms: nine bacteria, two archaea and five fungi. In the 27 strains, 29 NLS types and 1101 NLS-bearing proteins were identified, principal component analysis showed a significant transitional gradient from bacteria to Planctomycetaceae to fungi on their NLS-bearing protein abundance profiles. Then, we clustered the 993 non-redundant NLS-bearing proteins into 181 families and annotated their involved metabolic pathways. Afterwards, we aligned the ten types of NLS motifs from the 13 families containing NLS-bearing proteins among bacteria, Planctomycetaceae or fungi, considering their diversity, length and origin. A transition towards increased complexity from non-planctomycete bacteria to Planctomycetaceae to archaea and fungi was detected based on the complexity of the 10 types of NLS-like motifs in the 13 NLS-bearing proteins families. The results of this study reveal that
Cdc25A localisation and shuttling: characterisation of sequences mediating nuclear export and import
International Nuclear Information System (INIS)
Kaellstroem, Helena; Lindqvist, Arne; Pospisil, Vitek; Lundgren, Andreas; Karlsson Rosenthal, Christina
2005-01-01
The Cdc25 phosphatases play crucial roles in cell cycle progression by removing inhibitory phosphates from tyrosine and threonine residues of cyclin-dependent kinases. Cdc25A is an important regulator of the G1/S transition but functions also in the mitotic phase of the human cell cycle. In this paper, we investigate the sub-cellular localisation of exogenously expressed Cdc25A. We show that YFP-Cdc25A is localised both in the nucleus and the cytoplasm of HeLa cells and untransformed fibroblasts. Cell fusion assays and fluorescence loss in photobleaching (FLIP) assays reveal that the localisation is dynamic and the protein shuttles between the nucleus and the cytoplasm. We demonstrate that nuclear export of Cdc25A is partly mediated by an N-terminal nuclear export sequence (NES), in a manner not sensitive to the Exportin 1-inhibitor leptomycin B. A nuclear localisation signal (NLS) is also characterised, mutation of which leads to cytoplasmic localisation of Cdc25A. Our results imply that the Cdc25A phosphatase may interact with substrates and regulators both in the nucleus and the cytoplasm
Spatial localization in nuclear magnetic resonance spectroscopy
International Nuclear Information System (INIS)
Keevil, Stephen F
2006-01-01
The ability to select a discrete region within the body for signal acquisition is a fundamental requirement of in vivo NMR spectroscopy. Ideally, it should be possible to tailor the selected volume to coincide exactly with the lesion or tissue of interest, without loss of signal from within this volume or contamination with extraneous signals. Many techniques have been developed over the past 25 years employing a combination of RF coil properties, static magnetic field gradients and pulse sequence design in an attempt to meet these goals. This review presents a comprehensive survey of these techniques, their various advantages and disadvantages, and implications for clinical applications. Particular emphasis is placed on the reliability of the techniques in terms of signal loss, contamination and the effect of nuclear relaxation and J-coupling. The survey includes techniques based on RF coil and pulse design alone, those using static magnetic field gradients, and magnetic resonance spectroscopic imaging. Although there is an emphasis on techniques currently in widespread use (PRESS, STEAM, ISIS and MRSI), the review also includes earlier techniques, in order to provide historical context, and techniques that are promising for future use in clinical and biomedical applications. (topical review)
Energy Technology Data Exchange (ETDEWEB)
Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi
2016-03-18
Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.
DEFF Research Database (Denmark)
Jorgensen, T.H.; Frydenberg, J.
1999-01-01
The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential imp...
International Nuclear Information System (INIS)
Sato, Hiroki; Masuda, Munemitsu; Miura, Ryuichi; Yoneda, Misako; Kai, Chieko
2006-01-01
Morbilliviruses, which belong to the Mononegavirales, replicate its RNA genome in the cytoplasm of the host cell. However, they also form characteristic intranuclear inclusion bodies, consisting of nucleoprotein (N), in infected cells. To analyze the mechanisms of nucleocytoplasmic transport of N protein, we characterized the nuclear localization (NLS) and nuclear export (NES) signals of canine distemper virus (CDV) N protein by deletion mutation and alanine substitution of the protein. The NLS has a novel leucine/isoleucine-rich motif (TGILISIL) at positions 70-77, whereas the NES is composed of a leucine-rich motif (LLRSLTLF) at positions 4-11. The NLS and NES of the N proteins of other morbilliviruses, that is, measles virus (MV) and rinderpest virus (RPV), were also analyzed. The NLS of CDV-N protein is conserved at the same position in MV-N protein, whereas the NES of MV-N protein is located in the C-terminal region. The NES of RPV-N protein is also located at the same position as CDV-N protein, whereas the NLS motif is present not only at the same locus as CDV-N protein but also at other sites. Interestingly, the nuclear export of all these N proteins appears to proceed via a CRM1-independent pathway
Böhm, Jennifer; Thavaraja, Ramya; Giehler, Susanne; Nalaskowski, Marcus M
2017-09-15
Regulated transport of proteins between nucleus and cytoplasm is an important process in the eukaryotic cell. In most cases, active nucleo-cytoplasmic protein transport is mediated by nuclear localization signal (NLS) and/or nuclear export signal (NES) motifs. In this study, we developed a set of vectors expressing enhanced GFP (EGFP) concatemers ranging from 2 to 12 subunits (2xEGFP to 12xEGFP) for analysis of NLS strength. As shown by in gel GFP fluorescence analysis and αGFP Western blotting, EGFP concatemers are expressed as fluorescent full-length proteins in eukaryotic cells. As expected, nuclear localization of concatemeric EGFPs decreases with increasing molecular weight. By oligonucleotide ligation this set of EGFP concatemers can be easily fused to NLS motifs. After determination of intracellular localization of EGFP concatemers alone and fused to different NLS motifs we calculated the size of a hypothetic EGFP concatemer showing a defined distribution of EGFP fluorescence between nucleus and cytoplasm (n/c ratio = 2). Clear differences of the size of the hypothetic EGFP concatemer depending on the fused NLS motif were observed. Therefore, we propose to use the size of this hypothetic concatemer as quantitative indicator for comparing strength of different NLS motifs. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Parmenter, Andrew; Jensen, Mark; Crowe, Richard
2012-01-01
Document available in extended abstract form only. A key aspect of a Deep Geologic Repository (DGR) safety case is the ability to develop and communicate an understanding of the geologic stability and resilience to change at time frames relevant to demonstrating repository performance. As part of an on-going Environmental Assessment, Ontario Power Generation (OPG) recently completed site-specific investigations within an 850 m thick Paleozoic sedimentary sequence beneath the Bruce nuclear site for the proposed development of a DGR for Low and Intermediate Level Waste (L and ILW). As envisioned, the shaft-accessed DGR would be excavated at a nominal depth of 680 m within the low permeability Ordovician argillaceous limestone of the Cobourg Formation, which is overlain by more than 200 m of low permeability Ordovician shale. The geo-scientific investigations revealed a relatively undeformed and laterally continuous architecture within the sedimentary sequence at the repository scale (1.5 km 2 ) and beyond. This paper explores the predictable nature of the sedimentary sequence that has contributed to increasing confidence in an understanding of the spatial distribution of groundwater system properties, deep groundwater system evolution and natural barrier performance. Multi-disciplinary geo-scientific investigations of the Bruce nuclear site were completed in 3 phases between 2006 and 2010. The sub-surface investigations included a deep drilling, coring and in-situ testing program and, the completion of a 19.7 km (9 lines) 2-D seismic reflection survey. The drilling program involved 6 (150 mm dia.) deep boreholes (4-vertical; 2 inclined) that were extended through the sedimentary sequence from 4 drill sites, arranged around the 0.3 km 2 footprint of the proposed repository. The more than 3.8 km of rock core (77 mm dia.) retrieved have provided, in part, a strong basis to understand bedrock lithology and mineralogy, facies assemblages, structure, and oil and gas
International Nuclear Information System (INIS)
Knight, G.B.; Gudas, J.M.; Pardee, A.B.
1987-01-01
Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene
Poortvliet, Marloes; Olsen, Jeanine L; Croll, Donald A; Bernardi, Giacomo; Newton, Kelly; Kollias, Spyros; O'Sullivan, John; Fernando, Daniel; Stevens, Guy; Galván Magaña, Felipe; Seret, Bernard; Wintner, Sabine; Hoarau, Galice
2015-02-01
Manta and devil rays are an iconic group of globally distributed pelagic filter feeders, yet their evolutionary history remains enigmatic. We employed next generation sequencing of mitogenomes for nine of the 11 recognized species and two outgroups; as well as additional Sanger sequencing of two mitochondrial and two nuclear genes in an extended taxon sampling set. Analysis of the mitogenome coding regions in a Maximum Likelihood and Bayesian framework provided a well-resolved phylogeny. The deepest divergences distinguished three clades with high support, one containing Manta birostris, Manta alfredi, Mobula tarapacana, Mobula japanica and Mobula mobular; one containing Mobula kuhlii, Mobula eregoodootenkee and Mobula thurstoni; and one containing Mobula munkiana, Mobula hypostoma and Mobula rochebrunei. Mobula remains paraphyletic with the inclusion of Manta, a result that is in agreement with previous studies based on molecular and morphological data. A fossil-calibrated Bayesian random local clock analysis suggests that mobulids diverged from Rhinoptera around 30 Mya. Subsequent divergences are characterized by long internodes followed by short bursts of speciation extending from an initial episode of divergence in the Early and Middle Miocene (19-17 Mya) to a second episode during the Pliocene and Pleistocene (3.6 Mya - recent). Estimates of divergence dates overlap significantly with periods of global warming, during which upwelling intensity - and related high primary productivity in upwelling regions - decreased markedly. These periods are hypothesized to have led to fragmentation and isolation of feeding regions leading to possible regional extinctions, as well as the promotion of allopatric speciation. The closely shared evolutionary history of mobulids in combination with ongoing threats from fisheries and climate change effects on upwelling and food supply, reinforces the case for greater protection of this charismatic family of pelagic filter feeders
Malik, Afshan N; Czajka, Anna; Cunningham, Phil
2016-07-01
Mitochondria contain an extra-nuclear genome in the form of mitochondrial DNA (MtDNA), damage to which can lead to inflammation and bioenergetic deficit. Changes in MtDNA levels are increasingly used as a biomarker of mitochondrial dysfunction. We previously reported that in humans, fragments in the nuclear genome known as nuclear mitochondrial insertion sequences (NumtS) affect accurate quantification of MtDNA. In the current paper our aim was to determine whether mouse NumtS affect the quantification of MtDNA and to establish a method designed to avoid this. The existence of NumtS in the mouse genome was confirmed using blast N, unique MtDNA regions were identified using FASTA, and MtDNA primers which do not co-amplify NumtS were designed and tested. MtDNA copy numbers were determined in a range of mouse tissues as the ratio of the mitochondrial and nuclear genome using real time qPCR and absolute quantification. Approximately 95% of mouse MtDNA was duplicated in the nuclear genome as NumtS which were located in 15 out of 21 chromosomes. A unique region was identified and primers flanking this region were used. MtDNA levels differed significantly in mouse tissues being the highest in the heart, with levels in descending order (highest to lowest) in kidney, liver, blood, brain, islets and lung. The presence of NumtS in the nuclear genome of mouse could lead to erroneous data when studying MtDNA content or mutation. The unique primers described here will allow accurate quantification of MtDNA content in mouse models without co-amplification of NumtS. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
International Nuclear Information System (INIS)
Park, Byeolteo; Myung, Hyun
2014-01-01
With the development of unconventional gas, the technology of directional drilling has become more advanced. Underground localization is the key technique of directional drilling for real-time path following and system control. However, there are problems such as vibration, disconnection with external infrastructure, and magnetic field distortion. Conventional methods cannot solve these problems in real time or in various environments. In this paper, a novel underground localization algorithm using a re-measurement of the sequence of the magnetic field and pose graph SLAM (simultaneous localization and mapping) is introduced. The proposed algorithm exploits the property of the drilling system that the body passes through the previous pass. By comparing the recorded measurement from one magnetic sensor and the current re-measurement from another magnetic sensor, the proposed algorithm predicts the pose of the drilling system. The performance of the algorithm is validated through simulations and experiments. (paper)
Park, Byeolteo; Myung, Hyun
2014-12-01
With the development of unconventional gas, the technology of directional drilling has become more advanced. Underground localization is the key technique of directional drilling for real-time path following and system control. However, there are problems such as vibration, disconnection with external infrastructure, and magnetic field distortion. Conventional methods cannot solve these problems in real time or in various environments. In this paper, a novel underground localization algorithm using a re-measurement of the sequence of the magnetic field and pose graph SLAM (simultaneous localization and mapping) is introduced. The proposed algorithm exploits the property of the drilling system that the body passes through the previous pass. By comparing the recorded measurement from one magnetic sensor and the current re-measurement from another magnetic sensor, the proposed algorithm predicts the pose of the drilling system. The performance of the algorithm is validated through simulations and experiments.
International Nuclear Information System (INIS)
Lee, Sang Hoon; Son, Moon Kyu; Kim, Seong Sook
2003-02-01
It is expected that the results of this study will help policy makers in the government and nuclear industry enhance the confidence of local residents and citizens in the safety of nuclear energy. It is also believed that the citizen confidence on the nuclear energy will help them implement nuclear policies more efficiently and more safely. Considering that the newly sworn-in government is to involve citizens in wide variety of policy areas, this study fits with the policy directions of the new government. Most importantly, desirable citizen participation in public decision-making is to contribute to the enhancement of the working democracy
Energy Technology Data Exchange (ETDEWEB)
Lee, Sang Hoon; Son, Moon Kyu [Korea Association for Nuclear Technology, Taejon (Korea, Republic of); Kim, Seong Sook [Shila Univ., Busan (Korea, Republic of)
2003-02-15
It is expected that the results of this study will help policy makers in the government and nuclear industry enhance the confidence of local residents and citizens in the safety of nuclear energy. It is also believed that the citizen confidence on the nuclear energy will help them implement nuclear policies more efficiently and more safely. Considering that the newly sworn-in government is to involve citizens in wide variety of policy areas, this study fits with the policy directions of the new government. Most importantly, desirable citizen participation in public decision-making is to contribute to the enhancement of the working democracy.
Vlug, Eva J; van de Ven, Robert A H; Vermeulen, Jeroen F; Bult, Peter; van Diest, Paul J; Derksen, Patrick W B
2013-10-01
Yes Associated Protein (YAP) has been implicated in the control of organ size by regulating cell proliferation and survival. YAP is a transcriptional coactivator that controls cellular responses through interaction with TEAD transcription factors in the nucleus, while its transcriptional functions are inhibited by phosphorylation-dependent translocation to the cytosol. YAP overexpression has been associated with different types of cancer, such as lung, skin, prostate, ovary and liver cancer. Recently, YAP was linked to E-cadherin-dependent regulation of contact inhibition in breast cancer cells. In this study we examined YAP protein expression and cellular localization in 237 cases of human invasive breast cancer by immunohistochemistry and related its expression to clinicopathological features and E-cadherin expression. We observed that invasive lobular carcinoma is characterized by higher expression levels of both nuclear and cytosolic YAP (p invasive breast cancer. We observed that high nuclear and cytosolic YAP expression are associated with the E-cadherin deficient breast cancer subtype ILC (p cancers and conditional mouse models of human lobular breast cancer. Since our data indicate that nuclear YAP localization is more common in breast cancers lacking functional adherens junctions, it suggests that YAP-mediated transcription may be involved in the development and progression of invasive lobular breast cancer.
Local repeat sequence organization of an intergenic spacer
Indian Academy of Sciences (India)
The amplification yielded the same uniquely ``sequence-scrambled” product, whether the template used for PCR was total cellular DNA, chloroplast DNA or a plasmid clone DNA corresponding to that region. The PCR product, a ``unique” new sequence, had lost the repetitive organization of the template genome where it ...
New nuclear data service at CNEA: retrieval of the update libraries from a local Web-Server
International Nuclear Information System (INIS)
Suarez, Patricia M.; Pepe, Maria E.; Sbaffoni, Maria M.
2000-01-01
A new On-line Nuclear Data Service was implemented at National Atomic Energy Commission (CNEA) Web-Site. The information usually issued by the Nuclear Data Section of IAEA (NDS-IAEA) on CD-ROM, as well as complementary libraries periodically downloaded from the a mirror server of NDS-IAEA Service located at IPEN, Brazil are available on the new CNEA Web page. In the site, users can find numerical data on neutron, charged-particle, and photonuclear reactions, nuclear structure, and decay data, with related bibliographic information. This data server is permanently maintained and updated by CNEA staff members. This crew also offers assistance on the use and retrieval of nuclear data to local users. (author)
Energy Technology Data Exchange (ETDEWEB)
Han, Xiangzi [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Preventive Medicine, Yanbian University College of Medicine, Yanji (China); Ju, Ji-hyun [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Shin, Incheol, E-mail: incheol@hanyang.ac.kr [Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of)
2012-06-29
Highlights: Black-Right-Pointing-Pointer Novel S/T-P-S/T domains were identified in NICD. Black-Right-Pointing-Pointer Phosphorylation of NICD on the S/T-P-S/T domains induced nuclear localization. Black-Right-Pointing-Pointer GSK-3{beta} phosphorylated S and T residues in NICD S/T-P-S/T domains. -- Abstract: We identified two S/T-P-S/T domains (2122-2124, 2126-2128) inducing Notch intracellular domain (NICD) nuclear localization. The GFP-NICD (1963-2145) fusion protein deletion mutant without classical NLS was localized in the nucleus like the full length GFP-NICD. However, quadruple substitution mutant (T2122A T2124A S2126A T2128A) showed increased cytoplasmic localization. GSK-3{beta} enhanced nuclear localization and transcriptional activity of WT NICD but not of quadruple substitution mutant. In vitro kinase assays revealed that GSK-3{beta} phosphorylated S and T residues in NICD S/T-P-S/T domains. These results suggest that the novel S/T-P-S/T domain, phosphorylated by GSK-3{beta} is also involved in the nuclear localization of NICD as well as classical NLS.
International Nuclear Information System (INIS)
Tsuchida, Tatsuro; Kimura, Hiroshi
2011-01-01
Taking into consideration the influence of the media coverage, this research aims to analyze the characteristics of the local newspapers that cover diverse events relevant to nuclear energy in regional areas where nuclear facilities are located (hereinafter called the 'region'). According to the previous surveys, local residents in the region are more interested in the nuclear energy matters than those who live in urban areas. Plus, the local newspapers turn out to report more events of nuclear energy from a variety of angles. Through interviews with executives and journalists of the local newspaper companies in the regions, it is revealed that the local newspapers tend not to report news sensationally, but they would rather take a supportive stance toward the development in their regions. The interviewees hope that various activities of the nuclear industry will promote education, employment and cooperation among government, industry and academia. They also desire that the industry's activities will help to increase benefits in their regions. It appears that the interviewees' awareness reflects articles of the local newspapers. As a result of the surveys conducted for this research, it is considered that the journalists expect that their region will make particularly qualitative progress in the future. (author)
Czech Academy of Sciences Publication Activity Database
Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel
2012-01-01
Roč. 7, č. 1 (2012), e30529 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA204/07/1592; GA ČR(CZ) GD204/09/H084; GA ČR GAP305/11/2232; GA MŠk LC545; GA MŠk(CZ) LC06063 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 ; RVO:61388971 Keywords : NM1 * nuclear import * NLS * calmodulin Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012
Neural Network with Local Memory for Nuclear Reactor Power Level Control
International Nuclear Information System (INIS)
Uluyol, Oender; Ragheb, Magdi; Tsoukalas, Lefteri
2001-01-01
A methodology is introduced for a neural network with local memory called a multilayered local output gamma feedback (LOGF) neural network within the paradigm of locally-recurrent globally-feedforward neural networks. It appears to be well-suited for the identification, prediction, and control tasks in highly dynamic systems; it allows for the presentation of different timescales through incorporation of a gamma memory. A learning algorithm based on the backpropagation-through-time approach is derived. The spatial and temporal weights of the network are iteratively optimized for a given problem using the derived learning algorithm. As a demonstration of the methodology, it is applied to the task of power level control of a nuclear reactor at different fuel cycle conditions. The results demonstrate that the LOGF neural network controller outperforms the classical as well as the state feedback-assisted classical controllers for reactor power level control by showing a better tracking of the demand power, improving the fuel and exit temperature responses, and by performing robustly in different fuel cycle and power level conditions
Identification and evaluation of accident sequences in nuclear power reactors
International Nuclear Information System (INIS)
Amendola, A.; Capobianchi, S.; Mancini, G.; Olivi, L.; Volta, G.; Reina, G.
1981-01-01
Probabilistic analysis techniques are being more and more used for the evaluation of accident progression in nuclear power plants, especially after the issue of the Reactor Safety Study (Report WASH-1400). This study and subsequent discussions have indicated the necessity of better investigating some major items, namely: adequate data base for the probabilistic evaluations; completeness of the analysis with respect both to accident initiation and behaviour; adequate treatment of uncertainties on the physical and operational parameters governing the accident behaviour. Furthermore, recent occurrences have stressed the importance of the operational aspects of reactor safety, such as plant-specific identification of possible occurrences, their prompt recognition, on-line prediction of subsequent developments and actions to be taken. The paper reviews the contributions in progress at JRC-Ispra to all these aspects, and specifically reports on the following: (1) The set-up of a European Reliability Data System for the acquisition and organisation of operational data of LWRs in the European Community. (2) The development of more complete and realistic models of systems. This work includes multistate static models of components and systems with a view to automatic fault-tree construction and dynamic models for accident sequence identification. The dynamic modelling approach ESCS (Event Sequence and Consequences Spectrum), shown in detail with an example, represents a step forward with respect to event-tree technique and opens new possibilities in dealing with human factors and on-line diagnosis problems. (3) The development of RSM (Response Surface Methodology) for the analysis of uncertainty propagations in consequence and in probability of accident chains. (author)
Nuclear Renaissance? Think Globally, Act Locally
International Nuclear Information System (INIS)
Lawrence, Michael J.
2001-01-01
There is wide-scale belief in the nuclear industry that we are on the verge of a revival of nuclear power because of the projected large increase in the demand for non-carbon emitting electrical generating capacity. Energy consumption will at least double over the next 50 years as a result of population increase and the very real need to improve the standard of living particularly in developing countries. Growing acceptance of the need to reduce carbon emissions is positioning nuclear energy as a likely candidate to meet this increased demand provided valid concerns about economics, safety, proliferation and waste can be adequately resolved. While economics, safety, and proliferation resistance all can benefit from incremental improvement, a permanent waste disposal solution either exists or it doesn't. If a country cannot identify where it will dispose of its spent fuel or high-level nuclear waste, its further use of nuclear energy can be blocked. A number of countries today have generated significant quantities of spent fuel or high-level waste without firm plans or suitable geology for disposal of this material
International Nuclear Information System (INIS)
Tatebe, Yasumasa; Yoshida, Yoshitaka
2012-01-01
If an emergency event occurs in a nuclear power plant, appropriate action is selected and taken in accordance with the plant status, which changes from time to time, in order to prevent escalation and mitigate the event consequences. It is thus important to predict the event sequence and identify the plant behavior resulting from the action taken. In predicting the event sequence during a loss-of-coolant accident (LOCA), it is necessary to estimate break diameter. The conventional method for this estimation is time-consuming, since it involves multiple sensitivity analyses to determine the break diameter that is consistent with the plant behavior. To speed up the process of predicting the nuclear emergency event sequence, a new break diameter estimation technique that is applicable to pressurized water reactors was developed in this study. This technique enables the estimation of break diameter using the plant data sent from the safety parameter display system (SPDS), with focus on the depressurization rate in the reactor cooling system (RCS) during LOCA. The results of LOCA analysis, performed by varying the break diameter using the MAAP4 and RELAP5/MOD3.2 codes, confirmed that the RCS depressurization rate could be expressed by the log linear function of break diameter, except in the case of a small leak, in which RCS depressurization is affected by the coolant charging system and the high-pressure injection system. A correlation equation for break diameter estimation was developed from this function and tested for accuracy. Testing verified that the correlation equation could estimate break diameter accurately within an error of approximately 16%, even if the leak increases gradually, changing the plant status. (author)
International Nuclear Information System (INIS)
Peltzer, P.
1986-01-01
With regard to sharing of responsibility in the field of nuclear licensing between central and local authorities, the Belgian State has entered into a new phase of regionalisation since the enactment of the law of August 8, 1980. This might entail a conflict of competence in case of the licensing of nuclear power plants. A general survey of foreign legislations seems to indicate that a similar risk also exists in other countries. (CW) [de
Kolano, B; Gardunia, B W; Michalska, M; Bonifacio, A; Fairbanks, D; Maughan, P J; Coleman, C E; Stevens, M R; Jellen, E N; Maluszynska, J
2011-09-01
The chromosomal organization of two novel repetitive DNA sequences isolated from the Chenopodium quinoa Willd. genome was analyzed across the genomes of selected Chenopodium species. Fluorescence in situ hybridization (FISH) analysis with the repetitive DNA clone 18-24J in the closely related allotetraploids C. quinoa and Chenopodium berlandieri Moq. (2n = 4x = 36) evidenced hybridization signals that were mainly present on 18 chromosomes; however, in the allohexaploid Chenopodium album L. (2n = 6x = 54), cross-hybridization was observed on all of the chromosomes. In situ hybridization with rRNA gene probes indicated that during the evolution of polyploidy, the chenopods lost some of their rDNA loci. Reprobing with rDNA indicated that in the subgenome labeled with 18-24J, one 35S rRNA locus and at least half of the 5S rDNA loci were present. A second analyzed sequence, 12-13P, localized exclusively in pericentromeric regions of each chromosome of C. quinoa and related species. The intensity of the FISH signals differed considerably among chromosomes. The pattern observed on C. quinoa chromosomes after FISH with 12-13P was very similar to GISH results, suggesting that the 12-13P sequence constitutes a major part of the repetitive DNA of C. quinoa.
Identification of a putative nuclear export signal motif in human NANOG homeobox domain
International Nuclear Information System (INIS)
Park, Sung-Won; Do, Hyun-Jin; Huh, Sun-Hyung; Sung, Boreum; Uhm, Sang-Jun; Song, Hyuk; Kim, Nam-Hyung; Kim, Jae-Hwan
2012-01-01
Highlights: ► We found the putative nuclear export signal motif within human NANOG homeodomain. ► Leucine-rich residues are important for human NANOG homeodomain nuclear export. ► CRM1-specific inhibitor LMB blocked the potent human NANOG NES-mediated nuclear export. -- Abstract: NANOG is a homeobox-containing transcription factor that plays an important role in pluripotent stem cells and tumorigenic cells. To understand how nuclear localization of human NANOG is regulated, the NANOG sequence was examined and a leucine-rich nuclear export signal (NES) motif ( 125 MQELSNILNL 134 ) was found in the homeodomain (HD). To functionally validate the putative NES motif, deletion and site-directed mutants were fused to an EGFP expression vector and transfected into COS-7 cells, and the localization of the proteins was examined. While hNANOG HD exclusively localized to the nucleus, a mutant with both NLSs deleted and only the putative NES motif contained (hNANOG HD-ΔNLSs) was predominantly cytoplasmic, as observed by nucleo/cytoplasmic fractionation and Western blot analysis as well as confocal microscopy. Furthermore, site-directed mutagenesis of the putative NES motif in a partial hNANOG HD only containing either one of the two NLS motifs led to localization in the nucleus, suggesting that the NES motif may play a functional role in nuclear export. Furthermore, CRM1-specific nuclear export inhibitor LMB blocked the hNANOG potent NES-mediated export, suggesting that the leucine-rich motif may function in CRM1-mediated nuclear export of hNANOG. Collectively, a NES motif is present in the hNANOG HD and may be functionally involved in CRM1-mediated nuclear export pathway.
Roy, Catherine; Foudi, Fatah; Charton, Jeanne; Jung, Michel; Lang, Hervé; Saussine, Christian; Jacqmin, Didier
2013-04-01
The aim of this retrospective study was to determine the respective accuracies of three types of functional MRI sequences-diffusion-weighted imaging (DWI), dynamic contrast-enhanced (DCE) MRI, and 3D (1)H-MR spectroscopy (MRS)-in the depiction of local prostate cancer recurrence after two different initial therapy options. From a cohort of 83 patients with suspicion of local recurrence based on prostate-specific antigen (PSA) kinetics who were imaged on a 3-T MRI unit using an identical protocol including the three functional sequences with an endorectal coil, we selected 60 patients (group A, 28 patients who underwent radical prostatectomy; group B, 32 patients who underwent external-beam radiation) who had local recurrence ascertained on the basis of a transrectal ultrasound-guided biopsy results and a reduction in PSA level after salvage therapy. All patients presented with a local relapse. Sensitivity with T2-weighted MRI and 3D (1)H-MRS sequences was 57% and 53%, respectively, for group A and 71% and 78%, respectively, for group B. DCE-MRI alone showed a sensitivity of 100% and 96%, respectively, for groups A and B. DWI alone had a higher sensitivity for group B (96%) than for group A (71%). The combination of T2-weighted imaging plus DWI plus DCE-MRI provided a sensitivity as high as 100% in group B. The performance of functional imaging sequences for detecting recurrence is different after radical prostatectomy and external-beam radiotherapy. DCE-MRI is a valid and efficient tool to detect prostate cancer recurrence in radical prostatectomy as well as in external-beam radiotherapy. The combination of DCE-MRI and DWI is highly efficient after radiation therapy. Three-dimensional (1)H-MRS needs to be improved. Even though it is not accurate enough, T2-weighted imaging remains essential for the morphologic analysis of the area.
Local sequence alignments statistics: deviations from Gumbel statistics in the rare-event tail
Directory of Open Access Journals (Sweden)
Burghardt Bernd
2007-07-01
Full Text Available Abstract Background The optimal score for ungapped local alignments of infinitely long random sequences is known to follow a Gumbel extreme value distribution. Less is known about the important case, where gaps are allowed. For this case, the distribution is only known empirically in the high-probability region, which is biologically less relevant. Results We provide a method to obtain numerically the biologically relevant rare-event tail of the distribution. The method, which has been outlined in an earlier work, is based on generating the sequences with a parametrized probability distribution, which is biased with respect to the original biological one, in the framework of Metropolis Coupled Markov Chain Monte Carlo. Here, we first present the approach in detail and evaluate the convergence of the algorithm by considering a simple test case. In the earlier work, the method was just applied to one single example case. Therefore, we consider here a large set of parameters: We study the distributions for protein alignment with different substitution matrices (BLOSUM62 and PAM250 and affine gap costs with different parameter values. In the logarithmic phase (large gap costs it was previously assumed that the Gumbel form still holds, hence the Gumbel distribution is usually used when evaluating p-values in databases. Here we show that for all cases, provided that the sequences are not too long (L > 400, a "modified" Gumbel distribution, i.e. a Gumbel distribution with an additional Gaussian factor is suitable to describe the data. We also provide a "scaling analysis" of the parameters used in the modified Gumbel distribution. Furthermore, via a comparison with BLAST parameters, we show that significance estimations change considerably when using the true distributions as presented here. Finally, we study also the distribution of the sum statistics of the k best alignments. Conclusion Our results show that the statistics of gapped and ungapped local
Maity, Amit Ranjan; Stepensky, David
2016-01-27
Organelle-targeted drug delivery can enhance the efficiency of the intracellularly acting drugs and reduce their toxicity. We generated core-shell type CdSe-ZnS quantum dots (QDs) densely decorated with NLS peptidic targeting residues using a 3-stage decoration approach and investigated their endocytosis and nuclear targeting efficiencies. The diameter of the generated QDs increased following the individual decoration stages (16.3, 18.9, and 21.9 nm), the ζ-potential became less negative (-33.2, -17.5, and -11.9 mV), and characteristic changes appeared in the FTIR spectra following decoration with the linker and NLS peptides. Quantitative analysis of the last decoration stage revealed that 37.9% and 33.2% of the alkyne-modified NLS groups that were added to the reaction mix became covalently attached or adsorbed to the QDs surface, respectively. These numbers correspond to 63.6 and 55.7 peptides conjugated or adsorbed to a single QD (the surface density of 42 and 37 conjugated and adsorbed peptides per 1000 nm(2) of the QDs surface), which is higher than in the majority of previous studies that reported decoration efficiencies of formulations intended for nuclear-targeted drug delivery. QDs decorated with NLS peptides undergo more efficient endocytosis, as compared to other investigated QDs formulations, and accumulated to a higher extent in the cell nucleus or in close vicinity to it (11.9%, 14.6%, and 56.1% of the QDs endocytosed by an average cell for the QD-COOH, QD-azide, and QD-NLS formulations, respectively). We conclude that dense decoration of QDs with NLS residues increased their endocytosis and led to their nuclear targeting (preferential accumulation in the cells nuclei or in close vicinity to them). The experimental system and research tools that were used in this study allow quantitative investigation of the mechanisms that govern the QDs nuclear targeting and their dependence on the formulation properties. These findings will contribute to the
Nuclear Enhanced X-ray Maximum Entropy Method Used to Analyze Local Distortions in Simple Structures
DEFF Research Database (Denmark)
Christensen, Sebastian; Bindzus, Niels; Christensen, Mogens
We introduce a novel method for reconstructing pseudo nuclear density distributions (NDDs): Nuclear Enhanced X-ray Maximum Entropy Method (NEXMEM). NEXMEM offers an alternative route to experimental NDDs, exploiting the superior quality of synchrotron X-ray data compared to neutron data. The method...... proposed to result from anharmonic phonon scattering or from local fluctuating dipoles on the Pb site.[1,2] No macroscopic symmetry change are associated with these effects, rendering them invisible to conventional crystallographic techniques. For this reason PbX was until recently believed to adopt...
Directory of Open Access Journals (Sweden)
Jun Wang
2017-11-01
Full Text Available Protein-protein interactions (PPIs play crucial roles in almost all cellular processes. Although a large amount of PPIs have been verified by high-throughput techniques in the past decades, currently known PPIs pairs are still far from complete. Furthermore, the wet-lab experiments based techniques for detecting PPIs are time-consuming and expensive. Hence, it is urgent and essential to develop automatic computational methods to efficiently and accurately predict PPIs. In this paper, a sequence-based approach called DNN-LCTD is developed by combining deep neural networks (DNNs and a novel local conjoint triad description (LCTD feature representation. LCTD incorporates the advantage of local description and conjoint triad, thus, it is capable to account for the interactions between residues in both continuous and discontinuous regions of amino acid sequences. DNNs can not only learn suitable features from the data by themselves, but also learn and discover hierarchical representations of data. When performing on the PPIs data of Saccharomyces cerevisiae, DNN-LCTD achieves superior performance with accuracy as 93.12%, precision as 93.75%, sensitivity as 93.83%, area under the receiver operating characteristic curve (AUC as 97.92%, and it only needs 718 s. These results indicate DNN-LCTD is very promising for predicting PPIs. DNN-LCTD can be a useful supplementary tool for future proteomics study.
Nuclear magnetic resonance and the question of 5F electron localization in the actinides
International Nuclear Information System (INIS)
Fradin, F.Y.
1976-01-01
Nuclear magnetic resonance results are presented for a number of NaCl-type compounds and cubic Laves-phase type compounds of uranium, neptunium, and plutonium. Special emphasis is placed on the Knight shift and spin-lattice relaxation time measurements and their interpretation in terms of localized or itinerant pictures of the 5Line integral electrons
Corbett-Detig, Russell; Nielsen, Rasmus
2017-01-01
Admixture-the mixing of genomes from divergent populations-is increasingly appreciated as a central process in evolution. To characterize and quantify patterns of admixture across the genome, a number of methods have been developed for local ancestry inference. However, existing approaches have a number of shortcomings. First, all local ancestry inference methods require some prior assumption about the expected ancestry tract lengths. Second, existing methods generally require genotypes, which is not feasible to obtain for many next-generation sequencing projects. Third, many methods assume samples are diploid, however a wide variety of sequencing applications will fail to meet this assumption. To address these issues, we introduce a novel hidden Markov model for estimating local ancestry that models the read pileup data, rather than genotypes, is generalized to arbitrary ploidy, and can estimate the time since admixture during local ancestry inference. We demonstrate that our method can simultaneously estimate the time since admixture and local ancestry with good accuracy, and that it performs well on samples of high ploidy-i.e. 100 or more chromosomes. As this method is very general, we expect it will be useful for local ancestry inference in a wider variety of populations than what previously has been possible. We then applied our method to pooled sequencing data derived from populations of Drosophila melanogaster on an ancestry cline on the east coast of North America. We find that regions of local recombination rates are negatively correlated with the proportion of African ancestry, suggesting that selection against foreign ancestry is the least efficient in low recombination regions. Finally we show that clinal outlier loci are enriched for genes associated with gene regulatory functions, consistent with a role of regulatory evolution in ecological adaptation of admixed D. melanogaster populations. Our results illustrate the potential of local ancestry
EpCAM nuclear localization identifies aggressive Thyroid Cancer and is a marker for poor prognosis
Directory of Open Access Journals (Sweden)
MacMillan Christina
2010-06-01
Full Text Available Abstract Background Proteolytic cleavage of the extracellular domain (EpEx of Epithelial cell adhesion molecule (EpCAM and nuclear signaling by its intracellular oncogenic domain Ep-ICD has recently been implicated in increased proliferation of cancer cells. The clinical significance of Ep-ICD in human tumors remains an enigma. Methods EpEx, Ep-ICD and β-catenin immunohistochemistry using specific antibodies was conducted on 58 archived thyroid cancer (TC tissue blocks from 34 patients and correlated with survival analysis of these patients for up to 17 years. Results The anaplastic (ATC and aggressive thyroid cancers showed loss of EpEx and increased nuclear and cytoplasmic accumulation of Ep-ICD. In contrast, the low grade papillary thyroid cancers (PTC showed membranous EpEx and no detectable nuclear Ep-ICD. The ATC also showed concomitant nuclear expression of Ep-ICD and β-catenin. Kaplan-Meier Survival analysis revealed reduced overall survival (OS for TC patients showing nuclear Ep-ICD expression or loss of membranous EpEx (p Conclusion We report reciprocal loss of membrane EpEx but increased nuclear and cytoplasmic accumulation of Ep-ICD in aggressive TC; nuclear Ep-ICD correlated with poor OS of TC patients. Thus nuclear Ep-ICD localization may serve as a useful biomarker for aggressive TC and may represent a novel diagnostic, prognostic and therapeutic target for aggressive TC.
Energy Technology Data Exchange (ETDEWEB)
Knowles, David; Sudar, Damir; Bator, Carol; Bissell, Mina
2006-02-01
The organization of nuclear proteins is linked to cell and tissue phenotypes. When cells arrest proliferation, undergo apoptosis, or differentiate, the distribution of nuclear proteins changes. Conversely, forced alteration of the distribution of nuclear proteins modifies cell phenotype. Immunostaining and fluorescence microscopy have been critical for such findings. However, there is an increasing need for quantitative analysis of nuclear protein distribution to decipher epigenetic relationships between nuclear structure and cell phenotype, and to unravel the mechanisms linking nuclear structure and function. We have developed imaging methods to quantify the distribution of fluorescently-stained nuclear protein NuMA in different mammary phenotypes obtained using three-dimensional cell culture. Automated image segmentation of DAPI-stained nuclei was generated to isolate thousands of nuclei from three-dimensional confocal images. Prominent features of fluorescently-stained NuMA were detected using a novel local bright feature analysis technique, and their normalized spatial density calculated as a function of the distance from the nuclear perimeter to its center. The results revealed marked changes in the distribution of the density of NuMA bright features as non-neoplastic cells underwent phenotypically normal acinar morphogenesis. In contrast, we did not detect any reorganization of NuMA during the formation of tumor nodules by malignant cells. Importantly, the analysis also discriminated proliferating non-neoplastic cells from proliferating malignant cells, suggesting that these imaging methods are capable of identifying alterations linked not only to the proliferation status but also to the malignant character of cells. We believe that this quantitative analysis will have additional applications for classifying normal and pathological tissues.
International Nuclear Information System (INIS)
Lawrence, J.B.; Marselle, L.M.; Byron, K.S.; Johnson, C.V.; Sullivan, J.L.; Singer, R.H.
1990-01-01
Detection and subcellular localization of human immunodeficiency virus (HIV) were investigated using sensitive high-resolution in situ hybridization methodology. Lymphocytes infected with HIV in vitro or in vivo were detected by fluorescence after hybridization with either biotin or digoxigenin-labeled probes. At 12 hr after infection in vitro, a single intense signal appeared in the nuclei of individual cells. Later in infection, when cytoplasmic fluorescence became intense, multiple nuclear foci frequently appeared. The nuclear focus consisted of newly synthesized HIV RNA as shown by hybridization in the absence of denaturation and by susceptibility to RNase and actinomycin D. Virus was detected in patient lymphocytes and it was shown that a singular nuclear focus also characterizes cells infected in vivo. The cell line 8E5/LAV containing one defective integrated provirus revealed a similar focus of nuclear RNA, and the single integrated HIV genome was unequivocally visualized on a D-group chromosome. This demonstrates an extremely sensitive single-cell assay for the presence of a single site of HIV transcription in vitro and in vivo and suggests that it derives from one (or very few) viral genomes per cell. In contrast, productive Epstein-Barr virus infection exhibited many foci of nuclear RNA per cell
EpCAM nuclear localization identifies aggressive Thyroid Cancer and is a marker for poor prognosis
International Nuclear Information System (INIS)
Ralhan, Ranju; Cao, Jun; Lim, Terence; MacMillan, Christina; Freeman, Jeremy L; Walfish, Paul G
2010-01-01
Proteolytic cleavage of the extracellular domain (EpEx) of Epithelial cell adhesion molecule (EpCAM) and nuclear signaling by its intracellular oncogenic domain Ep-ICD has recently been implicated in increased proliferation of cancer cells. The clinical significance of Ep-ICD in human tumors remains an enigma. EpEx, Ep-ICD and β-catenin immunohistochemistry using specific antibodies was conducted on 58 archived thyroid cancer (TC) tissue blocks from 34 patients and correlated with survival analysis of these patients for up to 17 years. The anaplastic (ATC) and aggressive thyroid cancers showed loss of EpEx and increased nuclear and cytoplasmic accumulation of Ep-ICD. In contrast, the low grade papillary thyroid cancers (PTC) showed membranous EpEx and no detectable nuclear Ep-ICD. The ATC also showed concomitant nuclear expression of Ep-ICD and β-catenin. Kaplan-Meier Survival analysis revealed reduced overall survival (OS) for TC patients showing nuclear Ep-ICD expression or loss of membranous EpEx (p < 0.0004), median OS = 5 months as compared to 198 months for patients who did not show nuclear Ep-ICD or demonstrated only membranous EpE. We report reciprocal loss of membrane EpEx but increased nuclear and cytoplasmic accumulation of Ep-ICD in aggressive TC; nuclear Ep-ICD correlated with poor OS of TC patients. Thus nuclear Ep-ICD localization may serve as a useful biomarker for aggressive TC and may represent a novel diagnostic, prognostic and therapeutic target for aggressive TC
Description of the local dose rate measuring system for the Angra 2 nuclear power plant
International Nuclear Information System (INIS)
Costa, Lilian Rose Sobral da; Souza Mendes, Jorge Eduardo de
1995-01-01
The equipment used and the measured value processing involved in the Local Dose Rate Measuring System is described including the installation points for the measuring equipment in the reactor building, the auxiliary building and at the main gate of Angra 2 Nuclear Power Plant. Under normal operating conditions protecting of the personnel is ensured by measuring the local dose rate at those points which are generally accessible. In some cases , fixed sensors are not suitable so that mobile equipment is used. (author). 2 refs., 1 fig
Oppen, M J; Willis, B L; Vugt, H W; Miller, D J
2000-09-01
Although Acropora is the most species-rich genus of the scleractinian (stony) corals, only three species occur in the Caribbean: A. cervicornis, A. palmata and A. prolifera. Based on overall coral morphology, abundance and distribution patterns, it has been suggested that A. prolifera may be a hybrid between A. cervicornis and A. palmata. The species boundaries among these three morphospecies were examined using DNA sequence analyses of the nuclear Pax-C 46/47 intron and the ribosomal DNA Internal Transcribed Spacer (ITS1 and ITS2) and 5.8S regions. Moderate levels of sequence variability were observed in the ITS and 5.8S sequences (up to 5.2% overall sequence difference), but variability within species was as large as between species and all three species carried similar sequences. Since this is unlikely to represent a shared ancestral polymorphism, the data suggest that introgressive hybridization occurs among the three species. For the Pax-C intron, A. cervicornis and A. palmata had very distinct allele frequencies and A. cervicornis carried a unique allele at a frequency of 0.769 (although sequence differences between alleles were small). All A. prolifera colonies examined were heterozygous for the Pax-C intron, whereas heterozygosity was only 0.286 and 0.333 for A. cervicornis and A. palmata, respectively. These data support the hypothesis that A. prolifera is the product of hybridization between two species that have a different allelic composition for the Pax-C intron, i.e. A. cervicornis and A. palmata. We therefore suggest that A. prolifera is a hybrid between A. cervicornis and A. palmata, which backcrosses with the parental species at low frequency.
International Nuclear Information System (INIS)
Pascal, Michel; Villers, Anita; Sene, Monique; Godin, Francois; Quilichini, Jean-Michel; Rollinger, Francois; Delalonde, Jean-Claude; Mehl-Auget, Isabelle; Autret, Jean-Claude; Heriard Dubreuil, Gilles; Petitfrere, Michael; Lochard, Jacques; Demet, Michel; Boucherie, Jean-Claude; Calafat, Alexis; Sommade, Christian; Villain, Alain; Ragazzo, Romeo; Rengot, Marielle; Sename, Jean; Thellier, Yvette; Tremelet, David; Olszewski, Richard; Fournier, Nicolas
2009-12-01
During 40 years, France has chosen nuclear energy as main energy source for power generation. Today, nuclear energy covers 80% of the French electricity needs. For this reason, in France, each inhabitant lives at less than 200 km of a nuclear power plant. The September 11, 2001 terror attack has led to reconsider the nuclear risk in terms of security. In 2005, the French nuclear safety authority (ASN) has been entrusted with the preparation of a nuclear post-accident management study. This study has been mainly based on the experience feedback of the Chernobyl accident and on the dialogue with different actors of the French territory: the local authorities, the habitants, the associations and the health, environment and education actors. This colloquium represents the opening act of the joint elaboration of the management of a potential nuclear accident at the region scale. The colloquium was organized around 5 round tables: 1 - Did the nuclear safety transparency law change the situation?; 2 - Examples of pluralistic dialogues: the long-term management of a nuclear accident; 3 - How to encourage the necessary skills development of citizens? 4 - Regional development strategies in terms of nuclear risks management (incidents, effluents, wastes, transports..); 5 - New territory liabilities and citizens' legitimate aspiration in terms of health/environment: building something together. This document is the proceedings of this colloquium. It reports the exchanges between the participants
Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W
1996-02-15
Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).
Bilodeau, Marie-Claude; Roosink, Meyke; Mercier, Catherine
2016-02-01
Although pain is present in a large proportion of patients receiving rehabilitation, its impact on motor learning is still unclear, especially in the case of neuropathic pain that is not tightly linked to specific movements. The aim of this study was to determine the effect of local and remote tonic cutaneous heat pain applied during training on motor learning of a finger-tapping sequence task. Forty-five healthy participants, randomized to the control, local pain or remote pain groups, were trained to perform an explicit finger motor sequence of five items as fast as possible. During the 10 training blocks (30 s each), local pain and remote pain groups received a heat pain stimulus on the wrist or leg, respectively. Performance was tested in the absence of pain in all groups before (baseline), immediately after (post-immediate), 60 min after (post-60 min) and 24 h after training (post-24 h) to assess both acquisition and next-day retention. Speed increased over time from baseline to post-24 h (p pain during training. No changes were observed on error rates, which were very low even at baseline. These results with experimental heat pain suggest that the ability to relearn finger sequence should not be affected by concomitant neuropathic pain in neurorehabilitation. However, these results need to be validated in the context of chronic pain, by including pain as a co-variable in motor rehabilitation trials.
Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong
2016-09-01
Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.
International Nuclear Information System (INIS)
Kojo, Matti; Kari, Mika; Litmanen, Tapio
2009-01-01
The aim of the paper is to provide updated information on local opinion regarding the siting of a spent nuclear fuel repository in Finland. The main question is how the residents of the municipality perceive the threats and benefits of the repository. In accordance with the Decision in Principle by the Council of State passed in 2000, the Olkiluoto area in Municipality of Eurajoki was chosen as the location for the repository to accommodate spent nuclear fuel produced in Finland. Updated information on local opinions is needed as the siting process is approaching the next phase, the application for a construction license by 2012. The nuclear waste management company Posiva, owned by the utilities Teollisuuden Voima and Fortum Power and Heat, has also applied for a new Decision in Principle (DiP) for expansion of the repository. The data provided in this paper is based on a survey carried out in June 2008. The respondents were selected from the residents of the municipality of Eurajoki and the neighbouring municipalities using stratified random sampling (N=3000). The response rate of the survey was 20% (N=606). The paper is part of a joint research project between the University of Jyvaeskylae and the University of Tampere. The research project 'Follow-up research regarding socio-economic effects and communication of final disposal facility of spent nuclear fuel in Eurajoki and its neighbouring municipalities' is funded by the Finnish Research Programme on Nuclear Waste Management (KYT2010). (authors)
International Nuclear Information System (INIS)
Moriyama, Tetsuji; Sangel, Percival; Yamaguchi, Hiroki; Obuse, Chikashi; Miyamoto, Yoichi; Oka, Masahiro; Yoneda, Yoshihiro
2015-01-01
Tripartite motif-containing 28 (TRIM28) is a transcription regulator, which forms a repressor complex containing heterochromatin protein 1 (HP1). Here, we report identification of a nuclear localization signal (NLS) within the 462-494 amino acid region of TRIM28 that overlaps with its HP1 binding site, HP1 box. GST-pulldown experiments revealed the interaction of the arginine-rich TRIM28 NLS with various importin α subtypes (α1, α2 and α4). In vitro transport assay demonstrated that nuclear localization of GFP-TRIM28 NLS is mediated by importin αs, in conjunction with importin β1 and Ran. Further, we demonstrated that HP1 and importin αs compete for binding to TRIM28. Together, our findings suggest that importin α has an essential role in the nuclear delivery and preferential HP1 interaction of TRIM28. - Highlights: • TRIM28 contains an NLS within the 462-494 amino acid region. • The nuclear import of TRIM28 is mediated by importin α/importin β1. • TRIM28 NLS overlaps with HP1 Box. • HP1 and importin α compete for binding to TRIM28
Energy Technology Data Exchange (ETDEWEB)
Moriyama, Tetsuji; Sangel, Percival [Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Yamaguchi, Hiroki [School of Medicine, Osaka University, Osaka 565-0871 (Japan); Obuse, Chikashi [Graduate School of Life Science, Hokkaido University, Sapporo 001-0021 (Japan); Miyamoto, Yoichi [Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Oka, Masahiro, E-mail: moka@nibiohn.go.jp [Laboratory of Nuclear Transport Dynamics, National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Laboratory of Biomedical Innovation, Graduate School of Pharmaceutical Sciences, Osaka University, Osaka 565-0871 (Japan); Yoneda, Yoshihiro, E-mail: y-yoneda@nibiohn.go.jp [National Institutes of Biomedical Innovation, Health and Nutrition (NIBIOHN), Osaka 567-0085 (Japan); Laboratory of Biomedical Innovation, Graduate School of Pharmaceutical Sciences, Osaka University, Osaka 565-0871 (Japan)
2015-07-03
Tripartite motif-containing 28 (TRIM28) is a transcription regulator, which forms a repressor complex containing heterochromatin protein 1 (HP1). Here, we report identification of a nuclear localization signal (NLS) within the 462-494 amino acid region of TRIM28 that overlaps with its HP1 binding site, HP1 box. GST-pulldown experiments revealed the interaction of the arginine-rich TRIM28 NLS with various importin α subtypes (α1, α2 and α4). In vitro transport assay demonstrated that nuclear localization of GFP-TRIM28 NLS is mediated by importin αs, in conjunction with importin β1 and Ran. Further, we demonstrated that HP1 and importin αs compete for binding to TRIM28. Together, our findings suggest that importin α has an essential role in the nuclear delivery and preferential HP1 interaction of TRIM28. - Highlights: • TRIM28 contains an NLS within the 462-494 amino acid region. • The nuclear import of TRIM28 is mediated by importin α/importin β1. • TRIM28 NLS overlaps with HP1 Box. • HP1 and importin α compete for binding to TRIM28.
International Nuclear Information System (INIS)
Singh, Bhag; Gupta, Radhey S.
2006-01-01
Studies on yeast fumarase provide the main evidence for dual localization of a protein in mitochondria and cytosol by means of retrograde translocation. We have examined the subcellular targeting of yeast and human fumarase in live cells to identify factors responsible for this. The cDNAs for mature yeast or human fumarase were fused to the gene for enhanced green fluorescent protein (eGFP) and they contained, at their N-terminus, a mitochondrial targeting sequence (MTS) derived from either yeast fumarase, human fumarase, or cytochrome c oxidase subunit VIII (COX) protein. Two nuclear localization sequences (2x NLS) were also added to these constructs to facilitate detection of any cytosolic protein by its targeting to nucleus. In Cos-1 cells transfected with these constructs, human fumarase with either the native or COX MTSs was detected exclusively in mitochondria in >98% of the cells, while the remainder 1-2% of the cells showed varying amounts of nuclear labeling. In contrast, when human fumarase was fused to the yeast MTS, >50% of the cells showed nuclear labeling. Similar studies with yeast fumarase showed that with its native MTS, nuclear labeling was seen in 80-85% of the cells, but upon fusion to either human or COX MTS, nuclear labeling was observed in only 10-15% of the cells. These results provide evidence that extramitochondrial presence of yeast fumarase is mainly caused by the poor mitochondrial targeting characteristics of its MTS (but also affected by its primary sequence), and that the retrograde translocation mechanism does not play a significant role in the extramitochondrial presence of mammalian fumarase
Directory of Open Access Journals (Sweden)
Scott P Kenney
Full Text Available Human ribosomal protein S17 (RPS17 is mutated in Diamond-Blackfan Anemia (DBA, a bone marrow disorder that fails to produce sufficient red blood cells leading to anemia. Recently, an RPS17 protein sequence was also found to be naturally inserted in the genome of hepatitis E virus (HEV from patients chronically-infected by HEV. The role of RPS17 in HEV replication and pathogenesis remains unknown due to the lack of knowledge about how RPS17 functions at a molecular level. Understanding the biological function of RPS17 is critical for elucidating its role in virus infection and DBA disease processes. In this study we probed the subcellular distribution of normal and mutant RPS17 proteins in a human liver cell line (Huh7. RPS17 was primarily detected within the nucleus, and more specifically within the nucleoli. Using a transient expression system in which RPS17 or truncations were expressed as fusions with enhanced yellow fluorescent protein (eYFP, we were able to identify and map, for the first time, two separate nuclear localization signals (NLSs, one to the first 13 amino acids of the amino-terminus of RPS17 and the other within amino acids 30-60. Additionally, we mapped amino acid sequences required for nucleolar accumulation of RPS17 to amino acids 60-70. Amino acids 60-70 possess a di-RG motif that may be necessary for nucleolar retention of RPS17. The results from this study enhance our knowledge of RSP17 and will facilitate future mechanistic studies about the roles of RSP17 in hepatitis E and DBA disease processes.
Directory of Open Access Journals (Sweden)
Guido W. Grimm
2006-01-01
Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.
Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera
2007-01-01
The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198
Apparatus for measuring the nuclear radiation of a sequence of radioactive samples
International Nuclear Information System (INIS)
Lohr, W.; Berthold, F.; Allington, R.W.
1977-01-01
To measure the nuclear radiation of a sequence of radioactive samples, magazines that hold sample containers are removably positioned in shuttles, some of which are driven step-by-step by a toothed belt that engates racks on the sides of the shuttles from one compartment to another through a measuring station, with the shuttles that are being driven by the belt driving other shuttles not in engagement with the belt at that time. In the measuring station, the sample containers are released from the magazines one at a time through openings in their bottoms and lowered by a reciprocable support to a position adjacent to a radiation detector for the measurement, after which they are raised by the support to the magazine and the shuttle is driven one more step to the next position. 8 figures
Review study 1995. Localization of the repository for spent nuclear fuel
International Nuclear Information System (INIS)
1995-10-01
This report gives an overview of the studies performed by SKB pertinent to selection of a site for the Swedish repository for spent nuclear fuels, and is written for both experts in the various fields involved, decision-makers and the interested general public. The review can not comprise all detailed factors necessary for deciding the localization, but deals mainly with conditions on the land surface and can point out areas which are not well suited or less interesting as a site. It also treats several scientific, technical and social bases in different parts of the country. 120 refs, 53 figs
International Nuclear Information System (INIS)
Lee, Changhee; Hodgins, Douglas; Calvert, Jay G.; Welch, Siao-Kun W.; Jolie, Rika; Yoo, Dongwan
2006-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) is an RNA virus replicating in the cytoplasm, but the nucleocapsid (N) protein is specifically localized to the nucleus and nucleolus in virus-infected cells. A 'pat7' motif of 41-PGKK(N/S)KK has previously been identified in the N protein as the functional nuclear localization signal (NLS); however, the biological consequences of N protein nuclear localization are unknown. In the present study, the role of N protein nuclear localization during infection was investigated in pigs using an NLS-null mutant virus. When two lysines at 43 and 44 at the NLS locus were substituted to glycines, the modified NLS with 41-PGGGNKK restricted the N protein to the cytoplasm. This NLS-null mutation was introduced into a full-length infectious cDNA clone of PRRSV. Upon transfection of cells, the NLS-null full-length clone induced cytopathic effects and produced infectious progeny. The NLS-null virus grew to a titer 100-fold lower than that of wild-type virus. To examine the response to NLS-null PRRSV in the natural host, three groups of pigs, consisting of seven animals per group, were intranasally inoculated with wild-type, placebo, or NLS-null virus, and the animals were maintained for 4 weeks. The NLS-null-infected pigs had a significantly shorter mean duration of viremia than wild-type-infected pigs but developed significantly higher titers of neutralizing antibodies. Mutations occurred at the NLS locus in one pig during viremia, and four types of mutations were identified: 41-PGRGNKK, 41-PGGRNKK, and 41-PGRRNKK, and 41-PGKKSKK. Both wild-type and NLS-null viruses persisted in the tonsils for at least 4 weeks, and the NLS-null virus persisting in the tonsils was found to be mutated to either 41-PGRGNKK or 41-PGGRNKK in all pigs. No other mutation was found in the N gene. All types of reversions which occurred during viremia and persistence were able to translocate the mutated N proteins to the nucleus, indicating a
International Nuclear Information System (INIS)
Ruedig, W.
1990-01-01
Nuclear power, heralded in the years after World War II as the answer to the world's energy needs, has in more recent times become the focus of intense ecological, political and economic debate. In this study, the current worldwide opposition to nuclear power is examined from its origins in expert dissent to the widespread development of grassroots activity. Chapter headings include: Social Movements: A Theoretical Framework; Creating the Preconditions for Public Protest; Local and Regional Opposition: Mobilizing the Grass Roots; Local Opposition and the Politicization of Nuclear Power; The Use of Local Opposition as a Political Resource; Local Opposition and Social Movement Analysis; The Removal of Political Stimuli: The Unpolitics of Nuclear Siting; Analyzing Host Community Attitudes: The Survey Evidence; Attitudes and Political Action of Nuclear Host Communities: Approaches and Explanations; Novel Siting Approaches and their Political Implications; Siting and Social Movement Analysis; Patterns and Outcomes of Nuclear Energy Conflicts; The Future of the Nuclear Energy Conflict. Throughout the text, analysis and theory are blended with detailed accounts of the growth and activities of individual anti-nuclear organizations in different countries. (author)
Role of nuclear hexokinase II in DNA repair
International Nuclear Information System (INIS)
Khanna, S.; Bhatt, A.N.; Dwarakanath, B.S.; Kalaiarasan, P.; Brahmachari, V.
2012-01-01
A common signature of many cancer cells is a high glucose catabolic rate primarily due to the over expression of Type II hexokinase (HKII; responsible for the phosphorylation of glucose), generally known as cytosolic and mitochondrial bound enzyme that also suppresses cell death. Although, nuclear localization and transcriptional regulation of HKII has been reported in yeast; we and few others have recently demonstrated its nuclear localization in malignant cell lines. Interestingly, modification of a human glioma cell line (BMG-1) for enhancing glycolysis through mitochondrial respiration (OPMBMG cells) resulted in a higher nuclear localization of HKII as compared to the parental cells with concomitant increase in DNA repair and radio-resistance. Further, the glucose phosphorylation activity of the nuclear HKII was nearly 2 folds higher in the relatively more radioresistant HeLa cells (human cervical cancer cell line) as compared to MRC-5 cells (human normal lung fibroblast cell line). Therefore, we hypothesize that nuclear HKII facilitates DNA repair, in a hither to unknown mechanism, that may partly contribute to the enhanced resistance of highly glycolytic cells to radiation. Sequence alignment studies suggest that the isoenzymes, HKI and HKII share strong homology in the kinase active site, which is also found in few protein kinases. Interestingly HKI has been shown to phosphorylate H2A in-vitro. Further, in-silico protein-protein interaction data suggest that HKII can interact with several DNA repair proteins including ATM. Taken together; available experimental evidences as well as in-silico predictions strongly suggest that HKII may play a role in DNA repair by phosphorylation of certain DNA repair proteins. (author)
Nakao, Minoru; Li, Tiaoying; Han, Xiumin; Ma, Xiumin; Xiao, Ning; Qiu, Jiamin; Wang, Hu; Yanagida, Tetsuya; Mamuti, Wulamu; Wen, Hao; Moro, Pedro L.; Giraudoux, Patrick; Craig, Philip S.; Ito, Akira
2009-01-01
The genetic polymorphisms of Echinococcus spp. in the eastern Tibetan Plateau and the Xinjiang Uyghur Autonomous Region were evaluated by DNA sequencing analyses of genes for mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear elongation factor-1 alpha (ef1a). We collected 68 isolates of Echinococcus granulosus sensu stricto (s.s.) from Xinjiang and 113 isolates of E. granulosus s. s., 49 isolates of Echinococcus multilocularis and 34 isolates of Echinococcus shiquicus from the Tibetan Plateau. The results of molecular identification by mitochondrial and nuclear markers were identical, suggesting the infrequency of introgressive hybridization. A considerable intraspecific variation was detected in mitochondrial cox1 sequences. The parsimonious network of cox1 haplotypes showed star-like features in E. granulosus s. s. and E. multilocularis, but a divergent feature in E. shiquicus. The cox1 neutrality indexes computed by Tajima's D and Fu's Fs tests showed high negative values in E. granulosus s. s. and E. multilocularis, indicating significant deviations from neutrality. In contrast, the low positive values of both tests were obtained in E. shiquicus. These results suggest the following hypotheses: (i) recent founder effects arose in E. granulosus and E. multilocularis after introducing particular individuals into the endemic areas by anthropogenic movement or natural migration of host mammals, and (ii) the ancestor of E. shiquicus was segregated into the Tibetan Plateau by colonizing alpine mammals and its mitochondrial locus has evolved without bottleneck effects. PMID:19800346
Visualization of the dynamic multimerization of human Cytomegalovirus pp65 in punctuate nuclear foci
International Nuclear Information System (INIS)
Cui Zongqiang; Zhang Ke; Zhang Zhiping; Liu Yalan; Zhou Yafeng; Wei Hongping; Zhang Xian-En
2009-01-01
The phosphorylated protein pp65 of human Cytomegalovirus (HCMV) is the predominant virion protein and the major tegument constituent. It plays important roles in HCMV infection and virion assembly. Live cell imaging and fluorescence recovery after photobleaching (FRAP) analysis showed that HCMV pp65 accumulated dynamically in punctuate nuclear foci when transiently expressed in mammalian cells. Fluorescence resonance energy transfer (FRET) imaging disclosed that pp65 can self-interact in its localization foci. Yeast two-hybrid assay verified that pp65 is a self-associating protein, and the N-terminal amino acids 14-22 were determined to be essential for pp65 self-association. However, these amino acids were not related to pp65 localization in the specific nuclear foci. The interaction of pp65 and ppUL97 was also studied by FRET microscopy, and the result suggested that there is another signal sequence in pp65, being the ppUL97 phosphorylation site, that is responsible for localization of pp65 in nuclear foci. These results help to understand the function of pp65 in HCMV infection and virion morphogenesis.
International Nuclear Information System (INIS)
Kuznecov, M.V.
1992-01-01
The development is summarized of passive condensers for accident localization systems at nuclear power plants (with RBMK and WWER reactors) in the former USSR. Basic properties and criteria defining their availability are described, as are experimental tests and technical solution optimization results. (author) 2 fig
Directory of Open Access Journals (Sweden)
Bergthorsson Ulfar
2011-09-01
Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.
Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd
2017-01-26
The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.
Directory of Open Access Journals (Sweden)
Nehir Ozdemir Ozgenturk
2017-01-01
Full Text Available Kivircik sheep is an important local Turkish sheep according to its meat quality and milk productivity. The aim of this study was to analyze gene expression profiles of both prenatal and postnatal stages for the Kivircik sheep. Therefore, two different cDNA libraries, which were taken from the same Kivircik sheep mammary gland tissue at prenatal and postnatal stages, were constructed. Total 3072 colonies which were randomly selected from the two libraries were sequenced for developing a sheep ESTs collection. We used Phred/Phrap computer programs for analysis of the raw EST and readable EST sequences were assembled with the CAP3 software. Putative functions of all unique sequences and statistical analysis were determined by Geneious software. Total 422 ESTs have over 80% similarity to known sequences of other organisms in NCBI classified by Panther database for the Gene Ontology (GO category. By comparing gene expression profiles, we observed some putative genes that may be relative to reproductive performance or play important roles in milk synthesis and secretion. A total of 2414 ESTs have been deposited to the NCBI GenBank database (GW996847–GW999260. EST data in this study have provided a new source of information to functional genome studies of sheep.
Vargas, Walter A; Sanz-Martín, José M; Rech, Gabriel E; Armijos-Jaramillo, Vinicio D; Rivera, Lina P; Echeverria, María Mercedes; Díaz-Mínguez, José M; Thon, Michael R; Sukno, Serenella A
2016-02-01
Plant pathogens have the capacity to manipulate the host immune system through the secretion of effectors. We identified 27 putative effector proteins encoded in the genome of the maize anthracnose pathogen Colletotrichum graminicola that are likely to target the host's nucleus, as they simultaneously contain sequence signatures for secretion and nuclear localization. We functionally characterized one protein, identified as CgEP1. This protein is synthesized during the early stages of disease development and is necessary for anthracnose development in maize leaves, stems, and roots. Genetic, molecular, and biochemical studies confirmed that this effector targets the host's nucleus and defines a novel class of double-stranded DNA-binding protein. We show that CgEP1 arose from a gene duplication in an ancestor of a lineage of monocot-infecting Colletotrichum spp. and has undergone an intense evolution process, with evidence for episodes of positive selection. We detected CgEP1 homologs in several species of a grass-infecting lineage of Colletotrichum spp., suggesting that its function may be conserved across a large number of anthracnose pathogens. Our results demonstrate that effectors targeted to the host nucleus may be key elements for disease development and aid in the understanding of the genetic basis of anthracnose development in maize plants.
Nagaraj, Raghavendra; Sharpley, Mark S; Chi, Fangtao; Braas, Daniel; Zhou, Yonggang; Kim, Rachel; Clark, Amander T; Banerjee, Utpal
2017-01-12
Transcriptional control requires epigenetic changes directed by mitochondrial tricarboxylic acid (TCA) cycle metabolites. In the mouse embryo, global epigenetic changes occur during zygotic genome activation (ZGA) at the 2-cell stage. Pyruvate is essential for development beyond this stage, which is at odds with the low activity of mitochondria in this period. We now show that a number of enzymatically active mitochondrial enzymes associated with the TCA cycle are essential for epigenetic remodeling and are transiently and partially localized to the nucleus. Pyruvate is essential for this nuclear localization, and a failure of TCA cycle enzymes to enter the nucleus correlates with loss of specific histone modifications and a block in ZGA. At later stages, however, these enzymes are exclusively mitochondrial. In humans, the enzyme pyruvate dehydrogenase is transiently nuclear at the 4/8-cell stage coincident with timing of human embryonic genome activation, suggesting a conserved metabolic control mechanism underlying early pre-implantation development. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Knowles, David; Sudar, Damir; Bator, Carol; Bissell, Mina
2006-01-01
The organization of nuclear proteins is linked to cell and tissue phenotypes. When cells arrest proliferation, undergo apoptosis, or differentiate, the distribution of nuclear proteins changes. Conversely, forced alteration of the distribution of nuclear proteins modifies cell phenotype. Immunostaining and fluorescence microscopy have been critical for such findings. However, there is an increasing need for quantitative analysis of nuclear protein distribution to decipher epigenetic relationships between nuclear structure and cell phenotype, and to unravel the mechanisms linking nuclear structure and function. We have developed imaging methods to quantify the distribution of fluorescently-stained nuclear protein NuMA in different mammary phenotypes obtained using three-dimensional cell culture. Automated image segmentation of DAPI-stained nuclei was generated to isolate thousands of nuclei from three-dimensional confocal images. Prominent features of fluorescently-stained NuMA were detected using a novel local bright feature analysis technique, and their normalized spatial density calculated as a function of the distance from the nuclear perimeter to its center. The results revealed marked changes in the distribution of the density of NuMA bright features as non-neoplastic cells underwent phenotypically normal acinar morphogenesis. In contrast, we did not detect any reorganization of NuMA during the formation of tumor nodules by malignant cells. Importantly, the analysis also discriminated proliferating non-neoplastic cells from proliferating malignant cells, suggesting that these imaging methods are capable of identifying alterations linked not only to the proliferation status but also to the malignant character of cells. We believe that this quantitative analysis will have additional applications for classifying normal and pathological tissues
Regeneration and localization of radioactive waste in the nuclear fuel cycle
International Nuclear Information System (INIS)
Egorov, N.N.; Kudryavtsev, E.G.; Nikipelov, B.V.; Polyakov, A.S.; Zakharkin, B.S.; Mamaev, L.A.
1993-01-01
Normal functioning of the nuclear-power industry is only possible with a closed fuel cycle, including regeneration of the spent fuel from atomic power plants, the production and recycling of the secondary fuel, and localization of the radioactive waste. Despite the diversity of contemporary attitudes toward the structure of the nuclear fuel cycle around the world, the closure of the fuel cycle has been fundamental to the atomic-power industry in the USSR since the very beginning, and has taken on even greater significance in Russia today. From the beginning, the idea of a closed fuel cycle has been based essentially on one fundamental criterion: the concept of expanded productivity on the basis of fuel regeneration, i.e., the economic factor. Important as economic factors are, safety issues have taken on great significance in recent years: not only power-station reactors but all the ancillary stages of the fuel cycle must meet fundamentally new reliability, safety, and environmental hazards. The RT-1 plant is a versatile operation, regenerating spent fuel from VVER-440, BN-350, and BN-600 reactors, nuclear icebreakers and submarines, research reactors, and other power units. The plant can reprocess 400 ton/year of basic VVER-440 fuel. World-class modern processes have been introduced at the plant, meeting the necessary quality standards: zonal planning, remote operation to eliminate direct contact of the staff with radioactive material, extensive monitoring and control systems, multistage gas-purification systems, and new waste-treatment methods
Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren
2002-06-01
Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.
International Nuclear Information System (INIS)
Curry, M.; Goodrieght, J.; Green, M.; Merwin, D.; Smith, R.
1977-01-01
The roles of state and local agencies in planning for and managing social and economic impacts of nuclear power plants are studied. In order to be effective in these roles state and local agencies must work with each other as well as the NRC. A comparative case study approach is used which analyzes six sites in three West Coast states. The case studies included plants in operation, plants under construction, and plants still in the planning stages. In contrast to some states, all three of these states have moderately centralized procedures for siting power plants, and all have strong environmental laws
Directory of Open Access Journals (Sweden)
Keun-Yong Kim
2013-01-01
Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.
Guo, Haoran; Wei, Wei; Wei, Zhenhong; Liu, Xianjun; Evans, Sean L; Yang, Weiming; Wang, Hong; Guo, Ying; Zhao, Ke; Zhou, Jian-Ying; Yu, Xiao-Fang
2013-01-01
The sterile alpha motif (SAM) and HD domain-containing protein-1 (SAMHD1) inhibits the infection of resting CD4+ T cells and myeloid cells by human and related simian immunodeficiency viruses (HIV and SIV). Vpx inactivates SAMHD1 by promoting its proteasome-dependent degradation through an interaction with CRL4 (DCAF1) E3 ubiquitin ligase and the C-terminal region of SAMHD1. However, the determinants in SAMHD1 that are required for Vpx-mediated degradation have not been well characterized. SAMHD1 contains a classical nuclear localization signal (NLS), and NLS point mutants are cytoplasmic and resistant to Vpx-mediated degradation. Here, we demonstrate that NLS-mutant SAMHD1 K11A can be rescued by wild-type SAMHD1, restoring its nuclear localization; consequently, SAMHD1 K11A became sensitive to Vpx-mediated degradation in the presence of wild-type SAMHD1. Surprisingly, deletion of N-terminal regions of SAMHD1, including the classical NLS, generated mutant SAMHD1 proteins that were again sensitive to Vpx-mediated degradation. Unlike SAMHD1 K11A, these deletion mutants could be detected in the nucleus. Interestingly, NLS-defective SAMHD1 could still bind to karyopherin-β1 and other nuclear proteins. We also determined that the linker region between the SAM and HD domain and the HD domain itself is important for Vpx-mediated degradation but not Vpx interaction. Thus, SAMHD1 contains an additional nuclear targeting mechanism in addition to the classical NLS. Our data indicate that multiple regions in SAMHD1 are critical for Vpx-mediated nuclear degradation and that association with Vpx is not sufficient for Vpx-mediated degradation of SAMHD1. Since the linker region and HD domain may be involved in SAMHD1 multimerization, our results suggest that SAMHD1 multimerization may be required for Vpx-mediation degradation.
Directory of Open Access Journals (Sweden)
Xuan Xiao
Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may
Energy Technology Data Exchange (ETDEWEB)
Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae [Korea Univ., Seoul (Korea, Republic of); Lee, Kyoung Soo; Park, Chi Yong [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)
2008-07-01
Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR.
International Nuclear Information System (INIS)
Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae; Lee, Kyoung Soo; Park, Chi Yong
2008-01-01
Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR
Directory of Open Access Journals (Sweden)
Myeong Kyu Choi
Full Text Available The nonvirion (NV protein of infectious hematopoietic necrosis virus (IHNV has been previously reported to be essential for efficient growth and pathogenicity of IHNV. However, little is known about the mechanism by which the NV supports the viral growth. In this study, cellular localization of NV and its role in IHNV growth in host cells was investigated. Through transient transfection in RTG-2 cells of NV fused to green fluorescent protein (GFP, a nuclear localization of NV was demonstrated. Deletion analyses showed that the (32EGDL(35 residues were essential for nuclear localization of NV protein, and fusion of these 4 amino acids to GFP directed its transport to the nucleus. We generated a recombinant IHNV, rIHNV-NV-ΔEGDL in which the (32EGDL(35 was deleted from the NV. rIHNVs with wild-type NV (rIHNV-NV or with the NV gene replaced with GFP (rIHNV-ΔNV-GFP were used as controls. RTG-2 cells infected with rIHNV-ΔNV-GFP and rIHNV-NV-ΔEGDL yielded 12- and 5-fold less infectious virion, respectively, than wild type rIHNV-infected cells at 48 h post-infection (p.i.. While treatment with poly I∶C at 24 h p.i. did not inhibit replication of wild-type rIHNVs, replication rates of rIHNV-ΔNV-GFP and rIHNV-NV-ΔEGDL were inhibited by poly I∶C. In addition, both rIHNV-ΔNV and rIHNV-NV-ΔEGDL induced higher levels of expressions of both IFN1 and Mx1 than wild-type rIHNV. These data suggest that the IHNV NV may support the growth of IHNV through inhibition of the INF system and the amino acid residues of (32EGDL(35 responsible for nuclear localization are important for the inhibitory activity of NV.
Probabilistic studies of accident sequences
International Nuclear Information System (INIS)
Villemeur, A.; Berger, J.P.
1986-01-01
For several years, Electricite de France has carried out probabilistic assessment of accident sequences for nuclear power plants. In the framework of this program many methods were developed. As the interest in these studies was increasing and as adapted methods were developed, Electricite de France has undertaken a probabilistic safety assessment of a nuclear power plant [fr
Phylogeny of Eleusine (Poaceae: Chloridoideae) based on nuclear ITS and plastid trnT-trnF sequences.
Neves, Susana S; Swire-Clark, Ginger; Hilu, Khidir W; Baird, Wm Vance
2005-05-01
Phylogenetic relationships in the genus Eleusine (Poaceae: Chloridoideae) were investigated using nuclear ITS and plastid trnT-trnF sequences. Separate and combined data sets were analyzed using parsimony, distance, and likelihood based methods, including Bayesian. Data congruence was examined using character and topological measures. Significant data heterogeneity was detected, but there was little conflict in the topological substructure measures for triplets and quartets, and resolution and clade support increased in the combined analysis. Data incongruence may be a result of noise and insufficient information in the slower evolving trnT-trnF. Monophyly of Eleusine is strongly supported in all analyses, but basal relationships in the genus remain uncertain. There is good support for a CAIK clade (E. coracana subsp. coracana and africana, E. indica, and E. kigeziensis), with E. tristachya as its sister group. Two putative ITS homeologues (A and B loci) were identified in the allotetraploid E. coracana; the 'B' locus sequence type was not found in the remaining species. Eleusine coracana and its putative 'A' genome donor, the diploid E. indica, are confirmed close allies, but sequence data contradicts the hypothesis that E. floccifolia is its second genome donor. The 'B' genome donor remains unidentified and may be extinct.
Ibrahim, Shawki A; Simon, Steven L; Bouville, André; Melo, Dunstana; Beck, Harold L
2010-08-01
This paper presents gastrointestinal absorption fractions (f1 values) for estimating internal doses from local and regional fallout radionuclides due to nuclear tests. The choice of f1 values are based on specific circumstances of weapons test conditions and a review of reported f1 values for elements in different physical and chemical states. Special attention is given to fallout from nuclear tests conducted at the Marshall Islands. We make a distinction between the f1 values for intakes of radioactive materials immediately after deposition (acute intakes) and intakes that occur in the course of months and years after deposition, following incorporation into terrestrial and aquatic foodstuffs (chronic intakes). Multiple f1 values for different circumstances where persons are exposed to radioactive fallout (e.g., local vs. regional fallout and coral vs. continental tests) are presented when supportive information is available. In some cases, our selected f1 values are similar to those adopted by the International Commission on Radiological Protection (ICRP) (e.g., iodine and most actinides). However, f1 values for cesium and strontium derived from urine bioassay data of the Marshallese population are notably lower than the generic f1 values recommended by ICRP, particularly for acute intakes from local fallout (0.4 and 0.05 for Cs and Sr, respectively). The f1 values presented here form the first complete set of values relevant to realistic dose assessments for exposure to local or regional radioactive fallout.
Prospects of biomolecule sequencing with the techniques of translocation through nanopores: A review
International Nuclear Information System (INIS)
Nosik, V. L.; Rudakova, E. B.
2013-01-01
The interest in the functional properties of biomolecules in native solutions (in particular, their interaction with membranes) constantly increases with accumulation of data on the macromolecular structure, obtained by X-ray diffraction (with synchrotron radiation sources), nuclear magnetic resonance, and mass spectrometry; this interest is closely related to the development of new technologies of sequencing (i.e., determining the sequence of nucleotides in DNA biomolecule). One of the most promising “physical” approaches to sequencing is the application of methods based on the use of nanochannels or nanopores, through which biomolecules pass in ionic solutions under an electric field applied. A nanopore provides spatial localization of molecules and makes it possible to detect a signal (electric, fluorescent, etc.) from an individual nucleotide. In view of the development of new high-intensity pulsed X-ray sources, the popularity of fluorescence analysis constantly increases. The existing methods for simulating the motion of biomolecules and interpreting their structure, sequencing techniques, and the prospects of further development of investigations in this field are discussed
Evaluation and comparison of mammalian subcellular localization prediction methods
Directory of Open Access Journals (Sweden)
Fink J Lynn
2006-12-01
Full Text Available Abstract Background Determination of the subcellular location of a protein is essential to understanding its biochemical function. This information can provide insight into the function of hypothetical or novel proteins. These data are difficult to obtain experimentally but have become especially important since many whole genome sequencing projects have been finished and many resulting protein sequences are still lacking detailed functional information. In order to address this paucity of data, many computational prediction methods have been developed. However, these methods have varying levels of accuracy and perform differently based on the sequences that are presented to the underlying algorithm. It is therefore useful to compare these methods and monitor their performance. Results In order to perform a comprehensive survey of prediction methods, we selected only methods that accepted large batches of protein sequences, were publicly available, and were able to predict localization to at least nine of the major subcellular locations (nucleus, cytosol, mitochondrion, extracellular region, plasma membrane, Golgi apparatus, endoplasmic reticulum (ER, peroxisome, and lysosome. The selected methods were CELLO, MultiLoc, Proteome Analyst, pTarget and WoLF PSORT. These methods were evaluated using 3763 mouse proteins from SwissProt that represent the source of the training sets used in development of the individual methods. In addition, an independent evaluation set of 2145 mouse proteins from LOCATE with a bias towards the subcellular localization underrepresented in SwissProt was used. The sensitivity and specificity were calculated for each method and compared to a theoretical value based on what might be observed by random chance. Conclusion No individual method had a sufficient level of sensitivity across both evaluation sets that would enable reliable application to hypothetical proteins. All methods showed lower performance on the LOCATE
DEFF Research Database (Denmark)
Mantel, Claire; Korhonen, Jari; Pedersen, Jesper Mørkhøj
2015-01-01
This paper focuses on the influence of ambient light on the perceived quality of videos displayed on Liquid Crystal Display (LCD) with local backlight dimming. A subjective test assessing the quality of videos with two backlight dimming methods and three lighting conditions, i.e. no light, low...... light level (5 lux) and higher light level (60 lux) was organized to collect subjective data. Results show that participants prefer the method exploiting local dimming possibilities to the conventional full backlight but that this preference varies depending on the ambient light level. The clear...... preference for one method at the low light conditions decreases at the high ambient light, confirming that the ambient light significantly attenuates the perception of the leakage defect (light leaking through dark pixels). Results are also highly dependent on the content of the sequence, which can modulate...
LENUS (Irish Health Repository)
Sullivan, Shane
2012-02-01
Previous in vitro studies have identified a nuclear isoform of Cathepsin L. The aim of this study was to examine if nuclear Cathepsin L exists in vivo and examine its association with clinical, pathological and patient outcome data. Cellular localization (nuclear and cytoplasmic) and expression levels v of Cathespin L in 186 colorectal cancer cases using immunohistochemistry. The molecular weight and activity of nuclear and cytoplasmic Cathepsin L in vivo and in vitro were assessed by Western blotting and ELISA, respectively. Epithelial nuclear staining percentage (p = 0.04) and intensity (p = 0.006) increased with advancing tumor stage, whereas stromal cytoplasmic staining decreased (p = 0.02). Using multivariate statistical analysis, survival was inversely associated with staining intensity in the epithelial cytoplasm (p = 0.01) and stromal nuclei (p = 0.007). In different colorectal cell lines and in vivo tumors, pro- and active Cathepsin L isoforms were present in both the cytoplasm and nuclear samples, with pro-Cathepsin L at 50 kDa and active Cathepsin L at 25 kDa. Purified nuclear and cytoplasmic fractions from cell lines and tumors showed active Cathepsin L activity. The identification of nuclear Cathepsin L may play an important prognostic role in colorectal disease progression and patient outcome. Moreover, these findings suggest that altering active nuclear Cathepsin L may significantly influence disease progression.
Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes
Energy Technology Data Exchange (ETDEWEB)
McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.
2005-08-26
Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.
Plant DNA sequences from feces: potential means for assessing diets of wild primates.
Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik
2007-06-01
Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.
Prolonged exposure to particulate chromate inhibits RAD51 nuclear import mediator proteins.
Browning, Cynthia L; Wise, John Pierce
2017-09-15
Particulate hexavalent chromium (Cr(VI)) is a human lung carcinogen and a human health concern. The induction of structural chromosome instability is considered to be a driving mechanism of Cr(VI)-induced carcinogenesis. Homologous recombination repair protects against Cr(VI)-induced chromosome damage, due to its highly accurate repair of Cr(VI)-induced DNA double strand breaks. However, recent studies demonstrate Cr(VI) inhibits homologous recombination repair through the misregulation of RAD51. RAD51 is an essential protein in HR repair that facilitates the search for a homologous sequence. Recent studies show prolonged Cr(VI) exposure prevents proper RAD51 subcellular localization, causing it to accumulate in the cytoplasm. Since nuclear import of RAD51 is crucial to its function, this study investigated the effect of Cr(VI) on the RAD51 nuclear import mediators, RAD51C and BRCA2. We show acute (24h) Cr(VI) exposure induces the proper localization of RAD51C and BRCA2. In contrast, prolonged (120h) exposure increased the cytoplasmic localization of both proteins, although RAD51C localization was more severely impaired. These results correlate temporally with the previously reported Cr(VI)-induced RAD51 cytoplasmic accumulation. In addition, we found Cr(VI) does not inhibit interaction between RAD51 and its nuclear import mediators. Altogether, our results suggest prolonged Cr(VI) exposure inhibits the nuclear import of RAD51C, and to a lesser extent, BRCA2, which results in the cytoplasmic accumulation of RAD51. Cr(VI)-induced inhibition of nuclear import may play a key role in its carcinogenic mechanism since the nuclear import of many tumor suppressor proteins and DNA repair proteins is crucial to their function. Copyright © 2017 Elsevier Inc. All rights reserved.
Santos, Guilherme B; Soares, Manoel do C P; de F Brito, Elisabete M; Rodrigues, André L; Siqueira, Nilton G; Gomes-Gouvêa, Michele S; Alves, Max M; Carneiro, Liliane A; Malheiros, Andreza P; Póvoa, Marinete M; Zaha, Arnaldo; Haag, Karen L
2012-12-01
To date, nothing is known about the genetic diversity of the Echinococcus neotropical species, Echinococcus vogeli and Echinococcus oligarthrus. Here we used mitochondrial and nuclear DNA sequence polymorphisms to uncover the genetic structure, transmission and history of E. vogeli in the Brazilian Amazon, based on a sample of 38 isolates obtained from human and wild animal hosts. We confirm that the parasite is partially synanthropic and show that its populations are diverse. Furthermore, significant geographical structuring is found, with western and eastern populations being genetically divergent. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Benjannet, S; Leduc, R; Lazure, C; Seidah, N G; Marcinkiewicz, M; Chrétien, M
1985-01-16
During the course of reverse-phase high pressure liquid chromatography (RP-HPLC) purification of a postulated big ACTH (1) from human pituitary gland extracts, a highly purified peptide bearing no resemblance to any known polypeptide was isolated. The complete sequence of this 74 amino acid polypeptide, called GAWK, has been determined. Search on a computer data bank on the possible homology to any known protein or fragment, using a mutation data matrix, failed to reveal any homology greater than 30%. An antibody produced against a synthetic fragment allowed us to detect several immunoreactive forms. The antisera also enabled us to localize the polypeptide, by immunocytochemistry, in the anterior lobe of the pituitary gland.
Howard, Kellie; Cherezova, Lidia; DeMaster, Laura K; Rose, Timothy M
2017-11-01
The latency-associated nuclear antigens (LANA) of KSHV and macaque RFHVMn, members of the RV1 rhadinovirus lineage, are closely related with conservation of complex nuclear localization signals (NLS) containing bipartite KR-rich motifs and RG-rich domains, which interact distinctly with importins α and ß1 for nuclear import via classical and non-classical pathways, respectively. RV1 LANAs are expressed in the nucleus of latently-infected cells where they inhibit replication and establish a dominant RV1 latency. Here we show that LANA homologs of macaque RRV and MneRV2 from the more distantly-related RV2 lineage, lack the KR-rich NLS, and instead have a large RG-rich NLS with multiple RG dipeptides and a conserved RGG motif. The RG-NLS interacts uniquely with importin β1, which mediates nuclear import and accumulation of RV2 LANA in the nucleolus. The alternative nuclear import and localization of RV2 LANA homologs may contribute to the dominant RV2 lytic replication phenotype. Copyright © 2017. Published by Elsevier Inc.
Fukazawa, Hidesuke; Masumi, Atsuko
2012-01-01
The bromodomain and extraterminal (BET) family is a group of chromatin-binding proteins characterized by two bromodomains, an extraterminal (ET) domain, and several other conserved regions of unknown function. In humans, the BET family consists of four members, BRD2, BRD3, BRD4 and BRDT, that all normally localize to the nucleus. We identified a 12-amino acid stretch in the inter-bromodomain region that is perfectly conserved among the BET family members. We deleted these residues and expressed the mutant proteins in HEK293T cells to investigate the function of this motif. We found that the deletion of this motif alters the localization of BET proteins. Mutated BRD3 and BRD4 were excluded from the nucleus, and BRDT was found to be diffused throughout the nucleus and cytoplasm. Although the mutant BRD2 remained predominantly in the nucleus, a punctate distribution was also observed in the cytosol. It has been reported that a conserved motif between the second bromodomain and the ET domain serves as a nuclear localization signal for BRD2. Nevertheless, BET mutants lacking the reported nuclear localization signal motif but retaining the 12-amino acid stretch resided in the nucleus. Furthermore, these mutants were diffused throughout the cytoplasm when the 12 residues were removed. These results indicate that the conserved amino acid stretch in the inter-bromodomain region of the BET family functions as a nuclear localization signal.
International Nuclear Information System (INIS)
Ma, Qinglin; Tan, Juan; Cui, Xiaoxu; Luo, Di; Yu, Miao; Liang, Chen; Qiao, Wentao
2014-01-01
Prototype foamy virus encodes a transactivator called Bel1 that enhances viral gene transcription and is essential for PFV replication. Nuclear localization of Bel1 has been reported to rely on two proximal basic motifs R 199 H 200 and R 221 R 222 R 223 that likely function together as a bipartite nuclear localization signal. In this study, we report that mutating R 221 R 222 R 223 , but not R 199 H 200 , relocates Bel1 from the nucleus to the cytoplasm, suggesting an essential role for R 221 R 222 R 223 in the nuclear localization of Bel1. Although not affecting the nuclear localization of Bel1, mutating R 199 H 200 disables Bel1 from transactivating PFV promoters. Results of EMSA reveal that the R 199 H 200 residues are vital for the binding of Bel1 to viral promoter DNA. Moreover, mutating R 199 H 200 in Bel1 impairs PFV replication to a much greater extent than mutating R 221 R 222 R 223 . Collectively, our findings suggest that R 199 H 200 directly participate in Bel1 binding to viral promoter DNA and are indispensible for Bel1 transactivation activity. - Highlights: • The R 221 R 222 R 223 residues are essential for the nuclear localization of Bel1. • Although not affecting the nuclear localization of Bel1, mutating R 199 H 200 disables Bel1 from transactivating PFV promoters. • The R 199 H 200 residues directly participate in Bel1 binding to viral promoter DNA. • Mutating R 199 H 200 in Bel1 impairs PFV replication to a much greater extent than mutating R 221 R 222 R 223
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
Earthquake and nuclear explosion location using the global seismic network
International Nuclear Information System (INIS)
Lopez, L.M.
1983-01-01
The relocation of nuclear explosions, aftershock sequence and regional seismicity is addressed by using joint hypocenter determination, Lomnitz' distance domain location, and origin time and earthquake depth determination with local observations. Distance domain and joint hypocenter location are used for a stepwise relocation of nuclear explosions in the USSR. The resulting origin times are 2.5 seconds earlier than those obtained by ISC. Local travel times from the relocated explosions are compared to Jeffreys-Bullen tables. P times are found to be faster at 9-30 0 distances, the largest deviation being around 10 seconds at 13-18 0 . At these distances S travel times also are faster by approximately 20 seconds. The 1977 Sumba earthquake sequence is relocated by iterative joint hypocenter determination of events with most station reports. Simultaneously determined station corrections are utilized for the relocation of smaller aftershocks. The relocated hypocenters indicate that the aftershocks were initially concentrated along the deep trench. Origin times and depths are recalculated for intermediate depth and deep earthquakes using local observations in and around the Japanese Islands. It is found that origin time and depth differ systematically from ISC values for intermediate depth events. Origin times obtained for events below the crust down to 100 km depth are earlier, whereas no general bias seem to exist for origin times of events in the 100-400 km depth range. The recalculated depths for earthquakes shallower than 100 km are shallower than ISC depths. The depth estimates for earthquakes deeper than 100 km were increased by the recalculations
Earthquake and nuclear explosion location using the global seismic network
Energy Technology Data Exchange (ETDEWEB)
Lopez, L.M.
1983-01-01
The relocation of nuclear explosions, aftershock sequence and regional seismicity is addressed by using joint hypocenter determination, Lomnitz' distance domain location, and origin time and earthquake depth determination with local observations. Distance domain and joint hypocenter location are used for a stepwise relocation of nuclear explosions in the USSR. The resulting origin times are 2.5 seconds earlier than those obtained by ISC. Local travel times from the relocated explosions are compared to Jeffreys-Bullen tables. P times are found to be faster at 9-30/sup 0/ distances, the largest deviation being around 10 seconds at 13-18/sup 0/. At these distances S travel times also are faster by approximately 20 seconds. The 1977 Sumba earthquake sequence is relocated by iterative joint hypocenter determination of events with most station reports. Simultaneously determined station corrections are utilized for the relocation of smaller aftershocks. The relocated hypocenters indicate that the aftershocks were initially concentrated along the deep trench. Origin times and depths are recalculated for intermediate depth and deep earthquakes using local observations in and around the Japanese Islands. It is found that origin time and depth differ systematically from ISC values for intermediate depth events. Origin times obtained for events below the crust down to 100 km depth are earlier, whereas no general bias seem to exist for origin times of events in the 100-400 km depth range. The recalculated depths for earthquakes shallower than 100 km are shallower than ISC depths. The depth estimates for earthquakes deeper than 100 km were increased by the recalculations.
HIV protein sequence hotspots for crosstalk with host hub proteins.
Directory of Open Access Journals (Sweden)
Mahdi Sarmady
Full Text Available HIV proteins target host hub proteins for transient binding interactions. The presence of viral proteins in the infected cell results in out-competition of host proteins in their interaction with hub proteins, drastically affecting cell physiology. Functional genomics and interactome datasets can be used to quantify the sequence hotspots on the HIV proteome mediating interactions with host hub proteins. In this study, we used the HIV and human interactome databases to identify HIV targeted host hub proteins and their host binding partners (H2. We developed a high throughput computational procedure utilizing motif discovery algorithms on sets of protein sequences, including sequences of HIV and H2 proteins. We identified as HIV sequence hotspots those linear motifs that are highly conserved on HIV sequences and at the same time have a statistically enriched presence on the sequences of H2 proteins. The HIV protein motifs discovered in this study are expressed by subsets of H2 host proteins potentially outcompeted by HIV proteins. A large subset of these motifs is involved in cleavage, nuclear localization, phosphorylation, and transcription factor binding events. Many such motifs are clustered on an HIV sequence in the form of hotspots. The sequential positions of these hotspots are consistent with the curated literature on phenotype altering residue mutations, as well as with existing binding site data. The hotspot map produced in this study is the first global portrayal of HIV motifs involved in altering the host protein network at highly connected hub nodes.
International Nuclear Information System (INIS)
Waldhuber, Megan G.; Bateson, Michael; Tan, Judith; Greenway, Alison L.; McPhee, Dale A.
2003-01-01
The human immunodeficiency virus type 1 (HIV-1) Vpr protein is known to arrest the cell cycle in G 2 /M and induce apoptosis following arrest. The functions of Vpr relative to its location in the cell remain unresolved. We now demonstrate that the location and function of Vpr are dependent on the makeup of fusion proteins and that the functions of G 2 /M arrest and apoptosis are separable. Using green fluorescence protein mutants (EGFP or EYFP), we found that fusion at either the N- or C-terminus compromised the ability of Vpr to arrest cell cycling, relative to that of His-Vpr or wild-type protein. Additionally, utilizing the ability to specifically identify cells expressing the fusion proteins, we confirm that Vpr can induce apoptosis, but appears to be independent of cell-cycle arrest in G 2 /M. Both N- and C-terminal Vpr/EYFP fusion proteins induced apoptosis but caused minimal G 2 /M arrest. These studies with Vpr fusion proteins indicate that the functions of Vpr leading to G 2 /M arrest and apoptosis are separable and that fusion of Vpr to EGFP or EYFP affected the localization of the protein. Our findings suggest that nuclear membrane localization and nuclear import and export are strongly governed by modification of the N-terminus of Vpr
International Nuclear Information System (INIS)
Schuff, J.A.
2006-01-01
Low-frequency acoustic signal below about 1 Hz can travel for hundreds or thousands of kilometers through in the Earth atmosphere. If a source produces infrasonic energy, it can be detected by a remote sensor. Atmospheric strong explosions as the nuclear detonation contains low-frequency components that can travel long distances with measurable signal levels. This fact can be useful for detection and localization of clandestine events. The international regime on the non-proliferation of nuclear requires the ability to detect, localize, and discriminate nuclear events on a global scale. Monitoring systems such as the Inter national Monitoring System (I.M.S.) rely on several sensor technologies to perform these functions. The current I.M.S. infra sound system design includes a network of low-frequency atmospheric acoustic sensor arrays, which contribute primarily to the detection and localization of atmospheric nuclear events. There have been observed differences between the azimuth measurements and the true directions of the sources of infra sound waves in artificial and natural events such as explosive eruptions of strong volcanoes. The infra sound waves are reflected in stratospheric and thermospheric layers near 50 km and 120 km in height respectively. The azimuth deviation is affected by meteorological disturbances in the troposphere and stratosphere. This paper describe new elements to obtain the uncertainty in the azimuth calculation of arrival wave plane passing across of a not plane array of infra sound sensors. It also presents a 3D computation of infra sound propagation and estimation of the azimuth deviation using the zonal horizontal wind model and M.S.I.S.E.-90 model of the upper atmosphere to obtain temperature, density and concentration of the principal components of the air for altitudes of up to 120 km. Deviations of up to 12 degrees in the azimuth were obtained, depending on the location of the source of infra sound, the point of measurement and
Nuclear localization of Lyn tyrosine kinase mediated by inhibition of its kinase activity
International Nuclear Information System (INIS)
Ikeda, Kikuko; Nakayama, Yuji; Togashi, Yuuki; Obata, Yuuki; Kuga, Takahisa; Kasahara, Kousuke; Fukumoto, Yasunori; Yamaguchi, Naoto
2008-01-01
Src-family kinases, cytoplasmic enzymes that participate in various signaling events, are found at not only the plasma membrane but also subcellular compartments, such as the nucleus, the Golgi apparatus and late endosomes/lysosomes. Lyn, a member of the Src-family kinases, is known to play a role in DNA damage response and cell cycle control in the nucleus. However, it is still unclear how the localization of Lyn to the nucleus is regulated. Here, we investigated the mechanism of the distribution of Lyn between the cytoplasm and the nucleus in epitheloid HeLa cells and hematopoietic THP-1 cells. Lyn was definitely detected in purified nuclei by immunofluorescence and immunoblotting analyses. Nuclear accumulation of Lyn was enhanced upon treatment of cells with leptomycin B (LMB), an inhibitor of Crm1-mediated nuclear export. Moreover, Lyn mutants lacking the sites for lipid modification were highly accumulated in the nucleus upon LMB treatment. Intriguingly, inhibition of the kinase activity of Lyn by SU6656, Csk overexpression, or point mutation in the ATP-binding site induced an increase in nuclear Lyn levels. These results suggest that Lyn being imported into and rapidly exported from the nucleus preferentially accumulates in the nucleus by inhibition of the kinase activity and lipid modification
Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku
2016-05-13
The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Intracellular localization of Arabidopsis sulfurtransferases.
Bauer, Michael; Dietrich, Christof; Nowak, Katharina; Sierralta, Walter D; Papenbrock, Jutta
2004-06-01
Sulfurtransferases (Str) comprise a group of enzymes widely distributed in archaea, eubacteria, and eukaryota which catalyze the transfer of a sulfur atom from suitable sulfur donors to nucleophilic sulfur acceptors. In all organisms analyzed to date, small gene families encoding Str proteins have been identified. The gene products were localized to different compartments of the cells. Our interest concerns the localization of Str proteins encoded in the nuclear genome of Arabidopsis. Computer-based prediction methods revealed localization in different compartments of the cell for six putative AtStrs. Several methods were used to determine the localization of the AtStr proteins experimentally. For AtStr1, a mitochondrial localization was demonstrated by immunodetection in the proteome of isolated mitochondria resolved by one- and two-dimensional gel electrophoresis and subsequent blotting. The respective mature AtStr1 protein was identified by mass spectrometry sequencing. The same result was obtained by transient expression of fusion constructs with the green fluorescent protein in Arabidopsis protoplasts, whereas AtStr2 was exclusively localized to the cytoplasm by this method. Three members of the single-domain AtStr were localized in the chloroplasts as demonstrated by transient expression of green fluorescent protein fusions in protoplasts and stomata, whereas the single-domain AtStr18 was shown to be cytoplasmic. The remarkable subcellular distribution of AtStr15 was additionally analyzed by transmission electron immunomicroscopy using a monospecific antibody against green fluorescent protein, indicating an attachment to the thylakoid membrane. The knowledge of the intracellular localization of the members of this multiprotein family will help elucidate their specific functions in the organism.
State and local fiscal impacts associated with nuclear energy centers: some initial considerations
International Nuclear Information System (INIS)
Bjornstad, D.J.
1976-04-01
The concept of the nuclear energy center is designed to consolidate a number of electrical power reactors and/or related fuel cycle activities on a single site. Such a siting strategy would concentrate a great deal of economic activity in one area and, as a consequence, generate significant impacts on state and local governments by increasing tax bases and public service demands and by altering intergovernmental fiscal relations. This study was designed to place rough empirical measures on relevant impact variables and to highlight areas for which a need for further research was indicated.
International Nuclear Information System (INIS)
Lindsey, C.G.; Glantz, C.S.
1986-04-01
Effluent dispersion is evaluated using computer codes that require various meteorological parameters such as wind and stability data. These data will be based on current conditions at the site in question, and on forecasts of the expected local meteorology for the time period to be simulated. To assist NRC personnel in preparing these forecasts, a weather-typing model was implemented to analyze the characteristic behavior of local meteorology as it responds to various synoptic-scale weather features (e.g., warm fronts, cold fronts, high pressure systems). Historical observations acquired by instrumented towers at several nuclear power plants were analyzed as a function of the prevailing synoptic weather feature, synoptic-scale pressure gradient, and time of year. This study focused on sites located in shoreline and complex terrain environments because of the occurrence of mesoscale circulations, which are the sea/lake-land breeze and valley wind systems. Such circulations produce diurnally changing wind and stability conditions that cannot be readily identified by synoptic-scale weather forecasts. The advantage in analyzing the climatological behavior of local meteorology as it responds to various synoptic weather systems is that certain weather systems will control the local meteorology and produce persistent conditions
Smith, Kate M; Di Antonio, Veronica; Bellucci, Luca; Thomas, David R; Caporuscio, Fabiana; Ciccarese, Francesco; Ghassabian, Hanieh; Wagstaff, Kylie M; Forwood, Jade K; Jans, David A; Palù, Giorgio; Alvisi, Gualtiero
2018-08-01
Nuclear import involves the recognition by importin (IMP) superfamily members of nuclear localization signals (NLSs) within protein cargoes destined for the nucleus, the best understood being recognition of classical NLSs (cNLSs) by the IMPα/β1 heterodimer. Although the cNLS consensus [K-(K/R)-X-(K/R) for positions P2-P5] is generally accepted, recent studies indicated that the contribution made by different residues at the P4 position can vary. Here, we apply a combination of microscopy, molecular dynamics, crystallography, in vitro binding, and bioinformatics approaches to show that the nature of residues at P4 indeed modulates cNLS function in the context of a prototypical Simian Virus 40 large tumor antigen-derived cNLS (KKRK, P2-5). Indeed, all hydrophobic substitutions in place of R impaired binding to IMPα and nuclear targeting, with the largest effect exerted by a G residue at P4. Substitution of R with neutral hydrophobic residues caused the loss of electrostatic and van der Waals interactions between the P4 residue side chains and IMPα. Detailed bioinformatics analysis confirmed the importance of the P4 residue for cNLS function across the human proteome, with specific residues such as G being associated with low activity. Furthermore, we validate our findings for two additional cNLSs from human cytomegalovirus (HCMV) DNA polymerase catalytic subunit UL54 and processivity factor UL44, where a G residue at P4 results in a 2-3-fold decrease in NLS activity. Our results thus showed that the P4 residue makes a hitherto poorly appreciated contribution to nuclear import efficiency, which is essential to determining the precise nuclear levels of cargoes. Copyright © 2018 Elsevier B.V. All rights reserved.
Repeated DNA sequences in fungi
Energy Technology Data Exchange (ETDEWEB)
Dutta, S K
1974-11-01
Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)
International Nuclear Information System (INIS)
Leibovich, H.; Takacs, E.A.
1983-01-01
The paper describes Argentina's nuclear program, detailing its objectives, the schedule of construction of nuclear plants and local production of required equipment. The technologies adopted so far, the local industrial and engineering participation, the preliminary study for the construction of the next power station and Argentina's nonproliferation nuclear policy are analyzed. Argentina's point of view on Canadian nonproliferation policy and CANDU reactor export is discussed
Okray, Zeynep; de Esch, Celine E F; Van Esch, Hilde; Devriendt, Koen; Claeys, Annelies; Yan, Jiekun; Verbeeck, Jelle; Froyen, Guy; Willemsen, Rob; de Vrij, Femke M S; Hassan, Bassem A
2015-04-01
Loss of function of the FMR1 gene leads to fragile X syndrome (FXS), the most common form of intellectual disability. The loss of FMR1 function is usually caused by epigenetic silencing of the FMR1 promoter leading to expansion and subsequent methylation of a CGG repeat in the 5' untranslated region. Very few coding sequence variations have been experimentally characterized and shown to be causal to the disease. Here, we describe a novel FMR1 mutation and reveal an unexpected nuclear export function for the C-terminus of FMRP. We screened a cohort of patients with typical FXS symptoms who tested negative for CGG repeat expansion in the FMR1 locus. In one patient, we identified a guanine insertion in FMR1 exon 15. This mutation alters the open reading frame creating a short novel C-terminal sequence, followed by a stop codon. We find that this novel peptide encodes a functional nuclear localization signal (NLS) targeting the patient FMRP to the nucleolus in human cells. We also reveal an evolutionarily conserved nuclear export function associated with the endogenous C-terminus of FMRP. In vivo analyses in Drosophila demonstrate that a patient-mimetic mutation alters the localization and function of Dfmrp in neurons, leading to neomorphic neuronal phenotypes. © 2015 The Authors. Published under the terms of the CC BY 4.0 license.
Jaw1/LRMP has a role in maintaining nuclear shape via interaction with SUN proteins.
Kozono, Takuma; Tadahira, Kazuko; Okumura, Wataru; Itai, Nao; Tamura-Nakano, Miwa; Dohi, Taeko; Tonozuka, Takashi; Nishikawa, Atsushi
2018-06-06
Jaw1/LRMP is characterized as a type II integral membrane protein that is localized to endoplasmic reticulum (ER), however, its physiological functions have been poorly understood. An alignment of amino acid sequence of Jaw1 with KASH proteins, outer nuclear membrane proteins, revealed that Jaw1 has a partial homology to the KASH domain. Here, we show that the function of Jaw1 is to maintain nuclear shape in mouse melanoma cell line. The siRNA-mediated knockdown of Jaw1 caused a severe defect in nuclear shape, and the defect was rescued by ectopic expression of siRNA-resistant Jaw1. Since co-immunoprecipitation assay indicates that Jaw1 interacts with SUN proteins that are inner nuclear proteins and microtubules, this study suggests that Jaw1 has a role in maintaining nuclear shape via interactions with SUN proteins and microtubules.
Pomerantz, Aaron; Peñafiel, Nicolás; Arteaga, Alejandro; Bustamante, Lucas; Pichardo, Frank; Coloma, Luis A; Barrio-Amorós, César L; Salazar-Valenzuela, David; Prost, Stefan
2018-04-01
Advancements in portable scientific instruments provide promising avenues to expedite field work in order to understand the diverse array of organisms that inhabit our planet. Here, we tested the feasibility for in situ molecular analyses of endemic fauna using a portable laboratory fitting within a single backpack in one of the world's most imperiled biodiversity hotspots, the Ecuadorian Chocó rainforest. We used portable equipment, including the MinION nanopore sequencer (Oxford Nanopore Technologies) and the miniPCR (miniPCR), to perform DNA extraction, polymerase chain reaction amplification, and real-time DNA barcoding of reptile specimens in the field. We demonstrate that nanopore sequencing can be implemented in a remote tropical forest to quickly and accurately identify species using DNA barcoding, as we generated consensus sequences for species resolution with an accuracy of >99% in less than 24 hours after collecting specimens. The flexibility of our mobile laboratory further allowed us to generate sequence information at the Universidad Tecnológica Indoamérica in Quito for rare, endangered, and undescribed species. This includes the recently rediscovered Jambato toad, which was thought to be extinct for 28 years. Sequences generated on the MinION required as few as 30 reads to achieve high accuracy relative to Sanger sequencing, and with further multiplexing of samples, nanopore sequencing can become a cost-effective approach for rapid and portable DNA barcoding. Overall, we establish how mobile laboratories and nanopore sequencing can help to accelerate species identification in remote areas to aid in conservation efforts and be applied to research facilities in developing countries. This opens up possibilities for biodiversity studies by promoting local research capacity building, teaching nonspecialists and students about the environment, tackling wildlife crime, and promoting conservation via research-focused ecotourism.
Numerical forecast test on local wind fields at Qinshan Nuclear Power Plant
International Nuclear Information System (INIS)
Chen Xiaoqiu
2005-01-01
Non-hydrostatic, full compressible atmospheric dynamics model is applied to perform numerical forecast test on local wind fields at Qinshan nuclear power plant, and prognostic data are compared with observed data for wind fields. The results show that the prognostic of wind speeds is better than that of wind directions as compared with observed results. As the whole, the results of prognostic wind field are consistent with meteorological observation data, 54% of wind speeds are within a factor of 1.5, about 61% of the deviation of wind direction within the 1.5 azimuth (≤33.75 degrees) in the first six hours. (authors)
Characterization of the nuclear import mechanism of the CCAAT-regulatory subunit Php4.
Directory of Open Access Journals (Sweden)
Md Gulam Musawwir Khan
Full Text Available Php4 is a nucleo-cytoplasmic shuttling protein that accumulates in the nucleus during iron deficiency. When present in the nucleus, Php4 associates with the CCAAT-binding protein complex and represses genes encoding iron-using proteins. Here, we show that nuclear import of Php4 is independent of the other subunits of the CCAAT-binding complex. Php4 nuclear import relies on two functionally independent nuclear localization sequences (NLSs that are located between amino acid residues 171 to 174 (KRIR and 234 to 240 (KSVKRVR. Specific substitutions of basic amino acid residues to alanines within these sequences are sufficient to abrogate nuclear targeting of Php4. The two NLSs are biologically redundant and are sufficient to target a heterologous reporter protein to the nucleus. Under low-iron conditions, a functional GFP-Php4 protein is only partly targeted to the nucleus in imp1Δ and sal3Δ mutant cells. We further found that cells expressing a temperature-sensitive mutation in cut15 exhibit increased cytosolic accumulation of Php4 at the nonpermissive temperature. Further analysis by pull-down experiments revealed that Php4 is a cargo of the karyopherins Imp1, Cut15 and Sal3. Collectively, these results indicate that Php4 can be bound by distinct karyopherins, connecting it into more than one nuclear import pathway.
International Nuclear Information System (INIS)
Svenson, Ola
1998-01-01
This study applies a decision theoretic perspective on a severe accident management sequence in a processing industry. The sequence contains loss of feedwater and auxiliary feedwater in a boiling water nuclear reactor (BWR), which necessitates manual depressurization of the reactor pressure vessel to enable low pressure cooling of the core. The sequence is fast and is a major contributor to core damage in probabilistic risk analyses (PRAs) of this kind of plant. The management of the sequence also includes important, difficult and fast human decision making. The decision theoretic perspective, which is applied to a Swedish ABB-type reactor, stresses the roles played by uncertainties about plant state, consequences of different actions and goals during the management of a severe accident sequence. Based on a theoretical analysis and empirical simulator data the human error probabilities in the PRA for the plant are considered to be too small. Recommendations for how to improve safety are given and they include full automation of the sequence, improved operator training, and/or actions to assist the operators' decision making through reduction of uncertainties, for example, concerning water/steam level for sufficient cooling, time remaining before insufficient cooling level in the tank is reached and organizational cost-benefit evaluations of the events following a false alarm depressurization as well as the events following a successful depressurization at different points in time. Finally, it is pointed out that the approach exemplified in this study is applicable to any accident scenario which includes difficult human decision making with conflicting goals, uncertain information and with very serious consequences
Study of event sequence database for a nuclear power domain
International Nuclear Information System (INIS)
Kusumi, Yoshiaki
1998-01-01
A retrieval engine developed to extract event sequences from an accident information database using a time series retrieval formula expressed with ordered retrieval terms is explored. This engine outputs not only a sequence which completely matches with a time series retrieval formula, but also sequence which approximately matches the formula (fuzzy retrieval). An event sequence database in which records consist of three ordered parameters, namely the causal event, the process and result. Then the database is used to assess the feasibility of this engine and favorable results were obtained. (author)
International Nuclear Information System (INIS)
Salomon, S.N.
1979-10-01
Inadequate, sporadic, uncertain and frustrating are words local, state and Federal officials use to describe the current hodgepodge funding approach to State and local government radiological emergency response plans and preparedeness in support of commercial nuclear power stations. The creation of a Radiological Emergency Response Plans and Preparedness Fund for State and Local Government is offered as a preferred solution. Monies for the Fund could be derived from a one time Fee of $1 million levied on the operator of each nuclear power station. Every five years, adjustments could be made in the Fee to assure full recovery of costs because of inflation, revised criteria and other cost related factors. Any surplus would be refunded to the utilities. Any state that has obtained NRC concurrence or is in the process could be reimbursed for previous expenditures up to two years prior to NRC concurrence. Concurrence in all state and local government plans is the objective of the funding program. The Fund should be administered by the Nuclear Regulatory Commission. The report also discusses actions by Federal and state agencies and points to long range considerations, such as a training institute, including transportation and non-commercial and other fixed nuclear facilities, where preparedness could be enhanced by a coherent funding mechanism. All recommendations are based on an inquiry by the Office of state Programs, NRC, into the historical and future costs and funding of radiological emergency response plans and preparedness at the state and local government levels and are derived from discussions with many local, State and Federal officials
International Nuclear Information System (INIS)
Aboul-ela, F.M.
1987-12-01
Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA 3 XA 3 G with the complement dCT 3 YT 3 G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G/center dot/C base pair become more stable than those containing only A/center dot/T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I/center dot/C /succ/ I/center dot/ A/succ/ I/center dot/T ∼ I/center dot/G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG)/center dot/d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.)
Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles
2017-10-17
Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.
Japan's nuclear PA activity in local governments
International Nuclear Information System (INIS)
Fujii, Nobuyuki
1995-01-01
This presentation emphasises some points of PA activities, based on the experience of 'cooperation projects for local governments'. Local governments distribute the public information directly to the residents. This is very important because officers of the local government can be the opinion leaders of the region. Local government exist very close to the residents, while the central government is a distant and faceless existence for the local people. It is believed that the local governments play an imperative role in PA activities. In other words, we must further utilize the organizations and functions of the local governments to implement PA activities. In conclusion, three recommendations are offered. Firstly, enough budget and authority should be given to the local governments as far as PA activities in their areas are concerned, and most of such activities should be entrusted to the local governments. Local governments should place more public relations officers, and continue the manpower development. Second, with regard to highly technical or specialized issues which a local governments cannot treat alone, related organizations like JAERO should support their PA activities. Third, such related organizations should also cooperate with local government including assistance in providing know-how, when their public information activities focus on educators, journalists, or the women. These three points should be given due consideration in our cooperation projects for the local governments, and JAERO is doing its best every day
Mantel, Claire; Korhonen, Jari; Pedersen, Jesper M.; Bech, Søren; Andersen, Jakob Dahl; Forchhammer, Søren
2015-01-01
This paper focuses on the influence of ambient light on the perceived quality of videos displayed on Liquid Crystal Display (LCD) with local backlight dimming. A subjective test assessing the quality of videos with two backlight dimming methods and three lighting conditions, i.e. no light, low light level (5 lux) and higher light level (60 lux) was organized to collect subjective data. Results show that participants prefer the method exploiting local dimming possibilities to the conventional full backlight but that this preference varies depending on the ambient light level. The clear preference for one method at the low light conditions decreases at the high ambient light, confirming that the ambient light significantly attenuates the perception of the leakage defect (light leaking through dark pixels). Results are also highly dependent on the content of the sequence, which can modulate the effect of the ambient light from having an important influence on the quality grades to no influence at all.
Directory of Open Access Journals (Sweden)
Fiz-Palacios Omar
2008-12-01
Full Text Available Abstract Background Differences in plant annual/perennial habit are hypothesized to cause a generation time effect on divergence rates. Previous studies that compared rates of divergence for internal transcribed spacer (ITS1 and ITS2 sequences of nuclear ribosomal DNA (nrDNA in angiosperms have reached contradictory conclusions about whether differences in generation times (or other life history features are associated with divergence rate heterogeneity. We compared annual/perennial ITS divergence rates using published sequence data, employing sampling criteria to control for possible artifacts that might obscure any actual rate variation caused by annual/perennial differences. Results Relative rate tests employing ITS sequences from 16 phylogenetically-independent annual/perennial species pairs rejected rate homogeneity in only a few comparisons, with annuals more frequently exhibiting faster substitution rates. Treating branch length differences categorically (annual faster or perennial faster regardless of magnitude with a sign test often indicated an excess of annuals with faster substitution rates. Annuals showed an approximately 1.6-fold rate acceleration in nucleotide substitution models for ITS. Relative rates of three nuclear loci and two chloroplast regions for the annual Arabidopsis thaliana compared with two closely related Arabidopsis perennials indicated that divergence was faster for the annual. In contrast, A. thaliana ITS divergence rates were sometimes faster and sometimes slower than the perennial. In simulations, divergence rate differences of at least 3.5-fold were required to reject rate constancy in > 80 % of replicates using a nucleotide substitution model observed for the combination of ITS1 and ITS2. Simulations also showed that categorical treatment of branch length differences detected rate heterogeneity > 80% of the time with a 1.5-fold or greater rate difference. Conclusion Although rate homogeneity was not rejected
Lorenzato, Annalisa; Biolatti, Marta; Delogu, Giuseppe; Capobianco, Giampiero; Farace, Cristiano; Dessole, Salvatore; Cossu, Antonio; Tanda, Francesco; Madeddu, Roberto; Olivero, Martina; Di Renzo, Maria Flavia
2013-10-15
The human homolog of the yeast cse1 gene (CSE1L) is over-expressed in ovarian cancer. CSE1L forms complex with Ran and importin-α and has roles in nucleocytoplasmic traffic and gene expression. CSE1L accumulated in the nucleus of ovarian cancer cell lines, while it was localized also in the cytoplasm of other cancer cell lines. Nuclear localization depended on AKT, which was constitutively active in ovarian cancer cells, as the CSE1L protein translocated to the cytoplasm when AKT was inactivated. Moreover, the expression of a constitutively active AKT forced the translocation of CSE1L from the cytoplasm to the nucleus in other cancer cells. Nuclear accrual of CSE1L was associated to the nuclear accumulation of the phosphorylated Ran Binding protein 3 (RanBP3), which depended on AKT as well. Also in samples of human ovarian cancer, AKT activation was associated to nuclear accumulation of CSE1L and phosphorylation of RanBP3. Expression profiling of ovarian cancer cells after CSE1L silencing showed that CSE1L was required for the expression of genes promoting invasion and metastasis. In agreement, CSE1L silencing impaired motility and invasiveness of ovarian cancer cells. Altogether these data show that in ovarian cancer cells activated AKT by affecting RanBP3 phosphorylation determines the nuclear accumulation of CSE1L and likely the nuclear concentration of transcription factors conveying pro-oncogenic signals. © 2013 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Dallman, R.J.; Gottula, R.C.; Holcomb, E.E.; Jouse, W.C.; Wagoner, S.R.; Wheatley, P.D.
1987-05-01
An analysis of five anticipated transients without scram (ATWS) was conducted at the Idaho National Engineering Laboratory (INEL). The five detailed deterministic simulations of postulated ATWS sequences were initiated from a main steamline isolation valve (MSIV) closure. The subject of the analysis was the Browns Ferry Nuclear Plant Unit 1, a boiling water reactor (BWR) of the BWR/4 product line with a Mark I containment. The simulations yielded insights to the possible consequences resulting from a MSIV closure ATWS. An evaluation of the effects of plant safety systems and operator actions on accident progression and mitigation is presented
Hepler, John R.
2017-01-01
Regulator of G protein signaling 14 (RGS14) is a multifunctional scaffolding protein that integrates G protein and H-Ras/MAPkinase signaling pathways to regulate synaptic plasticity important for hippocampal learning and memory. However, to date, little is known about the subcellular distribution and roles of endogenous RGS14 in a neuronal cell line. Most of what is known about RGS14 cellular behavior is based on studies of tagged, recombinant RGS14 ectopically overexpressed in unnatural host cells. Here, we report for the first time a comprehensive assessment of the subcellular distribution and dynamic localization of endogenous RGS14 in rat B35 neuroblastoma cells. Using confocal imaging and 3D-structured illumination microscopy, we find that endogenous RGS14 localizes to subcellular compartments not previously recognized in studies of recombinant RGS14. RGS14 localization was observed most notably at juxtanuclear membranes encircling the nucleus, at nuclear pore complexes (NPC) on both sides of the nuclear envelope and within intranuclear membrane channels, and within both chromatin-poor and chromatin-rich regions of the nucleus in a cell cycle-dependent manner. In addition, a subset of nuclear RGS14 localized adjacent to active RNA polymerase II. Endogenous RGS14 was absent from the plasma membrane in resting cells; however, the protein could be trafficked to the plasma membrane from juxtanuclear membranes in endosomes derived from ER/Golgi, following constitutive activation of endogenous RGS14 G protein binding partners using AlF4¯. Finally, our findings show that endogenous RGS14 behaves as a cytoplasmic-nuclear shuttling protein confirming what has been shown previously for recombinant RGS14. Taken together, the findings highlight possible cellular roles for RGS14 not previously recognized that are distinct from the regulation of conventional GPCR-G protein signaling, in particular undefined roles for RGS14 in the nucleus. PMID:28934222
Sequencing Closterium moniliferum: Future prospects in nuclear ...
African Journals Online (AJOL)
Akanksha Pandey
2012-10-06
Oct 6, 2012 ... Abstract Genome sequencing can play a vital role in health and several other domains such as in .... ter have imposed some serious questions over the security is- ... strontium and barium from aqueous environment and store.
Gunawidjaja, Philips N.; Mathew, Renny; Lo, Andy Y. H.; Izquierdo-Barba, Isabel; García, Ana; Arcos, Daniel; Mattias Edén, María Vallet-Regí
2012-01-01
We review the benefits of using 29Si and 1H magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectroscopy for probing the local structures of both bulk and surface portions of mesoporous bioactive glasses (MBGs) of the CaO–SiO2−(P2O5) system. These mesoporous materials exhibit an ordered pore arrangement, and are promising candidates for improved bone and tooth implants. We discuss experimental MAS NMR results from three MBGs displaying different Ca, Si and P contents: the 29Si NMR spectra were recorded either directly by employing radio-frequency pulses to 29Si, or by magnetization transfers from neighbouring protons using cross polarization, thereby providing quantitative information about the silicate speciation present in the pore wall and at the MBG surface, respectively. The surface modifications were monitored for the three MBGs during their immersion in a simulated body fluid (SBF) for intervals between 30 min and one week. The results were formulated as a reaction sequence describing the interconversions between the distinct silicate species. We generally observed a depletion of Ca2+ ions at the MBG surface, and a minor condensation of the silicate-surface network over one week of SBF soaking. PMID:22349247
Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.
Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron
2012-02-01
Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53
Finding the most significant common sequence and structure motifs in a set of RNA sequences
DEFF Research Database (Denmark)
Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.
1997-01-01
We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...
Simple probabilistic method for relative risk evaluation of nuclear terrorism events
International Nuclear Information System (INIS)
Zhang Songbai; Wu Jun
2006-01-01
On the basis of the event-tree and probability analysis methods, a probabilistic method of nuclear terrorism risk was built, and the risk of terrorism events was analyzed. With the statistical data for and hypothetical data for relative events, the relative probabilities of the four kinds of nuclear terrorism events were obtained, as well as the relative risks of these four kinds of nuclear terrorism events were calculated by using this probabilistic method. The illustrated case show that the descending sequence of damages from the four kinds of nuclear terrorism events for single event is as following: nuclear explosive and improvised nuclear explosive, nuclear facility attacked, and 'dirty bomb'. Under the hypothetical condition, the descending sequence of possibilities for the four kinds of nuclear terrorism events is as following: 'dirty bomb', nuclear facility attacked, improvised nuclear explosive and nuclear explosive, but the descending sequence of risks is as following: 'dirty bomb', improvised nuclear explosive, nuclear facility attacked, and nuclear explosive . (authors)
A functional test of Neandertal and modern human mitochondrial targeting sequences
International Nuclear Information System (INIS)
Gralle, Matthias; Schaefer, Ingo; Seibel, Peter; Paeaebo, Svante
2010-01-01
Research highlights: → Two mutations in mitochondrial targeting peptides occurred during human evolution, possibly after Neandertals split off from modern human lineage. → The ancestral and modern human versions of these two targeting peptides were tested functionally for their effects on localization and cleavage rate. → In spite of recent evolution, and to the contrary of other mutations in targeting peptides, these mutations had no visible effects. -- Abstract: Targeting of nuclear-encoded proteins to different organelles, such as mitochondria, is a process that can result in the redeployment of proteins to new intracellular destinations during evolution. With the sequencing of the Neandertal genome, it has become possible to identify amino acid substitutions that occurred on the modern human lineage since its separation from the Neandertal lineage. Here we analyze the function of two substitutions in mitochondrial targeting sequences that occurred and rose to high frequency recently during recent human evolution. The ancestral and modern versions of the two targeting sequences do not differ in the efficiency with which they direct a protein to the mitochondria, an observation compatible with the neutral theory of molecular evolution.
A functional test of Neandertal and modern human mitochondrial targeting sequences
Energy Technology Data Exchange (ETDEWEB)
Gralle, Matthias, E-mail: gralle@bioqmed.ufrj.br [Instituto de Bioquimica Medica, Universidade Federal do Rio de Janeiro, CCS, Ilha do Fundao, 21941-590 Rio de Janeiro (Brazil); Department of Evolutionary Genetics, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig (Germany); Schaefer, Ingo; Seibel, Peter [Department of Molecular Cell Therapy, Leipzig University, Deutscher Platz 5, 04103 Leipzig (Germany); Paeaebo, Svante [Department of Evolutionary Genetics, Max Planck Institute for Evolutionary Anthropology, Deutscher Platz 6, 04103 Leipzig (Germany)
2010-11-26
Research highlights: {yields} Two mutations in mitochondrial targeting peptides occurred during human evolution, possibly after Neandertals split off from modern human lineage. {yields} The ancestral and modern human versions of these two targeting peptides were tested functionally for their effects on localization and cleavage rate. {yields} In spite of recent evolution, and to the contrary of other mutations in targeting peptides, these mutations had no visible effects. -- Abstract: Targeting of nuclear-encoded proteins to different organelles, such as mitochondria, is a process that can result in the redeployment of proteins to new intracellular destinations during evolution. With the sequencing of the Neandertal genome, it has become possible to identify amino acid substitutions that occurred on the modern human lineage since its separation from the Neandertal lineage. Here we analyze the function of two substitutions in mitochondrial targeting sequences that occurred and rose to high frequency recently during recent human evolution. The ancestral and modern versions of the two targeting sequences do not differ in the efficiency with which they direct a protein to the mitochondria, an observation compatible with the neutral theory of molecular evolution.
Camproux, A C; Tufféry, P
2005-08-05
Understanding and predicting protein structures depend on the complexity and the accuracy of the models used to represent them. We have recently set up a Hidden Markov Model to optimally compress protein three-dimensional conformations into a one-dimensional series of letters of a structural alphabet. Such a model learns simultaneously the shape of representative structural letters describing the local conformation and the logic of their connections, i.e. the transition matrix between the letters. Here, we move one step further and report some evidence that such a model of protein local architecture also captures some accurate amino acid features. All the letters have specific and distinct amino acid distributions. Moreover, we show that words of amino acids can have significant propensities for some letters. Perspectives point towards the prediction of the series of letters describing the structure of a protein from its amino acid sequence.
International Nuclear Information System (INIS)
Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.
2012-01-01
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)
2012-05-10
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Aboul-ela, F.M.
1987-12-01
Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.
Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.
Directory of Open Access Journals (Sweden)
Georgi K Marinov
Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.
Intracellular Localization of Arabidopsis Sulfurtransferases1
Bauer, Michael; Dietrich, Christof; Nowak, Katharina; Sierralta, Walter D.; Papenbrock, Jutta
2004-01-01
Sulfurtransferases (Str) comprise a group of enzymes widely distributed in archaea, eubacteria, and eukaryota which catalyze the transfer of a sulfur atom from suitable sulfur donors to nucleophilic sulfur acceptors. In all organisms analyzed to date, small gene families encoding Str proteins have been identified. The gene products were localized to different compartments of the cells. Our interest concerns the localization of Str proteins encoded in the nuclear genome of Arabidopsis. Computer-based prediction methods revealed localization in different compartments of the cell for six putative AtStrs. Several methods were used to determine the localization of the AtStr proteins experimentally. For AtStr1, a mitochondrial localization was demonstrated by immunodetection in the proteome of isolated mitochondria resolved by one- and two-dimensional gel electrophoresis and subsequent blotting. The respective mature AtStr1 protein was identified by mass spectrometry sequencing. The same result was obtained by transient expression of fusion constructs with the green fluorescent protein in Arabidopsis protoplasts, whereas AtStr2 was exclusively localized to the cytoplasm by this method. Three members of the single-domain AtStr were localized in the chloroplasts as demonstrated by transient expression of green fluorescent protein fusions in protoplasts and stomata, whereas the single-domain AtStr18 was shown to be cytoplasmic. The remarkable subcellular distribution of AtStr15 was additionally analyzed by transmission electron immunomicroscopy using a monospecific antibody against green fluorescent protein, indicating an attachment to the thylakoid membrane. The knowledge of the intracellular localization of the members of this multiprotein family will help elucidate their specific functions in the organism. PMID:15181206
Localization of ORC1 During the Cell Cycle in Human Leukemia Cells
Directory of Open Access Journals (Sweden)
Frederick D. Coffman
2011-01-01
Full Text Available The interaction of the origin recognition complex (ORC with replication origins is a critical parameter in eukaryotic replication initiation. In mammals the ORC remains bound except during mitosis, thus the localization of ORC complexes allows localization of origins. A monoclonal antibody that recognizes human ORC1 was used to localize ORC complexes in populations of human MOLT-4 cells separated by cell cycle position using centrifugal elutriation. ORC1 staining in cells in early G1 is diffuse and primarily peripheral. As the cells traverse G1, ORC1 accumulates and becomes more localized towards the center of the nucleus, however around the G1/S boundary the staining pattern changes and ORC1 appears peripheral. By mid to late S phase ORC1 immunofluorescence is again concentrated at the nuclear center. During anaphase, ORC1 staining is localized mainly in the pericentriolar regions. These findings suggest that concerted movements of origin DNA sequences in addition to the previously documented assembly and disassembly of protein complexes are an important aspect of replication initiation loci in eukaryotes.
International Nuclear Information System (INIS)
Hartley, C.S.; Levy, I.S.; Fecht, B.A.
1984-04-01
The Pacific Northwest Laboratory has completed a project to identify human factors deficiencies in safety-significant control stations outside the control room of a nuclear power plant and to determine whether NUREG-0700, Guidelines for Control Room Design Reviews, would be sufficient for reviewing those local control stations (LCSs). The project accomplished this task by first, reviewing existing data pertaining to human factors deficiencies in LCSs involved in significant safety actions; second, surveying LCSs environments and design features at several operating nuclear power plants; and third, assessing the results of that survey relative to the contents of NUREG-0700
Energy Technology Data Exchange (ETDEWEB)
Xiang, Qi-Wang; Zou, Jin-Feng; Wang, Xin [Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Shandong, Taian 271018 (China); Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong, Taian 271018 (China); Sun, Ya-Ni [College of Veterinary Medicine, Northwest A and F University, Shanxi, Yangling 712100 (China); Gao, Ji-Ming; Xie, Zhi-Jing [Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Shandong, Taian 271018 (China); Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong, Taian 271018 (China); Wang, Yu [Department of Basic Medical Sciences, Taishan Medical College, Shandong, Taian 271000 (China); Zhu, Yan-Li [Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Shandong, Taian 271018 (China); Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong, Taian 271018 (China); Jiang, Shi-Jin, E-mail: sjjiang@sdau.edu.cn [Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Shandong, Taian 271018 (China); Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong, Taian 271018 (China)
2013-02-05
The capsid protein (CP) of duck circovirus (DuCV) is the major immunogenic protein and has a high proportion of arginine residues concentrated at the N terminus of the protein, which inhibits efficient mRNA translation in prokaryotic expression systems. In this study, we investigated the subcellular distribution of DuCV CP expressed via recombinant baculoviruses in Sf9 cells and the DNA binding activities of the truncated recombinant DuCV CPs. The results showed that two independent bipartite nuclear localization signals (NLSs) situated at N-terminal 1-17 and 18-36 amino acid residue of the CP. Moreover, two expression level regulatory signals (ELRSs) and two DNA binding signals (DBSs) were also mapped to the N terminus of the protein and overlapped with the two NLSs. The ability of CP to bind DNA, coupled with the karyophilic nature of this protein, strongly suggests that it may be responsible for nuclear targeting of the viral genome.
International Nuclear Information System (INIS)
Xiang, Qi-Wang; Zou, Jin-Feng; Wang, Xin; Sun, Ya-Ni; Gao, Ji-Ming; Xie, Zhi-Jing; Wang, Yu; Zhu, Yan-Li; Jiang, Shi-Jin
2013-01-01
The capsid protein (CP) of duck circovirus (DuCV) is the major immunogenic protein and has a high proportion of arginine residues concentrated at the N terminus of the protein, which inhibits efficient mRNA translation in prokaryotic expression systems. In this study, we investigated the subcellular distribution of DuCV CP expressed via recombinant baculoviruses in Sf9 cells and the DNA binding activities of the truncated recombinant DuCV CPs. The results showed that two independent bipartite nuclear localization signals (NLSs) situated at N-terminal 1–17 and 18–36 amino acid residue of the CP. Moreover, two expression level regulatory signals (ELRSs) and two DNA binding signals (DBSs) were also mapped to the N terminus of the protein and overlapped with the two NLSs. The ability of CP to bind DNA, coupled with the karyophilic nature of this protein, strongly suggests that it may be responsible for nuclear targeting of the viral genome.
Yoshiaki, A; Zhang, Y C
2002-01-01
Embedded nano-Pd particles of 5 nm in size instantly abundant D-atoms more than 250% in the atomic ratio against Pd-atoms at room temperature when they are kept in D sub 2 gas pressurized to less than 10 atm. In such ultrahigh densities, 2-4 D-atoms can be coagulated inside each octahedral space of Pd lattice (pycnodeuterium-lump). When a stimulation energy such as latticequake causing by ultrasonic wave was supplied to those highly deuterated Pd particles, intense deuterium nuclear fusion (''solid fusion'') was generated there and both excess heat and sup 4 He gas were abundantly produced. Naturally, these facts can not be realized at all in bulk Pd. The results show that the nuclear fusion occurs without any hazardous rays in pycnodeuterium-lumps coagulated locally inside the each cell of the host metal lattice. These unit cells correspond to minimum unit of the solid fusion reactor as a ''Lattice Reactor''. (author)
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Directory of Open Access Journals (Sweden)
Jasmine Kolb
2018-04-01
Full Text Available Summary: Adult neurogenesis is regulated by stem cell niche-derived extrinsic factors and cell-intrinsic regulators, yet the mechanisms by which niche signals impinge on the activity of intrinsic neurogenic transcription factors remain poorly defined. Here, we report that MEIS2, an essential regulator of adult SVZ neurogenesis, is subject to posttranslational regulation in the SVZ olfactory bulb neurogenic system. Nuclear accumulation of MEIS2 in adult SVZ-derived progenitor cells follows downregulation of EGFR signaling and is modulated by methylation of MEIS2 on a conserved arginine, which lies in close proximity to nested binding sites for the nuclear export receptor CRM1 and the MEIS dimerization partner PBX1. Methylation impairs interaction with CRM1 without affecting PBX1 dimerization and thereby allows MEIS2 nuclear accumulation, a prerequisite for neuronal differentiation. Our results describe a form of posttranscriptional modulation of adult SVZ neurogenesis whereby an extrinsic signal fine-tunes neurogenesis through posttranslational modification of a transcriptional regulator of cell fate. : A hallmark of adult neurogenesis is its strong dependence on physiological stimuli and environmental signals. Schulte and colleagues show that the nuclear localization and activity of a transcriptional regulator of adult neurogenesis is controlled by posttranslational modification. Their results link intrinsic control over neuron production to external signals and help to explain how adult neurogenesis can occur “on demand.” Keywords: subventricular zone, stem cell niche, posttranslational modification, controlled nuclear import, TALE-homdomain protein, MEIS2, PBX1, CRM1, neurogenesis, stem cell niche
International Nuclear Information System (INIS)
Marsh, G.P.; Taylor, K.J.; Sharland, S.M.; Tasker, P.W.
1987-01-01
The paper considers the long term corrosion of carbon-steel containers for heat generating nuclear waste in a granitic repository. Under such conditions carbon steel may exhibit general, localized or passive corrosion behavior depending on the exact composition and redox potential of the groundwater contacting the containers; localized corrosion being of most concern because it has the fastest propagation rate. It is well established, however, that such localized corrosion is only possible when the environment is sufficiently oxidizing to maintain a positive potential gradient between the cathodic surface and the corrosion sites, which requires that species with oxidizing potentials greater than water need to be present. This fact provides a basis for estimating the periods during which containers may be subject to localized and subsequently to general corrosion, and hence for making an overall assessment of the metal allowance required for a specified container life. A model for the diffusion transport of oxygen has been developed, and a sensitivity analysis has shown that the period of possible localized attack is strongly dependent on the passive film leakage current, the radiation dose rate and the oxygen diffusion coefficient. 20 references, 5 figures
System for determining the local power in the fuel assembly of a nuclear reactor
International Nuclear Information System (INIS)
Rolstad, Erik; Korpas, T.-H.; Leyse, R.H.; Smith, R.D.
1979-01-01
System for determining the local power in the fuel assembly of a nuclear reactor which includes a rod conducting the heat and electricity, along which axial areas act as a gamma radiation thermometer. Each area includes a thermal bridge, a cold source and a pair of junctions acting as thermocouples so placed that they measure the temperature difference between the thermal bridge and the cold source. The power created by the fuel assembly near each area acting as gamma thermometer is found from this difference in temperature [fr
Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.
Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam
2018-01-01
Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.
An optimum analysis sequence for environmental gamma-ray spectrometry
International Nuclear Information System (INIS)
De la Torre, F.; Rios M, C.; Ruvalcaba A, M. G.; Mireles G, F.; Saucedo A, S.; Davila R, I.; Pinedo, J. L.
2010-10-01
This work aims to obtain an optimum analysis sequence for environmental gamma-ray spectroscopy by means of Genie 2000 (Canberra). Twenty different analysis sequences were customized using different peak area percentages and different algorithms for: 1) peak finding, and 2) peak area determination, and with or without the use of a library -based on evaluated nuclear data- of common gamma-ray emitters in environmental samples. The use of an optimum analysis sequence with certified nuclear information avoids the problems originated by the significant variations in out-of-date nuclear parameters of commercial software libraries. Interference-free gamma ray energies with absolute emission probabilities greater than 3.75% were included in the customized library. The gamma-ray spectroscopy system (based on a Ge Re-3522 Canberra detector) was calibrated both in energy and shape by means of the IAEA-2002 reference spectra for software intercomparison. To test the performance of the analysis sequences, the IAEA-2002 reference spectrum was used. The z-score and the reduced χ 2 criteria were used to determine the optimum analysis sequence. The results show an appreciable variation in the peak area determinations and their corresponding uncertainties. Particularly, the combination of second derivative peak locate with simple peak area integration algorithms provides the greater accuracy. Lower accuracy comes from the combination of library directed peak locate algorithm and Genie's Gamma-M peak area determination. (Author)
The tight junction protein Z O-2 has several functional nuclear export signals
International Nuclear Information System (INIS)
Gonzalez-Mariscal, Lorenza; Ponce, Arturo; Alarcon, Lourdes; Jaramillo, Blanca Estela
2006-01-01
The tight junction (TJ) protein ZO-2 changes its subcellular distribution according to the state of confluency of the culture. Thus in confluent monolayers, it localizes at the TJ region whereas in sparse cultures it concentrates at the nucleus. The canine sequence of ZO-2 displays four putative nuclear export signals (NES), two at the second PDZ domain (NES-0 and NES-1) and the rest at the GK region (NES-2 and NES-3). The functionality of NES-0 and NES-3 was unknown, hence here we have explored it with a nuclear export assay, injecting into the nucleus of MDCK cells peptides corresponding to the ZO-2 NES sequences chemically coupled to ovalbumin. We show that both NES-0 and NES-3 are functional and sensitive to leptomycin B. We also demonstrate that NES-1, previously characterized as a non functional NES, is rendered capable of nuclear export upon the acquisition of a negative charge at its Ser369 residue. Experiments performed injecting at the nucleus WT and mutated ZO-2-GST fusion proteins revealed the need of both NES-0 and NES-1, and NES-2 and NES-3 for attaining an efficient nuclear exit of the respective amino and middle segments of ZO-2. Moreover, the transfection of MDCK cells with full-length ZO-2 revealed that the mutation of any of the NES present in the molecule was sufficient to induce nuclear accumulation of the protein
International Nuclear Information System (INIS)
Kato, Takaaki; Takahara, Shogo; Nishikawa, Masashi; Homma, Toshimitsu
2013-01-01
The attitude of local communities near a nuclear power plant (NPP) is a key factor in nuclear policy decision making in Japan. This case study compared local citizens' attitudes in 2010 and 2011 toward the benefits and drawbacks of hosting Kashiwazaki–Kariwa NPP. The Fukushima accident occurred in this period. After the accident, benefit recognition of utility bill refunds clearly declined, while that of public facilities did not, suggesting the influence of a bribery effect. The negative shift of attitudes about hosting the NPP after the accident was more modest in Kariwa Village, which saw a large expansion of social welfare programs, than in the other two areas, which lacked such a budget expansion. Policy implications of these results regarding the provision of economic incentives in NPP host areas after the Fukushima accident were discussed. - Highlights: • The Fukushima accident shocked Japan's nuclear policy. • Citizens' attitudes toward incentives of hosting a nuclear power plant surveyed. • More citizens thought negatively about incentives after the Fukushima accident. • The bribery effect, mode and amount of incentives affected citizens' attitudes
Nuclear energy and nuclear technology in Switzerland
International Nuclear Information System (INIS)
Graf, P.
1975-01-01
The energy crisis, high fuel costs and slow progress in the development of alternative energy sources, e.g. solar energy have given further impetus to nuclear power generation. The Swiss nuclear energy programme is discussed and details are given of nuclear station in operation, under construction, in the project stage and of Swiss participation in foreign nuclear stations. Reference is made to the difficulties, delays and resulting cost increases caused by local and regional opposition to nuclear power stations. The significant contributions made by Swiss industry and Swiss consulting engineers are discussed. (P.G.R.)
Calculation of the heat flow peak in case of local defect of the fuel plate of a nuclear reactor
International Nuclear Information System (INIS)
Fabrega, Serge
1965-11-01
The author reports the calculation of the local thermal flow which exits a fuel plate in a nuclear reactor, where a fabrication defect creates a much localized peak of the power density released in the plate. He first reports the development of the problem equations: hypotheses and data, equation elaboration, simplification and resolution. He presents the results of a numeric application to actual cases, and describes how the conduction in the sheath is taken into account (study of the influence of peak width and shape), and gives a synthetic presentation of the formula for the approximate calculation of the heat flow in case of local defect [fr
Snedden, Donald D; Bertke, Michelle M; Vernon, Dominic; Huber, Paul W
2013-07-01
The 3' untranslated region of mRNA encoding PHAX, a phosphoprotein required for nuclear export of U-type snRNAs, contains cis-acting sequence motifs E2 and VM1 that are required for localization of RNAs to the vegetal hemisphere of Xenopus oocytes. However, we have found that PHAX mRNA is transported to the opposite, animal, hemisphere. A set of proteins that cross-link to the localization elements of vegetally localized RNAs are also cross-linked to PHAX and An1 mRNAs, demonstrating that the composition of RNP complexes that form on these localization elements is highly conserved irrespective of the final destination of the RNA. The ability of RNAs to bind this core group of proteins is correlated with localization activity. Staufen1, which binds to Vg1 and VegT mRNAs, is not associated with RNAs localized to the animal hemisphere and may determine, at least in part, the direction of RNA movement in Xenopus oocytes.
Rotondi, Kenneth S; Gierasch, Lila M
2003-01-01
We have recently shown that two of the beta-turns (III and IV) in the ten-stranded, beta-clam protein, cellular retinoic acid-binding protein I (CRABP I), are favored in short peptide fragments, arguing that they are encoded by local interactions (K. S. Rotondi and L. M. Gierasch, Biochemistry, 2003, Vol. 42, pp. 7976-7985). In this paper we examine these turns in greater detail to dissect the specific local interactions responsible for their observed native conformational biases. Conformations of peptides corresponding to the turn III and IV fragments were examined under conditions designed to selectively disrupt stabilizing interactions, using pH variation, chaotrope addition, or mutagenesis to probe specific side-chain influences. We find that steric constraints imposed by excluded volume effects between near neighbor residues (i,i+2), favorable polar (i,i+2) interactions, and steric permissiveness of glycines are the principal factors accounting for the observed native bias in these turns. Longer-range stabilizing interactions across the beta-turns do not appear to play a significant role in turn stability in these short peptides, in contrast to their importance in hairpins. Additionally, our data add to a growing number of examples of the 3:5 type I turn with a beta-bulge as a class of turns with high propensity to form locally defined structure. Current work is directed at the interplay between the local sequence information in the turns and more long-range influences in the mechanism of folding of this predominantly beta-sheet protein. Copyright 2004 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
S. H. Jafari
2013-01-01
Full Text Available Polylactic acid (PLA/linear low density polyethylene (LLDPE blend nanocomposites based on two different commercial-grade nanoclays, Cloisite® 30B and Cloisite® 15A, were produced via different melt mixing procedures in a counter-rotating twin screw extruder. The effects of mixing sequence and clay type on morphological and rheological behaviors as well as degradation properties of the blends were investigated. The X-ray diffraction (XRD results showed that generally the level of exfoliation in 30B based nanocomposites was better than 15A based nanocomposites. In addition, due to difference in hydrophilicity and kind of modifiers in these two clays, the effect of 30B on refinement of dispersed phase and enhancement of biodegradability of PLA/LLDPE blend was much more remarkable than that of 15A nanoclay. Unlike the one step mixing process, preparation of nanocomposites via a two steps mixing process improved the morphology. Based on the XRD and TEM (transmission electron microscopic results, it is found that the mixing sequence has a remarkable influence on dispersion and localization of the major part of 30B nanoclay in the PLA matrix. Owing to the induced selective localization of nanoclays in PLA phase, the nanocomposites prepared through a two steps mixing sequence exhibited extraordinary biodegradability, refiner morphology and better melt elasticity.
International Nuclear Information System (INIS)
Okada, Masashi; Hozumi, Yasukazu; Ichimura, Tohru; Tanaka, Toshiaki; Hasegawa, Hiroshi; Yamamoto, Masakazu; Takahashi, Nobuya; Iseki, Ken; Yagisawa, Hitoshi; Shinkawa, Takashi; Isobe, Toshiaki; Goto, Kaoru
2011-01-01
Diacylglycerol kinase (DGK) is involved in the regulation of lipid-mediated signal transduction through the metabolism of a second messenger diacylglycerol. Of the DGK family, DGKζ, which contains a nuclear localization signal, localizes mainly to the nucleus but translocates to the cytoplasm under pathological conditions. However, the detailed mechanism of translocation and its functional significance remain unclear. To elucidate these issues, we used a proteomic approach to search for protein targets that interact with DGKζ. Results show that nucleosome assembly protein (NAP) 1-like 1 (NAP1L1) and NAP1-like 4 (NAP1L4) are identified as novel DGKζ binding partners. NAP1Ls constitutively shuttle between the nucleus and the cytoplasm in transfected HEK293 cells. The molecular interaction of DGKζ and NAP1Ls prohibits nuclear import of DGKζ because binding of NAP1Ls to DGKζ blocks import carrier proteins, Qip1 and NPI1, to interact with DGKζ, leading to cytoplasmic tethering of DGKζ. In addition, overexpression of NAP1Ls exerts a protective effect against doxorubicin-induced cytotoxicity. These findings suggest that NAP1Ls are involved in a novel molecular basis for the regulation of nucleocytoplasmic shuttling of DGKζ and provide a clue to examine functional significance of its translocation under pathological conditions.
Introducing nuclear power into currently non-nuclear states
International Nuclear Information System (INIS)
Claassen, Gert
2007-01-01
As the nuclear renaissance gains momentum, many countries that currently have no nuclear power plants will begin to consider introducing them. It is anticipated that smaller reactors such as the Pebble Bed Modulator Reactor (PBMR) will not only be sold to current nuclear states to also to states where there is currently no nuclear experience. A range of issues would have to be considered for nuclear plants to be solid to non-nuclear states, such as the appropriate regulatory environment, standardization and codes, non-proliferation, security of supply, obtaining experienced merchant operators, appropriate financial structures and education and training. The paper considers nine major issues that need to be addressed by governments and vendors alike. International cooperation by organisations such as the IAEA, financial institutions and international suppliers will be required to ensure that developing countries as well as developed ones share the benefits of the nuclear renaissance. The opportunities that the nuclear industry affords to develop local skills, create job opportunities and to develop local manufacturing industries are among the important reasons that the South African Government has decided to support and fund the development of the Pebble Bed Modular Reactor project. These considerations are included in the paper. (author)
Chinese nuclear insurance and Chinese nuclear insurance pool
International Nuclear Information System (INIS)
Gong Zhiqi
2000-01-01
Chinese Nuclear Insurance Started with Daya Bay Nuclear Power Station, PICC issued the insurance policy. Nuclear insurance cooperation between Chinese and international pool's organizations was set up in 1989. In 1996, the Chinese Nuclear Insurance Pool was prepared. The Chinese Nuclear Insurance Pool was approved by The Chinese Insurance Regulatory Committee in May of 1999. The principal aim is to centralize maximum the insurance capacity for nuclear insurance from local individual insurers and to strengthen the reinsurance relations with international insurance pools so as to provide the high quality insurance service for Chinese nuclear industry. The Member Company of Chinese Nuclear Pool and its roles are introduced in this article
Sabbatini, A; Bombardieri, S; Migliorini, P
1993-05-01
SmD is one of the small nuclear ribonucleoproteins frequently targeted by autoantibodies in systemic lupus erythematosus. We isolated and characterized the antibodies present in lupus sera that are specific for the C-terminal region of SmD (sequence 95-119). This region is highly homologous to sequence 35-58 of the EBNA I antigen, one of the nuclear antigens induced by infection with Epstein-Barr virus. Antibodies affinity purified over a peptide 95-119 column were able to recognize this sequence in the context of the whole SmD molecule, as they reacted with blotted recombinant SmD. Anti-SmD 95-119 antibodies bound also the EBNA I 35-58 peptide and detected the EBNA I molecule in a total cell extract from Epstein-Barr virus-infected lines. A population of anti-SmD antibodies is, therefore, able to bind an epitope shared by the autoantigen and the viral antigen EBNA I. To investigate the involvement of this shared epitope in the generation of anti-SmD antibodies, we immunized mice with the EBNA I 35-58 peptide. Sera from immunized animals displayed the same pattern of reactivity of spontaneously produced anti-SmD antibodies. They reacted in fact with the EBNA peptide as well as with SmD 95-119 and recombinant SmD. These data suggest that molecular mimicry may play a role in the induction of anti-SmD autoantibodies.
On liberation of communities which relies on nuclear power
International Nuclear Information System (INIS)
Park, Seung-Joon
2013-01-01
Just after the Nuclear Regulation Authority pointed out possible active faults for fracture zones just under the Tsuruga nuclear power station, local government of reactor site criticized this view was mere judgement of small experts group after its short-term field survey and evaluation meeting without enough discussion with nuclear operators. Behavior of local government, which should insist assurance of residents safety at first, seemed inscrutable and the industrial and financial structure of communities dependent on nuclear power should be clarified. Accident affected costs of nuclear power station estimated in the past were far beyond several trillion yen but local residents of reactor site used to believe accident risk might be negligible because of quite low accident probability estimated by probabilistic safety analysis. Economy of local government of reactor site was dependent on nuclear power. Economic benefits consisted of tax or subsidy income of local governments (financial aspect) and limited employment or grants of residents (economical aspect). Depreciation of relevant nuclear power station varied financial dependency of local government respectively, which could be compensated by local tax subsidy after nuclear power was abolished. Local industry dependent on nuclear power was mostly subcontracted building work or related service industry. Nuclear power phaseout could bring about new employment of residents at reactor site with decommissioning works and introduction of gas-fired thermal power or production center for renewable energy. (T. Tanaka)
Jenkins-Smith, Hank C; Silva, Carol L; Nowlin, Matthew C; deLozier, Grant
2011-04-01
Nuclear facilities have long been seen as the top of the list of locally unwanted land uses (LULUs), with nuclear waste repositories generating the greatest opposition. Focusing on the case of the Waste Isolation Pilot Plant (WIPP) in southern New Mexico, we test competing hypotheses concerning the sources of opposition and support for siting the facility, including demographics, proximity, political ideology, and partisanship, and the unfolding policy process over time. This study tracks the changes of risk perception and acceptance of WIPP over a decade, using measures taken from 35 statewide surveys of New Mexico citizens spanning an 11-year period from fall 1990 to summer 2001. This time span includes periods before and after WIPP became operational. We find that acceptance of WIPP is greater among those whose residences are closest to the WIPP facility. Surprisingly, and contrary to expectations drawn from the broader literature, acceptance is also greater among those who live closest to the nuclear waste transportation route. We also find that ideology, partisanship, government approval, and broader environmental concerns influence support for WIPP acceptance. Finally, the sequence of procedural steps taken toward formal approval of WIPP by government agencies proved to be important to gaining public acceptance, the most significant being the opening of the WIPP facility itself. © 2010 Society for Risk Analysis.
International Nuclear Information System (INIS)
Kumar, Abhishek; Kollath-Leiß, Krisztina; Kempken, Frank
2013-01-01
Highlights: •All eukaryotes have at least a single copy of a bem46 ortholog. •The catalytic triad of BEM46 is illustrated using sequence and structural analysis. •We identified indels in the conserved domain of BEM46 protein. •Localization studies of BEM46 protein were carried out using GFP-fusion tagging. -- Abstract: The bud emergence 46 (BEM46) protein from Neurospora crassa belongs to the α/β-hydrolase superfamily. Recently, we have reported that the BEM46 protein is localized in the perinuclear ER and also forms spots close by the plasma membrane. The protein appears to be required for cell type-specific polarity formation in N. crassa. Furthermore, initial studies suggested that the BEM46 amino acid sequence is conserved in eukaryotes and is considered to be one of the widespread conserved “known unknown” eukaryotic genes. This warrants for a comprehensive phylogenetic analysis of this superfamily to unravel origin and molecular evolution of these genes in different eukaryotes. Herein, we observe that all eukaryotes have at least a single copy of a bem46 ortholog. Upon scanning of these proteins in various genomes, we find that there are expansions leading into several paralogs in vertebrates. Usingcomparative genomic analyses, we identified insertion/deletions (indels) in the conserved domain of BEM46 protein, which allow to differentiate fungal classes such as ascomycetes from basidiomycetes. We also find that exonic indels are able to differentiate BEM46 homologs of different eukaryotic lineage. Furthermore, we unravel that BEM46 protein from N. crassa possess a novel endoplasmic-retention signal (PEKK) using GFP-fusion tagging experiments. We propose that three residues namely a serine 188S, a histidine 292H and an aspartic acid 262D are most critical residues, forming a catalytic triad in BEM46 protein from N. crassa. We carried out a comprehensive study on bem46 genes from a molecular evolution perspective with combination of functional
Energy Technology Data Exchange (ETDEWEB)
Kumar, Abhishek; Kollath-Leiß, Krisztina; Kempken, Frank, E-mail: fkempken@bot.uni-kiel.de
2013-08-30
Highlights: •All eukaryotes have at least a single copy of a bem46 ortholog. •The catalytic triad of BEM46 is illustrated using sequence and structural analysis. •We identified indels in the conserved domain of BEM46 protein. •Localization studies of BEM46 protein were carried out using GFP-fusion tagging. -- Abstract: The bud emergence 46 (BEM46) protein from Neurospora crassa belongs to the α/β-hydrolase superfamily. Recently, we have reported that the BEM46 protein is localized in the perinuclear ER and also forms spots close by the plasma membrane. The protein appears to be required for cell type-specific polarity formation in N. crassa. Furthermore, initial studies suggested that the BEM46 amino acid sequence is conserved in eukaryotes and is considered to be one of the widespread conserved “known unknown” eukaryotic genes. This warrants for a comprehensive phylogenetic analysis of this superfamily to unravel origin and molecular evolution of these genes in different eukaryotes. Herein, we observe that all eukaryotes have at least a single copy of a bem46 ortholog. Upon scanning of these proteins in various genomes, we find that there are expansions leading into several paralogs in vertebrates. Usingcomparative genomic analyses, we identified insertion/deletions (indels) in the conserved domain of BEM46 protein, which allow to differentiate fungal classes such as ascomycetes from basidiomycetes. We also find that exonic indels are able to differentiate BEM46 homologs of different eukaryotic lineage. Furthermore, we unravel that BEM46 protein from N. crassa possess a novel endoplasmic-retention signal (PEKK) using GFP-fusion tagging experiments. We propose that three residues namely a serine 188S, a histidine 292H and an aspartic acid 262D are most critical residues, forming a catalytic triad in BEM46 protein from N. crassa. We carried out a comprehensive study on bem46 genes from a molecular evolution perspective with combination of functional
Energy Technology Data Exchange (ETDEWEB)
Lorenzato, Annalisa; Biolatti, Marta [Department of Oncology, University of Torino School of Medicine, Torino (Italy); Institute for Cancer Research at Candiolo, Candiolo, Torino (Italy); Delogu, Giuseppe [Department of Biomedical Sciences-Histology, University of Sassari, Sassari (Italy); Capobianco, Giampiero [Department of Surgical, Microsurgical and Medical Sciences, University of Sassari, Sassari (Italy); Farace, Cristiano [Department of Biomedical Sciences-Histology, University of Sassari, Sassari (Italy); Dessole, Salvatore; Cossu, Antonio; Tanda, Francesco [Department of Surgical, Microsurgical and Medical Sciences, University of Sassari, Sassari (Italy); Madeddu, Roberto [Department of Biomedical Sciences-Histology, University of Sassari, Sassari (Italy); National Institute of Biostructures and Biosystems, Rome (Italy); Olivero, Martina [Department of Oncology, University of Torino School of Medicine, Torino (Italy); Institute for Cancer Research at Candiolo, Candiolo, Torino (Italy); Di Renzo, Maria Flavia, E-mail: mariaflavia.direnzo@unito.it [Department of Oncology, University of Torino School of Medicine, Torino (Italy); Institute for Cancer Research at Candiolo, Candiolo, Torino (Italy)
2013-10-15
The human homolog of the yeast cse1 gene (CSE1L) is over-expressed in ovarian cancer. CSE1L forms complex with Ran and importin-α and has roles in nucleocytoplasmic traffic and gene expression. CSE1L accumulated in the nucleus of ovarian cancer cell lines, while it was localized also in the cytoplasm of other cancer cell lines. Nuclear localization depended on AKT, which was constitutively active in ovarian cancer cells, as the CSE1L protein translocated to the cytoplasm when AKT was inactivated. Moreover, the expression of a constitutively active AKT forced the translocation of CSE1L from the cytoplasm to the nucleus in other cancer cells. Nuclear accrual of CSE1L was associated to the nuclear accumulation of the phosphorylated Ran Binding protein 3 (RanBP3), which depended on AKT as well. Also in samples of human ovarian cancer, AKT activation was associated to nuclear accumulation of CSE1L and phosphorylation of RanBP3. Expression profiling of ovarian cancer cells after CSE1L silencing showed that CSE1L was required for the expression of genes promoting invasion and metastasis. In agreement, CSE1L silencing impaired motility and invasiveness of ovarian cancer cells. Altogether these data show that in ovarian cancer cells activated AKT by affecting RanBP3 phosphorylation determines the nuclear accumulation of CSE1L and likely the nuclear concentration of transcription factors conveying pro-oncogenic signals. - highlights: • CSE1L is a key player in nucleocytoplasmic traffic by forming complex with Ran. • AKT phosphorylates RanBP3 that regulates the nucleocytoplasmic gradient of Ran. • The activated oncogenic AKT drives the nuclear accumulation of CSE1L. • CSE1L in the nucleus up-regulates genes conveying pro-oncogenic signals. • CSE1L might contribute to tumor progression driven by the activated oncogenic AKT.
International Nuclear Information System (INIS)
Lorenzato, Annalisa; Biolatti, Marta; Delogu, Giuseppe; Capobianco, Giampiero; Farace, Cristiano; Dessole, Salvatore; Cossu, Antonio; Tanda, Francesco; Madeddu, Roberto; Olivero, Martina; Di Renzo, Maria Flavia
2013-01-01
The human homolog of the yeast cse1 gene (CSE1L) is over-expressed in ovarian cancer. CSE1L forms complex with Ran and importin-α and has roles in nucleocytoplasmic traffic and gene expression. CSE1L accumulated in the nucleus of ovarian cancer cell lines, while it was localized also in the cytoplasm of other cancer cell lines. Nuclear localization depended on AKT, which was constitutively active in ovarian cancer cells, as the CSE1L protein translocated to the cytoplasm when AKT was inactivated. Moreover, the expression of a constitutively active AKT forced the translocation of CSE1L from the cytoplasm to the nucleus in other cancer cells. Nuclear accrual of CSE1L was associated to the nuclear accumulation of the phosphorylated Ran Binding protein 3 (RanBP3), which depended on AKT as well. Also in samples of human ovarian cancer, AKT activation was associated to nuclear accumulation of CSE1L and phosphorylation of RanBP3. Expression profiling of ovarian cancer cells after CSE1L silencing showed that CSE1L was required for the expression of genes promoting invasion and metastasis. In agreement, CSE1L silencing impaired motility and invasiveness of ovarian cancer cells. Altogether these data show that in ovarian cancer cells activated AKT by affecting RanBP3 phosphorylation determines the nuclear accumulation of CSE1L and likely the nuclear concentration of transcription factors conveying pro-oncogenic signals. - highlights: • CSE1L is a key player in nucleocytoplasmic traffic by forming complex with Ran. • AKT phosphorylates RanBP3 that regulates the nucleocytoplasmic gradient of Ran. • The activated oncogenic AKT drives the nuclear accumulation of CSE1L. • CSE1L in the nucleus up-regulates genes conveying pro-oncogenic signals. • CSE1L might contribute to tumor progression driven by the activated oncogenic AKT
Kim, Hyun-Jun; Kwon, Hye-Rim; Bae, Chang-Dae; Park, Joobae; Hong, Kyung U
2010-05-15
During mitosis, regulation of protein structures and functions by phosphorylation plays critical roles in orchestrating a series of complex events essential for the cell division process. Tumor-associated microtubule-associated protein (TMAP), also known as cytoskeleton-associated protein 2 (CKAP2), is a novel player in spindle assembly and chromosome segregation. We have previously reported that TMAP is phosphorylated at multiple residues specifically during mitosis. However, the mechanisms and functional importance of phosphorylation at most of the sites identified are currently unknown. Here, we report that TMAP is a novel substrate of the Aurora B kinase. Ser627 of TMAP was specifically phosphorylated by Aurora B both in vitro and in vivo. Ser627 and neighboring conserved residues were strictly required for efficient phosphorylation of TMAP by Aurora B, as even minor amino acid substitutions of the phosphorylation motif significantly diminished the efficiency of the substrate phosphorylation. Nearly all mutations at the phosphorylation motif had dramatic effects on the subcellular localization of TMAP. Instead of being localized to the chromosome region during late mitosis, the mutants remained associated with microtubules and centrosomes throughout mitosis. However, the changes in the subcellular localization of these mutants could not be completely explained by the phosphorylation status on Ser627. Our findings suggest that the motif surrounding Ser627 ((625) RRSRRL (630)) is a critical part of a functionally important sequence motif which not only governs the kinase-substrate recognition, but also regulates the subcellular localization of TMAP during mitosis.
International Nuclear Information System (INIS)
Keasler, Victor V.; Hodgson, Amanda J.; Madden, Charles R.; Slagle, Betty L.
2009-01-01
Identifying the requirements for the regulatory HBx protein in hepatitis B virus (HBV) replication is an important goal. A plasmid-based HBV replication assay was used to evaluate whether HBx subcellular localization influences its ability to promote virus replication, as measured by real time PCR quantitation of viral capsid-associated DNA. HBx targeted to the nucleus by a nuclear localization signal (NLS-HBx) was able to restore HBx-deficient HBV replication, while HBx containing a nuclear export signal (NES-HBx) was not. Both NLS-HBx and NES-HBx were expressed at similar levels (by immunoprecipitation and Western blotting), and proper localization of the signal sequence-tagged proteins was confirmed by deconvolution microscopy using HBx, NLS-HBx, and NES-HBx proteins fused to GFP. Importantly, these findings were confirmed in vivo by hydrodynamic injection into mice. Our results demonstrate that in these HBV replication assays, at least one function of HBx requires its localization to the nucleus.
International Nuclear Information System (INIS)
Chazov, E.I.; Il'in, L.A.; Gus'kova, A.K.
1982-01-01
An attempt is made to forecast medical and bilogical and aftereffects of nuclear weapons application in a number of situations. In particular, the effects of a single high-yield air or surface nuclear explosion on a city with 1 mln population are considered as well as the aftereffects of the exposure of human beings to local radioactive fallouts outside the ground zero of a surface nuclear explosion. The aftereffects for the population of local and global radioactive fallouts caused by the realization of one of the adopted in the West variants of mass nuclear strives exchange between the hostile sides are estimated. Certain aspects of medical and biological aftereffects of neutron weapons application are discussed
An optimum analysis sequence for environmental gamma-ray spectrometry
Energy Technology Data Exchange (ETDEWEB)
De la Torre, F.; Rios M, C.; Ruvalcaba A, M. G.; Mireles G, F.; Saucedo A, S.; Davila R, I.; Pinedo, J. L., E-mail: fta777@hotmail.co [Universidad Autonoma de Zacatecas, Centro Regional de Estudis Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)
2010-10-15
This work aims to obtain an optimum analysis sequence for environmental gamma-ray spectroscopy by means of Genie 2000 (Canberra). Twenty different analysis sequences were customized using different peak area percentages and different algorithms for: 1) peak finding, and 2) peak area determination, and with or without the use of a library -based on evaluated nuclear data- of common gamma-ray emitters in environmental samples. The use of an optimum analysis sequence with certified nuclear information avoids the problems originated by the significant variations in out-of-date nuclear parameters of commercial software libraries. Interference-free gamma ray energies with absolute emission probabilities greater than 3.75% were included in the customized library. The gamma-ray spectroscopy system (based on a Ge Re-3522 Canberra detector) was calibrated both in energy and shape by means of the IAEA-2002 reference spectra for software intercomparison. To test the performance of the analysis sequences, the IAEA-2002 reference spectrum was used. The z-score and the reduced {chi}{sup 2} criteria were used to determine the optimum analysis sequence. The results show an appreciable variation in the peak area determinations and their corresponding uncertainties. Particularly, the combination of second derivative peak locate with simple peak area integration algorithms provides the greater accuracy. Lower accuracy comes from the combination of library directed peak locate algorithm and Genie's Gamma-M peak area determination. (Author)
Three distinct domains contribute to nuclear transport of murine Foxp3.
Directory of Open Access Journals (Sweden)
Wayne W Hancock
2009-11-01
Full Text Available Foxp3, a 47-kDa transcription factor, is necessary for the function of CD4+CD25+ regulatory T cells (Tregs, with an essential role in the control of self-reactive T cells and in preventing autoimmunity. Activation of Tregs by TCR engagement results in upregulation of Foxp3 expression, followed by its rapid nuclear transport and binding to chromatin. Here, we identify three distinct Foxp3 domains that contribute to nuclear transport. The first domain (Domain 1 comprises the C-terminal 12 amino acids. The second domain (Domain 2 is located immediately N-terminal to the forkhead domain (FHD, recently reported to be a binding site for the runt-related transcription factor 1/acute myeloid leukemia 1 (Runx1/AML1. The third domain (Domain 3 is located within the N-terminal first 51 amino acids. Unlike the known nuclear localization signals (NLSs, none of these three regions are rich in basic residues and do not bear any similarity to known monopartite or bipartite NLSs that have one or more clusters of basic amino acids. The basic arginine-lysine-lysine-arginine (RKKR sequence, located 12-aa from the C-terminal end of Foxp3 was previously reported to be a nuclear localization signal (NLS for several proteins, including for a GFP-Foxp3 hybrid. Evidence is provided here that in the full-length native Foxp3 RKKR does not function as an NLS. The data reported in this study indicates that Foxp3 achieves nuclear transport by binding to other nuclear factors and co-transporting with them to the nucleus.
Functional analysis of bipartite begomovirus coat protein promoter sequences
International Nuclear Information System (INIS)
Lacatus, Gabriela; Sunter, Garry
2008-01-01
We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters
Veeranki, Sudhakar; Choubey, Divaker
2012-01-01
The interferon (IFN)-inducible p200-protein family includes structurally related murine (for example, p202a, p202b, p204, and Aim2) and human (for example, AIM2 and IFI16) proteins. All proteins in the family share a partially conserved repeat of 200-amino acid residues (also called HIN-200 domain) in the C-terminus. Additionally, most proteins (except the p202a and p202b proteins) also share a protein-protein interaction pyrin domain (PYD) in the N-terminus. The HIN-200 domain contains two consecutive oligosaccharide/oligonucleotide binding folds (OB-folds) to bind double stranded DNA (dsDNA). The PYD domain in proteins allows interactions with the family members and an adaptor protein ASC. Upon sensing cytosolic dsDNA, Aim2, p204, and AIM2 proteins recruit ASC protein to form an inflammasome, resulting in increased production of proinflammatory cytokines. However, IFI16 protein can sense cytosolic as well as nuclear dsDNA. Interestingly, the IFI16 protein contains a nuclear localization signal (NLS). Accordingly, the initial studies had indicated that the endogenous IFI16 protein is detected in the nucleus and within the nucleus in the nucleolus. However, several recent reports suggest that subcellular localization of IFI16 protein in nuclear versus cytoplasmic (or both) compartment depends on cell type. Given that the IFI16 protein can sense cytosolic as well as nuclear dsDNA and can initiate different innate immune responses (production of IFN-β versus proinflammatory cytokines), here we evaluate the experimental evidence for the regulation of subcellular localization of IFI16 protein in various cell types. We conclude that further studies are needed to understand the molecular mechanisms that regulate the subcellular localization of IFI16 protein. Published by Elsevier Ltd.
Sun, Min; Long, Juan; Yi, Yuxin; Xia, Wei
2017-10-28
Insulin-like growth factor-binding protein (IGFBP)-5 is a secreted protein that binds to IGFs and modulates IGF actions, as well as regulates cell proliferation, migration, and apoptosis independent of IGF. Proper cellular localization is critical for the effective function of most signaling molecules. In previous studies, we have shown that the nuclear IGFBP-5 comes from ER-cytosol retro-translocation. In this study, we further investigated the pathway mediating IGFBP-5 nuclear import after it retro-translocation. Importin-α5 was identified as an IGFBP-5-interacting protein with a yeast two-hybrid system, and its interaction with IGFBP-5 was further confirmed by GST pull down and co-immunoprecipitation. Binding affinity of IGFBP-5 and importins were determined by surface plasmon resonance (IGFBP-5/importin-β: K D =2.44e-7, IGFBP-5/importin-α5: K D =3.4e-7). Blocking the importin-α5/importin-β nuclear import pathway using SiRNA or dominant negative impotin-β dramatically inhibited IGFBP-5-EGFP nuclear import, though importin-α5 overexpress does not affect IGFBP-5 nuclear import. Furthermore, nuclear IGFBP-5 was quantified using luciferase report assay. When deleted the IGFBP-5 nuclear localization sequence (NLS), IGFBP-5 ΔNLS loss the ability to translocate into the nucleus and accumulation of IGFBP-5 ΔNLS was visualized in the cytosol. Altogether, our findings provide a substantially evidence showed that the IGFBP-5 nuclear import is mediated by importin-α/importin-β complex, and NLS is critical domain in IGFBP-5 nuclear translocation.
Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.
Neuer-Nitsche, B; Lu, X N; Werner, D
1988-09-12
The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.
Alternative splicing affects the targeting sequence of peroxisome proteins in Arabidopsis.
An, Chuanjing; Gao, Yuefang; Li, Jinyu; Liu, Xiaomin; Gao, Fuli; Gao, Hongbo
2017-07-01
A systematic analysis of the Arabidopsis genome in combination with localization experiments indicates that alternative splicing affects the peroxisomal targeting sequence of at least 71 genes in Arabidopsis. Peroxisomes are ubiquitous eukaryotic cellular organelles that play a key role in diverse metabolic functions. All peroxisome proteins are encoded by nuclear genes and target to peroxisomes mainly through two types of targeting signals: peroxisomal targeting signal type 1 (PTS1) and PTS2. Alternative splicing (AS) is a process occurring in all eukaryotes by which a single pre-mRNA can generate multiple mRNA variants, often encoding proteins with functional differences. However, the effects of AS on the PTS1 or PTS2 and the targeting of the protein were rarely studied, especially in plants. Here, we systematically analyzed the genome of Arabidopsis, and found that the C-terminal targeting sequence PTS1 of 66 genes and the N-terminal targeting sequence PTS2 of 5 genes are affected by AS. Experimental determination of the targeting of selected protein isoforms further demonstrated that AS at both the 5' and 3' region of a gene can affect the inclusion of PTS2 and PTS1, respectively. This work underscores the importance of AS on the global regulation of peroxisome protein targeting.
Complete Sequence and Analysis of Coconut Palm (Cocos nucifera) Mitochondrial Genome.
Aljohi, Hasan Awad; Liu, Wanfei; Lin, Qiang; Zhao, Yuhui; Zeng, Jingyao; Alamer, Ali; Alanazi, Ibrahim O; Alawad, Abdullah O; Al-Sadi, Abdullah M; Hu, Songnian; Yu, Jun
2016-01-01
Coconut (Cocos nucifera L.), a member of the palm family (Arecaceae), is one of the most economically important crops in tropics, serving as an important source of food, drink, fuel, medicine, and construction material. Here we report an assembly of the coconut (C. nucifera, Oman local Tall cultivar) mitochondrial (mt) genome based on next-generation sequencing data. This genome, 678,653bp in length and 45.5% in GC content, encodes 72 proteins, 9 pseudogenes, 23 tRNAs, and 3 ribosomal RNAs. Within the assembly, we find that the chloroplast (cp) derived regions account for 5.07% of the total assembly length, including 13 proteins, 2 pseudogenes, and 11 tRNAs. The mt genome has a relatively large fraction of repeat content (17.26%), including both forward (tandem) and inverted (palindromic) repeats. Sequence variation analysis shows that the Ti/Tv ratio of the mt genome is lower as compared to that of the nuclear genome and neutral expectation. By combining public RNA-Seq data for coconut, we identify 734 RNA editing sites supported by at least two datasets. In summary, our data provides the second complete mt genome sequence in the family Arecaceae, essential for further investigations on mitochondrial biology of seed plants.
Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.
Directory of Open Access Journals (Sweden)
Laurent Chatre
Full Text Available The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.
Off-site nuclear emergency exercises in Japan
International Nuclear Information System (INIS)
Eiji, U.; Kiyoshi, T.; Masao, O.; Shigeru, F.
1993-01-01
Nuclear emergency planning and preparedness in Japan have been organized by both national and local governments based on the Disaster Countermeasures Basic Act. Off-site nuclear emergency exercises are classified into two types: national-government level exercises and local-government level exercises. National-government level exercises are carried out once a year by the competent national authorities. Among these authorities, the Science and Technology Agency (STA) fills a leading position in the Japanese nuclear emergency planning and preparedness. Local-government level exercises are carried out once a year or once in a few years by the local governments of the prefectures where nuclear facilities are located. Most of the off-site nuclear emergency exercises in Japan are performed by local-governments. The aim of these exercises is to reinforce the skills of the emergency staff. The national government (STA etc.) provides advices and assistance including financial support to the local-governments. Emergency exercises with the participation of residents have been carried out in some local-governments. As an example of local-government level exercises, an experience in Shizuoka prefecture (central part of Japan) is presented
International Nuclear Information System (INIS)
Cadini, F.; Zio, E.; Pedroni, N.
2007-01-01
In this paper, a locally recurrent neural network (LRNN) is employed for approximating the temporal evolution of a nonlinear dynamic system model of a simplified nuclear reactor. To this aim, an infinite impulse response multi-layer perceptron (IIR-MLP) is trained according to a recursive back-propagation (RBP) algorithm. The network nodes contain internal feedback paths and their connections are realized by means of IIR synaptic filters, which provide the LRNN with the necessary system state memory
Introducing nuclear power into currently non-nuclear states
International Nuclear Information System (INIS)
Gert, Claassen
2007-01-01
As the nuclear renaissance gains momentum, many countries that currently have no nuclear power plants will begin to consider introducing them. It is anticipated that smaller reactors such as the Pebble Bed Modular Reactor (PBMR) will not only be sold to current nuclear states to also to states where there is currently no nuclear experience. A range of issues would have to be considered for nuclear plants to be sold to non-nuclear states, such as the appropriate regulatory environment, standardization and codes, non-proliferation, security of supply, obtaining experienced merchant operators, appropriate financial structures and education and training. The paper considers nine major issues that need to be addressed by governments and vendors alike: 1) political enabling framework, 2) regulatory framework, 3) responsible owner, 4) responsible operator, 5) finance, 6) contact management, 7) fuel supply and waste management framework, 8) training and education, and 9) industrial infrastructure. International cooperation by organisations such as the IAEA, financial institutions and international suppliers will be required to ensure that developing countries as well as developed ones share the benefits of the nuclear renaissance. The opportunities that the nuclear industry affords to develop local skills, create job opportunities and to develop local manufacturing industries are among the important reasons that the South African Government has decided to support and fund the development of the Pebble Bed Modular Reactor project. (author)
International Nuclear Information System (INIS)
Zhang, Ping; Wang, Ningling; Lin, Xianhua; Jin, Li; Xu, Hong; Li, Rong; Huang, Hefeng
2016-01-01
Heterogeneous nuclear ribonucleoprotein K (hnRNP K), an evolutionarily conserved protein, is involved in several important cellular processes that are relevant to cell proliferation, differentiation, apoptosis, and cancer development. However, details of hnRNP K expression during mammalian oogenesis and preimplantation embryo development are lacking. The present study investigates the expression and cellular localization of K protein in the mouse ovaries and preimplantation embryos using immunostaining. We demonstrate, for the first time, that hnRNP K is abundantly expressed in the nuclei of mouse oocytes in primordial, primary and secondary follicles. In germ vesicle (GV)-stage oocytes, hnRNP K accumulates in the germinal vesicle in a spot distribution manner. After germinal vesicle breakdown, speckled hnRNP K is diffusely distributed in the cytoplasm. However, after fertilization, the K protein relocates into the female and male pronucleus and persists in the blastomere nuclei. Localization of K protein in the human ovary and ovarian granulosa cell tumor (GCT) was also investigated. Overall, this study provides important morphological evidence to better understand the possible roles of hnRNP K in mammalian oogenesis and early embryo development. - Highlights: • HnRNP K localizes in the nucleus of GV-stage oocyte in a punctate distribution. • HnRNP K strongly accumulates in zygotic pronuclei as condensed spots. • The localization of hnRNP K during oogenesis and embryogenesis is characteristic. • HnRNP K might have an important role in oogenesis and embryonic development.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Ping [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Wang, Ningling [Department of Assisted Reproduction, Shanghai Ninth People' s Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Lin, Xianhua; Jin, Li [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Xu, Hong, E-mail: xuhong1168@126.com [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Li, Rong [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China); Huang, Hefeng, E-mail: huanghefg@hotmail.com [The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai (China)
2016-02-26
Heterogeneous nuclear ribonucleoprotein K (hnRNP K), an evolutionarily conserved protein, is involved in several important cellular processes that are relevant to cell proliferation, differentiation, apoptosis, and cancer development. However, details of hnRNP K expression during mammalian oogenesis and preimplantation embryo development are lacking. The present study investigates the expression and cellular localization of K protein in the mouse ovaries and preimplantation embryos using immunostaining. We demonstrate, for the first time, that hnRNP K is abundantly expressed in the nuclei of mouse oocytes in primordial, primary and secondary follicles. In germ vesicle (GV)-stage oocytes, hnRNP K accumulates in the germinal vesicle in a spot distribution manner. After germinal vesicle breakdown, speckled hnRNP K is diffusely distributed in the cytoplasm. However, after fertilization, the K protein relocates into the female and male pronucleus and persists in the blastomere nuclei. Localization of K protein in the human ovary and ovarian granulosa cell tumor (GCT) was also investigated. Overall, this study provides important morphological evidence to better understand the possible roles of hnRNP K in mammalian oogenesis and early embryo development. - Highlights: • HnRNP K localizes in the nucleus of GV-stage oocyte in a punctate distribution. • HnRNP K strongly accumulates in zygotic pronuclei as condensed spots. • The localization of hnRNP K during oogenesis and embryogenesis is characteristic. • HnRNP K might have an important role in oogenesis and embryonic development.
Directory of Open Access Journals (Sweden)
Javed Iqbal Wattoo
2016-11-01
Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Directory of Open Access Journals (Sweden)
Jonathan Brassac
Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.
Pulse sequences and visualization of instruments
International Nuclear Information System (INIS)
Merkle, E.M.; Ulm Univ.; Wendt, M.; Chung, Y.C.; Duerk, J.L.; University Hospitals of Cleveland and Case Western Reserve University, OH; Lewin, J.S.
1998-01-01
While initially advocated primarily for intrasurgical visualization (e.g., craniotomy), interventional MRI rapidly evolved into roles in image-guided localization for needle-based procedures, minimally invasive neurosurgical procedures, and thermal ablation of cancer. In this contest, MRI pulse sequences and scanning methods serve one of four primary roles: (1) speed improvement, (2) device localization, (3) anatomy/lesion differentiation and (4) temperature sensitivity. The first part of this manuscript deals with passive visualization of MR-compatible needles and the effects of field strength, sequence design, and orientation of the needle relative to the static magnetic field of the scanner. Issues and recommendations are given for low-field as well as high-field scanners. The second part contains methods reported to achieve improved acquisition efficiency over conventional phase encoding (wavelets, locally focused imaging, singular value decomposition and keyhole imaging). Finally, the last part of the manuscrpt reports the current status of thermosensitive sequences and their dependence on spinlattice relaxation time (T1), water diffusion coefficient (D) and proton chemical shift (δ). (orig.) [de
International Nuclear Information System (INIS)
Finsterbusch, T.; Steinfeldt, T.; Caliskan, R.; Mankertz, A.
2005-01-01
Porcine circovirus type 1 (PCV1) encodes two major ORFs. The cap gene comprises the major structural protein of PCV, the rep gene specifies Rep and Rep', which are both essential for initiating the replication of the viral DNA. Rep corresponds to the full-length protein, whereas Rep' is a truncated splice product that is frame-shifted in its C-terminal sequence. In this study, the cellular localization of PCV1-encoded proteins was investigated by immune fluorescence techniques using antibodies against Rep, Rep' and Cap and by expression of viral proteins fused to green and red fluorescence proteins. Rep and Rep' protein co-localized in the nucleus of infected cells as well as in cells transfected with plasmids expressing Rep and Rep' fused to fluorescence proteins, but no signal was seen in the nucleoli. Rep and Rep' carry three potential nuclear localization signals in their identical N-termini, and the contribution of these motifs to nuclear import was experimentally dissected. In contrast to the rep gene products, the localization of the Cap protein varied. While the Cap protein was restricted to the nucleoli in plasmid-transfected cells and was also localized in the nucleoli at an early stage of PCV1 infection, it was seen in the nucleoplasm and the cytoplasm later in infection, suggesting that a shuttling between distinct cellular compartments occurs
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
Nuclear fuel rod loading apparatus
International Nuclear Information System (INIS)
King, H.B.
1981-01-01
A nuclear fuel loading apparatus, incorporating a microprocessor control unit, is described which automatically loads nuclear fuel pellets into dual fuel rods with a minimum of manual involvement and in a manner and sequence to ensure quality control and accuracy. (U.K.)
STELLAR: fast and exact local alignments
Directory of Open Access Journals (Sweden)
Weese David
2011-10-01
Full Text Available Abstract Background Large-scale comparison of genomic sequences requires reliable tools for the search of local alignments. Practical local aligners are in general fast, but heuristic, and hence sometimes miss significant matches. Results We present here the local pairwise aligner STELLAR that has full sensitivity for ε-alignments, i.e. guarantees to report all local alignments of a given minimal length and maximal error rate. The aligner is composed of two steps, filtering and verification. We apply the SWIFT algorithm for lossless filtering, and have developed a new verification strategy that we prove to be exact. Our results on simulated and real genomic data confirm and quantify the conjecture that heuristic tools like BLAST or BLAT miss a large percentage of significant local alignments. Conclusions STELLAR is very practical and fast on very long sequences which makes it a suitable new tool for finding local alignments between genomic sequences under the edit distance model. Binaries are freely available for Linux, Windows, and Mac OS X at http://www.seqan.de/projects/stellar. The source code is freely distributed with the SeqAn C++ library version 1.3 and later at http://www.seqan.de.
Energy Technology Data Exchange (ETDEWEB)
Eto, Masumi, E-mail: masumi.eto@jefferson.edu [Department of Molecular Physiology and Biophysics, and Kimmel Cancer Center, Thomas Jefferson University, 1020 Locust Street, PA 19107 (United States); Kirkbride, Jason A.; Chugh, Rishika; Karikari, Nana Kofi [Department of Molecular Physiology and Biophysics, and Kimmel Cancer Center, Thomas Jefferson University, 1020 Locust Street, PA 19107 (United States); Kim, Jee In [Department of Molecular Physiology and Biophysics, and Kimmel Cancer Center, Thomas Jefferson University, 1020 Locust Street, PA 19107 (United States); Cardiovascular Research Institute, Kyungpook National University School of Medicine, Daegu 700-422 (Korea, Republic of)
2013-04-26
Highlights: •Non-canonical roles of the myosin phosphatase inhibitor (CPI-17) were studied. •CPI-17 is localized in the nucleus of hyperplastic cancer and smooth muscle cells. •CPI-17 Ser12 phosphorylation may regulate the nuclear import. •CPI-17 regulates histone H3 phosphorylation and cell proliferation. •The nuclear CPI-17-PP1 axis plays a proliferative role in cells. -- Abstract: CPI-17 (C-kinase-activated protein phosphatase-1 (PP1) inhibitor, 17 kDa) is a cytoplasmic protein predominantly expressed in mature smooth muscle (SM) that regulates the myosin-associated PP1 holoenzyme (MLCP). Here, we show CPI-17 expression in proliferating cells, such as pancreatic cancer and hyperplastic SM cells. Immunofluorescence showed that CPI-17 was concentrated in nuclei of human pancreatic cancer (Panc1) cells. Nuclear accumulation of CPI-17 was also detected in the proliferating vascular SM cell culture and cells at neointima of rat vascular injury model. The N-terminal 21-residue tail domain of CPI-17 was necessary for the nuclear localization. Phospho-mimetic Asp-substitution of CPI-17 at Ser12 attenuated the nuclear import. CPI-17 phosphorylated at Ser12 was not localized at nuclei, suggesting a suppressive role of Ser12 phosphorylation in the nuclear import. Activated CPI-17 bound to all three isoforms of PP1 catalytic subunit in Panc1 nuclear extracts. CPI-17 knockdown in Panc1 resulted in dephosphorylation of histone H3 at Thr3, Ser10 and Thr11, whereas it had no effects on the phosphorylation of myosin light chain and merlin, the known targets of MLCP. In parallel, CPI-17 knockdown suppressed Panc1 proliferation. We propose that CPI-17 accumulated in the nucleus through the N-terminal tail targets multiple PP1 signaling pathways regulating cell proliferation.
Directory of Open Access Journals (Sweden)
Puchalski Bartosz
2015-12-01
Full Text Available In the paper, analysis of multi-region fuzzy logic controller with local PID controllers for steam generator of pressurized water reactor (PWR working in wide range of thermal power changes is presented. The U-tube steam generator has a nonlinear dynamics depending on thermal power transferred from coolant of the primary loop of the PWR plant. Control of water level in the steam generator conducted by a traditional PID controller which is designed for nominal power level of the nuclear reactor operates insufficiently well in wide range of operational conditions, especially at the low thermal power level. Thus the steam generator is often controlled manually by operators. Incorrect water level in the steam generator may lead to accidental shutdown of the nuclear reactor and consequently financial losses. In the paper a comparison of proposed multi region fuzzy logic controller and traditional PID controllers designed only for nominal condition is presented. The gains of the local PID controllers have been derived by solving appropriate optimization tasks with the cost function in a form of integrated squared error (ISE criterion. In both cases, a model of steam generator which is readily available in literature was used for control algorithms synthesis purposes. The proposed multi-region fuzzy logic controller and traditional PID controller were subjected to broad-based simulation tests in rapid prototyping software - Matlab/Simulink. These tests proved the advantage of multi-region fuzzy logic controller with local PID controllers over its traditional counterpart.
International Nuclear Information System (INIS)
Ito, Tatsuo; Kitamura, Haruka; Uwatoko, Chisana; Azumano, Makiko; Itoh, Kohji; Kuwahara, Jun
2010-01-01
Research highlights: → Sp1 zinc fingers themselves interact with importin α. → Sp1 zinc finger domains play an essential role as a nuclear localization signal. → Sp1 can be transported into the nucleus in an importin-dependent manner. -- Abstract: Transcription factor Sp1 is localized in the nucleus and regulates the expression of many cellular genes, but the nuclear transport mechanism of Sp1 is not well understood. In this study, we revealed that GST-fused Sp1 protein bound to endogenous importin α in HeLa cells via the Sp1 zinc finger domains, which comprise the DNA binding domain of Sp1. It was found that the Sp1 zinc finger domains directly interacted with a wide range of importin α including the armadillo (arm) repeat domain and the C-terminal acidic domain. Furthermore, it turned out that all three zinc fingers of Sp1 are essential for binding to importin α. Taken together, these results suggest that the Sp1 zinc finger domains play an essential role as a NLS and Sp1 can be transported into the nucleus in an importin-dependent manner even though it possesses no classical NLSs.
International Nuclear Information System (INIS)
Ohnishi, Teruaki
1998-01-01
The behavior of the secular variation of public opinion with respect to nuclear energy since 1973 was simulated by using an already developed mathematical model with the assumption that the public opinion, regardless of the local resident or of the average Japanese, has been subject almost solely to the quality and quantity of information by the newsmedia. The quality and quantity of nuclear information was assumed here to be measurable by the amount of information with positive or negative contents regarding the promotion of nuclear generation, which is released by the press, television and magazines. From the comparison of the quality and quantity of information by several newspapers, a major difference was found to exist between the information made by the press in the located region of nuclear station and the information by the national press, such that the former has released everyday information of both positive and negative contents for local residents with the amount several times higher than the latter. Model calculation showed that the attitude of local residents to nuclear energy is quite stable in time as compared to that of average Japanese. Such an essential difference of nuclear attitude between the local resident and the average Japanese became clear to originate from the above-cited difference of the characteristics of information between the local and national media. With the use of such model calculation as this, useful knowledge concerning the method of disclosure of nuclear information is expected to obtain. (author)
Entropic fluctuations in DNA sequences
Thanos, Dimitrios; Li, Wentian; Provata, Astero
2018-03-01
The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.
Consumption of locally grown foods by the populations residing near nuclear power stations
International Nuclear Information System (INIS)
Mathieu, P.Y.
1980-01-01
The studies carried out by the Geographical Institute of Aix-en-Provence and the B.E.G.E.A. are in three forms: the first studies the local rural production (farming, animal rearing and fishing); the second is concerned with the food intake of the population within a radius of 5 to 10 km around the site; the third consists in working out a soil utilization map covering an area of about 2500 hectares around the site in order to determine the agricultural and urban areas as well as the open spaces, and the exact sort of cultivation carried out, plot by plot. The map also represents all the phenomena concerning hydrography, irrigation, watering and the supply of potable water. All these studies concern only a few parishes and enable an accurate knowledge of the environment to be acquired. The food studies seek an order of magnitude of the amount of local produce consumed by the populations of the nuclear power station sites with a view to determining radioactive contamination levels. The results show the specific food consumption features of a population bearing the deep stamp of its environment and its rural origin [fr
Prediction of localization and interactions of apoptotic proteins
Directory of Open Access Journals (Sweden)
Matula Pavel
2009-07-01
Full Text Available Abstract During apoptosis several mitochondrial proteins are released. Some of them participate in caspase-independent nuclear DNA degradation, especially apoptosis-inducing factor (AIF and endonuclease G (endoG. Another interesting protein, which was expected to act similarly as AIF due to the high sequence homology with AIF is AIF-homologous mitochondrion-associated inducer of death (AMID. We studied the structure, cellular localization, and interactions of several proteins in silico and also in cells using fluorescent microscopy. We found the AMID protein to be cytoplasmic, most probably incorporated into the cytoplasmic side of the lipid membranes. Bioinformatic predictions were conducted to analyze the interactions of the studied proteins with each other and with other possible partners. We conducted molecular modeling of proteins with unknown 3D structures. These models were then refined by MolProbity server and employed in molecular docking simulations of interactions. Our results show data acquired using a combination of modern in silico methods and image analysis to understand the localization, interactions and functions of proteins AMID, AIF, endonuclease G, and other apoptosis-related proteins.
Accident sequence precursor events with age-related contributors
Energy Technology Data Exchange (ETDEWEB)
Murphy, G.A.; Kohn, W.E.
1995-12-31
The Accident Sequence Precursor (ASP) Program at ORNL analyzed about 14.000 Licensee Event Reports (LERs) filed by US nuclear power plants 1987--1993. There were 193 events identified as precursors to potential severe core accident sequences. These are reported in G/CR-4674. Volumes 7 through 20. Under the NRC Nuclear Plant Aging Research program, the authors evaluated these events to determine the extent to which component aging played a role. Events were selected that involved age-related equipment degradation that initiated an event or contributed to an event sequence. For the 7-year period, ORNL identified 36 events that involved aging degradation as a contributor to an ASP event. Except for 1992, the percentage of age-related events within the total number of ASP events over the 7-year period ({approximately}19%) appears fairly consistent up to 1991. No correlation between plant ape and number of precursor events was found. A summary list of the age-related events is presented in the report.
Spectral entropy criteria for structural segmentation in genomic DNA sequences
International Nuclear Information System (INIS)
Chechetkin, V.R.; Lobzin, V.V.
2004-01-01
The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions
International Nuclear Information System (INIS)
Lewis, Chris; McRoberts, Doug
2002-01-01
Tip O'Neill, one of the grand old men of modem US politics, once famously remarked that all politics is local. Like most politicians who succeed on the national stage - and not just in the US - it was a truth he never lost sight of. What is true for politicians is equally true in the communications business. We may increasingly live in a global village, but successful companies - even multi-nationals - forget the importance of local and regional public relations at their peril. Think of Douglas Ivester, the CEO of Coca-Cola at the time of the 1999 Belgian contamination scandal, who allegedly reacted to first reports of the crisis by asking: 'Where the hell is Belgium?' A more appropriate question today - several years after Coke's share price toppled and the CEO was unceremoniously sacked - might be: 'Who the hell is Douglas Nester?' But - to adapt another famous phrase - the fact that communications (and marketing) professionals still need to 'act local' as much as ever before should not blind us to the growing need to 'think global'. In the nuclear industry, as in the world economy generally, increasing global integration is a reality, as are the international nature of the news media and the increasingly global nature of the anti-nuclear pressure groups. Indeed, it was the growing need for a truly global information network to counter these trends, by increasing the overall speed and accuracy of the worldwide nuclear information flow, that led the nuclear community to establish NucNet in 1991. So where exactly is the line between local and regional nuclear communications on the one hand, and global communications on the other? Is there one spin for a regional audience, and another for a global audience? This presentation proposes some guiding principles, by examining the response of nuclear communicators world-wide to the new communications agenda imposed in the wake of the September 11th suicide attacks in the US. NucNet President Doug McRoberts and Executive
A R54L mutation of CRYAA associated with autosomal dominant nuclear cataracts in a Chinese family.
Yang, Zhenfei; Su, Dongmei; Li, Qian; Ma, Zicheng; Yang, Fan; Zhu, Siquan; Ma, Xu
2013-12-01
To identify the genetic defect in a three-generation Chinese family with congenital cataracts. The phenotype of a three-generation Chinese family with congenital cataract was recruited. Detailed family history and clinical data of the family were recorded. Candidate genes sequencing was performed to screen out the disease-causing mutation. Bioinformatics analysis was performed to predict the function of mutant gene. The phenotype of the family was identified as nuclear cataract. Direct sequencing revealed a c.161 G > T transversion in exon 1 of crystallin alpha-A (CRYAA). This mutation co-segregated with all affected individuals in the family and was not found in unaffected family members nor in the 100 unrelated controls. Bioinformatics analysis indicated that the 54th amino acid position was highly conserved and the mutation R54L caused an increase of local hydrophobicity around the substitution site. This study identified a novel disease-causing mutation c.161 G > T (p.R54L) in CRYAA in a Chinese family with autosomal dominant nuclear cataracts, this is the first report relating a G > T mutation in CRYAA leading to congenital nuclear cataract.
Tengs, T; Bowers, H A; Ziman, A P; Stoecker, D K; Oldach, D W
2001-02-01
Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtained from several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses and comparison of sequences indicate that the chloroplast sequences show a higher degree of sequence divergence than the nuclear homologue. The chloroplast sequences were chosen as targets for the development of a 5'--3' exonuclease assay for detection of the organism. The assay has a very high degree of specificity and has been used to screen environmental water samples from a fish farm where the presence of this dinoflagellate species has previously been associated with fish kills. Various hypotheses for the derived nature of the chloroplast sequences are discussed, as well as what is known about the toxicity of the species.
Directory of Open Access Journals (Sweden)
Maíra C. M. Freire
2008-01-01
Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.
González-Weil, C.; Merino-Rubilar, C.; Ahumada, G.; Arenas, A.; Salinas, V.; Bravo, P.
2014-01-01
The present work arises from the need to reform Science Education, particularly through the contextualization of teaching. It is proposed to achieve this through the use of local territory as a resource for the design of teaching-learning-sequences (TLS). To do this, an interdisciplinary group of researchers and teachers from a Secondary School created a Professional Circle for Reflection on Teaching, which constructed an emerging conceptualization of Territory, analyzed the possibil...
Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle
2016-06-01
Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree
International Nuclear Information System (INIS)
Couto, A.J.; Perez, S.S.
1987-01-01
This work is part of a study on the service water systems of the Embalse nuclear power plant from a safety point of view. The faults of service water systems of high and low pressure that can lead to situations threatening the plant safety were analyzed in a previous report. The event 'total loss of low pressure service water' causes the largest number of such conditions. Such event is an operational incident that can lead to an accident situation due to faults in the required process systems or by omission of a procedure. The annual frequency of the event 'total loss of low pressure service water' is calculated. The main contribution comes from pump failure. The evaluation of the accident sequences shows that the most direct way to the liberation of fission products is the loss of steam generators as heat sink. The contributions to small and large LOCA and electric supply loss are analyzed. The sequence that leads to tritium release through boiling of moderator is also evaluated. (Author)
International Nuclear Information System (INIS)
Layral, S.I.
1987-01-01
The aim of this study was to perform for the Embalse nuclear power plant, a probabilistic evaluation of loss-of-coolant accidents (LOCA) to identify the risks associated with them and to determine their acceptability in accordance with norms. This study includes all ruptures in the primary system that produce the automatic activation of 'emergency core cooling system'. Three starting events were selected for the probabilistic evaluation: 100% rupture of an input collector; 5% rupture of an input collector; 1.2% rupture of an input collector. At this stage the evaluation is focussed on the identification and quantization of the main failure sequences that follow a LOCA and lead to an uncontrolled reactor state or 'core meltdown'. The most important contribution to the core meltdown due to LOCA is the failure of supplies that are required for the emergency core cooling system. (Author)
Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo
2014-01-01
Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.
Directory of Open Access Journals (Sweden)
Zhaoshan Wang
Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.
Localization of the CAPRICE-ENHANCER OF TRY AND CPC1 chimera protein in Arabidopsis root epidermis.
Tominaga-Wada, Rumi; Kurata, Tetsuya; Wada, Takuji
2017-09-01
The CAPRICE (CPC) encodes an R3-type MYB transcription factor, which promotes root-hair differentiation. Previously, we showed that the CPC protein moves from the non-hair cell to the neighboring cell and induces root-hair differentiation in Arabidopsis. In addition, we proposed two cell-to-cell movement signal sequences, S1 and S2, in CPC. However, an S1:2xGFP:S2 chimera protein did not move between root epidermal cells. Here, we show that the S1 and S2 sequences do not confer cell-to-cell movement or nuclear localization ability to a GFP protein. The ENHANCER OF TRY AND CPC1 (ETC1) gene encodes the CPC homolog R3 MYB; this protein does not possess cell-to-cell movement ability or the S1 sequence. To elucidate whether the S1 sequence can induce cell-to-cell movement ability in ETC1, CPCp:S1:ETC1:2xGFP was constructed and introduced into Arabidopsis. Our results indicate that the addition of the S1 sequence was not sufficient for ETC1 to acquire cell-to-cell movement ability.
Gerbi, Susan A.; Lange, Thilo Sascha
2002-01-01
Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120
Benefits and challenges of localization
International Nuclear Information System (INIS)
Nowak, Martin
2009-01-01
One of the CANDU pressurized heavy water reactor's principal design features is its simple modular construction. This feature is suited particularly well for localization and offers a good opportunity to further develop an existing national nuclear industry or as in the case of Romania, establish new nuclear enterprises. When the first commercial 540 MW multi-unit CANDU reactors entered service in 1971, Canada's population of less than 24 million supported only a 'medium' level of industrial development and therefore lacked the heavy industrial capabilities of larger countries and regions such as the USA, Japan and Europe. A key motivation for the government of Canada in developing the CANDU design was to ensure that it would have the autonomous capacity to build and operate nuclear power reactors without depending on foreign sources for key components and supply of enriched uranium. Further examples of successful CANDU technology localization include India, which achieved almost complete localization of the 220 MW CANDU Prototype design in the early 1970s as well as Korea where AECL transferred the CANDU 6 700 MWe reactor design and manufacturing technology enabling the Koreans to supply over 75% of equipment for the fourth unit. In China on the Qinshan Phase 3 CANDU Nuclear Power Plant, Chinese contractors performed most of the construction and AECL has arranged for the transfer of full CANDU fuel processing and fabrication technology. As indicated one of the primary benefits realized from localization has been the creation of a nuclear power program that enables a recipient country in the pursuit of an independent national energy strategy. While a secondary benefit is the generation of wealth and economic activity in countries with strong indigenous nuclear equipment manufacturing capability. (author)
Absolute nuclear material assay
Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA
2010-07-13
A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.
A software pipeline for processing and identification of fungal ITS sequences
Directory of Open Access Journals (Sweden)
Kristiansson Erik
2009-01-01
Full Text Available Abstract Background Fungi from environmental samples are typically identified to species level through DNA sequencing of the nuclear ribosomal internal transcribed spacer (ITS region for use in BLAST-based similarity searches in the International Nucleotide Sequence Databases. These searches are time-consuming and regularly require a significant amount of manual intervention and complementary analyses. We here present software – in the form of an identification pipeline for large sets of fungal ITS sequences – developed to automate the BLAST process and several additional analysis steps. The performance of the pipeline was evaluated on a dataset of 350 ITS sequences from fungi growing as epiphytes on building material. Results The pipeline was written in Perl and uses a local installation of NCBI-BLAST for the similarity searches of the query sequences. The variable subregion ITS2 of the ITS region is extracted from the sequences and used for additional searches of higher sensitivity. Multiple alignments of each query sequence and its closest matches are computed, and query sequences sharing at least 50% of their best matches are clustered to facilitate the evaluation of hypothetically conspecific groups. The pipeline proved to speed up the processing, as well as enhance the resolution, of the evaluation dataset considerably, and the fungi were found to belong chiefly to the Ascomycota, with Penicillium and Aspergillus as the two most common genera. The ITS2 was found to indicate a different taxonomic affiliation than did the complete ITS region for 10% of the query sequences, though this figure is likely to vary with the taxonomic scope of the query sequences. Conclusion The present software readily assigns large sets of fungal query sequences to their respective best matches in the international sequence databases and places them in a larger biological context. The output is highly structured to be easy to process, although it still needs
Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp
2017-02-01
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).
Choe, Keith P; Kato, Akira; Hirose, Shigehisa; Plata, Consuelo; Sindic, Aleksandra; Romero, Michael F; Claiborne, J B; Evans, David H
2005-11-01
In mammals, the Na+/H+ exchanger 3 (NHE3) is expressed with Na+/K+-ATPase in renal proximal tubules, where it secretes H+ and absorbs Na+ to maintain blood pH and volume. In elasmobranchs (sharks, skates, and stingrays), the gills are the dominant site of pH and osmoregulation. This study was conducted to determine whether epithelial NHE homologs exist in elasmobranchs and, if so, to localize their expression in gills and determine whether their expression is altered by environmental salinity or hypercapnia. Degenerate primers and RT-PCR were used to deduce partial sequences of mammalian NHE2 and NHE3 homologs from the gills of the euryhaline Atlantic stingray (Dasyatis sabina). Real-time PCR was then used to demonstrate that mRNA expression of the NHE3 homolog increased when stingrays were transferred to low salinities but not during hypercapnia. Expression of the NHE2 homolog did not change with either treatment. Rapid amplification of cDNA was then used to deduce the complete sequence of a putative NHE3. The 2,744-base pair cDNA includes a coding region for a 2,511-amino acid protein that is 70% identical to human NHE3 (SLC9A3). Antisera generated against the carboxyl tail of the putative stingray NHE3 labeled the apical membranes of Na+/K+-ATPase-rich epithelial cells, and acclimation to freshwater caused a redistribution of labeling in the gills. This study provides the first NHE3 cloned from an elasmobranch and is the first to demonstrate an increase in gill NHE3 expression during acclimation to low salinities, suggesting that NHE3 can absorb Na+ from ion-poor environments.
Tau regulates the subcellular localization of calmodulin
Energy Technology Data Exchange (ETDEWEB)
Barreda, Elena Gomez de [Centro de Biologia Molecular ' Severo Ochoa' , CSIC/UAM, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Avila, Jesus, E-mail: javila@cbm.uam.es [Centro de Biologia Molecular ' Severo Ochoa' , CSIC/UAM, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); CIBER de Enfermedades Neurodegenerativas, 28031 Madrid (Spain)
2011-05-13
Highlights: {yields} In this work we have tried to explain how a cytoplasmic protein could regulate a cell nuclear function. We have tested the role of a cytoplasmic protein (tau) in regulating the expression of calbindin gene. We found that calmodulin, a tau-binding protein with nuclear and cytoplasmic localization, increases its nuclear localization in the absence of tau. Since nuclear calmodulin regulates calbindin expression, a decrease in nuclear calmodulin, due to the presence of tau that retains it at the cytoplasm, results in a change in calbindin expression. -- Abstract: Lack of tau expression in neuronal cells results in a change in the expression of few genes. However, little is known about how tau regulates gene expression. Here we show that the presence of tau could alter the subcellular localization of calmodulin, a protein that could be located at the cytoplasm or in the nucleus. Nuclear calmodulin binds to co-transcription factors, regulating the expression of genes like calbindin. In this work, we have found that in neurons containing tau, a higher proportion of calmodulin is present in the cytoplasm compared with neurons lacking tau and that an increase in cytoplasmic calmodulin correlates with a higher expression of calbindin.
Tau regulates the subcellular localization of calmodulin
International Nuclear Information System (INIS)
Barreda, Elena Gomez de; Avila, Jesus
2011-01-01
Highlights: → In this work we have tried to explain how a cytoplasmic protein could regulate a cell nuclear function. We have tested the role of a cytoplasmic protein (tau) in regulating the expression of calbindin gene. We found that calmodulin, a tau-binding protein with nuclear and cytoplasmic localization, increases its nuclear localization in the absence of tau. Since nuclear calmodulin regulates calbindin expression, a decrease in nuclear calmodulin, due to the presence of tau that retains it at the cytoplasm, results in a change in calbindin expression. -- Abstract: Lack of tau expression in neuronal cells results in a change in the expression of few genes. However, little is known about how tau regulates gene expression. Here we show that the presence of tau could alter the subcellular localization of calmodulin, a protein that could be located at the cytoplasm or in the nucleus. Nuclear calmodulin binds to co-transcription factors, regulating the expression of genes like calbindin. In this work, we have found that in neurons containing tau, a higher proportion of calmodulin is present in the cytoplasm compared with neurons lacking tau and that an increase in cytoplasmic calmodulin correlates with a higher expression of calbindin.
International Nuclear Information System (INIS)
1981-01-01
There is a rich mixture of formal and informal approaches being used in our sister nuclear democracies in their attempts to deal with the difficulties in obtaining local siting acceptance of national waste management facilities. Some of these are meeting with a degree of success not yet achieved in the US. Although this survey documents and assesses many of these approaches, the scope of the study did not include an assessment of their relevance to common problems in the US. It would appear that in addition to a periodic updating of the approaches and progress of other countries in dealing with the siting of nuclear waste facilities, an assessment of the applicability of the more successful of these approaches to the US political system could make good use of the information developed in the preparation of this report
Localization of Non-Linearly Modeled Autonomous Mobile Robots Using Out-of-Sequence Measurements
Directory of Open Access Journals (Sweden)
Jesus M. de la Cruz
2012-02-01
Full Text Available This paper presents a state of the art of the estimation algorithms dealing with Out-of-Sequence (OOS measurements for non-linearly modeled systems. The state of the art includes a critical analysis of the algorithm properties that takes into account the applicability of these techniques to autonomous mobile robot navigation based on the fusion of the measurements provided, delayed and OOS, by multiple sensors. Besides, it shows a representative example of the use of one of the most computationally efficient approaches in the localization module of the control software of a real robot (which has non-linear dynamics, and linear and non-linear sensors and compares its performance against other approaches. The simulated results obtained with the selected OOS algorithm shows the computational requirements that each sensor of the robot imposes to it. The real experiments show how the inclusion of the selected OOS algorithm in the control software lets the robot successfully navigate in spite of receiving many OOS measurements. Finally, the comparison highlights that not only is the selected OOS algorithm among the best performing ones of the comparison, but it also has the lowest computational and memory cost.
Maurer-Alcalá, Xyrus X; Katz, Laura A
2016-06-08
The relationship between nuclear architecture and patterns of molecular evolution in lineages across the eukaryotic tree of life is not well understood, partly because molecular evolution is traditionally explored as changes in base pairs along a linear sequence without considering the context of nuclear position of chromosomes. The ciliate Chilodonella uncinata is an ideal system to address the relationship between nuclear architecture and patterns of molecular evolution as the somatic macronucleus of this ciliate is composed of a peripheral DNA-rich area (orthomere) and a DNA-poor central region (paramere) to form a "heteromeric" macronucleus. Moreover, because the somatic chromosomes of C. uncinata are highly processed into "gene-sized" chromosomes (i.e., nanochromosomes), we can assess fine-scale relationships between location and sequence evolution. By combining fluorescence microscopy and analyses of transcriptome data from C. uncinata, we find that highly expressed genes have the greatest codon usage bias and are enriched in DNA-poor regions. In contrast, genes with less biased sequences tend to be concentrated in DNA abundant areas, at least during vegetative growth. Our analyses are consistent with recent work in plants and animals where nuclear architecture plays a role in gene expression. At the same time, the unusual localization of nanochromosomes suggests that the highly structured nucleus in C. uncinata may create a "gene bank" that facilitates rapid changes in expression of genes required only in specific life history stages. By using "nonmodel" organisms like C. uncinata, we can explore the universality of eukaryotic features while also providing examples of novel properties (i.e., the presence of a gene bank) that build from these features. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Studies on the intracellular localization of hHR23B
International Nuclear Information System (INIS)
Katiyar, Samiksha; Lennarz, William J.
2005-01-01
Yeast Rad23, originally identified as a DNA repair protein, has been proposed to participate in other cellular functions, i.e., the proteasome-degradation pathway, the process of spindle pole body duplication and as a component of the anaphase checkpoint. Two human homologs of yeast Rad23, hHR23A and hHR23B, exhibit high sequence homology with yRad23 and also have been shown to be involved in DNA repair and proteasome-dependent degradation. Previous studies on the intracellular localization of hHR23A and hHR23B revealed their predominant localization in the nucleus during interphase and in the cytoplasm during mitosis. We have analyzed the localization of hHR23B during all the phases of the cell cycle using immunofluorescence. Unlike previous studies, our results suggest localization of hHR23B in the nucleus as well as in the cytoplasm during G1 phase. The nuclear levels of hHR23B decrease during S-phase of the cell cycle. When the cell enters mitosis, hHR23B relocalizes in the cytoplasm without association with chromatin. These results indicate that the intracellular distribution hHR23B is cell cycle dependent
The SAMI Galaxy Survey: spatially resolving the main sequence of star formation
Medling, Anne M.; Cortese, Luca; Croom, Scott M.; Green, Andrew W.; Groves, Brent; Hampton, Elise; Ho, I.-Ting; Davies, Luke J. M.; Kewley, Lisa J.; Moffett, Amanda J.; Schaefer, Adam L.; Taylor, Edward; Zafar, Tayyaba; Bekki, Kenji; Bland-Hawthorn, Joss; Bloom, Jessica V.; Brough, Sarah; Bryant, Julia J.; Catinella, Barbara; Cecil, Gerald; Colless, Matthew; Couch, Warrick J.; Drinkwater, Michael J.; Driver, Simon P.; Federrath, Christoph; Foster, Caroline; Goldstein, Gregory; Goodwin, Michael; Hopkins, Andrew; Lawrence, J. S.; Leslie, Sarah K.; Lewis, Geraint F.; Lorente, Nuria P. F.; Owers, Matt S.; McDermid, Richard; Richards, Samuel N.; Sharp, Robert; Scott, Nicholas; Sweet, Sarah M.; Taranu, Dan S.; Tescari, Edoardo; Tonini, Chiara; van de Sande, Jesse; Walcher, C. Jakob; Wright, Angus
2018-04-01
We present the ˜800 star formation rate maps for the Sydney-AAO Multi-object Integral field spectrograph (SAMI) Galaxy Survey based on H α emission maps, corrected for dust attenuation via the Balmer decrement, that are included in the SAMI Public Data Release 1. We mask out spaxels contaminated by non-stellar emission using the [O III]/H β, [N II]/H α, [S II]/H α, and [O I]/H α line ratios. Using these maps, we examine the global and resolved star-forming main sequences of SAMI galaxies as a function of morphology, environmental density, and stellar mass. Galaxies further below the star-forming main sequence are more likely to have flatter star formation profiles. Early-type galaxies split into two populations with similar stellar masses and central stellar mass surface densities. The main-sequence population has centrally concentrated star formation similar to late-type galaxies, while galaxies >3σ below the main sequence show significantly reduced star formation most strikingly in the nuclear regions. The split populations support a two-step quenching mechanism, wherein halo mass first cuts off the gas supply and remaining gas continues to form stars until the local stellar mass surface density can stabilize the reduced remaining fuel against further star formation. Across all morphologies, galaxies in denser environments show a decreased specific star formation rate from the outside in, supporting an environmental cause for quenching, such as ram-pressure stripping or galaxy interactions.
Energy Technology Data Exchange (ETDEWEB)
Okada, Masashi; Hozumi, Yasukazu [Department of Anatomy and Cell Biology, Yamagata University School of Medicine, Yamagata 990-9585 (Japan); Ichimura, Tohru [Department of Chemistry, Graduate School of Sciences and Engineering, Tokyo Metropolitan University, Hachioji 192-0397 (Japan); Tanaka, Toshiaki; Hasegawa, Hiroshi; Yamamoto, Masakazu; Takahashi, Nobuya [Department of Anatomy and Cell Biology, Yamagata University School of Medicine, Yamagata 990-9585 (Japan); Iseki, Ken [Department of Emergency and Critical Care Medicine, Yamagata University School of Medicine, Yamagata 990-9585 (Japan); Yagisawa, Hitoshi [Laboratory of Biological Signaling, Graduate School of Life Science, University of Hyogo, Hyogo 678-1297 (Japan); Shinkawa, Takashi; Isobe, Toshiaki [Department of Chemistry, Graduate School of Sciences and Engineering, Tokyo Metropolitan University, Hachioji 192-0397 (Japan); Goto, Kaoru, E-mail: kgoto@med.id.yamagata-u.ac.jp [Department of Anatomy and Cell Biology, Yamagata University School of Medicine, Yamagata 990-9585 (Japan)
2011-12-10
Diacylglycerol kinase (DGK) is involved in the regulation of lipid-mediated signal transduction through the metabolism of a second messenger diacylglycerol. Of the DGK family, DGK{zeta}, which contains a nuclear localization signal, localizes mainly to the nucleus but translocates to the cytoplasm under pathological conditions. However, the detailed mechanism of translocation and its functional significance remain unclear. To elucidate these issues, we used a proteomic approach to search for protein targets that interact with DGK{zeta}. Results show that nucleosome assembly protein (NAP) 1-like 1 (NAP1L1) and NAP1-like 4 (NAP1L4) are identified as novel DGK{zeta} binding partners. NAP1Ls constitutively shuttle between the nucleus and the cytoplasm in transfected HEK293 cells. The molecular interaction of DGK{zeta} and NAP1Ls prohibits nuclear import of DGK{zeta} because binding of NAP1Ls to DGK{zeta} blocks import carrier proteins, Qip1 and NPI1, to interact with DGK{zeta}, leading to cytoplasmic tethering of DGK{zeta}. In addition, overexpression of NAP1Ls exerts a protective effect against doxorubicin-induced cytotoxicity. These findings suggest that NAP1Ls are involved in a novel molecular basis for the regulation of nucleocytoplasmic shuttling of DGK{zeta} and provide a clue to examine functional significance of its translocation under pathological conditions.
Cao, Wuteng; Li, Fangqian; Gong, Jiaying; Liu, Dechao; Deng, Yanhong; Kang, Liang; Zhou, Zhiyang
2016-11-22
To investigate the efficacy of liver acquisition with acceleration volume acquisition (LAVA) gadolinium-enhanced magnetic resonance (MR) sequences and to assess its added accuracy in diagnosing local recurrence (LR) of rectal cancer with conventional T2-weighted fast spin echo (FSE) sequences. Pelvic MRI, including T2-weighted FSE sequences, gadolinium-enhanced sequences of LAVA and T1-weighted FSE with fat suppression, was performed on 225 patients with postoperative rectal cancer. Two readers evaluated the presence of LR according to "T2" (T2 sequences only), "T2 + LAVA-Gad" (LAVA and T2 imaging), and "T2 + T1-fs-Gad" (T1 fat suppression-enhanced sequence with T2 images). To evaluate diagnostic efficiency, imaging quality with LAVA and T1-fs-Gad by subjective scores and the signal intensity (SI) ratio. In the result, the SI ratio of LAVA was significantly higher than that of T1-fs-Gad (p = 0.0001). The diagnostic efficiency of "T2 + LAVA-Gad" was better than that of "T2 + T1-fs-Gad" (p = 0.0016 for Reader 1, p = 0.0001 for Reader 2) and T2 imaging only (p = 0.0001 for Reader 1; p = 0.0001 for Reader 2). Therefore, LAVA gadolinium-enhanced MR increases the accuracy of diagnosis of LR from rectal cancer and could replace conventional T1 gadolinium-enhanced sequences in the postoperative pelvic follow-up of rectal cancer.
Conformational determinants of the intracellular localization of midkine
International Nuclear Information System (INIS)
Dai Lichen; Xu, Diyong; Yao Xing; Lu Yongliang; Xu Zhengping
2005-01-01
Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize to the nucleus and nucleolus, however, the data are not consistent and the signals responsible for the localization are unknown. Here we reported that human MK exclusively localized to the nucleus and nucleolus in HepG2 cells by using GFP as a tracking molecule. In order to identify the motifs required for the nuclear localization and nucleolar accumulation, point- and deletion-mutations were introduced and the corresponding subcellular localizations were analyzed. Data revealed that (i) K79R81, K86K87, and the C-terminal tail of MK constitute the nuclear localization determinant of MK, and (ii) the C-terminal tail is the key element controlling MK nucleolar accumulation though the N-terminal tail, K79R81, and K86K87 also contribute to this process. Taken together, our results provide the first documentation about the determinants required for MK nuclear and nucleolar localization
Anti-nuclear activities and critics concerning nuclear power plant sites
International Nuclear Information System (INIS)
Rhee, We-Beg
2000-01-01
Korea has dynamic nuclear power expansion programs, operating 16 nuclear units producing 13710 MW in total located on 4 different sites. Last year, nuclear power supplied over 40 % of national total electricity demands. In 1998, Korean government initiated re-designation work investigating circumstance changes to rule out the unnecessary sites in consideration of a long-term power supply. Korean government has determined to expand the Ulchin site and to designate one point of Woolju county as a new candidate site, and ruled out the rest candidate sites at the end of 1998. About such a governmental measure, the two areas show different reactions. Ulchin where nuclear power plant has been operated safely for about 10 years was likely to accept the governmental determination in spite of some opposition and called for several financial supports for local development. WooIju county, however, showed a strong opposition among local environmental groups and autonomous politicians, and they presented a variety of anti-nuclear activities including demonstrations mainly at the neighbouring metropolis, Ulsan city
Dynes, Joseph L; Xu, Shuping; Bothner, Sarah; Lahti, Jill M; Hori, Roderick T
2004-03-01
The protein complex Selectivity Factor 1, composed of TBP, TAF(I)48, TAF(I)63 and TAF(I)110, is required for rRNA transcription by RNA polymerase I in the nucleolus. The steps involved in targeting Selectivity Factor 1 will be dependent on the transport pathways that are used and the localization signals that direct this trafficking. In order to investigate these issues, we characterized human TAF(I)48, a subunit of Selectivity Factor 1. By domain analysis of TAF(I)48, the carboxyl-terminal 51 residues were found to be required for the localization of TAF(I)48, as well as sufficient to direct Green Fluorescent Protein to the nucleus and nucleolus. The carboxyl-terminus of TAF(I)48 also has the ability to associate with multiple members of the beta-karyopherin family of nuclear import receptors, including importin beta (karyopherin beta1), transportin (karyopherin beta2) and RanBP5 (karyopherin beta3), in a Ran-dependent manner. This property of interacting with multiple beta-karyopherins has been previously reported for the nuclear localization signals of some ribosomal proteins that are likewise directed to the nucleolus. This study identifies the first nuclear import sequence identified within the TBP-Associated Factor subunits of Selectivity Factor 1.
Nuclear DNA sequences from the Middle Pleistocene Sima de los Huesos hominins.
Meyer, Matthias; Arsuaga, Juan-Luis; de Filippo, Cesare; Nagel, Sarah; Aximu-Petri, Ayinuer; Nickel, Birgit; Martínez, Ignacio; Gracia, Ana; Bermúdez de Castro, José María; Carbonell, Eudald; Viola, Bence; Kelso, Janet; Prüfer, Kay; Pääbo, Svante
2016-03-24
A unique assemblage of 28 hominin individuals, found in Sima de los Huesos in the Sierra de Atapuerca in Spain, has recently been dated to approximately 430,000 years ago. An interesting question is how these Middle Pleistocene hominins were related to those who lived in the Late Pleistocene epoch, in particular to Neanderthals in western Eurasia and to Denisovans, a sister group of Neanderthals so far known only from southern Siberia. While the Sima de los Huesos hominins share some derived morphological features with Neanderthals, the mitochondrial genome retrieved from one individual from Sima de los Huesos is more closely related to the mitochondrial DNA of Denisovans than to that of Neanderthals. However, since the mitochondrial DNA does not reveal the full picture of relationships among populations, we have investigated DNA preservation in several individuals found at Sima de los Huesos. Here we recover nuclear DNA sequences from two specimens, which show that the Sima de los Huesos hominins were related to Neanderthals rather than to Denisovans, indicating that the population divergence between Neanderthals and Denisovans predates 430,000 years ago. A mitochondrial DNA recovered from one of the specimens shares the previously described relationship to Denisovan mitochondrial DNAs, suggesting, among other possibilities, that the mitochondrial DNA gene pool of Neanderthals turned over later in their history.
Conditionally controlling nuclear trafficking in yeast by chemical-induced protein dimerization.
Xu, Tao; Johnson, Cole A; Gestwicki, Jason E; Kumar, Anuj
2010-11-01
We present here a protocol to conditionally control the nuclear trafficking of target proteins in yeast. In this system, rapamycin is used to heterodimerize two chimeric proteins. One chimera consists of a FK506-binding protein (FKBP12) fused to a cellular 'address' (nuclear localization signal or nuclear export sequence). The second chimera consists of a target protein fused to a fluorescent protein and the FKBP12-rapamycin-binding (FRB) domain from FKBP-12-rapamycin associated protein 1 (FRAP1, also known as mTor). Rapamycin induces dimerization of the FKBP12- and FRB-containing chimeras; these interactions selectively place the target protein under control of the cell address, thereby directing the protein into or out of the nucleus. By chemical-induced dimerization, protein mislocalization is reversible and enables the identification of conditional loss-of-function and gain-of-function phenotypes, in contrast to other systems that require permanent modification of the targeted protein. Yeast strains for this analysis can be constructed in 1 week, and the technique allows protein mislocalization within 15 min after drug treatment.
Directory of Open Access Journals (Sweden)
Ji-Yong An
2016-01-01
Full Text Available We propose a novel computational method known as RVM-LPQ that combines the Relevance Vector Machine (RVM model and Local Phase Quantization (LPQ to predict PPIs from protein sequences. The main improvements are the results of representing protein sequences using the LPQ feature representation on a Position Specific Scoring Matrix (PSSM, reducing the influence of noise using a Principal Component Analysis (PCA, and using a Relevance Vector Machine (RVM based classifier. We perform 5-fold cross-validation experiments on Yeast and Human datasets, and we achieve very high accuracies of 92.65% and 97.62%, respectively, which is significantly better than previous works. To further evaluate the proposed method, we compare it with the state-of-the-art support vector machine (SVM classifier on the Yeast dataset. The experimental results demonstrate that our RVM-LPQ method is obviously better than the SVM-based method. The promising experimental results show the efficiency and simplicity of the proposed method, which can be an automatic decision support tool for future proteomics research.
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
Oda, Yoshinao; Ohishi, Yoshihiro; Basaki, Yuji; Kobayashi, Hiroaki; Hirakawa, Toshio; Wake, Norio; Ono, Mayumi; Nishio, Kazuto; Kuwano, Michihiko; Tsuneyoshi, Masazumi
2007-07-01
The nuclear localization of Y-box-binding protein-1 (YB-1) is known to be a poor prognostic factor in several human malignancies, including ovarian carcinoma. Following on from our basic study dealing with microarray analyses of YB-1-associated gene expression in ovarian cancer cells, we examined whether nuclear localization of YB-1 is associated with the expression of CXCR4, a vault protein named lung resistance-related vault protein (LRP/MVP), phosphorylated Akt (p-Akt) or P-glycoprotein (P-gp) in human ovarian carcinoma. Fifty-three surgically resected ovarian carcinomas treated with paclitaxel and carboplatin were examined immunohistochemically for nuclear YB-1 expression and intrinsic expression of p-Akt, P-gp, LRP/MVP and CXCR4. Nuclear expression of YB-1 demonstrated significant correlation with p-Akt, P-gp and LRP expression, but no relationship with CXCR4 expression. By multivariate analysis, only YB-1 nuclear expression and CXCR4 expression were independent prognostic factors with regard to overall survival. These results indicate that YB-1 nuclear expression and CXCR4 expression are important prognostic factors in ovarian carcinoma.
Nuclear localization of Annexin A7 during murine brain development
Directory of Open Access Journals (Sweden)
Noegel Angelika A
2005-04-01
Full Text Available Abstract Background Annexin A7 is a member of the annexin protein family, which is characterized by its ability to interact with phospholipids in the presence of Ca2+-ions and which is thought to function in Ca2+-homeostasis. Results from mutant mice showed altered Ca2+-wave propagation in astrocytes. As the appearance and distribution of Annexin A7 during brain development has not been investigated so far, we focused on the distribution of Annexin A7 protein during mouse embryogenesis in the developing central nervous system and in the adult mouse brain. Results Annexin A7 is expressed in cells of the developing brain where a change in its subcellular localization from cytoplasm to nucleus was observed. In the adult CNS, the subcellular distribution of Annexin A7 depends on the cell type. By immunohistochemistry analysis Annexin A7 was detected in the cytosol of undifferentiated cells at embryonic days E5–E8. At E11–E15 the protein is still present in the cytosol of cells predominantly located in the ventricular germinative zone surrounding the lateral ventricle. Later on, at embryonic day E16, Annexin A7 in cells of the intermediate and marginal zone of the neopallium translocates to the nucleus. Neuronal cells of all areas in the adult brain present Annexin A7 in the nucleus, whereas glial fibrillary acidic protein (GFAP-positive astrocytes exhibit both, a cytoplasmic and nuclear staining. The presence of nuclear Annexin A7 was confirmed by extraction of the nucleoplasm from isolated nuclei obtained from neuronal and astroglial cell lines. Conclusion We have demonstrated a translocation of Annexin A7 to nuclei of cells in early murine brain development and the presence of Annexin A7 in nuclei of neuronal cells in the adult animal. The role of Annexin A7 in nuclei of differentiating and mature neuronal cells remains elusive.
García, Miguel A; Costea, Mihai; Kuzmina, Maria; Stefanović, Saša
2014-04-01
The parasitic genus Cuscuta, containing some 200 species circumscribed traditionally in three subgenera, is nearly cosmopolitan, occurring in a wide range of habitats and hosts. Previous molecular studies, on subgenera Grammica and Cuscuta, delimited major clades within these groups. However, the sequences used were unalignable among subgenera, preventing the phylogenetic comparison across the genus. We conducted a broad phylogenetic study using rbcL and nrLSU sequences covering the morphological, physiological, and geographical diversity of Cuscuta. We used parsimony methods to reconstruct ancestral states for taxonomically important characters. Biogeographical inferences were obtained using statistical and Bayesian approaches. Four well-supported major clades are resolved. Two of them correspond to subgenera Monogynella and Grammica. Subgenus Cuscuta is paraphyletic, with section Pachystigma sister to subgenus Grammica. Previously described cases of strongly supported discordance between plastid and nuclear phylogenies, interpreted as reticulation events, are confirmed here and three new cases are detected. Dehiscent fruits and globose stigmas are inferred as ancestral character states, whereas the ancestral style number is ambiguous. Biogeographical reconstructions suggest an Old World origin for the genus and subsequent spread to the Americas as a consequence of one long-distance dispersal. Hybridization may play an important yet underestimated role in the evolution of Cuscuta. Our results disagree with scenarios of evolution (polarity) previously proposed for several taxonomically important morphological characters, and with their usage and significance. While several cases of long-distance dispersal are inferred, vicariance or dispersal to adjacent areas emerges as the dominant biogeographical pattern.
Brassac, Jonathan; Blattner, Frank R
2015-09-01
Polyploidization is an important speciation mechanism in the barley genus Hordeum. To analyze evolutionary changes after allopolyploidization, knowledge of parental relationships is essential. One chloroplast and 12 nuclear single-copy loci were amplified by polymerase chain reaction (PCR) in all Hordeum plus six out-group species. Amplicons from each of 96 individuals were pooled, sheared, labeled with individual-specific barcodes and sequenced in a single run on a 454 platform. Reference sequences were obtained by cloning and Sanger sequencing of all loci for nine supplementary individuals. The 454 reads were assembled into contigs representing the 13 loci and, for polyploids, also homoeologues. Phylogenetic analyses were conducted for all loci separately and for a concatenated data matrix of all loci. For diploid taxa, a Bayesian concordance analysis and a coalescent-based dated species tree was inferred from all gene trees. Chloroplast matK was used to determine the maternal parent in allopolyploid taxa. The relative performance of different multilocus analyses in the presence of incomplete lineage sorting and hybridization was also assessed. The resulting multilocus phylogeny reveals for the first time species phylogeny and progenitor-derivative relationships of all di- and polyploid Hordeum taxa within a single analysis. Our study proves that it is possible to obtain a multilocus species-level phylogeny for di- and polyploid taxa by combining PCR with next-generation sequencing, without cloning and without creating a heavy load of sequence data. © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.
Properties of Localized Protons in Neutron Star Matter at Finite Temperatures
Szmaglinski, A.; Kubis, S.; Wójcik, W.
2014-02-01
We study properties of the proton component of neutron star matter for realistic nuclear models. Vanishing of the nuclear symmetry energy implies proton-neutron separation in dense nuclear matter. Protons which form admixture tend to be localized in potential wells. Here, we extend the description of proton localization to finite temperatures. It appears that the protons are still localized at temperatures typical for hot neutron stars. That fact has important astrophysical consequences. Moreover, the temperature inclusion leads to unexpected results for the behavior of the proton localized state.
Bending-Twisting Motions and Main Interactions in Nucleoplasmin Nuclear Import.
Directory of Open Access Journals (Sweden)
Marcos Tadeu Geraldo
Full Text Available Alpha solenoid proteins play a key role in regulating the classical nuclear import pathway, recognizing a target protein and transporting it into the nucleus. Importin-α (Impα is the solenoid responsible for cargo protein recognition, and it has been extensively studied by X-ray crystallography to understand the binding specificity. To comprehend the main motions of Impα and to extend the information about the critical interactions during carrier-cargo recognition, we surveyed different conformational states based on molecular dynamics (MD and normal mode (NM analyses. Our model of study was a crystallographic structure of Impα complexed with the classical nuclear localization sequence (cNLS from nucleoplasmin (Npl, which was submitted to multiple 100 ns of MD simulations. Representative conformations were selected for calculating the 87 lowest frequencies NMs of vibration, and a displacement approach was applied along each NM. Based on geometric criteria, using the radius of curvature and inter-repeat angles as the reference metrics, the main motions of Impα were described. Moreover, we determined the salt bridges, hydrogen bonds and hydrophobic interactions in the Impα-NplNLS interface. Our results show the bending and twisting motions participating in the recognition of nuclear proteins, allowing the accommodation and adjustment of a classical bipartite NLS sequence. The essential contacts for the nuclear import were also described and were mostly in agreement with previous studies, suggesting that the residues in the cNLS linker region establish important contacts with Impα adjusting the cNLS backbone. The MD simulations combined with NM analysis can be applied to the Impα-NLS system to help understand interactions between Impα and cNLSs and the analysis of non-classic NLSs.
Non-local effects in kaonic atoms
International Nuclear Information System (INIS)
Lutz, M.; Florkowski, W.
2000-04-01
Optical potentials with non-local (gradient) terms are used to describe the spectra of kaonic atoms. The strength of the non-local terms is determined from a many-body calculation of the kaon self-energy in nuclear matter. The optical potentials show strong non-linearities in the nucleon density and sizeable non-local terms. We find that the non-local terms are quantitatively important and the results depend strongly on the way the gradient terms are arranged. Phenomenologically successful fits are obtained for p-wave like optical potentials. It is suggested that the microscopic form of the non-local interaction terms is obtained systematically by means of a semi-classical expansion of the nucleus structure. We conclude that a microscopic description of kaonic atom data requires further detailed studies of the microscopic K - nuclear dynamics. (orig.)
International Nuclear Information System (INIS)
Kiss, A.; Li, L.; Gettemeier, T.; Venkatesh, L.K.
2003-01-01
Human immunodeficiency virus type 1 (HIV-1) Rev-mediated nuclear export of viral RNAs involves the interaction of its leucine-rich nuclear export sequence (NES) with nuclear cofactors. In yeast two-hybrid screens of a human lymph node derived cDNA expression library, we identified the human nucleoporin Nup98 as a highly specific and potent interactor of the Rev NES. Using an extensive panel of nuclear export positive and negative mutants of the functionally homologous NESs of the HIV-1 Rev, human T cell leukemia virus type 1 (HTLV-1) Rex, and equine infectious anemia virus (EIAV) Rev proteins, physiologically significant interaction of hNup98 with the various NESs was demonstrated. Missense mutations in the yeast nuclear export factor Crm1p that abrogated Rev NES interaction with the XXFG repeat-containing nucleoporin, Rab/hRIP, had minimal effects on the interaction of GLFG repeat-containing hNup98. Functional analysis of Nup98 domains required for nuclear localization demonstrated that the entire ORF was required for efficient incorporation into the nuclear envelope. A putative nuclear localization signal was identified downstream of the GLFG repeat region. Whereas overexpression of both full-length Nup98 and the amino-terminal GLFG repeat region, but not the unique carboxy-terminal region, induced significant suppression of HIV unspliced RNA export, lower levels of exogenous Nup98 expression resulted in a relatively modest increase in unspliced RNA export. These results suggest a physiological role for hNup98 in modulating Rev-dependent RNA export during HIV infection
Chameleon sequences in neurodegenerative diseases.
Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Salari, Ali
2016-03-25
Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to "helix to strand (HE)", "helix to coil (HC)" and "strand to coil (CE)" alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases. Copyright © 2016 Elsevier Inc. All rights reserved.
Chameleon sequences in neurodegenerative diseases
International Nuclear Information System (INIS)
Bahramali, Golnaz; Goliaei, Bahram; Minuchehr, Zarrin; Salari, Ali
2016-01-01
Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to “helix to strand (HE)”, “helix to coil (HC)” and “strand to coil (CE)” alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases.
Chameleon sequences in neurodegenerative diseases
Energy Technology Data Exchange (ETDEWEB)
Bahramali, Golnaz [Institute of Biochemistry and Biophysics, University of Tehran, Tehran (Iran, Islamic Republic of); Goliaei, Bahram, E-mail: goliaei@ut.ac.ir [Institute of Biochemistry and Biophysics, University of Tehran, Tehran (Iran, Islamic Republic of); Minuchehr, Zarrin, E-mail: minuchehr@nigeb.ac.ir [Department of Systems Biotechnology, National Institute of Genetic Engineering and Biotechnology, (NIGEB), Tehran (Iran, Islamic Republic of); Salari, Ali [Department of Systems Biotechnology, National Institute of Genetic Engineering and Biotechnology, (NIGEB), Tehran (Iran, Islamic Republic of)
2016-03-25
Chameleon sequences can adopt either alpha helix sheet or a coil conformation. Defining chameleon sequences in PDB (Protein Data Bank) may yield to an insight on defining peptides and proteins responsible in neurodegeneration. In this research, we benefitted from the large PDB and performed a sequence analysis on Chameleons, where we developed an algorithm to extract peptide segments with identical sequences, but different structures. In order to find new chameleon sequences, we extracted a set of 8315 non-redundant protein sequences from the PDB with an identity less than 25%. Our data was classified to “helix to strand (HE)”, “helix to coil (HC)” and “strand to coil (CE)” alterations. We also analyzed the occurrence of singlet and doublet amino acids and the solvent accessibility in the chameleon sequences; we then sorted out the proteins with the most number of chameleon sequences and named them Chameleon Flexible Proteins (CFPs) in our dataset. Our data revealed that Gly, Val, Ile, Tyr and Phe, are the major amino acids in Chameleons. We also found that there are proteins such as Insulin Degrading Enzyme IDE and GTP-binding nuclear protein Ran (RAN) with the most number of chameleons (640 and 405 respectively). These proteins have known roles in neurodegenerative diseases. Therefore it can be inferred that other CFP's can serve as key proteins in neurodegeneration, and a study on them can shed light on curing and preventing neurodegenerative diseases.
Local repeat sequence organization of an intergenic spacer in the ...
Indian Academy of Sciences (India)
Unknown
chloroplast genome of Chlamydomonas reinhardtii leads to DNA expansion and sequence ... The discovery of uniparentally inherited streptomycin resistant mutants ... resembles yeast, mitochondrial and phage recombination in that it is typically ...... Sager R and Lane D 1972 Molecular basis of maternal inheritance; Proc.
Comparative analyses of two Geraniaceae transcriptomes using next-generation sequencing.
Zhang, Jin; Ruhlman, Tracey A; Mower, Jeffrey P; Jansen, Robert K
2013-12-29
Organelle genomes of Geraniaceae exhibit several unusual evolutionary phenomena compared to other angiosperm families including accelerated nucleotide substitution rates, widespread gene loss, reduced RNA editing, and extensive genomic rearrangements. Since most organelle-encoded proteins function in multi-subunit complexes that also contain nuclear-encoded proteins, it is likely that the atypical organellar phenomena affect the evolution of nuclear genes encoding organellar proteins. To begin to unravel the complex co-evolutionary interplay between organellar and nuclear genomes in this family, we sequenced nuclear transcriptomes of two species, Geranium maderense and Pelargonium x hortorum. Normalized cDNA libraries of G. maderense and P. x hortorum were used for transcriptome sequencing. Five assemblers (MIRA, Newbler, SOAPdenovo, SOAPdenovo-trans [SOAPtrans], Trinity) and two next-generation technologies (454 and Illumina) were compared to determine the optimal transcriptome sequencing approach. Trinity provided the highest quality assembly of Illumina data with the deepest transcriptome coverage. An analysis to determine the amount of sequencing needed for de novo assembly revealed diminishing returns of coverage and quality with data sets larger than sixty million Illumina paired end reads for both species. The G. maderense and P. x hortorum transcriptomes contained fewer transcripts encoding the PLS subclass of PPR proteins relative to other angiosperms, consistent with reduced mitochondrial RNA editing activity in Geraniaceae. In addition, transcripts for all six plastid targeted sigma factors were identified in both transcriptomes, suggesting that one of the highly divergent rpoA-like ORFs in the P. x hortorum plastid genome is functional. The findings support the use of the Illumina platform and assemblers optimized for transcriptome assembly, such as Trinity or SOAPtrans, to generate high-quality de novo transcriptomes with broad coverage. In addition