WorldWideScience

Sample records for nuclear gene families

  1. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Isolation, structural analysis, and expression characteristics of the maize nuclear factor Y gene families

    International Nuclear Information System (INIS)

    Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi

    2016-01-01

    NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.

  3. AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

    International Nuclear Information System (INIS)

    Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

    2007-01-01

    Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

  4. The nuclear receptor gene family in the Pacific oyster, Crassostrea gigas, contains a novel subfamily group.

    Science.gov (United States)

    Vogeler, Susanne; Galloway, Tamara S; Lyons, Brett P; Bean, Tim P

    2014-05-15

    Nuclear receptors are a superfamily of transcription factors important in key biological, developmental and reproductive processes. Several of these receptors are ligand- activated and through their ability to bind endogenous and exogenous ligands, are potentially vulnerable to xenobiotics. Molluscs are key ecological species in defining aquatic and terrestrial habitats and are sensitive to xenobiotic compounds in the environment. However, the understanding of nuclear receptor presence, function and xenobiotic disruption in the phylum Mollusca is limited. Here, forty-three nuclear receptor sequences were mined from the genome of the Pacific oyster, Crassostrea gigas. They include members of NR0-NR5 subfamilies, notably lacking any NR6 members. Phylogenetic analyses of the oyster nuclear receptors have been conducted showing the presence of a large novel subfamily group not previously reported, which is named NR1P. Homologues to all previous identified nuclear receptors in other mollusc species have also been determined including the putative heterodimer partner retinoid X receptor, estrogen receptor and estrogen related receptor. C. gigas contains a highly diverse set of nuclear receptors including a novel NR1 group, which provides important information on presence and evolution of this transcription factor superfamily in invertebrates. The Pacific oyster possesses two members of NR3, the sex steroid hormone receptor analogues, of which there are 9 in humans. This provides increasing evidence that steroid ligand specific expansion of this family is deuterostome specific. This new knowledge on divergence and emergence of nuclear receptors in C. gigas provides essential information for studying regulation of molluscan gene expression and the potential effects of xenobiotics.

  5. Transcriptional Activity of Nuclear Factor κB Family Genes in Patients with Systemic Sclerosis.

    Science.gov (United States)

    Lis-Święty, Anna; Gola, Joanna; Mazurek, Urszula; Brzezińska-Wcisło, Ligia

    2017-05-01

    Systemic sclerosis (SSc) is a connective tissue disease of unknown etiology and unclear pathogenesis. Evaluation of the activation of nuclear factor κB (NF-κB) family genes IκBα, p50, p52, p65, and c-Rel, potentially involved in the regulation of immunity, inflammation, angiogenesis, and tissue remodeling in SSc, was carried out. The study included 19 patients with limited SSc, 11 patients with early SSc, and 10 healthy persons constituting the control group. Real-time QRT-PCR was used to evaluate the mRNAs in peripheral blood samples. The patients with early SSc showed a decrease in transcriptional activity of IκBα inhibitor and c-Rel subunit. Transcriptional activity decrease in the other patients with limited SSc included genes encoding c-Rel and p50, subunits of NF-κB factor. Deregulation of intracellular signal transduction by NF-κB takes place at the beginning of SSc and in its fibrosis stage. Associations between clinical variables and NF-κB related gene expression as well as the activation of NF-κB family members in SSc patients should be addressed in future studies. © 2017 by the Association of Clinical Scientists, Inc.

  6. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  7. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  8. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2017-10-01

    Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  9. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals.

    Science.gov (United States)

    Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli

    2017-10-08

    The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  10. Association between SNP and haplotypes in PPARGCl and adiponectin genes and bone mineral density in Chinese nuclear families

    Institute of Scientific and Technical Information of China (English)

    Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU

    2007-01-01

    Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.

  11. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales.

    Science.gov (United States)

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva; Renner, Susanne S

    2016-08-03

    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites' occurrence. Cynomorium has large genomes of 13.70-13.61 (Italy) to 13.95-13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas

    2015-01-01

    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

  13. Association of ALOX15 gene polymorphisms with obesity-related phenotypes in Chinese nuclear families with male offspring

    Institute of Scientific and Technical Information of China (English)

    Yao-hua KE; Chun WANG; Yun-qiu HU; Miao LI; Yu-juan LIU; Wen-zhen FU; Zhen-lin ZHANG; Wen-jin XIAO; Jin-wei HE; Hao ZHANG; Jin-bo YU; Wei-wei HU; Jie-mei GU; Gao GAO; Hua YUE

    2012-01-01

    Aim:Genetic variation in ALOX12,which encoded human 12-lipoxygenase,was found to be associated with fat mass in young Chinese men.The objective of this study was to investigate the relationship between single nucleotide polymorphisms (SNPs) and haplotypes in the ALOX15 gene and obesity-related phenotypes in Chinese nuclear families with male offspring.Methods:We recruited 1,296 subjects from 427 nuclear families with male offspring and genotyped five SNPs (rs9894225,rs748694,rs2619112,rs2619118,and rs916055) in the ALOX15 gene locus.The total fat mass (TFM),trunk fat mass (tFM),leg fat mass (LFM) and arm fat mass (AFM) were measured using dual-energy X-ray absorptiometry (DXA).The percentage of fat mass (PFM) was the ratio of TFM and body weight.The association between SNPs and haplotypes of ALOX15 and obesity-related phenotypic variation was measured using quantitative transmission disequilibrium test (QTDT).Results:Using QTDT to measure family-based genetic association,we found that rs916055 had a statistically significant association with PFM (P=0.038),whereas rs916055 had a marginal but statistically insignificant association with tFM (P=0.093).The multipleparameter 1000 permutations test agreed with the family-based association results:both showed that rs916055 had a statistically significant association with PFM (P=0.033).Conclusion:rs916055 in ALOX15 gene was significantly associated with the percentage of fat mass in Chinese nuclear families with male offspring in the family-based association study using QTDT approach.

  14. Insights into the evolution and diversification of the AT-hook Motif Nuclear Localized gene family in land plants.

    Science.gov (United States)

    Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M

    2014-10-14

    Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other clade. Over-expression of a Glycine max AHL PPC domain in Arabidopsis thaliana recapitulates the phenotype observed when over-expressing its Arabidopsis thaliana counterpart. This result suggests that the AHL genes from different land plant species may share conserved functions in regulating plant growth and development. Our study further suggests that such functional conservation may be due to conserved physical interactions among the PPC domains of AHL proteins. Our analyses reveal a possible evolutionary scenario for the AHL gene family

  15. [Expression of mutation type GJA8 gene and wild type GJA8 gene of a congenital inherited nuclear cataract family in eukaryotic cells].

    Science.gov (United States)

    Zheng, Jian-qiu; Liu, Ping; Wang, Jian-wen; Liu, Jian-ju

    2010-04-20

    To clone the sequence of mutation type GJA8 gene (mGJA8) and wild type GJA8 gene (wGJA8) of a congenital inherited nuclear cataract family and study their expression in eukaryotic cell lines in vitro. The mGJA8 and wGJA8 were amplified from this family's DNA and healthy people's DNA by PCR respectively. The mGJA8 and wGJA8 were recombined with plasmid pEGFP-N1 respectively. The accuracy of pEGFP-N1-GJA8 was confirmed by restriction enzyme digestion and DNA sequencing. Finally pEGFP-N1- mGJA8 and pEGFP-N1- wGJA8 and GFP protein were transfected into COS7 cells by lipofectin. The expression of pEGFP-N1-GJA8 and GFP fusion protein were to observe under fluorescence microscope, and to detect by Western-blotting and immunohistochemical staining. The mGJA8 and wGJA8 were cloned successfully. With restricting enzyme digestion analysis and DNA sequencing, recombinant plasmid pEGFP-N1-mGJA8 and pEGFP-N1-wGJA8 were constructed correctly and their GFP fusions were expressed in transfected COS7 cells. The expression of pEGFP-N1-mGJA8 and pEGFP-N1-wGJA8 fusion protein were observed under fluorescence microscope, and detected by Western-blotting and immunohistochemical staining successfully. The mGJA8 gene and wGJA8 gene are cloned successfully, and pEGFP-N1-mGJA8 and pEGFP-N1-mGJA8 fusion protein can be expressed in COS7 cells, which establish the foundation for further studying the mechanism of this congenital inherited nuclear cataract family.

  16. Gene structure, expression pattern and interaction of Nuclear Factor-Y family in castor bean (Ricinus communis).

    Science.gov (United States)

    Wang, Yue; Xu, Wei; Chen, Zexi; Han, Bing; Haque, Mohammad E; Liu, Aizhong

    2018-03-01

    Nuclear Factor-Y transcription factors, which function in regulating seed development (including storage reservoir accumulation) and responding to abiotic stresses, were identified and characterized in castor bean. Nuclear Factor-Y (NF-Y) transcription factors in plants contain three subunits (NF-YA, NF-YB and NF-YC), and function as a heterodimer or heterotrimer complex in regulating plant growth, development and response to stresses. Castor bean (Ricinus communis, Euphorbiaceae) one of the most economically important non-edible oilseed crops, able to grow in diverse soil conditions and displays high tolerance to abiotic stresses. Due to increasing demands for its seed oils, it is necessary to elucidate the molecular mechanism underlying the regulation of growth and development. Based on the available genome data, we identified 25 RcNF-Y members including six RcNF-YAs, 12 RcNF-YBs and seven RcNF-YCs, and characterized their gene structures. Yeast two-hybrid assays confirmed the protein-protein interactions among three subunits. Using transcriptomic data from different tissues, we found that six members were highly or specifically expressed in endosperms (in particular, two LEC1-type members RcNF-YB2 and RcNF-YB12), implying their involvement in regulating seed development and storage reservoir accumulation. Further, we investigated the expression changes of RcNF-Y members in two-week-old seedlings under drought, cold, hot and salt stresses. We found that the expression levels of 20 RcNF-Y members tested were changed and three RcNF-Y members might function in response to abiotic stresses. This study is the first reported on genomic characterization of NF-Y transcription factors in the family Euphorbiaceae. Our results provide the basis for improved understanding of how NF-Y genes function in the regulation of seed development and responses to abiotic stresses in both castor bean and other plants in this family.

  17. Nuclear Industry Family Study

    International Nuclear Information System (INIS)

    1993-01-01

    This is a copy of the U.K.A.E.A. Question and Answer brief concerning an epidemiological study entitled the Nuclear Industry Family Study, to investigate the health of children of AEA, AWE, and BNFL Workers. The study is being carried out by an independent team of medical research workers from the London School of Hygiene and Tropical Medicine, and the Imperial Cancer Research Fund. (UK)

  18. No association of the polymorphisms of the frizzled-related protein gene with peak bone mineral density in Chinese nuclear families

    Directory of Open Access Journals (Sweden)

    Yue Hua

    2010-01-01

    Full Text Available Abstract Background The Wnt/beta-catenin signaling pathway plays an important role in skeletal development. Polymorphisms of frizzled-related protein (FRZB, an antagonist of this pathway, may generate variations in bone mineral density (BMD. In this study, we analyzed the association between FRZB genotypes and peak BMD variation in the spines and hips of two relatively large samples of Chinese female-offspring and male-offspring nuclear families. Methods We recruited 1,260 subjects from 401 female-offspring nuclear families and 1,296 subjects from 427 male-offspring nuclear families and genotyped four tagging single nucleotide polymorphisms (tagSNPs (rs6433993, rs409238, rs288324, and rs4666865 spanning the entire FRZB gene. The SNPs rs288326 and rs7775, which are associated with hip osteoarthritis, were not selected in this study because of their low minor allele frequencies (MAFs in Chinese people. The quantitative transmission disequilibrium test (QTDT was used to analyze the association between each SNP and haplotype with peak BMD in female- and male-offspring nuclear families. Results In the female-offspring nuclear families, we found no evidence of an association between either single SNPs or haplotypes and peak BMD in the spine or hip. In the male-offspring nuclear families, no within-family association was observed for either SNPs or haplotypes, although a significant total association was found between rs4666865 and spine BMD (P = 0.0299. Conclusion Our results suggest that natural variation in FRZB is not a major contributor to the observed variability in peak BMD in either Chinese females or males. Because ethnic differences in the FRZB genotypes may exist, other studies in different population are required to confirm such results.

  19. Mitochondrial and nuclear genes suggest that stony corals are monophyletic but most families of stony corals are not (Order Scleractinia, Class Anthozoa, Phylum Cnidaria.

    Directory of Open Access Journals (Sweden)

    Hironobu Fukami

    Full Text Available Modern hard corals (Class Hexacorallia; Order Scleractinia are widely studied because of their fundamental role in reef building and their superb fossil record extending back to the Triassic. Nevertheless, interpretations of their evolutionary relationships have been in flux for over a decade. Recent analyses undermine the legitimacy of traditional suborders, families and genera, and suggest that a non-skeletal sister clade (Order Corallimorpharia might be imbedded within the stony corals. However, these studies either sampled a relatively limited array of taxa or assembled trees from heterogeneous data sets. Here we provide a more comprehensive analysis of Scleractinia (127 species, 75 genera, 17 families and various outgroups, based on two mitochondrial genes (cytochrome oxidase I, cytochrome b, with analyses of nuclear genes (ss-tubulin, ribosomal DNA of a subset of taxa to test unexpected relationships. Eleven of 16 families were found to be polyphyletic. Strikingly, over one third of all families as conventionally defined contain representatives from the highly divergent "robust" and "complex" clades. However, the recent suggestion that corallimorpharians are true corals that have lost their skeletons was not upheld. Relationships were supported not only by mitochondrial and nuclear genes, but also often by morphological characters which had been ignored or never noted previously. The concordance of molecular characters and more carefully examined morphological characters suggests a future of greater taxonomic stability, as well as the potential to trace the evolutionary history of this ecologically important group using fossils.

  20. Family Therapy for the "Truncated" Nuclear Family.

    Science.gov (United States)

    Zuk, Gerald H.

    1980-01-01

    The truncated nuclear family consists of a two-generation group in which conflict has produced a polarization of values. The single-parent family is at special risk. Go-between process enables the therapist to depolarize sharply conflicted values and reduce pathogenic relating. (Author)

  1. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  2. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  3. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

    Science.gov (United States)

    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

    2016-05-01

    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  4. Circadian clock gene aryl hydrocarbon receptor nuclear translocator-like polymorphisms are associated with seasonal affective disorder: An Indian family study.

    Science.gov (United States)

    Rajendran, Bhagya; Janakarajan, Veeramahali Natarajan

    2016-01-01

    Polymorphisms in aryl hydrocarbon receptor nuclear translocator-like (ARNTL) gene, the key component of circadian clock manifests circadian rhythm abnormalities. As seasonal affective disorder (SAD) is associated with disrupted circadian rhythms, the main objective of this study was to screen an Indian family with SAD for ARNTL gene polymorphisms. In this study, 30 members of close-knit family with SAD, 30 age- and sex-matched controls of the same caste with no prior history of psychiatric illness and 30 age- and sex-matched controls belonging to 17 different castes with no prior history of psychiatric illness were genotyped for five different single nucleotide polymorphisms (SNPs) in ARNTL gene by TaqMan allele-specific genotyping assay. Statistical significance was assessed by more powerful quasi-likelihood score test-XM. Most of the family members carried the risk alleles and we observed a highly significant SNP rs2279287 (A/G) in ARNTL gene with an allelic frequency of 0.75. Polymorphisms in ARNTL gene disrupt circadian rhythms causing SAD and genetic predisposition becomes more deleterious in the presence of adverse environment.

  5. Families Facing the Nuclear Taboo.

    Science.gov (United States)

    Jacobs, Judith Bula

    1988-01-01

    Discusses attitudes of 12 families participating in group which was formed to focus on issues related to the possibility of a nuclear disaster. Why and how these families are facing the nuclear taboo plus various outcomes of doing so are discussed as well as the role of the professional in encouraging such openness about these difficult issues.…

  6. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  7. Interspecies introgressive hybridization in spiny frogs Quasipaa (Family Dicroglossidae) revealed by analyses on multiple mitochondrial and nuclear genes.

    Science.gov (United States)

    Zhang, Qi-Peng; Hu, Wen-Fang; Zhou, Ting-Ting; Kong, Shen-Shen; Liu, Zhi-Fang; Zheng, Rong-Quan

    2018-01-01

    Introgression may lead to discordant patterns of variation among loci and traits. For example, previous phylogeographic studies on the genus Quasipaa detected signs of genetic introgression from genetically and morphologically divergent Quasipaa shini or Quasipaa spinosa . In this study, we used mitochondrial and nuclear DNA sequence data to verify the widespread introgressive hybridization in the closely related species of the genus Quasipaa , evaluate the level of genetic diversity, and reveal the formation mechanism of introgressive hybridization. In Longsheng, Guangxi Province, signs of asymmetrical nuclear introgression were detected between Quasipaa boulengeri and Q. shini . Unidirectional mitochondrial introgression was revealed from Q. spinosa to Q. shini . By contrast, bidirectional mitochondrial gene introgression was detected between Q. spinosa and Q. shini in Lushan, Jiangxi Province. Our study also detected ancient hybridizations between a female Q. spinosa and a male Q. jiulongensis in Zhejiang Province. Analyses on mitochondrial and nuclear genes verified three candidate cryptic species in Q. spinosa , and a cryptic species may also exist in Q. boulengeri . However, no evidence of introgressive hybridization was found between Q. spinosa and Q. boulengeri . Quasipaa exilispinosa from all the sampling localities appeared to be deeply divergent from other communities. Our results suggest widespread introgressive hybridization in closely related species of Quasipaa and provide a fundamental basis for illumination of the forming mechanism of introgressive hybridization, classification of species, and biodiversity assessment in Quasipaa .

  8. Orphan Nuclear Receptor NR4A1 Binds a Novel Protein Interaction Site on Anti-apoptotic B Cell Lymphoma Gene 2 Family Proteins.

    Science.gov (United States)

    Godoi, Paulo H C; Wilkie-Grantham, Rachel P; Hishiki, Asami; Sano, Renata; Matsuzawa, Yasuko; Yanagi, Hiroko; Munte, Claudia E; Chen, Ya; Yao, Yong; Marassi, Francesca M; Kalbitzer, Hans R; Matsuzawa, Shu-Ichi; Reed, John C

    2016-07-01

    B cell lymphoma gene 2 (Bcl-2) family proteins are key regulators of programmed cell death and important targets for drug discovery. Pro-apoptotic and anti-apoptotic Bcl-2 family proteins reciprocally modulate their activities in large part through protein interactions involving a motif known as BH3 (Bcl-2 homology 3). Nur77 is an orphan member of the nuclear receptor family that lacks a BH3 domain but nevertheless binds certain anti-apoptotic Bcl-2 family proteins (Bcl-2, Bfl-1, and Bcl-B), modulating their effects on apoptosis and autophagy. We used a combination of NMR spectroscopy-based methods, mutagenesis, and functional studies to define the interaction site of a Nur77 peptide on anti-apoptotic Bcl-2 family proteins and reveal a novel interaction surface. Nur77 binds adjacent to the BH3 peptide-binding crevice, suggesting the possibility of cross-talk between these discrete binding sites. Mutagenesis of residues lining the identified interaction site on Bcl-B negated the interaction with Nur77 protein in cells and prevented Nur77-mediated modulation of apoptosis and autophagy. The findings establish a new protein interaction site with the potential to modulate the apoptosis and autophagy mechanisms governed by Bcl-2 family proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  10. Identification of haplotype tag single nucleotide polymorphisms within the nuclear factor-κB family genes and their clinical relevance in patients with major trauma.

    Science.gov (United States)

    Pan, Wei; Zhang, An Qiang; Gu, Wei; Gao, Jun Wei; Du, Ding Yuan; Zhang, Lian Yang; Zeng, Ling; Du, Juan; Wang, Hai Yan; Jiang, Jian Xin

    2015-03-20

    Nuclear factor-κB (NF-κB) family plays an important role in the development of sepsis in critically ill patients. Although several single nucleotide polymorphisms (SNPs) have been identified in the NF-κB family genes, only a few SNPs have been studied. A total of 753 patients with major blunt trauma were included in this study. Tag SNPs (tSNPs) were selected from the NF-κB family genes (NFKB1, NFKB2, RELA, RELB and REL) through construction of haplotype blocks. The SNPs selected from genes within the canonical NF-κB pathway (including NFKB1, RELA and REL), which played a critical role in innate immune responses were genotyped using pyrosequencing method and analyzed in relation to the risk of development of sepsis and multiple organ dysfunction (MOD) syndrome. Moreover, the rs842647 polymorphism was analyzed in relation to tumor necrosis factor α (TNF-α) production by peripheral blood leukocytes in response to bacterial lipoprotein stimulation. Eight SNPs (rs28362491, rs3774932, rs4648068, rs7119750, rs4803789, rs12609547, rs1560725 and rs842647) were selected from the NF-κB family genes. All of them were shown to be high-frequency SNPs in this study cohort. Four SNPs (rs28362491, rs4648068, rs7119750 and rs842647) within the canonical NF-κB pathway were genotyped, and rs842647 was associated with sepsis morbidity rate and MOD scores. An association was also observed between the rs842647 A allele and lower TNF-α production. rs842647 polymorphism might be used as relevant risk estimate for the development of sepsis and MOD syndrome in patients with major trauma.

  11. Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

    Science.gov (United States)

    Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

    2012-11-01

    5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

  12. The Nuclear Age: Context for Family Interaction.

    Science.gov (United States)

    Ptacek, Carmen

    1988-01-01

    Suggests that concerns regarding the nuclear threat are prevalent among family members; parents and children feel powerless in response to the nuclear threat; response to the nuclear threat is a family issue; responding to the nuclear threat requires empowering families and changing the social context; and nuclear concerns need to be addressed in…

  13. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  14. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  15. Studies of genetic variability of the hepatocyte nuclear factor-1α gene in an Indian maturity-onset diabetes of the young family.

    Science.gov (United States)

    Yang, Jing; Jiang, Feng; Guo, Hui; Soniya, Thadimacca; Yan, Chun-Xia; Tian, Zhu-Fang; Shi, Bing-Yin

    2016-01-01

    Maturity-onset diabetes of the young (MODY), one of the specific types of diabetes mellitus, is a monogenetic disorder characterized by an autosomal dominant (AD) inheritance and β-cell dysfunction. To study an Indian family with clinical diagnosis of MODY and detect the genetic mutations in the aspect of molecular mechanism, seven blood samples were obtained from the diabetic patients of this pedigree and genomic DNA was extracted from peripheral leukocytes. The exon1, exon2 and exon4 of hepatocyte nuclear factor-1α (HNF-1α) gene were amplified by polymerase chain reaction. Then the products were sequenced and compared with standard sequences on gene bank. As a result, two mutations were detected in exon1. That was CTC → CTG (Leu → Leu) in codon17 and ATC → CTC (Ile → Leu) in codon27. I27L was speculated to have a close relationship with the glycometabolism and the pathogenesis of diabetes mellitus together with the putative novel mutation existed in this Indian pedigree. Meanwhile, one mutation of GGG → GGC (Gly → Gly) in codon288 of exon4 was detected in the proband. No mutations were found in exon2 but a G → T base substitution in the intron4 region among all seven samples was detected. It may have some potential effects on the onset of diabetes in this family, but we do not have any evidence right now. Although it requires further investigation on the function of mutations found in the intron region, our research may provide some clue for this issue and it deserves more attention.

  16. MBNL142 and MBNL143 gene isoforms, overexpressed in DM1-patient muscle, encode for nuclear proteins interacting with Src family kinases.

    Science.gov (United States)

    Botta, A; Malena, A; Tibaldi, E; Rocchi, L; Loro, E; Pena, E; Cenci, L; Ambrosi, E; Bellocchi, M C; Pagano, M A; Novelli, G; Rossi, G; Monaco, H L; Gianazza, E; Pantic, B; Romeo, V; Marin, O; Brunati, A M; Vergani, L

    2013-08-15

    Myotonic dystrophy type-1 (DM1) is the most prevalent form of muscular dystrophy in adults. This disorder is an RNA-dominant disease, caused by expansion of a CTG repeat in the DMPK gene that leads to a misregulation in the alternative splicing of pre-mRNAs. The longer muscleblind-like-1 (MBNL1) transcripts containing exon 5 and the respective protein isoforms (MBNL142-43) were found to be overexpressed in DM1 muscle and localized exclusively in the nuclei. In vitro assays showed that MBNL142-43 bind the Src-homology 3 domain of Src family kinases (SFKs) via their proline-rich motifs, enhancing the SFK activity. Notably, this association was also confirmed in DM1 muscle and myotubes. The recovery, mediated by an siRNA target to Ex5-MBNL142-43, succeeded in reducing the nuclear localization of both Lyn and MBNL142-43 proteins and in decreasing the level of tyrosine phosphorylated proteins. Our results suggest an additional molecular mechanism in the DM1 pathogenesis, based on an altered phosphotyrosine signalling pathway.

  17. Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

    Science.gov (United States)

    He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

    2008-03-01

    The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis

  18. Nuclear transfer alters placental gene expression and associated histone modifications of the placental-specific imprinted gene pleckstrin homology-like domain, family A, member 2 (PHLDA2) in cattle.

    Science.gov (United States)

    Arnold, Daniel R; Gaspar, Roberta C; da Rocha, Carlos V; Sangalli, Juliano R; de Bem, Tiago H C; Corrêa, Carolina A P; Penteado, João C T; Meirelles, Flavio V; Lopes, Flavia L

    2017-03-01

    Abnormal placental development is frequent in nuclear transfer (NT) pregnancies and is likely to be associated with altered epigenetic reprogramming. In the present study, fetal and placental measurements were taken on Day 60 of gestation in cows with pregnancies produced by AI, IVF and NT. Placentas were collected and subjected to histological evaluation, the expression of genes important in trophoblast differentiation and expression of the placental imprinted gene pleckstrin homology-like domain, family A, member 2 (PHLDA2), as well as chromatin immunoprecipitation (ChIP) for histone marks within the promoter of PHLDA2. Fewer binucleated cells were observed in NT cotyledons, followed by IVF and AI cotyledons (P<0.05). Expression of heart and neural crest derivatives expressed 1 (HAND1), placental lactogen (PL), pregnancy-associated glycoprotein 9 (PAG-9) and PHLDA2 was elevated in NT cotyledons compared with AI cotyledons. Expression of PHLDA2 was higher in IVF than AI samples (P<0.05). ChIP revealed an increase in the permissive mark dimethylation of lysine 4 on histone H3 (H3K4me2), surprisingly associated with the silent allele of PHLDA2, and a decrease in the inhibitory mark H3K9me2 in NT samples. Thus, genes critical for placental development were altered in NT placentas, including an imprinted gene. Allele-specific changes in the permissive histone mark in the PHLDA2 promoter indicate misregulation of imprinting in clones. Abnormal trophoblast differentiation could have resulted in lower numbers of binucleated cells following NT. These results suggest that the altered expression of imprinted genes associated with NT are also caused by changes in histone modifications.

  19. On the validity of within-nuclear-family genetic association analysis in samples of extended families.

    Science.gov (United States)

    Bureau, Alexandre; Duchesne, Thierry

    2015-12-01

    Splitting extended families into their component nuclear families to apply a genetic association method designed for nuclear families is a widespread practice in familial genetic studies. Dependence among genotypes and phenotypes of nuclear families from the same extended family arises because of genetic linkage of the tested marker with a risk variant or because of familial specificity of genetic effects due to gene-environment interaction. This raises concerns about the validity of inference conducted under the assumption of independence of the nuclear families. We indeed prove theoretically that, in a conditional logistic regression analysis applicable to disease cases and their genotyped parents, the naive model-based estimator of the variance of the coefficient estimates underestimates the true variance. However, simulations with realistic effect sizes of risk variants and variation of this effect from family to family reveal that the underestimation is negligible. The simulations also show the greater efficiency of the model-based variance estimator compared to a robust empirical estimator. Our recommendation is therefore, to use the model-based estimator of variance for inference on effects of genetic variants.

  20. The knottin-like Blufensin family regulates genes involved in nuclear import and the secretory pathway in barley-powdery mildew interactions

    Science.gov (United States)

    Xu, Weihui; Meng, Yan; Surana, Priyanka; Fuerst, Greg; Nettleton, Dan; Wise, Roger P.

    2015-01-01

    Plants have evolved complex regulatory mechanisms to control a multi-layered defense response to microbial attack. Both temporal and spatial gene expression are tightly regulated in response to pathogen ingress, modulating both positive and negative control of defense. BLUFENSINs, small knottin-like peptides in barley, wheat, and rice, are highly induced by attack from fungal pathogens, in particular, the obligate biotrophic fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of barley powdery mildew. Previous research indicated that Blufensin1 (Bln1) functions as a negative regulator of basal defense mechanisms. In the current report, we show that BLN1 and BLN2 can both be secreted to the apoplast and Barley stripe mosaic virus (BSMV)-mediated overexpression of Bln2 increases susceptibility of barley to Bgh. Bimolecular fluorescence complementation (BiFC) assays signify that BLN1 and BLN2 can interact with each other, and with calmodulin. We then used BSMV-induced gene silencing to knock down Bln1, followed by Barley1 GeneChip transcriptome analysis, to identify additional host genes influenced by Bln1. Analysis of differential expression revealed a gene set enriched for those encoding proteins annotated to nuclear import and the secretory pathway, particularly Importin α1-b and Sec61 γ subunits. Further functional analysis of these two affected genes showed that when silenced, they also reduced susceptibility to Bgh. Taken together, we postulate that Bln1 is co-opted by Bgh to facilitate transport of disease-related host proteins or effectors, influencing the establishment of Bgh compatibility on its barley host. PMID:26089830

  1. MTA family of coregulators in nuclear receptor biology and pathology

    Science.gov (United States)

    Manavathi, Bramanandam; Singh, Kamini; Kumar, Rakesh

    2007-01-01

    Nuclear receptors (NRs) rely on coregulators (coactivators and corepressors) to modulate the transcription of target genes. By interacting with nucleosome remodeling complexes, NR coactivators potentiate transcription, whereas corepressors inhibit transcription of the target genes. Metastasis-associated proteins (MTA) represent an emerging family of novel NR coregulators. In general, MTA family members form independent nucleosome remodeling and deacetylation (NuRD) complexes and repress the transcription of different genes by recruiting histone deacetylases onto their target genes. However, MTA1 also acts as a coactivator in a promoter-context dependent manner. Recent findings that repression of estrogen receptor transactivation functions by MTA1, MTA1s, and MTA2 and regulation of MTA3 by estrogen signaling have indicated the significance of these proteins in NR signaling. Here, we highlight the action of MTA proteins on NR signaling and their roles in pathophysiological conditions. PMID:18174918

  2. A novel family of plant nuclear envelope-associated proteins.

    Science.gov (United States)

    Pawar, Vidya; Poulet, Axel; Détourné, Gwénaëlle; Tatout, Christophe; Vanrobays, Emmanuel; Evans, David E; Graumann, Katja

    2016-10-01

    This paper describes the characterisation of a new family of higher plant nuclear envelope-associated proteins (NEAPs) that interact with other proteins of the nuclear envelope. In the model plant Arabidopsis thaliana, the family consists of three genes expressed ubiquitously (AtNEAP1-3) and a pseudogene (AtNEAP4). NEAPs consist of extensive coiled-coil domains, followed by a nuclear localisation signal and a C-terminal predicted transmembrane domain. Domain deletion mutants confirm the presence of a functional nuclear localisation signal and transmembrane domain. AtNEAP proteins localise to the nuclear periphery as part of stable protein complexes, are able to form homo- and heteromers, and interact with the SUN domain proteins AtSUN1 and AtSUN2, involved in the linker of nucleoskeleton and cytoskeleton (LINC) complex. An A. thaliana cDNA library screen identified a putative transcription factor called AtbZIP18 as a novel interactor of AtNEAP1, which suggest a connection between NEAP and chromatin. An Atneap1 Atneap3 double-knockout mutant showed reduced root growth, and altered nuclear morphology and chromatin structure. Thus AtNEAPs are suggested as inner nuclear membrane-anchored coiled-coil proteins with roles in maintaining nuclear morphology and chromatin structure. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  4. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  5. Phylogenetic relationships of Acheilognathidae (Cypriniformes: Cyprinoidea) as revealed from evidence of both nuclear and mitochondrial gene sequence variation: evidence for necessary taxonomic revision in the family and the identification of cryptic species.

    Science.gov (United States)

    Chang, Chia-Hao; Li, Fan; Shao, Kwang-Tsao; Lin, Yeong-Shin; Morosawa, Takahiro; Kim, Sungmin; Koo, Hyeyoung; Kim, Won; Lee, Jae-Seong; He, Shunping; Smith, Carl; Reichard, Martin; Miya, Masaki; Sado, Tetsuya; Uehara, Kazuhiko; Lavoué, Sébastien; Chen, Wei-Jen; Mayden, Richard L

    2014-12-01

    Bitterlings are relatively small cypriniform species and extremely interesting evolutionarily due to their unusual reproductive behaviors and their coevolutionary relationships with freshwater mussels. As a group, they have attracted a great deal of attention in biological studies. Understanding the origin and evolution of their mating system demands a well-corroborated hypothesis of their evolutionary relationships. In this study, we provide the most comprehensive phylogenetic reconstruction of species relationships of the group based on partitioned maximum likelihood and Bayesian methods using DNA sequence variation of nuclear and mitochondrial genes on 41 species, several subspecies and three undescribed species. Our findings support the monophyly of the Acheilognathidae. Two of the three currently recognized genera are not monophyletic and the family can be subdivided into six clades. These clades are further regarded as genera based on both their phylogenetic relationships and a reappraisal of morphological characters. We present a revised classification for the Acheilognathidae with five genera/lineages: Rhodeus, Acheilognathus (new constitution), Tanakia (new constitution), Paratanakia gen. nov., and Pseudorhodeus gen. nov. and an unnamed clade containing five species currently referred to as "Acheilognathus". Gene trees of several bitterling species indicate that the taxa are not monophyletic. This result highlights a potentially dramatic underestimation of species diversity in this family. Using our new phylogenetic framework, we discuss the evolution of the Acheilognathidae relative to classification, taxonomy and biogeography. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  7. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  8. mQTL-seq and classical mapping implicates the role of an AT-HOOK MOTIF CONTAINING NUCLEAR LOCALIZED (AHL) family gene in Ascochyta blight resistance of chickpea.

    Science.gov (United States)

    Kumar, Kamal; Purayannur, Savithri; Kaladhar, Vemula Chandra; Parida, Swarup Kumar; Verma, Praveen Kumar

    2018-03-01

    Ascochyta blight (AB) caused by the fungal pathogen Ascochyta rabiei is a serious foliar disease of chickpea (Cicer arietinum L.). Despite many genetic studies on chickpea-Ascochyta interaction, genome-wide scan of chickpea for the identification of AB-associated quantitative trait loci (QTLs) and their gene(s) has not been accomplished. To elucidate narrow QTLs for AB resistance, here, we report the use of multiple QTL-sequencing approach on 2 sets of extreme AB phenotype bulks derived from Cicer intraspecific and interspecific crosses. Two major QTLs, qABR4.1 and qABR4.2, and a minor QTL, qABR4.3, were identified on assembled chickpea pseudomolecule 4. We narrowed qABR4.1 to a "robust region" at 4.568-4.618 Mb through mapping on a larger intraspecific cross-derived population and comparative analysis. Among 4 genes, the CaAHL18 gene showed higher expression under Ascochyta stress in AB resistant parent suggesting that it is the candidate gene under "robust qABR4.1." Dual-luciferase assay with CaAHL18 polymorphic cis-regulatory sequences showed that allelic variation is associated with higher expression. Thus, our findings on chickpea-Ascochyta interaction have narrowed down AB resistance associated QTLs on chickpea physical map. The narrowed QTLs and gene-associated markers will help in biotechnological and breeding programs for chickpea improvement. © 2018 John Wiley & Sons Ltd.

  9. Estimating Heritability from Nuclear Family and Pedigree Data.

    Science.gov (United States)

    Bochud, Murielle

    2017-01-01

    Heritability is a measure of familial resemblance. Estimating the heritability of a trait could be one of the first steps in the gene mapping process. This chapter describes how to estimate heritability for quantitative traits from nuclear and pedigree data using the ASSOC program in the Statistical Analysis in Genetic Epidemiology (S.A.G.E.) software package. Estimating heritability rests on the assumption that the total phenotypic variance of a quantitative trait can be partitioned into independent genetic and environmental components. In turn, the genetic variance can be divided into an additive (polygenic) genetic variance, a dominance variance (nonlinear interaction effects between alleles at the same locus) and an epistatic variance (interaction effects between alleles at different loci). The last two are often assumed to be zero. The additive genetic variance represents the average effects of individual alleles on the phenotype and reflects transmissible resemblance between relatives. Heritability in the narrow sense (h 2 ) refers to the ratio of the additive genetic variance to the total phenotypic variance. Heritability is a dimensionless population-specific parameter. ASSOC estimates association parameters (regression coefficients) and variance components from family data. ASSOC uses a linear regression model in which the total residual variance is partitioned, after regressing on covariates, into the sum of random components such as an additive polygenic component, a random sibship component, random nuclear family components, a random marital component, and an individual-specific random component. Assortative mating, nonrandom ascertainment of families, and failure to account for key confounding factors may bias heritability estimates.

  10. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  11. Shikonin, a constituent of Lithospermum erythrorhizon exhibits anti-allergic effects by suppressing orphan nuclear receptor Nr4a family gene expression as a new prototype of calcineurin inhibitors in mast cells.

    Science.gov (United States)

    Wang, Xiaoyu; Hayashi, Shusaku; Umezaki, Masahito; Yamamoto, Takeshi; Kageyama-Yahara, Natsuko; Kondo, Takashi; Kadowaki, Makoto

    2014-12-05

    Over the last few decades, food allergy (FA) has become a common disease in infants in advanced countries. However, anti-allergic medicines available in the market have no effect on FA, and consequently effective drug therapies for FA are not yet available. We have already demonstrated that mucosal mast cells play an essential role in the development of FA in a murine model. Thus, we screened many constituents from medicinal herbs for the ability to inhibit rat basophilic leukemia-2H3 mast-like cell degranulation, and found that shikonin, a naphthoquinone dye from Lithospermum erythrorhizon, exhibited the most potent inhibitory effect among them. Furthermore, shikonin extremely inhibited the IgE/antigen-induced and calcium ionophore-induced upregulation of tumor necrosis factor (TNF)-α mRNA expression in mucosal-type bone marrow-derived mast cells (mBMMCs). Global gene expression analysis confirmed by real-time PCR revealed that shikonin drastically inhibited the IgE/antigen-induced and calcium ionophore-induced upregulation of mRNA expression of the nuclear orphan receptor 4a family (Nr4a1, Nr4a2 and Nr4a3) in mBMMCs, and knockdown of Nr4a1 or Nr4a2 suppressed the IgE/antigen-induced upregulation of TNF-α mRNA expression. Computational docking simulation of a small molecule for a target protein is a useful technique to elucidate the molecular mechanisms underlying the effects of drugs. Therefore, the simulation revealed that the predicted binding sites of shikonin to immunophilins (cyclophilin A and FK506 binding protein (FKBP) 12) were almost the same as the binding sites of immunosuppressants (cyclosporin A and FK506) to immunophilins. Indeed, shikonin inhibited the calcineurin activity to a similar extent as cyclosporin A that markedly suppressed the IgE/antigen-enhanced mRNA expression of TNF-α and the Nr4a family in mBMMCs. These findings suggest that shikonin suppresses mucosal mast cell activation by reducing Nr4a family gene expression through the

  12. Living in the Nuclear Age: Families and the threat of nuclear war

    International Nuclear Information System (INIS)

    Demorest, D.M.

    1991-01-01

    The main interest of this research was to add to the body of knowledge about the possible psychological impact of the nuclear threat on the family unit. Data were utilized from the Family Interaction, Stress and Nuclear War study conducted by Jules Riskin, M.D. and Victoria Dickerson, Ph.D. at the Mental Research Institute in Palo Alto, California. The sample consisted of ten families who were recruited for this study. In order to examine family-interaction variables and the impact of the threat of nuclear war, a standardized semi-structured family interview was conducted. Topics ranged from ordinary activities to external, non-nuclear stresses such as landslides or hurricanes, to the topic of nuclear war. A distinction is drawn between a family's level of nuclear concern while they discuss nuclear issues and a family's level of nuclear concern when viewed in the context of their overall pattern of family communication. In terms of family coping, family nuclear concern was found to be significantly related to two family-coping strategies. Families who utilized the coping strategies of seeking spiritual support and mobilizing the family to acquire and accept help were significantly less concerned about the threat of nuclear war

  13. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  14. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  15. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  16. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  17. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  18. Peer Relations of Adolescents from Nuclear and Separated Families.

    Science.gov (United States)

    Noack, Peter; Krettek, Christine; Walper, Sabine

    2001-01-01

    Examined peer relations of young people from nuclear families, step families, and single-parent families. Findings suggest peer relations were affected by parental separation only to a minor extent as compared to, e.g. gender- or age-specific effects. A central aspect of friendship quality, however, namely admiration by friends, clearly suffered…

  19. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  20. The LIM domain protein FHL2 interacts with the NR5A family of nuclear receptors and CREB to activate the inhibin-α subunit gene in ovarian granulosa cells.

    Science.gov (United States)

    Matulis, Christina K; Mayo, Kelly E

    2012-08-01

    Nuclear receptor transcriptional activity is enhanced by interaction with coactivators. The highly related nuclear receptor 5A (NR5A) subfamily members liver receptor homolog 1 and steroidogenic factor 1 bind to and activate several of the same genes, many of which are important for reproductive function. To better understand transcriptional activation by these nuclear receptors, we sought to identify interacting proteins that might function as coactivators. The LIM domain protein four and a half LIM domain 2 (FHL2) was identified as interacting with the NR5A receptors in a yeast two-hybrid screen of a human ovary cDNA library. FHL2, and the closely related FHL1, are both expressed in the rodent ovary and in granulosa cells. Small interfering RNA-mediated knockdown of FHL1 and FHL2 in primary mouse granulosa cells reduced expression of the NR5A target genes encoding inhibin-α and P450scc. In vitro assays confirmed the interaction between the FHL and NR5A proteins and revealed that a single LIM domain of FHL2 is sufficient for this interaction, whereas determinants in both the ligand binding domain and DNA binding domain of NR5A proteins are important. FHL2 enhances the ability of both liver receptor homolog 1 and steroidogenic factor 1 to activate the inhibin-α subunit gene promoter in granulosa cells and thus functions as a transcriptional coactivator. FHL2 also interacts with cAMP response element-binding protein and substantially augments activation of inhibin gene expression by the combination of NR5A receptors and forskolin, suggesting that FHL2 may facilitate integration of these two signals. Collectively these results identify FHL2 as a novel coactivator of NR5A nuclear receptors in ovarian granulosa cells and suggest its involvement in regulating target genes important for mammalian reproduction.

  1. The Role of Nuclear Bodies in Gene Expression and Disease

    Science.gov (United States)

    Morimoto, Marie; Boerkoel, Cornelius F.

    2013-01-01

    This review summarizes the current understanding of the role of nuclear bodies in regulating gene expression. The compartmentalization of cellular processes, such as ribosome biogenesis, RNA processing, cellular response to stress, transcription, modification and assembly of spliceosomal snRNPs, histone gene synthesis and nuclear RNA retention, has significant implications for gene regulation. These functional nuclear domains include the nucleolus, nuclear speckle, nuclear stress body, transcription factory, Cajal body, Gemini of Cajal body, histone locus body and paraspeckle. We herein review the roles of nuclear bodies in regulating gene expression and their relation to human health and disease. PMID:24040563

  2. A novel mutation in MIP associated with congenital nuclear cataract in a Chinese family.

    Science.gov (United States)

    Wang, Kai Jie; Li, Sha Sha; Yun, Bo; Ma, Wen Xian; Jiang, Tian Ge; Zhu, Si Quan

    2011-01-08

    To identify the underlying genetic defect in a Chinese family affected with autosomal dominant congenital nuclear cataract. A four-generation Chinese family with inherited nuclear cataract phenotype was recruited. Detailed family history and clinical data were recorded. All reported nuclear cataract-related candidate genes were screened for causative mutations by direct DNA sequencing. Effects of amino acid changes on the structure and function of protein were predicted by bioinformatics analysis. All affected individuals in this family showed nuclear cataracts. Sequencing of the candidate genes revealed a heterozygous c.559C>T change in the coding region of the major intrinsic protein (MIP), which caused a substitution of highly conserved arginine by cysteine at codon 187 (p.R187C). This mutation co-segregated with all affected individuals and was not observed in unaffected family members or 110 ethnically matched controls. Bioinformatics analysis showed that the mutation was predicted to affect the function and secondary structure of MIP protein. This study identified a novel disease-causing mutation p.R187C in MIP in a Chinese cataract family, expanding the mutation spectrum of MIP causing congenital cataract.

  3. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  4. A unified framework for haplotype inference in nuclear families.

    Science.gov (United States)

    Iliadis, Alexandros; Anastassiou, Dimitris; Wang, Xiaodong

    2012-07-01

    Many large genome-wide association studies include nuclear families with more than one child (trio families), allowing for analysis of differences between siblings (sib pair analysis). Statistical power can be increased when haplotypes are used instead of genotypes. Currently, haplotype inference in families with more than one child can be performed either using the familial information or statistical information derived from the population samples but not both. Building on our recently proposed tree-based deterministic framework (TDS) for trio families, we augment its applicability to general nuclear families. We impose a minimum recombinant approach locally and independently on each multiple children family, while resorting to the population-derived information to solve the remaining ambiguities. Thus our framework incorporates all available information (familial and population) in a given study. We demonstrate that using all the constraints in our approach we can have gains in the accuracy as opposed to breaking the multiple children families to separate trios and resorting to a trio inference algorithm or phasing each family in isolation. We believe that our proposed framework could be the method of choice for haplotype inference in studies that include nuclear families with multiple children. Our software (tds2.0) is downloadable from www.ee.columbia.edu/∼anastas/tds. © 2012 The Authors Annals of Human Genetics © 2012 Blackwell Publishing Ltd/University College London.

  5. Families and the prospect of nuclear attack/holocaust

    Energy Technology Data Exchange (ETDEWEB)

    Marciano, T.; Sussman, M.B.

    1986-01-01

    This volume addresses the issues attending the continuing threat of a nuclear holocaust and the effect this threat has on the behavior of families. It examines topics such as denial, involvement in community program social movements and other political actions.

  6. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  7. Goal Direction and Effectiveness, Emotional Maturity, and Nuclear Family Functioning

    Science.gov (United States)

    Klever, Phillip

    2009-01-01

    Differentiation of self, a cornerstone concept in Bowen theory, has a profound influence over time on the functioning of the individual and his or her family unit. This 5-year longitudinal study tested this hypothesis with 50 developing nuclear families. The dimensions of differentiation of self that were examined were goal direction and…

  8. Phospholipid metabolism and nuclear function: roles of the lipin family of phosphatidic acid phosphatases.

    Science.gov (United States)

    Siniossoglou, Symeon

    2013-03-01

    Phospholipids play important roles in nuclear function as dynamic building blocks for the biogenesis of the nuclear membrane, as well as signals by which the nucleus communicates with other organelles, and regulate a variety of nuclear events. The mechanisms underlying the nuclear roles of phospholipids remain poorly understood. Lipins represent a family of phosphatidic acid (PA) phosphatases that are conserved from yeasts to humans and perform essential functions in lipid metabolism. Several studies have identified key roles for lipins and their regulators in nuclear envelope organization, gene expression and the maintenance of lipid homeostasis in yeast and metazoans. This review discusses recent advances in understanding the roles of lipins in nuclear structure and function. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  10. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  11. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  12. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  13. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  14. Nuclear AXIN2 represses MYC gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S., E-mail: gsy3@psu.edu

    2014-01-03

    Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling.

  15. Nuclear AXIN2 represses MYC gene expression

    International Nuclear Information System (INIS)

    Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S.

    2014-01-01

    Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling

  16. The Role of Nuclear Receptor-Binding SET Domain Family Histone Lysine Methyltransferases in Cancer.

    Science.gov (United States)

    Bennett, Richard L; Swaroop, Alok; Troche, Catalina; Licht, Jonathan D

    2017-06-01

    The nuclear receptor-binding SET Domain (NSD) family of histone H3 lysine 36 methyltransferases is comprised of NSD1, NSD2 (MMSET/WHSC1), and NSD3 (WHSC1L1). These enzymes recognize and catalyze methylation of histone lysine marks to regulate chromatin integrity and gene expression. The growing number of reports demonstrating that alterations or translocations of these genes fundamentally affect cell growth and differentiation leading to developmental defects illustrates the importance of this family. In addition, overexpression, gain of function somatic mutations, and translocations of NSDs are associated with human cancer and can trigger cellular transformation in model systems. Here we review the functions of NSD family members and the accumulating evidence that these proteins play key roles in tumorigenesis. Because epigenetic therapy is an important emerging anticancer strategy, understanding the function of NSD family members may lead to the development of novel therapies. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  17. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  18. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  19. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  20. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  1. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  2. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  3. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  4. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  5. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Directory of Open Access Journals (Sweden)

    Ogunjumo Oluwasanmi

    2004-06-01

    Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

  6. The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

    Science.gov (United States)

    Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

    2004-01-01

    Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

  7. Maturing of the nuclear receptor family.

    Science.gov (United States)

    Lazar, Mitchell A

    2017-04-03

    Members of the nuclear receptor (NR) superfamily of ligand-regulated transcription factors play important roles in reproduction, development, and physiology. In humans, genetic mutations in NRs are causes of rare diseases, while hormones and drugs that target NRs are in widespread therapeutic use. The present issue of the JCI includes a series of Review articles focused on specific NRs and their wide range of biological functions. Here I reflect on the past, present, and potential future highlights of research on the NR superfamily.

  8. Mutations in the nuclear bile acid receptor FXR cause progressive familial intrahepatic cholestasis

    Science.gov (United States)

    Gomez-Ospina, Natalia; Potter, Carol J.; Xiao, Rui; Manickam, Kandamurugu; Kim, Mi-Sun; Kim, Kang Ho; Shneider, Benjamin L.; Picarsic, Jennifer L.; Jacobson, Theodora A.; Zhang, Jing; He, Weimin; Liu, Pengfei; Knisely, A. S.; Finegold, Milton J.; Muzny, Donna M.; Boerwinkle, Eric; Lupski, James R.; Plon, Sharon E.; Gibbs, Richard A.; Eng, Christine M.; Yang, Yaping; Washington, Gabriel C.; Porteus, Matthew H.; Berquist, William E.; Kambham, Neeraja; Singh, Ravinder J.; Xia, Fan; Enns, Gregory M.; Moore, David D.

    2016-01-01

    Neonatal cholestasis is a potentially life-threatening condition requiring prompt diagnosis. Mutations in several different genes can cause progressive familial intrahepatic cholestasis, but known genes cannot account for all familial cases. Here we report four individuals from two unrelated families with neonatal cholestasis and mutations in NR1H4, which encodes the farnesoid X receptor (FXR), a bile acid-activated nuclear hormone receptor that regulates bile acid metabolism. Clinical features of severe, persistent NR1H4-related cholestasis include neonatal onset with rapid progression to end-stage liver disease, vitamin K-independent coagulopathy, low-to-normal serum gamma-glutamyl transferase activity, elevated serum alpha-fetoprotein and undetectable liver bile salt export pump (ABCB11) expression. Our findings demonstrate a pivotal function for FXR in bile acid homeostasis and liver protection. PMID:26888176

  9. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  10. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  11. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  12. Television Intertextuality and the Discourse of the Nuclear Family.

    Science.gov (United States)

    Naficy, Hamid

    1989-01-01

    Presents an intertextual approach to reading television. Investigates how the heterosexual nuclear family and its various simulations are circulated within the intertextual flow of television, articulating and distributing "cultural capital." Analyzes a 39-minute segment of television text that includes commercials, news briefs, and the…

  13. The Nuclear Family: Can It Survive the Storm?

    Science.gov (United States)

    Perlman, Matthew

    The nuclear family as a vital support system is being undermined by a wide variety of direct and indirect factors. These factors include rapid technological advances, changes in socially accepted child-rearing techniques, changes in moral values, changes in acceptable sexual practices, effects of an improved educational system, effects of the…

  14. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  15. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  16. Handling missing data in transmission disequilibrium test in nuclear families with one affected offspring.

    Directory of Open Access Journals (Sweden)

    Gulhan Bourget

    Full Text Available The Transmission Disequilibrium Test (TDT compares frequencies of transmission of two alleles from heterozygote parents to an affected offspring. This test requires all genotypes to be known from all members of the nuclear families. However, obtaining all genotypes in a study might not be possible for some families, in which case, a data set results in missing genotypes. There are many techniques of handling missing genotypes in parents but only a few in offspring. The robust TDT (rTDT is one of the methods that handles missing genotypes for all members of nuclear families [with one affected offspring]. Even though all family members can be imputed, the rTDT is a conservative test with low power. We propose a new method, Mendelian Inheritance TDT (MITDT-ONE, that controls type I error and has high power. The MITDT-ONE uses Mendelian Inheritance properties, and takes population frequencies of the disease allele and marker allele into account in the rTDT method. One of the advantages of using the MITDT-ONE is that the MITDT-ONE can identify additional significant genes that are not found by the rTDT. We demonstrate the performances of both tests along with Sib-TDT (S-TDT in Monte Carlo simulation studies. Moreover, we apply our method to the type 1 diabetes data from the Warren families in the United Kingdom to identify significant genes that are related to type 1 diabetes.

  17. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  18. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

    Science.gov (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

    2013-05-01

    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  19. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  20. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  1. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  2. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  3. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  4. Combined analysis of fourteen nuclear genes refines the Ursidae phylogeny.

    Science.gov (United States)

    Pagès, Marie; Calvignac, Sébastien; Klein, Catherine; Paris, Mathilde; Hughes, Sandrine; Hänni, Catherine

    2008-04-01

    Despite numerous studies, questions remain about the evolutionary history of Ursidae and additional independent genetic markers were needed to elucidate these ambiguities. For this purpose, we sequenced ten nuclear genes for all the eight extant bear species. By combining these new sequences with those of four other recently published nuclear markers, we provide new insights into the phylogenetic relationships of the Ursidae family members. The hypothesis that the giant panda was the first species to diverge among ursids is definitively confirmed and the precise branching order within the Ursus genus is clarified for the first time. Moreover, our analyses indicate that the American and the Asiatic black bears do not cluster as sister taxa, as had been previously hypothesised. Sun and sloth bears clearly appear as the most basal ursine species but uncertainties about their exact relationships remain. Since our larger dataset did not enable us to clarify this last question, identifying rare genomic changes in bear genomes could be a promising solution for further studies.

  5. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  6. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  7. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  8. Analysis of nuclear localization of interleukin-1 family cytokines by flow cytometry.

    Science.gov (United States)

    Ross, Ralf; Grimmel, Jan; Goedicke, Sybelle; Möbus, Anna M; Bulau, Ana-Maria; Bufler, Philip; Ali, Shafaqat; Martin, Michael U

    2013-01-31

    The dual function cytokines IL-1α, IL-33 and IL-37 are members of the IL-1 cytokine family. Besides of being able to bind to their cognate receptors on target cells, they can act intracellularly in the producing cell. All three are able to translocate to the nucleus and have been discussed to affect gene expression. In order to compare and quantitate nuclear translocation of these IL-1 family members we established a robust technique which enables to measure nuclear localization on a single cell level by flow cytometry. Vectors encoding fusion proteins of different IL-1 family members with enhanced green fluorescent protein were cloned and cell lines transiently transfected with these. Fluorescent fusion proteins in intact cells or in isolated nuclei were detected subsequently by fluorescence microscopy and flow cytometry, respectively. Depending on the cellular system, cells and nuclei were distinguishable by flow cytometry in forward scatter/sideward scatter. Fluorescent fusion proteins were detectable in isolated nuclei up to three days following preparation. Signal intensity of fusion proteins of IL-33 and IL-37 in isolated nuclei but not of IL-1α, was markedly increased by fixation with paraformaldehyde, directly following cell lysis, indicating that IL-1α binds stronger to nuclear structures than IL-33 and IL-37. Nuclear translocation of fluorescent IL-37 fusion proteins in a stably transfected RAW264.7 mouse macrophage cell line required stimulation with lipopolysaccharide. Applying this method we demonstrated that a prolonged lag phase of more than 15h before LPS-stimulated nuclear translocation was detected. In summary, we present a robust method to analyze and quantitate nuclear localization of IL-1 cytokine family members. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. A R54L mutation of CRYAA associated with autosomal dominant nuclear cataracts in a Chinese family.

    Science.gov (United States)

    Yang, Zhenfei; Su, Dongmei; Li, Qian; Ma, Zicheng; Yang, Fan; Zhu, Siquan; Ma, Xu

    2013-12-01

    To identify the genetic defect in a three-generation Chinese family with congenital cataracts. The phenotype of a three-generation Chinese family with congenital cataract was recruited. Detailed family history and clinical data of the family were recorded. Candidate genes sequencing was performed to screen out the disease-causing mutation. Bioinformatics analysis was performed to predict the function of mutant gene. The phenotype of the family was identified as nuclear cataract. Direct sequencing revealed a c.161 G > T transversion in exon 1 of crystallin alpha-A (CRYAA). This mutation co-segregated with all affected individuals in the family and was not found in unaffected family members nor in the 100 unrelated controls. Bioinformatics analysis indicated that the 54th amino acid position was highly conserved and the mutation R54L caused an increase of local hydrophobicity around the substitution site. This study identified a novel disease-causing mutation c.161 G > T (p.R54L) in CRYAA in a Chinese family with autosomal dominant nuclear cataracts, this is the first report relating a G > T mutation in CRYAA leading to congenital nuclear cataract.

  10. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  11. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  12. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  13. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  14. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  15. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  16. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  17. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  18. Congruent Deep Relationships in the Grape Family (Vitaceae) Based on Sequences of Chloroplast Genomes and Mitochondrial Genes via Genome Skimming.

    Science.gov (United States)

    Zhang, Ning; Wen, Jun; Zimmer, Elizabeth A

    2015-01-01

    Vitaceae is well-known for having one of the most economically important fruits, i.e., the grape (Vitis vinifera). The deep phylogeny of the grape family was not resolved until a recent phylogenomic analysis of 417 nuclear genes from transcriptome data. However, it has been reported extensively that topologies based on nuclear and organellar genes may be incongruent due to differences in their evolutionary histories. Therefore, it is important to reconstruct a backbone phylogeny of the grape family using plastomes and mitochondrial genes. In this study,next-generation sequencing data sets of 27 species were obtained using genome skimming with total DNAs from silica-gel preserved tissue samples on an Illumina NextSeq 500 instrument [corrected]. Plastomes were assembled using the combination of de novo and reference genome (of V. vinifera) methods. Sixteen mitochondrial genes were also obtained via genome skimming using the reference genome of V. vinifera. Extensive phylogenetic analyses were performed using maximum likelihood and Bayesian methods. The topology based on either plastome data or mitochondrial genes is congruent with the one using hundreds of nuclear genes, indicating that the grape family did not exhibit significant reticulation at the deep level. The results showcase the power of genome skimming in capturing extensive phylogenetic data: especially from chloroplast and mitochondrial DNAs.

  19. Congruent Deep Relationships in the Grape Family (Vitaceae Based on Sequences of Chloroplast Genomes and Mitochondrial Genes via Genome Skimming.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available Vitaceae is well-known for having one of the most economically important fruits, i.e., the grape (Vitis vinifera. The deep phylogeny of the grape family was not resolved until a recent phylogenomic analysis of 417 nuclear genes from transcriptome data. However, it has been reported extensively that topologies based on nuclear and organellar genes may be incongruent due to differences in their evolutionary histories. Therefore, it is important to reconstruct a backbone phylogeny of the grape family using plastomes and mitochondrial genes. In this study,next-generation sequencing data sets of 27 species were obtained using genome skimming with total DNAs from silica-gel preserved tissue samples on an Illumina NextSeq 500 instrument [corrected]. Plastomes were assembled using the combination of de novo and reference genome (of V. vinifera methods. Sixteen mitochondrial genes were also obtained via genome skimming using the reference genome of V. vinifera. Extensive phylogenetic analyses were performed using maximum likelihood and Bayesian methods. The topology based on either plastome data or mitochondrial genes is congruent with the one using hundreds of nuclear genes, indicating that the grape family did not exhibit significant reticulation at the deep level. The results showcase the power of genome skimming in capturing extensive phylogenetic data: especially from chloroplast and mitochondrial DNAs.

  20. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  1. A novel mutation in CRYAB associated with autosomal dominant congenital nuclear cataract in a Chinese family.

    Science.gov (United States)

    Chen, Qiang; Ma, Junjie; Yan, Ming; Mothobi, Maneo Emily; Liu, Yuanyuan; Zheng, Fang

    2009-07-10

    To identify the genetic defects associated with autosomal dominant congenital nuclear cataract in a Chinese family. Clinical data were collected, and the phenotypes of the affected members in this family were recorded by slit-lamp photography. Genomic DNA was isolated from peripheral blood. Mutations were screened in cataract-associated candidate genes through polymerase chain reaction (PCR) analyses and sequencing. Structural models of the wild-type and mutant alphaB-crystallin were generated and analyzed by SWISS-MODEL. Mutation screening identified only one heterozygous G-->A transition at nucleotide 32 in the first exon of alphaB-crystallin (CRYAB), resulting in an amino acid change from arginine to histidine at codon 11 (R11H). This mutation segregated in all available affected family members but was not observed in any of the unaffected persons of the family. The putative mutation disrupted a restriction site for the enzyme, Fnu4HI, in the affected family members. The disruption, however, was not found in any of the randomly selected ophthalmologically normal individuals or in 40 unrelated senile cataract patients. Computer-assisted prediction suggested that this mutation affected the biochemical properties as well as the structure of alphaB-crystallin. These results supported the idea that the novel R11H mutation was responsible for the autosomal dominant nuclear congenital cataract in this pedigree.

  2. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  3. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  4. Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.

    Science.gov (United States)

    Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi

    2008-07-01

    Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.

  5. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  6. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  7. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  8. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  9. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  10. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  11. Going nuclear? Family structure and young women's health in India, 1992-2006.

    Science.gov (United States)

    Allendorf, Keera

    2013-06-01

    Scholars traditionally argued that industrialization, urbanization, and educational expansion lead to a decline in extended families and complementary rise in nuclear families. Some have suggested that such transitions are good for young married women because living in nuclear families benefits their health. However, extended families may also present advantages for young women's health that outweigh any disadvantages. Using the Indian National Family Health Survey, this article examines whether young married women living in nuclear families have better health than those in patrilocal extended families. It also examines whether young married women's living arrangements are changing over time and, if so, how such changes will affect their health. Results show that young married women living in nuclear families do not have better health than those in patrilocal extended families. Of eight health outcomes examined, only five differ significantly by family structure. Further, of the five outcomes that differ, four are patrilocal extended-family advantages and only one is a nuclear-family advantage. From 1992 to 2006, the percentage of young married women residing in nuclear families increased, although the majority remained in patrilocal extended families. This trend toward nuclear families will not benefit young women's health.

  12. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  13. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  14. A family-based association study of the HTR1B gene in eating disorders

    Directory of Open Access Journals (Sweden)

    Sandra Hernández

    Full Text Available Objective: To explore the association of three polymorphisms of the serotonin receptor 1Dβ gene (HTR1B in the etiology of eating disorders and their relationship with clinical characteristics. Methods: We analyzed the G861C, A-161T, and A1180G polymorphisms of the HTR1B gene through a family-based association test (FBAT in 245 nuclear families. The sample was stratified into anorexia nervosa (AN spectrum and bulimia nervosa (BN spectrum. In addition, we performed a quantitative FBAT analysis of anxiety severity, depression severity, and Yale-Brown-Cornell Eating Disorders Scale (YBC-EDS in the AN and BN-spectrum groups. Results: FBAT analysis of the A-161T polymorphism found preferential transmission of allele A-161 in the overall sample. This association was stronger when the sample was stratified by spectrums, showing transmission disequilibrium between the A-161 allele and BN spectrum (z = 2.871, p = 0.004. Quantitative trait analysis showed an association between severity of anxiety symptoms and the C861 allele in AN-spectrum participants (z = 2.871, p = 0.004. We found no associations on analysis of depression severity or preoccupation and ritual scores in AN or BN-spectrum participants. Conclusions: Our preliminary findings suggest a role of the HTR1B gene in susceptibility to development of BN subtypes. Furthermore, this gene might have an impact on the severity of anxiety in AN-spectrum patients.

  15. Expression of a transferred nuclear gene in a mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Yichun Qiu

    2014-08-01

    Full Text Available Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements. In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer to the mitochondrial genome and become expressed. Here we show that the orf164 gene in the mitochondrial genome of several Brassicaceae species, including Arabidopsis, is derived from the nuclear ARF17 gene that codes for an auxin responsive protein and is present across flowering plants. Orf164 corresponds to a portion of ARF17, and the nucleotide and amino acid sequences are 79% and 81% identical, respectively. Orf164 is transcribed in several organ types of Arabidopsis thaliana, as detected by RT-PCR. In addition, orf164 is transcribed in five other Brassicaceae within the tribes Camelineae, Erysimeae and Cardamineae, but the gene is not present in Brassica or Raphanus. This study shows that nuclear genes can be transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between the genomes of subcellular compartments.

  16. Nuclear Families and Nuclear Risks: The Effects of Gender, Geography, and Progeny on Attitudes toward a Nuclear Waste Facility

    Science.gov (United States)

    Freudenburg, William R.; Davidson, Debra J.

    2007-01-01

    Studies of reactions to nuclear facilities have found consistent male/female differences, but the underlying reasons have never been well-clarified. The most common expectations involve traditional roles--with men focusing more on economic concerns and with women (especially mothers) being more concerned about family safety/health. Still, with…

  17. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  18. Attachment Stability in Children Aged 6 to 9 Years in Extended and Nuclear Families

    Science.gov (United States)

    Seven, Serdal; Ogelman, Hulya Gulay

    2012-01-01

    Research Findings: The main aim of this study was to identify whether the attachment security of children living in nuclear and extended families is stable from ages 6 to 9 years in a sample of Turkish children. In total, 54 children participated in the study, of whom 27 lived in nuclear families and the other 27 lived in extended families in Mus…

  19. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  20. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  1. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  2. The worldwide holoparasitic Apodanthaceae confidently placed in the Cucurbitales by nuclear and mitochondrial gene trees

    Directory of Open Access Journals (Sweden)

    Renner Susanne S

    2010-07-01

    Full Text Available Abstract Background Of the c. 450 families of flowering plants, only two are left "unplaced" in the most recent APG classification of angiosperms. One of these is the Apodanthaceae, a clade of c. 19 holoparasitic species in two or three genera occurring in North and South America, Africa, the Near East, and Australia. Because of lateral gene transfer between Apodanthaceae and their hosts it has been difficult to infer the family's true closest relatives. Results Here we report a phylogenetic analysis of 16 accessions representing six species of Apodanthaceae from the United States, Chile, Iran, and Australia, using the mitochondrial matR gene and the nuclear 18S gene. Data matrices include 190 matR sequences from up to 95 families in 39 orders of flowering plants and 197 18S sequences from 101 families representing the 16 orders of rosids. Analyses were performed at the nucleotide and at the amino acid level. Both gene trees agree with angiosperm phylogenies found in other studies using more genes. Apodanthaceae and the seven families of the order Cucurbitales form a clade with 100% bootstrap support from matR and 56% from 18 S. In addition, the Apodanthaceae and Cucurbitales matR gene sequences uniquely share two non-synonymous codon changes and one synonymous change, as well as a codon insertion, already found by Barkman et al. (2007. Conclusions Apodanthaceae belong in the Cucurbitales with which they share inferior ovaries, parietal placentation and a dioecious mating system, traits that are ancestral in Cucurbitales and which can now be interpreted as possible synapomorphies of an enlarged order Cucurbitales. The occurrence of Apodanthaceae in the Americas, Africa, the Near East, and Australia, and their adaptation to distantly related host species in the Fabaceae and Salicaceae suggest a long evolutionary history.

  3. Genetic linkage analyses and Cx50 mutation detection in a large multiplex Chinese family with hereditary nuclear cataract.

    Science.gov (United States)

    He, Wei; Li, Xin; Chen, Jiajing; Xu, Ling; Zhang, Feng; Dai, Qiushi; Cui, Hao; Wang, Duen-Mei; Yu, Jun; Hu, Songnian; Lu, Shan

    2011-03-01

    The aim of the study was to characterize the underlying mutation in a large multiplex Chinese family with hereditary nuclear cataract. A 6-generation Chinese family having hereditary nuclear cataract was recruited and clinically verified. Blood DNA samples were obtained from 53 available family members. Linkage analyses were performed on the known candidate regions for hereditary cataract with 36 polymorphic microsatellite markers. To identify mutations related to cataract, a direct sequencing approach was applied to a candidate gene residing in our linkage locus. A linkage locus was identified with a maximum 2-point LOD score of 4.31 (recombination fraction = 0) at marker D1S498 and a maximum multipoint LOD score of 5.7 between markers D1S2344 and D1S498 on chromosome 1q21.1, where the candidate gene Cx50 is located. Direct sequencing of Cx50 showed a 139 G to A transition occurred in all affected family members. This transitional mutation resulted in a replacement of aspartic acid by asparagine at residue 47 (D47N) and led to a loss-of-function of the protein. The D47N mutation of Cx50 causes the hereditary nuclear cataract in this family in an autosomal dominant mode of inheritance with incomplete penetrance.

  4. Dynamical analysis of mCAT2 gene models with CTN-RNA nuclear retention

    International Nuclear Information System (INIS)

    Wang, Qianliang; Zhou, Tianshou

    2015-01-01

    As an experimentally well-studied nuclear-retained RNA, CTN-RNA plays a significant role in many aspects of mouse cationic amino acid transporter 2 (mCAT2) gene expression, but relevant dynamical mechanisms have not been completely clarified. Here we first show that CTN-RNA nuclear retention can not only reduce pre-mCAT2 RNA noise but also mediate its coding partner noise. Then, by collecting experimental observations, we conjecture a heterodimer formed by two proteins, p54 nrb and PSP1, named p54 nrb -PSP1, by which CTN-RNA can positively regulate the expression of nuclear mCAT2 RNA. Therefore, we construct a sequestration model at the molecular level. By analyzing the dynamics of this model system, we demonstrate why most nuclear-retained CTN-RNAs stabilize at the periphery of paraspeckles, how CTN-RNA regulates its protein-coding partner, and how the mCAT2 gene can maintain a stable expression. In particular, we obtain results that can easily explain the experimental phenomena observed in two cases, namely, when cells are stressed and unstressed. Our entire analysis not only reveals that CTN-RNA nuclear retention may play an essential role in indirectly preventing diseases but also lays the foundation for further study of other members of the nuclear-regulatory RNA family with more complicated molecular mechanisms. (paper)

  5. A catalog of observed nuclear magnitudes of Jupiter family comets

    Science.gov (United States)

    Tancredi, G.; Fernández, J. A.; Rickman, H.; Licandro, J.

    2000-10-01

    A catalog of a sample of 105 Jupiter family (JF) comets (defined as those with Tisserand constants T > 2 and orbital periods P International Comet Quarterly Archive of Cometary Photometric Data, the Minor Planet Center (MPC) data base, IAU Circulars, International Comet Quarterly, and a few papers devoted to some particular comets, together with our own observations. Photometric data previous to 1990 have mainly been taken from the Comet Light Curve Catalogue (CLICC) compiled by Kamél (\\cite{kamel}). We discuss the reliability of the reported nuclear magnitudes in relation to the inherent sources of errors and uncertainties, in particular the coma contamination often present even at large heliocentric distances. A large fraction of the JF comets of our sample indeed shows various degrees of activity at large heliocentric distances, which is correlated with recent downward jumps in their perihelion distances. The reliability of coma subtraction methods to compute the nuclear magnitude is also discussed. Most absolute nuclear magnitudes are found in the range 15 - 18, with no magnitudes fainter than H_N ~ 19.5. The catalog can be found at: http://www.fisica.edu.uy/ ~ gonzalo/catalog/. Table 2 and Appendix B are only available in electronic form at http://www.edpsciences.org Table 5 is also available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html

  6. Phylogenetic relationships of Acheilognathidae (Cypriniformes: Cyprinoidea) as revealed from evidence of both nuclear and mitochondrial gene sequence variation: Evidence for necessary taxonomic revision in the family and the identification of cryptic species

    Czech Academy of Sciences Publication Activity Database

    Chang, H.-C.; Li, F.; Shao, K.-T.; Lin, Y.-S.; Morosawa, T.; Kim, S.; Koo, H.; Kim, W.; Lee, J.-S.; He, S.; Smith, Carl; Reichard, Martin; Miya, M.; Sado, T.; Uehara, K.; Lavoué, S.; Chen, W.-J.; Mayden, R. L.

    2014-01-01

    Roč. 81, December (2014), s. 182-194 ISSN 1055-7903 Institutional support: RVO:68081766 Keywords : Acheilognathinae * Cyprinidae * Cryptic species * Nuclear loci * Cytochrome b * European bitterling Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.916, year: 2014

  7. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  8. A Novel Insertion Variant of CRYGD Is Associated with Congenital Nuclear Cataract in a Chinese Family.

    Science.gov (United States)

    Zhuang, Xiaotong; Wang, Lianqing; Song, Zixun; Xiao, Wei

    2015-01-01

    To investigate a novel insertion variant of CRYGD identified in a Chinese family with nuclear congenital cataract. A Chinese family with congenital nuclear cataract was recruited for the mutational screening of candidate genes by direct sequencing. Recombinant N-terminal Myc tagged wildtype or mutant CRYGD was expressed in HEK293T cells. The expression pattern, protein solubility and subcellular distribution were analyzed by western blotting and immunofluorescence. A novel insertion variant, c.451_452insGACT, in CRYGD was identified in the patients. It causes a frameshift and a premature termination of the polypeptide to become Y151*. A significantly reduced solubility was observed for this mutant. Unlike wildtype CRYGD, which existed mainly in the cytoplasm, Y151* was mis-located in the nucleus. We have identified a novel mutation, c.451_452insGACT, in CRYGD, which is associated with nuclear cataract. This is the first insertion mutation of CRYGD found to cause autosomal dominant congenital cataract. The mutant protein, with loss of solubility and localization to the nucleus, is hypothesized to be the major cause of cataract in these patients.

  9. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  10. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  11. Nuclear Gene Indicates Coat-Color Polymorphism in Mammoths

    DEFF Research Database (Denmark)

    Römpler, Holger; Rohland, Nadin; Lalueza-Fox, Carles

    2006-01-01

    By amplifying the melanocortin type 1 receptor from the woolly mammoth, we can report the complete nucleotide sequence of a nuclear-encoded gene from an extinct species. We found two alleles and show that one allele produces a functional protein whereas the other one encodes a protein with strongly...

  12. Adducin family proteins possess different nuclear export potentials.

    Science.gov (United States)

    Liu, Chia-Mei; Hsu, Wen-Hsin; Lin, Wan-Yi; Chen, Hong-Chen

    2017-05-10

    The adducin (ADD) family proteins, namely ADD1, ADD2, and ADD3, are actin-binding proteins that play important roles in the stabilization of membrane cytoskeleton and cell-cell junctions. All the ADD proteins contain a highly conserved bipartite nuclear localization signal (NLS) at the carboxyl termini, but only ADD1 can localize to the nucleus. The reason for this discrepancy is not clear. To avoid the potential effect of cell-cell junctions on the distribution of ADD proteins, HA epitope-tagged ADD proteins and mutants were transiently expressed in NIH3T3 fibroblasts and their distribution in the cytoplasm and nucleus was examined by immunofluorescence staining. Several nuclear proteins were identified to interact with ADD1 by mass spectrometry, which were further verified by co-immunoprecipitation. In this study, we found that ADD1 was detectable both in the cytoplasm and nucleus, whereas ADD2 and ADD3 were detected only in the cytoplasm. However, ADD2 and ADD3 were partially (~40%) sequestered in the nucleus by leptomycin B, a CRM1/exportin1 inhibitor. Upon the removal of leptomycin B, ADD2 and ADD3 re-distributed to the cytoplasm. These results indicate that ADD2 and ADD3 possess functional NLS and are quickly transported to the cytoplasm upon entering the nucleus. Indeed, we found that ADD2 and ADD3 possess much higher potential to counteract the activity of the NLS derived from Simian virus 40 large T-antigen than ADD1. All the ADD proteins appear to contain multiple nuclear export signals mainly in their head and neck domains. However, except for the leucine-rich motif ( 377 FEALMRMLDWLGYRT 391 ) in the neck domain of ADD1, no other classic nuclear export signal was identified in the ADD proteins. In addition, the nuclear retention of ADD1 facilitates its interaction with RNA polymerase II and zinc-finger protein 331. Our results suggest that ADD2 and ADD3 possess functional NLS and shuttle between the cytoplasm and nucleus. The discrepancy in the

  13. Karyopherin alpha7 (KPNA7), a divergent member of the importin alpha family of nuclear import receptors.

    Science.gov (United States)

    Kelley, Joshua B; Talley, Ashley M; Spencer, Adam; Gioeli, Daniel; Paschal, Bryce M

    2010-08-11

    Classical nuclear localization signal (NLS) dependent nuclear import is carried out by a heterodimer of importin alpha and importin beta. NLS cargo is recognized by importin alpha, which is bound by importin beta. Importin beta mediates translocation of the complex through the central channel of the nuclear pore, and upon reaching the nucleus, RanGTP binding to importin beta triggers disassembly of the complex. To date, six importin alpha family members, encoded by separate genes, have been described in humans. We sequenced and characterized a seventh member of the importin alpha family of transport factors, karyopherin alpha 7 (KPNA7), which is most closely related to KPNA2. The domain of KPNA7 that binds Importin beta (IBB) is divergent, and shows stronger binding to importin beta than the IBB domains from of other importin alpha family members. With regard to NLS recognition, KPNA7 binds to the retinoblastoma (RB) NLS to a similar degree as KPNA2, but it fails to bind the SV40-NLS and the human nucleoplasmin (NPM) NLS. KPNA7 shows a predominantly nuclear distribution under steady state conditions, which contrasts with KPNA2 which is primarily cytoplasmic. KPNA7 is a novel importin alpha family member in humans that belongs to the importin alpha2 subfamily. KPNA7 shows different subcellular localization and NLS binding characteristics compared to other members of the importin alpha family. These properties suggest that KPNA7 could be specialized for interactions with select NLS-containing proteins, potentially impacting developmental regulation.

  14. Extensive paraphylies within sharks of the order Carcharhiniformes inferred from nuclear and mitochondrial genes.

    Science.gov (United States)

    Iglésias, Samuel P; Lecointre, Guillaume; Sellos, Daniel Y

    2005-03-01

    Using nuclear coding and mitochondrial ribosomal genes we try to clarify relationships within Carcharhiniformes with special focus on the two most problematic groups: scyliorhinids and triakids. The mitochondrial aligned sequences are 1542 bp long, and include principally portion of 16S rRNA gene. They are obtained for two outgroup species and 43 Carcharhiniformes species, covering 5 of the 8 families and 15 of the 48 genera of the order. The nuclear RAG1 sequences are 1454 bp long, and are obtained for 17 species representative of the diversity of all species sampled. We used Maximum Parsimony and Maximum Likelihood criteria for tree reconstruction. Paraphylies within the family Scyliorhinidae was proposed for the first time by Maisey [Zool. J. Linn. Soc. 82, 33, 1984] in a morphological cladistic analysis. This result has never been proposed again until recently from molecular phylogenies [Mol. Phylogenet. Evol. 31, 214, 2004]. Here, independent and simultaneous analyses of nuclear and mitochondrial data are congruent in supporting the paraphyly of scyliorhinids. Two groups of scyliorhinids are obtained, thoroughly in line with discrimination proposed by previous authors, based on presence/absence of supraorbital crests on the chondrocranium. The first group (Scyliorhinus+Cephaloscyllium) is basal within carcharhiniforms and the second group (Apristurus+Asymbolus+Cephalurus+Galeus+Parmaturus) is sister group of all the other families investigated (Carcharhinidae, Proscyllidae, Pseudotriakidae, and Triakidae). The paraphyly of triakids appeared probable but more investigations are needed. In conclusion several independent morphological and molecular phylogenetic studies support paraphyly within scyliorhinids. So we propose a new classification for the group, with the redefinition of the family Scyliorhinidae sensu stricto and the resurrection of the family Pentanchidae with a new definition.

  15. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  16. A nonsense mutation of γD-crystallin associated with congenital nuclear and posterior polar cataract in a Chinese family.

    Science.gov (United States)

    Zhai, Yi; Li, Jinyu; Zhu, Yanan; Xia, Yan; Wang, Wei; Yu, Yinhui; Yao, Ke

    2014-01-01

    The goal of this study was to characterize the disease-causing mutations in a Chinese family with congenital nuclear and posterior polar cataracts. Clinical data of patients in the family were recorded using slit-lamp photography and high definition video. Genomic DNA samples were extracted from the peripheral blood of the pedigree members and 100 healthy controls. Mutation screening was performed in the candidate genes by bi-directional sequencing of the amplified products. The congenital cataract phenotype of the pedigree was identified by slit-lamp examinations and observation during surgery as nuclear and posterior polar cataracts. Through the sequencing of the candidate genes, a heterozygous c. 418C>T change was detected in the coding region of the γD-crystallin gene (CRYGD). As a result of this change, a highly conserved arginine residue was replaced by a stop codon (p. R140X). This change was discovered among all of the affected individuals with cataracts, but not among the unaffected family members or the 100 ethnically matched controls. This study identified a novel congenital nuclear and posterior polar cataract phenotype caused by the recurrent mutation p. R140X in CRYGD.

  17. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  18. The etiology of social aggression: a nuclear twin family study.

    Science.gov (United States)

    Slawinski, Brooke L; Klump, Kelly L; Burt, S Alexandra

    2018-04-02

    Social aggression is a form of antisocial behavior in which social relationships and social status are used to damage reputations and inflict emotional harm on others. Despite extensive research examining the prevalence and consequences of social aggression, only a few studies have examined its genetic-environmental etiology, with markedly inconsistent results. We estimated the etiology of social aggression using the nuclear twin family (NTF) model. Maternal-report, paternal-report, and teacher-report data were collected for twin social aggression (N = 1030 pairs). We also examined the data using the classical twin (CT) model to evaluate whether its strict assumptions may have biased previous heritability estimates. The best-fitting NTF model for all informants was the ASFE model, indicating that additive genetic, sibling environmental, familial environmental, and non-shared environmental influences significantly contribute to the etiology of social aggression in middle childhood. However, the best-fitting CT model varied across informants, ranging from AE and ACE to CE. Specific heritability estimates for both NTF and CT models also varied across informants such that teacher reports indicated greater genetic influences and father reports indicated greater shared environmental influences. Although the specific NTF parameter estimates varied across informants, social aggression generally emerged as largely additive genetic (A = 0.15-0.77) and sibling environmental (S = 0.42-0.72) in origin. Such findings not only highlight an important role for individual genetic risk in the etiology of social aggression, but also raise important questions regarding the role of the environment.

  19. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  20. Inferring kangaroo phylogeny from incongruent nuclear and mitochondrial genes.

    Directory of Open Access Journals (Sweden)

    Matthew J Phillips

    Full Text Available The marsupial genus Macropus includes three subgenera, the familiar large grazing kangaroos and wallaroos of M. (Macropus and M. (Osphranter, as well as the smaller mixed grazing/browsing wallabies of M. (Notamacropus. A recent study of five concatenated nuclear genes recommended subsuming the predominantly browsing Wallabia bicolor (swamp wallaby into Macropus. To further examine this proposal we sequenced partial mitochondrial genomes for kangaroos and wallabies. These sequences strongly favour the morphological placement of W. bicolor as sister to Macropus, although place M. irma (black-gloved wallaby within M. (Osphranter rather than as expected, with M. (Notamacropus. Species tree estimation from separately analysed mitochondrial and nuclear genes favours retaining Macropus and Wallabia as separate genera. A simulation study finds that incomplete lineage sorting among nuclear genes is a plausible explanation for incongruence with the mitochondrial placement of W. bicolor, while mitochondrial introgression from a wallaroo into M. irma is the deepest such event identified in marsupials. Similar such coalescent simulations for interpreting gene tree conflicts will increase in both relevance and statistical power as species-level phylogenetics enters the genomic age. Ecological considerations in turn, hint at a role for selection in accelerating the fixation of introgressed or incompletely sorted loci. More generally the inclusion of the mitochondrial sequences substantially enhanced phylogenetic resolution. However, we caution that the evolutionary dynamics that enhance mitochondria as speciation indicators in the presence of incomplete lineage sorting may also render them especially susceptible to introgression.

  1. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  2. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  3. Haplotype phasing and inheritance of copy number variants in nuclear families.

    Science.gov (United States)

    Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido

    2015-01-01

    DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.

  4. Haplotype phasing and inheritance of copy number variants in nuclear families.

    Directory of Open Access Journals (Sweden)

    Priit Palta

    Full Text Available DNA copy number variants (CNVs that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i phase normal and CNV-carrying haplotypes in the copy number variable regions, ii resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.

  5. The Myth of the Nuclear Family: Historical Background and Clinical Implications.

    Science.gov (United States)

    Uzoka, Azubike Felix

    1979-01-01

    Research reviewed indicates that the concept of the nuclear family is inadequate and misleading for an understanding of family dynamics or a guide for therapeutic intervention. Nonetheless, clinical practitioners and psychological theorists foster the nuclear myth. A new approach to the study of human relationships is needed. (Author/GC)

  6. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  7. Parathyroid hormone induces the Nrna family of nuclear orphan receptors in vivo

    International Nuclear Information System (INIS)

    Pirih, Flavia Q.; Aghaloo, Tara L.; Bezouglaia, Olga; Nervina, Jeanne M.; Tetradis, Sotirios

    2005-01-01

    Parathyroid hormone (PTH) has both anabolic and catabolic effects on bone metabolism, although the molecular mechanisms mediating these effects are largely unknown. Among the transcription factors induced by Pth in osteoblasts are the nerve growth factor-inducible factor B (NR4A; NGFI-B) family of orphan nuclear receptors: Nurr1, Nur77, and NOR-1. PTH induces NR4A members through the cAMP-protein kinase A (PKA) pathway in vitro. We report here that PTH rapidly and transiently induced expression of all three NR4A genes in PTH-target tissues in vivo. In calvaria, long bones, and kidneys, NR4A induction was maximal 0.5-1 h after a single intraperitoneal (i.p.) injection of 80 μg/kg PTH. Nur77 demonstrated the highest expression, followed, in order, by Nurr1 and NOR-1. In calvaria and long bone, PTH-induced expression of each NR4A gene was detectable at 10 μg/kg i.p. with maximum induction at 40-80 μg/kg. PTH (3-34) did not induce NR4A mRNA levels in calvaria, long bone, and kidney in vivo, confirming our in vitro results that NR4A genes are induced primarily through the cAMP-PKA pathway. The magnitude of PTH-induced NR4A expression was comparable in vivo and in vitro. However, NR4A mRNA levels peaked and returned to baseline faster in vivo. Both in vivo and in vitro, PTH induced NR4A pre-mRNA levels suggesting that induction of these genes is, at least in part, through activation of mRNA synthesis. The in vivo induction of the NR4A family members by PTH suggests their involvement in, at least some, PTH-induced changes in bone metabolism

  8. Nuclear localization of SNARK; its impact on gene expression

    International Nuclear Information System (INIS)

    Kuga, Wataru; Tsuchihara, Katsuya; Ogura, Tsutomu; Kanehara, Sakyo; Saito, Marie; Suzuki, Atsushi; Esumi, Hiroyasu

    2008-01-01

    SNARK, a member of the AMPK-related kinases, has been involved in the cellular stress responses but its precise mechanisms remain unclear. Subcellular localization of SNARK protein was identified. Unlike cytoplasmic localizing AMPKα, SNARK was predominantly localized in the nucleus. SNARK was constitutively distributed in the nucleus even when SNARK was activated by metabolic stimuli such as AICAR and glucose-deprivation. Conserved nuclear localization signal (NLS) was identified at the N-terminal portion ( 68 KKAR 71 ). Deletion and point mutation of this part resulted in the cytoplasmic translocation of mutant proteins. Furthermore, GFP fused with the SNARK fragment containing 68 KKAR 71 translocated to the nucleus. A microarray analysis revealed that the nuclear localizing SNARK altered transcriptome profiles and a considerable part of these alterations were canceled by the mutation of NLS, suggesting the ability of SNARK to modulate gene expression dependent on its nuclear localization.

  9. Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice

    Directory of Open Access Journals (Sweden)

    Shuchi eSmita

    2015-12-01

    Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought

  10. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  11. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  12. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  13. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  14. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  15. Familial aggregation in blood pressure and body composition in portuguese nuclear families

    Directory of Open Access Journals (Sweden)

    Rogério César Fermino

    2008-06-01

    Full Text Available The aims of this study were (1 to verify the indirect presence of vertical transmission of genetic factors between parents and children in blood pressure (BP and body composition (BC, and (2 identify the infl uence of genetic factors in the variability of BP and BC. Sample size comprises 367 subjects (164 parents: 41±4.6 years old and 203 children of 13.2±3 years old from 107 nuclear families participating in the project “FAMÍLIAS ACTIVAS”; they proceed from different regions of North of Portugal (36 from Vouzela, 36 from Esposende, 25 from Vila Nova de Paiva and 10 from Vila Nova de Famalicão. BP was measured with an automatic digital device, Omron® model M6 (HEM-7001-E. BC phenotypes were assessed with a bioelectric impedance device from Tanita® model BC-418 (Tanita Corp., Tokyo, Japan. PEDSTATS was used to verify the structure of each family and to analyze the generic behavior of the variables in family members. FCOR and ASSOC modules, from Genetic Epidemiology S.A.G.E. 5.3 software, were use to calculate correlations (r and the heritability (h2 of different phenotypes. Signifi cant level was set at 0.05. Main results evidenced an important familial aggregation between family members for systolic BP (SBP (0.01≤ r ≤0.35, and diastolic BP (DBP (0.24≤ r ≤0.50 the same occurred for BC phenotypes (-0.15≤ r ≤0.65. Genetic factors contributed to 43% of the SBP and 49% of DBP variation; the same occurred for BC phenotypes ranging from 35 to 46% of the total variation. The conclusions were that (1 a strong familial aggregation exists in the BP and the BC in this sample of portuguese nuclear families and that (2 genetic factors play important role in these phenotypes.ResumoO objetivo deste estudo foi (1 verifi car a presença indireta de transmissão vertical de fatores genéticos entre progenitores e descendentes na pressão arterial (PA e na composição corporal (CC, e (2 estimar a contribuição dos fatores genéticos que s

  16. On sensitivity of gamma families to the model of nuclear interaction

    International Nuclear Information System (INIS)

    Krys, A.; Tomaszewski, A.; Wrotniak, J.A.

    1980-01-01

    A variety of 5 different models of nuclear interaction has been used in a Monte Carlo simulation of nuclear and electromagnetic showers in the atmosphere. The gamma families obtained from this simulation were processed in a way, analogous to one employed in analysis of Pamir experimental results. The sensitivity of observed pattern to the nuclear interaction model assumptions was investigated. Such sensitivity, though not a strong one, was found. In case of longitudinal (or energetical) family characteristics, the changes in nuclear interaction should be really large, if they were to be reflected in the experimental data -with all methodical error possibilities. The transverse characteristics of gamma families are more sensitive to the assumed transverse momentum distribution, but they feel the longitudinal features of nuclear interaction as well. Additionally, there was tested the dependence of observed family pattern on some methodical effects (resolving power of X-ray film, radial cut-off and energy underestimation.) (author)

  17. Upregulation of human heme oxygenase gene expression by Ets-family proteins.

    Science.gov (United States)

    Deramaudt, B M; Remy, P; Abraham, N G

    1999-03-01

    Overexpression of human heme oxygenase-1 has been shown to have the potential to promote EC proliferation and angiogenesis. Since Ets-family proteins have been shown to play an important role in angiogenesis, we investigated the presence of ETS binding sites (EBS), GGAA/T, and ETS protein contributing to human HO-1 gene expression. Several chloramphenicol acetyltransferase constructs were examined in order to analyze the effect of ETS family proteins on the transduction of HO-1 in Xenopus oocytes and in microvessel endothelial cells. Heme oxygenase promoter activity was up-regulated by FLI-1ERGETS-1 protein(s). Chloramphenicol acetyltransferase (CAT) assays demonstrated that the promoter region (-1500 to +19) contains positive and negative control elements and that all three members of the ETS protein family were responsible for the up-regulation of HHO-1. Electrophoretic mobility shift assays (EMSA), performed with nuclear extracts from endothelial cells overexpressing HHO-1 gene, and specific HHO-1 oligonucleotides probes containing putative EBS resulted in a specific and marked bandshift. Synergistic binding was observed in EMSA between AP-1 on the one hand, FLI-1, ERG, and ETS-1 protein on the other. Moreover, 5'-deletion analysis demonstrated the existence of a negative control element of HHO-1 expression located between positions -1500 and -120 on the HHO-1 promoter. The presence of regulatory sequences for transcription factors such as ETS-1, FLI-1, or ERG, whose activity is associated with cell proliferation, endothelial cell differentiation, and matrix metalloproteinase transduction, may be an indication of the important role that HO-1 may play in coronary collateral circulation, tumor growth, angiogenesis, and hemoglobin-induced endothelial cell injuries.

  18. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  19. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  20. Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

    Science.gov (United States)

    Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

    2012-04-01

    Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

  1. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  2. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  3. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  4. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  5. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  6. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  7. Infection-triggered familial or recurrent cases of acute necrotizing encephalopathy caused by mutations in a component of the nuclear pore, RANBP2

    DEFF Research Database (Denmark)

    Neilson, Derek E; Adams, Mark D; Orr, Caitlin M D

    2009-01-01

    a susceptibility locus (ANE1) in a family segregating recurrent ANE as an incompletely penetrant, autosomal-dominant trait. We now report that all affected individuals and obligate carriers in this family are heterozygous for a missense mutation (c.1880C-->T, p.Thr585Met) in the gene encoding the nuclear pore...... protein Ran Binding Protein 2 (RANBP2). To determine whether this mutation is the susceptibility allele, we screened controls and other patients with ANE who are unrelated to the index family. Patients from 9 of 15 additional kindreds with familial or recurrent ANE had the identical mutation. It arose de...... novo in two families and independently in several other families. Two other patients with familial ANE had different RANBP2 missense mutations that altered conserved residues. None of the three RANBP2 missense mutations were found in 19 patients with isolated ANE or in unaffected controls. We conclude...

  8. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  9. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  10. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  11. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  12. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  13. A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

    Science.gov (United States)

    Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

    2012-08-06

    The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

  14. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  15. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  16. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  17. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  18. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species.

    Science.gov (United States)

    Ansari, Hifzur Rahman; Templeton, Thomas J; Subudhi, Amit Kumar; Ramaprasad, Abhinay; Tang, Jianxia; Lu, Feng; Naeem, Raeece; Hashish, Yasmeen; Oguike, Mary C; Benavente, Ernest Diez; Clark, Taane G; Sutherland, Colin J; Barnwell, John W; Culleton, Richard; Cao, Jun; Pain, Arnab

    2016-10-01

    Malaria in humans is caused by six species of Plasmodium parasites, of which the nuclear genome sequences for the two Plasmodium ovale spp., P. ovale curtisi and P. ovale wallikeri, and Plasmodium malariae have not yet been analyzed. Here we present an analysis of the nuclear genome sequences of these three parasites, and describe gene family expansions therein. Plasmodium ovale curtisi and P. ovale wallikeri are genetically distinct but morphologically indistinguishable and have sympatric ranges through the tropics of Africa, Asia and Oceania. Both P. ovale spp. show expansion of the surfin variant gene family, and an amplification of the Plasmodium interspersed repeat (pir) superfamily which results in an approximately 30% increase in genome size. For comparison, we have also analyzed the draft nuclear genome of P. malariae, a malaria parasite causing mild malaria symptoms with a quartan life cycle, long-term chronic infections, and wide geographic distribution. Plasmodium malariae shows only a moderate level of expansion of pir genes, and unique expansions of a highly diverged transmembrane protein family with over 550 members and the gamete P25/27 gene family. The observed diversity in the P. ovale wallikeri and P. ovale curtisi surface antigens, combined with their phylogenetic separation, supports consideration that the two parasites be given species status. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species

    KAUST Repository

    Ansari, Hifzur Rahman; Templeton, Thomas J.; Subudhi, Amit; Ramaprasad, Abhinay; Tang, Jianxia; Lu, Feng; Naeem, Raeece; Hashish, Yasmeen; Oguike, Mary C.; Benavente, Ernest Diez; Clark, Taane G.; Sutherland, Colin J.; Barnwell, John W.; Culleton, Richard; Cao, Jun; Pain, Arnab

    2016-01-01

    Malaria in humans is caused by six species of Plasmodium parasites, of which the nuclear genome sequences for the two Plasmodium ovale spp., P. ovale curtisi and P. ovale wallikeri, and Plasmodium malariae have not yet been analyzed. Here we present an analysis of the nuclear genome sequences of these three parasites, and describe gene family expansions therein. Plasmodium ovale curtisi and P. ovale wallikeri are genetically distinct but morphologically indistinguishable and have sympatric ranges through the tropics of Africa, Asia and Oceania. Both P. ovale spp. show expansion of the surfin variant gene family, and an amplification of the Plasmodium interspersed repeat (pir) superfamily which results in an approximately 30% increase in genome size. For comparison, we have also analyzed the draft nuclear genome of P. malariae, a malaria parasite causing mild malaria symptoms with a quartan life cycle, long-term chronic infections, and wide geographic distribution. Plasmodium malariae shows only a moderate level of expansion of pir genes, and unique expansions of a highly diverged transmembrane protein family with over 550 members and the gamete P25/27 gene family. The observed diversity in the P. ovale wallikeri and P. ovale curtisi surface antigens, combined with their phylogenetic separation, supports consideration that the two parasites be given species status.

  20. Genome-scale comparison of expanded gene families in Plasmodium ovale wallikeri and Plasmodium ovale curtisi with Plasmodium malariae and with other Plasmodium species

    KAUST Repository

    Ansari, Hifzur Rahman

    2016-07-05

    Malaria in humans is caused by six species of Plasmodium parasites, of which the nuclear genome sequences for the two Plasmodium ovale spp., P. ovale curtisi and P. ovale wallikeri, and Plasmodium malariae have not yet been analyzed. Here we present an analysis of the nuclear genome sequences of these three parasites, and describe gene family expansions therein. Plasmodium ovale curtisi and P. ovale wallikeri are genetically distinct but morphologically indistinguishable and have sympatric ranges through the tropics of Africa, Asia and Oceania. Both P. ovale spp. show expansion of the surfin variant gene family, and an amplification of the Plasmodium interspersed repeat (pir) superfamily which results in an approximately 30% increase in genome size. For comparison, we have also analyzed the draft nuclear genome of P. malariae, a malaria parasite causing mild malaria symptoms with a quartan life cycle, long-term chronic infections, and wide geographic distribution. Plasmodium malariae shows only a moderate level of expansion of pir genes, and unique expansions of a highly diverged transmembrane protein family with over 550 members and the gamete P25/27 gene family. The observed diversity in the P. ovale wallikeri and P. ovale curtisi surface antigens, combined with their phylogenetic separation, supports consideration that the two parasites be given species status.

  1. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  2. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  3. The PSI family of nuclear proteins is required for growth in arabidopsis.

    Science.gov (United States)

    Stührwohldt, Nils; Hartmann, Jens; Dahlke, Renate I; Oecking, Claudia; Sauter, Margret

    2014-10-01

    PSI1 was identified as a gene that is co-expressed with the phytosulfokine (PSK) receptor genes PSKR1 and PSKR2 in Arabidopsis thaliana. It represents a plant-specific protein family of unknown function with six members in two clades. Clade 1 members PSI1, PSI2 and PSI3 were characterized in this study. All three are nuclear localized. A predicted N-terminal myristoylation site was functionally analyzed. psi1-1 seedlings have shorter roots and hypocotyls. This growth-retarded phenotype was restored by expression of either wildtype PSI1 or PSI1 G2A with a mutated myristate attachment site in the psi1-1 background suggesting that myristate attachment was not essential for PSI1 function. psi2-1 and psi3-1 seedlings have a wildtype phenotype but overexpression of PSI1 or PSI2 promoted seedling growth. PSI2 activity appears to be linked to PSK signaling as psi2-1 and psi2-1 psi3-1 roots are unresponsive to PSK. PSI3 functions in vegetative plant growth synergistic with PSI2. psi3-1 and particularly psi2-1 psi3-1 rosettes are small. Overexpression of PSI3 promoted plant growth indicating that PSI3 is limiting at the vegetative stage. Severe dwarfism of psi2-1 psi3-1 plants results from reduced cell growth and proliferation and premature leaf growth arrest. Plants further display reduced fertility and premature senescence revealing a crucial function of PSI proteins in vegetative growth and reproduction. Psi single and double knock-out plants have less and PSI3ox plants have more starch compared to wt and growth retardation is partially rescued by sucrose. Our studies reveal a crucial function of the nuclear-localized PSI proteins in growth possibly through metabolic control.

  4. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  5. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  6. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  7. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  8. Adaptation and Integration in the Nuclear Family: Some Thoughts on the Current Status of the Theory.

    Science.gov (United States)

    O'Neill, Michael

    The paper briefly outlines some of the factors which influence the differentiation of leadership roles in the nuclear family, such that it may or may not occur, and that it may or may not occur along lines of sexual identity. Three general categories of factors are discussed: (1) the impact of individual differences in the family members; (2) the…

  9. Childhood Problems in a Sudanese City: A Comparison of Extended and Nuclear Families.

    Science.gov (United States)

    Al Awad, Ahmed M. El Hassan; Sonuga-Barke, Edmund J. S.

    1992-01-01

    Compared mothers' ratings of childhood problems of 4- to 9-year-old Sudanese children. Compared to children in extended families, children in nuclear families had more conduct, emotional, and sleep problems; exhibited poorer self-care and greater overdependence; and were less likely to be breastfed and have grandmothers involved in their care. (BC)

  10. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  11. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  12. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  13. A novel T→G splice site mutation of CRYBA1/A3 associated with autosomal dominant nuclear cataracts in a Chinese family.

    Science.gov (United States)

    Yang, Zhenfei; Su, Dongmei; Li, Qian; Yang, Fan; Ma, Zicheng; Zhu, Siquan; Ma, Xu

    2012-01-01

    The purpose of this study was to identify the disease-causing mutation and the molecular phenotype that are responsible for the presence of an autosomal dominant congenital nuclear cataract disease in a Chinese family. The family history and clinical data were recorded. The patients were given a physical examination and their blood samples were collected for DNA extraction. Direct sequencing was used to detect the mutation. Transcription analysis of the mutant crystallin, beta A1 (CRYBA1/A3) gene was performed to verify whether the defective mutation had influenced the splice of the mature mRNA. The phenotype of the congenital cataract in the family was identified as a nuclear cataract type, by using slit-lamp photography. Direct sequencing revealed a novel mutation IVS3+2 T→G in CRYBA1/A3. This mutation co-segregated with all affected individuals in the family, but was not found in unaffected family members nor in the 100 unrelated controls. Transcription analysis of the mutant CRYBA1/A3 gene indicated that this mutation had influenced the splice of the mature mRNA. Our study identified a novel splice site mutation in CRYBA1/A3. This mutation was responsible for aberrant splicing of the mature mRNA and had caused the congenital nuclear cataracts in the family. This is the first report relating an IVS3+2 T→G mutation of CRYBA1/A3 to congenital cataracts.

  14. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  15. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  16. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  17. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  18. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  19. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  20. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    Science.gov (United States)

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  1. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  2. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  3. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  4. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  5. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  6. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  7. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  8. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  9. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

    Science.gov (United States)

    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

    2014-12-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; Pperipheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative

  10. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  11. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  12. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  13. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  14. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  15. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  16. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  17. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2018-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...

  18. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  19. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  20. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  1. Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia.

    Science.gov (United States)

    Kojima, Kenji K; Jurka, Jerzy

    2015-01-01

    Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an "archaeal" RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes.

  2. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  3. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Li

    2018-05-01

    Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

  4. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  5. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  6. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  7. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  8. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  9. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  10. Nuclear deformation and expression change of cartilaginous genes during in vitro expansion of chondrocytes

    International Nuclear Information System (INIS)

    Hoshiba, Takashi; Yamada, Tomoe; Lu, Hongxu; Kawazoe, Naoki; Tateishi, Tetsuya; Chen, Guoping

    2008-01-01

    Cartilaginous gene expression decreased when chondrocytes were expanded on cell-culture plates. Understanding the dedifferentiation mechanism may provide valuable insight into cartilage tissue engineering. Here, we demonstrated the relationship between the nuclear shape and gene expression during in vitro expansion culture of chondrocytes. Specifically, the projected nuclear area increased and cartilaginous gene expressions decreased during in vitro expansion culture. When the nuclear deformation was recovered by cytochalasin D treatment, aggrecan expression was up-regulated and type I collagen (Col1a2) expression was down-regulated. These results suggest that nuclear deformation may be one of the mechanisms for chondrocyte dedifferentiation during in vitro expansion culture

  11. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  12. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  13. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  14. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  15. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  16. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...

  17. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.

    2016-01-01

    -causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  18. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis o...

  19. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, ... Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. ..... between red-winged blackbirds and European starlings. ... Academic Press,.

  20. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  1. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  2. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  3. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  5. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  7. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  8. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  9. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  10. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  11. The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

    Science.gov (United States)

    Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

    2014-05-01

    Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  13. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  14. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  15. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    International Nuclear Information System (INIS)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-01-01

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  16. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Junpeng [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Cao, Xiaoli; Shi, Shandang [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Yuling [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Wang, Kai; Liu, Shengjie [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Chen, Dan [School of Life Sciences and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Chen, Qin [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Haoli, E-mail: mahaoli@nwsuaf.edu.cn [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China)

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  17. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  18. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  19. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  20. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  1. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  2. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  3. Familial placement and relations of Rehmannia and Triaenophora (Scrophulariaceae s.l.) inferred from five gene regions.

    Science.gov (United States)

    Xia, Zhi; Wang, Yin-Zheng; Smith, James F

    2009-02-01

    Accurate classification systems based on evolution are imperative for biological investigations. The recent explosion of molecular phylogenetics has resulted in a much improved classification of angiosperms. More than five phylogenetic lineages have been recognized from Scrophulariaceae sensu lato since the family was determined to be polyphyletic; however, questions remain about the genera that have not been assigned to one of the segregate families of Scrophulariaceae s.l. Rehmannia Liboschitz and Triaenophora Solereder are such genera with uncertain familial placement. There also is debate whether Triaenophora should be segregated from Rehmannia. To evaluate the phylogenetic relations between Rehmannia and Triaenophora, to find their closest relatives, and to verify their familial placement, we conducted phylogenetic analyses of the sequences of one nuclear DNA (ITS) region and four chloroplast DNA gene regions (trnL-F, rps16, rbcL, and rps2) individually and combined. The analyses showed that Rehmannia and Triaenophora are each strongly supported as monophyletic and together are sister to Orobanchaceae. This relation was corroborated by phytochemical and morphological data. Based on these data, we suggest that Rehmannia and Triaenophora represent the second nonparasitic branch sister to the remainder of Orobanchaceae (including Lindenbergia).

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  5. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  7. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  8. AtTZF gene family localizes to cytoplasmic foci

    OpenAIRE

    Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun

    2010-01-01

    In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...

  9. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  10. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  11. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development.

    Science.gov (United States)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  13. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  14. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  15. Cosmic ray nuclear interactions and EAS-triggered families observed by the Chacaltaya hybrid experiment

    International Nuclear Information System (INIS)

    Aoki, H.; Honda, K.; Inoue, N.; Ishii, T.; Kawasumi, N.; Martinic, N.; Ochi, N.; Ohmori, N.; Ohsawa, A.; Tamada, M.; Ticona, R.

    2008-01-01

    Longitudinal and lateral characteristics of the families detected by emulsion chambers in the hybrid experiment with AS-array at Mt. Chacaltaya are studied in detail. Although many groups discuss about an increase of the heavy component in primary cosmic-rays beyond the knee region, it is shown that the observed characteristics of the families accompanied by large shower size, Ne>10 6 , can not be explained by an increase of heavy primaries alone. It is necessary to assume some changes of nuclear interaction in order to explain the observed characteristics of the air-showers accompanied by families

  16. A Zinc-Finger-Family Transcription Factor, AbVf19, Is Required for the Induction of a Gene Subset Important for Virulence in Alternaria brassicicola

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Akhil [Univ. of Hawaii, Manoa, HI (United States); Ohm, Robin A. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Oxiles, Lindsay [Univ. of Hawaii, Manoa, HI (United States); Brooks, Fred [Univ. of Hawaii, Manoa, HI (United States); Lawrence, Christopher B. [Virginia Polytechnic Inst. and State Univ. (Virginia Tech), Blacksburg, VA (United States); Grigoriev, Igor V. [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Cho, Yangrae [Univ. of Hawaii, Manoa, HI (United States)

    2011-10-26

    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen with a broad host range within the family Brassicaceae. It produces secondary metabolites that marginally affect virulence. Cell wall degrading enzymes (CDWE) have been considered important for pathogenesis but none of them individually have been identified as significant virulence factors in A. brassicicola. In this study, knockout mutants of a gene, AbVf19, were created and produced considerably smaller lesions than the wild type on inoculated host plants. The presence of tandem zinc-finger domains in the predicted amino acid sequence and nuclear localization of AbVf19- reporter protein suggested that it was a transcription factor. Gene expression comparisons using RNA-seq identified 74 genes being downregulated in the mutant during a late stage of infection. Among the 74 downregulated genes, 28 were putative CWDE genes. These were hydrolytic enzyme genes that composed a small fraction of genes within each family of cellulases, pectinases, cutinases, and proteinases. The mutants grew slower than the wild type on an axenic medium with pectin as a major carbon source. This study demonstrated the existence and the importance of a transcription factor that regulates a suite of genes that are important for decomposing and utilizing plant material during the late stage of plant infection.

  17. Variants in estrogen-biosynthesis genes CYP17 and CYP19 and breast cancer risk: a family-based genetic association study

    International Nuclear Information System (INIS)

    Ahsan, Habibul; Whittemore, Alice S; Chen, Yu; Senie, Ruby T; Hamilton, Steven P; Wang, Qiao; Gurvich, Irina; Santella, Regina M

    2005-01-01

    Case-control studies have reported inconsistent results concerning breast cancer risk and polymorphisms in genes that control endogenous estrogen biosynthesis. We report findings from the first family-based association study examining associations between female breast cancer risk and polymorphisms in two key estrogen-biosynthesis genes CYP17 (T→C promoter polymorphism) and CYP19 (TTTA repeat polymorphism). We conducted the study among 278 nuclear families containing one or more daughters with breast cancer, with a total of 1123 family members (702 with available constitutional DNA and questionnaire data and 421 without them). These nuclear families were selected from breast cancer families participating in the Metropolitan New York Registry, one of the six centers of the National Cancer Institute's Breast Cancer Family Registry. We used likelihood-based statistical methods to examine allelic associations. We found the CYP19 allele with 11 TTTA repeats to be associated with breast cancer risk in these families. We also found that maternal (but not paternal) carrier status of CYP19 alleles with 11 repeats tended to be associated with breast cancer risk in daughters (independently of the daughters' own genotype), suggesting a possible in utero effect of CYP19. We found no association of a woman's breast cancer risk either with her own or with her mother's CYP17 genotype. This family-based study indicates that a woman's personal and maternal carrier status of CYP19 11 TTTA repeat allele might be related to increased breast cancer risk. However, because this is the first study to report an association between CYP19 11 TTTA repeat allele and breast cancer, and because multiple comparisons have been made, the associations should be interpreted with caution and need confirmation in future family-based studies

  18. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  19. Mutations in the coding regions of the hepatocyte nuclear factor 4 alpha in Iranian families with maturity onset diabetes of the young

    Directory of Open Access Journals (Sweden)

    Tavakolafshari Jalil

    2009-12-01

    Full Text Available Abstract Hepatocyte nuclear factor 4α (HNF4α is a nuclear receptor involved in glucose homeostasis and is required for normal β cell function. Mutations in the HNF4α gene are associated with maturity onset diabetes of the young type 1 (MODY1. The aim of the present study was to determine the prevalence and nature of mutations in HNF4α gene in Iranian patients with a clinical diagnosis of MODY and their family members. Twelve families including 30 patients with clinically MODY diagnosis and 21 members of their family were examined using PCR-RFLP method and in case of mutation confirmed by sequencing techniques. Fifty age and sex matched subjects with normal fasting blood sugar (FBS and Glucose tolerance test (GTT were constituted the control group and investigated in the similar pattern. Single mutation of V255M in the HNF4α gene was detected. This known mutation was found in 8 of 30 patients and 3 of 21 individuals in relatives. Fifty healthy control subjects did not show any mutation. Here, it is indicated that the prevalence of HNF4α mutation among Iranian patients with clinical MODY is considerable. This mutation was present in 26.6% of our patients, but nothing was found in control group. In the family members, 3 subjects with the age of ≤25 years old carried this mutation. Therefore, holding this mutation in this range of age could be a predisposing factor for developing diabetes in future.

  20. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  1. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  2. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  3. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  4. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  5. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  6. Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae based on the mitochondrial COI gene and the 18S and the 5' end of the 28S rRNA genes indicates that several genera are polyphyletic.

    Directory of Open Access Journals (Sweden)

    Tomoko Matsuda

    Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.

  7. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  8. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  9. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  10. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  11. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  12. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  13. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  14. Application of nuclear theory methods to new family of fermi systems

    International Nuclear Information System (INIS)

    Nesterenko, V.O.

    1995-01-01

    Application of nuclear theory methods to the description of the properties of the new family of small Fermi systems (metal clusters, fullerenes, helium clusters and quantum dots) is briefly reviewed. The main attention is paid to giant resonances in these systems. 52 refs., 7 figs

  15. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  16. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  17. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  18. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  19. Motivational readiness of children to school in nuclear and single parent families

    Directory of Open Access Journals (Sweden)

    Kateryna Ostrovska

    2015-12-01

    Full Text Available The aim of the paper is a comparison of psychological readiness of the child to go to school in nuclear and single parent families. To obtain the objectives of the paper the following methods were used: 1 methods “Two schools” by L.A Venger to identify the level of formation of internal position of the student; 2 the method “Motivational research studies in older preschoolers” by M.R. Ginsburg; 3 method “Pattern” by L.I. Tsehanskaya to determine the degree of development of skills training activities; 4 method “Graphic dictation” by D. El’konin to study the ability to follow adult instructions. The investigated group consisted of 40 students from first grade secondary school - 20 students from nuclear families (12 girls and 8 boys and 20 students from single parent families (9 girls and 11 boys. As a result of qualitative, comparative and correlation analysis it was shown that readiness of children to go to school susbstantially depends on completness of their families. The children from families have a higher level of skill training and internal position than children from single parent families. This occurs because both parents pay more attention to the children in the forming of a willingness to learn in school. The studies have shown that in the group of children from nuclear families dominate the highest level of development of skills training activities, increased formation of internal positions and childrens social motivation. These indicators are the hallmarks of readiness to learn at school. Also, some recommendations to teachers are provided as for increase of motivation to learn in children from single parent families.

  20. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  1. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  2. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  3. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  4. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  5. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  6. Dact gene expression profiles suggest a role for this gene family in integrating Wnt and TGF-β signaling pathways during chicken limb development.

    Science.gov (United States)

    Sensiate, Lucimara Aparecida; Sobreira, Débora R; Da Veiga, Fernanda Cristina; Peterlini, Denner Jefferson; Pedrosa, Angelica Vasconcelos; Rirsch, Thaís; Joazeiro, Paulo Pinto; Schubert, Frank R; Collares-Buzato, Carla Beatriz; Xavier-Neto, José; Dietrich, Susanne; Alvares, Lúcia Elvira

    2014-03-01

    Dact gene family encodes multifunctional proteins that are important modulators of Wnt and TGF-β signaling pathways. Given that these pathways coordinate multiple steps of limb development, we investigated the expression pattern of the two chicken Dact genes (Dact1 and Dact2) from early limb bud up to stages when several tissues are differentiating. During early limb development (HH24-HH30) Dact1 and Dact2 were mainly expressed in the cartilaginous rudiments of the appendicular skeleton and perichondrium, presenting expression profiles related, but distinct. At later stages of development (HH31-HH35), the main sites of Dact1 and Dact2 expression were the developing synovial joints. In this context, Dact1 expression was shown to co-localize with regions enriched in the nuclear β-catenin protein, such as developing joint capsule and interzone. In contrast, Dact2 expression was restricted to the interzone surrounding the domains of bmpR-1b expression, a TGF-β receptor with crucial roles during digit morphogenesis. Additional sites of Dact expression were the developing tendons and digit blastemas. Our data indicate that Dact genes are good candidates to modulate and, possibly, integrate Wnt and TGF-β signaling during limb development, bringing new and interesting perspectives about the roles of Dact molecules in limb birth defects and human diseases. Copyright © 2013 Wiley Periodicals, Inc.

  7. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  8. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  9. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  10. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  11. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  12. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  13. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  14. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  15. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  16. Cloning and characterization of a novel Gladiolus hybridus AFP family gene (GhAFP-like) related to corm dormancy

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Jian; Seng, Shanshan [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China); Carianopol, Carina [Department of Biological Sciences, University of Toronto, Toronto, Ontario (Canada); Sui, Juanjuan [College of Biology, Fuyang Normal College, Fuyang, Anhui (China); Yang, Qiuyan; Zhang, Fengqin; Jiang, Huiru [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China); He, Junna, E-mail: hejunna@cau.edu.cn [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China); Yi, Mingfang, E-mail: ymfang@cau.edu.cn [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China)

    2016-02-26

    Abscisic acid (ABA) is an important phytohormone controlling seed dormancy. AFPs (ABA INSENSITIVE FIVE BINDING PROTEINS) are reported to be negative regulators of the ABA signaling pathway. The involvement of AFPs in dormant vegetative organs remains poorly understood. Here, we isolated and characterized a novel AFP family member from Gladiolus dormant cormels, GhAFP-like, containing three conserved domains of the AFP family. Quantitative PCR analysis revealed that GhAFP-like was expressed in dormant organs and its expression was down-regulated along with corm storage. GhAFP-like was verified to be a nuclear-localized protein. Overexpressing GhAFP-like in Arabidopsis thaliana not only showed weaker seed dormancy with insensitivity to ABA, but also changed the expression of some ABA related genes. In addition, a primary root elongation assay showed GhAFP-like may involve in auxin signaling response. The results in this study indicate that GhAFP-like acts as a negative regulator in ABA signaling and is related to dormancy. - Highlights: • GhAFP-like is expessed in dormant corm. • Overexpressing GhAFP-like showed early germination and insensitivity to ABA. • Overexpressing GhAFP-like changed ABI5 downstream genes expression.

  17. Cloning and characterization of a novel Gladiolus hybridus AFP family gene (GhAFP-like) related to corm dormancy

    International Nuclear Information System (INIS)

    Wu, Jian; Seng, Shanshan; Carianopol, Carina; Sui, Juanjuan; Yang, Qiuyan; Zhang, Fengqin; Jiang, Huiru; He, Junna; Yi, Mingfang

    2016-01-01

    Abscisic acid (ABA) is an important phytohormone controlling seed dormancy. AFPs (ABA INSENSITIVE FIVE BINDING PROTEINS) are reported to be negative regulators of the ABA signaling pathway. The involvement of AFPs in dormant vegetative organs remains poorly understood. Here, we isolated and characterized a novel AFP family member from Gladiolus dormant cormels, GhAFP-like, containing three conserved domains of the AFP family. Quantitative PCR analysis revealed that GhAFP-like was expressed in dormant organs and its expression was down-regulated along with corm storage. GhAFP-like was verified to be a nuclear-localized protein. Overexpressing GhAFP-like in Arabidopsis thaliana not only showed weaker seed dormancy with insensitivity to ABA, but also changed the expression of some ABA related genes. In addition, a primary root elongation assay showed GhAFP-like may involve in auxin signaling response. The results in this study indicate that GhAFP-like acts as a negative regulator in ABA signaling and is related to dormancy. - Highlights: • GhAFP-like is expessed in dormant corm. • Overexpressing GhAFP-like showed early germination and insensitivity to ABA. • Overexpressing GhAFP-like changed ABI5 downstream genes expression.

  18. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  19. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  20. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  1. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  2. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  3. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  4. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  5. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  6. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  7. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    Science.gov (United States)

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  9. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  10. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  11. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  12. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  13. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  14. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  15. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  16. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  17. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  18. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  19. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  20. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  1. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  2. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  3. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  4. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  5. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Genome-wide analysis of WRKY gene family in Cucumis sativus.

    Science.gov (United States)

    Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

    2011-09-28

    WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

  7. A novel GJA3 mutation associated with congenital nuclear pulverulent and posterior polar cataract in a Chinese family.

    Science.gov (United States)

    Yao, Ke; Wang, Wei; Zhu, Yanan; Jin, Chongfei; Shentu, Xingchao; Jiang, Jin; Zhang, Yidong; Ni, Shuang

    2011-12-01

    Congenital cataract (CC) is the leading cause of visual disability in children. To date, mutations in many genes have been linked to CC. In a four-generation Chinese family with congenital nuclear pulverulent and posterior polar cataracts, we detected a heterozygous c.5G>A transition in the second exon of GJA3, resulting in the substitution of a highly conserved glycine with aspartic acid (p.G2D) at the N-terminus of the connexin46 (Cx46) protein. Wild type (wt) and mutant Cx46 plasmids were transfected into HeLa cells to examine the molecular basis of cataract formation. Unlike wt Cx46, Cx46G2D mutant formed gap junction plaques inefficiently, changed hemichannel permeability, and caused apoptosis. These results suggest that the glycine residue at the second position of the N-terminus is important for gap junction plaque formation and hemichannel function. © 2011 Wiley Periodicals, Inc.

  8. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  9. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  10. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  11. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  12. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Directory of Open Access Journals (Sweden)

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  13. Phylogeny and biogeography of hawkmoths (Lepidoptera: Sphingidae: evidence from five nuclear genes.

    Directory of Open Access Journals (Sweden)

    Akito Y Kawahara

    2009-05-01

    Full Text Available The 1400 species of hawkmoths (Lepidoptera: Sphingidae comprise one of most conspicuous and well-studied groups of insects, and provide model systems for diverse biological disciplines. However, a robust phylogenetic framework for the family is currently lacking. Morphology is unable to confidently determine relationships among most groups. As a major step toward understanding relationships of this model group, we have undertaken the first large-scale molecular phylogenetic analysis of hawkmoths representing all subfamilies, tribes and subtribes.The data set consisted of 131 sphingid species and 6793 bp of sequence from five protein-coding nuclear genes. Maximum likelihood and parsimony analyses provided strong support for more than two-thirds of all nodes, including strong signal for or against nearly all of the fifteen current subfamily, tribal and sub-tribal groupings. Monophyly was strongly supported for some of these, including Macroglossinae, Sphinginae, Acherontiini, Ambulycini, Philampelini, Choerocampina, and Hemarina. Other groupings proved para- or polyphyletic, and will need significant redefinition; these include Smerinthinae, Smerinthini, Sphingini, Sphingulini, Dilophonotini, Dilophonotina, Macroglossini, and Macroglossina. The basal divergence, strongly supported, is between Macroglossinae and Smerinthinae+Sphinginae. All genes contribute significantly to the signal from the combined data set, and there is little conflict between genes. Ancestral state reconstruction reveals multiple separate origins of New World and Old World radiations.Our study provides the first comprehensive phylogeny of one of the most conspicuous and well-studied insects. The molecular phylogeny challenges current concepts of Sphingidae based on morphology, and provides a foundation for a new classification. While there are multiple independent origins of New World and Old World radiations, we conclude that broad-scale geographic distribution in hawkmoths

  14. Turnover of amyloid precursor protein family members determines their nuclear signaling capability.

    Science.gov (United States)

    Gersbacher, Manuel T; Goodger, Zoë V; Trutzel, Annette; Bundschuh, Diana; Nitsch, Roger M; Konietzko, Uwe

    2013-01-01

    The amyloid precursor protein (APP) as well as its homologues, APP-like protein 1 and 2 (APLP1 and APLP2), are cleaved by α-, β-, and γ-secretases, resulting in the release of their intracellular domains (ICDs). We have shown that the APP intracellular domain (AICD) is transported to the nucleus by Fe65 where they jointly bind the histone acetyltransferase Tip60 and localize to spherical nuclear complexes (AFT complexes), which are thought to be sites of transcription. We have now analyzed the subcellular localization and turnover of the APP family members. Similarly to AICD, the ICD of APLP2 localizes to spherical nuclear complexes together with Fe65 and Tip60. In contrast, the ICD of APLP1, despite binding to Fe65, does not translocate to the nucleus. In addition, APLP1 predominantly localizes to the plasma membrane, whereas APP and APLP2 are detected in vesicular structures. APLP1 also demonstrates a much slower turnover of the full-length protein compared to APP and APLP2. We further show that the ICDs of all APP family members are degraded by the proteasome and that the N-terminal amino acids of ICDs determine ICD degradation rate. Together, our results suggest that different nuclear signaling capabilities of APP family members are due to different rates of full-length protein processing and ICD proteasomal degradation. Our results provide evidence in support of a common nuclear signaling function for APP and APLP2 that is absent in APLP1, but suggest that APLP1 has a regulatory role in the nuclear translocation of APP family ICDs due to the sequestration of Fe65.

  15. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  16. Calculation of the probability of overlapping one family of nuclear levels with resonances of an independent family

    International Nuclear Information System (INIS)

    Difilippo, F.C.

    1982-01-01

    Calculations of the resonance integrals of particular isotopes in a mixture of isotopes show that the overlapping of the resonances of one isotope by resonances of other isotopes affects the final values of effective cross sections. The same effect might adversely influence those nondestructive techniques which assay fissile materials on the basis of resonance effects. Of relevance for these applications is the knowledge of the probability of overlapping resonances of a family of nuclear levels (class 1) with resonances of an independent family (class 2). For the sequence of class 1 resonances we calculate the probability distribution, p(delta), to find a class 2, first-neighbor resonance at distance (in energy) delta from a class 1 resonance; integration of p(delta) over the average finite width of the resonances would give the aforementioned probability of overlapping. Because a class 1 resonance can have a class 1 or a class 2 resonance as a first neighbor, the resultant p(delta) is not given by the distribution of spacings of the composite family

  17. Nuclear import mechanism for myocardin family members and their correlation with vascular smooth muscle cell phenotype.

    Science.gov (United States)

    Nakamura, Seiji; Hayashi, Ken'ichiro; Iwasaki, Kazuhiro; Fujioka, Tomoaki; Egusa, Hiroshi; Yatani, Hirofumi; Sobue, Kenji

    2010-11-26

    Myocardin (Mycd), which is essential for the differentiation of the smooth muscle cell lineage, is constitutively located in the nucleus, although its family members, myocardin-related transcription factors A and B (MRTF-A/B), mostly reside in the cytoplasm and translocate to the nucleus in response to Rho signaling. The mechanism for their nuclear import is unclear. Here we investigated the mechanism for the nuclear import of Mycd family members and demonstrated any correlation between such mechanism and the phenotype of vascular smooth muscle cells (VSMCs). In cultured VSMCs, the knockdown of importin β1 inhibited the nuclear import of Mycd and MRTF-A/B. Their NH(2)-terminal basic domain was identified as a binding site for importin α/β1 by in vitro analyses. However, Mycd had a higher affinity for importin α/β1 than did MRTF-A/B, even in the absence of G-actin, and Mycd affinity for importin α1/β1 was stronger than for any other importin α/β1 heterodimers. The binding of Mycd to importin α/β1 was insensitive to G-actin, whereas that of MRTF-A/B was differently inhibited by G-actin. In dedifferentiated VSMCs, the levels of importins α1 and β1 were reduced concomitant with down-regulation of Mycd, serum response factor, and smooth muscle cell markers. By contrast, in differentiated VSMCs, their expressions were up-regulated. Thus, the nuclear import of Mycd family members in VSMCs depends on importin α/β1, and their relative affinities for importin α/β1 heterodimers determine Mycd nuclear import. The expression of Mycd nuclear import machineries is related to the expression levels of VSMC phenotype-dependent smooth muscle cell markers.

  18. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  19. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  1. Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2015-11-01

    The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  3. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  4. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  5. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  6. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  7. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  8. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  9. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  10. Molecular phylogeny of the Oriental butterfly genus Arhopala (Lycaenidae, Theclinae) inferred from mitochondrial and nuclear genes

    NARCIS (Netherlands)

    Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.

    2004-01-01

    We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42

  11. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  12. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica

    NARCIS (Netherlands)

    Pessina, S.; Pavan, S.N.C.; Catalano, D.; Gallotta, A.; Visser, R.G.F.; Bai, Y.; Malnoy, M.; Schouten, H.J.

    2014-01-01

    Background Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO

  13. An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data.

    Science.gov (United States)

    Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza

    2017-09-27

    Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.

  14. Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken

    Directory of Open Access Journals (Sweden)

    Power Deborah M

    2010-12-01

    Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which

  15. A phylogenetic analysis of the genus Psathyrostachys (Poaceae) based on one nuclear gene, three plastid genes, and morphology

    DEFF Research Database (Denmark)

    Petersen, Gitte; Seberg, Ole; Baden, Claus

    2004-01-01

    A phylogenetic analysis of the small, Central Asian genus Psathyrostachys Nevski is presented. The analysis is based on morphological characters and nucleotide sequence data from one nuclear gene, DMC1, and three plastid genes, rbcL, rpoA, and rpoC2. Separate analyses of the three data partitions...... (morphology, nuclear sequences, and plastid sequences) result in mostly congruent trees. The plastid and nuclear sequences produce completely congruent trees, and only the trees based on plastid sequences and morphological characters are incongruent. Combined analysis of all data results in a fairly well......-resolved strict consensus tree: Ps. rupestris is the sister to the remaining species, which are divided into two clades: one including Ps. fragilis and Ps. caduca, the other including Ps. juncea, Ps. huashanica, Ps. lanuginosa, Ps. stoloniformis, and Ps. kronenburgii. Pubescent culms and more than 20 mm long...

  16. Cancer as a complex phenotype: pattern of cancer distribution within and beyond the nuclear family.

    Directory of Open Access Journals (Sweden)

    Laufey T Amundadottir

    2004-12-01

    Full Text Available BACKGROUND: The contribution of low-penetrant susceptibility variants to cancer is not clear. With the aim of searching for genetic factors that contribute to cancer at one or more sites in the body, we have analyzed familial aggregation of cancer in extended families based on all cancer cases diagnosed in Iceland over almost half a century. METHODS AND FINDINGS: We have estimated risk ratios (RRs of cancer for first- and up to fifth-degree relatives both within and between all types of cancers diagnosed in Iceland from 1955 to 2002 by linking patient information from the Icelandic Cancer Registry to an extensive genealogical database, containing all living Icelanders and most of their ancestors since the settlement of Iceland. We evaluated the significance of the familial clustering for each relationship separately, all relationships combined (first- to fifth-degree relatives and for close (first- and second-degree and distant (third- to fifth-degree relatives. Most cancer sites demonstrate a significantly increased RR for the same cancer, beyond the nuclear family. Significantly increased familial clustering between different cancer sites is also documented in both close and distant relatives. Some of these associations have been suggested previously but others not. CONCLUSION: We conclude that genetic factors are involved in the etiology of many cancers and that these factors are in some cases shared by different cancer sites. However, a significantly increased RR conferred upon mates of patients with cancer at some sites indicates that shared environment or nonrandom mating for certain risk factors also play a role in the familial clustering of cancer. Our results indicate that cancer is a complex, often non-site-specific disease for which increased risk extends beyond the nuclear family.

  17. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  18. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  19. The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.

    Science.gov (United States)

    Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María

    2016-09-01

    The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

  20. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  1. Expression of glucocorticoid and progesterone nuclear receptor genes in archival breast cancer tissue

    International Nuclear Information System (INIS)

    Smith, Robert A; Lea, Rod A; Curran, Joanne E; Weinstein, Stephen R; Griffiths, Lyn R

    2003-01-01

    Previous studies in our laboratory have shown associations of specific nuclear receptor gene variants with sporadic breast cancer. In order to investigate these findings further, we conducted the present study to determine whether expression levels of the progesterone and glucocorticoid nuclear receptor genes vary in different breast cancer grades. RNA was extracted from paraffin-embedded archival breast tumour tissue and converted into cDNA. Sample cDNA underwent PCR using labelled primers to enable quantitation of mRNA expression. Expression data were normalized against the 18S ribosomal gene multiplex and analyzed using analysis of variance. Analysis of variance indicated a variable level of expression of both genes with regard to breast cancer grade (P = 0.00033 for glucocorticoid receptor and P = 0.023 for progesterone receptor). Statistical analysis indicated that expression of the progesterone nuclear receptor is elevated in late grade breast cancer tissue

  2. Evolutionary gradient of predicted nuclear localization signals (NLS)-bearing proteins in genomes of family Planctomycetaceae.

    Science.gov (United States)

    Guo, Min; Yang, Ruifu; Huang, Chen; Liao, Qiwen; Fan, Guangyi; Sun, Chenghang; Lee, Simon Ming-Yuen

    2017-04-04

    The nuclear envelope is considered a key classification marker that distinguishes prokaryotes from eukaryotes. However, this marker does not apply to the family Planctomycetaceae, which has intracellular spaces divided by lipidic intracytoplasmic membranes (ICMs). Nuclear localization signal (NLS), a short stretch of amino acid sequence, destines to transport proteins from cytoplasm into nucleus, and is also associated with the development of nuclear envelope. We attempted to investigate the NLS motifs in Planctomycetaceae genomes to demonstrate the potential molecular transition in the development of intracellular membrane system. In this study, we identified NLS-like motifs that have the same amino acid compositions as experimentally identified NLSs in genomes of 11 representative species of family Planctomycetaceae. A total of 15 NLS types and 170 NLS-bearing proteins were detected in the 11 strains. To determine the molecular transformation, we compared NLS-bearing protein abundances in the 11 representative Planctomycetaceae genomes with them in genomes of 16 taxonomically varied microorganisms: nine bacteria, two archaea and five fungi. In the 27 strains, 29 NLS types and 1101 NLS-bearing proteins were identified, principal component analysis showed a significant transitional gradient from bacteria to Planctomycetaceae to fungi on their NLS-bearing protein abundance profiles. Then, we clustered the 993 non-redundant NLS-bearing proteins into 181 families and annotated their involved metabolic pathways. Afterwards, we aligned the ten types of NLS motifs from the 13 families containing NLS-bearing proteins among bacteria, Planctomycetaceae or fungi, considering their diversity, length and origin. A transition towards increased complexity from non-planctomycete bacteria to Planctomycetaceae to archaea and fungi was detected based on the complexity of the 10 types of NLS-like motifs in the 13 NLS-bearing proteins families. The results of this study reveal that

  3. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Ocular Phenotype Analysis of a Family With Biallelic Mutations in the BEST1 Gene

    DEFF Research Database (Denmark)

    Sharon, Dror; Al-Hamdani, Sermed; Engelsberg, Karl

    2014-01-01

    in the inner nuclear layer, no light rise in the electro-oculography, and a reduced central but preserved peripheral retinal function by multifocal electroretinography. Full-field electroretinography demonstrated a reduced rod response and inner retina dysfunction. Retinal structure was normal in all 3 family......PURPOSE: To investigate the genetic cause and perform a comprehensive clinical analysis of a Danish family with autosomal recessive bestrophinopathy; to investigate whether Bestrophin may be expressed in normal human retina. DESIGN: Retrospective clinical and molecular genetic analysis...... and immunohistochemical observational study. METHODS: setting: National referral center. participants: A family with 5 individuals and biallelic BEST1 mutations, and enucleated eyes from 2 individuals with nonaffected retinas. observation procedures: Molecular genetic analysis included sequencing of BEST1 and co...

  5. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  6. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  7. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  8. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  9. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family.

    Science.gov (United States)

    Guo, Chunlei; Guo, Rongrong; Xu, Xiaozhao; Gao, Min; Li, Xiaoqin; Song, Junyang; Zheng, Yi; Wang, Xiping

    2014-04-01

    WRKY proteins comprise a large family of transcription factors that play important roles in plant defence regulatory networks, including responses to various biotic and abiotic stresses. To date, no large-scale study of WRKY genes has been undertaken in grape (Vitis vinifera L.). In this study, a total of 59 putative grape WRKY genes (VvWRKY) were identified and renamed on the basis of their respective chromosome distribution. A multiple sequence alignment analysis using all predicted grape WRKY genes coding sequences, together with those from Arabidopsis thaliana and tomato (Solanum lycopersicum), indicated that the 59 VvWRKY genes can be classified into three main groups (I-III). An evaluation of the duplication events suggested that several WRKY genes arose before the divergence of the grape and Arabidopsis lineages. Moreover, expression profiles derived from semiquantitative PCR and real-time quantitative PCR analyses showed distinct expression patterns in various tissues and in response to different treatments. Four VvWRKY genes showed a significantly higher expression in roots or leaves, 55 responded to varying degrees to at least one abiotic stress treatment, and the expression of 38 were altered following powdery mildew (Erysiphe necator) infection. Most VvWRKY genes were downregulated in response to abscisic acid or salicylic acid treatments, while the expression of a subset was upregulated by methyl jasmonate or ethylene treatments.

  10. Gross features of nuclear interactions around 1015 eV through observation of gamma ray families

    International Nuclear Information System (INIS)

    Semba, Hiroshi

    1983-01-01

    A systematic analysis is made on the 106 γ-ray families with visible energy in the range of 100--300 TeV observed in the Chacaltaya emulsion chamber experiment. A new method called 'decascading' is introduced to pick up a cluster of γ-rays and electrons in a family, so that the cluster is an air cascade from one parent γ-ray. The application of 'decascading' method to the family data gives information on original γ-rays produced at the atmospheric nuclear interactions. The results are compared with expected ones from the simulation calculation on the base of H-quantum model, and with data from the target interactions at lower energy range (ΣE sub(γ)=20 --100 TeV). The conclusion is that the characteristics of nuclear interactions at the concerned family energy range (E 0 asymptotically equals 1,000 TeV) are in accordance with those at the target interaction range (E 0 asymptotically equals 100 TeV), with increased ratio of frequencies of a heavy fire-ball (SH-quantum) to a small and usual fire-ball (H-quantum). (author)

  11. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  12. Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

    Directory of Open Access Journals (Sweden)

    Ashutosh ePandey

    2016-02-01

    Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

  13. Phylogeny of Celastraceae tribe Euonymeae inferred from morphological characters and nuclear and plastid genes.

    Science.gov (United States)

    Simmons, Mark P; McKenna, Miles J; Bacon, Christine D; Yakobson, Kendra; Cappa, Jennifer J; Archer, Robert H; Ford, Andrew J

    2012-01-01

    The phylogeny of Celastraceae tribe Euonymeae (≈ 230 species in eight genera in both the Old and New Worlds) was inferred using morphological characters together with plastid (matK, trnL-F) and nuclear (ITS and 26S rDNA) genes. Tribe Euonymeae has been defined as those genera of Celastraceae with generally opposite leaves, isomerous carpels, loculicidally dehiscent capsules, and arillate seeds (except Microtropis). Euonymus is the most diverse (129 species) and widely cultivated genus in the tribe. We infer that tribe Euonymeae consists of at least six separate lineages within Celastraceae and that a revised natural classification of the family is needed. Microtropis and Quetzalia are inferred to be distinct sister groups that together are sister to Zinowiewia. The endangered Monimopetalum chinense is an isolated and early derived lineage of Celastraceae that represents an important component of phylogenetic diversity within the family. Hedraianthera is sister to Brassiantha, and we describe a second species (Brassiantha hedraiantheroides A.J. Ford) that represents the first reported occurrence of this genus in Australia. Euonymus globularis, from eastern Australia, is sister to Menepetalum, which is endemic to New Caledonia, and we erect a new genus (Dinghoua R.H. Archer) for it. The Madagascan species of Euonymus are sister to Pleurostylia and recognized as a distinct genus (Astrocassine ined.). Glyptopetalum, Torralbasia, and Xylonymus are all closely related to Euonymus sensu stricto and are questionably distinct from it. Current intrageneric classifications of Euonymus are not completely natural and require revision. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Familial adult spinal muscular atrophy associated with the VAPB gene: report of 42 cases in Brazil

    Directory of Open Access Journals (Sweden)

    Victor Kosac

    2013-10-01

    Full Text Available Familial spinal muscular atrophy (FSMA associated with the vesicle-associated membrane protein-associated protein B (VAPB gene is a rare autosomal dominant disease with late onset and slow progression. We studied 10 of 42 patients from 5 families by taking clinical histories and performing physical exams, electrophysiological studies, and genetic tests. All patients presented late onset disease with slow progression characterized by fasciculations, proximal weakness, amyotrophy, and hypoactive deep tendon reflex, except two who exhibited brisk reflex. Two patients showed tongue fasciculations and respiratory insufficiency. Electrophysiological studies revealed patterns of lower motor neuron disease, and genetic testing identified a P56S mutation of the VAPB gene. Although it is a rare motor neuron disease, FSMA with this mutation might be much more prevalent in Brazil than expected, and many cases may be undiagnosed. Genetic exams should be performed whenever it is suspected in Brazil.

  15. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  16. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  17. miR-92a family and their target genes in tumorigenesis and metastasis

    Energy Technology Data Exchange (ETDEWEB)

    Li, Molin, E-mail: molin_li@hotmail.com [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Guan, Xingfang; Sun, Yuqiang [Department of Pathophysiology, Basic Medical Science of Dalian Medical University, Dalian 116044 (China); Mi, Jun [Institute of Cancer Stem Cell, Dalian Medical University Cancer Center, Dalian 116044 (China); Shu, Xiaohong [College of Pharmacy, Dalian Medical University Cancer Center, Dalian 116044 (China); Liu, Fang [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China); Li, Chuangang, E-mail: li_chuangang@sina.com [Department of Surgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116027 (China)

    2014-04-15

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis.

  18. miR-92a family and their target genes in tumorigenesis and metastasis

    International Nuclear Information System (INIS)

    Li, Molin; Guan, Xingfang; Sun, Yuqiang; Mi, Jun; Shu, Xiaohong; Liu, Fang; Li, Chuangang

    2014-01-01

    The miR-92a family, including miR-25, miR-92a-1, miR-92a-2 and miR-363, arises from three different paralog clusters miR-17-92, miR-106a-363, and miR-106b-25 that are highly conservative in the process of evolution, and it was thought as a group of microRNAs (miRNAs) correlated with endothelial cells. Aberrant expression of miR-92a family was detected in multiple cancers, and the disturbance of miR-92a family was related with tumorigenesis and tumor development. In this review, the progress on the relationship between miR-92a family and their target genes and malignant tumors will be summarized. - Highlights: • Aberrant expression of miR-92a, miR-25 and miR-363 can be observed in many kinds of malignant tumors. • The expression of miR-92a family is regulated by LOH, epigenetic alteration, transcriptional factors such as SP1, MYC, E2F, wild-type p53 etc. • Roles of miR-92a family in tumorigenesis and development: promoting cell proliferation, invasion and metastasis, inhibiting cell apoptosis

  19. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  20. Genome-wide identification and expression analysis of MAPK and MAPKK gene family in Malus domestica.

    Science.gov (United States)

    Zhang, Shizhong; Xu, Ruirui; Luo, Xiaocui; Jiang, Zesheng; Shu, Huairui

    2013-12-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, which are composed of three classes of hierarchically organized protein kinases, namely MAPKKKs, MAPKKs, and MAPKs. Although genome-wide analysis of this family has been carried out in some species, little is known about MAPK and MAPKK genes in apple (Malus domestica). In this study, a total of 26 putative apple MAPK genes (MdMPKs) and 9 putative apple MAPKK genes (MdMKKs) have been identified and located within the apple genome. Phylogenetic analysis revealed that MdMAPKs and MdMAPKKs could be divided into 4 subfamilies (groups A, B, C and D), respectively. The predicted MdMAPKs and MdMAPKKs were distributed across 13 out of 17 chromosomes with different densities. In addition, analysis of exon-intron junctions and of intron phase inside the predicted coding region of each candidate gene has revealed high levels of conservation within and between phylogenetic groups. According to the microarray and expressed sequence tag (EST) analysis, the different expression patterns indicate that they may play different roles during fruit development and rootstock-scion interaction process. Moreover, MAPK and MAPKK genes were performed expression profile analyses in different tissues (root, stem, leaf, flower and fruit), and all of the selected genes were expressed in at least one of the tissues tested, indicating that the MAPKs and MAPKKs are involved in various aspects of physiological and developmental processes of apple. To our knowledge, this is the first report of a genome-wide analysis of the apple MAPK and MAPKK gene family. This study provides valuable information for understanding the classification and putative functions of the MAPK signal in apple. © 2013.

  1. Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Liu, Peng; Stajich, Jason E

    2015-04-01

    Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. A novel nonsense mutation in the NDP gene in a Chinese family with Norrie disease

    OpenAIRE

    Liu, Deyuan; Hu, Zhengmao; Peng, Yu; Yu, Changhong; Liu, Yalan; Mo, Xiaoyun; Li, Xiaoping; Lu, Lina; Xu, Xiaojuan; Su, Wei; Pan, Qian; Xia, Kun

    2010-01-01

    Purpose Norrie disease (ND), a rare X-linked recessive disorder, is characterized by congenital blindness and, occasionally, mental retardation and hearing loss. ND is caused by the Norrie Disease Protein gene (NDP), which codes for norrin, a cysteine-rich protein involved in ocular vascular development. Here, we report a novel mutation of NDP that was identified in a Chinese family in which three members displayed typical ND symptoms and other complex phenotypes, such as cerebellar atrophy, ...

  3. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  4. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  5. Genome-wide comparative in silico analysis of the RNA helicase gene family in Zea mays and Glycine max: a comparison with Arabidopsis and Oryza sativa.

    Science.gov (United States)

    Xu, Ruirui; Zhang, Shizhong; Huang, Jinguang; Zheng, Chengchao

    2013-01-01

    RNA helicases are enzymes that are thought to unwind double-stranded RNA molecules in an energy-dependent fashion through the hydrolysis of NTP. RNA helicases are associated with all processes involving RNA molecules, including nuclear transcription, editing, splicing, ribosome biogenesis, RNA export, and organelle gene expression. The involvement of RNA helicase in response to stress and in plant growth and development has been reported previously. While their importance in Arabidopsis and Oryza sativa has been partially studied, the function of RNA helicase proteins is poorly understood in Zea mays and Glycine max. In this study, we identified a total of RNA helicase genes in Arabidopsis and other crop species genome by genome-wide comparative in silico analysis. We classified the RNA helicase genes into three subfamilies according to the structural features of the motif II region, such as DEAD-box, DEAH-box and DExD/H-box, and different species showed different patterns of alternative splicing. Secondly, chromosome location analysis showed that the RNA helicase protein genes were distributed across all chromosomes with different densities in the four species. Thirdly, phylogenetic tree analyses identified the relevant homologs of DEAD-box, DEAH-box and DExD/H-box RNA helicase proteins in each of the four species. Fourthly, microarray expression data showed that many of these predicted RNA helicase genes were expressed in different developmental stages and different tissues under normal growth conditions. Finally, real-time quantitative PCR analysis showed that the expression levels of 10 genes in Arabidopsis and 13 genes in Zea mays were in close agreement with the microarray expression data. To our knowledge, this is the first report of a comparative genome-wide analysis of the RNA helicase gene family in Arabidopsis, Oryza sativa, Zea mays and Glycine max. This study provides valuable information for understanding the classification and putative functions of

  6. Analysis of inversions in the factor VIII gene in Spanish hemophilia A patients and families

    Energy Technology Data Exchange (ETDEWEB)

    Domenech, M.; Tizzano, E.; Baiget, M. [Hospital de Sant Pau, Barcelona (Spain); Altisent, C. [Hospital Vall d`Hebron, Barcelona (Spain)

    1994-09-01

    Intron 22 is the largest intron of the factor VIII gene and contains a CpG island from which two additional transcripts originate. One of these transcripts corresponds to the F8A gene which have telomeric extragenic copies in the X chromosome. An inversion involving homologous recombination between the intragenic and the distal or proximal copies of the F8A gene has been recently described as a common cause of severe hemophilia A (HA). We analyzed intron 22 rearrangements in 195 HA patients (123 familial and 72 sporadic cases). According to factor VIII levels, our sample was classified as severe in 114 cases, moderate in 29 cases and mild in 52 cases. An intron 22 (F8A) probe was hybridized to Southern blots of BcII digested DNA obtained from peripheral blood. A clear pattern of altered bands identifies distal or proximal inversions. We detected an abnormal pattern identifying an inversion in 49 (25%) of the analyzed cases. 43% of severe HA patients (49 cases) showed an inversion. As expected, no inversion was found in the moderate and mild group of patients. We found a high proportion (78%) of the distal rearrangement. From 49 identified inversions, 33 were found in familial cases (27%), while the remaining 15 were detected in sporadic patients (22%) in support that this mutational event occurs with a similar frequency in familial or sporadic cases. In addition, we detected a significant tendency of distal inversion to occur more frequently in familial cases than in sporadic cases. Inhibitor development to factor VIII was documented in approximately 1/3 of the patients with inversion. The identification of such a frequent molecular event in severe hemophilia A patients has been applied in our families to carrier and prenatal diagnosis, to determine the origin of the mutation in the sporadic cases and to detect the presence of germinal mosaicism.

  7. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  8. Genome-wide identification and characterization of the bHLH gene family in tomato.

    Science.gov (United States)

    Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing

    2015-01-22

    The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis

  9. Evolution of the vertebrate claudin gene family: insights from a basal vertebrate, the sea lamprey.

    Science.gov (United States)

    Mukendi, Christian; Dean, Nicholas; Lala, Rushil; Smith, Jeramiah; Bronner, Marianne E; Nikitina, Natalya V

    2016-01-01

    Claudins are major constituents of tight junctions, contributing both to their intercellular sealing and selective permeability properties. While claudins and claudin-like molecules are present in some invertebrates, the association of claudins with tight junctions has been conclusively documented only in vertebrates. Here we report the sequencing, phylogenetic analysis and comprehensive spatiotemporal expression analysis of the entire claudin gene family in the basal extant vertebrate, the sea lamprey. Our results demonstrate that clear orthologues to about half of all mammalian claudins are present in the lamprey, suggesting that at least one round of whole genome duplication contributed to the diversification of this gene family. Expression analysis revealed that claudins are expressed in discrete and specific domains, many of which represent vertebrate-specific innovations, such as in cranial ectodermal placodes and the neural crest; whereas others represent structures characteristic of chordates, e.g. pronephros, notochord, somites, endostyle and pharyngeal arches. By comparing the embryonic expression of claudins in the lamprey to that of other vertebrates, we found that ancestral expression patterns were often preserved in higher vertebrates. Morpholino mediated loss of Cldn3b demonstrated a functional role for this protein in placode and pharyngeal arch morphogenesis. Taken together, our data provide novel insights into the origins and evolution of the claudin gene family and the significance of claudin proteins in the evolution of vertebrates.

  10. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  11. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    Directory of Open Access Journals (Sweden)

    Lise Bols Toustrup

    2017-03-01

    Full Text Available Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI is caused by variants in the arginine vasopressin (AVP gene. Here we report the generation of induced pluripotent stem cells (iPSCs from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using lentivirus-mediated nuclear reprogramming. The iPSCs carried the expected variant in the AVP gene. Furthermore, the iPSCs expressed pluripotency markers; displayed in vitro differentiation potential to the three germ layers and had a normal karyotype consistent with the original fibroblasts. This iPSC line is useful in future studies focusing on the pathogenesis of adFNDI.

  12. Two novel mutations of CLCN7 gene in Chinese families with autosomal dominant osteopetrosis (type II).

    Science.gov (United States)

    Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin

    2016-07-01

    Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense

  13. Subcortical laminar heterotopia and lissencephaly in two families: a single X linked dominant gene.

    Science.gov (United States)

    Pinard, J M; Motte, J; Chiron, C; Brian, R; Andermann, E; Dulac, O

    1994-01-01

    Neuronal migration disorders can now be recognised by MRI. This paper reports two families in which the mothers had subcortical laminar heterotopia and four of their children had either similar heterotopia (two girls) or severe pachygyria or lissencephaly (two boys). Laminar heterotopia was more evident on MRI T2 weighted images. The patients had mild to severe epilepsy and mental retardation depending on the extent of cortical abnormalities. In these families, subcortical laminar heterotopia, pachygyria, and lissencephaly seem to share the same X linked or autosomal dominant gene. No chromosomal abnormalities, especially of chromosome 17, could be identified. For appropriate genetic counselling of the family of a child with lissencephaly or subcortical laminar heterotopia, MRI should be performed in parents or siblings with mental retardation or epilepsy. Images PMID:8057113

  14. XPC gene mutations in families with xeroderma pigmentosum from Pakistan; prevalent founder effect.

    Science.gov (United States)

    Ijaz, Ambreen; Basit, Sulman; Gul, Ajab; Batool, Lilas; Hussain, Abrar; Afzal, Sibtain; Ramzan, Khushnooda; Ahmad, Jamil; Wali, Abdul

    2018-03-23

    Xeroderma pigmentosum (XP) is a rare autosomal recessive skin disorder characterized by hyperpigmentation, premature skin aging, ocular and cutaneous photosensitivity, and increased risk of skin carcinoma. We investigated seven consanguineous XP families with nine patients from Pakistan. All the Patients exhibited typical clinical symptoms of XP since first year of life. Whole genome SNP genotyping identified a 14 Mb autozygous region segregating with the disease phenotype on chromosome 3p25.1. DNA sequencing of XPC gene revealed a founder homozygous splice site mutation (c.2251-1G>C) in patients from six families (A-F) and a homozygous nonsense mutation (c.1399C>T; p.Gln467*) in patients of family G. This is the first report of XPC mutations, underlying XP phenotype, in Pakistani population. © 2018 Japanese Teratology Society.

  15. GDNF gene is associated with tourette syndrome in a family study.

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  16. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  17. Multigenerational Brazilian family with malignant hyperthermia and a novel mutation in the RYR1 gene.

    Science.gov (United States)

    Matos, A R; Sambuughin, N; Rumjanek, F D; Amoedo, N D; Cunha, L B P; Zapata-Sudo, G; Sudo, R T

    2009-12-01

    Malignant hyperthermia (MH) is a pharmacogenetic disease triggered in susceptible individuals by the administration of volatile halogenated anesthetics and/or succinylcholine, leading to the development of a hypermetabolic crisis, which is caused by abnormal release of Ca2+ from the sarcoplasmic reticulum, through the Ca2+ release channel ryanodine receptor 1 (RyR1). Mutations in the RYR1 gene are associated with MH in the majority of susceptible families. Genetic screening of a 5-generation Brazilian family with a history of MH-related deaths and a previous MH diagnosis by the caffeine halothane contracture test (CHCT) in some individuals was performed using restriction and sequencing analysis. A novel missense mutation, Gly4935Ser, was found in an important functional and conserved locus of this gene, the transmembrane region of RyR1. In this family, 2 MH-susceptible individuals previously diagnosed with CHCT carry this novel mutation and another 24 not previously diagnosed members also carry it. However, this same mutation was not found in another MH-susceptible individual whose CHCT was positive to the test with caffeine but not to the test with halothane. None of the 5 MH normal individuals of the family, previously diagnosed by CHCT, carry this mutation, nor do 100 controls from control Brazilian and USA populations. The Gly4932Ser variant is a candidate mutation for MH, based on its co-segregation with disease phenotype, absence among controls and its location within the protein.

  18. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  19. Identification and characterization of nuclear genes