WorldWideScience

Sample records for nuclear form factor

  1. Surface sensitivity of nuclear-knock-out form factors

    International Nuclear Information System (INIS)

    Fratamico, G.

    1984-01-01

    A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors

  2. Overview of factors affecting the leachability of nuclear waste forms

    International Nuclear Information System (INIS)

    Stone, J.A.

    1980-01-01

    An overview of various factors that affect the leachability of nuclear waste forms is presented. The factors affect primarily the leaching system (temperature, for example), the leachant (pH, for example), or the solid being leached (surface condition, for example). A qualitative understanding exists of the major factors affecting leaching, but further studies are needed to establish leaching mechanisms and develop predictive models. 67 refs

  3. Separating form factor and nuclear model effects in quasielastic neutrino-nucleus scattering

    Science.gov (United States)

    Wieske, Joseph

    2017-09-01

    When studying neutrino oscillations an understanding of charged current quasielastic (CCQE) neutrino-nucleus scattering is imperative. This interaction depends on a nuclear model as well as knowledge of form factors. In the past, CCQE data from the MiniBooNE experiment was analyzed assuming the Relativistic Fermi Gas (RFG) nuclear model, an axial dipole form factor in, and using the the z-expansion for the axial form factor in. We present the first analysis that combines a non-RFG nuclear model, in particular the Correlated Fermi Gas nuclear model (CFG) of, and the z expansion for the axial form factor. This will allow us to separate form factor and nuclear model effects in CCQE scattering. This project was supported through the Wayne State University REU program under NSF Grant PHY-1460853 and by the DOE Grant DE-SC0007983.

  4. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  5. The dependence of the nuclear charge form factor on short range correlations and surface fluctuation effects

    International Nuclear Information System (INIS)

    Massen, S. E.; Garistov, V. P.; Grypeos, M. E.

    1996-01-01

    The effects of nuclear surface fluctuations on harmonic oscillator elastic charge form factor of light nuclei are investigated, simultaneously approximating the short-range correlations through a Jastrow correlation factor. Inclusion of the surface fluctuation effects within this description, by truncating the cluster expansion at the two-body part, is found to improve somewhat the fit to the elastic charge form-factor of 16 O and 40 Ca. However, the convergence of the cluster expansion is expected to deteriorate. An additional finding is that surface-fluctuation correlations produce a drastic change in the asymptotic behaviour of the point-proton form-factor, which now falls off quite slowly (i.e. as const.q -4 ) at large values of the momentum transfer q

  6. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Directory of Open Access Journals (Sweden)

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  7. Nuclear critical opalescence and the M1 form factors of 12C and 13C

    International Nuclear Information System (INIS)

    Delorme, J.; Figureau, A.; Guichon, P.

    1981-01-01

    It is shown that core polarization by the nuclear pion field has opposite effects on the M1 form factors of 12 C(15.11 MeV) and 13 C(g.s.). New data on 13 C are found to agree with this prediction and a common interpretation of the experiments is shown to be possible for the two nuclei in terms of critical opalescence. Discrimination from alternative explanations of the observed anomalies should await further experiments, especially photopion reactions. (orig.)

  8. High energy approximations for nuclear knockout form factors at small momentum transfer

    International Nuclear Information System (INIS)

    Amado, R.D.; Cannata, F.; Dedonder, J.P.

    1985-01-01

    We obtain an explicit approximate expression for the nucleon knockout form factor at small momentum transfer induced by a scalar probe in a single particle model in terms of the momentum space bound state wave function. Our form preserves the orthogonality constraint without using explicitly the final state scattering wave function. We examine the leading large momentum behavior of the momentum space wave function and of correction terms to our expression for the form factor in the case where the bound state is an s state

  9. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  10. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  11. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  12. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter

    2001-01-01

    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  13. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.

    1987-01-01

    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  14. The role of the form factor and short-range correlation in the relativistic Hartree-Fock model for nuclear matter

    International Nuclear Information System (INIS)

    Hu, J.; Toki, H.; Wen, W.; Shen, H.

    2010-01-01

    The role of the form factor and short-range correlation in nuclear matter is studied within the relativistic Hartree-Fock approximation. We take, first, the mean-field approximation for meson fields and obtain the fluctuation terms of mesons to be used for the Fock energies. We introduce form factors in the meson-nucleon coupling vertices to take into account the finite-size effect of the nucleon. We use further the unitary correlation operator method for the treatment of the short-range correlation. The form factors of the size (Λ∝1.0 -2.0 GeV) of the nucleon-nucleon interaction cut down largely the contribution of the ρ-meson in the Fock term. The short-range correlation effect is not large but has a significant effect on the pion and ρ-meson energies in the relativistic Hartree-Fock approximation for nuclear matter. (orig.)

  15. The role of the form factor and short-range correlation in the relativistic Hartree-Fock model for nuclear matter

    Science.gov (United States)

    Hu, J.; Toki, H.; Wen, W.; Shen, H.

    2010-03-01

    The role of the form factor and short-range correlation in nuclear matter is studied within the relativistic Hartree-Fock approximation. We take, first, the mean-field approximation for meson fields and obtain the fluctuation terms of mesons to be used for the Fock energies. We introduce form factors in the meson-nucleon coupling vertices to take into account the finite-size effect of the nucleon. We use further the unitary correlation operator method for the treatment of the short-range correlation. The form factors of the size ( Λ ˜ 1.0 -2.0GeV) of the nucleon-nucleon interaction cut down largely the contribution of the ρ -meson in the Fock term. The short-range correlation effect is not large but has a significant effect on the pion and ρ -meson energies in the relativistic Hartree-Fock approximation for nuclear matter.

  16. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  17. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  18. Critical opalescence of the nuclear pion field: A possible evidence in the M1 (15.11 MeV) form factor of 12C

    International Nuclear Information System (INIS)

    Delorme, J.; Figureau, A.; Giraud, N.

    1980-01-01

    We have computed the nuclear pion field for the transition to the 15.11 MeV (1 + , T = 1) state of 12 C, evaluating the nuclear polarization with a large basis of nucleon- and isobar-hole excitations. The field shows an enhancement (or critical opalescence) in the momentum region beyond 1.5 msub(π) which leads to a substantial increase of the second maximum of the M1 form factor. Agreement with experiment can be obtained if the 12 C nucleus is much closer to the condensation threshold than currently expected. (orig.)

  19. Critical opalescence of the nuclear pion field: a possible evidence in the M1 (15.11 MeV) form factor of 12C

    International Nuclear Information System (INIS)

    Delorme, J.; Ericson, M.; Figureau, A.; Giraud, N.

    1979-07-01

    The nuclear pion field for the transition to the 15.11 MeV (1 + , T= 1) state of 12 C has been computed, evaluating the nuclear polarization with a large basis of nucleon- and isobar-hole excitations. The field shows an enhancement (or critical opalescence) in the momentum region beyond 1.5msub(π) which leads to a substantial increase of the second maximum of the M1 form factor. Agreement with experiment can be obtained if the 12 C nucleus is much closer to the pion condensation threshold than currently expected

  20. Crystallization behavior of nuclear waste forms

    International Nuclear Information System (INIS)

    Rusin, J.M.; Lokken, R.O.; May, R.P.; Wald, J.W.

    1981-09-01

    Several waste form options have been or are being developed for the immobilization of high-level wastes. The final selection of a waste form must take into consideration both waste form product as well as process factors. Crystallization behavior has an important role in nuclear waste form technology. For glass or vitreous waste forms, crystallization is generally controlled to a minimum by appropriate glass formulation and heat treatment schedules. With glass ceramic waste forms, crystallization is essential to convert glass products to highly crystalline waste forms with a minimum residual glass content. In the case of ceramic waste forms, additives and controlled sintering schedules are used to contain the radionuclides in specific tailored crystalline phases

  1. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.

    2005-01-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  2. Nuclear waste forms for actinides

    Science.gov (United States)

    Ewing, Rodney C.

    1999-01-01

    The disposition of actinides, most recently 239Pu from dismantled nuclear weapons, requires effective containment of waste generated by the nuclear fuel cycle. Because actinides (e.g., 239Pu and 237Np) are long-lived, they have a major impact on risk assessments of geologic repositories. Thus, demonstrable, long-term chemical and mechanical durability are essential properties of waste forms for the immobilization of actinides. Mineralogic and geologic studies provide excellent candidate phases for immobilization and a unique database that cannot be duplicated by a purely materials science approach. The “mineralogic approach” is illustrated by a discussion of zircon as a phase for the immobilization of excess weapons plutonium. PMID:10097054

  3. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  4. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  5. Electron form factors of deformable nuclei

    International Nuclear Information System (INIS)

    Tartakovskii, V.K.; Isupov, V.Yu.

    1988-01-01

    Using the smallness of the deformation parameter of the nucleus, we obtain simple explicit expressions for the form factors of electroexcitation of the low-lying rotation-vibration states of light, deformable, even-even nuclei. The expressions satisfactorily describe the experimental data on the excitation of collective nuclear states by the inelastic scattering of fast electrons

  6. Calculation of pion form factor

    International Nuclear Information System (INIS)

    Vahedi, N.; Amirarjomand, S.

    1975-09-01

    The pion form factor is calculated using the structure function Wsub(2), which incorporates kinematical constraints, threshold behaviour and scaling. The Bloom-Gilman sum rule is used and only the two leading Regge trajectories are taken into account

  7. Nucleon electromagnetic form factors with Wilson fermions

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2007-10-01

    The nucleon electromagnetic form factors continue to be of major interest for experimentalists and phenomenologists alike. They provide important insights into the structure of nuclear matter. For a range of interesting momenta they can be calculated on the lattice. The limiting factor continues to be the value of the pion mass. We present the latest results of the QCDSF collaboration using gauge configurations with two dynamical, non-perturbatively improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  8. Nucleon electromagnetic form factors with Wilson fermions

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Inst. fuer Theoretische Physik; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2007-10-15

    The nucleon electromagnetic form factors continue to be of major interest for experimentalists and phenomenologists alike. They provide important insights into the structure of nuclear matter. For a range of interesting momenta they can be calculated on the lattice. The limiting factor continues to be the value of the pion mass. We present the latest results of the QCDSF collaboration using gauge configurations with two dynamical, non-perturbatively improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  9. Factors affecting nuclear development

    International Nuclear Information System (INIS)

    Stevens, G.H.; Girouard, P.

    1995-01-01

    Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos

  10. TRASYS form factor matrix normalization

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1992-01-01

    A method has been developed for adjusting a TRASYS enclosure form factor matrix to unity. This approach is not limited to closed geometries, and in fact, it is primarily intended for use with open geometries. The purpose of this approach is to prevent optimistic form factors to space. In this method, nodal form factor sums are calculated within 0.05 of unity using TRASYS, although deviations as large as 0.10 may be acceptable, and then, a process is employed to distribute the difference amongst the nodes. A specific example has been analyzed with this method, and a comparison was performed with a standard approach for calculating radiation conductors. In this comparison, hot and cold case temperatures were determined. Exterior nodes exhibited temperature differences as large as 7 C and 3 C for the hot and cold cases, respectively when compared with the standard approach, while interior nodes demonstrated temperature differences from 0 C to 5 C. These results indicate that temperature predictions can be artificially biased if the form factor computation error is lumped into the individual form factors to space.

  11. A novel form of the RelA nuclear factor kappaB subunit is induced by and forms a complex with the proto-oncogene c-Myc.

    Science.gov (United States)

    Chapman, Neil R; Webster, Gill A; Gillespie, Peter J; Wilson, Brian J; Crouch, Dorothy H; Perkins, Neil D

    2002-01-01

    Members of both Myc and nuclear factor kappaB (NF-kappaB) families of transcription factors are found overexpressed or inappropriately activated in many forms of human cancer. Furthermore, NF-kappaB can induce c-Myc gene expression, suggesting that the activities of these factors are functionally linked. We have discovered that both c-Myc and v-Myc can induce a previously undescribed, truncated form of the RelA(p65) NF-kappaB subunit, RelA(p37). RelA(p37) encodes the N-terminal DNA binding and dimerization domain of RelA(p65) and would be expected to function as a trans-dominant negative inhibitor of NF-kappaB. Surprisingly, we found that RelA(p37) no longer binds to kappaB elements. This result is explained, however, by the observation that RelA(p37), but not RelA(p65), forms a high-molecular-mass complex with c-Myc. These results demonstrate a previously unknown functional and physical interaction between RelA and c-Myc with many significant implications for our understanding of the role that both proteins play in the molecular events underlying tumourigenesis. PMID:12027803

  12. Strange mesonic transition form factor

    International Nuclear Information System (INIS)

    Goity, J.L.; Musolf, M.J.

    1996-01-01

    The strange-quark vector current ρ-to-π meson transition form factor is computed at one-loop order using strange meson intermediate states. A comparison is made with a φ-meson dominance model estimate. We find that one-loop contributions are comparable in magnitude to those predicted by φ-meson dominance. It is possible that the one-loop contribution can make the matrix element as large as those of the electromagnetic current mediating vector meson radiative decays. However, due to the quadratic dependence of the one-loop results on the hadronic form factor cutoff mass, a large uncertainty in the estimate of the loops is unavoidable. These results indicate that non-nucleonic strange quarks could contribute appreciable in moderate-parallel Q 2 parallel parity-violating electron-nucleus scattering measurements aimed at probing the strange-quark content of the nucleon. copyright 1996 The American Physical Society

  13. Contribution to the study of nuclear aerosol: looking for the dynamic form factor of the aerosol of primary particles of sodium oxide

    International Nuclear Information System (INIS)

    Barbe, M.

    1982-09-01

    The dynamical form factor describes the entrainment of any non spherical particle, of inhomogeneous density, in relation to the entrainment of a spherical particle with the same volume and some sedimentation speed. Experimental study of the form factor and particle size distribution of sodium peroxide primary aerosols [fr

  14. Medium modifications of nucleon electromagnetic form factors

    Energy Technology Data Exchange (ETDEWEB)

    Horikawa, T. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan); Bentz, W. [Department of Physics, School of Science, Tokai University, Hiratsuka-shi, Kanagawa 259-1292 (Japan)]. E-mail: bentz@keyaki.cc.u-tokai.ac.jp

    2005-11-28

    We use the Nambu-Jona-Lasinio model as an effective quark theory to investigate the medium modifications of the nucleon electromagnetic form factors. By using the equation of state of nuclear matter derived in this model, we discuss the results based on the naive quark-scalar diquark picture, the effects of finite diquark size, and the meson cloud around the constituent quarks. We apply this description to the longitudinal response function for quasielastic electron scattering. RPA correlations, based on the nucleon-nucleon interaction derived in the same model, are also taken into account in the calculation of the response function.

  15. Factorization and pion form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1979-01-01

    The behaviour of the pion electromagnetic form factor (EMFF) in the framework of quantum chromodynamics (QCD) is discussed. Pion is considered to be a quark-antiquark bound state. It is proposed to use an OPE description of the bound state structure by matrix elements of certain local gauge-invariant operators. Short-distance quark interactions is proved using a direct analysis of perturbation theory in the α-parametric representation of the Feynman diagrams. It is shown that the short-distance parton picture privides a self-consistent description of the large Q 2 momentum behaviour of the pion EMFF in QCD. Pion EMFF asymptotics is expressed in terms of fu fundamental constants of the theory

  16. Transcriptional activation of LON Gene by a new form of mitochondrial stress: A role for the nuclear respiratory factor 2 in StAR overload response (SOR).

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Isaac, Sara; Eden, Amir; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2015-06-15

    High output of steroid hormone synthesis in steroidogenic cells of the adrenal cortex and the gonads requires the expression of the steroidogenic acute regulatory protein (StAR) that facilitates cholesterol mobilization to the mitochondrial inner membrane where the CYP11A1/P450scc enzyme complex converts the sterol to the first steroid. Earlier studies have shown that StAR is active while pausing on the cytosolic face of the outer mitochondrial membrane while subsequent import of the protein into the matrix terminates the cholesterol mobilization activity. Consequently, during repeated activity cycles, high level of post-active StAR accumulates in the mitochondrial matrix. To prevent functional damage due to such protein overload effect, StAR is degraded by a sequence of three to four ATP-dependent proteases of the mitochondria protein quality control system, including LON and the m-AAA membranous proteases AFG3L2 and SPG7/paraplegin. Furthermore, StAR expression in both peri-ovulatory ovarian cells, or under ectopic expression in cell line models, results in up to 3-fold enrichment of the mitochondrial proteases and their transcripts. We named this novel form of mitochondrial stress as StAR overload response (SOR). To better understand the SOR mechanism at the transcriptional level we analyzed first the unexplored properties of the proximal promoter of the LON gene. Our findings suggest that the human nuclear respiratory factor 2 (NRF-2), also known as GA binding protein (GABP), is responsible for 88% of the proximal promoter activity, including the observed increase of transcription in the presence of StAR. Further studies are expected to reveal if common transcriptional determinants coordinate the SOR induced transcription of all the genes encoding the SOR proteases. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Electroweak form factors of the Skyrmion

    International Nuclear Information System (INIS)

    Braaten, E.; Sze-Man Tse; Willcox, C.

    1986-01-01

    The electroweak form factors of baryons are studied in the semiclassical approximation to the Skyrme model. General expressions for the form factors are given for arbitrary choices of the Skyrme-model Lagrangian. They are applied to the original two-parameter Skyrme model to compute the electric, magnetic, and axial-vector form factors of the nucleon and the electromagnetic nucleon-Δ transition form factors. The dependence of the form factors on the momentum transfer is compared with phenomenological dipole parametrizations

  18. Advanced waste forms from spent nuclear fuel

    International Nuclear Information System (INIS)

    Ackerman, J.P.; McPheeters, C.C.

    1995-01-01

    More than one hundred spent nuclear fuel types, having an aggregate mass of more than 5000 metric tons (2700 metric tons of heavy metal), are stored by the United States Department of Energy. This paper proposes a method for converting this wide variety of fuel types into two waste forms for geologic disposal. The method is based on a molten salt electrorefining technique that was developed for conditioning the sodium-bonded, metallic fuel from the Experimental Breeder Reactor-II (EBR-II) for geologic disposal. The electrorefining method produces two stable, optionally actinide-free, high-level waste forms: an alloy formed from stainless steel, zirconium, and noble metal fission products, and a ceramic waste form containing the reactive metal fission products. Electrorefining and its accompanying head-end process are briefly described, and methods for isolating fission products and fabricating waste forms are discussed

  19. Alternative solidified forms for nuclear wastes

    International Nuclear Information System (INIS)

    McElroy, J.L.; Ross, W.A.

    1976-01-01

    Radioactive wastes will occur in various parts of the nuclear fuel cycle. These wastes have been classified in this paper as high-level waste, intermediate and low-level waste, cladding hulls, and residues. Solidification methods for each type of waste are discussed in a multiple barrier context of primary waste form, applicable coatings or films, matrix encapsulation, canister, engineered structures, and geological storage. The four major primary forms which have been most highly developed are glass for HLW, cement for ILW, organics for LLW, and metals for hulls

  20. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  1. On form factors of boundary changing operators

    Energy Technology Data Exchange (ETDEWEB)

    Bajnok, Z., E-mail: bajnok.zoltan@wigner.mta.hu [MTA Lendület Holographic QFT Group, Wigner Research Centre for Physics, P.O.B. 49, H-1525 Budapest 114 (Hungary); Hollo, L., E-mail: hollo.laszlo@wigner.mta.hu [MTA Lendület Holographic QFT Group, Wigner Research Centre for Physics, P.O.B. 49, H-1525 Budapest 114 (Hungary); Laboratoire de Physique Théorique, École Normale Supérieure, 24, rue Lhomond, 75005 Paris (France)

    2016-04-15

    We develop a form factor bootstrap program to determine the matrix elements of local, boundary condition changing operators. We propose axioms for these form factors and determine their solutions in the free boson and Lee–Yang models. The sudden change in the boundary condition, caused by an operator insertion, can be interpreted as a local quench and the form factors provide the overlap of any state before the quench with any outgoing state after the quench.

  2. Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

    International Nuclear Information System (INIS)

    Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

    2015-01-01

    Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

  3. Charge-symmetry-breaking nucleon form factors

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, Bastian, E-mail: kubis@hiskp.uni-bonn.de [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics (Germany)

    2011-11-15

    A quantitative understanding of charge-symmetry breaking is an increasingly important ingredient for the extraction of the nucleon's strange vector form factors. We review the theoretical understanding of the charge-symmetry-breaking form factors, both for single nucleons and for {sup 4}He.

  4. Charge-symmetry-breaking nucleon form factors

    International Nuclear Information System (INIS)

    Kubis, Bastian

    2011-01-01

    A quantitative understanding of charge-symmetry breaking is an increasingly important ingredient for the extraction of the nucleon’s strange vector form factors. We review the theoretical understanding of the charge-symmetry-breaking form factors, both for single nucleons and for 4 He.

  5. Calculation of nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Renner, D.B.; Brower, R.; Dolgov, D.; Eicker, N.; Lippert, Th.; Negele, J.W.; Pochinsky, A.; Schilling, K.

    2003-01-01

    The formalism is developed to express nucleon matrix elements of the electromagnetic current in terms of form factors consistent with the translational, rotational, and parity symmetries of a cubic lattice. We calculate the number of these form factors and show how appropriate linear combinations approach the continuum limit

  6. Electromagnetic form factors of a massive neutrino

    International Nuclear Information System (INIS)

    Dvornikov, M.S.; Studenikin, A.I.

    2004-01-01

    Electromagnetic form factors of a massive neutrino are studied in a minimally extended standard model in an arbitrary R ξ gauge and taking into account the dependence on the masses of all interacting particles. The contribution from all Feynman diagrams to the electric, magnetic, and anapole form factors, in which the dependence of the masses of all particles as well as on gauge parameters is accounted for exactly, are obtained for the first time in explicit form. The asymptotic behavior of the magnetic form factor for large negative squares of the momentum of an external photon is analyzed and the expression for the anapole moment of a massive neutrino is derived. The results are generalized to the case of mixing between various flavors of the neutrino. Explicit expressions are obtained for the electric, magnetic, and electric dipole and anapole transitional form factors as well as for the transitional electric dipole moment

  7. The pion form factor from first principles

    International Nuclear Information System (INIS)

    Heide, J. van der

    2004-01-01

    We calculate the electromagnetic form factor of the pion in quenched lattice QCD. The non-perturbatively improved Sheikoleslami-Wohlert lattice action is used together with the O(a) improved current. We calculate form factor for pion masses down to mπ = 380 MeV. We compare the mean square radius for the pion extracted from our form factors to the value obtained from the 'Bethe Salpeter amplitude'. Using (quenched) chiral perturbation theory, we extrapolate our results towards the physical pion mass

  8. Measurement of the pion form factor

    International Nuclear Information System (INIS)

    Dally, E.; Hauptman, J.; May, C.

    1977-01-01

    The pion form factor has been measured in the momentum transfer range of 0.03( 2 by scattering pions from atomic electrons in a liquid hydrogen target. The pion form factor is defined to be the elastic scattering cross section divided by that predicted for a point pion. The experiment has been performed in a 100 GeV/c negative pion beam incident on a 50 cm liquid hydrogen target at Fermi laboratory. The corrected form factor equals 0.33+-0.06 f 2 . Vector dominance predicts 0.40 f 2

  9. Small Form Factor RFID Applicator, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — The proposed development of a small form factor Astrobee dedicated RFID label applicator will allow current and future free flying vehicles to place RFID labels...

  10. Heavy meson form factors from QCD

    International Nuclear Information System (INIS)

    Falk, A.F.; Georgi, H.; Grinstein, B.

    1990-01-01

    We calculate the leading QCD radiative corrections to the relations which follow from the decoupling of the heavy quark spin as the quark mass goes infinity and from the symmetry between systems with different heavy quarks. One of the effects we calculate gives the leading q 2 -dependence of the form factor of a heavy quark, which in turn dominates the q 2 -dependence of the form factors of bound states of the heavy quark with light quarks. This, combined with the normalization of the form factor provided by symmetry, gives us a first principles calculation of the heavy meson (or baryon) form factors in the limit of very large heavy quark mass. (orig.)

  11. Make Projects Small Form Factor PCs

    CERN Document Server

    Wessels, Duane

    2006-01-01

    Shoebox sized and smaller, small-form-factor PCs can pack as much computing muscle as a full-sized desktop computer. They consumer less power, have few or no moving parts, and are very quiet. Whether you plan to use one as a standalone PC or want to embed it in your next hacking project, a small-form-factor PC can be a lot of fun to build. Make Projects: Small Form Factor PCs is the only book available that shows you how to build small-form-factor PCs -- from kits and from scratch -- that are more interesting and more personalized than what a full-sized PC can give you. Included in the book

  12. Parallel Integer Factorization Using Quadratic Forms

    National Research Council Canada - National Science Library

    McMath, Stephen S

    2005-01-01

    .... In 1975, Daniel Shanks used class group infrastructure to modify the Morrison-Brillhart algorithm and develop Square Forms Factorization, but he never published his work on this algorithm or provided...

  13. Hadron collisions and the fifth form factor

    International Nuclear Information System (INIS)

    Dokshitzer, Yu.L.; Marchesini, G.

    2005-01-01

    Logarithmically enhanced effects due to radiation of soft gluons at large angles in 2->2 QCD scattering processes are treated in terms of the ''fifth form factor'' that accompanies the four collinear singular Sudakov form factors attached to incoming and outgoing hard partons. Unexpected symmetry under exchange of internal and external variables of the problem is pointed out for the anomalous dimension that governs soft gluon effects in hard gluon-gluon scattering

  14. Nuclear Energy Assessment Battery. Form C.

    Science.gov (United States)

    Showers, Dennis Edward

    This publication consists of a nuclear energy assessment battery for secondary level students. The test contains 44 multiple choice items and is organized into four major sections. Parts include: (1) a knowledge scale; (2) attitudes toward nuclear energy; (3) a behaviors and intentions scale; and (4) an anxiety scale. Directions are provided for…

  15. Magnetic form factors of the trinucleons

    Energy Technology Data Exchange (ETDEWEB)

    Schiavilla, R; Pandharipande, V R; Riska, Dan-Olof

    1989-11-01

    The magnetic form factors of 3H and 3He are calculated with the Monte Carlo method from variational ground-state wave functions obtained for the Argonne and Urbana two- and three-nucleon interactions. The electromagnetic current operator contains one- and two-body terms that are constructed so as to satisfy the continuity equation with the two-nucleon potential in the Hamiltonian. The results obtained with the Argonne two-nucleon interaction are in overall agreement with the empirical values. It appears that the remaining theoretical uncertainty, in the calculation of these form factors from a given interaction model, is dominated by that in the electromagnetic form factors of the nucleon. It is found that the isovector magnetic form factors are rather sensitive to the details of the isospin-dependent tensor force, and they are much better reproduced with the Argonne than the Urbana potential. The isoscalar magnetic form factors appear to be sensitive to the spin-orbit interactions, and are better reproduced with the Urbana potential. The Argonne potential has a stronger τ1∙τ2 tensor force, while the Urbana one has a shorter-range spin-orbit interaction.

  16. Asymptotics of Heavy-Meson Form Factors

    CERN Document Server

    Grozin, A.G.; Grozin, Andrey G.; Neubert, Matthias

    1997-01-01

    Using methods developed for hard exclusive QCD processes, we calculate the asymptotic behaviour of heavy-meson form factors at large recoil. It is determined by the leading- and subleading-twist meson wave functions. For $1\\ll |v\\cdot v'|\\ll m_Q/\\Lambda$, the form factors are dominated by the Isgur--Wise function, which is determined by the interference between the wave functions of leading and subleading twist. At $|v\\cdot v'|\\gg m_Q/\\Lambda$, they are dominated by two functions arising at order $1/m_Q$ in the heavy-quark expansion, which are determined by the leading-twist wave function alone. The sum of these contributions describes the form factors in the whole region $|v\\cdot v'|\\gg 1$. As a consequence, there is an exact zero in the form factor for the scattering of longitudinally polarized $B^*$ mesons at some value $v\\cdot v'\\sim m_b/\\Lambda$, and an approximate zero in the form factor of $B$ mesons in the timelike region ($v\\cdot v'\\sim -m_b/\\Lambda$). We obtain the evolution equations and sum rules ...

  17. Review of radiation effects in solid-nuclear-waste forms

    International Nuclear Information System (INIS)

    Weber, W.J.

    1981-09-01

    Radiation effects on the stability of high-level nuclear waste (HLW) forms are an important consideration in the development of technology to immobilize high-level radioactive waste because such effects may significantly affect the containment of the radioactive waste. Since the required containment times are long (10 3 to 10 6 years), an understanding of the long-term cumulative effects of radiation damage on the waste forms is essential. Radiation damage of nuclear waste forms can result in changes in volume, leach rate, stored energy, structure/microstructure, and mechanical properties. Any one or combination of these changes might significantly affect the long-term stability of the nuclear waste forms. This report defines the general radiation damage problem in nuclear waste forms, describes the simulation techniques currently available for accelerated testing of nuclear waste forms, and reviews the available data on radiation effects in both glass and ceramic (primarily crystalline) waste forms. 76 references

  18. Soviet Nuclear Strategy form Stalin to Gorbachev

    International Nuclear Information System (INIS)

    Catudal, H.M.

    1989-01-01

    This book examines the nature of the Soviet nuclear threat and how it has evolved over the years. Too often in the past U.S. officials, in shaping and directing plans for American nuclear forces, have tended to see Soviet military forces and strategy as a reflection of their own stance or simply as projecting the worst plausible case of Soviet intentions and capabilities. The result has been a distorted if not dangerous portrayal of the real threat. Soviet nuclear strategy, as explained in this detailed book, has evolved significantly since the days when the Soviets first possessed nuclear weapons under Joseph Stalin. Today there is in development a new Soviet military and strategic doctrine reflected in Gorbachev's words, We require a radical break with traditions of political thinking. This new doctrine promises to have a profound impact on European security and the overall East-West relationship

  19. Color-kinematic duality for form factors

    International Nuclear Information System (INIS)

    Boels, Rutger H.; Kniehl, Bernd A.; Tarasov, Oleg V.; Yang, Gang

    2012-12-01

    Recently a powerful duality between color and kinematics has been proposed for integrands of scattering amplitudes in quite general gauge theories. In this paper the duality proposal is extended to the more general class of gauge theory observables formed by form factors. After a discussion of the general setup the existence of the duality is verified in two and three loop examples in four dimensional maximally supersymmetric Yang-Mills theory which involve the stress energy tensor multiplet. In these cases the duality reproduces known results in a particularly transparent and uniform way. As a non-trivial application we obtain a very simple form of the integrand of the four-loop two-point (Sudakov) form factor which passes a large set of unitarity cut checks.

  20. Color-kinematic duality for form factors

    Energy Technology Data Exchange (ETDEWEB)

    Boels, Rutger H.; Kniehl, Bernd A.; Tarasov, Oleg V.; Yang, Gang [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik

    2012-12-15

    Recently a powerful duality between color and kinematics has been proposed for integrands of scattering amplitudes in quite general gauge theories. In this paper the duality proposal is extended to the more general class of gauge theory observables formed by form factors. After a discussion of the general setup the existence of the duality is verified in two and three loop examples in four dimensional maximally supersymmetric Yang-Mills theory which involve the stress energy tensor multiplet. In these cases the duality reproduces known results in a particularly transparent and uniform way. As a non-trivial application we obtain a very simple form of the integrand of the four-loop two-point (Sudakov) form factor which passes a large set of unitarity cut checks.

  1. Hadronic form factors in kaon photoproduction

    Energy Technology Data Exchange (ETDEWEB)

    Syukurilla, L., E-mail: tmart@fisika.ui.ac.id; Mart, T., E-mail: tmart@fisika.ui.ac.id [Department Fisika, FMIPA, Universitas Indonesia, Depok, 164242 (Indonesia)

    2014-09-25

    We have revisited the effect of hadronic form factors in kaon photoproduction process by utilizing an isobaric model developed for kaon photoproduction off the proton. The model is able to reproduce the available experimental data nicely as well as to reveal the origin of the second peak in the total cross section, which was the main source of confusion for decades. Different from our previous study, in the present work we explore the possibility of using different hadronic form factors in each of the KΛN vertices. The use of different hadronic form factors, e.g. dipole, Gaussian, and generalized dipole, has been found to produce a more flexible isobar model, which can provide a significant improvement in the model.

  2. Paramagnetic form factors from itinerant electron theory

    International Nuclear Information System (INIS)

    Cooke, J.F.; Liu, S.H.; Liu, A.J.

    1985-01-01

    Elastic neutron scattering experiments performed over the past two decades have provided accurate information about the magnetic form factors of paramagnetic transition metals. These measurements have traditionally been analyzed in terms of an atomic-like theory. There are, however, some cases where this procedure does not work, and there remains the overall conceptual problem of using an atomistic theory for systems where the unpaired-spin electrons are itinerant. We have recently developed computer codes for efficiently evaluating the induced magnetic form factors of fcc and bcc itinerant electron paramagnets. Results for the orbital and spin contributions have been obtained for Cr, Nb, V, Mo, Pd, and Rh based on local density bands. By using calculated spin enhancement parameters, we find reasonable agreement between theory and neutron form factor data. In addition, these zero parameter calculations yield predictions for the bulk susceptibility on an absolute scale which are in reasonable agreement with experiment in all treated cases except palladium

  3. Weak form factors of beauty baryons

    International Nuclear Information System (INIS)

    Ivanov, M.A.; Lyubovitskij, V.E.

    1992-01-01

    Full analysis of semileptonic decays of beauty baryons with J p =1/2 2 and J p =3/2 2 into charmed ones within the Quark Confinement Model is reported. Weak form factors and decay rates are calculated. Also the heavy quark limit m Q →∞ (Isgur-Wise symmetry) is examined. The weak heavy-baryon form factors in the Isgur-Wise limit and 1/m Q -corrections to them are computered. The Ademollo-Gatto theorem is spin-flavour symmetry of heavy quarks is checked. 33 refs.; 1 fig.; 9 tabs

  4. The Nucleon Axial Form Factor and Staggered Lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Aaron Scott [Chicago U.

    2017-01-01

    The study of neutrino oscillation physics is a major research goal of the worldwide particle physics program over the upcoming decade. Many new experiments are being built to study the properties of neutrinos and to answer questions about the phenomenon of neutrino oscillation. These experiments need precise theoretical cross sections in order to access fundamental neutrino properties. Neutrino oscillation experiments often use large atomic nuclei as scattering targets, which are challenging for theorists to model. Nuclear models rely on free-nucleon amplitudes as inputs. These amplitudes are constrained by scattering experiments with large nuclear targets that rely on the very same nuclear models. The work in this dissertation is the rst step of a new initiative to isolate and compute elementary amplitudes with theoretical calculations to support the neutrino oscillation experimental program. Here, the eort focuses on computing the axial form factor, which is the largest contributor of systematic error in the primary signal measurement process for neutrino oscillation studies, quasielastic scattering. Two approaches are taken. First, neutrino scattering data on a deuterium target are reanalyzed with a model-independent parametrization of the axial form factor to quantify the present uncertainty in the free-nucleon amplitudes. The uncertainties on the free-nucleon cross section are found to be underestimated by about an order of magnitude compared to the ubiquitous dipole model parametrization. The second approach uses lattice QCD to perform a rst-principles computation of the nucleon axial form factor. The Highly Improved Staggered Quark (HISQ) action is employed for both valence and sea quarks. The results presented in this dissertation are computed at physical pion mass for one lattice spacing. This work presents a computation of the axial form factor at zero momentum transfer, and forms the basis for a computation of the axial form factor momentum dependence

  5. Chiral analysis of baryon form factors

    Energy Technology Data Exchange (ETDEWEB)

    Gail, T.A.

    2007-11-08

    This work presents an extensive theoretical investigation of the structure of the nucleon within the standard model of elementary particle physics. In particular, the long range contributions to a number of various form factors parametrizing the interactions of the nucleon with an electromagnetic probe are calculated. The theoretical framework for those calculations is chiral perturbation theory, the exact low energy limit of Quantum Chromo Dynamics, which describes such long range contributions in terms of a pion-cloud. In this theory, a nonrelativistic leading one loop order calculation of the form factors parametrizing the vector transition of a nucleon to its lowest lying resonance, the {delta}, a covariant calculation of the isovector and isoscalar vector form factors of the nucleon at next to leading one loop order and a covariant calculation of the isoscalar and isovector generalized vector form factors of the nucleon at leading one loop order are performed. In order to perform consistent loop calculations in the covariant formulation of chiral perturbation theory an appropriate renormalization scheme is defined in this work. All theoretical predictions are compared to phenomenology and results from lattice QCD simulations. These comparisons allow for a determination of the low energy constants of the theory. Furthermore, the possibility of chiral extrapolation, i.e. the extrapolation of lattice data from simulations at large pion masses down to the small physical pion mass is studied in detail. Statistical as well as systematic uncertainties are estimated for all results throughout this work. (orig.)

  6. Simple parametrization of nucleon form factors

    International Nuclear Information System (INIS)

    Kelly, J.J.

    2004-01-01

    This Brief Report provides simple parametrizations of the nucleon electromagnetic form factors using functions of Q 2 that are consistent with dimensional scaling at high Q 2 . Good fits require only four parameters each for G Ep , G Mp , and G Mn and only two for G En

  7. From form factors to generalized parton distributions

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus

    2013-06-15

    I present an extraction of generalized parton distributions from selected data on the electromagnetic nucleon form factors. The extracted distributions can in particular be used to quantify the contribution to the proton spin from the total angular momentum carried by valence quarks, as well as their transverse spatial distribution inside the proton.

  8. Form factor expansion for thermal correlators

    NARCIS (Netherlands)

    Pozsgay, B.; Takács, G.

    2010-01-01

    We consider finite temperature correlation functions in massive integrable quantum field theory. Using a regularization by putting the system in finite volume, we develop a novel approach (based on multi-dimensional residues) to the form factor expansion for thermal correlators. The first few terms

  9. Baryon electromagnetic form factors at BESIII

    Directory of Open Access Journals (Sweden)

    Dbeyssi Alaa

    2017-01-01

    Full Text Available Electromagnetic form factors are fundamental quantities which parameterize the electric and magnetic structure of hadrons. This contribution reports on the measurements of baryon electromagnetic form factors at the BESIII experiment in Beijing. The Beijing e+e− collider BEPCII is a double-ring symmetric collider running at √s between 2.0 and 4.6 GeV. Baryon electromagnetic form factors can be measured at BESIII in direct e+e−-annihilation and in initial state radiation processes. Based on the data collected by the BESIII detector at 12 center of mass energies between 2.23 and 3.67 GeV, the e+e− → p̄p cross section and the time-like proton form factor is measured. Preliminary results from the analysis of the initial state radiation process e+e− → p̄pγ using a data set of 7.408 fb−1 collected at center-of-mass energies between 3.773 and 4.6 GeV, are also presented. The cross section for e+e−→Λ¯Λ${e^ + }{e^ - } \\to \\bar \\Lambda \\Lambda $ is measured based on 40.5 pb−1 data collected at 4 energy points from the threshold up to 3.08 GeV. Preliminary results on the total cross section and the Λ effective form factor are shown. Ongoing analysis based on the high luminosity energy scan from 2015 and from radiative return at different √s are also described.

  10. Evaluation of E2 form factor = 24Mg

    International Nuclear Information System (INIS)

    Marinelli, J.R.; Moreira, J.R.

    1988-11-01

    Longitudinal and transverse electron scattering form factors for the 2 + state at 1.37 Mev of the 24 Mg nucleus was evaluated with rotational model wavefunctions. Four different approaches were used for the transverse E2 form factor: PHF, cranking model, ridig rotor and irrotational flow. For the nuclear intrinsic wavefunction, the Nilsson model was assumed in all approaches yielding the calculation of the form factor in PWBA and DWBA. The results are discussed and compared with a recent measurement performed with 180 0 electron scattered from this state. The DWBA calculation, taking into account first order corrections shows that PHF and irrotational flow models give the best agreements with the available data and compete in quality with more complex calculation performed under the 'shell model' approach. (author) [pt

  11. Is nuclear riskier than other energy forms?

    International Nuclear Information System (INIS)

    Inhaber, Herbert

    1987-01-01

    Risk is defined as danger to human health by death, accident or disease. The risks identified in this chapter are assessed by comparison. Comparative risk analysis touches on health physics, human perception, statistics, occupational safety, probability, energy analysis, physics and many branches of engineering. Only the major conclusions of risk analysis are considered, as this is essentially a summary of major issues with specific comparisons added. One of the issues considered is risk perception. A comparison is made of nuclear risk with conventional and non-conventional energy sources. It is concluded that the total nuclear risk is one of the lowest, if not the lowest, of the major energy sources of the future. (U.K.)

  12. Leaching of nuclear power reactor wastes forms

    International Nuclear Information System (INIS)

    Endo, L.S.; Villalobos, J.P.; Miyamoto, H.

    1986-01-01

    The leaching tests for power reactor wastes carried out at IPEN/CNEN-SP are described. These waste forms consist mainly of spent resins and boric acid concentrates solidified in ordinary Portland cement. All tests were conducted according to the ISO and IAEA recommendations. 3 years leaching results are reported, determining cesium and strontium diffusivity coefficients for boric acid waste form and ion-exchange resins. (Author) [pt

  13. Organizational factors in nuclear safety

    International Nuclear Information System (INIS)

    Wilpert, Bernhard

    2000-01-01

    The overall picture of factors which contributed to the event presents a panorama of a NPP where organizational and managerial characteristics were intricately intertwined and emerged as crucial for a general deterioration of the plant's capabilities to continually correct its deficiencies and optimize its operations. In the following author shall attempt to first cover various important efforts to modeling organizational factors relevant to safety. The second part of my presentation will offer an attempt towards an integrative model. The third part concludes with an agenda for research and practice. Most of the twelve different approaches above attempt to consider safety relevant organizational factors by way of pragmatic classifications. Together with their sub-categories we can count close to 160 different factors on various levels of abstraction. This is tantamount to say that most approaches lack systematic theoretical underpinnings. Thus then arises the question whether we need to develop a generic model, which promises to encompass these three major approaches altogether. Practical issues emerge particularly in the domain of organizational development, i.e. the goal oriented efforts to change the structures and the functioning of nuclear operations in such a way that the desired outputs in terms safety and reliability result in a sustained fashion. Again, these practical concerns are intimately related to developments and advances in theory and methodology. Only a close cooperation among scientists from various disciplines and of practitioners holds the promise of adequately understanding and use of organizational factors in future improving the safety record of nuclear industry worldwide. (S.Y.)

  14. Perturbative QCD and electromagnetic form factors

    International Nuclear Information System (INIS)

    Carlson, C.E.; Gross, F.

    1987-01-01

    We calculate nucleon magnetic form factors using perturbative QCD for several distribution amplitudes including a general one given in terms of Appell polynomials. We find that the magnitude and sign of both nucleon magnetic form factors can be explained within perturbative QCD. The observed normalization of G/sub Mp/ requires that the distribution amplitude be broader than its superhigh momentum transfer limit, and the G/sub Mn//G/sub Mp/ data may require the distribution amplitude to be asymmetric, in accord with distribution amplitudes derived from QCD sum rules. Some speculation as to how an asymmetric distribution amplitude can come about is offered. Finally, we show that the soft contributions corresponding to the particular distribution amplitudes we use need not be bigger than the data. 16 refs., 6 figs

  15. Nucleon electromagnetic form factors from lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Koutsou, G.; Negele, J. W.; Tsapalis, A.

    2006-01-01

    We evaluate the isovector nucleon electromagnetic form factors in quenched and unquenched QCD on the lattice using Wilson fermions. In the quenched theory we use a lattice of spatial size 3 fm at β=6.0 enabling us to reach low momentum transfers and a lowest pion mass of about 400 MeV. In the unquenched theory we use two degenerate flavors of dynamical Wilson fermions on a lattice of spatial size 1.9 fm at β=5.6 and lowest pion mass of about 380 MeV enabling comparison with the results obtained in the quenched theory. that unquenching effects are small for the pion masses considered in this work. We compare our lattice results to the isovector part of the experimentally measured form factors

  16. Nucleon form factors. Probing the chiral limit

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Physik-Dept.; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2006-10-15

    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  17. Form factors of heavy mesons in QCD

    International Nuclear Information System (INIS)

    Shifman, M.A.; Vysotsky, M.I.

    1980-01-01

    Logarithmic corrections to form factors of mesons built from heavy quarks are dirived in the framework of quantum chromodynamics. The reactions e + e - → etasub(c)γ and H → J/PSIγ are considered as an example. A novel feature as compared to the well studied problem of the pion form factor is the existence of the transformations between the quark-antiquark state c anti c and the gluonic one. O(αsub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms is summed up with the help of the operator technique. Apart from already known results for quark operators some new results referring to gluon operators and their mixing with the quark ones are used. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second derivation is based on conformal symmetry considerations

  18. Nucleon form factors. Probing the chiral limit

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2006-10-01

    The electromagnetic form factors provide important hints for the internal structure of the nucleon and continue to be of major interest for experimentalists. For an intermediate range of momentum transfers the form factors can be calculated on the lattice. However, reliability of the results is limited by systematic errors due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet unaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with Nf=2, non-perturbatively O(a)-improved Wilson fermions at very small quark masses down to 340 MeV pion mass, where we start to probe the relevant quark mass region. (orig.)

  19. Elastic form factors at higher CEBAF energies

    Energy Technology Data Exchange (ETDEWEB)

    Petratos, G.G. [Kent State Univ., OH (United States)

    1994-04-01

    The prospects for elastic scattering from few body systems with higher beam energies at CEBAF is presented. The deuteron and{sup 3}He elastic structure functions A(Q{sup 2}) can be measured at sufficiently high momentum transfers to study the transition between the conventional meson-nucleon and the constituent quark-gluon descriptions. Possible improvements in the proton magnetic form factor data are also presented.

  20. Baryon form factors in chiral perturbation theory

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, B.; Meissner, U.G. [Forschungszentrum Juelich GmbH (Germany). Inst. fuer Kernphysik

    2001-01-01

    We analyze the electromagnetic form factors of the ground state baryon octet to fourth order in relativistic baryon chiral perturbation theory. Predictions for the {sigma}{sup -} charge radius and the {lambda}-{sigma}{sup 0} transition moment are found to be in excellent agreement with the available experimental information. Furthermore, the convergence behavior of the hyperon charge radii is shown to be more than satisfactory. (orig.)

  1. Electromagnetic form factors of composite systems

    International Nuclear Information System (INIS)

    Nowak, E.J.

    1978-01-01

    Electromagnetic form factors are examined for a spin-zero, two-body composite system with emphasis on the case of small momentum transfer and/or deep (relativistic) binding. Perturbation theory calculations are first performed using spin-zero and then spin-one-half constituents. A dispersion representation of the bound-state vertex function is conjectured first for scalar and then for fermion constituents. Then a relativistic effective range approximation (RERA) is developed for each case and applied to the calculation of the electromagnetic form factor. The approach is applied to the study of the charge radii of the K 0 and K + mesons. The K/sub l3/ form factor is calculated in the fermion constituent RERA model, and restrictions are imposed on the model parameters from available experimental data. With these restrictions the limits 0.24fm less than or equal to √[abs. value ( 2 >/sub K 0 /)] less than or equal to = 0.36fm and 0.66fm less than or equal to = √( 2 >/sub K + /) less than or equal to 0.79fm are obtained for the kaon charge radii, and -.22 less than or equal to xi less than or equal to -.13 is found for the ratio of the neutral to charged kaon charge radius squared

  2. Leaching of nuclear power reactor waste forms

    International Nuclear Information System (INIS)

    Endo, L.S.; Villalobos, J.P.; Miyamoto, H.

    1987-01-01

    The leaching tests for immobilized power reactor wastes carried out at IPEN are described. These wastes forms consist mainly of spent resins and boric acid concentrates solidified in ordinary Portland cement. All tests were conducted according to the ISO and IAEA recommendations. Three years leaching results are reported. The cesium diffuvity coefficients determined out of these results are about 1 x 10 -8 cm 2 /s for boric acid waste form and 9 x 10 -9 cm 2 /s for ion-exchange resin waste. Strontium diffusivity coefficients found are about 3 x 10 -11 cm 2 /s and 9 x 10 -11 cm 2 /s respectively. (Author) [pt

  3. Electromagnetic form factors and vertex constants for 6Li

    International Nuclear Information System (INIS)

    Blokhintsev, L.D.; Shvarts, I.A.

    1977-01-01

    It has been assumed that the main contribution to the rapidly changing part of the charge form factor of 6 Li provides the amplitude of the triangle diagram containing virtual lines of deuteron and α particle. The vertex constant G 2 for the 6 Li→α+d decay is expressed through the nuclear charge radii for 6 Li, d, and α. Taking into account coulomb interaction in the vertex of the 6 Li→α+d reaction increases G 2 by about a factor of two. The account of virtuality of a deuteron cluster also leads to an increase in G 2

  4. Electric Form Factor of the Neutron

    Science.gov (United States)

    Feuerbach, Robert

    2007-10-01

    Recent polarization-based precision measurements of the nucleons' elastic electric form factors have led to surprising results. The measurement of the ratio of the proton's electromagnetic form factors, μpGE^p/GM^p, was found to drop nearly linearly with Q^2 out to at least 5 GeV^2, inconsistent with the older Rosenbluth-type experiments. A recent measurement of GE^n, the neutron's electric form-factor saw GE^n does not fall off as quickly as commonly expected up to Q^2 1.5 GeV^2. Extending this study, a precision measurement of GE^n up to Q^2=3.5 GeV^2 was completed in Hall A at Jefferson Lab. The ratio GE^n/GM^n was measured through the beam-target asymmetry A of electrons quasi-elastically scattered off polarized neutrons in the reaction ^3He(e,e' n). The experiment took full advantage of the electron beam, recent target developments, as well as two detectors new to Jefferson Lab. The measurement used the accelerator's 100% duty-cycle high-polarization (typically 84%) electron beam and a new, hybrid optically-pumped polarized ^3He target which achieved in-beam polarizations in excess of 50%. A medium acceptance (80msr) open-geometry magnetic spectrometer (BigBite) detected the scattered electron, while a geometrically matched neutron detector observed the struck neutron. Preliminary results from this measurement will be discussed and compared to modern calculations of GE^n.

  5. Development of standard testing methods for nuclear-waste forms

    International Nuclear Information System (INIS)

    Mendel, J.E.; Nelson, R.D.

    1981-11-01

    Standard test methods for waste package component development and design, safety analyses, and licensing are being developed for the Nuclear Waste Materials Handbook. This paper describes mainly the testing methods for obtaining waste form materials data

  6. Form factors and excitations of topological solitons

    International Nuclear Information System (INIS)

    Weir, David J.; Rajantie, Arttu

    2011-01-01

    We show how the interaction properties of topological solitons in quantum field theory can be calculated with lattice Monte Carlo simulations. Topologically nontrivial field configurations are key to understanding the nature of the QCD vacuum through, for example, the dual superconductor picture. Techniques that we have developed to understand the excitations and form factors of topological solitons, such as kinks and 't Hooft-Polyakov monopoles, should be equally applicable to chromoelectric flux tubes. We review our results for simple topological solitons and their agreement with exact results, then discuss our progress towards studying objects of interest to high energy physics.

  7. Recent Studies of Nucleon Electromagnetic Form Factors

    International Nuclear Information System (INIS)

    Gilad, Shalev

    2010-01-01

    The electromagnetic form factors of nucleons are fundamental quantities in nucleon structure. As such, they have been studied extensively both theoretically and experimentally. Significant progress has been made with new measurements at Jlab, MAMI and MIT-Bates, with emphases on expanding the momentum-transfer range and on higher precision. In this paper, we describe the status of this field and present new results from measurements at both low and high momentum transfers. We also compare the experimental data to model predictions, and mention possible implications of the new results to other fields.

  8. Neutron electric form factor via recoil polarimetry

    International Nuclear Information System (INIS)

    Richard Madey; Andrei Semenov; Simon Taylor; Aram Aghalaryan; Erick Crouse; Glen MacLachlan; Bradley Plaster; Shigeyuki Tajima; William Tireman; Chenyu Yan; Abdellah Ahmidouch; Brian Anderson; Razmik Asaturyan; O. Baker; Alan Baldwin; Herbert Breuer; Roger Carlini; Michael Christy; Steve Churchwell; Leon Cole; Samuel Danagoulian; Donal Day; Mostafa Elaasar; Rolf Ent; Manouchehr Farkhondeh; Howard Fenker; John Finn; Liping Gan; Kenneth Garrow; Paul Gueye; Calvin Howell; Bitao Hu; Mark Jones; James Kelly; Cynthia Keppel; Mahbubul Khandaker; Wooyoung Kim; Stanley Kowalski; Allison Lung; David Mack; D. Manley; Pete Markowitz; Joseph Mitchell; Hamlet Mkrtchyan; Allena Opper; Charles Perdrisat; Vina Punjabi; Brian Raue; Tilmann Reichelt; Joerg Reinhold; Julie Roche; Yoshinori Sato; Wonick Seo; Neven Simicevic; Gregory Smith; Samuel Stepanyan; Vardan Tadevosyan; Liguang Tang; Paul Ulmer; William Vulcan; John Watson; Steven Wells; Frank Wesselmann; Stephen Wood; Chen Yan; Seunghoon Yang; Lulin Yuan; Wei-Ming Zhang; Hong Guo Zhu; Xiaofeng Zhu

    2003-01-01

    The ratio of the electric to the magnetic form factor of the neutron, G En /G Mn , was measured via recoil polarimetry from the quasielastic d((pol-e),e(prime)(pol-n)p) reaction at three values of Q 2 [viz., 0.45, 1.15 and 1.47 (GeV/c) 2 ] in Hall C of the Thomas Jefferson National Accelerator Facility. Preliminary data indicate that G En follows the Galster parameterization up to Q 2 = 1.15 (GeV/c) 2 and appears to rise above the Galster parameterization at Q 2 = 1.47 (GeV/c) 2

  9. Axial nucleon form factors from lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Brinet, M.; Carbonell, J.; Harraud, P. A.; Papinutto, M.; Constantinou, M.; Guichon, P.; Jansen, K.; Korzec, T.

    2011-01-01

    We present results on the nucleon axial form factors within lattice QCD using two flavors of degenerate twisted mass fermions. Volume effects are examined using simulations at two volumes of spatial length L=2.1 fm and L=2.8 fm. Cut-off effects are investigated using three different values of the lattice spacings, namely a=0.089 fm, a=0.070 fm and a=0.056 fm. The nucleon axial charge is obtained in the continuum limit and chirally extrapolated to the physical pion mass enabling comparison with experiment.

  10. Development of multibarrier nuclear waste forms

    International Nuclear Information System (INIS)

    1979-03-01

    The multibarrier concept aims to separate the radionuclide-containing inner core material and the environment by the use of coatings and matrices. Two options were developed for the inner core of the multibarrier concept: supercalcine pellets and glass marbles. Supercalcine is a crystalline assemblage of mutually compatible, refractory, and leach-resistant solid solution phases incorporating high-level liquid waste ions. Supercalcine powder is produced by spray calcining the liquid waste stream to which Al 2 O 3 , CaO, SiO 2 , and SrO have been added. Supercalcine pellets are produced by disc pelletizing. The amorphous supercalcine crystallizes into solid solution phases after subsequent heat treatment. Based on the multibarrier processes described, several conclusions can be made: gravity sintering and vacuum casting are both applicable methods for metal matrix encapsulation. The multibarrier concept of glass marbles encapsulated in a vacuum-cast lead alloy provides enhanced inertness at a minimum increase in technological complexity. If it were desirable to develop a crystalline multibarrier waste form, uncoated sintered supercalcine pellets would offer enhanced inertness at a much lower level of technological complexity than glaze- or CVD-coated supercalcine. The 16-inch diameter pelletizer unit has enough capacity to handle the output of a large PNL spray calciner (52.5 kg of calcine/hr) and it can form spray-calcined material into pellets with diameters of 2 mm to 20 mm having strength enough to withstand handling without significant breakage.Chemical vapor deposition coating of supercalcine should be pursued only if a very high level of inertness is required

  11. Form factors of heavy mesons in QCD

    Energy Technology Data Exchange (ETDEWEB)

    Shifman, M A; Vysotsky, M I [Moskovskii Inst. Theoreticheskoj i Ehksperimental' noj Fiziki (USSR)

    1981-08-10

    We discuss logarithmic corrections to form factors of mesons built from heavy quarks. The reactions e/sup +/e/sup -/ ..-->.. etasub(c)..gamma.. and H ..-->.. J/psi..gamma.. are considered as an example. A novel feature as compared to the well-studied problem of the pion form factor is the existence of transitions between the quark-antiquark state canti c and the gluonic one. O(..cap alpha..sub(s)) corrections are calculated exactly. An infinite series of the leading logarithmic terms (..cap alpha..sub(s)ln(Q/sup 2//m/sup 2/sub(c)))sup(n) is summed up with the help of the operator technique. Apart from results already known for quark operators, we use some new results referring to gluon operator and their mixing with those made from quarks. Two alternative derivations of the multiplicatively renormalizable operators are given. The first one reduces to a direct computation of the mixing matrix and its diagonalization, the second is based on conformal symmetry considerations.

  12. Helium Compton Form Factor Measurements at CLAS

    Energy Technology Data Exchange (ETDEWEB)

    Voutier, Eric J.-M. [Laboratoire de Physique Subatomique et Cosmologie

    2013-07-01

    The distribution of the parton content of nuclei, as encoded via the generalized parton distributions (GPDs), can be accessed via the deeply virtual Compton scattering (DVCS) process contributing to the cross section for leptoproduction of real photons. Similarly to the scattering of light by a material, DVCS provides information about the dynamics and the spatial structure of hadrons. The sensitivity of this process to the lepton beam polarization allows to single-out the DVCS amplitude in terms of Compton form factors that contain GPDs information. The beam spin asymmetry of the $^4$He($\\vec {\\mathrm e}$,e$' \\gamma ^4$He) process was measured in the experimental Hall B of the Jefferson Laboratory to extract the real and imaginary parts of the twist-2 Compton form factor of the $^4$He nucleus. The experimental results reported here demonstrate the relevance of this method for such a goal, and suggest the dominance of the Bethe-Heitler amplitude to the unpolarized process in the kinematic range explored by the experiment.

  13. Nucleon Form Factors Using Spin Degrees of Freedom

    International Nuclear Information System (INIS)

    Jones, Mark

    2002-01-01

    An overview of recent measurements of the neutron and proton electromagnetic form factors from double polarization experiments. Spin observables are sensitive to the product of nucleon form factor which allows access to the small nucleon electric form factors

  14. Determination of chemical forms of C-14 in liquid discharges from nuclear power plants

    Czech Academy of Sciences Publication Activity Database

    Světlík, Ivo; Fejgl, M.; Povinec, P. P.; Kořínková, Tereza; Tomášková, Lenka; Pospíchal, J.; Kurfiřt, M.; Striegler, R.; Kaufmanová, M.

    2017-01-01

    Roč. 177, OCT (2017), s. 256-260 ISSN 0265-931X Institutional support: RVO:61389005 Keywords : analytical routines * dissolved organic forms of C-14 (DIC) * dissolved inorganic forms of C-14 (DOC) * Nuclear power plant (NPP) * liquid releases Subject RIV: DL - Nuclear Waste, Radioactive Pollution ; Quality OBOR OECD: Environment al sciences (social aspects to be 5.7) Impact factor: 2.310, year: 2016

  15. Nur77 forms novel nuclear structures upon DNA damage that cause transcriptional arrest

    International Nuclear Information System (INIS)

    Leseleuc, Louis de; Denis, Francois

    2006-01-01

    The orphan nuclear receptor Nur77 has been implicated in both growth and apoptosis, and its function and activity can be modulated by cellular redistribution. Green fluorescent protein-tagged Nur77 was used to evaluate the role of Nur77 intracellular redistribution in response to genotoxic stress. Selected DNA damaging agents and transcription inhibition lead to rapid redistribution of Nur77 into nuclear structures distinct from conventional nuclear bodies. These nuclear bodies formed transiently were tightly bound to the nuclear matrix and conditions that lead to their appearance were associated with Nur77 transcriptional inhibition. The formation of Nur77 nuclear bodies might be involved in programmed cell death modulation upon exposure to DNA damaging agents that inhibit transcription by sequestrating this proapoptotic factor in dense nuclear structures

  16. Pion transition form factor in k{sub T} factorization

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hsiang-nan [Academica Sinica, Taipei, Taiwan (China). Inst. of Physics; Tsing-Hua Univ., Hsinchu, Taiwan (China). Dept. of Phyiscs; National Cheng-Kung Univ., Tainan, Taiwan (China). Dept. of Physics; National Cheng-Chi Univ, Taipei, Taiwan (China). Inst. of Applied Physics; Mishima, Satoshi [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2009-07-15

    It has been pointed out that the recent BaBar data on the {pi}{gamma}{sup *} {yields} {gamma} transition form factor F{sub {pi}}{sub {gamma}}(Q{sup 2}) at low (high) momentum transfer squared Q{sup 2} indicate an asymptotic (flat) pion distribution amplitude. These seemingly contradictory observations can be reconciled in the k{sub T} factorization theorem: the increase of the measured Q{sup 2}FF{sub {pi}}{sub {gamma}}(Q{sup 2}) for Q{sup 2} > 10 GeV{sup 2} is explained by convoluting a k{sub T} dependent hard kernel with a flat pion distribution amplitude, k{sub T} being a parton transverse momentum. The low Q{sup 2} data are accommodated by including the resummation of {alpha}{sub s} ln{sup 2}x, x being a parton momentum fraction, which provides a stronger suppression at the endpoints of x. The next-to-leading-order correction to the pion transition form factor is found to be less than 20% in the considered range of Q{sup 2}. (orig.)

  17. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Swain, A.D.

    1981-01-01

    This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants. (orig.) [de

  18. Human factors in nuclear power plant operations

    International Nuclear Information System (INIS)

    Swain, A.D.

    1980-08-01

    This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants

  19. Method for forming microspheres for encapsulation of nuclear waste

    Science.gov (United States)

    Angelini, Peter; Caputo, Anthony J.; Hutchens, Richard E.; Lackey, Walter J.; Stinton, David P.

    1984-01-01

    Microspheres for nuclear waste storage are formed by gelling droplets containing the waste in a gelation fluid, transferring the gelled droplets to a furnace without the washing step previously used, and heating the unwashed gelled droplets in the furnace under temperature or humidity conditions that result in a substantially linear rate of removal of volatile components therefrom.

  20. Parallel Integer Factorization Using Quadratic Forms

    National Research Council Canada - National Science Library

    McMath, Stephen S

    2005-01-01

    Factorization is important for both practical and theoretical reasons. In secure digital communication, security of the commonly used RSA public key cryptosystem depends on the difficulty of factoring large integers...

  1. Alternate nuclear waste forms and interactions in geologic media

    International Nuclear Information System (INIS)

    Boatner, L.A.; Battle, G.C. Jr.

    1981-04-01

    The primary purposes of the conference on Alternate Nuclear Waste Forms and Interactions in Geologic Media were: First, to provide an opportunity for a review of the status of the research on some of the candidate alternative waste forms; second, to provide an opportunity for comparing the characteristics of alternate waste forms to those of glasses; and third, to stimulate increased interactions between those research groups that were engaged in a more basic approach to characterizing waste forms and those who were concerned with more applied aspects such as the processing of these materials. The motivating philosophy behind this third purpose of the conference was based on the idea that by operating from the soundest possible fundamental base for any of the candidate waste forms, hopefully any future unpleasant surprise - such as that alluded to earlier in the case of glass waste forms - could be avoided. Separate abstracts have been prepared for individual papers for inclusion in the Energy Data Base

  2. Availability improvement factors at Taipower's nuclear power plant system

    International Nuclear Information System (INIS)

    Chen, J.H.

    1985-01-01

    Sufficient electricity to meet the needs of a growing industrial economy, is one of the most important factors in the total economic development of a nation. Currently, nuclear power is considered one of the most economical and available sources of energy. To keep pace with Taiwan's rapid economic development, while also observing our government's policy of diversifying the requirements for imported forms of energy, Taiwan Power Company has embarked upon an ambitious of nuclear power plant construction. This paper discusses the improvement of Taiwan's nuclear power plants. At the present time, Taipower has completed three nuclear power plants. Two of these are located in northern Taiwan, along the East China Sea, while the third is on the southern tip of Taiwan, bordering the South China Sea. These three plants, each with two nuclear generating units, comprise a total nuclear generating capacity of 5144 MWe

  3. Nuclear reactor structural material forming less radioactive corrosion product

    International Nuclear Information System (INIS)

    Nakazawa, Hiroshi.

    1988-01-01

    Purpose: To provide nuclear reactor structural materials forming less radioactive corrosion products. Constitution: Ni-based alloys such as inconel alloy 718, 600 or inconel alloy 750 and 690 having excellent corrosion resistance and mechanical property even in coolants at high temperature and high pressure have generally been used as nuclear reactor structural materials. However, even such materials yield corrosion products being attacked by coolants circulating in the nuclear reactor, which produce by neutron irradiation radioactive corrosion products, that are deposited in primary circuit pipeways to constitute exposure sources. The present invention dissolves dissolves this problems by providing less activating nuclear reactor structural materials. That is, taking notice on the fact that Ni-58 contained generally by 68 % in Ni changes into Co-58 under irradiation of neutron thereby causing activation, the surface of nuclear reactor structural materials is applied with Ni plating by using Ni with a reduced content of Ni-58 isotopes. Accordingly, increase in the radiation level of the nuclear reactor structural materials can be inhibited. (K.M.)

  4. Effects of an electromagnetic quark form factor on meson properties

    International Nuclear Information System (INIS)

    Silvestre-Brac, B.

    2002-01-01

    A form factor is introduced in the quark electromagnetic current. Its effect is analyzed on charge mean square radii and form factors in the mesonic sector. The decay of a vector meson into lepton-antilepton pair is also affected. Two different expressions for the form factors, and two different types of quark potential are tested and some relativistic kinematical corrections are proposed. In any case the introduction of a quark form factor greatly improves the agreement with experimental data

  5. Form factors in (HI,HI') direct reactions

    International Nuclear Information System (INIS)

    Chu, Y.H.

    1981-01-01

    Using the semiclassical theory, the inelastic transition form factors are analyzed. For the first order form factors, we find that: (i) In the strong absorption limit, the Austern-Blair theory is a good approximation to the inelastic form factor--even in highly mismatched reactions. (ii) In weak to moderate absorption, the amplitude of the inelastic form factor oscillates due to overlapping potential resonances. The internal part of the form factor can be expressed in a simple form, which may easily be used to analyze heavy-ion inelastic scattering. (iii) In the presence of an isolated resonance, the inelastic form factor is enhanced greatly at the resonance due to multiple reflections inside the potential well. The second order form factors contain two terms, i.e. the one-step direct process (OSD) term and the two-step process (TS) term. It is found that: (i) In the strong absorption limit, OSD and TS form factors are equally important and interfere destructively near the grazing angular momentum. The Austern-Blair theory gives satisfactory results for well-matched reactions. The angular distributions of the mutual and double excitations are out of phase compared with that of the single excitation. (ii) For the weak absorption case, the internal part of the TS form factor is so enhanced that the OSD form factor can simply be neglected. The internal TS form factor can be parameterized in a form proportional to the internal-wave elastic Smatrix, where the angular distribution shows characteristically refractive phenomenon

  6. MesonNet Workshop on Meson Transition Form Factors

    CERN Document Server

    Eidelman, S; Hanhart, C; Kubis, B; Kupsc, A; Leupold, S; Moskal, P; Schadmand, S

    2012-01-01

    The mini-proceedings of the Workshop on Meson Transition Form Factors held in Cracow from May 29th to 30th, 2012 introduce the meson transition form factor project with special emphasis on the interrelations between the various form factors (on-shell, single off-shell, double off-shell). Short summaries of the talks presented at the workshop follow.

  7. Zeros in the electromagnetic and hadronic form factors

    International Nuclear Information System (INIS)

    Martini, A.F.; Menon, M.J.; Montanha, J.

    2004-01-01

    We discuss the evidences for the existence of zeros in the electric and in the hadronic form factors of the proton. We show that the shape of both form factors are similar, but there is indication that the hadronic form factors can depend on the energy. (author)

  8. Characterization of glass and glass ceramic nuclear waste forms

    International Nuclear Information System (INIS)

    Lutze, W.; Borchardt, J.; De, A.K.

    1979-01-01

    Characteristics of solidified nuclear waste forms, glass and glass ceramic compositions and the properties (composition, thermal stability, crystallization, phase behavior, chemical stability, mechanical stability, and radiation effects) of glasses and glass ceramics are discussed. The preparation of glass ceramics may be an optional step for proposed vitrification plants if tailored glasses are used. Glass ceramics exhibit some improved properties with respect to glasses. The overall leach resistance is similar to that of glasses. An increased leach resistance may become effective for single radionuclides being hosted in highly insoluble crystal phases mainly when higher melting temperatures are applicable in order to get more leach resistant residual glass phases. The development of glass ceramic is going on. The technological feasibility is still to be demonstrated. The potential gain of stability when using glass ceramics qualifies the material as an alternative nuclear waste form

  9. Radiation and Thermal Effects on Used Nuclear Fuel and Nuclear Waste Forms

    Energy Technology Data Exchange (ETDEWEB)

    Weber, William J. [Univ. of Tennessee, Knoxville, TN (United States). Dept. of Materials Science and Engineering; Zhang, Yanwen [Univ. of Tennessee, Knoxville, TN (United States). Dept. of Materials Science and Engineering

    2016-09-20

    This is the final report of the NEUP project “Radiation and Thermal Effects on Used Nuclear Fuel and Nuclear Waste Forms.” This project started on July 1, 2012 and was successfully completed on June 30, 2016. This report provides an overview of the main achievements, results and findings through the duration of the project. Additional details can be found in the main body of this report and in the individual Quarterly Reports and associated Deliverables of this project, which have been uploaded in PICS-NE. The objective of this research was to advance understanding and develop validated models on the effects of self-radiation from beta and alpha decay on the response of used nuclear fuel and nuclear waste forms during high-temperature interim storage and long-term permanent disposition. To achieve this objective, model used-fuel materials and model waste form materials were identified, fabricated, and studied.

  10. Chou-Yang model and PHI form factor

    Energy Technology Data Exchange (ETDEWEB)

    Fazal-e-Aleem; Saleem, M.; Rafique, M.

    1988-03-01

    By using the deduced differential cross-section data for PHIp elastic scattering at 175 GeV/c in the Chou-Yang model, the PHI form factor has been computed and parametrized. Then in conjunction with the proton form factor this form factor is used in the pristine Chou-Yang model to obtain differential cross-section data at Fermilab energies. The theoretical results agree with the experimental measurements, endorsing the conjecture that the hadronic form factor of neutral particle is proportional to its magnetic form factor.

  11. Electromagnetic form factors in the light-front dynamics

    International Nuclear Information System (INIS)

    Karmanov, V.A.; Smirnov, A.V.

    1992-01-01

    It is shown that the electromagnetic vertex of a nucleus (and of any bound system), expressed through the wave function in the light-front dynamics at relativistic values of momentum transfer, contains a contribution of nonphysical form factors which increases the total number of invariant form factors (for the deuteron from 3 up to 11). This fact explains an ambiguity in the form factors calculated previously. The physical and nonphysical form factors are covariantly separated. Explicit expressions for physical form factors of systems with spin 0, 1/2 and 1 through the vertex functions are obtained. (orig.)

  12. Electron - A fortran programme for the coupled channel calculation of nuclear electromagnetic (e,e') form factors and cross sections in the self-consistent random-phase approximation

    International Nuclear Information System (INIS)

    Cavinato, M.; Marangoni, M.; Saruis, A.M.

    1984-01-01

    Description is given of the Electron programme for IBM 370/168 computer, written in Fortran 4. language. The programme calculates (e,e') cross-sections and longitudinal/transverse form factors for closed shell nuclei in the framework of a self-consistent RPA theory

  13. The Nuclear Energy Factor In Indian Politics

    Directory of Open Access Journals (Sweden)

    A. A. Boyko

    2017-01-01

    Full Text Available Nuclear energy is a key branch of the world power system. The nuclear energy development is viewed by India as one of the ways to resolve the problem of the energy supply. In 2008 the country gained more opportunities for developing nuclear power sector and solving the national power deficit problem after NSG lifted restrictions on nuclear trade. This resulted in foreign companies emerging on the Indian nuclear market. In 2011 after the major emergency at Fukushima Daiichi Nuclear Power Plant in Japan India faced numerous anti-nuclear protests backed by NGOs, including those with foreign funding, and political parties. The article deals with the question of the political role this anti-nuclear opposition plays in India. According to some researchers the protests are organized by the competitors in order to compromise the business of a Russian company Rosatom in India. However, such demonstrations are spread throughout the country and directed against the competitors of Rosatom as well. The article comes to conclusion that the protests are just a reflection of the political fights in India where nuclear energy is a significant political factor.

  14. Magnetic form factors of rare earth ions

    International Nuclear Information System (INIS)

    Deckman, H.W.

    1976-01-01

    The magnetic scattering of neutrons by atoms has been investigated by exploiting its similarity to the radiation problem in spectroscopy. Expressions for the magnetic scattering amplitude were developed for cases in whcih an atom in the l/sup n/ electronic configuration is described either by a relativistic or nonrelativistic Hamiltonian. For each of these cases, it has been shown that the magnetic scattering amplitude can be expressed in terms of relativistic or nonrelativistic matrix elements of magnetic and electric multipole operators. For a nonrelativistic atom, the calculation of these matrix elements has been separated into evaluating radial matrix elements and matrix elements of Racah tensors W/(sup 0,k)k/ and W/(sup 1,k')k/. For a relativistic atom the effective operator approach has been used to define effective multipole operators so that a relativistic result is obtained by taking matrix elements of these effective operators between nonrelativistic states of the atom. The calculation of matrix elements of these effective operators has been reduced to evaluating relativistic radial integrals and matrix elements of the Racah tensors taken between nonrelativistic states of the atom. It is shown tha for the case of elastic scattering by either a relativistic or nonrelativistic atom in single Russel-Saunders state, the magnetic scattering amplitude can be written in the conventional form p(vector q)vector q/sub m/.vector sigma. General expressions for p(vector q) as well as elastic magnetic form factorshave been obtained. The formalism has been illustrated throughout by applying it to the case of scattering by rare earth ions

  15. Human Factor on Gravelines Nuclear Power Plants

    International Nuclear Information System (INIS)

    Duboc, Gerard

    1998-01-01

    In a first part, the documents describes the commitments by EDF nuclear power plan operations to demands made by the Safety Authority regarding actions in the field of human factors (concerns expressed by the Authority, in-depth analysis, positions on different points raised by the Authority). In a second part, it presents the various actions undertaken in the Gravelines nuclear power station regarding human factors: creation of an 'operator club' (mission and objectives, methods and means, first meetings, tracking file), development of risk analysis strategy, setting up of a human factor engineering mission and example of action in case of a significant event

  16. Human factor problem in nuclear power generation

    International Nuclear Information System (INIS)

    Yoshino, Kenji; Fujimoto, Junzo

    1999-01-01

    Since a nuclear power plant accident at Threemile Island in U.S.A. occurred in March, 1979, twenty years have passed. After the accident, the human factor problem became focussed in nuclear power, to succeed its research at present. For direct reason of human error, most of factors at individual level or work operation level are often listed at their center. Then, it is natural that studies on design of a machine or apparatus suitable for various human functions and abilities and on improvement of relationship between 'human being and machine' and 'human being and working environment' are important in future. Here was, as first, described on outlines of the human factor problem in a nuclear power plant developed at a chance of past important accident, and then was described on educational training for its countermeasure. At last, some concrete researching results obtained by human factor research were introduced. (G.K.)

  17. THE FACTORS FORMING QUALITY OF GRANULATED SUGAR

    Directory of Open Access Journals (Sweden)

    N. G. Kulneva

    2015-01-01

    Full Text Available Sugar, with good taste and high caloric, is one of the most popular human food. Consumers sugar must be sure that the sugar under normal conditions of use is of high quality and is not harmful to the health of the product. One reason for the decline in the quality of sugar is bacterial contamination. This is because the sugar industry products are good targets for the development of different groups of microorganisms, e.g., Bacillus subtilis, Clostridium perfringes, Leuconostoc dextranicum, Torula alba, Pseudomonas fluorescens, Sarcina lutea and others. These organisms are affected with beets, and then with sugar beet chips and diffusion juice fall into the processing line of sugar production. Their number in the diffusion juice varies and depends on many facto rs such as the quality of raw materials, the quality of cleaning beet root colonization of transporter-washing and the supply of water to the diffusion process, the temperature of the diffusion and others. In the diffusion unit has the most favorable conditions for the development of micro-organisms. Some of them, especially resistant bacteria and thermophilic bacteria or their spores, forming a capsule which protects against external influences occur in the final product sugar. When injected into the fresh crop of product (juice, syrup, they begin to multiply rapidly, causing difficulties in the process. The higher seeding beet microorganisms, the more they decompose and emit sucrose metabolism byproducts. To reduce the negative impact of microbiological and reduce losses from decomposition of sucrose conducted research on the possibility of using chlorine-containing substances in the sugar industry. It was established experimentally that the investigated chlorinated drug has bacteriostatic action and can be recommended for use in sugar beet production.

  18. The QCD form factor of massive quarks and applications

    International Nuclear Information System (INIS)

    Moch, S.

    2009-11-01

    We review the electromagnetic form factor of heavy quarks with emphasis on the QCD radiative corrections at two-loop order in the perturbative expansion. We discuss important properties of the heavy-quark form factor such as its exponentiation in the high-energy limit and its role in QCD factorization theorems for massive n-parton amplitudes. (orig.)

  19. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Pack, R.W.

    1978-01-01

    The Electric Power Research Institute has started research in human factors in nuclear power plants. One project, completed in March 1977, reviewed human factors problems in operating power plants and produced a report evaluating those problems. A second project developed computer programs for evaluating operator performance on training simulators. A third project is developing and evaluating control-room design approaches. A fourth project is reviewing human factors problems associated with power-plant maintainability and instrumentation and control technician activities. Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. The Electric Power Research Institute (EPRI) has undertaken four projects studying the application of human factors engineering principles to nuclear power plants. (author)

  20. The spin-dependent neutralino-nucleus form factor for 127I

    International Nuclear Information System (INIS)

    Ressell, M.T.

    1996-01-01

    We present the results of detailed shell model calculations of the spin-dependent elastic form factor for the nucleus 127 I. the calculations were performed in extremely large model spaces which adequately describe the configuration mixing in this nucleus. Good agreement between the calculated and experimental values of the magnetic moment are found. Other nuclear observables are also compared to experiment. The dependence of the form factor upon the model space and effective interaction is discussed

  1. Asymptotical behaviour of pion electromagnetic form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1978-01-01

    In the framework of the renormalizable quantum field theory a new approach is developed to the investigation of asymptotical behaviour of two-particle bound state electromagnetic form factor. It is shown that the behaviour of the pion EM form factor in quantum chromodynamics at sufficiently large momentum transfers is controlled by the short-distance dynamics only. The formula is obtained which expresses the asymptotical behaviour of the pion form factor in terms of the fundamental constants of the theory

  2. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    Energy Technology Data Exchange (ETDEWEB)

    Safari, L., E-mail: laleh.safari@ist.ac.at [IST Austria (Institute of Science and Technology Austria), Am Campus 1, 3400 Klosterneuburg (Austria); Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Santos, J. P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Amaro, P. [Laboratório de Instrumentação, Engenharia Biomédica e Física da Radiação (LIBPhys-UNL), Departamento de Física, Faculdade de Ciências e Tecnologia, FCT, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Physikalisches Institut, Universität Heidelberg, D-69120 Heidelberg (Germany); Jänkälä, K. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Fratini, F. [Department of Physics, University of Oulu, Box 3000, FI-90014 Oulu (Finland); Institute of Atomic and Subatomic Physics, TU Wien, Stadionallee 2, 1020 Wien (Austria); Departamento de Física, Instituto de Ciências Exatas, Universidade Federal de Minas Gerais, 31270-901 Belo Horizonte, MG (Brazil)

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  3. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Hennig, J.; Bohr, E.

    1976-04-01

    This annotated bibliography is a first attempt to give a survey of the kind of literature which is relevant for the ergonomic working conditions in nuclear power plants. Such a survey seems to be useful in view of the fact that the 'factor human being' comes recently more and more to the fore in nuclear power plants. In this context, the necessity is often pointed out to systematically include our knowledge of the performance capacity and limits of human beings when designing the working conditions for the personnel of nuclear power plants. For this reason, the bibliography is so much intended for the ergonomics experts as for the experts of nuclear engineering. (orig./LN) [de

  4. The human factor in the nuclear industry

    International Nuclear Information System (INIS)

    Colas, Armand

    1998-01-01

    After having evoked the progressive reduction and stabilization of significant incidents occurring every year in French nuclear power plants, and the challenges faced by nuclear energy (loss of public confidence, loss of competitiveness), and then outlined the importance of safety to overcome these challenges, the author comments EDF's approach to the human factor. He first highlights the importance of information and communication towards the population. He briefly discusses the meaning of human factors for the nuclear industry, sometimes perceived as the contribution people to the company's safety and performance. He comments the evolution observed in the perception of human error in different industrial or technical environments and situations, and outlines what is at stake to reduce the production of faults and organize a 'hunt for latent defects'

  5. Human factors methods in DOE nuclear facilities

    International Nuclear Information System (INIS)

    Bennett, C.T.; Banks, W.W.; Waters, R.J.

    1993-01-01

    The US Department of Energy (DOE) is in the process of developing a series of guidelines for the use of human factors standards, procedures, and methods to be used in nuclear facilities. This paper discusses the philosophy and process being used to develop a DOE human factors methods handbook to be used during the design cycle. The following sections will discuss: (1) basic justification for the project; (2) human factors design objectives and goals; and (3) role of human factors engineering (HFE) in the design cycle

  6. Measurement of the form factor in the decay K+ → π0e+vsub(e)

    International Nuclear Information System (INIS)

    Martyn, H.U.

    1974-01-01

    Following an introduction into the theory of the K(l3) decay, the fundamentals for the measuring methods of the form factor are derived. The choice of the quantity of nuclear events, the problems of the detection probabilities and of the background, and the form factor analysis are dealt with in detail. The analysis shows that the form factor can be very well described by a linear parametrization. The upper limits for scalar and tensorial interaction contributions are given; these results confirm the validity of the V-A theory also for strangeness-changing decays. (BJ/LH) [de

  7. Nucleon mass difference and off-shell form factors

    International Nuclear Information System (INIS)

    Kimel, I.

    1981-08-01

    The use of off-shell form factors in calculating the proton-neutron mass difference is advocated. These form factors appear in a Cottingham rotated Born-like expression for the mass difference and could lead to a good value for Δ = M sub(p) - M sub(n). (Author) [pt

  8. The heavy quark form factors at two loops

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Behring, A. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); RWTH Aachen Univ. (Germany). Inst. fuer Theoretische Teilchenphysik und Kosmologie; Bluemlein, J.; Freitas, A. de; Marquard, P.; Rana, N. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Falcioni, G. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Nikhef, Amsterdam (Netherlands). Theory Group

    2017-12-15

    We compute the two-loop QCD corrections to the heavy quark form factors in case of the vector, axial-vector, scalar and pseudo-scalar currents up to second order in the dimensional parameter ε=(4-D)/2. These terms are required in the renormalization of the higher order corrections to these form factors.

  9. Model of separated form factors for unilamellar vesicles

    International Nuclear Information System (INIS)

    Kiselev, M.A.; Aksenov, V.L.; Lesieur, P.; Lombardo, D.; Kiselev, A.M.

    2001-01-01

    A new model of separated form factors is proposed for the evaluation of small-angle neutron scattering curves from large unilamellar vesicles. The validity of the model was checked via comparison with the model of a hollow sphere. The model of separated form factors and the hollow sphere model give a reasonable agreement in the evaluation of vesicle parameters

  10. Molecular form factors in X-ray crystallography

    NARCIS (Netherlands)

    Groenewegen, P.P.M.; Feil, D.

    1969-01-01

    The calculation of molecular form factors from ab initio molecular electronic wavefunctions is discussed, and a scheme for application to X-ray diffraction structure analysis is given. The method is used to calculate the form factor of the NH+4 molecular ion from three accurate molecular

  11. Analytic properties of form factors in strictly confining models

    International Nuclear Information System (INIS)

    Csikor, F.

    1979-12-01

    An argument is presented showing that strict confinement implies the possible existence of an (unwanted) branch point at q 2 =0 in the form factors. In case of a bag extended to infinity in the relative time, the branch point is certainly there (provided that the form factor is non zero at q 2 =0). (author)

  12. Uranium, a factor limiting nuclear energy?

    International Nuclear Information System (INIS)

    Ohnemus, J.

    2006-01-01

    Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)

  13. Uranium, a factor limiting nuclear energy?

    International Nuclear Information System (INIS)

    2006-01-01

    Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig./GL)

  14. Relationship Domain of Form Six Teachers Thinking in Teaching with External Factors of Form Six Teachers

    Science.gov (United States)

    bin Pet, Mokhtar; Sihes, Ahmad Johari Hj

    2015-01-01

    This study aims to examine the external factors of form six teachers who can influence thinking domain form six teachers in their teaching. This study was conducted using a quantitative approach using questionnaires. A total of 300 form six teacher schools in Johor were chosen as respondents. The findings were obtained as student background…

  15. Matter density distributions and elastic form factors of some two ...

    Indian Academy of Sciences (India)

    Ahmed N Abdullah

    2017-08-31

    Aug 31, 2017 ... include the proton, neutron and matter density distributions, the corresponding rms radii, the binding energy per nucleon and the charge form ... the nuclear structure models based on the experimental data for stable nuclei ... Most exotic nuclei are so short lived that they cannot be used as targets at rest.

  16. Nucleon form factors in dispersively improved chiral effective field theory. II. Electromagnetic form factors

    Science.gov (United States)

    Alarcón, J. M.; Weiss, C.

    2018-05-01

    We study the nucleon electromagnetic form factors (EM FFs) using a recently developed method combining chiral effective field theory (χ EFT ) and dispersion analysis. The spectral functions on the two-pion cut at t >4 Mπ2 are constructed using the elastic unitarity relation and an N /D representation. χ EFT is used to calculate the real functions J±1(t ) =f±1(t ) /Fπ(t ) (ratios of the complex π π →N N ¯ partial-wave amplitudes and the timelike pion FF), which are free of π π rescattering. Rescattering effects are included through the empirical timelike pion FF | Fπ(t) | 2 . The method allows us to compute the isovector EM spectral functions up to t ˜1 GeV2 with controlled accuracy (leading order, next-to-leading order, and partial next-to-next-to-leading order). With the spectral functions we calculate the isovector nucleon EM FFs and their derivatives at t =0 (EM radii, moments) using subtracted dispersion relations. We predict the values of higher FF derivatives, which are not affected by higher-order chiral corrections and are obtained almost parameter-free in our approach, and explain their collective behavior. We estimate the individual proton and neutron FFs by adding an empirical parametrization of the isoscalar sector. Excellent agreement with the present low-Q2 FF data is achieved up to ˜0.5 GeV2 for GE, and up to ˜0.2 GeV2 for GM. Our results can be used to guide the analysis of low-Q2 elastic scattering data and the extraction of the proton charge radius.

  17. Extraction of the neutron electric form factor from measurements of inclusive double spin asymmetries

    Science.gov (United States)

    Sulkosky, V.; Jin, G.; Long, E.; Zhang, Y.-W.; Mihovilovic, M.; Kelleher, A.; Anderson, B.; Higinbotham, D. W.; Širca, S.; Allada, K.; Annand, J. R. M.; Averett, T.; Bertozzi, W.; Boeglin, W.; Bradshaw, P.; Camsonne, A.; Canan, M.; Cates, G. D.; Chen, C.; Chen, J.-P.; Chudakov, E.; De Leo, R.; Deng, X.; Deur, A.; Dutta, C.; El Fassi, L.; Flay, D.; Frullani, S.; Garibaldi, F.; Gao, H.; Gilad, S.; Gilman, R.; Glamazdin, O.; Golge, S.; Gomez, J.; Hansen, J.-O.; Holmstrom, T.; Huang, J.; Ibrahim, H.; de Jager, C. W.; Jensen, E.; Jiang, X.; Jones, M.; Kang, H.; Katich, J.; Khanal, H. P.; King, P.; Korsch, W.; LeRose, J.; Lindgren, R.; Lu, H.-J.; Luo, W.; Markowitz, P.; Meekins, D.; Meziane, M.; Michaels, R.; Moffit, B.; Monaghan, P.; Muangma, N.; Nanda, S.; Norum, B. E.; Pan, K.; Parno, D.; Piasetzky, E.; Posik, M.; Punjabi, V.; Puckett, A. J. R.; Qian, X.; Qiang, Y.; Qui, X.; Riordan, S.; Saha, A.; Sawatzky, B.; Shabestari, M.; Shahinyan, A.; Shoenrock, B.; John, J. St.; Subedi, R.; Tobias, W. A.; Tireman, W.; Urciuoli, G. M.; Wang, D.; Wang, K.; Wang, Y.; Watson, J.; Wojtsekhowski, B.; Ye, Z.; Zhan, X.; Zhang, Y.; Zheng, X.; Zhao, B.; Zhu, L.; Jefferson Lab Hall A Collaboration

    2017-12-01

    Background: Measurements of the neutron charge form factor, GEn, are challenging because the neutron has no net charge. In addition, measurements of the neutron form factors must use nuclear targets which require accurately accounting for nuclear effects. Extracting GEn with different targets and techniques provides an important test of our handling of these effects. Purpose: The goal of the measurement was to use an inclusive asymmetry measurement technique to extract the neutron charge form factor at a four-momentum transfer of 1 (GeV/c ) 2 . This technique has very different systematic uncertainties than traditional exclusive measurements and thus serves as an independent check of whether nuclear effects have been taken into account correctly. Method: The inclusive quasielastic reaction 3He ⃗(e ⃗,e') was measured at Jefferson Laboratory. The neutron electric form factor, GEn, was extracted at Q2=0.98 (GeV/c ) 2 from ratios of electron-polarization asymmetries measured for two orthogonal target spin orientations. This Q2 is high enough that the sensitivity to GEn is not overwhelmed by the neutron magnetic contribution, and yet low enough that explicit neutron detection is not required to suppress pion production. Results: The neutron electric form factor, GEn, was determined to be 0.0414 ±0.0077 (stat)±0.0022 (syst) , providing the first high-precision inclusive extraction of the neutron's charge form factor. Conclusions: The use of the inclusive quasielastic 3He ⃗(e ⃗,e') with a four-momentum transfer near 1 (GeV/c ) 2 has been used to provide a unique measurement of GEn. This new result provides a systematically independent validation of the exclusive extraction technique results and implies that the nuclear corrections are understood. This is contrary to the proton form factor where asymmetry and differential cross section measurements have been shown to have large systematic differences.

  18. Comments on electromagnetic form factors of the nucleon

    International Nuclear Information System (INIS)

    Sachs, R.G.; Wali, K.C.

    1989-01-01

    This paper draws the concept of nucleon form factors further to consider the electromagnetic aspect based on the magnetic moment of the nucleon. These are seen as valid physical interpretations of form factors in electron-nucleon interactions. A linear combination of two functions, associated with charge radius, is derived, which agreed well with experimental results. The paper also expands the specific form to include relativistic cases and consider appropriate frames of reference. (UK)

  19. Review of EPRI Nuclear Human Factors Program

    International Nuclear Information System (INIS)

    Hanes, L.F.; O'Brien, J.F.

    1996-01-01

    The Electric Power Research Institute (EPRI) Human Factors Program, which is part of the EPRI Nuclear Power Group, was established in 1975. Over the years, the Program has changed emphasis based on the shifting priorities and needs of the commercial nuclear power industry. The Program has produced many important products that provide significant safety and economic benefits for EPRI member utilities. This presentation will provide a brief history of the Program and products. Current projects and products that have been released recently will be mentioned

  20. Human and organizational factors in nuclear safety

    International Nuclear Information System (INIS)

    Garcia, A.; Barrientos, M.; Gil, B.

    2015-01-01

    Nuclear installations are socio technical systems where human and organizational factors, in both utilities and regulators, have a significant impact on safety. Three Mile Island (TMI) accident, original of several initiatives in the human factors field, nevertheless became a lost opportunity to timely acquire lessons related to the upper tiers of the system. Nowadays, Spanish nuclear installations have integrated in their processes specialists and activities in human and organizational factors, promoted by the licensees After many years of hard work, Spanish installations have achieved a better position to face new challenges, such as those posed by Fukushima. With this experience, only technology-centered action plan would not be acceptable, turning this accident in yet another lost opportunity. (Author)

  1. Evolution of 99Tc Species in Cementitious Nuclear Waste Form

    International Nuclear Information System (INIS)

    Um, Woo Yong; Westsik, Joseph H.

    2011-01-01

    Technetium (Tc) is produced in large quantities as a fission product during the irradiation of 235 U-enriched fuel for commercial power production and plutonium genesis for nuclear weapons. The most abundant isotope of Tc present in the wastes is 99 Tc because of its high fission yield (∼6%) and long half-life (2.13x10 5 years). During the Cold War era, generation of fissile 239 Pu for use in America's atomic weapons arsenal yielded nearly 1900 kg of 99 Tc at the U.S. Department of Energy's (DOE) Hanford Site in southeastern Washington State. Most of this 99 Tc is present in fuel reprocessing wastes temporarily stored in underground tanks awaiting retrieval and permanent disposal. After the wastes are retrieved from the storage tanks, the bulk of the high-level waste (HLW) and lowactivity waste (LAW) stream is scheduled to be converted into a borosilicate glass waste form that will be disposed of in a shallow burial facility called the Integrated Disposal Facility (IDF) at the Hanford Site. Even with careful engineering controls, volatilization of a fraction of Tc during the vitrification of both radioactive waste streams is expected. Although this volatilized Tc can be captured in melter off-gas scrubbers and returned to the melter, some of the Tc is expected to become part of the secondary waste stream from the vitrification process. The off-gas scrubbers downstream from the melters will generate a high pH, sodium-ammonium carbonate solution containing the volatilized Tc and other fugitive species. Effective and cost-efficient disposal of Tc found in the off-gas scrubber solution remains difficult. A cementitious waste form (Cast Stone) is one of the nuclear waste form candidates being considered to solidify the secondary radioactive liquid waste that will be generated by the operation of the waste treatment plant (WTP) at the Hanford Site. Because Tc leachability from the waste form is closely related with Tc speciation or oxidation state in both the simulant

  2. Pyrochlore as nuclear waste form. Actinide uptake and chemical stability

    Energy Technology Data Exchange (ETDEWEB)

    Finkeldei, Sarah Charlotte

    2015-07-01

    Radioactive waste is generated by many different technical and scientific applications. For the past decades, different waste disposal strategies have been considered. Several questions on the waste disposal strategy remain unanswered, particularly regarding the long-term radiotoxicity of minor actinides (Am, Cm, Np), plutonium and uranium. These radionuclides mainly arise from high level nuclear waste (HLW), specific waste streams or dismantled nuclear weapons. Although many countries have opted for the direct disposal of spent fuel, from a scientific and technical point of view it is imperative to pursue alternative waste management strategies. Apart from the vitrification, especially for trivalent actinides and Pu, crystalline ceramic waste forms are considered. In contrast to glasses, crystalline waste forms, which are chemically and physically highly stable, allow the retention of radionuclides on well-defined lattice positions within the crystal structure. Besides polyphase ceramics such as SYNROC, single phase ceramics are considered as tailor made host phases to embed a specific radionuclide or a specific group. Among oxidic single phase ceramics pyrochlores are known to have a high potential for this application. This work examines ZrO{sub 2} based pyrochlores as potential nuclear waste forms, which are known to show a high aqueous stability and a high tolerance towards radiation damage. This work contributes to (1) understand the phase stability field of pyrochlore and consequences of non-stoichiometry which leads to pyrochlores with mixed cationic sites. Mixed cationic occupancies are likely to occur in actinide-bearing pyrochlores. (2) The structural uptake of radionuclides themselves was studied. (3) The chemical stability and the effect of phase transition from pyrochlore to defect fluorite were probed. This phase transition is important, as it is the result of radiation damage in ZrO{sub 2} based pyrochlores. ZrO{sub 2} - Nd{sub 2}O{sub 3} pellets

  3. Pyrochlore as nuclear waste form. Actinide uptake and chemical stability

    International Nuclear Information System (INIS)

    Finkeldei, Sarah Charlotte

    2015-01-01

    Radioactive waste is generated by many different technical and scientific applications. For the past decades, different waste disposal strategies have been considered. Several questions on the waste disposal strategy remain unanswered, particularly regarding the long-term radiotoxicity of minor actinides (Am, Cm, Np), plutonium and uranium. These radionuclides mainly arise from high level nuclear waste (HLW), specific waste streams or dismantled nuclear weapons. Although many countries have opted for the direct disposal of spent fuel, from a scientific and technical point of view it is imperative to pursue alternative waste management strategies. Apart from the vitrification, especially for trivalent actinides and Pu, crystalline ceramic waste forms are considered. In contrast to glasses, crystalline waste forms, which are chemically and physically highly stable, allow the retention of radionuclides on well-defined lattice positions within the crystal structure. Besides polyphase ceramics such as SYNROC, single phase ceramics are considered as tailor made host phases to embed a specific radionuclide or a specific group. Among oxidic single phase ceramics pyrochlores are known to have a high potential for this application. This work examines ZrO 2 based pyrochlores as potential nuclear waste forms, which are known to show a high aqueous stability and a high tolerance towards radiation damage. This work contributes to (1) understand the phase stability field of pyrochlore and consequences of non-stoichiometry which leads to pyrochlores with mixed cationic sites. Mixed cationic occupancies are likely to occur in actinide-bearing pyrochlores. (2) The structural uptake of radionuclides themselves was studied. (3) The chemical stability and the effect of phase transition from pyrochlore to defect fluorite were probed. This phase transition is important, as it is the result of radiation damage in ZrO 2 based pyrochlores. ZrO 2 - Nd 2 O 3 pellets with pyrochlore and defect

  4. Form factors in the projected linear chiral sigma model

    International Nuclear Information System (INIS)

    Alberto, P.; Coimbra Univ.; Bochum Univ.; Ruiz Arriola, E.; Fiolhais, M.; Urbano, J.N.; Coimbra Univ.; Goeke, K.; Gruemmer, F.; Bochum Univ.

    1990-01-01

    Several nucleon form factors are computed within the framework of the linear chiral soliton model. To this end variational means and projection techniques applied to generalized hedgehog quark-boson Fock states are used. In this procedure the Goldberger-Treiman relation and a virial theorem for the pion-nucleon form factor are well fulfilled demonstrating the consistency of the treatment. Both proton and neutron charge form factors are correctly reproduced, as well as the proton magnetic one. The shapes of the neutron magnetic and of the axial form factors are good but their absolute values at the origin are too large. The slopes of all the form factors at zero momentum transfer are in good agreement with the experimental data. The pion-nucleon form factor exhibits to great extent a monopole shape with a cut-off mass of Λ=690 MeV. Electromagnetic form factors for the vertex γNΔ and the nucleon spin distribution are also evaluated and discussed. (orig.)

  5. Theory of Inclusive Scattering of Polarized Electrons by Polarized $^{3}$He and the Neutron Form Factors

    OpenAIRE

    Atti, C. Ciofi degli; Pace, E.; Salmé, G.

    1993-01-01

    The theory of inclusive lepton scattering of polarized leptons by polarized J = 1/2 hadrons is presented and the origin of different expressions for the polarized nuclear response function appearing in the literature is explained. The sensitivity of the longitudinal asymmetry upon the neutron form factors is investigated.

  6. Radiation damage studies related to nuclear waste forms

    International Nuclear Information System (INIS)

    Gray, W.J.; Wald, J.W.; Turcotte, R.P.

    1981-12-01

    Much of the previously reported work on alpha radiation effects on crystalline phases of importance to nuclear waste forms has been derived from radiation effects studies of composite waste forms. In the present work, two single-phase crystalline materials, Gd 2 Ti 2 O 7 (pyrochlore) and CaZrTi 2 O 7 (zirconolite), of relative importance to current waste forms were studied independently by doping with 244 Cm at the 3 wt % level. Changes in the crystalline structure measured by x-ray diffraction as a function of dose show that damage ingrowth follows an expected exponential relationship of the form ΔV/V 0 = A[1-exp(-BD)]. In both cases, the materials became x-ray amorphous before the estimated saturation value was reached. The predicted magnitudes of the unit cell volume changes at saturation are 5.4% and 3.5%, respectively, for Gd 2 Ti 2 O 7 and CaZrTi 2 O 7 . The later material exhibited anisotropic behavior in which the expansion of the monoclinic cell in the c 0 direction was over five times that of the a 0 direction. The effects of transmutations on the properties of high-level waste solids have not been studied until now because of the long half-lives of the important fission products. This problem was circumvented in the present study by preparing materials containing natural cesium and then irradiating them with neutrons to produce 134 Cs, which has only a 2y half-life. The properties monitored at about one year intervals following irradiation have been density, leach rate and microstructure. A small amount of x-ray diffraction work has also been done. Small changes in density and leach rate have been observed for some of the materials, but they were not large enough to be of any consequence for the final disposal of high level wastes

  7. Absorptive form factors for high-energy electron diffraction

    International Nuclear Information System (INIS)

    Bird, D.M.; King, Q.A.

    1990-01-01

    The thermal diffuse scattering contribution to the absorptive potential in high-energy electron diffraction is calculated in the form of an absorptive contribution to the atomic form factor. To do this, the Einstein model of lattice vibrations is used, with isotropic Debye-Waller factors. The absorptive form factors are calculated as a function of scattering vector s and temperature factor M on a grid which enables polynomial interpolation of the results to be accurate to better than 2% for much of the ranges 0≤Ms 2 ≤6 and 0≤M≤2 A 2 . The computed values, together with an interpolation routine, have been incorporated into a Fortran subroutine which calculates both the real and absorptive form factors for 54 atomic species. (orig.)

  8. Uranium - a factor limiting nuclear energy?

    International Nuclear Information System (INIS)

    Ohnemus, J.

    2006-01-01

    Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this st ep was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken int o account: stocks, resources, and reserves. To clarify the situation, this artic le outlines important aspects of short and long term uranium supplies, and analy zes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the in fluence of the price of uranium on the cost of electricity generation? Among oth er results, it is found that comprehensive sources of low-price uranium and nucl ear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)

  9. Pseudoscalar form factors in tau-neutrino nucleon scattering

    International Nuclear Information System (INIS)

    Hagiwara, K.; Mawatari, K.; Yokoya, H.

    2004-01-01

    We investigate the pseudoscalar transition form factors of nucleon for quasi-elastic scattering and Δ resonance production in tau-neutrino nucleon scattering via the charged current interactions. Although the pseudoscalar form factors play an important role for the τ production in neutrino-nucleon scattering, these are not known well. In this Letter, we examine their effects in quasi-elastic scattering and Δ resonance production and find that the cross section, Q 2 distribution, and spin polarization of the produced τ ± leptons are quite sensitive to the pseudoscalar form factors

  10. Anomaly, mixing and transition form factors of pseudoscalar mesons

    International Nuclear Information System (INIS)

    Klopot, Yaroslav; Oganesian, Armen; Teryaev, Oleg

    2011-01-01

    We derive the exact non-perturbative QCD sum rule for the transition form factors of η and η ′ using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on η,η ′ transition form factors in the range from real to highly virtual photons was obtained.

  11. Anomaly, mixing and transition form factors of pseudoscalar mesons

    Energy Technology Data Exchange (ETDEWEB)

    Klopot, Yaroslav, E-mail: klopot@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Oganesian, Armen, E-mail: armen@itep.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation); Institute of Theoretical and Experimental Physics, B. Cheremushkinskaya 25, Moscow 117218 (Russian Federation); Teryaev, Oleg, E-mail: teryaev@theor.jinr.ru [Bogoliubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Joliot-Curie 6, Dubna 141980 (Russian Federation)

    2011-10-15

    We derive the exact non-perturbative QCD sum rule for the transition form factors of {eta} and {eta}{sup Prime} using the dispersive representation of axial anomaly. This sum rule allows to express the transition form factors entirely in terms of meson decay constants. Using this sum rule several mixing schemes were analyzed and compared to recent experimental data. A good agreement with experimental data on {eta},{eta}{sup Prime} transition form factors in the range from real to highly virtual photons was obtained.

  12. Form factors and QCD in spacelike and timelike region

    International Nuclear Information System (INIS)

    A.P. Bakulev; A.V. Radyushkin; N.G. Stefanis

    2000-01-01

    The authors analyze the basic hard exclusive processes: πγ * γ-transition, pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 > 0 of the relevant momentum transfers. They describe the construction of the timelike version of the coupling constant α s . They show that due to the analytic continuation of the collinear logarithms each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. They found no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, they use a QCD sum rule inspired model and show that there are non-canceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  13. Form factors and QCD in spacelike and timelike regions

    International Nuclear Information System (INIS)

    Bakulev, A. P.; Radyushkin, A. V.; Stefanis, N. G.

    2000-01-01

    We analyze the basic hard exclusive processes, the πγ * γ-transition and the pion and nucleon electromagnetic form factors, and discuss the analytic continuation of QCD formulas from the spacelike q 2 2 >0 of the relevant momentum transfers. We describe the construction of the timelike version of the coupling constant α s . We show that due to the analytic continuation of the collinear logarithms, each eigenfunction of the evolution equation acquires a phase factor and investigate the resulting interference effects which are shown to be very small. We find no sources for the K-factor-type enhancements in the perturbative QCD contribution to the hadronic form factors. To study the soft part of the pion electromagnetic form factor, we use a QCD sum rule inspired model and show that there are noncanceling Sudakov double logarithms which result in a K-factor-type enhancement in the timelike region

  14. Strange nucleon electromagnetic form factors from lattice QCD

    Science.gov (United States)

    Alexandrou, C.; Constantinou, M.; Hadjiyiannakou, K.; Jansen, K.; Kallidonis, C.; Koutsou, G.; Avilés-Casco, A. Vaquero

    2018-05-01

    We evaluate the strange nucleon electromagnetic form factors using an ensemble of gauge configurations generated with two degenerate maximally twisted mass clover-improved fermions with mass tuned to approximately reproduce the physical pion mass. In addition, we present results for the disconnected light quark contributions to the nucleon electromagnetic form factors. Improved stochastic methods are employed leading to high-precision results. The momentum dependence of the disconnected contributions is fitted using the model-independent z-expansion. We extract the magnetic moment and the electric and magnetic radii of the proton and neutron by including both connected and disconnected contributions. We find that the disconnected light quark contributions to both electric and magnetic form factors are nonzero and at the few percent level as compared to the connected. The strange form factors are also at the percent level but more noisy yielding statistical errors that are typically within one standard deviation from a zero value.

  15. Infrared photons and gluons and the electromagnetic quark form factor

    International Nuclear Information System (INIS)

    Scholz, B.

    1982-01-01

    A method for a consistent treatment of the infrared behaviour of QED and QCD is presented. As an application of the method the calculation of the electromagnetic quark form factor is discussed. (M.F.W.)

  16. Hadronic Form Factors in Asymptotically Free Field Theories

    Science.gov (United States)

    Gross, D. J.; Treiman, S. B.

    1974-01-01

    The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

  17. Hadron form factors in the constituent quark model

    International Nuclear Information System (INIS)

    Cardarelli, F.; Salme', G.; Simula, S.; Pace, E.

    1998-01-01

    Hadron electromagnetic form factors are evaluated in a light-front constituent quark model based on the eigenfunctions of a mass operator, including in the q-q interaction a confining term and a one-gluon-exchange term (OGE). The spin-dependent part of the interaction plays an essential role for obtaining both a proper fit of the experimental nucleon electromagnetic form factors and the faster than dipole decrease of the magnetic N-P 33 (1232) transition form factor. The effects of the D wave, produced by the tensor part of the OGE interaction, on the quadrupole and Coulomb N-P 33 (1232) transition form factors have been found to be negligible. (author)

  18. Finite volume form factors in the presence of integrable defects

    International Nuclear Information System (INIS)

    Bajnok, Z.; Buccheri, F.; Hollo, L.; Konczer, J.; Takacs, G.

    2014-01-01

    We developed the theory of finite volume form factors in the presence of integrable defects. These finite volume form factors are expressed in terms of the infinite volume form factors and the finite volume density of states and incorporate all polynomial corrections in the inverse of the volume. We tested our results, in the defect Lee–Yang model, against numerical data obtained by truncated conformal space approach (TCSA), which we improved by renormalization group methods adopted to the defect case. To perform these checks we determined the infinite volume defect form factors in the Lee–Yang model exactly, including their vacuum expectation values. We used these data to calculate the two point functions, which we compared, at short distance, to defect CFT. We also derived explicit expressions for the exact finite volume one point functions, which we checked numerically. In all of these comparisons excellent agreement was found

  19. Dispersive analysis of the pion transition form factor

    Science.gov (United States)

    Hoferichter, M.; Kubis, B.; Leupold, S.; Niecknig, F.; Schneider, S. P.

    2014-11-01

    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the cross section, generalizing previous studies on decays and scattering, and verify our result by comparing to data. We perform the analytic continuation to the space-like region, predicting the poorly-constrained space-like transition form factor below , and extract the slope of the form factor at vanishing momentum transfer . We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon.

  20. The connected prescription for form factors in twistor space

    Energy Technology Data Exchange (ETDEWEB)

    Brandhuber, A.; Hughes, E.; Panerai, R.; Spence, B.; Travaglini, G. [Centre for Research in String Theory, School of Physics and Astronomy,Queen Mary University of London,Mile End Road, London E1 4NS (United Kingdom)

    2016-11-23

    We propose a connected prescription formula in twistor space for all tree-level form factors of the stress tensor multiplet operator in N=4 super Yang-Mills, which is a generalisation of the expression of Roiban, Spradlin and Volovich for superamplitudes. By introducing link variables, we show that our formula is identical to the recently proposed four-dimensional scattering equations for form factors. Similarly to the case of amplitudes, the link representation of form factors is shown to be directly related to BCFW recursion relations, and is considerably more tractable than the scattering equations. We also discuss how our results are related to a recent Grassmannian formulation of form factors, and comment on a possible derivation of our formula from ambitwistor strings.

  1. Normalization Of Thermal-Radiation Form-Factor Matrix

    Science.gov (United States)

    Tsuyuki, Glenn T.

    1994-01-01

    Report describes algorithm that adjusts form-factor matrix in TRASYS computer program, which calculates intraspacecraft radiative interchange among various surfaces and environmental heat loading from sources such as sun.

  2. Classical limit of diagonal form factors and HHL correlators

    Energy Technology Data Exchange (ETDEWEB)

    Bajnok, Zoltan [MTA Lendület Holographic QFT Group, Wigner Research Centre,H-1525 Budapest 114, P.O.B. 49 (Hungary); Janik, Romuald A. [Institute of Physics, Jagiellonian University,ul. Łojasiewicza 11, 30-348 Kraków (Poland)

    2017-01-16

    We propose an expression for the classical limit of diagonal form factors in which we integrate the corresponding observable over the moduli space of classical solutions. In infinite volume the integral has to be regularized by proper subtractions and we present the one, which corresponds to the classical limit of the connected diagonal form factors. In finite volume the integral is finite and can be expressed in terms of the classical infinite volume diagonal form factors and subvolumes of the moduli space. We analyze carefully the periodicity properties of the finite volume moduli space and found a classical analogue of the Bethe-Yang equations. By applying the results to the heavy-heavy-light three point functions we can express their strong coupling limit in terms of the classical limit of the sine-Gordon diagonal form factors.

  3. Conformal symmetry and pion form factor: Soft and hard contributions

    International Nuclear Information System (INIS)

    Choi, Ho-Meoyng; Ji, Chueng-Ryong

    2006-01-01

    We discuss a constraint of conformal symmetry in the analysis of the pion form factor. The usual power-law behavior of the form factor obtained in the perturbative QCD analysis can also be attained by taking negligible quark masses in the nonperturbative quark model analysis, confirming the recent AdS/CFT correspondence. We analyze the transition from soft to hard contributions in the pion form factor considering a momentum-dependent dynamical quark mass from an appreciable constituent quark mass at low momentum region to a negligible current quark mass at high momentum region. We find a correlation between the shape of nonperturbative quark distribution amplitude and the amount of soft and hard contributions to the pion form factor

  4. Electromagnetic form factors at large momenta from lattice QCD

    Science.gov (United States)

    Chambers, A. J.; Dragos, J.; Horsley, R.; Nakamura, Y.; Perlt, H.; Pleiter, D.; Rakow, P. E. L.; Schierholz, G.; Schiller, A.; Somfleth, K.; Stüben, H.; Young, R. D.; Zanotti, J. M.; Qcdsf/Ukqcd/Cssm Collaborations

    2017-12-01

    Accessing hadronic form factors at large momentum transfers has traditionally presented a challenge for lattice QCD simulations. Here, we demonstrate how a novel implementation of the Feynman-Hellmann method can be employed to calculate hadronic form factors in lattice QCD at momenta much higher than previously accessible. Our simulations are performed on a single set of gauge configurations with three flavors of degenerate mass quarks corresponding to mπ≈470 MeV . We are able to determine the electromagnetic form factors of the pion and nucleon up to approximately 6 GeV2 , with results for the ratio of the electric and magnetic form factors of the proton at our simulated quark mass agreeing well with experimental results.

  5. Human factors in nuclear safety oversight

    International Nuclear Information System (INIS)

    Taylor, K.

    1989-01-01

    The mission of the nuclear safety oversight function at the Savannah River Plant is to enhance the process and nuclear safety of site facilities. One of the major goals surrounding this mission is the reduction of human error. It is for this reason that several human factors engineers are assigned to the Operations assessment Group of the Facility Safety Evaluation Section (FSES). The initial task of the human factors contingent was the design and implementation of a site wide root cause analysis program. The intent of this system is to determine the most prevalent sources of human error in facility operations and to assist in determining where the limited human factors resources should be focused. In this paper the strategy used to educate the organization about the field of human factors is described. Creating an awareness of the importance of human factors engineering in all facets of design, operation, and maintenance is considered to be an important step in reducing the rate of human error

  6. ELECTROMAGENTIC FORM FACTORS OF THE PROTON AND NEUTRON

    Energy Technology Data Exchange (ETDEWEB)

    Griffy, T. A.; Hofstadter, R.; Hughes, E. B.; Janssens, T.; Yearian, M. R.

    1963-06-15

    Proton form factors in the four-momentum-transfer range q/sup 2/ = 4.6 to 32.0 f/sup -2/ and neutron form factors in the range q/sup 2/ = 2.5 to 10.0 f/ sup -2/ are measured by means of electron elastic scattering by protons and electron inelastic scattering by deuterons. (T.F.H.)

  7. Low-energy analysis of the nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Kubis, Bastian.; Meissner, Ulf-G.

    2001-01-01

    We analyze the electromagnetic form factors of the nucleon to fourth order in relativistic baryon chiral perturbation theory. We employ the recently proposed infrared regularization scheme and show that the convergence of the chiral expansion is improved as compared to the heavy-fermion approach. We also discuss the inclusion of vector mesons and obtain an accurate description of all four-nucleon form factors for momentum transfer squared up to Q 2 ≅0.4 GeV 2

  8. Hyperon decay form factors in chiral perturbation theory

    International Nuclear Information System (INIS)

    Lacour, Andre; Kubis, Bastian; Meissner, Ulf-G.

    2007-01-01

    We present a complete calculation of the SU(3)-breaking corrections to the hyperon vector form factors up to O(p 4 ) in covariant baryon chiral perturbation theory. Partial higher-order contributions are obtained, and we discuss chiral extrapolations of the vector form factor at zero momentum transfer. In addition we derive low-energy theorems for the subleading moments in hyperon decays, the weak Dirac radii and the weak anomalous magnetic moments, up to O(p 4 )

  9. Form factors and other measures of strangeness in the nucleon

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, M. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Feldmann, T. [Siegen Univ. (Germany). Theoretische Physik I; Kroll, P. [Bergische Univ., Wuppertal (Germany). Fachbereich Physik

    2007-11-15

    We discuss the phenomenology of strange-quark dynamics in the nucleon, based on experimental and theoretical results for electroweak form factors and for parton densities. In particular, we construct a model for the generalized parton distribution that relates the asymmetry s(x)- anti s(x) between the longitudinal momentum distributions of strange quarks and antiquarks with the form factor F{sup s}{sub 1}(t), which describes the distribution of strangeness in transverse position space. (orig.)

  10. Form factors and other measures of strangeness in the nucleon

    International Nuclear Information System (INIS)

    Diehl, M.; Feldmann, T.; Kroll, P.

    2007-11-01

    We discuss the phenomenology of strange-quark dynamics in the nucleon, based on experimental and theoretical results for electroweak form factors and for parton densities. In particular, we construct a model for the generalized parton distribution that relates the asymmetry s(x)- anti s(x) between the longitudinal momentum distributions of strange quarks and antiquarks with the form factor F s 1 (t), which describes the distribution of strangeness in transverse position space. (orig.)

  11. From quarks and gluons to baryon form factors.

    Science.gov (United States)

    Eichmann, Gernot

    2012-04-01

    I briefly summarize recent results for nucleon and [Formula: see text] electromagnetic, axial and transition form factors in the Dyson-Schwinger approach. The calculation of the current diagrams from the quark-gluon level enables a transparent discussion of common features such as: the implications of dynamical chiral symmetry breaking and quark orbital angular momentum, the timelike structure of the form factors, and their interpretation in terms of missing pion-cloud effects.

  12. Form factors of the finite quantum XY-chain

    International Nuclear Information System (INIS)

    Iorgov, Nikolai

    2011-01-01

    Explicit factorized formulas for the matrix elements (form factors) of the spin operators σ x and σ y between the eigenvectors of the Hamiltonian of the finite quantum periodic XY-chain in a transverse field were derived. The derivation is based on the relations between three models: the model of quantum XY-chain, Ising model on 2D lattice and N = 2 Baxter-Bazhanov-Stroganov τ (2) -model. Due to these relations we transfer the formulas for the form factors of the latter model recently obtained by the use of separation of variables method to the model of quantum XY-chain. Hopefully, the formulas for the form factors will help in analysis of multipoint dynamic correlation functions at a finite temperature. As an example, we re-derive the asymptotics of the two-point correlation function in the disordered phase without the use of the Toeplitz determinants and the Wiener-Hopf factorization method.

  13. Geologic factors in nuclear waste disposal

    International Nuclear Information System (INIS)

    Towse, D.

    1978-07-01

    The study of geosciences and their relation to nuclear waste disposal and management entails analyzing the hydrology, chemistry, and geometry of the nuclear waste migration process. Hydrologic effects are determined by analyzing the porosity and permeability (natural and induced) of rock as well as pressures and gradients, dispersion, and aquifer length of the system. Chemistry parameters include radionuclide retardation factors and waste dissolution rate. Geometric parameters (i.e., parameters with dimension) evaluated include repository layer thickness, fracture zone area, tunnel length, and aquifer length. The above parameters act as natural barriers or controls to nuclear waste migration, and are evaluated in three potential geologic media: salt, shale, and crystalline rock deposits. Parametric values are assigned that correspond to many existing situations. These values, in addition to other important inputs, are lumped as a hydrology input into a computer simulation program used to model and calculate nuclear waste migration from the repository to the biosphere, and potential individual and population dose and radiation effects. These results are preliminary and show trends only; they do not represent an actual risk analysis

  14. Current algebra constraints on K13 form factors

    International Nuclear Information System (INIS)

    Simmons, L.D.

    1975-01-01

    New theoretical constraints on the divergence form factor in K 13 decays are derived. The assumptions underlying the derivation are presented. The constraints on the divergence form factor are derived and summarized in the form of a theorem. It is shown that the finiteness of the leakage charge is a natural consequence of the parallelΔI vectorparallel = 1 / 2 rule. The Lorentz invariance of current algebra sum rules is discussed. The theorem is rederived within the context of the conserved vector current hypothesis. Finally, the implications of the present work are noted with attention being paid to both the theoretical and experimental consequences

  15. Describing the nucleon electromagnetic form factors at high momentum transfers

    International Nuclear Information System (INIS)

    Theussl, L.; Desplanques, B.; Silvestre-Brac, B.; Varga, K.

    1999-01-01

    Electromagnetic form factors of the nucleon are calculated within the framework of a non-relativistic constituent-quark model. The emphasis is put on the reliability and accuracy of present day numerical methods used to solve the three-body problem. The high-q 2 behaviour of the form factors is determined by the form of the wave function at short distances and, due to the small absolute values that one deals with, an accurate solution is essential. Refs. 5, figs. 2 (author)

  16. Human Factors in Nuclear Reactor Accidents

    International Nuclear Information System (INIS)

    Mustafa, M.E.

    2016-01-01

    While many people would blame nature for the disaster of the “Fukushima Daiichi” accident, experts considered this accident to be also a human-induced disaster. This confirmed the importance of human errors which have been getting a growing interest in the nuclear field after the Three Mile Island accident. Personnel play an important role in design, operation, maintenance, planning, and management. The interface between machine and man is known as a human factor. In the present work, the human factors that have to be considered were discussed. The effect of the control room configuration and equipment design effect on the human behavior was also discussed. Precise reviewing of person’s qualifications and experience was focused. Insufficient training has been a major cause of human error in the nuclear field. The effective training issues were introduced. Avoiding complicated operational processes and non responsive management systems was stressed. Distinguishing between the procedures for normal and emergency operations was emphasised. It was stated that human error during maintenance and testing activities could cause a serious accident. This is because safety systems do not cover much more risk probabilities in the maintenance and testing activities like they do in the normal operation. In nuclear industry, the need for a classification and identification of human errors has been well recognised. As a result of this, human reliability must be assessed. These errors are analyzed by a probabilistic safety assessment which deals with errors in reading, listening and implementing procedures but not with cognitive errors. Much efforts must be accomplished to consider cognitive errors in the probabilistic safety assessment. The ways of collecting human factor data were surveyed. The methods for identifying safe designs, helping decision makers to predict how proposed or current policies will affect safety, and comprehensive understanding of the relationship

  17. Study of nuclear fuel powders forming by axial compaction

    International Nuclear Information System (INIS)

    Fourcade, J.

    2002-12-01

    Nuclear fuel powders forming, although perfectly dominated, fail to make compacts without density gradients. Density heterogeneities induce diametric deformations during firing which force manufacturers to adjust shape with a high cost machining stage. Manufacturing process improvement is a major project to obtain perfectly shaped pellets and reduce their cost. One way of investigation of this project is the study of powders compaction mechanisms to understand and improve their behaviour. The goal of this study is to identify the main mechanisms linked with powder properties that act on pressing. An empirical model is developed to predict pellet deformations from a single compaction test. This model has to link powder properties with their compaction behaviour. Then, compaction tests identify the main mechanisms whereas a contact dynamic program is used to explain them. These works, done to improve the understanding in powders behaviour, focus on powders agglomeration state and macroscopic particles arrangement during the die filling stage. Actually, for granulated powders, granules cohesion act on the powder bed behaviour under pressure. The first particles arrangement is responsible for the first transfer directions into the powder and so for its transfer homogeneity and isotropy. As a consequence, the knowledge of all the macroscopic powder properties is essential to understand and improve the manufacturing process. Moreover, tests on UO 2 powders have shown that it is better to use granulated powders with spherical granules, short size distribution and granules cohesion according with compaction pressure to improve compact homogeneity of densification. (author)

  18. Dispersion-theoretical analysis of the nucleon electromagnetic form factors

    Energy Technology Data Exchange (ETDEWEB)

    Belushkin, M.

    2007-09-29

    The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the {pi}{pi}, K anti K and the {rho}{pi} continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

  19. Dispersion-theoretical analysis of the nucleon electromagnetic form factors

    International Nuclear Information System (INIS)

    Belushkin, M.

    2007-01-01

    The structure of the proton and the neutron is of fundamental importance for the study of the strong interaction dynamics over a wide range of momentum transfers. The nucleon form factors encode information on the internal structure of the nucleon as probed by the electromagnetic interaction, and, to a certain extent, reflect the charge and magnetisation distributions within the proton and the neutron. In this thesis we report on our investigation of the electromagnetic form factors of the proton and the neutron with dispersion relation techniques, including known experimental input on the ππ, K anti K and the ρπ continua and perturbative QCD constraints. We include new experimental data on the pion form factor and the nucleon form factors in our simultaneous analysis of all four form factors in both the space- and the timelike regions for all momentum transfers, and perform Monte- Carlo sampling in order to obtain theoretical uncertainty bands. Finally, we discuss the implications of our results on the pion cloud of the nucleon, the nucleon radii and the Okubo-Zweig-Iizuka rule, and present our results of a model-independent approach to estimating two-photon effects in elastic electron-proton scattering. (orig.)

  20. The neutron electric form factor to Q² = 1.45 (GeV/c)²

    Energy Technology Data Exchange (ETDEWEB)

    Plaster, Bradley [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)

    2004-02-01

    The nucleon elastic electromagnetic form factors are fundamental quantities needed for an understanding of nucleon and nuclear electromagnetic structure. The evolution of the Sachs electric and magnetic form factors with Q2, the square of the four-momentum transfer, is related to the distribution of charge and magnetization within the nucleon. High precision measurements of the nucleon form factors are essential for stringent tests of our current theoretical understanding of confinement within the nucleon. Measurements of the neutron form factors, in particular, those of the neutron electric form factor, have been notoriously difficult due to the lack of a free neutron target and the vanishing integral charge of the neutron. Indeed, a precise measurement of the neutron electric form factor has eluded experimentalists for decades; however, with the advent of high duty-factor polarized electron beam facilities, experiments employing polarization degrees of freedom have finally yielded the first precise measurements of this fundamental quantity. Following a general overview of the experimental and theoretical status of the nucleon form factors, a detailed description of an experiment designed to extract the neutron electric form factor from measurements of the neutron's recoil polarization in quasielastic 2H(e, e')1H scattering is presented. The experiment described here employed the Thomas Jefferson National Accelerator Facility's longitudinally polarized electron beam, a magnetic spectrometer for detection of the scattered electron, and a neutron polarimeter designed specifically for this experiment. Measurements were conducted at three Q2 values of 0.45, 1.13, and 1.45 (GeV/c)2, and the final results extracted from an analysis of the data acquired in this experiment are reported and compared with recent theoretical predictions for the nucleon form factors.

  1. Electromagnetic form factors at large momenta from lattice QCD

    International Nuclear Information System (INIS)

    Chambers, Alexander J.; Dragos, J.; Michigan State Univ., East Lansing, MI; Horsley, R.

    2017-01-01

    Accessing hadronic form factors at large momentum transfers has traditionally presented a challenge for lattice QCD simulations. Here we demonstrate how a novel implementation of the Feynman-Hellmann method can be employed to calculate hadronic form factors in lattice QCD at momenta much higher than previously accessible. Our simulations are performed on a single set of gauge configurations with three flavours of degenerate mass quarks corresponding to m_π∼470 MeV. We are able to determine the electromagnetic form factors of the pion and nucleon up to approximately 6 GeV"2, with results for G_E/G_M in the proton agreeing well with experimental results.

  2. Two-loop SL(2) form factors and maximal transcendentality

    International Nuclear Information System (INIS)

    Loebbert, Florian; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2016-01-01

    Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  3. Two-body form factors at high Q2

    International Nuclear Information System (INIS)

    Gross, F.; Keister, B.D.

    1983-02-01

    The charge form factor of a scalar deuteron at high momentum transfer is examined in a model employing scalar nucleons and mesons. With an eye toward establishing consistency criteria for more realistic calculations, several aspects of the model are examined in detail: the role of nucleon and meson singularities in the one-loop impulse diagram, the role of positive-and negative-energy nucleons, and the relationship to time-ordered perturbation theory. It is found that at large Q 2 (1) the form factor is dominated by a term in which the spectator nucleon is on the mass shell, and (2) the meson singularity structure of the d-n-p vertex function is unimportant in determining the overall high-Q 2 behaviour of the form factor

  4. Computation of 3D form factors in complex environments

    International Nuclear Information System (INIS)

    Coulon, N.

    1989-01-01

    The calculation of radiant interchange among opaque surfaces in a complex environment poses the general problem of determining the visible and hidden parts of the environment. In many thermal engineering applications, surfaces are separated by radiatively non-participating media and may be idealized as diffuse emitters and reflectors. Consenquently the net radiant energy fluxes are intimately related to purely geometrical quantities called form factors, that take into account hidden parts: the problem is reduced to the form factor evaluation. This paper presents the method developed for the computation of 3D form factors in the finite-element module of the system TRIO, which is a general computer code for thermal and fluid flow analysis. The method is derived from an algorithm devised for synthetic image generation. A comparison is performed with the standard contour integration method also implemented and suited to convex geometries. Several illustrative examples of finite-element thermal calculations in radiating enclosures are given

  5. Two-loop SL(2) form factors and maximal transcendentality

    Energy Technology Data Exchange (ETDEWEB)

    Loebbert, Florian [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Sieg, Christoph [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Institut für Mathematik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark); Yang, Gang [CAS Key Laboratory of Theoretical Physics,Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Institut für Physik, Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany)

    2016-12-19

    Form factors of composite operators in the SL(2) sector of N=4 SYM theory are studied up to two loops via the on-shell unitarity method. The non-compactness of this subsector implies the novel feature and technical challenge of an unlimited number of loop momenta in the integrand’s numerator. At one loop, we derive the full minimal form factor to all orders in the dimensional regularisation parameter. At two loops, we construct the complete integrand for composite operators with an arbitrary number of covariant derivatives, and we obtain the remainder functions as well as the dilatation operator for composite operators with up to three covariant derivatives. The remainder functions reveal curious patterns suggesting a hidden maximal uniform transcendentality for the full form factor. Finally, we speculate about an extension of these patterns to QCD.

  6. Electromagnetic form factors of the Ω- in lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Korzec, T.; Koutsou, G.; Negele, J. W.; Proestos, Y.

    2010-01-01

    We present results on the omega baryon (Ω - ) electromagnetic form factors using N f =2+1 domain-wall fermion configurations for three pion masses in the range of about 350 to 300 MeV. We compare results obtained using domain-wall fermions with those of a mixed-action (hybrid) approach, which combines domain-wall valence quarks on staggered sea quarks, for a pion mass of about 350 MeV. We pay particular attention in the evaluation of the subdominant electric quadrupole form factor to sufficient accuracy to exclude a zero value, by constructing a sequential source that isolates it from the dominant form factors. The Ω - magnetic moment, μ Ω - , and the electric charge and magnetic radius, E0/M1 2 >, are extracted for these pion masses. The electric quadrupole moment is determined for the first time using dynamical quarks.

  7. Regression analysis of nuclear plant capacity factors

    International Nuclear Information System (INIS)

    Stocks, K.J.; Faulkner, J.I.

    1980-07-01

    Operating data on all commercial nuclear power plants of the PWR, HWR, BWR and GCR types in the Western World are analysed statistically to determine whether the explanatory variables size, year of operation, vintage and reactor supplier are significant in accounting for the variation in capacity factor. The results are compared with a number of previous studies which analysed only United States reactors. The possibility of specification errors affecting the results is also examined. Although, in general, the variables considered are statistically significant, they explain only a small portion of the variation in the capacity factor. The equations thus obtained should certainly not be used to predict the lifetime performance of future large reactors

  8. Master integrals for the four-loop Sudakov form factor

    International Nuclear Information System (INIS)

    Boels, Rutger; Kniehl, Bernd A.; Yang, Gang; Chinese Academy of Sciences, Beijing

    2015-08-01

    The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N=4) supersymmetric Yang-Mills theory (SYM) in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. Probably the simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was obtained in integrand form in a previous work for N=4 SYM, up to a single parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP) identities using (a tweaked version of) Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. The appearing master integrals are cross-checked using algebraic techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N=4 SYM and beyond are identified.

  9. Master integrals for the four-loop Sudakov form factor

    Directory of Open Access Journals (Sweden)

    Rutger H. Boels

    2016-01-01

    Full Text Available The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N=4 supersymmetric Yang–Mills theory (SYM in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. The simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was largely obtained in integrand form in a previous work for N=4 SYM, up to a free parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP identities using a modified version of Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. Moreover, two of the integral topologies vanish after reduction. The appearing master integrals are cross-checked using independent algebraic-geometry techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Discrepancies between explicitly solving the IBP relations and the MINT approach are highlighted. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N=4 SYM and beyond are identified.

  10. Organizational factors and nuclear power plant safety

    International Nuclear Information System (INIS)

    Haber, S.B.

    1995-01-01

    There are many organizations in our society that depend on human performance to avoid incidents involving significant adverse consequences. As our culture and technology have become more sophisticated, the management of risk on a broad basis has become more and more critical. The safe operation of military facilities, chemical plants, airlines, and mass transit, to name a few, are substantially dependent on the performance of the organizations that operate those facilities. The nuclear power industry has, within the past 15 years, increased the attention given to the influence of human performance in the safe operation of nuclear power plants (NPP). While NPPs have been designed through engineering disciplines to intercept and mitigate events that could cause adverse consequences, it has been clear from various safety-related incidents that human performance also plays a dominant role in preventing accidents. Initial efforts following the 1979 Three Mile Island incident focused primarily on ergonomic factors (e.g., the best design of control rooms for maximum performance). Greater attention was subsequently directed towards cognitive processes involved in the use of NPP decision support systems and decision making in general, personnel functions such as selection systems, and the influence of work scheduling and planning on employees' performance. Although each of these approaches has contributed to increasing the safety of NPPS, during the last few years, there has been a growing awareness that particular attention must be paid to how organizational processes affect NPP personnel performance, and thus, plant safety. The direct importance of organizational factors on safety performance in the NPP has been well-documented in the reports on the Three Mile Island and Chernobyl accidents as well as numerous other events, especially as evaluated by the U.S. Nuclear Regulatory Commission (NRC)

  11. Nucleon quark structure and strong meson-nucleon form factors

    International Nuclear Information System (INIS)

    Efimov, G.V.; Ivanov, M.A.

    1987-01-01

    The nucleon is considered as a three-quark system in virton-quark model. The main statistic properties of proton and neutron are calculated: magnetic moments, electromagnetic radii, G A /G V ratio in weak neutron decay. Strong meson-nucleon form factors which determine nucleon-nucleon potential are obtained as a function of squared transfer momentum of mesons. The results are compared with phenomenological form factors used for description of phases of NN-scattering in the one-boson-, exchange model

  12. Towards a dispersive determination of the pion transition form factor

    Science.gov (United States)

    Leupold, Stefan; Hoferichter, Martin; Kubis, Bastian; Niecknig, Franz; Schneider, Sebastian P.

    2018-01-01

    We start with a brief motivation why the pion transition form factor is interesting and, in particular, how it is related to the high-precision standard-model calculation of the gyromagnetic ratio of the muon. Then we report on the current status of our ongoing project to calculate the pion transition form factor using dispersion theory. Finally we present and discuss a wish list of experimental data that would help to improve the input for our calculations and/or to cross-check our results.

  13. Towards a dispersive determination of the pion transition form factor

    Directory of Open Access Journals (Sweden)

    Leupold Stefan

    2018-01-01

    Full Text Available We start with a brief motivation why the pion transition form factor is interesting and, in particular, how it is related to the high-precision standard-model calculation of the gyromagnetic ratio of the muon. Then we report on the current status of our ongoing project to calculate the pion transition form factor using dispersion theory. Finally we present and discuss a wish list of experimental data that would help to improve the input for our calculations and/or to cross-check our results.

  14. Covariance dynamics and symmetries, and hadron form factors

    International Nuclear Information System (INIS)

    Bhagwat, M.S.; Cloet, I.C.; Roberts, C.D.

    2007-01-01

    We summarize applications of Dyson-Schwinger equations to the theory and phenomenology of hadrons. Some exact results for pseudoscalar mesons are highlighted with details relating to the U A (1) problem. We describe inferences from the gap equation relating to the radius of convergence for expansions of observables in the current-quark mass. We recapitulate upon studies of nucleon electromagnetic form factors, providing a comparison of the ln-weighted ratios of Pauli and Dirac form factors for the neutron and proton.

  15. Measurement of the Charged Pion Electromagnetic Form Factor

    International Nuclear Information System (INIS)

    J. Volmer; David Abbott; H. Anklin; Chris Armstrong; John Arrington; K. Assamagan; Steven Avery; Oliver K. Baker; Henk Blok; C. Bochna; Ed Brash; Herbert Breuer; Nicholas Chant; Jim Dunne; Tom Eden; Rolf Ent; David Gaskell; Ron Gilman; Kenneth Gustafsson; Wendy Hinton; Garth Huber; Hal Jackson; Mark K. Jones; Cynthia Keppel; P.H. Kim; Wooyoung Kim; Andi Klein; Doug Koltenuk; Meme Liang; George Lolos; Allison Lung; David Mack; D. McKee; David Meekins; Joseph Mitchell; H. Mkrtchian; B. Mueller; Gabriel Niculescu; Ioana Niculescu; D. Pitz; D. Potterveld; Liming Qin; Juerg Reinhold; I.K. Shin; Stepan Stepanyan; V. Tadevosian; L.G. Tang; R.L.J. van der Meer; K. Vansyoc; D. Van Westrum; Bill Vulcan; Stephen Wood; Chen Yan; W.X. Zhao; Beni Zihlmann

    2001-01-01

    Separated longitudinal and transverse structure functions for the reaction 1H(e,eprime pi+)n were measured in the momentum transfer region Q2=0.6-1.6 (GeV/c)**2 at a value of the invariant mass W=1.95 GeV. New values for the pion charge form factor were extracted from the longitudinal cross section by using a recently developed Regge model. The results indicate that the pion form factor in this region is larger than previously assumed and is consistent with a monopole parameterization fitted to very low Q2 elastic data

  16. Form factors and structure functions of hadrons in parton model

    International Nuclear Information System (INIS)

    Volkonskij, N.Yu.

    1979-01-01

    The hadron charge form factors and their relation to the deep-inelastic lepton-production structure functions in the regions of asymptotically high and small momentum transfer Q 2 are studied. The nucleon and pion charge radii are calculated. The results of calculations are in good agreement with the experimental data. The K- and D-meson charge radii are estimated. In the region of asymptotically high Q 2 the possibility of Drell-Yan-West relation violation is analyzed. It is shown, that for pseudoscalar mesons this relation is violated. The relation between the proton and neutron form factor asymptotics is obtained

  17. Deuteron form factor measurements at low momentum transfers

    Directory of Open Access Journals (Sweden)

    Schlimme B. S.

    2016-01-01

    Full Text Available A precise measurement of the elastic electron-deuteron scattering cross section at four-momentum transfers of 0.24 fm−1 ≤ Q ≤ 2.7 fm−1 has been performed at the Mainz Microtron. In this paper we describe the utilized experimental setup and the necessary analysis procedure to precisely determine the deuteron charge form factor from these data. Finally, the deuteron charge radius rd can be extracted from an extrapolation of that form factor to Q2 = 0.

  18. Perturbative corrections to B → D form factors in QCD

    Science.gov (United States)

    Wang, Yu-Ming; Wei, Yan-Bing; Shen, Yue-Long; Lü, Cai-Dian

    2017-06-01

    We compute perturbative QCD corrections to B → D form factors at leading power in Λ/ m b , at large hadronic recoil, from the light-cone sum rules (LCSR) with B-meson distribution amplitudes in HQET. QCD factorization for the vacuum-to- B-meson correlation function with an interpolating current for the D-meson is demonstrated explicitly at one loop with the power counting scheme {m}_c˜ O(√{Λ {m}_b}) . The jet functions encoding information of the hard-collinear dynamics in the above-mentioned correlation function are complicated by the appearance of an additional hard-collinear scale m c , compared to the counterparts entering the factorization formula of the vacuum-to- B-meson correction function for the construction of B → π from factors. Inspecting the next-to-leading-logarithmic sum rules for the form factors of B → Dℓν indicates that perturbative corrections to the hard-collinear functions are more profound than that for the hard functions, with the default theory inputs, in the physical kinematic region. We further compute the subleading power correction induced by the three-particle quark-gluon distribution amplitudes of the B-meson at tree level employing the background gluon field approach. The LCSR predictions for the semileptonic B → Dℓν form factors are then extrapolated to the entire kinematic region with the z-series parametrization. Phenomenological implications of our determinations for the form factors f BD +,0 ( q 2) are explored by investigating the (differential) branching fractions and the R( D) ratio of B → Dℓν and by determining the CKM matrix element |V cb | from the total decay rate of B → Dμν μ .

  19. On form factors and correlation functions in twistor space

    International Nuclear Information System (INIS)

    Koster, Laura; Mitev, Vladimir; Staudacher, Matthias; Wilhelm, Matthias

    2017-01-01

    In this paper, we continue our study of form factors and correlation functions of gauge-invariant local composite operators in the twistor-space formulation of N=4 super Yang-Mills theory. Using the vertices for these operators obtained in our recent papers (DOI: 10.1103/PhysRevLett.117.011601; 10.1007/JHEP06(2016)162 ), we show how to calculate the twistor-space diagrams for general N k MHV form factors via the inverse soft limit, in analogy to the amplitude case. For general operators without α-dot indices, we then reexpress the NMHV form factors from the position-twistor calculation in terms of momentum twistors, deriving and expanding on a relation between the two twistor formalisms previously observed in the case of amplitudes. Furthermore, we discuss the calculation of generalized form factors and correlation functions as well as the extension to loop level, in particular providing an argument promised in https://www.doi.org/10.1002/prop.201400085.

  20. Heavy quark form factors at two loops in perturbative QCD

    International Nuclear Information System (INIS)

    Ablinger, J.; Schneider, C.; Behring, A.; Falcioni, G.

    2017-11-01

    We present the results for heavy quark form factors at two-loop order in perturbative QCD for different currents, namely vector, axial-vector, scalar and pseudo-scalar currents, up to second order in the dimensional regularization parameter. We outline the necessary computational details, ultraviolet renormalization and corresponding universal infrared structure.

  1. Generation of truncated recombinant form of tumor necrosis factor ...

    African Journals Online (AJOL)

    7. Original Research Article. Generation of truncated recombinant form of tumor necrosis factor ... as 6×His tagged using E.coli BL21 (DE3) expression system. The protein was ... proapoptotic signaling cascade through TNFR1. [5] which is ...

  2. Pion form factor within QCD instanton vacuum model

    International Nuclear Information System (INIS)

    Dorokhov, A.E.

    1997-01-01

    Instanton induced pion wave function is constructed. It provides an intrinsic k 1 dependence which suppress soft virtual one-gluon exchanges and thus legitimate the perturbative QCD (pQCD) calculations of the pion electromagnetic form factor in the region of momentum transfers above the scale. (author)

  3. Form factors and charge radii in a quantum chromodynamics ...

    Indian Academy of Sciences (India)

    tic form factors and charge radii of D, Ds,B,Bs and Bc mesons in a quantum chromodynamics. (QCD)-inspired ... as pointed out in [12,13], one can expect a similar success here too. .... 0 were large and the formalism failed to account for large ...

  4. Numerical study of the lattice meson form factor

    International Nuclear Information System (INIS)

    Woloshyn, R.M.; Kobos, A.M.

    1986-01-01

    The electric form factor of the pseudo-Goldstone meson (the generic pion) is calculated in quenched lattice quantum chromodynamics with SU(2) color. Charge radii are calculated for different values of the bare-quark mass. The results are in agreement with the physically reasonable expectation that heavier quarks have distributions of smaller radius

  5. Dispersive analysis of the pion transition form factor

    Energy Technology Data Exchange (ETDEWEB)

    Hoferichter, M. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, ExtreMe Matter Institute EMMI, Darmstadt (Germany); University of Bern, Albert Einstein Center for Fundamental Physics, Institute for Theoretical Physics, Bern (Switzerland); Kubis, B.; Niecknig, F.; Schneider, S.P. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany); Leupold, S. [Uppsala Universitet, Institutionen foer fysik och astronomi, Box 516, Uppsala (Sweden)

    2014-11-15

    We analyze the pion transition form factor using dispersion theory. We calculate the singly-virtual form factor in the time-like region based on data for the e{sup +}e{sup -} → 3π cross section, generalizing previous studies on ω, φ → 3π decays and γπ → ππ scattering, and verify our result by comparing to e{sup +}e{sup -} → π{sup 0}γ data. We perform the analytic continuation to the space-like region, predicting the poorlyconstrained space-like transition form factor below 1 GeV, and extract the slope of the form factor at vanishing momentum transfer a{sub π} = (30.7 ± 0.6) x 10{sup -3}. We derive the dispersive formalism necessary for the extension of these results to the doubly-virtual case, as required for the pion-pole contribution to hadronic light-by-light scattering in the anomalous magnetic moment of the muon. (orig.)

  6. Measurement of the pion form factor at higher energies

    Energy Technology Data Exchange (ETDEWEB)

    Mack, D.J. [CEBAF, Newport News, VA (United States)

    1994-04-01

    One of the strongest arguments for increasing the nominal CEBAF beam energy to equal or exceed 6 GeV is that one would be able to make quality high Q{sup 2} measurements of the charged pion form factor.

  7. Δ(1232) Axial Charge and Form Factors from Lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, Constantia; Gregory, Eric B.; Korzec, Tomasz; Koutsou, Giannis; Negele, John W.; Sato, Toru; Tsapalis, Antonios

    2011-01-01

    We present the first calculation on the Δ axial vector and pseudoscalar form factors using lattice QCD. Two Goldberger-Treiman relations are derived and examined. A combined chiral fit is performed to the nucleon axial charge, N to Δ axial transition coupling constant and Δ axial charge.

  8. On form factors and correlation functions in twistor space

    Energy Technology Data Exchange (ETDEWEB)

    Koster, Laura [Institut für Mathematik, Institut für Physik und IRIS Adlershof,Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Mitev, Vladimir [PRISMA Cluster of Excellence, Institut für Physik, WA THEP,Johannes Gutenberg-Universität Mainz,Staudingerweg 7, 55128 Mainz (Germany); Staudacher, Matthias [Institut für Mathematik, Institut für Physik und IRIS Adlershof,Humboldt-Universität zu Berlin,Zum Großen Windkanal 6, 12489 Berlin (Germany); Wilhelm, Matthias [Niels Bohr Institute, Copenhagen University,Blegdamsvej 17, 2100 Copenhagen Ø (Denmark)

    2017-03-24

    In this paper, we continue our study of form factors and correlation functions of gauge-invariant local composite operators in the twistor-space formulation of N=4 super Yang-Mills theory. Using the vertices for these operators obtained in our recent papers (DOI: 10.1103/PhysRevLett.117.011601; 10.1007/JHEP06(2016)162 ), we show how to calculate the twistor-space diagrams for general N{sup k}MHV form factors via the inverse soft limit, in analogy to the amplitude case. For general operators without α-dot indices, we then reexpress the NMHV form factors from the position-twistor calculation in terms of momentum twistors, deriving and expanding on a relation between the two twistor formalisms previously observed in the case of amplitudes. Furthermore, we discuss the calculation of generalized form factors and correlation functions as well as the extension to loop level, in particular providing an argument promised in https://www.doi.org/10.1002/prop.201400085.

  9. Heavy quark form factors at two loops in perturbative QCD

    Energy Technology Data Exchange (ETDEWEB)

    Ablinger, J.; Schneider, C. [Johannes Kepler Univ., Linz (Austria). Research Inst. for Symbolic Computation (RISC); Behring, A. [RWTH Aachen Univ. (Germany). Inst. fuer Theoretische Teilchenphysik und Kosmologie; Bluemlein, J.; Freitas, A. de; Marquard, P.; Rana, N. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Falcioni, G. [Nikhef, Amsterdam (Netherlands). Theory Group

    2017-11-15

    We present the results for heavy quark form factors at two-loop order in perturbative QCD for different currents, namely vector, axial-vector, scalar and pseudo-scalar currents, up to second order in the dimensional regularization parameter. We outline the necessary computational details, ultraviolet renormalization and corresponding universal infrared structure.

  10. Isospin Mixing in the Nucleon and 4He and the Nucleon Strange Electric Form Factor

    International Nuclear Information System (INIS)

    Viviani, M.; Girlanda, L.; Kievsky, A.; Marcucci, L. E.; Rosati, S.; Schiavilla, R.; Kubis, B.; Lewis, R.

    2007-01-01

    In order to isolate the contribution of the nucleon strange electric form factor to the parity-violating asymmetry measured in 4 He(e-vector,e ' ) 4 He experiments, it is crucial to have a reliable estimate of the magnitude of isospin-symmetry-breaking (ISB) corrections in both the nucleon and 4 He. We examine this issue in the present Letter. Isospin admixtures in the nucleon are determined in chiral perturbation theory, while those in 4 He are derived from nuclear interactions, including explicit ISB terms. A careful analysis of the model dependence in the resulting predictions for the nucleon and nuclear ISB contributions to the asymmetry is carried out. We conclude that, at the low momentum transfers of interest in recent measurements reported by the HAPPEX Collaboration at Jefferson Lab, these contributions are of comparable magnitude to those associated with strangeness components in the nucleon electric form factor

  11. Isospin mixing in the nucleon and He-4 and the nucleon strange electric form-factor

    International Nuclear Information System (INIS)

    M. Viviani; R. Schiavilla; B. Kubis; R. Lewis; L. Girlanda; A. Kievsky; L.E. Marcucci; S. Rosati

    2007-01-01

    In order to isolate the contribution of the nucleon strange electric form factor to the parity-violating asymmetry measured in 4 He((rvec e),e(prime)) 4 He experiments, it is crucial to have a reliable estimate of the magnitude of isospin-symmetry-breaking (ISB) corrections in both the nucleon and 4 He. We examine this issue in the present letter. Isospin admixtures in the nucleon are determined in chiral perturbation theory, while those in 4 He are derived from nuclear interactions, including explicit ISB terms. A careful analysis of the model dependence in the resulting predictions for the nucleon and nuclear ISB contributions to the asymmetry is carried out. We conclude that, at the low momentum transfers of interest in recent measurements reported by the HAPPEX collaboration at Jefferson Lab, these contributions are of comparable magnitude to those associated with strangeness components in the nucleon electric form factor

  12. Nucleon form factors, generalized parton distributions and quark angular momentum

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Kroll, Peter [Bergische Univ., Wuppertal (Germany). Fachbereich Physik; Regensburg Univ. (Germany). Institut fuer Theoretische Physik

    2013-02-15

    We extract the individual contributions from u and d quarks to the Dirac and Pauli form factors of the proton, after a critical examination of the available measurements of electromagnetic nucleon form factors. From this data we determine generalized parton distributions for valence quarks, assuming a particular form for their functional dependence. The result allows us to study various aspects of nucleon structure in the valence region. In particular, we evaluate Ji's sum rule and estimate the total angular momentum carried by valence quarks at the scale {mu}=2 GeV to be J{sup u}{sub v}=0.230{sup +0.009}{sub -0.024} and J{sup d}{sub v}=-0.004{sup +0.010}{sub -0.016}.

  13. Form factors and radiation widths of the giant multipole resonances

    International Nuclear Information System (INIS)

    Denisov, V.Yu.

    1990-01-01

    Simple analytic relations for the form factors of inelastic electron scattering in the Born approximation and radiation widths of the isovector and isoscalar giant multipole resonances are derived. The dynamic relationship between the volume and surface density vibrations were taken into account in this calculation. The form factors in the Born approximation were found to be in satisfactory agreement with experimental data in the region of small transferred momenta. The radiation widths of isoscalar multipole resonances increase when the number of nucleons increase as A 1/3 , and for isovector resonances this dependence has the form f(A)A 1/3 , where f(A) is a slowly increasing function of A. Radiation widths well fit the experimental data

  14. Nucleon form factors, generalized parton distributions and quark angular momentum

    International Nuclear Information System (INIS)

    Diehl, Markus; Kroll, Peter; Regensburg Univ.

    2013-02-01

    We extract the individual contributions from u and d quarks to the Dirac and Pauli form factors of the proton, after a critical examination of the available measurements of electromagnetic nucleon form factors. From this data we determine generalized parton distributions for valence quarks, assuming a particular form for their functional dependence. The result allows us to study various aspects of nucleon structure in the valence region. In particular, we evaluate Ji's sum rule and estimate the total angular momentum carried by valence quarks at the scale μ=2 GeV to be J u v =0.230 +0.009 -0.024 and J d v =-0.004 +0.010 -0.016 .

  15. Development of human factors engineering guide for nuclear power project

    International Nuclear Information System (INIS)

    Wu Dangshi; Sheng Jufang

    1997-01-01

    'THE PRACTICAL GUIDE FOR APPLICATION OF HUMAN FACTORS ENGINEERING TO NUCLEAR POWER PROJECT (First Draft, in Chinese)', which was developed under a research program sponsored by National Nuclear Safety Administration (NNSA) is described briefly. It is hoped that more conscious, more systematical and more comprehensive application of Human Factors Engineering to the nuclear power projects from the preliminary feasibility studies up to the commercial operation will benefit the safe, efficient and economical operations of nuclear power plants in China

  16. Human factors in nuclear power plant operation

    International Nuclear Information System (INIS)

    Sabri, Z.A.; Husseiny, A.A.

    1980-01-01

    An extensive effort is being devoted to developing a comprehensive human factor program that encompasses establishment of a data base for human error prediction using past operation experience in commercial nuclear power plants. Some of the main results of such an effort are reported including data retrieval and classification systems which have been developed to assist in estimation of operator error rates. Also, statistical methods are developed to relate operator error data to reactor type, age, and specific technical design features. Results reported in this paper are based on an analysis of LER's covering a six-year period for LWR's. Developments presently include a computer data management program, statistical model, and detailed error taxonomy

  17. Cement matrix for immobilisation of spent anionic resins in borate form arising from nuclear power plants

    International Nuclear Information System (INIS)

    Sathi Sasidharan, N.; Deshingkar, D.S.; Wattal, P.K.

    2005-11-01

    In water cooled reactors boron is added as boric acid to control nuclear reactor power levels. The boric acid concentration in coolant/moderator water, is controlled by using strongly basic anionic resins in borate (H 2 BO 3 - ) form. The spent anionic resins in borate form contain 131 Iodine, 99 Technitium and 137 Cesium activities. Direct immobilisation of anionic resins in borate form in Ordinary Portland Cement (OPC) and Slag Cement was investigated using vermiculite, bentonite, calcium oxide and silica as admixtures. The cumulative fraction of 137 Cesium leached and 137 Cesium leach rate for slag cement matrix were 0.029 and 0.00064 g.cm 2 .d -1 respectively for 95 days of leaching. The volume reduction factor achieved by direct immobilisation of anionic resins in borate form was 0.48. Immobilisation of pyrolysis residues from these resins in OPC matrix was also studied. Leaching of matrix blocks was carried out for 180 days in DM water to optimise the matrix formulation. The cumulative fraction of 137 Cesium leached and 137 Cesium leach rate were 0.076 and 0.00054 respectively for 180 days leaching. The volume reduction factor achieved by immobilisation of pyrolysis residues was 2.4. OPC is non compatible to cationic resins loaded with alkali in absence of specific admixtures. Hence cationic resins loaded with alkali and anionic resins in borate form can not be immobilised together. (author)

  18. 10 CFR 140.91 - Appendix A-Form of nuclear energy liability policy for facilities.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Appendix A-Form of nuclear energy liability policy for facilities. 140.91 Section 140.91 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) FINANCIAL PROTECTION... other matter not within the Commission's statutory jurisdiction under the Atomic Energy Act. Nuclear...

  19. The Factors of Forming the National HR-Management Model

    Directory of Open Access Journals (Sweden)

    Elena P. Kostenko

    2017-12-01

    Full Text Available There are some factors considered in this article, which influence the forming of national HR-management model. The group-forming criterion is the nature of factors, that determine the system of HR-management as a system of corporate culture values, norms and rules of organizational behavior, ways of realization some important managing functions and dominating approaches to make decisions. This article shows that the plurality of combinations in different factors leads to forming the unique HR-management model. The geoclimatic factor influences the principles of the labor organization (orientation primarily on individual or collective forms of labor, attitude to the management experience of other countries, attitude to resources, etc., the distribution of labor resources, the level of labor mobility, and the psychosocial type of employee. Models of man's labor behavior are constituted In the process of historical development. Attention is focused on the formation of a national HR-model, such as the conducted socio-economic policy, the characteristics of the institutional environment, economic goals and priorities of the country's development, the level of development and the nature of the national productive forces and economic structures. Much attention was paid to the analysis of the historically formed value system and labor traditions, which influence the approaches to HR-management. As far as religion influences the model of person’s inclusion in labor, motives of labor behavior, management culture of a certain employee, preferred payment etc., we examined how the main traditional religions (Christianity, Islam, Judaism, Buddhism, Confucianism, Hinduism influence the HR-management system in different countries.

  20. Form factor of some types of toroidal solenoids

    International Nuclear Information System (INIS)

    Koryavko, V.I.; Litvinenko, Yu.A.

    1979-01-01

    Obtained were the type of dependence between consumed power and formed field for toroidal helical-wound solenoids and the expression for the form factor analogous to the Fabry coefficient for cylindrical solenoids. Determined were optimum dimensions of the helical winding of ''forceless'' toroidal solenoids satisfying the condition of the formation of maximum field at minimum consumed power. Investigations also covered some types of conventional toroidal solenoids. Presented in the paper diagrams permitted to chose dimensions of the considered toroidal solenoids according to their consumed power and winding material volume

  1. Process considerations for hot pressing ceramic nuclear waste forms

    International Nuclear Information System (INIS)

    Wilson, C.N.; Brite, D.W.

    1981-01-01

    Spray calcined simulated ceramic nuclear waste powders were hot pressed in graphite, nickel-lined graphite and ZrO 2 -lined Al 2 O 3 dies. Densification, initial off-gas, waste element retention and pellet-die interactions were evaluated. Indicated process considerations and limitations are discussed. 15 figures

  2. Canonical form of an elastoplastic model of nuclear fusion

    International Nuclear Information System (INIS)

    Mikhajlova, T.I.; Mikhajlov, I.N.; Do Dang, G.

    1997-01-01

    Starting from equations of motion describing the fusion process in symmetrical nuclear systems of low angular momenta we reconstruct the collective Lagrangian and dissipation Rayleigh functions. This opens new perspectives in studying the dynamical effects in the heavy nuclei collisions. In particular, it provides a basis for a quantal description of the fusion process and accompanying its effects

  3. Nuclear information systems: Forming the hub of quality assurance

    International Nuclear Information System (INIS)

    Shepherd, S.H.

    1990-01-01

    Data processing, storage, and transmission technology has advanced sufficiently that nuclear information system networks are developing at many nuclear power plant sites. The networks offer much promise - repetitive tasks can be eliminated, cross checks and reviews can be implemented, and the user can do a more thorough, more professional job. With the arrival of this new power to analyze, plan, communicate, and simplify work comes a duty to properly harness the power. If the power of the information age is misused, or used carelessly, much damage can be done. When it comes to nuclear applications, there are really only three significant features to an information system: quality, reliability, and security. Put simply, the user must trust the accuracy of the system or it cannot be used. A system that is not available for use on demand will not be in demand for long. Fast processors, video graphics, and laser publishing are worthless if one must back up the system with hand calculations and tedious verification of data. An effective nuclear information system has good quality practices interwoven into the hardware and software, so that the system itself can foster and promote better quality assurance

  4. Measurement of weak meson form factors in spacelike regions

    CERN Document Server

    Brene, N

    1973-01-01

    With the construction of high energy, high intensity accelerators (NAL & CERN, SPS) investigation of neutrino scattering on virtual pions, a la Chew-Low, becomes experimentally possible. The process nu +N to mu /sup -/+K+ Delta is analysed to extract the usual K/sub l3/ form factor(s) for spacelike momentum transfer. A model calculation suggests that f/sub +/(T) can be determined reasonably well from a triple differential cross section, whereas only rough information on f /sub -/(T) may be obtained from the transverse polarization of the muon. The experiment proposed requires scanning of several millions of bubble chamber pictures. (14 refs).

  5. Revisiting the pion's scalar form factor in chiral perturbation theory

    CERN Document Server

    Juttner, Andreas

    2012-01-01

    The quark-connected and the quark-disconnected Wick contractions contributing to the pion's scalar form factor are computed in the two and in the three flavour chiral effective theory at next-to-leading order. While the quark-disconnected contribution to the form factor itself turns out to be power-counting suppressed its contribution to the scalar radius is of the same order of magnitude as the one of the quark-connected contribution. This result underlines that neglecting quark-disconnected contributions in simulations of lattice QCD can cause significant systematic effects. The technique used to derive these predictions can be applied to a large class of observables relevant for QCD-phenomenology.

  6. SU(3) breaking in hyperon transition vector form factors

    International Nuclear Information System (INIS)

    Shanahan, P.E.; Thomas, A.W.; Young, R.D.; Zanotti, J.M.; Rakow, P.E.L.

    2015-08-01

    We present a calculation of the SU(3)-breaking corrections to the hyperon transition vector form factors to O(p 4 ) in heavy baryon chiral perturbation theory with finite-range regularisation. Both octet and decuplet degrees of freedom are included. We formulate a chiral expansion at the kinematic point Q 2 =-(M B 1 -M B 2 ) 2 , which can be conveniently accessed in lattice QCD. The two unknown low-energy constants at this point are constrained by lattice QCD simulation results for the Σ - →n and Ξ 0 →Σ + transition form factors. Hence we determine lattice-informed values of f 1 at the physical point. This work constitutes progress towards the precise determination of vertical stroke V us vertical stroke from hyperon semileptonic decays.

  7. Sine-Gordon breather form factors and quantum field equations

    International Nuclear Information System (INIS)

    Babujian, H; Karowski, M

    2002-01-01

    Using the results of previous investigations on sine-Gordon form factors, exact expressions of all breather matrix elements are obtained for several operators: all powers of the fundamental Bose field, general exponentials of it, the energy-momentum tensor and all higher currents. Formulae for the asymptotic behaviour of bosonic form factors are presented which are motivated by Weinberg's power counting theorem in perturbation theory. It is found that the quantum sine-Gordon field equation holds, and an exact relation between the 'bare' mass and the renormalized mass is obtained. Also a quantum version of a classical relation for the trace of the energy-momentum is proved. The eigenvalue problem for all higher conserved charges is solved. All results are compared with perturbative Feynman graph expansions and full agreement is found

  8. Nucleon form factors on the lattice with light dynamical fermions

    International Nuclear Information System (INIS)

    Goeckeler, M.; Haegler, P.; Horsley, R.

    2007-09-01

    The electromagnetic form factors provide important insight into the internal structure of the nucleon and continue to be of major interest for experiment and phenomenology. For an intermediate range of momenta the form factors can be calculated on the lattice. However, the reliability of the results is limited by systematic errors mostly due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet inaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with dynamical N f =2, non-perturbatively O(a)-improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  9. Nucleon form factors on the lattice with light dynamical fermions

    Energy Technology Data Exchange (ETDEWEB)

    Goeckeler, M. [Regensburg Univ. (Germany). Inst. fuer Theoretische Physik; Haegler, P. [Technische Univ. Muenchen, Garching (Germany). Inst. fuer Theoretische Physik T39; Horsley, R. [Edinburgh Univ. (GB). School of Physics] (and others)

    2007-09-15

    The electromagnetic form factors provide important insight into the internal structure of the nucleon and continue to be of major interest for experiment and phenomenology. For an intermediate range of momenta the form factors can be calculated on the lattice. However, the reliability of the results is limited by systematic errors mostly due to the required extrapolation to physical quark masses. Chiral effective field theories predict a rather strong quark mass dependence in a range which was yet inaccessible for lattice simulations. We give an update on recent results from the QCDSF collaboration using gauge configurations with dynamical N{sub f}=2, non-perturbatively O(a)-improved Wilson fermions at pion masses as low as 350 MeV. (orig.)

  10. Quark-flavor mixing and the nucleon strangeness form factors

    International Nuclear Information System (INIS)

    Ito, H.

    1995-01-01

    We have calculated the strangeness form factors of the nucleon G E s (Q), G M s (Q) and G A s (Q) and the electromagnetic form factors G E N (Q) as well, by using a relativistic constituent quark model of the nucleon wave function on the light-cone. Octet of Goldstone bosons (π, K, η) are assumed to induce the SU flavor mixing among the light constituent quarks; d-→K+s →d for example, and this mechanism induces the strangeness content in the nucleon. To calculate the meson-loop corrections to the electroweak couplings of constituent quarks, we have employed two models of the quark-meson vertex; (1) composite model of the Goldstone bosons (2) and (3) chiral quark Lagrangian. The loop momenta are regulated in a gauge-invariant way for both models

  11. Generation of truncated recombinant form of tumor necrosis factor ...

    African Journals Online (AJOL)

    Purpose: To produce truncated recombinant form of tumor necrosis factor receptor 1 (TNFR1), cysteine-rich domain 2 (CRD2) and CRD3 regions of the receptor were generated using pET28a and E. coli/BL21. Methods: DNA coding sequence of CRD2 and CRD3 was cloned into pET28a vector and the corresponding ...

  12. Coverlayer fabrication for small form factor optical disks

    Science.gov (United States)

    Kim, Jong-Hwan; Lee, Seung-Won; Kim, Jin-Hong

    2004-09-01

    Two different coverlayers made of UV resin and coversheet were prepared for small form factor optical disks. Thin coverlayer of 10 mm and thick coverlayer of 80 mm were fabricated for flying optical head and non-flying optical head, respectively. Thickness uniformity was analyzed for both coverlayers, and new designs to diminish a ski-jump phenomenon were suggested. Mechanical properties of protective film made of UV resin were investigated.

  13. Nucleon structure functions, resonance form factors, and duality

    International Nuclear Information System (INIS)

    Davidovsky, V.V.; Struminsky, B.V.

    2003-01-01

    The behavior of nucleon structure functions in the resonance region is explored. For form factors that describe resonance production, expressions are obtained that are dependent on the photon virtuality Q 2 , which have a correct threshold behavior, and which take into account available experimental data on resonance decay. Resonance contributions to nucleon structure functions are calculated. The resulting expressions are used to investigate quark-hadron duality in electron-nucleon scattering by taking the example of the structure function F 2

  14. Stackable Form-Factor Peripheral Component Interconnect Device and Assembly

    Science.gov (United States)

    Somervill, Kevin M. (Inventor); Ng, Tak-kwong (Inventor); Torres-Pomales, Wilfredo (Inventor); Malekpour, Mahyar R. (Inventor)

    2013-01-01

    A stackable form-factor Peripheral Component Interconnect (PCI) device can be configured as a host controller or a master/target for use on a PCI assembly. PCI device may comprise a multiple-input switch coupled to a PCI bus, a multiplexor coupled to the switch, and a reconfigurable device coupled to one of the switch and multiplexor. The PCI device is configured to support functionality from power-up, and either control function or add-in card function.

  15. QCD constraints for the electromagnetic form factor of the pion

    International Nuclear Information System (INIS)

    Machet, B.

    1980-07-01

    Using the modulus representation, we derive constraints for the behaviour of the electromagnetic form factor of the pion in the time like region [1 GeV 2 , + infinity[, from information given by perturbative QCD in the space like region [-μ 2 , - infinity[. A phenomenological μ dependent upper bound for the exponent of the first non leading logarithmic correction is deduced. Restrictions and problems of the method are discussed

  16. Strong CP violation and the neutron electric dipole form factor

    International Nuclear Information System (INIS)

    Kuckei, J.; Dib, C.; Faessler, A.; Gutsche, T.; Kovalenko, S. G.; Lyubovitskij, V. E.; Pumsa-ard, K.

    2007-01-01

    We calculate the neutron electric dipole form factor induced by the CP-violating θ term of QCD within a perturbative chiral quark model which includes pion and kaon clouds. On this basis, we derive the neutron electric dipole moment and the electron-neutron Schiff moment. From the existing experimental upper limits on the neutron electric dipole moment, we extract constraints on the θ parameter and compare our results with other approaches

  17. Massive three-loop form factor in the planar limit

    Energy Technology Data Exchange (ETDEWEB)

    Henn, Johannes [PRISMA Cluster of Excellence, Johannes Gutenberg University,Staudingerweg 9, 55099 Mainz (Germany); Smirnov, Alexander V. [Research Computing Center, Moscow State University,119991 Moscow (Russian Federation); Smirnov, Vladimir A. [Skobeltsyn Institute of Nuclear Physics of Moscow State University,119991 Moscow (Russian Federation); Institut für Theoretische Teilchenphysik, Karlsruhe Institute of Technology (KIT),Wolfgang-Gaede Straße 1, 76128 Karlsruhe (Germany); Steinhauser, Matthias [Institut für Theoretische Teilchenphysik, Karlsruhe Institute of Technology (KIT),Wolfgang-Gaede Straße 1, 76128 Karlsruhe (Germany)

    2017-01-17

    We compute the three-loop QCD corrections to the massive quark-anti-quark-photon form factors F{sub 1} and F{sub 2} in the large-N{sub c} limit. The analytic results are expressed in terms of Goncharov polylogarithms. This allows for a straightforward numerical evaluation. We also derive series expansions, including power suppressed terms, for three kinematic regions corresponding to small and large invariant masses of the photon momentum, and small velocities of the heavy quarks.

  18. Helicity non-conserving form factor of the proton

    Energy Technology Data Exchange (ETDEWEB)

    Voutier, E.; Furget, C.; Knox, S. [Universite Joseph Fourier, Grenoble (France)] [and others

    1994-04-01

    The study of the hadron structure in the high Q{sup 2} range contributes to the understanding of the mechanisms responsible for the confinement of quarks and gluons. Among the numerous experimental candidates sensitive to these mechanisms, the helicity non-conserving form factor of the proton is a privileged observable since it is controlled by non-perturbative effects. The authors investigate here the feasibility of high Q{sup 2} measurements of this form factor by means of the recoil polarization method in the context of the CEBAF 8 GeV facility. For that purpose, they discuss the development of a high energy proton polarimeter, based on the H({rvec p},pp) elastic scattering, to be placed at the focal plane of a new hadron spectrometer. It is shown that this experimental method significantly improves the knowledge of the helicity non-conserving form factor of the proton up to 10 GeV{sup 2}/c{sup 2}.

  19. Meson Transition Form Factors in Light-Front Holographic QCD

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, Stanley J.; /SLAC; Cao, Fu-Guang; /Massey U.; de Teramond, Guy F.; /Costa Rica U.

    2011-06-22

    We study the photon-to-meson transition form factors (TFFs) F{sub M{gamma}}(Q{sup 2}) for {gamma}{gamma}* {yields} M using light-front holographic methods. The Chern-Simons action, which is a natural form in 5-dimensional anti-de Sitter (AdS) space, leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the q{bar q} component of the pion wavefunction, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0} {yields} {gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the q{bar q} component of the pion wavefunction P{sub q{bar q}} = 0.5 is required; thus giving indication that the contributions from higher Fock states in the pion light-front wavefunction need to be included in the analysis. The probability for the Fock state containing four quarks (anti-quarks) which follows from analyzing the hadron matrix elements, P{sub q{bar q}q{bar q}} {approx} 10%, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wavefunction. The results for the TFFs for the {eta} and {eta}{prime} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{prime} TFFs.

  20. Neutron charge radius and the neutron electric form factor

    International Nuclear Information System (INIS)

    Gentile, T. R.; Crawford, C. B.

    2011-01-01

    For nearly forty years, the Galster parametrization has been employed to fit existing data for the neutron electric form factor, G E n , vs the square of the four-momentum transfer, Q 2 . Typically this parametrization is constrained to be consistent with experimental data for the neutron charge radius. However, we find that the Galster form does not have sufficient freedom to accommodate reasonable values of the radius without constraining or compromising the fit. In addition, the G E n data are now at sufficient precision to motivate a two-parameter fit (or three parameters if we include thermal neutron data). Here we present a modified form of a two-dipole parametrization that allows this freedom and fits both G E n (including recent data at both low and high four-momentum transfer) and the charge radius well with simple, well-defined parameters. Analysis reveals that the Galster form is essentially a two-parameter approximation to the two-dipole form but becomes degenerate if we try to extend it naturally to three parameters.

  1. Summary and evaluation of nuclear waste forms. Chapter 12

    International Nuclear Information System (INIS)

    Lutze, W.; Ewing, R.C.

    1988-01-01

    In this chapter data are compiled from the foregoing contributed chapters into tables. In a few cases additional more recent data not found in the chapters have been included in the tables. The following waste form data are summarized: physical properties, chemical durability, radiation effects and the status of processing techniques. In addition important aspects of the comparison of waste forms and the response of waste forms (glass and ceramic) to corrosion and radiation effects are discussed. (author). 119 refs.; 6 figs.; 5 tabs

  2. Nuclear modification factor for J/ψ production in nucleus-nucleus collisions

    International Nuclear Information System (INIS)

    Xu Xiaoming; Zhou Jie

    2011-01-01

    The STAR Collaboration has offered an eminent nuclear modification factor of J/ψ at high p T and midrapidity produced in Cu-Cu collisions at √ s NN= 200 GeV. Recalling a prediction, we can understand that the feature of high-p T nuclear modification factor is related to cc produced by 2 → 1 and 2 → 2 partonic processes in deconfined matter, particularly in the prethermal stage and to the recombination of c and c-bar. The nuclear modification factor at high p T is sensitive to the earliest form of deconfined matter that does not have a temperature.(authors)

  3. Nuclear safety regulation on nuclear safety equipment activities in relation to human and organizational factors

    International Nuclear Information System (INIS)

    Li Tianshu

    2013-01-01

    Based on years of knowledge in nuclear safety supervision and experience of investigating and dealing with violation events in repair welding of DFHM, this paper analyzes major faults in manufacturing and maintaining activities of nuclear safety equipment in relation to human and organizational factors. It could be deducted that human and organizational factors has definitely become key features in the development of nuclear energy and technology. Some feasible measures to reinforce supervision on nuclear safety equipment activities have also been proposed. (author)

  4. Relativistic form factors for clusters with nonrelativistic wave functions

    International Nuclear Information System (INIS)

    Mitra, A.N.; Kumari, I.

    1977-01-01

    Using a simple variant of an argument employed by Licht and Pagnamenta (LP) on the effect of Lorentz contraction on the elastic form factors of clusters with nonrelativistic wave functions, it is shown how their result can be generalized to inelastic form factors so as to produce (i) a symmetrical appearance of Lorentz contraction effects in the initial and final states, and (ii) asymptotic behavior in accord with dimensional scaling theories. A comparison of this result with a closely analogous parametric form obtained by Brodsky and Chertok from a propagator chain model leads, with plausible arguments, to the conclusion of an effective mass M for the cluster, with M 2 varying as the number n of the quark constituents, instead of as n 2 . A further generalization of the LP formula is obtained for an arbitrary duality-diagram vertex, again with asymptotic behavior in conformity with dimensional scaling. The practical usefulness of this approach is emphasized as a complementary tool to those of high-energy physics for phenomenological fits to data up to moderate values of q 2

  5. Human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Bohr, E.; Hennig, J.; Preuss, W.; Thau, G.

    1977-01-01

    This report describes the results of a study on the functions of operating and maintenance personnel in nuclear power plants. Since an effective power plant design must take into systematic account the possibilities and limitations of the human element, the basic aim of the study was to identify what the human operators are required to do and how they achieve it. Information was acquired by direct observation and by interviews as well as by evaluation of written documents (e.g. incident reports, procedures manuals, work regulations) and of working conditions (e.g. equipment and workplace design). A literature search and evaluation carried out within the scope of this study has been published as a separate document. The main part of the report is devoted to discussions and conclusions on selected areas of potential improvements. The topics include control room design, factors of the physical environment including radiation, problems of maintainability, design of written documents, problems in communicating information, design and control of tasks, placement and training. A separate section deals with problems of recording human errors. (orig.) [de

  6. Forms and factors of peer violence and victimisation

    Directory of Open Access Journals (Sweden)

    Dinić Bojana

    2014-01-01

    Full Text Available The main aim of this study was to explore the latent structure of violence and victimisation based on the factor analysis of the Peer Violence and Victimisation Questionnaire (PVVQ, as well as to examine the correlates of violence and victimisation. The sample included 649 secondary school students (61.8% male from the urban area. Besides the PVVQ, the Aggressiveness questionnaire AVDH was administered. Based on parallel analysis, three factors were extracted in the violence domain, as well as in the victimisation domain of the PVVQ. The factors were interpreted as a physical, verbal and relational form of violence and victimisation, which is in line with common classifications. The correlations of those forms with the aggressiveness dimensions were positive. The relationships with gender, school grade and school achievement referred to the importance of interaction effects between the mentioned characteristics of students and the tendency towards violence or being exposed to it. The main result is that boys from lower school grades and students with lower school achievement in general, are more prone to manifesting physical violence and more often are the target of physical violence. These groups of students are the target groups for preventive programs. The resulting effects indicated the complexity of the violence phenomenon and pointed to the need to consider the wider context of student’s characteristics in the determination of violence. [Projekat Ministarstva nauke Republike Srbije, br. 179037 i br. 179053

  7. Dispersive analysis of the scalar form factor of the nucleon

    Science.gov (United States)

    Hoferichter, M.; Ditsche, C.; Kubis, B.; Meißner, U.-G.

    2012-06-01

    Based on the recently proposed Roy-Steiner equations for pion-nucleon ( πN) scattering [1], we derive a system of coupled integral equations for the π π to overline N N and overline K K to overline N N S-waves. These equations take the form of a two-channel Muskhelishvili-Omnès problem, whose solution in the presence of a finite matching point is discussed. We use these results to update the dispersive analysis of the scalar form factor of the nucleon fully including overline K K intermediate states. In particular, we determine the correction {Δ_{σ }} = σ ( {2M_{π }^2} ) - {σ_{{π N}}} , which is needed for the extraction of the pion-nucleon σ term from πN scattering, as a function of pion-nucleon subthreshold parameters and the πN coupling constant.

  8. Baryon octet electromagnetic form factors in a confining NJL model

    Directory of Open Access Journals (Sweden)

    Manuel E. Carrillo-Serrano

    2016-08-01

    Full Text Available Electromagnetic form factors of the baryon octet are studied using a Nambu–Jona-Lasinio model which utilizes the proper-time regularization scheme to simulate aspects of colour confinement. In addition, the model also incorporates corrections to the dressed quarks from vector meson correlations in the t-channel and the pion cloud. Comparison with recent chiral extrapolations of lattice QCD results shows a remarkable level of consistency. For the charge radii we find the surprising result that rEp

  9. CEBAF at higher energies and the kaon electromagnetic form factor

    Energy Technology Data Exchange (ETDEWEB)

    Baker, O.K.

    1994-04-01

    The electromagnetic production of strangeness, the physics of exciting systems having strangeness degrees of freedom (production of hadrons with one or more strange constituent quarks) using electromagnetic probes (real or virtual photons), is one of the frontier areas of research which will be investigated at the Continuous Electron Beam Accelerator Facility (CEBAF) when it becomes operational. CEBAF is expected to have an important impact upon this field of research using its specialized set of detection instruments and high quality electron beam. This paper focusses upon one aspect of the associated production of strangeness - the determination of the kaon electromagnetic form factor at high squared momentum transfers.

  10. Nucleon electromagnetic form factors in twisted mass lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Jansen, K.; Korzec, T.; Humboldt Univ. Berlin

    2011-02-01

    We present results on the nucleon electromagnetic form factors within lattice QCD using two flavors of degenerate twisted mass fermions. Volume effects are examined using simulations at two volumes of spatial length L=2.1 fm and L=2.8 fm. Cut-off effects are investigated using three different values of the lattice spacings, namely a=0.089 fm, a=0.070 fm and a=0.056 fm. The nucleon magnetic moment, Dirac and Pauli radii are obtained in the continuum limit and chirally extrapolated to the physical pion mass allowing for a comparison with experiment. (orig.)

  11. Nucleon electromagnetic form factors in twisted mass lattice QCD

    International Nuclear Information System (INIS)

    Alexandrou, C.; Brinet, M.; Carbonell, J.; Harraud, P. A.; Papinutto, M.; Guichon, P.; Jansen, K.; Korzec, T.; Constantinou, M.

    2011-01-01

    We present results on the nucleon electromagnetic form factors within lattice QCD using two flavors of degenerate twisted mass fermions. Volume effects are examined using simulations at two volumes of spatial length L=2.1 fm and L=2.8 fm. Cutoff effects are investigated using three different values of the lattice spacings, namely a=0.089 fm, a=0.070 fm and a=0.056 fm. The nucleon magnetic moment, Dirac and Pauli radii are obtained in the continuum limit and chirally extrapolated to the physical pion mass allowing for a comparison with experiment.

  12. Nucleon form factors with NF=2 twisted mass fermions

    International Nuclear Information System (INIS)

    Alexandrou, C.; Korzec, T.; Brinet, M.; Carbonell, J.; Harraud, P.A.; Jansen, K.

    2009-10-01

    We present results on the electromagnetic and axial nucleon form factors using two degenerate flavors of twisted mass fermions on lattices of spatial size 2.1 fm and 2.7 fm and a lattice spacing of about 0.09 fm. We consider pion masses in the range of 260-470MeV.We chirally extrapolate results on the nucleon axial charge, the isovector Dirac and Pauli root mean squared radii and magnetic moment to the physical point and compare to experiment. (orig.)

  13. Disposability Assessment: Aluminum-Based Spent Nuclear Fuel Forms

    Energy Technology Data Exchange (ETDEWEB)

    Vinson, D.W.

    1998-11-06

    This report provides a technical assessment of the Melt-Dilute and Direct Al-SNF forms in disposable canisters with respect to meeting the requirements for disposal in the Mined Geologic Disposal System (MGDS) and for interim dry storage in the Treatment and Storage Facility (TSF) at SRS.

  14. Factors in public perception of nuclear energy

    International Nuclear Information System (INIS)

    Hore-Lacy, I.

    1999-01-01

    Public communication about nuclear energy needs to relate to the cultural undercurrents which determine how people perceive the environment. The paper discusses some of these and suggests ways of responding to them. It also outlines major ethical considerations relevant to uranium mining and nuclear energy and communication about both and shows that competent discourse about values is fundamental

  15. Public opinion factors regarding nuclear power

    International Nuclear Information System (INIS)

    Benson, B.

    1991-01-01

    This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible

  16. Public opinion factors regarding nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Benson, B.

    1991-12-31

    This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry`s practices are aligned with public opinion, a more favorable regulatory climate is possible.

  17. Public opinion factors regarding nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Benson, B.

    1991-01-01

    This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible.

  18. In-Medium K^+ Electromagnetic Form Factor with a Symmetric Vertex in a Light Front Approach

    Science.gov (United States)

    Yabusaki, George H. S.; de Melo, J. P. B. C.; de Paula, Wayne; Tsushima, K.; Frederico, T.

    2018-05-01

    Using the light-front K^ +-Meson wave function based on a Bethe-Salpeter amplitude model for the Quark-Antiquark bound state, we study the Electromagnetic Form Factor (EMFF) of the K^ +-Meson in nuclear medium within the framework of light-front field theory. The K^ +-Meson model we adopt is well constrained by previous and recent studies to explain its properties in vacuum. The in-medium K^ +-Meson EMFF is evaluated for the plus-component of the electromagnetic current, J^+, in the Breit frame. In order to consistently incorporate the constituent up and antistrange Quarks of the K^ +-Meson immersed in symmetric nuclear matter, we use the Quark-Meson coupling model, which has been widely applied to various hadronic and nuclear phenomena in a nuclear medium with success. We predict the in-medium modification of the K^ +-Meson EMFF in symmetric nuclear matter. It is found that, after a fine tuning of the regulator mass, i.e. m_R = 0.600 GeV, the model is suitable to fit the available experimental data in vacuum within the theoretical uncertainties, and based on this we predict the in-medium modification of the K^ +-Meson EMFF.

  19. The pion form factor within the hidden local symmetry model

    International Nuclear Information System (INIS)

    Benayoun, M.; David, P.; DelBuono, L.; Leruste, P.; O'Connell, H.B.

    2003-01-01

    We analyze a pion form factor formulation which fulfills the Analyticity requirement within the Hidden Local Symmetry (HLS) Model. This implies an s-dependent dressing of the ρ-γ VMD coupling and an account of several coupled channels. The corresponding function F π (s) provides nice fits of the pion form factor data from s=-0.25 to s=1 GeV 2 . It is shown that the coupling to KK has little effect, while ωπ 0 improves significantly the fit probability below the φ mass. No need for additional states like ρ(1450) shows up in this invariant-mass range. All parameters, except for the subtraction polynomial coefficients, are fixed from the rest of the HLS phenomenology. The fits show consistency with the expected behaviour of F π (s) at s=0 up to O(s 2 ) and with the phase shift data on δ 1 1 (s) from threshold to somewhat above the φ mass. The ω sector is also examined in relation with recent data from CMD-2. (orig.)

  20. Analytical and unitary approach in mesons electromagnetic form factor applications

    International Nuclear Information System (INIS)

    Liptaj, A.

    2010-07-01

    In the dissertation thesis we address several topics related to the domain of particle physics. All of them represent interesting open problems that can be connected to the elastic or transition electromagnetic form factors of mesons, the form factors being the main objects of our interest. Our ambition is to contribute to the solution of these problems and use for that purpose known analytic properties of the form factors and the unitarity condition. These two tools are very powerful in the low energy domain (such as bound states of partons), where the perturbative QCD looses its validity. This is the motivation for construction of the unitary and analytic (U and A) models of studied form factors, that enable us to get the majority of our results. We use the U and A model to evaluate the contribution of the processes e"+e"- → Pγ, P = π"0, η, η to the muon magnetic anomaly a_μ in the lowest order of the hadronic vacuum polarization. For the contribution a_μ"h"a"d","L"O (π"+π"-) we demonstrate, that the use of the model leads to a dramatic error reduction with respect to the results of other authors. We also get a shift in the central value in the 'correct' direction, that brings the theoretical value closer to the experimental one. This results encourages us to use the model also for the evaluation of a_μ"h"a"d","L"O (P_γ). These contributions are smaller, however the precision of the experiment makes their evaluation necessary. We further use the U and A model of the transition form factors of π"0, η and η"' mesons to predict the partial decay widths of these particles Γ_π_"0_→_γ_γ and Γ_η_→_γ_γ and Γ_η_"'_→_γ_γ. In this way we make an independent cross check of the PDG table values. We find an agreement in the case of Γ_η_→_γ_γ and Γ_η_"'_→_γ_γ, even a smaller uncertainty for Γ_η_"'_→_γ_γ. In the case of Γ_π_"0_→_γ_γ we find a disagreement that points to an interesting problem. We wonder whether it could be

  1. Measurement of the $\\Lambda_{b}^{0}$ Decay Form Factor

    CERN Document Server

    Abdallah, J; Adam, W; Adzic, P; Albrecht, T; Alderweireld, T; Alemany-Fernandez, R; Allmendinger, T; Allport, P P; Amaldi, Ugo; Amapane, N; Amato, S; Anashkin, E; Andreazza, A; Andringa, S; Anjos, N; Antilogus, P; Apel, W D; Arnoud, Y; Ask, S; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Ballestrero, A; Bambade, P; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Behrmann, A; Ben-Haim, E; Benekos, N C; Benvenuti, Alberto C; Bérat, C; Berggren, M; Berntzon, L; Bertrand, D; Besançon, M; Besson, N; Bloch, D; Blom, M; Bluj, M; Bonesini, M; Boonekamp, M; Booth, P S L; Borisov, G; Botner, O; Bouquet, B; Bowcock, T J V; Boyko, I; Bracko, M; Brenner, R; Brodet, E; Brückman, P; Brunet, J M; Bugge, L; Buschmann, P; Calvi, M; Camporesi, T; Canale, V; Carena, F; Castro, N; Cavallo, F R; Chapkin, M M; Charpentier, P; Checchia, P; Chierici, R; Shlyapnikov, P; Chudoba, J; Chung, S U; Cieslik, K; Collins, P; Contri, R; Cosme, G; Cossutti, F; Costa, M J; Crawley, B; Crennell, D J; Cuevas-Maestro, J; D'Hondt, J; Dalmau, J; Da Silva, T; Da Silva, W; Della Ricca, G; De Angelis, A; de Boer, Wim; De Clercq, C; De Lotto, B; De Maria, N; De Min, A; De Paula, L S; Di Ciaccio, Lucia; Di Simone, A; Doroba, K; Drees, J; Dris, M; Eigen, G; Ekelöf, T J C; Ellert, M; Elsing, M; Espirito-Santo, M C; Fanourakis, G K; Fassouliotis, D; Feindt, M; Fernández, J; Ferrer, A; Ferro, F; Flagmeyer, U; Föth, H; Fokitis, E; Fulda-Quenzer, F; Fuster, J A; Gandelman, M; García, C; Gavillet, P; Gazis, E N; Gokieli, R; Golob, B; Gómez-Ceballos, G; Gonçalves, P; Graziani, E; Grosdidier, G; Grzelak, K; Guy, J; Haag, C; Hallgren, A; Hamacher, K; Hamilton, K; Haug, S; Hauler, F; Hedberg, V; Hennecke, M; Herr, H; Hoffman, J; Holmgren, S O; Holt, P J; Houlden, M A; Hultqvist, K; Jackson, J N; Jarlskog, G; Jarry, P; Jeans, D; Johansson, E K; Johansson, P D; Jonsson, P; Joram, C; Jungermann, L; Kapusta, F; Katsanevas, S; Katsoufis, E C; Kernel, G; Kersevan, Borut P; Kerzel, U; Kiiskinen, A P; King, B T; Kjaer, N J; Kluit, P; Kokkinias, P; Kourkoumelis, C; Kuznetsov, O; Krumshtein, Z; Kucharczyk, M; Lamsa, J; Leder, G; Ledroit, F; Leinonen, L; Leitner, R; Lemonne, J; Lepeltier, V; Lesiak, T; Liebig, W; Liko, D; Lipniacka, A; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J; Malek, A; Maltezos, S; Mandl, F; Marco, J; Marco, R; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Masik, J; Mastroyiannopoulos, N; Matorras, F; Matteuzzi, C; Mazzucato, F; Mazzucato, M; McNulty, R; Meroni, C; Meyer, W T; Myagkov, A; Migliore, E; Mitaroff, W A; Mjörnmark, U; Moa, T; Moch, M; Mönig, K; Monge, R; Montenegro, J; Moraes, D; Moreno, S; Morettini, P; Müller, U; Münich, K; Mulders, M; Mundim, L M; Murray, W; Muryn, B; Myatt, Gerald; Myklebust, T; Nassiakou, M; Navarria, Francesco Luigi; Nawrocki, K; Nicolaidou, R; Nikolenko, M; Oblakowska-Mucha, A; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Österberg, K; Ouraou, A; Oyanguren, A; Paganoni, M; Paiano, S; Palacios, J P; Palka, H; Papadopoulou, T D; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Passon, O; Peralta, L; Perepelitsa, V F; Perrotta, A; Petrolini, A; Piedra, J; Pieri, L; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Poireau, V; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Pukhaeva, N; Pullia, Antonio; Rames, J; Ramler, L; Read, A; Rebecchi, P; Rehn, J; Reid, D; Reinhardt, R; Renton, P B; Richard, F; Rídky, J; Rivero, M; Rodríguez, D; Romero, A; Ronchese, P; Rosenberg, E I; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ryabtchikov, D; Sadovskii, A; Salmi, L; Salt, J; Savoy-Navarro, A; Schwickerath, U; Segar, A; Sekulin, R L; Siebel, M; Sissakian, A N; Smadja, G; Smirnova, O G; Sokolov, A; Sopczak, A; Sosnowski, R; Spassoff, Tz; Stanitzki, M; Stocchi, A; Strauss, J; Stugu, B; Szczekowski, M; Szeptycka, M; Szumlak, T; Tabarelli de Fatis, T; Taffard, A C; Tegenfeldt, F; Timmermans, J; Tkatchev, L G; Tobin, M; Todorovova, S; Tomé, B; Tonazzo, A; Tortosa, P; Travnicek, P; Treille, D; Tristram, G; Trochimczuk, M; Troncon, C; Turluer, M L; Tyapkin, I A; Tyapkin, P; Tzamarias, S; Uvarov, V; Valenti, G; van Dam, P; Van Eldik, J; Van Lysebetten, A; Van Remortel, N; Van Vulpen, I B; Vegni, G; Veloso, F; Venus, W A; Verdier, P; Verzi, V; Vilanova, D; Vitale, L; Vrba, V; Wahlen, H; Washbrook, A J; Weiser, C; Wicke, D; Wickens, J H; Wilkinson, G; Winter, M; Witek, M; Yushchenko, O P; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zhuravlov, V; Zimin, N I; Zinchenko, A I; Zupan, M

    2004-01-01

    The form factor of Lambda_b^0 baryons is estimated using 3.46 10^6 hadronic Z decays collected by the DELPHI experiment between 1992 and 1995. Charmed Lambda_c^+ baryons fully reconstructed in the pK-pi+, pK0_S, and Lambda pi+pi+pi- modes, are associated to a lepton with opposite charge in order to select Lambda_b^0 -> Lambda_c^+ l^- anti-nu_l decays. From a combined likelihood and event rate fit to the distribution of the Isgur-Wise variable w, and using the Heavy Quark Effective Theory (HQET), the slope of the b-baryon form factor is measured to be: rho-hat^2 = 2.03 +/- 0.46 (stat) ^{+0.72}_{-1.00} (syst). The exclusive semileptonic branching fraction Br(Lambda_b^0 -> Lambda_c^+ l^- anti-nu_l) can be derived from rho-hat^2 and is found to be (5.0^{+1.1}_{-0.8} (stat) ^{+1.6}_{-1.2} (syst))%. Limits on other branching fractions are also obtained.

  2. Small form factor optical fiber connector evaluation for harsh environments

    Science.gov (United States)

    Ott, Melanie N.; Thomes, W. Joe, Jr.; Chuska, Richard F.; Switzer, Robert; Blair, Diana E.

    2011-09-01

    For the past decade NASA programs have utilized the Diamond AVIM connector for optical fiber assemblies on space flight instrumentation. These connectors have been used in communications, sensing and LIDAR systems where repeatability and high performance are required. Recently Diamond has released a smaller form factor optical fiber connector called the "Mini-AVIM" which although more compact still includes the tight tolerances and the ratcheting feature of the heritage AVIM. NASA Goddard Space Flight Center Photonics Group in the Parts, Packaging and Assembly Technologies Office has been performing evaluations of this connector to determine how it compares to the performance of the AVIM connector and to assess its feasibility for harsh environmental applications. Vibration and thermal testing were performed on the Mini-AVIM with both multi-mode and single-mode optical fiber using insitu optical transmission monitoring. Random vibration testing was performed using typical launch condition profiles for most NASA missions but extended to 35 Grms, which is much higher than most requirements. Thermal testing was performed incrementally up to a range of -55°C to +125°C. The test results include both unjacketed fiber and cabled assembly evaluations. The data presented here indicate that the Mini-AVIM provides a viable option for small form factor applications that require a high performance optical fiber connector.

  3. Fundamental Science-Based Simulation of Nuclear Waste Forms

    Energy Technology Data Exchange (ETDEWEB)

    Devanathan, Ramaswami; Gao, Fei; Sun, Xin; Khaleel, Mohammad A.

    2010-10-04

    This report presents a hierarchical multiscale modeling scheme based on two-way information exchange. To account for all essential phenomena in waste forms over geological time scales, the models have to span length scales from nanometer to kilometer and time scales from picoseconds to millenia. A single model cannot cover this wide range and a multi-scale approach that integrates a number of different at-scale models is called for. The approach outlined here involves integration of quantum mechanical calculations, classical molecular dynamics simulations, kinetic Monte Carlo and phase field methods at the mesoscale, and continuum models. The ultimate aim is to provide science-based input in the form of constitutive equations to integrated codes. The atomistic component of this scheme is demonstrated in the promising waste form xenotime. Density functional theory calculations have yielded valuable information about defect formation energies. This data can be used to develop interatomic potentials for molecular dynamics simulations of radiation damage. Potentials developed in the present work show a good match for the equilibrium lattice constants, elastic constants and thermal expansion of xenotime. In novel waste forms, such as xenotime, a considerable amount of data needed to validate the models is not available. Integration of multiscale modeling with experimental work is essential to generate missing data needed to validate the modeling scheme and the individual models. Density functional theory can also be used to fill knowledge gaps. Key challenges lie in the areas of uncertainty quantification, verification and validation, which must be performed at each level of the multiscale model and across scales. The approach used to exchange information between different levels must also be rigorously validated. The outlook for multiscale modeling of wasteforms is quite promising.

  4. Hadron spectroscopy and form factors at quark level

    International Nuclear Information System (INIS)

    Chakrabarty, S.; Gupta, K.K.; Singh, N.N.; Mitra, A.N.

    1988-01-01

    The theoretical status of hadrons as quark composites is examined from the point of view of a simultaneous understanding of their on-shell (mass spectra) and off-shell (form factors, transition amplitudes) properties. Greater stress is laid on light quark systems which are more sensitive to the confinement regime, and more prone to relativistic effects than on heavy quarkonia (on which many reviews exist). Two broad theoretical approaches obeying Lorentz and gauge invariance are identified: (i) QCD sum rules as a means of extrapolation from high to low energies; and (ii) dynamical equations for providing a microcausal link in the opposite direction (from low to high energies). The latter represents the major focus of attention in this article, with the Bethe-Salpeter Equation (BSE) providing a formal plank for a comparative assessment of several models. The Null-plane ansatz which facilitates the reduction of the 4-D BSE to a covariant 3-D form also provides the language for its comparison with other covariant 3-D equations. In particular, attention is drawn to the interesting possibility of reconstructing the 4-D BS wave function from its 3-D form (in a two-tier fashion) as a practical tool for generating higher Fock-space components (qq effects) in the BS wave function, and (more interestingly) for a clean separation between soft and hard QCD effects. To illustrate one such practical tool for an integrated view of different hadronic sectors within a single framework, the results of a two-tier BS model are presented in respect of qq-bar, qqq, gg, ggg, gqq-bar states and compared with experiment as well as with the results of other contemporary models. The N.R Resonating Group Method, which becomes necessary for bigger (six-quark) systems is briefly discussed from the point of view of its compatibility with a relativistic form of quark dynamics motivated from the BSC. (Author)

  5. Ergonomics in nuclear and human factors engineering

    International Nuclear Information System (INIS)

    Muench, E.; Schultheiss, G.F.

    1988-01-01

    The work situation including man-machine-relationships in nuclear power plants is described. The overview gives only a compact summary of some important ergonomic parameters, i.e. human body dimension, human load, human characteristics and human knowledge. (DG)

  6. Scaling of nuclear modification factors for hadrons and light nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, C.S. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); University of Chinese Academy of Sciences, Beijing (China); Ma, Y.G. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China); ShanghaiTech University, Shanghai (China); Zhang, S. [Chinese Academy of Sciences, Shanghai Institute of Applied Physics, Shanghai (China)

    2016-12-15

    The number of constituent quarks (NCQ) scaling for hadrons and the number of constituent nucleons (NCN) scaling for light nuclei are proposed for nuclear modification factors (R{sub cp}) of hadrons and light nuclei, respectively, according to the experimental investigations in relativistic heavy-ion collisions. Based on the coalescence mechanism the scalings are performed for pions and protons at the quark level, and for light nuclei d(anti d) and {sup 3}He at the nucleonic level, respectively, formed in Au+Au and Pb+Pb collisions, and a nice scaling behaviour emerges. The NCQ or NCN scaling law of R{sub cp} can be, respectively, taken as a probe for the quark or nucleon coalescence mechanism for the formation of hadron or light nuclei in relativistic heavy-ion collisions. (orig.)

  7. Pion form factor in QCD at intermediate momentum transfers

    Science.gov (United States)

    Braun, V. M.; Khodjamirian, A.; Maul, M.

    2000-04-01

    We present a quantitative analysis of the electromagnetic pion form factor in the light-cone sum rule approach, including radiative corrections and higher-twist effects. The comparison to the existing data favors the asymptotic profile of the pion distribution amplitude and allows us to estimate the deviation: [∫du/uφπ(u)]/[∫du/uφasπ(u)]=1.1+/-0.1 at the scale of 1 GeV. Special attention is paid to the precise definition and interplay of soft and hard contributions at intermediate momentum transfer, and to the matching of the sum rule to the perturbative QCD prediction. We observe a strong numerical cancellation between the soft (end-point) contribution and power-suppressed hard contributions of higher twist, so that the total nonperturbative correction to the usual PQCD result turns out to be of the order of 30% for Q2~1 GeV2.

  8. Five-meson VDM fits to the nucleon form factors

    International Nuclear Information System (INIS)

    Mehrotra, S.; Roos, M.

    1975-01-01

    Nucleon electromagnetic form factor data in the spacelike and the timelike regions are fitted with a VDM sum of (up to five) isovector and isoscalar pole terms. Finite width effects are included in the rho and the rhosup(,) terms. The effects of including the rhosup(,) and the psi(3105) are studied. Good fits are found only when the rhosup(,) is allowed to have a too low mass (1.2-1.4 GeV) and when in addition some of the couplings or other derived quantities disagree with other estimates. It is concluded that VDM is unable to describe the data unless one introduces a number of yet unknown mesons, such as ωsup(,), phisup(,), rhosup(,)(1.2), etc. (author)

  9. Form factors and related quantities in clothed-particle representation

    Directory of Open Access Journals (Sweden)

    Shebeko Alexander

    2017-01-01

    Full Text Available We show new applications of the notion of clothed particles in quantum field theory. Its realization by means of the clothing procedure put forward by Greenberg and Schweber allows one to express the total Hamiltonian H and other generators of the Poincaré group for a given system of interacting fields through the creation (annihilation operators for the so-called clothed particles with physical (observed properties. Here such a clothed particle representation is used to calculate the matrix elements (shortly, form factors of the corresponding Nöther current operators sandwiched between the H eigenstates. Our calculations are performed with help of an iterative technique suggested by us earlier when constructing the NN → πNN transition operators. As an illustration, we outline some application of our approach in the spinor quantum electrodynamics.

  10. Finite-lattice form factors in free-fermion models

    International Nuclear Information System (INIS)

    Iorgov, N; Lisovyy, O

    2011-01-01

    We consider the general Z 2 -symmetric free-fermion model on the finite periodic lattice, which includes as special cases the Ising model on the square and triangular lattices and the Z n -symmetric BBS τ (2) -model with n = 2. Translating Kaufman's fermionic approach to diagonalization of Ising-like transfer matrices into the language of Grassmann integrals, we determine the transfer matrix eigenvectors and observe that they coincide with the eigenvectors of a square lattice Ising transfer matrix. This allows us to find exact finite-lattice form factors of spin operators for the statistical model and the associated finite-length quantum chains, of which the most general is equivalent to the XY chain in a transverse field

  11. Electric form factor of the proton through recoil polarization

    International Nuclear Information System (INIS)

    Punjabi, V.

    2000-01-01

    The electromagnetic form factors of the nucleon, G E and G M , describe the charge and current distribution inside the nucleon and thus are quite intimately related to its structure. Jefferson Lab experiment 93-027 measured P l and Pt, the longitudinal and transverse recoil proton polarization, respectively, for the 1 H(e-vector,e'p-vector) reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV 2 , using the Hall A facility with two high resolution spectrometers and a Focal Plane Polarimeter. The ratio G Ep /G Mp is directly proportional to the ratio P t /P l . These data have unprecedented precision, and show for the first time that the Q 2 dependence of G Ep and G Mp is very different. (author)

  12. Meson Form Factors and Deep Exclusive Meson Production Experiments

    Energy Technology Data Exchange (ETDEWEB)

    Horn, Tanja [The Catholic Univ. of America, Washington, DC (United States); Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2017-05-01

    Pion and kaon electroproduction data play a unique role in Nature and our understanding of them is essential for explaining hadron structure. Precision longitudinaltransverse separated pion and kaon cross sections are of particular interest. They allow for the extraction of meson form factors and validation of understanding of hard exclusive and semi-inclusive reactions (π+, K+, π0, γ) towards 3D hadron imaging and potential future flavor decomposition. We review recent data and present prospects for deep exclusive pion and kaon electroproduction at the 12 GeV Jefferson Lab including the prospects to use projected charged- and neutral pion data to further determine the spin, charge-parity and flavor of GPDs, including the helicity-flip GPDs.

  13. Conformal anomaly of generalized form factors and finite loop integrals

    CERN Document Server

    Chicherin, Dmitry

    2017-01-01

    We reveal a new mechanism of conformal symmetry breaking at Born level. It occurs in generalized form factors with several local operators and an on-shell state of massless particles. The effect is due to hidden singularities on collinear configurations of the momenta. This conformal anomaly is different from the holomorphic anomaly of amplitudes. We present a number of examples in four and six dimensions. We find an application of the new conformal anomaly to finite loop momentum integrals with one or more massless legs. The collinear region around a massless leg creates a contact anomaly, made visible by the loop integration. The anomalous conformal Ward identity for an $\\ell-$loop integral is a 2nd-order differential equation whose right-hand side is an $(\\ell-1)-$loop integral. We show several examples, in particular the four-dimensional scalar double box.

  14. Current correlators and form factors in the resonance region

    Energy Technology Data Exchange (ETDEWEB)

    Rosell, I. [Departamento de Ciencias Fisicas, Matematicas y de la Computacion, Universidad CEU Cardenal Herrera, c/Sant Bartomeu 55, E-46115 Alfara del Patriarca, Valencia (Spain); IFIC, Universitat de Valencia - CSIC, Apt. Correus 22085, E-46071 Valencia (Spain)

    2009-01-15

    Within Resonance Chiral Theory and in the context of QCD current correlators at next-to-leading order in 1/N{sub C}, we have analyzed the two-body form factors which include resonances as a final state. The short-distance constraints have been studied. One of the main motivations is the estimation of the chiral low-energy constants at subleading order, that is, keeping full control of the renormalization scale dependence. As an application we show the resonance estimation of some coupling, L{sub 10}{sup r}({mu}{sub 0})=(-4.4{+-}0.9).10{sup -3} and C{sub 87}{sup r}({mu}{sub 0})=(3.1{+-}1.1).10{sup -5}.

  15. Disconnected-Sea Quarks Contribution to Nucleon Electromagnetic Form Factors

    Science.gov (United States)

    Sufian, Raza Sabbir

    We present comprehensive analysis of the light and strange disconnected-sea quarks contribution to the nucleon electric and magnetic form factors. The lattice QCD estimates of strange quark magnetic moment GsM (0) = -0.064(14)(09) microN and the mean squared charge radius E = -0.0043(16)(14) fm2 are more precise than any existing experimental measurements and other lattice calculations. The lattice QCD calculation includes ensembles across several lattice volumes and lattice spacings with one of the ensembles at the physical pion mass. We have performed a simultaneous chiral, infinite volume, and continuum extrapolation in a global fit to calculate results in the continuum limit. We find that the combined light-sea and strange quarks contribution to the nucleon magnetic moment is -0.022(11)(09) microN and to the nucleon mean square charge radius is -0.019(05)(05) fm 2. The most important outcome of this lattice QCD calculation is that while the combined light-sea and strange quarks contribution to the nucleon magnetic moment is small at about 1%, a negative 2.5(9)% contribution to the proton charge radius and a relatively larger positive 16.3(6.1)% contribution to the neutron charge radius come from the sea quarks in the nucleon. For the first time, by performing global fits, we also give predictions of the light-sea and strange quarks contributions to the nucleon electric and magnetic form factors at the physical point and in the continuum and infinite volume limits in the momentum transfer range of 0 ≤ Q2 ≤ 0.5 GeV2.

  16. Human factor as nuclear safety element

    International Nuclear Information System (INIS)

    Valeca, S.C.; Preda, M.; Valeca, M.; Ana, E. M.; Popescu, D.

    2008-01-01

    National nuclear power system is based on western technology, it covers almost 20% from national need and could be briefly described by: - Safety and economic performances of Cernavoda NPP Unit 1; - Reduced influence on environment, population and workers; - Excellent ranking (place 4) among CANDU units from all over the world. Also, the national nuclear power system plays a major role in Romanian power policy accomplishment: - Energy safety and independence assurance; - Decrease of production of greenhouse effect gases; - Preserve the stability and adequacy of energy cost. 'Nuclear Safety' concept covers all the activities resulting from nuclear fuel cycle. By taking into account the international experience, the related activities are estimated to last around 70 years in Romania: - 10 years for site description and selection, design, manufacturing and commissioning activities; - 40 years for Nuclear Power Plant operation, maintenance and modernization activities; - 20 years for preservation and decommissioning activities. The above mentioned activities requires human resources, qualified and specialized in the following areas: - research and development; - equipment design, manufacturing and operation; - components construction and assembly, operation and maintenance. (authors)

  17. The d(e, e'p)n reaction and the nuetron electric form factor

    International Nuclear Information System (INIS)

    Dieperink, A.E.L.

    1978-01-01

    An accurate determination of the electric form factor of the neutron, Gsub(En), is important both for our understanding of the structure of the nucleons, and for the description of electron scattering on nuclear many-body systems. At present only reliable model-independent information on Gsub(En) is available for four-momentum transfer (qsub(μ)) 2 →0 from the scattering of thermal neutrons off atoms. Electron scattering offers the possibility to obtain information at higher (qsub(μ)) 2 . However, since electrons can only be scattered off neutrons embedded in a many-body target the extraction of Gsub(En) will in general be affected by nuclear structure uncertainties. Some methods to obtain information on Gsub(En) in e-d experiments are discussed. (Auth.)

  18. Leaching behavior of glass ceramic nuclear waste forms

    International Nuclear Information System (INIS)

    Lokken, R.O.

    1981-11-01

    Glass ceramic waste forms have been investigated as alternatives to borosilicate glasses for the immobilization of high-level radioactive waste at Pacific Northwest Laboratory (PNL). Three glass ceramic systems were investigated, including basalt, celsian, and fresnoite, each containing 20 wt % simulated high-level waste calcine. Static leach tests were performed on seven glass ceramic materials and one parent glass (before recrystallization). Samples were leached at 90 0 C for 3 to 28 days in deionized water and silicate water. The results, expressed in normalized elemental mass loss, (g/m 2 ), show comparable releases from celsian and fresnoite glass ceramics. Basalt glass ceramics demonstrated the lowest normalized elemental losses with a nominal release less than 2 g/m 2 when leached in polypropylene containers. The releases from basalt glass ceramics when leached in silicate water were nearly identical with those in deionized water. The overall leachability of celsian and fresnoite glass ceramics was improved when silicate water was used as the leachant

  19. Direct Measurement of Surface Dissolution Rates in Potential Nuclear Waste Forms: The Example of Pyrochlore.

    Science.gov (United States)

    Fischer, Cornelius; Finkeldei, Sarah; Brandt, Felix; Bosbach, Dirk; Luttge, Andreas

    2015-08-19

    The long-term stability of ceramic materials that are considered as potential nuclear waste forms is governed by heterogeneous surface reactivity. Thus, instead of a mean rate, the identification of one or more dominant contributors to the overall dissolution rate is the key to predict the stability of waste forms quantitatively. Direct surface measurements by vertical scanning interferometry (VSI) and their analysis via material flux maps and resulting dissolution rate spectra provide data about dominant rate contributors and their variability over time. Using pyrochlore (Nd2Zr2O7) pellet dissolution under acidic conditions as an example, we demonstrate the identification and quantification of dissolution rate contributors, based on VSI data and rate spectrum analysis. Heterogeneous surface alteration of pyrochlore varies by a factor of about 5 and additional material loss by chemo-mechanical grain pull-out within the uppermost grain layer. We identified four different rate contributors that are responsible for the observed dissolution rate range of single grains. Our new concept offers the opportunity to increase our mechanistic understanding and to predict quantitatively the alteration of ceramic waste forms.

  20. Importance of human factors on nuclear installations safety

    International Nuclear Information System (INIS)

    Caruso, G.J.

    1990-01-01

    Actually, installations safety and, in particular the nuclear installations infer a strong incidence in human factors related to the design and operation of such installations. In general, the experience aims to that the most important accidents have happened as result of the components' failures combination and human failures in the operation of safety systems. Human factors in the nuclear installations may be divided into two areas: economy and human reliability. Human factors treatments for the safety evaluation of the nuclear installations allow to diagnose the weak points of man-machine interaction. (Author) [es

  1. Densities, form factors, transitions and multipole moments in the s-d shell, with the Skyrme force

    International Nuclear Information System (INIS)

    Oliveira, D.R. de; Mizrahi, S.S.

    1977-09-01

    The nuclear densities, radii, multipole moments, form-factors and transition probabilities obtained for the A = 4n type of nuclei in the s-d shell are reported, using the Hartree-Fock wave functions calculated with the Skyrme force. Experimental data and theoretical values derived by others are shown for comparison [pt

  2. Determination of gaseous radionuclide forms in the stack air of nuclear power plants

    Czech Academy of Sciences Publication Activity Database

    Tecl, J.; Světlík, Ivo

    2009-01-01

    Roč. 67, č. 5 (2009), s. 950-952 ISSN 0969-8043 Institutional research plan: CEZ:AV0Z10480505 Keywords : Nuclear-energy facilities * radioactive noble gases * 14C Subject RIV: DL - Nuclear Waste, Radioactive Pollution ; Quality Impact factor: 1.094, year: 2009

  3. Coupling of Nuclear Waste Form Corrosion and Radionuclide Transports in Presence of Relevant Repository Sediments

    International Nuclear Information System (INIS)

    Wall, Nathalie A.; Neeway, James J.; Qafoku, Nikolla P.; Ryan, Joseph V.

    2015-01-01

    Assessments of waste form and disposal options start with the degradation of the waste forms and consequent mobilization of radionuclides. Long-term static tests, single-pass flow-through tests, and the pressurized unsaturated flow test are often employed to study the durability of potential waste forms and to help create models that predict their durability throughout the lifespan of the disposal site. These tests involve the corrosion of the material in the presence of various leachants, with different experimental designs yielding desired information about the behavior of the material. Though these tests have proved instrumental in elucidating various mechanisms responsible for material corrosion, the chemical environment to which the material is subject is often not representative of a potential radioactive waste repository where factors such as pH and leachant composition will be controlled by the near-field environment. Near-field materials include, but are not limited to, the original engineered barriers, their resulting corrosion products, backfill materials, and the natural host rock. For an accurate performance assessment of a nuclear waste repository, realistic waste corrosion experimental data ought to be modeled to allow for a better understanding of waste form corrosion mechanisms and the effect of immediate geochemical environment on these mechanisms. Additionally, the migration of radionuclides in the resulting chemical environment during and after waste form corrosion must be quantified and mechanisms responsible for migrations understood. The goal of this research was to understand the mechanisms responsible for waste form corrosion in the presence of relevant repository sediments to allow for accurate radionuclide migration quantifications. The rationale for this work is that a better understanding of waste form corrosion in relevant systems will enable increased reliance on waste form performance in repository environments and potentially

  4. Coupling of Nuclear Waste Form Corrosion and Radionuclide Transports in Presence of Relevant Repository Sediments

    Energy Technology Data Exchange (ETDEWEB)

    Wall, Nathalie A. [Washington State Univ., Pullman, WA (United States); Neeway, James J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Qafoku, Nikolla P. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Ryan, Joseph V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2015-09-30

    Assessments of waste form and disposal options start with the degradation of the waste forms and consequent mobilization of radionuclides. Long-term static tests, single-pass flow-through tests, and the pressurized unsaturated flow test are often employed to study the durability of potential waste forms and to help create models that predict their durability throughout the lifespan of the disposal site. These tests involve the corrosion of the material in the presence of various leachants, with different experimental designs yielding desired information about the behavior of the material. Though these tests have proved instrumental in elucidating various mechanisms responsible for material corrosion, the chemical environment to which the material is subject is often not representative of a potential radioactive waste repository where factors such as pH and leachant composition will be controlled by the near-field environment. Near-field materials include, but are not limited to, the original engineered barriers, their resulting corrosion products, backfill materials, and the natural host rock. For an accurate performance assessment of a nuclear waste repository, realistic waste corrosion experimental data ought to be modeled to allow for a better understanding of waste form corrosion mechanisms and the effect of immediate geochemical environment on these mechanisms. Additionally, the migration of radionuclides in the resulting chemical environment during and after waste form corrosion must be quantified and mechanisms responsible for migrations understood. The goal of this research was to understand the mechanisms responsible for waste form corrosion in the presence of relevant repository sediments to allow for accurate radionuclide migration quantifications. The rationale for this work is that a better understanding of waste form corrosion in relevant systems will enable increased reliance on waste form performance in repository environments and potentially

  5. The human factor in nuclear reactor operation

    International Nuclear Information System (INIS)

    Bertron, L.

    1982-05-01

    The principal operating characteristics of nuclear power plants are summarized. A description of major hazards relating to operator fallibility in normal and abnormal operating conditions is followed by a specific analysis of control room hazards, shift organization and selection and training of management personnel

  6. IEEE 1588 Time Synchronization Board in MTCA.4 Form Factor

    Science.gov (United States)

    Jabłoński, G.; Makowski, D.; Mielczarek, A.; Orlikowski, M.; Perek, P.; Napieralski, A.; Makijarvi, P.; Simrock, S.

    2015-06-01

    Distributed data acquisition and control systems in large-scale scientific experiments, like e.g. ITER, require time synchronization with nanosecond precision. A protocol commonly used for that purpose is the Precise Timing Protocol (PTP), also known as IEEE 1588 standard. It uses the standard Ethernet signalling and protocols and allows obtaining timing accuracy of the order of tens of nanoseconds. The MTCA.4 is gradually becoming the platform of choice for building such systems. Currently there is no commercially available implementation of the PTP receiver on that platform. In this paper, we present a module in the MTCA.4 form factor supporting this standard. The module may be used as a timing receiver providing reference clocks in an MTCA.4 chassis, generating a Pulse Per Second (PPS) signal and allowing generation of triggers and timestamping of events on 8 configurable backplane lines and two front panel connectors. The module is based on the Xilinx Spartan 6 FPGA and thermally stabilized Voltage Controlled Oscillator controlled by the digital-to-analog converter. The board supports standalone operation, without the support from the host operating system, as the entire control algorithm is run on a Microblaze CPU implemented in the FPGA. The software support for the card includes the low-level API in the form of Linux driver, user-mode library, high-level API: ITER Nominal Device Support and EPICS IOC. The device has been tested in the ITER timing distribution network (TCN) with three cascaded PTP-enabled Hirschmann switches and a GPS reference clock source. An RMS synchronization accuracy, measured by direct comparison of the PPS signals, better than 20 ns has been obtained.

  7. Microscopic models for hadronic form factors and vertex functions

    International Nuclear Information System (INIS)

    Santhanam, I.; Bhatnagar, S.; Mitra, A.N.

    1990-01-01

    We review the status of nucleon (N) and few-nucleon form factors (f.f.'s) from the view-point of a gradual unfolding of successively inner degrees of freedom (d.o.f.) with increase in q 2 . To this end we focus attention on the problem of a microscopic formulation of hadronic vertex functions (v.f.) from the point of view of their key role in understanding the physics of a large variety of few-hadron reactions on the one hand, and their practical usefulness in articulating the internal dynamics of hadron and few-hadron systems on the other hand. The criterion of an integrated view from low-energy spectroscopy to high-q 2 amplitudes is employed to emphasize the desirability of formulations in terms of relativistic dynamical equations based on Lorentz and gauge invariance in preference to phenomenological models, which often require additional assumptions beyond their original premises to extend their applicability domains. In this respect, the practical possibilities of the Bethe-Salpeter equation (BSE) in articulating the necessary dynamical ingredients are emphasized on a two-tier basis, the basis constants (3) being pre-determined from the mass spectral data (1 st stage) in preparation for the construction of the hadron-quark vertex functions (2 nd stage). An explicit construction is outlined for meson-quark and baryon-quark vertex functions as well as of meson-nucleon vertex functions in a stepwise fashion. The role of the latter as basic parameter-free ingredients is discussed for possible use in the more serious treatment in the current literature of quark-meson level (α) and meson-isobar (β) d.o.f. in 2-N and 3-N form factor studies. Since most of these studies are characterized by the use of RGM techniques at the six-quark level, a comparative discussion is also given of several contemporary RGM based models. Finally, the concrete prospects for employing such hardon-quark vertex functions for evaluating pp-bar annihilation amplitudes are briefly indicated

  8. Melt-Dilute Form of AI-Based Spent Nuclear Fuel Disposal Criticality Summary Report

    International Nuclear Information System (INIS)

    D. Vinson; A. Serika

    2002-01-01

    Criticality analysis of the proposed melt-dilute (MD) form of aluminum-based spent nuclear fuel (SNF), under geologic repository conditions, was performed [1] following the methodology documented in the Disposal Criticality Analysis Methodology Topical Report [2]. This methodology evaluates the potential for nuclear criticality for a waste form in a waste package. Criticality calculations show that even with waste package failure, followed by degradation of material within the waste package and potential loss of neutron absorber materials, sub-critical conditions can be readily demonstrated for the MD form of aluminum-based SNF

  9. Nuclear safety and human factors: the French factory of expertise

    International Nuclear Information System (INIS)

    Rolina, G.

    2009-01-01

    The French regulation of the nuclear safety is based on the maintaining of a deep technical dialogue between the nuclear safety authority, the I.R.S.N. (Institute of radiation protection and nuclear safety) and the nuclear operators. This type of risk management is called 'french coking' by the Anglo-Saxons, followers of stricter regulatory approach, more readable by the civil society. This technical dialogue is not without quality, especially in the field of human and organizational factors where it allows to improve the know how situation that stays incomplete. (N.C.)

  10. Factorization of heavy-to-light form factors in soft-collinear effective theory

    CERN Document Server

    Beneke, Martin; Feldmann, Th.

    2004-01-01

    Heavy-to-light transition form factors at large recoil energy of the light meson have been conjectured to obey a factorization formula, where the set of form factors is reduced to a smaller number of universal form factors up to hard-scattering corrections. In this paper we extend our previous investigation of heavy-to-light currents in soft-collinear effective theory to final states with invariant mass Lambda^2 as is appropriate to exclusive B meson decays. The effective theory contains soft modes and two collinear modes with virtualities of order m_b*Lambda (`hard-collinear') and Lambda^2. Integrating out the hard-collinear modes results in the hard spectator-scattering contributions to exclusive B decays. We discuss the representation of heavy-to-light currents in the effective theory after integrating out the hard-collinear scale, and show that the previously conjectured factorization formula is valid to all orders in perturbation theory. The naive factorization of matrix elements in the effective theory ...

  11. U.S. Nuclear Regulatory Commission human factors program plan

    International Nuclear Information System (INIS)

    1986-04-01

    The purpose of the U.S. Nuclear Regulatory Commission (NRC) Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design and operation of nuclear facilities. This revised plan addresses human factors issues related to the operation of nuclear power plants (NPPs). The three issues of concern are (1) the activities planned to provide the technical bases to resolve the remaining tasks related to human factors as described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the need to address the additional human factors efforts that were identified during implementation of the Action Plan; and (3) the actual fulfillment of those developmental activities specified in Revision 1 of this plan. The plan represents a systematic approach for addressing high priority human factors concerns important to NPP safety in FY 1986 through 1987

  12. Human factors aspects of advanced instrumentation in the nuclear industry

    International Nuclear Information System (INIS)

    Carter, R.J.

    1989-01-01

    An important consideration in regards to the use of advanced instrumentation in the nuclear industry is the interface between the instrumentation system and the human. A survey, oriented towards identifying the human factors aspects of digital instrumentation, was conducted at a number of United States (US) and Canadian nuclear vendors and utilities. Human factors issues, subsumed under the categories of computer-generated displays, controls, organizational support, training, and related topics were identified. 20 refs., 2 tabs

  13. Factors determining the UK's back-end nuclear fuel cycle strategy and future nuclear systems

    International Nuclear Information System (INIS)

    Dunn, M.J.; Ainsworth, Z.E.

    2002-01-01

    Nuclear generating capacity in the UK is static with no units currently under construction. The AGRs and the UK's only PWR, Sizewell B, are operated by British Energy Generation Ltd (BEGL) and British Energy Generation (UK) Ltd (BEG(UK)L), who are subsidiaries of British Energy plc (BE) which was privatised in July 1996. Ownership of the Magnox stations, which were excluded from this privatisation, has now been transferred to BNFL.Government policy on spent fuel management in the UK is that it is for the owners of the spent fuel to decide on the appropriate spent fuel management options, based on their own commercial judgement, subject to meeting the necessary regulatory requirements. The main factors which have predominantly determined UK utility decisions on spent fuel management, to date, have been based on the technical considerations of the spent fuel characteristics, economic attractiveness of the options and at reactor site spent fuel storage capacities. To date, reprocessing has been the dominant form of spent fuel treatment in the UK. Spent fuel storage facilities consist of a mixture of at-reactor stores and large, centralised ponds associated with the reprocessing activities which take place at the Sellafield site. BEGL and BEG(UK)L have contracts for the lifetime arisings of AGR fuel which allow for all AGR spent fuel to be sent to Sellafield for reprocessing or long-term storage. The prompt reprocessing of all Magnox fuel will continue, and spent PWR fuel will continue to be stored at the reactor site in the short to medium term. It is likely that a combination of factors, which are discussed later in this paper, will continue to affect back-end nuclear fuel cycle strategy and future nuclear systems. (author)

  14. Nucleon form factors and hidden symmetry in holographic QCD

    International Nuclear Information System (INIS)

    Hong, D.K.; Rho, M.; Yee, H.-U.; Yi, P.

    2007-10-01

    The vector dominance of the electromagnetic (EM) form factors both for mesons and baryons arises naturally in holographic QCD, where both the number of colors and the 't Hooft coupling are taken to be very large, offering a bona-fide derivation of the notion of vector dominance. The crucial ingredient for this is the infinite tower of vector mesons in the approximations made which share features that are characteristic of the quenched approximation in lattice QCD. We approximate the infinite sum by contributions from the lowest four vector mesons of the tower which turn out to saturate the charge and magnetic moment sum rules within a few % and compute them totally free of unknown parameters for momentum transfers Q 2 approx.= 1 GeV 2 . We identify certain observables that can be reliably computed within the approximations and others that are not, and discuss how the improvement of the latter can enable one to bring holographic QCD closer to QCD proper. (author)

  15. Conformal anomaly of generalized form factors and finite loop integrals

    Science.gov (United States)

    Chicherin, Dmitry; Sokatchev, Emery

    2018-04-01

    We reveal a new mechanism of conformal symmetry breaking at Born level. It occurs in generalized form factors with several local operators and an on-shell state of massless particles. The effect is due to hidden singularities on collinear configurations of the momenta. This conformal anomaly is different from the holomorphic anomaly of amplitudes. We present a number of examples in four and six dimensions. We find an application of the new conformal anomaly to finite loop momentum integrals with one or more massless legs. The collinear region around a massless leg creates a contact anomaly, made visible by the loop integration. The anomalous conformal Ward identity for an ℓ-loop integral is a 2nd-order differential equation whose right-hand side is an (ℓ - 1)-loop integral. It could serve as a new useful tool to find/test analytic expressions for conformal integrals. We illustrate this point with several examples of known integrals. We propose a new differential equation for the four-dimensional scalar double box.

  16. Measurements of the nucleon form factors at large momentum transfers

    International Nuclear Information System (INIS)

    Andivahis, L.; Bosted, P.; Lung, A.; Arnold, R.; Keppel, C.; Rock, S.; Spengos, M.; Szalata, Z.; Tao, L.; Stuart, L.; Dietrich, F.; Alster, J.; Lichtenstadt, J.; Chang, C.; Dodge, W.; Gearhart, R.; Kuhn, S.; Gomez, J.; Griffioen, K.; Hicks, R.; Miskimen, R.; Peterson, G.; Rokni, S.; Hyde-Wright, C.; Swartz, K.; Petratos, G.; Sakumoto, W.

    1992-12-01

    New measurements of the electric G E (Q 2 ) and magnetic G M (Q 2 ) form factors of the nucleons are reported. The proton data cover the Q 2 range from 1.75 to 8.83 (GeV/c) 2 and the neutron data from 1.75 to 4.00 (GeV/c) 2 , more than doubling the range of previous data. Scaled by the dipole fit, G D (Q 2 ), the results for G Mp (Q 2 )/μ p G D (Q 2 ) decrease smoothly from 1.05 to 0.92, while G Ep (Q 2 )/G D (Q 2 ) is consistent with unity. The preliminary results for Gm.(Q2)1 GD(Q2) consistent with unity, while F En 2 is consistent with zero at all values of Q 2 . Comparisons are made to QCD Sum Rule, diquark, constituent quark, and VMD models, none of which agree with all of the new data

  17. Baryon form factors at high momentum transfer and generalized parton distributions

    International Nuclear Information System (INIS)

    Stoler, Paul

    2002-01-01

    Nucleon form factors at high momentum transfer t are treated in the framework of generalized parton distributions (GPD's). The possibility of obtaining information about parton high transverse momentum components by application of GPD's to form factors is discussed. This is illustrated by applying an ad hoc 2-body parton wave function to elastic nucleon form factors F 1 and F 2 , the N→Δ transition magnetic form factor G M * , and the wide angle Compton scattering form factor R 1

  18. Factors influencing chemical durability of nuclear waste glasses

    International Nuclear Information System (INIS)

    Feng, Xiangdong; Bates, J.K.

    1993-01-01

    A short summary is given of our studies on the major factors that affect the chemical durability of nuclear waste glasses. These factors include glass composition, solution composition, SA/V (ratio of glass surface area to the volume of solution), radiation, and colloidal formation. These investigations have enabled us to gain a better understanding of the chemical durability of nuclear waste glasses and to accumulate.a data base for modeling the long-term durability of waste glass, which will be used in the risk assessment of nuclear waste disposal. This knowledge gained also enhances our ability to formulate optimal waste glass compositions

  19. Human factor analysis and preventive countermeasures in nuclear power plant

    International Nuclear Information System (INIS)

    Li Ye

    2010-01-01

    Based on the human error analysis theory and the characteristics of maintenance in a nuclear power plant, human factors of maintenance in NPP are divided into three different areas: human, technology, and organization. Which is defined as individual factors, including psychological factors, physiological characteristics, health status, level of knowledge and interpersonal skills; The technical factors including technology, equipment, tools, working order, etc.; The organizational factors including management, information exchange, education, working environment, team building and leadership management,etc The analysis found that organizational factors can directly or indirectly affect the behavior of staff and technical factors, is the most basic human error factor. Based on this nuclear power plant to reduce human error and measures the response. (authors)

  20. Zirconium sponge and other forms of virgin metal for nuclear applications - approved standard 1973

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    This specification covers virgin zirconium metal commonly designated as sponge because of its porous, sponge-like texture, but it may also take other forms such as chunklets. One grade is described which is designated as reactor grade R-1, suitable for use in nuclear applications. The most important characteristic of the reactor grade is its low nuclear cross section as achieved by removal of hafnium and careful quality control in manufacturing procedures to prevent contamination with other high cross section materials

  1. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    Energy Technology Data Exchange (ETDEWEB)

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  2. Nucleon Structure and hyperon form factors from lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  3. Cytokinin response factors regulate PIN-FORMED auxin transporters

    Czech Academy of Sciences Publication Activity Database

    Šimášková, M.; O'Brien, J.A.; Khan, M.; Van Noorden, G.; Ötvös, K.; Vieten, A.; De Clercq, E.; Van Haperen, J.M.A.; Cuesta, C.; Hoyerová, Klára; Vanneste, S.; Marhavý, P.; Wabnik, K.; Van Breusegem, F.; Nowack, M.; Murphy, A.; Friml, J.; Weijers, D.; Beeckman, T.; Benková, E.

    2015-01-01

    Roč. 6, NOV (2015), s. 8717 ISSN 2041-1723 Institutional support: RVO:61389030 Keywords : ARABIDOPSIS -THALIANA * ROOT-MERISTEM * TRANSCRIPTION FACTORS Subject RIV: ED - Physiology Impact factor: 11.329, year: 2015

  4. Conservative flight with a varying load factor and closed form ...

    Indian Academy of Sciences (India)

    Conservative flight performance of an aircraft with constant load factor was analysed by ... Within the frame work of flat earth hypotheses the equations of motion of an aircraft as obtained by ..... load factor function if this inequality holds good.

  5. Sampling and transport of paraffin waste form from CWDS of nuclear power plant

    International Nuclear Information System (INIS)

    Lee, J. M.; Hwang, J. H.; Kim, C. R.; Park, J. W.

    2000-01-01

    Sampling and transport of paraffin waste form from concentrated waste drying system (CWDS) of domestic nuclear power plant were performed to collect the leaching characteristic data for the disposal of radioactive waste. Transport was performed according to the national regulations and the internal rules of the nuclear power plant. The sample of paraffin waste form was classified as L type package according to the regulation and radiation exposure of operator was measured in the range of 6 to 12 mrem that was less than the estimated amount

  6. Research of human factor in nuclear power plants

    International Nuclear Information System (INIS)

    Nopp, I.

    1983-01-01

    The question is discussed of the study of the human factor with regard to the reliability of nuclear power plant operation. The reliability of the human factor is the result of the functional fitness, motivation, working conditions and working regime of personnel. (J.B.)

  7. Economic benefits of power factor correction at a nuclear facility

    International Nuclear Information System (INIS)

    Boger, R.M.; Dalos, W.; Juguilon, M.E.

    1986-01-01

    The economic benefits of correcting poor power factor at an operating nuclear facility are shown. A project approach for achieving rapid return of investment without disrupting plant availability is described. Examples of technical problems associated with using capacitors for power factor correction are presented

  8. Role of zinc finger structure in nuclear localization of transcription factor Sp1

    International Nuclear Information System (INIS)

    Ito, Tatsuo; Azumano, Makiko; Uwatoko, Chisana; Itoh, Kohji; Kuwahara, Jun

    2009-01-01

    Transcription factor Sp1 is localized in the nucleus and regulates gene expression. Our previous study demonstrated that the carboxyl terminal region of Sp1 containing 3-zinc finger region as DNA binding domain can also serve as nuclear localization signal (NLS). However, the nuclear transport mechanism of Sp1 has not been well understood. In this study, we performed a gene expression study on mutant Sp1 genes causing a set of amino acid substitutions in zinc finger domains to elucidate nuclear import activity. Nuclear localization of the GFP-fused mutant Sp1 proteins bearing concomitant substitutions in the first and third zinc fingers was highly inhibited. These mutant Sp1 proteins had also lost the binding ability as to the GC box sequence. The results suggest that the overall tertiary structure formed by the three zinc fingers is essential for nuclear localization of Sp1 as well as dispersed basic amino acids within the zinc fingers region.

  9. Computational Efficient Upscaling Methodology for Predicting Thermal Conductivity of Nuclear Waste forms

    International Nuclear Information System (INIS)

    Li, Dongsheng; Sun, Xin; Khaleel, Mohammad A.

    2011-01-01

    This study evaluated different upscaling methods to predict thermal conductivity in loaded nuclear waste form, a heterogeneous material system. The efficiency and accuracy of these methods were compared. Thermal conductivity in loaded nuclear waste form is an important property specific to scientific researchers, in waste form Integrated performance and safety code (IPSC). The effective thermal conductivity obtained from microstructure information and local thermal conductivity of different components is critical in predicting the life and performance of waste form during storage. How the heat generated during storage is directly related to thermal conductivity, which in turn determining the mechanical deformation behavior, corrosion resistance and aging performance. Several methods, including the Taylor model, Sachs model, self-consistent model, and statistical upscaling models were developed and implemented. Due to the absence of experimental data, prediction results from finite element method (FEM) were used as reference to determine the accuracy of different upscaling models. Micrographs from different loading of nuclear waste were used in the prediction of thermal conductivity. Prediction results demonstrated that in term of efficiency, boundary models (Taylor and Sachs model) are better than self consistent model, statistical upscaling method and FEM. Balancing the computation resource and accuracy, statistical upscaling is a computational efficient method in predicting effective thermal conductivity for nuclear waste form.

  10. State-of-the-art review of materials properties of nuclear waste forms

    International Nuclear Information System (INIS)

    Mendel, J.E.; Nelson, R.D.; Turcotte, R.P.; Gray, W.J.; Merz, M.D.; Roberts, F.P.; Weber, W.J.; Westsik, J.H. Jr.; Clark, D.E.

    1981-04-01

    The Materials Characterization Center (MCC) was established at the Pacific Northwest Laboratory to assemble a standardized nuclear waste materials data base for use in research, systems and facility design, safety analyses, and waste management decisions. This centralized data base will be provided through the means of a Nuclear Waste Materials Handbook. The first issue of the Handbook will be published in the fall of 1981 in looseleaf format so that it can be updated as additional information becomes available. To ensure utmost reliability, all materials data appearing in the Handbook will be obtained by standard procedures defined in the Handbook and approved by an independent Materials Review Board (MRB) comprised of materials experts from Department of Energy laboratories and from universities and industry. In the interim before publication of the Handbook there is need for a report summarizing the existing materials data on nuclear waste forms. This review summarizes materials property data for the nuclear waste forms that are being developed for immobilization of high-level radioactive waste. It is intended to be a good representation of the knowledge concerning the properties of HLW forms as of March 1981. The table of contents lists the following topics: introduction which covers waste-form categories, and important waste-form materials properties; physical properties; mechanical properties; chemical durability; vaporization; radiation effects; and thermal phase stability

  11. B-decay form factors from QCD sum rules

    International Nuclear Information System (INIS)

    Offen, Nils

    2008-01-01

    In the Standard Model of particle physics there is only one source of CP-violation. Namely, a single complex phase in the unitary 3 x 3 CKM-Matrix governing flavor transitions in the weak interaction. The unitarity is usually visualized by a triangle in the complex ρ - η-plane. Therefore testing this framework comes down to measuring weak decays, relating observables to sides and angles of this so called Unitarity Triangle(UT). Particular interest in this respect is payed to decays of mesons containing a heavy b-quark, giving the opportunity to alone determine all parameters of the UT. Doing this is far from easy. Besides tedious experimental measurements the theoretical calculations are plagued by hadronic quantities which cannot be determined by perturbation theory. In this work several of these quantities so called form factors are computed using the well known method of light cone sum rules(LCSR). Two different setups have been used. One, established in this work, utilizing a correlation function with an on-shell B-Meson and one following the traditional calculation by taking the light meson on-shell. Both using light cone expansion in the respective on-shell mesons distribution amplitudes. While the first approach allows to calculate a whole bunch of phenomenologically interesting quantities by just changing Dirac-structures of the relevant currents it has the drawback that it does not have access to the well developed twist expansion of the latter. To incorporate higher Fock-state contributions the first models for three-particle distribution amplitudes of the B-Meson have been derived. α s -corrections remain out of the scope of this work. Nevertheless does a comparison with more sophisticated methods show an encouraging numerical agreement. In the second setup all known corrections especially the never verified α s -corrections to Twist three terms have been recalculated and a competitive result for the CKM-matrixelement vertical stroke V ub vertical

  12. Annual report on the development and characterization of solidified forms for nuclear wastes, 1979

    International Nuclear Information System (INIS)

    Chick, L.A.; McVay, G.L.; Mellinger, G.B.; Roberts, F.P.

    1980-12-01

    Development and characterization of solidified nuclear waste forms is a major continuing effort at Pacific Northwest Laboratory. Contributions from seven programs directed at understanding chemical composition, process conditions, and long-term behaviors of various nuclear waste forms are included in this report. The major findings of the report are included in extended figure captions that can be read as brief technical summaries of the research, with additional information included in a traditional narrative format. Waste form development proceeded on crystalline and glass materials for high-level and transuranic (TRU) wastes. Leaching studies emphasized new areas of research aimed at more basic understanding of waste form/aqueous solution interactions. Phase behavior and thermal effects research included studies on crystal phases in defense and TRU waste glasses and on liquid-liquid phase separation in borosilicate waste glasses. Radiation damage effects in crystals and glasses from alpha decay and from transmutation are reported

  13. Nuclear energy - stabilising factor in the world economy

    International Nuclear Information System (INIS)

    Legassov, V.; Feoktistov, L.; Kouzmine, I.

    1986-01-01

    One of the most important factors for international stability is the development of the economy, reducing the risk of local armed conflicts which could escalate into world-wide nuclear war. Economic progress which plays such a vital part is in turn heavily dependent on energy supplies. The article takes a brief look at the role of nuclear power in this context. (B.M.S.)

  14. Cluster form factor calculation in the ab initio no-core shell model

    International Nuclear Information System (INIS)

    Navratil, Petr

    2004-01-01

    We derive expressions for cluster overlap integrals or channel cluster form factors for ab initio no-core shell model (NCSM) wave functions. These are used to obtain the spectroscopic factors and can serve as a starting point for the description of low-energy nuclear reactions. We consider the composite system and the target nucleus to be described in the Slater determinant (SD) harmonic oscillator (HO) basis while the projectile eigenstate to be expanded in the Jacobi coordinate HO basis. This is the most practical case. The spurious center of mass components present in the SD bases are removed exactly. The calculated cluster overlap integrals are translationally invariant. As an illustration, we present results of cluster form factor calculations for 5 He vertical bar 4 He+n>, 5 He vertical bar 3 H+d>, 6 Li vertical bar 4 He+d>, 6 Be vertical bar 3 He+ 3 He>, 7 Li vertical bar 4 He+ 3 H>, 7 Li vertical bar 6 Li+n>, 8 Be vertical bar 6 Li+d>, 8 Be vertical bar 7 Li+p>, 9 Li vertical bar 8 Li+n>, and 13 C vertical bar 12 C+n>, with all the nuclei described by multi-(ℎ/2π)Ω NCSM wave functions

  15. Stabilities of nuclear waste forms and their geochemical interactions in repositories

    International Nuclear Information System (INIS)

    White, W.B.

    1980-01-01

    The stabilities of high-level nuclear waste forms in a repository environment are briefly discussed. The advantages and disadvantages of such waste forms as borosilicate glass, supercalcine ceramics, and synthetic minerals are presented in context with the different rock types which have been proposed as possible host rocks for repositories. It is concluded that the growing geochemical evidence favors the use of a silicate rock repository because of the effectiveness of aluminosilicate rocks as chemical barriers for most radionuclides

  16. Transfer factors for nuclear emergency preparedness

    Energy Technology Data Exchange (ETDEWEB)

    Kostiainen, E.; Haenninen, R. [Radiation and Nuclear Safety Authority (STUK) (Finland); Rosen, K.; Haak, E.; Eriksson, Aa. [Swedish Univ. of Agricultural Science (Sweden); Nielsen, S.P.; Keith-Roach, M. [Risoe National Lab. (Denmark); Salbu, B. [Agricultural Univ. of Norway (Norway)

    2002-12-01

    This report by the NKS/BOK-1.4 project subgroup describes transfer factors for radiocaesium and radiostrontium for the fallout year and the years after the fallout. The intention has been to collect information on tools to assess the order of magnitude of radioactive contamination of agricultural products in an emergency situation in Nordic environment. The report describes transfer paths from fallout to plant, from soil to plant and to animal products. The transfer factors of radionuclides (Sr, Cs, I) given in the report are intended to be used for making rough estimates of the contamination of agricultural products soon after the heaviness and composition of the deposition (Bq m{sup -2}) is known. (au)

  17. Transfer factors for nuclear emergency preparedness

    International Nuclear Information System (INIS)

    Kostiainen, E.; Haenninen, R.; Rosen, K.; Haak, E.; Eriksson, Aa.; Nielsen, S.P.; Keith-Roach, M.; Salbu, B.

    2002-12-01

    This report by the NKS/BOK-1.4 project subgroup describes transfer factors for radiocaesium and radiostrontium for the fallout year and the years after the fallout. The intention has been to collect information on tools to assess the order of magnitude of radioactive contamination of agricultural products in an emergency situation in Nordic environment. The report describes transfer paths from fallout to plant, from soil to plant and to animal products. The transfer factors of radionuclides (Sr, Cs, I) given in the report are intended to be used for making rough estimates of the contamination of agricultural products soon after the heaviness and composition of the deposition (Bq m -2 ) is known. (au)

  18. Human factors engineering in nuclear plant rehabilitations

    International Nuclear Information System (INIS)

    Bernston, K.; Remisz, M.; Malcolm, S.

    2001-01-01

    There are several unique considerations when creating and maintaining a human factors program for a plant refurbishment. These consideration arise from a variety of sources, including budget and time constraints on life extension projects, working to existing plant protocols and current acceptable HFE practices, and issues relating to function and task analysis. This results in a need to streamline and carefully time HFE practices from project start up to completion. In order to perform this task adequately, a comprehensive Human Factors Engineering Program Plan should be designed and tailored to the project. Systems of planning and prioritization are essential, and the required HFE designer training needs to be established. HFE specialists need to be aware of the existing plant constraints, and he prepared to work within them when providing support. The current paper discusses these aspects in the context of major refurbishment work at CANDU stations. (author)

  19. Some comments on the behaviour of the excited nuclear matter formed in nuclear collisions at high energies

    International Nuclear Information System (INIS)

    Besliu, Calin; Jipa, Alexandru; Argintaru, Dan

    2003-01-01

    In the last years many experiments have been performed in different laboratories to investigate the behaviour of the nuclear matter formed in nuclear collisions at high energies. Therefore, many experimental results are available at present. For explaining these experimental results a lot of models have been proposed. A very large number of concepts have been used. Taking into account some own experimental results obtained in proton-nucleus and nucleus-nucleus collisions at energies between a few A GeV and a few hundred A GeV we comments in the frame a phenomenological geometric picture the main experimental results on charged particle multiplicities, participants, cross sections, momentum spectra, temperature slopes, nuclear matter flow, size and structure of the participant regions, antiparticle to particle ratios and chemical potential. Some jumps in the dependencies of some interesting physical quantities on the available energies in the centre of mass system can be reported. Trends to behaviours like-saturation of some physical quantities are observed, too. Therefore, some connections with the possible phase transitions in nuclear matter are included. A few specific signals of different phase transitions in nuclear matter are suggested. (authors)

  20. Key Factors for Nuclear Being Economic after Fukushima

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Myung Sub; Park, Seo Yeon [KEPCO International Nuclear Graduate School, Ulju (Korea, Republic of)

    2012-05-15

    It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc

  1. Key Factors for Nuclear Being Economic after Fukushima

    International Nuclear Information System (INIS)

    Roh, Myung Sub; Park, Seo Yeon

    2012-01-01

    It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc

  2. A regulatory perspective on human factors in nuclear power

    International Nuclear Information System (INIS)

    Whitfield, D.

    1987-01-01

    This paper sets out the approaches being taken by the United Kingdom Nuclear Installations Inspectorate (NII) to monitoring the application of human factors principles and practice in the UK industry. The role of NII is outlined, the development of human factors concerns is reviewed, the assessment of the Sizewell 'B' safety case is presented as a particular example, and pertinent future developments in the human factors discipline are proposed. (author)

  3. Adult education as information and help in forming opinions shown from the example of nuclear power

    International Nuclear Information System (INIS)

    Wild, W.; Markus, B.; Dietrich, T.; Schmitt Glaeser, W.

    1977-01-01

    The lectures printed here, partly in revised form, were given at a University meeting for teachers in adult education on July 9th and 10th 1976 in Bayreuth, with the main theme of 'Adult education as information and help in forming opinions shown from the subject of nuclear power'. It should be shown by examples related to this problem, which urgently requires more objectivity, and which will be freed of emotional opinions with extraordinary difficulty, how complex such objects can be and how many different aspects have to be taken into account. The grouping of scientific referees, a teacher, a nuclear physicist, a radiation biologist and a lawyer, makes the plurality of the aspects quite clear. Themes: 1) The contribution of adult education to de-idealogising the population, 2) The scientific and technical basis of generation and use of nuclear power, 3)Radiation stresses of living organismus, particularly human being. 4) Smug authorities, protesting citizens, overload judges. (GL) [de

  4. Secondary phases formed during nuclear waste glass-water interactions: Thermodynamic and derived properties

    International Nuclear Information System (INIS)

    McKenzie, W.F.

    1992-08-01

    The thermodynamic properties of secondary phases observed to form during nuclear waste glass-water interactions are of particular interest as it is with the application of these properties together with the thermodynamic properties of other solid phases, fluid phases, and aqueous species that one may predict the environmental consequences of introducing radionuclides contained in the glass into groundwater at a high-level nuclear waste repository. The validation of these predicted consequences can be obtained from laboratory experiments and field observations at natural analogue sites. The purpose of this report is to update and expand the previous compilation (McKenzie, 1991) of thermodynamic data retrieved from the literature and/or estimated for secondary phases observed to form (and candidate phases from observed chemical compositions) during nuclear waste glass-water interactions. In addition, this report includes provisionally recommended thermodynamic data of secondary phases

  5. Method for forming nuclear fuel containers of a composite construction and the product thereof

    International Nuclear Information System (INIS)

    Cheng, B.-C.; Rosenbaum, H.S.; Armijo, J.S.

    1981-01-01

    An improved method of producing a composite nuclear fuel container is described which comprises a casing or fuel sheath of zirconium or its alloy with a lining cladding of deposited copper superimposed over the inside surface of the zirconium or alloy and a layer of oxide of the zirconium or alloy formed on the inside surface of the casing or sheath. (U.K.)

  6. Human factor engineering applied to nuclear power plant design

    International Nuclear Information System (INIS)

    Manrique, A.; Valdivia, J.C.; Jimenez, A.

    2001-01-01

    For the design and construction of new nuclear power plants as well as for maintenance and operation of the existing ones new man-machine interface designs and modifications are been produced. For these new designs Human Factor Engineering must be applied the same as for any other traditional engineering discipline. Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. Additionally, the big saving achieved by a nuclear power plant having an operating methodology which significantly decreases the risk of operating errors makes it necessary and almost vital its implementation. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. (author)

  7. The significance of human factors in nuclear activities

    International Nuclear Information System (INIS)

    Weil, L.; Berg, H.P.

    1999-01-01

    Human factors is an aspect increasingly investigated in the last few years in efforts and programmes for enhancing the operational safety of nuclear systems. Methodology has been elaborated for analysis and evaluation of human reliability, or development of instruments supporting the decisions to be taken by the operators at the man-control room interface of nuclear installations, as well as initial approaches to introduce organisational factors which may influence the man-machine function allocation, and thus are an element of the safety culture concept. The significance of human factors in nuclear activities, as well as activities at the national and international level for optimisation of the man-machine interface and the man-organisation interface are discussed. (orig./CB) [de

  8. Human factors in the Canadian nuclear industry: future needs

    International Nuclear Information System (INIS)

    Harrison, F.

    2008-01-01

    Currently the industry is facing refurbishment and new builds. At present most licensees in Canada do not have sufficient numbers of Human Factors staff. As a result, the activities of the CNSC are too often focused on providing guidance regarding the application of Human Factors, in addition to reviewing work submitted by the licensee. Greater efficiencies for both the licensee and the CNSC could be realized if licensee staff had greater Human Factors expertise. Strategies for developing Human Factors expertise should be explored through cooperative partnerships with universities, which could be encouraged to include Human Factors courses specific to nuclear. (author)

  9. Human factor in the problem of Russian nuclear industry safety

    International Nuclear Information System (INIS)

    Abramova, V.

    2002-01-01

    The approach to human factor definition, considered in the paper, consists of recognition of as many as possible factors for developing a complete list of factors, which have influence on mistakes or successful work of NPP personnel. Safety culture is considered as the main factor. The enhancement in nuclear power industry includes an optimization of organizational structures and development of personnel safety attitudes. The organizational factors, as possible root causes for human errors, need to be identified, assessed and improved. The organizational activities taken in Russia are presented

  10. Interleukin (IL) 36 gamma induces mucin 5AC, oligomeric mucus/gel-forming expression via IL-36 receptor-extracellular signal regulated kinase 1 and 2, and p38-nuclear factor kappa-light-chain-enhancer of activated B cells in human airway epithelial cells.

    Science.gov (United States)

    Bae, Chang Hoon; Choi, Yoon Seok; Na, Hyung Gyun; Song, Si-Youn; Kim, Yong-Dae

    2018-03-01

    Mucin 5AC, oligomeric mucus/gel-forming (MUC5AC) expression is significantly increased in allergic and inflammatory airway diseases. Interleukin (IL) 36 gamma is predominantly expressed in airway epithelial cells and plays an important role in innate and adaptive immune responses. IL-36 gamma is induced by many inflammatory mediators, including cytokines and bacterial and viral infections. However, the association between IL-36 gamma and mucin secretion in human airway epithelial cells has not yet been fully investigated. The objective of this study was to determine whether IL-36 gamma might play a role in the regulation of mucin secretion in airway epithelial cells. We investigated the effect and brief signaling pathway of IL-36 gamma on MUC5AC expression in human airway epithelial cells. Enzyme immunoassay, immunoblot analysis, immunofluorescence staining, reverse transcriptase-polymerase chain reaction (PCR), and real-time PCR were performed in mucin-producing human airway epithelial NCI-H292 cells and in human nasal epithelial cells after pretreatment with IL-36 gamma, several specific inhibitors, or small interfering RNAs (siRNA). IL-36 gamma induced MUC5AC expression and activated the phosphorylation of extracellular signal regulated kinase (ERK) 1 and 2, p38, and nuclear factor-kappa-light-chain-enhancer of activated B cells (NF-kappa B). IL-36 receptor antagonist significantly attenuated these effects. The specific inhibitor and siRNA of ERK1, ERK2, p38, and NF-kappa B significantly attenuated IL-36 gamma induced MUC5AC expression. These results indicated that IL-36 gamma induced MUC5AC expression via the IL-36 receptor-mediated ERK1/2 and p38/NF-kappa B pathway in human airway epithelial cells.

  11. US Nuclear Regulatory Commission human-factors program plan

    International Nuclear Information System (INIS)

    1983-08-01

    The purpose of the NRC Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This initial plan addresses nuclear power plants (NPP) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements, and (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-83 through FY-85 time frame

  12. Correction factors for photon spectrometry in nuclear parameters study

    International Nuclear Information System (INIS)

    Patrao, Karla Cristina de Souza

    2004-10-01

    The goal of this work was the determination, using metrologic severity, the factors of correction for coincidences XX, Xγ and γγ and the factors of transference of efficiency for use in gamma spectrometry. On this way, it was carried through by determination of nuclear parameters of a nuclide used in medicine diagnostic ( 201 Tl) and the standardization of two environmental samples, of regular and irregular geometry, proceeding from the residual (ashes and slag) from the nuclear industry. The results shows that this adopted methodology is valid, and it allows its application for many different nuclides, including complex decay schema nuclides, using only photons spectrometry techniques on semiconductor detectors. (author)

  13. Nuclear modification factor using Tsallis non-extensive statistics

    Energy Technology Data Exchange (ETDEWEB)

    Tripathy, Sushanta; Garg, Prakhar; Kumar, Prateek; Sahoo, Raghunath [Indian Institute of Technology Indore, Discipline of Physics, School of Basic Sciences, Simrol (India); Bhattacharyya, Trambak; Cleymans, Jean [University of Cape Town, UCT-CERN Research Centre and Department of Physics, Rondebosch (South Africa)

    2016-09-15

    The nuclear modification factor is derived using Tsallis non-extensive statistics in relaxation time approximation. The variation of the nuclear modification factor with transverse momentum for different values of the non-extensive parameter, q, is also observed. The experimental data from RHIC and LHC are analysed in the framework of Tsallis non-extensive statistics in a relaxation time approximation. It is shown that the proposed approach explains the R{sub AA} of all particles over a wide range of transverse momentum but does not seem to describe the rise in R{sub AA} at very high transverse momenta. (orig.)

  14. Forms and factors of peer violence and victimisation

    OpenAIRE

    Dinić Bojana; Sokolovska Valentina; Milovanović Ilija; Oljača Milan

    2014-01-01

    The main aim of this study was to explore the latent structure of violence and victimisation based on the factor analysis of the Peer Violence and Victimisation Questionnaire (PVVQ), as well as to examine the correlates of violence and victimisation. The sample included 649 secondary school students (61.8% male) from the urban area. Besides the PVVQ, the Aggressiveness questionnaire AVDH was administered. Based on parallel analysis, three factors were extra...

  15. Form factors and transition charge density of 16O and 18O nuclei

    International Nuclear Information System (INIS)

    Gul'karov, I.S.; Vakil', R.Kh.

    1986-01-01

    A formula is obtained for the transition density of charge (TDC) in the Helm model. The form factors are analysed for inelastic scattering of electrons On the 16 O isotopes (O 1 + , 6.052 MeV; 2 1 + , 6.917 MeV) and on the 18 O isotopes (0 1 + , 3.630 MeV; 2 1 + , 1.982 MeV; 0 2 + , 3.919 MeV; 2 3 + , 5.250 MeV; 4 1 + , 3.553 MeV; 4 2 + , 7.114 MeV). For monopole transitions the TDC is of the volume kind, but for L=2 and 4 transitions the TDC has a maximum at approximately R (R is the nuclear surface radius). There are as well obtained the first TDC moments, i.e. the reduced transition probabilities and transition radii of 16 O and 18 O

  16. Iso-vector form factors of the delta and nucleon in QCD sum rules

    International Nuclear Information System (INIS)

    Ozpineci, A.

    2012-01-01

    Form factors are important non-perturbative properties of hadrons. They give information about the internal structure of the hadrons. In this work, iso-vector axial-vector and iso-vector tensor form factors of the nucleon and the iso-vector axial-vector Δ→N transition form factor calculations in QCD Sum Rules are presented.

  17. Two neutron transfer form factor for the reaction 42Ca(p,t)40Ca

    International Nuclear Information System (INIS)

    Meyer, R.H.

    1978-01-01

    In an attempt to better interpret experimental data concerning the two-neutron pickup process 42 Ca(p,t) 40 Ca, a detailed study of the form factors associated with the reaction is carried out. A set of coupled integro-differential equations describing these form factors is derived, starting from a microscopic, model-independent Hamiltonian. These equations allow contributions to the form factors from hole terms as well as from the particle and so-called ''continuum'' states, which were previously studied. An approximate solution of the form factor equations is obtained by neglecting the coupling terms and expressing the form factor in terms of a set of Sturmian states. Form factors for the transition to the 40 Ca ground state (O 1 + ) are calculated using various sets of Sturmian states. The inclusion of hole states is found to have a major effect upon both the shape of the form factor and the size of the related cross section. Finally, a comparison is made between the O 1 + form factors calculated using Sturmian states and a O 1 + form factor obtained using Sturmian states and a O 1 + form factor obtained using the coexistence model. It is found that a form factor based on Sturmian particle and hole states is very similar to the form factor obtained from the coexistence model calculation

  18. Economic Conditions and Factors Affecting New Nuclear Power Deployment

    Energy Technology Data Exchange (ETDEWEB)

    Harrison, Thomas J [ORNL

    2014-10-01

    This report documents work performed in support of the US Department of Energy Office of Nuclear Energy’s Advanced Small Modular Reactor (AdvSMR) program. The report presents information and results from economic analyses to describe current electricity market conditions and those key factors that may impact the deployment of AdvSMRs or any other new nuclear power plants. Thus, this report serves as a reference document for DOE as it moves forward with its plans to develop advanced reactors, including AdvSMRs. For the purpose of this analysis, information on electricity markets and nuclear power plant operating costs will be combined to examine the current state of the nuclear industry and the process required to successfully move forward with new nuclear power in general and AdvSMRs in particular. The current electricity market is generally unfavorable to new nuclear construction, especially in deregulated markets with heavy competition from natural gas and subsidized renewables. The successful and profitable operation of a nuclear power plant (or any power plant) requires the rate at which the electricity is sold to be sufficiently greater than the cost to operate. The wholesale rates in most US markets have settled into values that provide profits for most operating nuclear power plants but are too low to support the added cost of capital recovery for new nuclear construction. There is a strong geographic dependence on the wholesale rate, with some markets currently able to support new nuclear construction. However, there is also a strong geographic dependence on pronuclear public opinion; the areas where power prices are high tend to have unfavorable views on the construction of new nuclear power plants. The use of government-backed incentives, such as subsidies, can help provide a margin to help justify construction projects that otherwise may not seem viable. Similarly, low interest rates for the project will also add a positive margin to the economic

  19. Melt-Dilute Spent Nuclear Fuel Form Criticality Summary Report; FINAL

    International Nuclear Information System (INIS)

    Vinson, D.W.

    2002-01-01

    Criticality analysis of the proposed Melt-Dilute (MD) form of aluminum-based spent nuclear fuel (SNF), under geologic repository conditions, was performed following the methodology, documented in the Disposal Criticality Analysis Methodology Topical Report. This methodology evaluates the potential for nuclear criticality as determined by the composition of the waste and its geometry, namely waste form configuration, including presence of moderator, reflecting structural material, and neutron absorbers. The initial emplaced configuration of the SNF form is a dry package placed in a mined repository passageway. Criticality calculations show that even with waste package failure, followed by degradation of material within the waste package and potential loss of neutron absorber materials, sub-critical conditions can be maintained

  20. Plan for spent fuel waste form testing for NNWSI [Nevada Nuclear Waste Storage Investigations

    International Nuclear Information System (INIS)

    Shaw, H.F.

    1987-11-01

    The purpose of spent fuel waste form testing is to determine the rate of release of radionuclides from failed disposal containers holding spent fuel, under conditions appropriate to the Nevada Nuclear Waste Storage Investigations (NNWSI) Project tuff repository. The information gathered in the activities discussed in this document will be used: to assess the performance of the waste package and engineered barrier system (EBS) with respect to the containment and release rate requirements of the Nuclear Regulatory Commission, as the basis for the spent fuel waste form source term in repository-scale performance assessment modeling to calculate the cumulative releases to the accessible environment over 10,000 years to determine compliance with the Environmental Protection Agency, and as the basis for the spent fuel waste form source term in repository-scale performance assessment modeling to calculate cumulative releases over 100,000 years as required by the site evaluation process specified in the DOE siting guidelines. 34 refs

  1. Factors which could limit the nuclear fuel cycle development

    International Nuclear Information System (INIS)

    Pecqueur, M.; Barre, B.

    1977-01-01

    The nuclear fuel cycle is a most important industry for the energy future of the world. It has also a leading part as regards the physical continuity of energy supply of the countries engaged in the nuclear field. The development of this industry is subject to the economic or political constraints involved by the availability of raw materials, technologies or production means. The various limiting factors which could affect the different stages of the fuel cycle are linked with the technical, economic and financial aspects, with the impact on the environment, nuclear safety, risks of non-pacific uses and proliferation of arms. Interesting to note is also the correlation between the fuel cycle development and the problems of energy independence and security of nuclear programs. As a conclusion, the nuclear fuel cycle industry is confronted to difficulties due to its extremely rapid growth (doubling time 5 years) which only few heavy industries have encountered for long periods. It is more over submitted to the political and safety constraints always linked with nuclear matters. The task is therefore a difficult one. But the objective is worth-while since it is a condition to the development of nuclear industry [fr

  2. Human factor in the process of nuclear power development

    International Nuclear Information System (INIS)

    Enenkl, V.

    The building up of nuclear power requires the training not only of personnel but of the whole population as well. Professional workers in nuclear power facilities production and personnel operating the equipment of nuclear power plants must be on a high technical and managerial level. The important quality of such personnel is their reliability and responsibility. The human factor influences the level, quality and thereby also the service-life of the machines and equipment and their operation. The improvement of the quality of work in nuclear power production depends on upgrading the scientific and technical level of workers and personnel, their training, in-service education and the raising of the social standing. (B.H.)

  3. Recruitment of bloom-forming cyanobacteria and its driving factors ...

    African Journals Online (AJOL)

    Based on most of the literature, this paper reviewed the progress made in following aspects: cognition to cyanobacteria recruitment, various traps for studying cyanobacteria recruitment in lakes, recruitment patterns of some species of cyanobacteria, and the driving factors for recruitment. Additionally, perspective studies of ...

  4. Human factors engineering plan for reviewing nuclear plant modernization programs

    International Nuclear Information System (INIS)

    O'Hara, John; Higgins, James

    2004-12-01

    The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation

  5. Human factors engineering plan for reviewing nuclear plant modernization programs

    Energy Technology Data Exchange (ETDEWEB)

    O' Hara, John; Higgins, James [Brookhaven National Laboratory, Upton, NY (United States)

    2004-12-01

    The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation.

  6. Improved polyphase ceramic form for high-level defense nuclear waste

    International Nuclear Information System (INIS)

    Harker, A.B.; Morgan, P.E.D.; Clarke, D.R.; Flintoff, J.J.; Shaw, T.M.

    1983-01-01

    An improved ceramic nuclear waste form and fabrication process have been developed using simulated Savannah River Plant defense high-level waste compositions. The waste form provides flexibility with respect to processing conditions while exhibiting superior resistance to ground water leaching than other currently proposed forms. The ceramic, consolidated by hot-isostatic pressing at 1040 0 C and 10,000 psi, is composed of six major phases, nepheline, zirconolite, a murataite-type cubic phase, magnetite-type spinel, a magnetoplumbite solid solution, and perovskite. The waste form provides multiple crystal lattice sites for the waste elements, minimizes amorphous intergranular material, and can accommodate waste loadings in excess of 60 wt %. The fabrication of the ceramic can be accomplished with existing manufacturing technology and eliminates the effects of radionuclide volatilization and off-gas induced corrosion experienced with the molten processes for vitreous form production

  7. Personality Factors and Nuclear Power Plant Operators: Initial License Success

    Science.gov (United States)

    DeVita-Cochrane, Cynthia

    Commercial nuclear power utilities are under pressure to effectively recruit and retain licensed reactor operators in light of poor candidate training completion rates and recent candidate failures on the Nuclear Regulatory Commission (NRC) license exam. One candidate failure can cost a utility over $400,000, making the successful licensing of new operators a critical path to operational excellence. This study was designed to discover if the NEO-PI-3, a 5-factor measure of personality, could improve selection in nuclear utilities by identifying personality factors that predict license candidate success. Two large U.S. commercial nuclear power corporations provided potential participant contact information and candidate results on the 2014 NRC exam from their nuclear power units nation-wide. License candidates who participated (n = 75) completed the NEO-PI-3 personality test and results were compared to 3 outcomes on the NRC exam: written exam, simulated operating exam, and overall exam result. Significant correlations were found between several personality factors and both written and operating exam outcomes on the NRC exam. Further, a regression analysis indicated that personality factors, particularly Conscientiousness, predicted simulated operating exam scores. The results of this study may be used to support the use of the NEO-PI-3 to improve operator selection as an addition to the current selection protocol. Positive social change implications from this study include support for the use of a personality measure by utilities to improve their return-on-investment in candidates and by individual candidates to avoid career failures. The results of this study may also positively impact the public by supporting the safe and reliable operation of commercial nuclear power utilities in the United States.

  8. A report on human factors in nuclear safety

    International Nuclear Information System (INIS)

    1983-03-01

    Following the Three Mile Island incident of 1979, studies were undertaken by the Atomic Energy Control Board (AECB), in-house and through outside consultants, to address the role of human factors in the regulatory process. This report by the Advisory Committee on Nuclear Safety (ACNS) comments briefly on these studies and offers suggestions which would promote a more formal treatment of human factors by the AECB

  9. Factor of radioactive waste on nuclear power program

    International Nuclear Information System (INIS)

    Syed Abdul Malik Syed Zain

    2009-01-01

    Global warming phenomena and rising oil prices have brought the excitement of open space use of nuclear power. Arguments in favor of this technology range in terms of more environmentally friendly, energy diversification and cost efficiency has prompted the government to widen the choice of nuclear power be considered as a serious alternative. Despite the attractive factors to the use of these powers, there are also factors that stem from the continued development of nuclear power. These include the factor of safety, security, security of fuel supply, and public attention is often associated with radioactive waste management. This article attempts to debate specific to radioactive waste management factors that impact on public acceptance of a country's nuclear power program, especially in Malaysia. Starting from the absence of radioactive waste management policy to model uncertainty of the landfill and complications in selecting a repository site shows the basic infrastructure is still lacking. In addition, previous experience handling thorium waste has not reached a final settlement after several years of implementation. It reinforced the perception about the level of public confidence in the competence and attitude of local workers who are not very encouraging to pursue this advanced.

  10. on skin keratinocytes by nuclear factor-kappa B

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-21

    Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...

  11. Materials characterization center workshop on the irradiation effects in nuclear waste forms

    International Nuclear Information System (INIS)

    Roberts, F.P.; Turcotte, R.P.; Weber, W.J.

    1981-01-01

    The Workshop on Irradiation Effects in Nuclear Waste Forms sponsored by the Materials Characterization Center (MCC) brought together experts in radiation damage in materials and waste-management technology to review the problems associated with irradiation effects on waste-form integrity and to evaluate standard methods for generating data to be included in the Nuclear Waste Materials Handbook. The workshop reached the following conclusions: the concept of Standard Test for the Effects of Alpha-Decay in Nuclear Waste Solids, (MCC-6) for evaluating the effects of alpha decay is valid and useful, and as a result of the workshop, modifications to the proposed procedure will be incorpoated in a revised version of MCC-6; the MCC-6 test is not applicable to the evaluation of radiation damage in spent fuel; plutonium-238 is recommended as the dopant for transuranic and defense high-level waste forms, and when high doses are required, as in the case of commercial high-level waste forms, 244 Cm can be used; among the important property changes caused by irradiation are those that lead to greater leachability, and additionally, radiolysis of the leachant may increase leach rates; research is needed in this area; ionization-induced changes in physical properties can be as important as displacement damage in some materials, and a synergism is also likely to exist from the combined effects of ionization and displacement damage; and the effect of changing the temperature and dose rates on property changes induced by radiation damage needs to be determined

  12. Nuclear power forms an important pillar of many countries’ climate change mitigation strategies

    International Nuclear Information System (INIS)

    Gaspar, Miklos; Sadler, Julie

    2015-01-01

    The need for climate change mitigation is a salient reason for an increasing number of countries considering nuclear power within their national energy portfolios, according to IAEA experts and government sources. “Concerns about climate change is one of the drivers for countries to introduce or to expand their use of nuclear power,” said David Shropshire, Head of the IAEA’s Planning and Economic Studies Section. Other factors include growing energy demands and the desire to increase energy security and reduce dependence on volatile fossil fuel costs, he added.

  13. (14) N nuclear quadrupole resonance study of piroxicam: confirmation of new polymorphic form V.

    Science.gov (United States)

    Lavrič, Zoran; Pirnat, Janez; Lužnik, Janko; Puc, Uroš; Trontelj, Zvonko; Srčič, Stane

    2015-06-01

    A new polymorphic crystal form of piroxicam was discovered while preparing crystalline samples of piroxicam for (14) N nuclear quadrupole resonance (NQR) analysis. The new crystal form, designated as V, was prepared by evaporative recrystallization from dichloromethane. Three known polymorphic forms (I, II, and III) were also prepared. Our aim was to apply (14) N NQR to characterize the new polymorphic form of piroxicam and compare the results with those of the other known polymorphic forms. Additional analytical methods used for characterization were X-ray powder diffraction (XRPD), thermal analysis, and vibrational spectroscopy. For the first time, a complete set of nine characteristic (14) N NQR frequencies was found for each prepared polymorph of piroxicam. The consistent set of measured frequencies and calculated characteristic quadrupole parameters found for the new polymorphic form V is a convincing evidence that we are dealing with a new form. The already known piroxicam polymorphic forms were characterized similarly. The XRPD results were in accordance with the conclusions of (14) N NQR analysis. The performed study clearly demonstrates a strong potential of (14) N NQR method to be applied as a highly discriminative spectroscopic analytical tool to characterize polymorphic forms. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

  14. A comparison of hydrogen with alternate energy forms from coal and nuclear energy

    International Nuclear Information System (INIS)

    Cox, K.E.

    1976-01-01

    Alternate energy forms that can be produced from coal and nuclear energy have been analyzed on efficiency, economic and end-use grounds. These forms include hydrogen, methane, electricity, and EVA-ADAM, a 'chemical heat pipe' approach to energy transmission. The EVA-ADAM system for nuclear heat appears to be economically competitive with the other energy carriers except over very large distances. The cost of hydrogen derived from coal is approximately equal to that of methane derived from the same source when compared on an equal BTU basis. Thermochemically derived hydrogen from nuclear energy shows a break-even range with hydrogen derived from coal at coal costs of from Pound33 to 80/ton depending on the cost of nuclear heat. Electricity and electrolytically derived hydrogen are the most expensive energy carriers and electricity's use should be limited to applications involving work rather than heat. Continued work in thermochemical hydrogen production schemes should be supported as an energy option for the future. (author)

  15. Organizational factors and reoccurrence protection on the JCO nuclear critical accident

    International Nuclear Information System (INIS)

    Takano, Kenichi

    2000-01-01

    A nuclear critical accident formed at a nuclear fuel conversion factory in Tokai-mura on September, 1999 became gradually clear not to be a simple human error formed at a level of workmen but to be an organizational error or accident relating to various organizational factors. As a nuclear power facility adopts a depth protection system fundamentally, a large accident with serious danger would not form only by a single trouble and a human error and unless some factors overlaps. By reviewing recent serious accidents and troubles, all of them seem to have a keyword of 'organizational factor'. In the JCO accident, there are some organizational factors such as a climate deviating from a manual, insufficient and loose check against change of procedure, reduction of operators from a reason of profit priority, attitude on priority of working efficiency, and so forth, which are partially common to the Chernobyl accident. Recently, accidents and troubles impossible to make them a cause of simple human error by a person but to have to say an organizational error, have increased. This trend seems to depend upon not only complication and scale-up of technology system but also graduate change of social and management systems operating them. Therefore, it seems to be necessary to introduce a concept of depth protection (multiple protection) in order to keep its reliability and safety when complicating and scaling-up of system. (G.K.)

  16. Waste form development and characterization in pyrometallurgical treatment of spent nuclear fuel

    International Nuclear Information System (INIS)

    Ackerman, J.

    1998-01-01

    Electrometallurgical treatment is a compact, inexpensive method that is being developed at Argonne National Laboratory to deal with spent nuclear fuel, primarily metallic and oxide fuels. In this method, metallic nuclear fuel constituents are electrorefined in a molten salt to separate uranium from the rest of the spent fuel. Oxide and other fuels are subjected to appropriate head end steps to convert them to metallic form prior to electrorefining. The treatment process generates two kinds of high-level waste--a metallic and a ceramic waste. Isolation of these wastes has been developed as an integral part of the process. The wastes arise directly from the electrorefiner, and waste streams do not contain large quantities of solvent or other process fluids. Consequently, waste volumes are small and waste isolation processes can be compact and rapid. This paper briefly summarizes waste isolation processes then describes development and characterization of the two waste forms in more detail

  17. The export receptor Crm1 forms a dimer to promote nuclear export of HIV RNA.

    Science.gov (United States)

    Booth, David S; Cheng, Yifan; Frankel, Alan D

    2014-12-08

    The HIV Rev protein routes viral RNAs containing the Rev Response Element (RRE) through the Crm1 nuclear export pathway to the cytoplasm where viral proteins are expressed and genomic RNA is delivered to assembling virions. The RRE assembles a Rev oligomer that displays nuclear export sequences (NESs) for recognition by the Crm1-Ran(GTP) nuclear receptor complex. Here we provide the first view of an assembled HIV-host nuclear export complex using single-particle electron microscopy. Unexpectedly, Crm1 forms a dimer with an extensive interface that enhances association with Rev-RRE and poises NES binding sites to interact with a Rev oligomer. The interface between Crm1 monomers explains differences between Crm1 orthologs that alter nuclear export and determine cellular tropism for viral replication. The arrangement of the export complex identifies a novel binding surface to possibly target an HIV inhibitor and may point to a broader role for Crm1 dimerization in regulating host gene expression.

  18. US Nuclear Regulatory Commission Human Factors Program Plan. Revision 1

    International Nuclear Information System (INIS)

    1984-09-01

    The purpose of the NRC Human Factors Program Plan (NUREG-0985) is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This revised plan addresses nuclear power plants (NPPs) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, THE NRC Action Plan developed as a result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention; (3) conduct of developmental activities specified in NUREG-0985 during FY-83; and (4) the impact of Section 306 of the Nuclear Waste Policy Act of 1982, PL 97-425. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-84 through FY-86 time frame

  19. Quality management in the nuclear industry: the human factor

    International Nuclear Information System (INIS)

    1990-01-01

    In the nuclear industry it is vital to understand the 'human factor' with regard to plant performance and plant safety. A proper management system ensures that personnel perform their duties correctly. 'Quality Management in the Nuclear Industry: the Human Factor', was a conference organized by the Institution of Mechanical Engineers in October 1990. The conference covered a wide range of topics on an international level including: standards, licensing and regulatory procedures; selection assessment and training of personnel; feedback from experience of good practice and of deviations; management and support of personnel performance; modelling and evaluation of human factors. The papers presented at the conference are contained in this volume. All twenty papers are indexed separately. (author)

  20. Explosively free-formed pass partition plate for a nuclear steam generator

    International Nuclear Information System (INIS)

    Schroeder, J.W.

    1980-01-01

    A large flow-separating dished plate of a complex shape was manufactured by near-contact explosive forming in which only an edge die was used. The shape of the part, for service in a large, nuclear steam generator, was obtained by careful sizing and placement of the explosive charge. The development of the technique and the manufacture of the plate are described. 4 refs

  1. Metal waste forms from the electrometallurgical treatment of spent nuclear fuel

    International Nuclear Information System (INIS)

    Abraham, D.P.; McDeavitt, S.M.; Park, J.

    1996-01-01

    Stainless steel-zirconium alloys are being developed for the disposal of radioactive metal isotopes isolated using an electrometallurgical treatment technique to treat spent nuclear fuel. The nominal waste forms are stainless steel-15 wt% zirconium alloy and zirconium-8 wt% stainless steel alloy. These alloys are generated in yttria crucibles by melting the starting materials at 1,600 C under an argon atmosphere. This paper discusses the microstructures, corrosion and mechanical test results, and thermophysical properties of the metal waste form alloys

  2. The unit cost factors and calculation methods for decommissioning - Cost estimation of nuclear research facilities

    International Nuclear Information System (INIS)

    Kwan-Seong Jeong; Dong-Gyu Lee; Chong-Hun Jung; Kune-Woo Lee

    2007-01-01

    Available in abstract form only. Full text of publication follows: The uncertainties of decommissioning costs increase high due to several conditions. Decommissioning cost estimation depends on the complexity of nuclear installations, its site-specific physical and radiological inventories. Therefore, the decommissioning costs of nuclear research facilities must be estimated in accordance with the detailed sub-tasks and resources by the tasks of decommissioning activities. By selecting the classified activities and resources, costs are calculated by the items and then the total costs of all decommissioning activities are reshuffled to match with its usage and objectives. And the decommissioning cost of nuclear research facilities is calculated by applying a unit cost factor method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning costs of nuclear research facilities are composed of labor cost, equipment and materials cost. Of these three categorical costs, the calculation of labor costs are very important because decommissioning activities mainly depend on labor force. Labor costs in decommissioning activities are calculated on the basis of working time consumed in decommissioning objects and works. The working times are figured out of unit cost factors and work difficulty factors. Finally, labor costs are figured out by using these factors as parameters of calculation. The accuracy of decommissioning cost estimation results is much higher compared to the real decommissioning works. (authors)

  3. Nuclear Factor-kappaB in Autoimmunity: Man and Mouse.

    Science.gov (United States)

    Miraghazadeh, Bahar; Cook, Matthew C

    2018-01-01

    NF-κB (nuclear factor-kappa B) is a transcription complex crucial for host defense mediated by innate and adaptive immunity, where canonical NF-κB signaling, mediated by nuclear translocation of RelA, c-Rel, and p50, is important for immune cell activation, differentiation, and survival. Non-canonical signaling mediated by nuclear translocation of p52 and RelB contributes to lymphocyte maturation and survival and is also crucial for lymphoid organogenesis. We outline NF-κB signaling and regulation, then summarize important molecular contributions of NF-κB to mechanisms of self-tolerance. We relate these mechanisms to autoimmune phenotypes described in what is now a substantial catalog of immune defects conferred by mutations in NF-κB pathways in mouse models. Finally, we describe Mendelian autoimmune syndromes arising from human NF-κB mutations, and speculate on implications for understanding sporadic autoimmune disease.

  4. Materials Characterization Center. Second workshop on irradiation effects in nuclear waste forms. Summary report

    International Nuclear Information System (INIS)

    Weber, W.J.; Turcotte, R.P.

    1982-01-01

    The purpose of this second workshop on irradiations effects was to continue the discussions initiated at the first workshop and to obtain guidance for the Materials Characterization Center in developing test methods. The following major conclusions were reached: Ion or neutron irradiations are not substitutes for the actinide-doping technique, as described by the MCC-6 Method for Preparation and Characterization of Actinide-Doped Waste Forms, in the final evaluation of any waste form with respect to the radiation effects from actinide decay. Ion or neutron irradiations may be useful for screening tests or more fundamental studies. The use of these simulation techniques as screening tests for actinide decay requires that a correlation between ion or neutron irradiations and actinide decay be established. Such a correlation has not yet been established and experimental programs in this area are highly recommended. There is a need for more fundamental studies on dose-rate effects, temperature dependence, and the nature and importance of alpha-particle effects relative to the recoil nucleus in actinide decay. There are insufficient data presently available to evaluate the potential for damage from ionizing radiation in nuclear waste forms. No additional test methods were recommended for using ion or neutron irradiations to simulate actinide decay or for testing ionization damage in nuclear waste forms. It was recognized that additional test methods may be required and developed as more data become available. An American Society for Testing and Materials (ASTM) Task Group on the Simulation of Radiation Effects in Nuclear Waste Forms (E 10.08.03) was organized to act as a continuing vehicle for discussions and development of procedures, particularly with regard to ion irradiations

  5. Human factors guidelines for nuclear power plant applications

    International Nuclear Information System (INIS)

    Ketchel, J.

    1993-01-01

    In 1989, Waters et al. reported to the Human Factors Society on developing human factors criteria for a new reactor plant. They correctly indicated that much of the guidance documentation in human factors engineering has derived from MIL-STD-1472 and its antecedents. Guidelines for human-computer interface have sprung primarily from the Smith and Mosier compendium and its source documents. NUREG-0700, which is currently being updated, was developed by the US Nuclear Regulatory Commission (NRC) as a general evaluation guide for inspecting control rooms. In addition, the Electric Power Research Institute, Institute of Nuclear Power Operations, US Department of Energy, the NRC, and others have published a number of specialized documents on a range of subjects. The number of guidelines and standards has grown in the past few years to an impressive number, including those published by international organizations and professional societies. This paper provides an update on current efforts to provide appropriate guidance for the power industry and, perhaps more importantly, offers a perspective on how users should think about using the available materials and what else is needed. The Electric Power Research Institute (EPRI) continues to be one of the principal participants in providing guidance to the utilities. Human factors guidelines is indeed a timely topic, currently of great interest to EPRI's constituents and to designers of new and upgraded nuclear power plants (NPMs) in the Advanced Light Water Reactor and the Instrumentation and Control Upgrade Initiative programs

  6. Factors affecting the next generation of nuclear power

    International Nuclear Information System (INIS)

    Remick, F.J.

    1990-01-01

    For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it

  7. Factors affecting the next generation of nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Remick, F J [Nuclear Regulatory Commission, Washington, DC (United States)

    1990-07-01

    For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it.

  8. Statistical factors affecting the success of nuclear operations

    International Nuclear Information System (INIS)

    Sunder, S.; Stephenson, J.R.; Hochman, D.

    1999-01-01

    In this article, the authors present a statistical analysis to determine the operational, financial, technical, and managerial factors that most significantly affect the success of nuclear operations. The study analyzes data for over 70 nuclear plants and 40 operating companies over a period of five years in order to draw conclusions that they hope will be of interest to utility companies and public utility commissions as they seek ways to improve rates of success in nuclear operations. Some of these conclusions will not be surprising--for example, that older plants have heavier maintenance requirements--but others are less intuitive. For instance, the observation that operators of fewer plants have lower costs suggests that any experience curve benefits associated with managing multiple nuclear facilities is overshadowed by the logistic problems of multiple facilities. After presenting a brief history of nuclear power in America, the authors outline the motivations of the study and the methodology of their analysis. They end the article with the results of the study and discuss some of the managerial implications of these findings

  9. Factors influencing the decommissioning of large-scale nuclear plants

    International Nuclear Information System (INIS)

    Large, J.H.

    1988-01-01

    The decision-making process involving the decommissioning of the UK graphite moderated, gas-cooled nuclear power stations is complex. There are timing, engineering, waste disposal, cost and lost generation capacity factors to consider and the overall decision of when and how to proceed with decommissioning may include political and public tolerance dimensions. For the final stage of decommissioning the nuclear industry could either completely dismantle the reactor island leaving a green-field site or, alternatively, the reactor island could be maintained indefinitely with additional super- and substructure containment. At this time the first of these options, or deferred decommissioning, prevails and with this the nuclear industry has expressed considerable confidence that the technology required will become available with passing time, that acceptable radioactive waste disposal methods and facilities will be available and that the eventual costs of decommissioning will not escalate without restraint. If the deferred decommissioning strategy is wrong and it is not possible to completely dismantle the reactor islands a century into the future, then it may be too late to effect sufficient longer term containment to maintain the reactor hulks in a reliable condition. With respect to the final decommissioning of large-scale nuclear plant, it is concluded that the nuclear industry does not know quite how to do it, when it will be attempted and when it will be completed, and they do not know how much it will eventually cost. (author)

  10. Human factor engineering applied to nuclear power plant design

    International Nuclear Information System (INIS)

    Manrique, A.; Valdivia, J.C.

    2007-01-01

    Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. Such a plan should state: -) Activities to be performed, and -) Creation of a Human Factor Engineering team adequately qualified. The Human Factor Engineering team is an integral part of the design team and is strongly linked to the engineering organizations but simultaneously has independence to act and is free to evaluate designs and propose changes in order to enhance human behavior. TECNATOM S.A. (a Spanish company) has been a part of the Design and Human Factor Engineering Team and has collaborated in the design of an advanced Nuclear Power Plant, developing methodologies and further implementing those methodologies in the design of the plant systems through the development of the plant systems operational analysis and of the man-machine interface design. The methodologies developed are made up of the following plans: -) Human Factor Engineering implementation in the Man-Machine Interface design; -) Plant System Functional Requirement Analysis; -) Allocation of Functions to man/machine; -) Task Analysis; -) Human-System Interface design; -) Control Room Verification and -) Validation

  11. Nuclear Regulatory Commission Human Factors Program Plan. Revision 2

    International Nuclear Information System (INIS)

    1986-04-01

    This document is the Second Annual Revision to the NRC Human Factors Program Plan. The first edition was published in August 1983. Revision 1 was published in July of 1984. Purpose of the NRC Human Factors Program is to ensure that proper consideration is given to human factors in the design and operation of nuclear power plants. This document describes the plans of the Office of Nuclear Reactor Regulation to address high priority human factors concerns of importance to reactor safety in FY 1986 and FY 1987. Revision 2 of the plan incorporates recent Commission decisions and policies bearing on the human factors aspects of reactor safety regulation. With a few exceptions, the principal changes from prior editions reflect a shift from developing new requirements to staff evaluation of industry progress in resolving human factors issues. The plan addresses seven major program elements: (1) Training, (2) Licensing Examinations, (3) Procedures, (4) Man-Machine Interface, (5) Staffing and Qualifications, (6) Management and Organization, and (7) Human Performance

  12. Major factors influencing craft productivity in nuclear power plant construction

    International Nuclear Information System (INIS)

    Borcherding, J.D.; Sebastian, S.J.

    1980-01-01

    This paper reports on a research study whose objective was to determine the most influential factors adversely affecting craft productivity in nuclear power plant construction from the perspective of the tradesmen employed at the sites. Data were collected through the use of a questionnaire survey and group interview sessions, predominantly with workmen, at six nuclear power plant construction projects. Craftsmen were chosen as the major data base because of their awareness of how their time would actually be spent on the project. Topics considered include the factors influencing craft productivity, material availability, redoing work, crew interfacing, overcrowded work areas, instruction time, inspection delays, craft turnover, craft absenteeism, foreman changes, foreman incompetence, engineering design lead time, comprehensive scheduling of the design function, the responsibility of the utility, value engineering, plant standardization, the effective utilization of the planning and scheduling system, and the labor-management committee

  13. Meson widths and form factor at intermediate momentum transfer in nonperturbative QCD

    International Nuclear Information System (INIS)

    Ioffe, B.L.; Smilga, A.V.

    1982-01-01

    A general method is proposed for the QCD based calculations of form factors at intermediate momentum transfer Q 2 and of the partial widths of the low-lying meson resonances. The basic idea is to use the QCD sum rules for the vertex functions. With this method the pion electromagnetic form factor along with electromagnetic form factors of rho- and A 1 mesons and transition form factors γπ → A 1 at 0.5 2 2 are calculated. The widths rho+2π and A 1 → rhoπ are also determined. +.he results are in a good agreement with experiment

  14. Calculation of the Nucleon Axial Form Factor Using Staggered Lattice QCD

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Aaron S. [Fermilab; Hill, Richard J. [Perimeter Inst. Theor. Phys.; Kronfeld, Andreas S. [Fermilab; Li, Ruizi [Indiana U.; Simone, James N. [Fermilab

    2016-10-14

    The nucleon axial form factor is a dominant contribution to errors in neutrino oscillation studies. Lattice QCD calculations can help control theory errors by providing first-principles information on nucleon form factors. In these proceedings, we present preliminary results on a blinded calculation of $g_A$ and the axial form factor using HISQ staggered baryons with 2+1+1 flavors of sea quarks. Calculations are done using physical light quark masses and are absolutely normalized. We discuss fitting form factor data with the model-independent $z$ expansion parametrization.

  15. Electromagnetic form factors of the ρ meson in light cone QCD sum rules

    International Nuclear Information System (INIS)

    Aliev, T.M.; Savci, M.

    2004-01-01

    We investigate the electromagnetic form factors of the ρ meson in light cone QCD sum rules. We find that the ratio of the magnetic and charge form factors is larger than 2 at all values of Q 2 (Q 2 ≥0.5 GeV 2 ). The values of the individual form factors at fixed values of Q 2 predicted by the light cone QCD sum rules are quite different compared to the results of other approaches. These results can be checked in the future, when more precise data on ρ meson form factors is available

  16. Up- and Down-Quark Contributions to the Nucleon Form Factors

    Directory of Open Access Journals (Sweden)

    Qattan I. A.

    2014-03-01

    Full Text Available Recent measurements of the neutron s electric to magnetic form factors ratio, Rn = µnGnE/GnM, up to 3.4 (GeV/c2 combined with existing Rp = µpGpE/GpM measurements in the same Q2 range allowed, for the first time, a separation of the up- and downquark contributions to the form factors at high Q2, as presented by Cates, et al.. Our analysis expands on the original work by including additional form factor data, applying two-photon exchange (TPE corrections, and accounting for the uncertainties associated with all of the form factor measurements.

  17. Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue

    Directory of Open Access Journals (Sweden)

    R. Linden

    1999-07-01

    Full Text Available Programmed cell death in the form of apoptosis involves a network of metabolic events and may be triggered by a variety of stimuli in distinct cells. The nervous system contains several neuron and glial cell types, and developmental events are strongly dependent on selective cell interactions. Retinal explants have been used as a model to investigate apoptosis in nervous tissue. This preparation maintains the structural complexity and cell interactions similar to the retina in situ, and contains cells in all stages of development. We review the finding of nuclear exclusion of several transcription factors during apoptosis in retinal cells. The data reviewed in this paper suggest a link between apoptosis and a failure in the nucleo-cytoplasmic partition of transcription factors. It is argued that the nuclear exclusion of transcription factors may be an integral component of apoptosis both in the nervous system and in other types of cells and tissues.

  18. A ΩXaV motif in the Rift Valley fever virus NSs protein is essential for degrading p62, forming nuclear filaments and virulence.

    Science.gov (United States)

    Cyr, Normand; de la Fuente, Cynthia; Lecoq, Lauriane; Guendel, Irene; Chabot, Philippe R; Kehn-Hall, Kylene; Omichinski, James G

    2015-05-12

    Rift Valley fever virus (RVFV) is a single-stranded RNA virus capable of inducing fatal hemorrhagic fever in humans. A key component of RVFV virulence is its ability to form nuclear filaments through interactions between the viral nonstructural protein NSs and the host general transcription factor TFIIH. Here, we identify an interaction between a ΩXaV motif in NSs and the p62 subunit of TFIIH. This motif in NSs is similar to ΩXaV motifs found in nucleotide excision repair (NER) factors and transcription factors known to interact with p62. Structural and biophysical studies demonstrate that NSs binds to p62 in a similar manner as these other factors. Functional studies in RVFV-infected cells show that the ΩXaV motif is required for both nuclear filament formation and degradation of p62. Consistent with the fact that the RVFV can be distinguished from other Bunyaviridae-family viruses due to its ability to form nuclear filaments in infected cells, the motif is absent in the NSs proteins of other Bunyaviridae-family viruses. Taken together, our studies demonstrate that p62 binding to NSs through the ΩXaV motif is essential for degrading p62, forming nuclear filaments and enhancing RVFV virulence. In addition, these results show how the RVFV incorporates a simple motif into the NSs protein that enables it to functionally mimic host cell proteins that bind the p62 subunit of TFIIH.

  19. The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export*

    Science.gov (United States)

    Port, Sarah A.; Mendes, Adélia; Valkova, Christina; Spillner, Christiane; Fahrenkrog, Birthe; Kaether, Christoph; Kehlenbach, Ralph H.

    2016-01-01

    Genetic rearrangements are a hallmark of several forms of leukemia and can lead to oncogenic fusion proteins. One example of an affected chromosomal region is the gene coding for Nup214, a nucleoporin that localizes to the cytoplasmic side of the nuclear pore complex (NPC). We investigated two such fusion proteins, SET-Nup214 and SQSTM1 (sequestosome)-Nup214, both containing C-terminal portions of Nup214. SET-Nup214 nuclear bodies containing the nuclear export receptor CRM1 were observed in the leukemia cell lines LOUCY and MEGAL. Overexpression of SET-Nup214 in HeLa cells leads to the formation of similar nuclear bodies that recruit CRM1, export cargo proteins, and certain nucleoporins and concomitantly affect nuclear protein and poly(A)+ RNA export. SQSTM1-Nup214, although mostly cytoplasmic, also forms nuclear bodies and inhibits nuclear protein but not poly(A)+ RNA export. The interaction of the fusion proteins with CRM1 is RanGTP-dependent, as shown in co-immunoprecipitation experiments and binding assays. Further analysis revealed that the Nup214 parts mediate the inhibition of nuclear export, whereas the SET or SQSTM1 part determines the localization of the fusion protein and therefore the extent of the effect. SET-Nup214 nuclear bodies are highly mobile structures, which are in equilibrium with the nucleoplasm in interphase and disassemble during mitosis or upon treatment of cells with the CRM1-inhibitor leptomycin B. Strikingly, we found that nucleoporins can be released from nuclear bodies and reintegrated into existing NPC. Our results point to nuclear bodies as a means of preventing the formation of potentially insoluble and harmful protein aggregates that also may serve as storage compartments for nuclear transport factors. PMID:27613868

  20. The Oncogenic Fusion Proteins SET-Nup214 and Sequestosome-1 (SQSTM1)-Nup214 Form Dynamic Nuclear Bodies and Differentially Affect Nuclear Protein and Poly(A)+ RNA Export.

    Science.gov (United States)

    Port, Sarah A; Mendes, Adélia; Valkova, Christina; Spillner, Christiane; Fahrenkrog, Birthe; Kaether, Christoph; Kehlenbach, Ralph H

    2016-10-28

    Genetic rearrangements are a hallmark of several forms of leukemia and can lead to oncogenic fusion proteins. One example of an affected chromosomal region is the gene coding for Nup214, a nucleoporin that localizes to the cytoplasmic side of the nuclear pore complex (NPC). We investigated two such fusion proteins, SET-Nup214 and SQSTM1 (sequestosome)-Nup214, both containing C-terminal portions of Nup214. SET-Nup214 nuclear bodies containing the nuclear export receptor CRM1 were observed in the leukemia cell lines LOUCY and MEGAL. Overexpression of SET-Nup214 in HeLa cells leads to the formation of similar nuclear bodies that recruit CRM1, export cargo proteins, and certain nucleoporins and concomitantly affect nuclear protein and poly(A) + RNA export. SQSTM1-Nup214, although mostly cytoplasmic, also forms nuclear bodies and inhibits nuclear protein but not poly(A) + RNA export. The interaction of the fusion proteins with CRM1 is RanGTP-dependent, as shown in co-immunoprecipitation experiments and binding assays. Further analysis revealed that the Nup214 parts mediate the inhibition of nuclear export, whereas the SET or SQSTM1 part determines the localization of the fusion protein and therefore the extent of the effect. SET-Nup214 nuclear bodies are highly mobile structures, which are in equilibrium with the nucleoplasm in interphase and disassemble during mitosis or upon treatment of cells with the CRM1-inhibitor leptomycin B. Strikingly, we found that nucleoporins can be released from nuclear bodies and reintegrated into existing NPC. Our results point to nuclear bodies as a means of preventing the formation of potentially insoluble and harmful protein aggregates that also may serve as storage compartments for nuclear transport factors. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Human-factor operating concept for Borssele Nuclear Power Station

    International Nuclear Information System (INIS)

    Wieman, J.L.

    1995-01-01

    The safety level in the operation of a reactor is determined basically by human beings. The Borssele Nuclear Power Station has carried out measures for improving the man-machine interface through training and operating instructions for the shift personnel. The retrofitting of control technology relevant to safety engineering should avoid operating instructions which can cause potential failures. A safety study has shown that the remaining risk following all retrofitting measures remains dependent to the extent of 80% on human factors and that human factors as a whole have a positive effect on reactor safety. (orig.) [de

  2. A human factors data bank for French nuclear power plants

    International Nuclear Information System (INIS)

    Villemeur, A.; Mosneron-Dupin, F.; Bouissou, M.; Meslin, T.

    1986-01-01

    CONFUCIUS is a computerized data bank developed by Electricite de France to study human factors in nuclear power plants. A detailed and homogeneous grouping of described operation and maintenance errors as well as of performance times is possible with CONFUCIUS. It also incorporates a selection of statistical treatment softwares. Readily usable and modifiable, the system can easily evolve. It allows a wide range of applications (safety analysis, event analysis, training, human factors engineering, probabilistic analysis). Data derived from the analysis of significant events reported in power plants and from the analysis of simulator tests are used as inputs into this data bank

  3. Battelle's human factors program for the US Nuclear Regulatory Commission

    International Nuclear Information System (INIS)

    Shikiar, R.

    1983-10-01

    Battelle has been involved in a programmatic effort of technical assistance to the Division of Human Factors Safety of the NRC. This program involves the efforts of over 75 professionals engaged in over 20 projects. These projects span the areas of human factors engineering, procedures, examinations, training, staffing and qualifications, and utility management and organization. All of these bear, one way or another, on the role of operators in nuclear power plants. This programmatic effort can be viewed as part of an integrative approach to system safety

  4. Minerals and design of new waste forms for conditioning nuclear waste

    Science.gov (United States)

    Montel, Jean-Marc

    2011-02-01

    Safe storage of radioactive waste is a major challenge for the nuclear industry. Mineralogy is a good basis for designing ceramics, which could eventually replace nuclear glasses. This requires a new storage concept: separation-conditioning. Basic rules of crystal chemistry allow one to select the most suitable structures and natural occurrences allow assessing the long-term performance of ceramics in a geological environment. Three criteria are of special interest: compatibility with geological environment, resistance to natural fluids, and effects of self-irradiation. If mineralogical information is efficient for predicting the behaviour of common, well-known minerals, such as zircon, monazite or apatite, more research is needed to rationalize the long-term behaviour of uncommon waste form analogs.

  5. Human factors methods for nuclear control room design. Volume I. Human factors enhancement of existing nuclear control rooms. Final report

    International Nuclear Information System (INIS)

    Seminara, J.L.; Seidenstein, S.; Eckert, S.K.; Smith, D.L.

    1979-11-01

    Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. Human factors approaches were applied in the design of representative nuclear power plant control panels. First, methods for upgrading existing operational control panels were examined. Then, based on detailed human factors analyses of operator information and control requirements, designs of reactor, feedwater, and turbine-generator control panels were developed to improve the operator-control board interface, thereby reducing the potential for operator errors. In addition to examining present-generation concepts, human factors aspects of advanced systems and of hybrid combinations of advanced and conventional designs were investigated. Special attention was given to warning system designs. Also, a survey was conducted among control board designers to (1) develop an overview of design practices in the industry, and (2) establish appropriate measures leading to a more systematic concern for human factors in control board design

  6. An improvement of the applicability of human factors guidelines for coping with human factors issues in nuclear power plants

    International Nuclear Information System (INIS)

    Lee, Y. H.; Lee, J. Y.

    2003-01-01

    Human factors have been well known as one of the key factors to the system effectiveness as well as the efficiency and safety of nuclear power plants(NPPs). Human factors engineering(HFE) are included in periodic safety review(PSR) on the existing NPPs and the formal safety assessment for the new ones. However, HFE for NPPs is still neither popular in practice nor concrete in methodology. Especially, the human factors guidelines, which are the most frequent form of human factors engineering in practice, reveal the limitations in their applications. We discuss the limitations and their casual factors found in human factors guidelines in order to lesson the workload of HFE practitioners and to improve the applicability of human factors guidelines. According to the purposes and the phases of HFE for NPPs, more selective items and specified criteria should be prepared carefully in the human factors guidelines for the each HFE applications in practice. These finding on the human factors guidelines can be transferred to the other HFE application field, such as military, aviation, telecommunication, HCI, and product safety

  7. Sol-gel technology applied to crystalline ceramic nuclear waste forms

    International Nuclear Information System (INIS)

    Angelini, P.; Bond, W.D.; Caputo, A.J.; Mack, J.E.; Lackey, W.J.; Lee, D.A.; Stinton, D.P.

    1980-01-01

    The sol-gel process is being developed for the solidification and isolation of high-level nuclear fuel waste. Three gelation methods are being developed for producing alternative waste forms. These include internal gelation for producing spheres of up to 1 mm diam suitable for coating, external gelation, and water extraction methods for producing material suitable for alternate ceramic processing. In this study internal gelation has been used to produce ceramic spheres of various alternative nuclear waste compositions. A gelation system capable of producing 100-g batches has been assembled and used for development. Waste forms containing up to 70 wt % simulated Savannah River Plant waste have been produced. Dopants such as Cs, Sr, Nd, Ru, and Mo were used in some experiments to observe side waste streams and sintering effects. Synroc microspheres were coated with both low-density carbon, high-density impermeable carbon, high-temperature dense SiC, and SiC deposited at temperatures near 900 0 C. Other gelation methods and other alternative waste forms are being developed

  8. Key Response Planning Factors for the Aftermath of Nuclear Terrorism

    Energy Technology Data Exchange (ETDEWEB)

    Buddemeier, B R; Dillon, M B

    2009-01-21

    Despite hundreds of above-ground nuclear tests and data gathered from Hiroshima and Nagasaki, the effects of a ground-level, low-yield nuclear detonation in a modern urban environment are still the subject of considerable scientific debate. Extensive review of nuclear weapon effects studies and discussions with nuclear weapon effects experts from various federal agencies, national laboratories, and technical organizations have identified key issues and bounded some of the unknowns required to support response planning for a low-yield, ground-level nuclear detonation in a modern U.S. city. This study, which is focused primarily upon the hazards posed by radioactive fallout, used detailed fallout predictions from the advanced suite of three-dimensional (3-D) meteorology and plume/fallout models developed at Lawrence Livermore National Laboratory (LLNL), including extensive global Key Response Planning Factors for the Aftermath of Nuclear Terrorism geographical and real-time meteorological databases to support model calculations. This 3-D modeling system provides detailed simulations that account for complex meteorology and terrain effects. The results of initial modeling and analysis were presented to federal, state, and local working groups to obtain critical, broad-based review and feedback on strategy and messaging. This effort involved a diverse set of communities, including New York City, National Capitol Regions, Charlotte, Houston, Portland, and Los Angeles. The largest potential for reducing casualties during the post-detonation response phase comes from reducing exposure to fallout radiation. This can be accomplished through early, adequate sheltering followed by informed, delayed evacuation.B The response challenges to a nuclear detonation must be solved through multiple approaches of public education, planning, and rapid response actions. Because the successful response will require extensive coordination of a large number of organizations, supplemented by

  9. Properties of SYNROC C nuclear-waste form: a state-of-the-art review

    International Nuclear Information System (INIS)

    Oversby, V.M.

    1982-09-01

    SYNROC C is a titanate ceramic waste form designed to contain the waste generated by the reprocessing of commercial nuclear reactor fuel. The properties of SYNROC C are described with particular emphasis on the distribution of chemical elements in SYNROC, the fabrication of good quality specimens, and the chemical durability of SYNROC. Data obtained from testing of natural mineral analogues of SYNROC minerals are briefly discussed. The information available on radiation effects in SYNROC in relation to structural alteration and changes in chemical durability are summarized. 26 references, 2 figures, 18 tables

  10. Chandra and ALMA observations of the nuclear activity in two strongly lensed star-forming galaxies

    Science.gov (United States)

    Massardi, M.; Enia, A. F. M.; Negrello, M.; Mancuso, C.; Lapi, A.; Vignali, C.; Gilli, R.; Burkutean, S.; Danese, L.; Zotti, G. De

    2018-02-01

    -z galaxies with high star formation rates. This is useful to extend the investigation of the relationship between star formation and nuclear activity to two intrinsically less luminous high-z star-forming galaxies than was possible so far. Given our results for only two objects, they alone cannot constrain the evolutionary models, but provide us with interesting hints and set an observational path toward addressing the role of star formation and nuclear activity in forming galaxies. The reduced images and data cubes as FITS files are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/610/A53

  11. Form factors in quantum integrable models with GL(3)-invariant R-matrix

    Energy Technology Data Exchange (ETDEWEB)

    Pakuliak, S., E-mail: pakuliak@theor.jinr.ru [Laboratory of Theoretical Physics, JINR, 141980 Dubna, Moscow Reg. (Russian Federation); Moscow Institute of Physics and Technology, 141700 Dolgoprudny, Moscow Reg. (Russian Federation); Institute of Theoretical and Experimental Physics, 117259 Moscow (Russian Federation); Ragoucy, E., E-mail: eric.ragoucy@lapth.cnrs.fr [Laboratoire de Physique Théorique LAPTH, CNRS and Université de Savoie, BP 110, 74941 Annecy-le-Vieux Cedex (France); Slavnov, N.A., E-mail: nslavnov@mi.ras.ru [Steklov Mathematical Institute, Moscow (Russian Federation)

    2014-04-15

    We study integrable models solvable by the nested algebraic Bethe ansatz and possessing GL(3)-invariant R-matrix. We obtain determinant representations for form factors of off-diagonal entries of the monodromy matrix. These representations can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  12. Recoil of the pion-surrounded nucleon bag and axial form factors

    International Nuclear Information System (INIS)

    Klabucar, D.; Picek, I.

    1984-03-01

    A recent method of boosting the bag is extended to the pion-surrounded nucleon bag and developed for the calculation of low-energy nucleon form factors. The usefulness of the method is illustrated by the induced pseudoscalar form factor where both the inclusion of the pion field and the non-vanishing momentum transfer are necessary. (Auth.)

  13. Gluing operation and form factors of local operators in N = 4 Super Yang-Mills theory

    Science.gov (United States)

    Bolshov, A. E.

    2018-04-01

    The gluing operation is an effective way to get form factors of both local and non-local operators starting from different representations of on-shell scattering amplitudes. In this paper it is shown how it works on the example of form factors of operators from stress-tensor operator supermultiplet in Grassmannian and spinor helicity representations.

  14. Finite element analysis of ion transport in solid state nuclear waste form materials

    Science.gov (United States)

    Rabbi, F.; Brinkman, K.; Amoroso, J.; Reifsnider, K.

    2017-09-01

    Release of nuclear species from spent fuel ceramic waste form storage depends on the individual constituent properties as well as their internal morphology, heterogeneity and boundary conditions. Predicting the release rate is essential for designing a ceramic waste form, which is capable of effectively storing the spent fuel without contaminating the surrounding environment for a longer period of time. To predict the release rate, in the present work a conformal finite element model is developed based on the Nernst Planck Equation. The equation describes charged species transport through different media by convection, diffusion, or migration. And the transport can be driven by chemical/electrical potentials or velocity fields. The model calculates species flux in the waste form with different diffusion coefficient for each species in each constituent phase. In the work reported, a 2D approach is taken to investigate the contributions of different basic parameters in a waste form design, i.e., volume fraction, phase dispersion, phase surface area variation, phase diffusion co-efficient, boundary concentration etc. The analytical approach with preliminary results is discussed. The method is postulated to be a foundation for conformal analysis based design of heterogeneous waste form materials.

  15. Standard test method for splitting tensile strength for brittle nuclear waste forms

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1989-01-01

    1.1 This test method is used to measure the static splitting tensile strength of cylindrical specimens of brittle nuclear waste forms. It provides splitting tensile-strength data that can be used to compare the strength of waste forms when tests are done on one size of specimen. 1.2 The test method is applicable to glass, ceramic, and concrete waste forms that are sufficiently homogeneous (Note 1) but not to coated-particle, metal-matrix, bituminous, or plastic waste forms, or concretes with large-scale heterogeneities. Cementitious waste forms with heterogeneities >1 to 2 mm and 5 mm can be tested using this procedure provided the specimen size is increased from the reference size of 12.7 mm diameter by 6 mm length, to 51 mm diameter by 100 mm length, as recommended in Test Method C 496 and Practice C 192. Note 1—Generally, the specimen structural or microstructural heterogeneities must be less than about one-tenth the diameter of the specimen. 1.3 This test method can be used as a quality control chec...

  16. Transferring aviation human factors technology to the nuclear power industry

    International Nuclear Information System (INIS)

    Montemerlo, M.D.

    1981-01-01

    The purpose of this paper is to demonstrate the availability of aviation safety technology and research on problems which are sufficiently similar to those faced by the nuclear power industry that an agressive effort to adapt and transfer that technology and research is warranted. Because of time and space constraints, the scope of this paper is reduced from a discussion of all of aviation safety technology to the human factors of air carrier safety. This area was selected not only because of similarities in the human factors challenges shared by both industries (e.g. selection, training, evaluation, certification, etc.) but because experience in aviation has clearly demonstrated that human error contributes to a substantially greater proportion of accidents and incidents than does equipment failure. The Congress of the United States has placed a great deal of emphasis on investigating and solving human factors problems in aviation. A number of recent examples of this interest and of the resulting actions are described. The opinions of prominent aviation organizations as to the human factors problems most in need of research are presented, along with indications of where technology transfer to the nuclear power industry may be viable. The areas covered include: fatigue, crew size, information transfer, resource management, safety data-bases, the role of automation, voice and data recording systems, crew distractions, the management of safety regulatory agencies, equipment recertification, team training, crew work-load, behavioural factors, human factors of equipment design, medical problems, toxicological factors, the use of simulators for training and certification, determining the causes of human errors, the politics of systems improvement, and importance of both safety and public perception of safety if the industry is to be viable. (author)

  17. Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.

    Science.gov (United States)

    Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu

    2018-01-20

    The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.

  18. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development of...

  19. Dose factors to calculate the radiation exposure due to radioactive waste air from nuclear facilities

    International Nuclear Information System (INIS)

    Brenk, H.D.; Vogt, K.J.

    1977-01-01

    An evaluation of the environmental impact of nuclear plants according to paragraph 45 of the Radiation Protection Directive of the Federal Republic of Germany requires the calculation of dose conversion factors indicating the correlation between the contaminated medium and individual radiation exposure. The present study is to be conceived as a contribution to discussion on this subject. For the determination of radiation exposure caused by the waste air of nuclear plants, models are being specified for computing the dose conversion factors for the external exposure pathways of β-submersion, γ-submersion and γ-radiation from contaminated ground as well as the internal exposure pathways of inhalation and ingestion, which further elaborate and improve the models previously applied, especially as far as the ingestion pathway is concerned, which distinguishes between 6 major food categories. The computer models are applied to those radionuclides which are significan for nuclear emitters, in particular nuclear light-water power stations. The results obtained for the individual exposure pathways and affected organs are specified in the form of tables. For this purpose, calculations were first of all carried out for the so-called 'reference man'. The results can be transferred to population groups with different consumption habits (e.g. vegetarians) by the application of correction factors. The models are capable of being extended with a view to covering other age groups. (orig.) [de

  20. Effects of the d-state quarks on the nucleon electric form factors

    International Nuclear Information System (INIS)

    Oh, Y.J.; Kong, K.J.; Cheon, I.T.

    1987-11-01

    Considering the d-orbital excitation of a quark in the bag, we calculate the nucleon electric form factors in the cloudy bag model. In these calculations, we have taken into account the πNN, πΔN and πγ form factors though neglecting the c.m. correction. It turns out that the neutron charge form factor is very sensitive to the d-state quark admixture in the overall region of the momentum transfer but the proton charge form factor remains unchanged. Taking the d-state quark admixture in the intermediate state baryons, we can obtain the nucleon rms radii in remarkable agreement with the experimental values. We also investigate the roles of Δ particles in the nucleon charge form factors. (author). 20 refs, 10 figs

  1. Future Measurements of the Nucleon Elastic Electromagnetic Form Factors at Jefferson Lab

    Science.gov (United States)

    Gilfoyle, Gerard

    2018-01-01

    The elastic, electromagnetic form factors are fundamental observables that describe the internal structure of protons, neutrons, and atomic nuclei. Jefferson Lab in the United States has completed the 12 GeV Upgrade that will open new opportunities to study the form factors. A campaign to measure all four nucleon form factors (electric and magnetic ones for both proton and neutron) has been approved consisting of seven experiments in Halls A, B, and C. The increased energy of the electron beam will extend the range of precision measurements to higher Q2 for all four form factors together. This combination of measurements will allow for the decomposition of the results into their quark components and guide the development of a QCD-based understanding of nuclei in the non-perturbative regime. I will present more details on the 12 GeV Upgrade, the methods used to measure the form factors, and what we may learn.

  2. Skyrme-model πNN form factor and nucleon-nucleon interaction

    International Nuclear Information System (INIS)

    Holzwarth, G.; Machleidt, R.

    1997-01-01

    We apply the strong πNN form factor, which emerges from the Skyrme model, in the two-nucleon system using a one-boson-exchange (OBE) model for the nucleon-nucleon (NN) interaction. Deuteron properties and phase parameters of NN scattering are reproduced well. In contrast to the form factor of monopole shape that is traditionally used in OBE models, the Skyrme form factor leaves low-momentum transfers essentially unaffected while it suppresses the high-momentum region strongly. It turns out that this behavior is very appropriate for models of the NN interaction and makes it possible to use a soft pion form factor in the NN system. As a consequence, the πN and the NN systems can be described using the same πNN form factor, which is impossible with the monopole. copyright 1997 The American Physical Society

  3. Human Factors Engineering Review Model for advanced nuclear power reactors

    International Nuclear Information System (INIS)

    O'Hara, J.; Higgins, J.; Goodman, C.; Galletti, G.: Eckenrode, R.

    1993-01-01

    One of the major issues to emerge from the initial design reviews under the certification process was that detailed human-systems interface (HSI) design information was not available for staff review. To address the lack of design detail issue. The Nuclear Regulatory Commission (NRC) is performing the design certification reviews based on a design process plan which describes the human factors engineering (HFE) program elements that are necessary and sufficient to develop an acceptable detailed design specification. Since the review of a design process is unprecedented in the nuclear industry. The criteria for review are not addressed by current regulations or guidance documents and. therefore, had to be developed. Thus, an HFE Program Review Model was developed. This paper will describe the model's rationale, scope, objectives, development, general characteristics. and application

  4. Human factors considerations for expert systems in the nuclear industry

    International Nuclear Information System (INIS)

    Nelson, W.R.

    1988-01-01

    This paper discusses the general human factors issues relative to the development and implementation of expert systems for the nuclear industry. It summarizes the relevant research that addresses these issues, and identifies those areas that need the most effort for success. Since much of the prominent work for the application of expert systems has focused on computerized aids for decision making in emergencies, this paper draws from this area for its examples. This area tends to highlight the issues because of the safety-critical nature of the application. The same issues, however, are relevant to other applications of expert systems in the nuclear industry as well, even though the consequences of failure may not be as dramatic

  5. Overview of mineral waste form development for the electrometallurgical treatment of spent nuclear fuel

    International Nuclear Information System (INIS)

    Pereira, C.; Lewis, M.A.; Ackerman, J.P.

    1996-01-01

    Argonne is developing a method to treat spent nuclear fuel in a molten salt electrorefiner. Wastes from this treatment will be converted into metal and mineral forms for geologic disposal. A glass-bonded zeolite is being developed to serve as the mineral waste form that will contain the fission products that accumulate in the electrorefiner salt. Fission products are ion exchanged from the salt into the zeolite A structure. The crystal structure of the zeolite after ion exchange is filled with salt ions. The salt-loaded zeolite A is mixed with glass frit and hot pressed. During hot pressing, the zeolite A may be converted to sodalite which also retains the waste salt. The glass-bonded zeolite is leach resistant. MCC-1 testing has shown that it has a release rate below 1 g/(m 2 day) for all elements

  6. The choice of nuclear material measurement strategy in bulk-form in material balance area

    International Nuclear Information System (INIS)

    Smirnov, V.M.; Sergeev, S.A.; Kirsanov, V.S.

    1999-01-01

    Concepts have been defined such as Shipment batch, Technological batch, and Accounting batch, it has been found that Shipment and Technological batches should be formed through the arrangement of group of measured Accounting batches. The strategy for nuclear material (NM) measurement based on the Accounting batch is shown to give a possibility to use the advantages for the accounting purposes: ensure safeguards of non-diversion of NM at quantitative (numerical) level, which is a higher grade of safeguards compared to the systems of accounting and control now in force of the US and EURATOM; ensure a guaranteed accuracy and reliability (confidence level) when making up NM balance in Material Balance Area (MBA) and at Federal level, which has been realized only in part in the NM control and accounting systems. Strategy of NM measurement for MBAs counting NM in bulk form has been proposed [ru

  7. STAR CLUSTERS IN A NUCLEAR STAR FORMING RING: THE DISAPPEARING STRING OF PEARLS

    Energy Technology Data Exchange (ETDEWEB)

    Väisänen, Petri; Barway, Sudhanshu; Randriamanakoto, Zara, E-mail: petri@saao.ac.za [South African Astronomical Observatory, P.O. Box 9 Observatory, Cape Town (South Africa)

    2014-12-20

    An analysis of the star cluster population in a low-luminosity early-type galaxy, NGC 2328, is presented. The clusters are found in a tight star forming nuclear spiral/ring pattern and we also identify a bar from structural two-dimensional decomposition. These massive clusters are forming very efficiently in the circumnuclear environment and they are young, possibly all less than 30 Myr of age. The clusters indicate an azimuthal age gradient, consistent with a ''pearls-on-a-string'' formation scenario, suggesting bar-driven gas inflow. The cluster mass function has a robust down turn at low masses at all age bins. Assuming clusters are born with a power-law distribution, this indicates extremely rapid disruption at timescales of just several million years. If found to be typical, it means that clusters born in dense circumnuclear rings do not survive to become old globular clusters in non-interacting systems.

  8. STAR CLUSTERS IN A NUCLEAR STAR FORMING RING: THE DISAPPEARING STRING OF PEARLS

    International Nuclear Information System (INIS)

    Väisänen, Petri; Barway, Sudhanshu; Randriamanakoto, Zara

    2014-01-01

    An analysis of the star cluster population in a low-luminosity early-type galaxy, NGC 2328, is presented. The clusters are found in a tight star forming nuclear spiral/ring pattern and we also identify a bar from structural two-dimensional decomposition. These massive clusters are forming very efficiently in the circumnuclear environment and they are young, possibly all less than 30 Myr of age. The clusters indicate an azimuthal age gradient, consistent with a ''pearls-on-a-string'' formation scenario, suggesting bar-driven gas inflow. The cluster mass function has a robust down turn at low masses at all age bins. Assuming clusters are born with a power-law distribution, this indicates extremely rapid disruption at timescales of just several million years. If found to be typical, it means that clusters born in dense circumnuclear rings do not survive to become old globular clusters in non-interacting systems

  9. The scalar and electromagnetic form factors of the nucleon in dispersively improved Chiral EFT

    Energy Technology Data Exchange (ETDEWEB)

    Alarcon, Jose Manuel [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2018-04-01

    We present a method for calculating the nucleon form factors of G-parity-even operators. This method combines chiral effective field theory (χEFT) and dispersion theory. Through unitarity we factorize the imaginary part of the form factors into a perturbative part, calculable with χEFT, and a non-perturbative part, obtained through other methods. We consider the scalar and electromagnetic (EM) form factors of the nucleon. The results show an important improvement compared to standard chiral calculations, and can be used in analysis of the low-energy properties of the nucleon.

  10. Heavy-to-light form factors for non-relativistic bound states

    International Nuclear Information System (INIS)

    Bell, G.; Feldmann, Th.

    2007-01-01

    We investigate transition form factors between non-relativistic QCD bound states at large recoil energy. Assuming the decaying quark to be much heavier than its decay product, the relativistic dynamics can be treated according to the factorization formula for heavy-to-light form factors obtained from the heavy-quark expansion in QCD. The non-relativistic expansion determines the bound-state wave functions to be Coulomb-like. As a consequence, one can explicitly calculate the so-called 'soft-overlap' contribution to the transition form factor

  11. Mineralogy and thermodynamic properties of magnesium phyllosilicates formed during the alteration of a simplified nuclear glass

    Energy Technology Data Exchange (ETDEWEB)

    Debure, Mathieu, E-mail: m.debure@brgm.fr [CEA, DEN, DTCD, SECM, F-30207 Bagnols-sur-Ceze (France); MINES-ParisTech, PSL Research University, Centre de Géosciences, 77305 Fontainebleau (France); De Windt, Laurent [MINES-ParisTech, PSL Research University, Centre de Géosciences, 77305 Fontainebleau (France); Frugier, Pierre; Gin, Stéphane [CEA, DEN, DTCD, SECM, F-30207 Bagnols-sur-Ceze (France); Vieillard, Philippe [IC2MP-CNRS-UMR 7285, 5 Ave. Albert Turpain TSA 51106, 86073 Poitiers Cedex 09 (France)

    2016-07-15

    The precipitation of crystallized magnesium phyllosilicates generally sustains the alteration rate of nuclear waste containment glass. However, glass alteration slows down to a residual rate as soon as Mg disappears from the solution. The identification of the phyllosilicates formed is therefore crucial for modeling the long-term behavior of nuclear glass. This study deals with batch alteration of the simplified nuclear glass ISG in presence of magnesium, and the characterization of the secondary phases. Morphological, chemical and structural analyses (MET, EDX, XRD) were performed to determine the nature and structure of the precipitated phases identified as trioctahedral smectites. Analyses conducted on the secondary phases proved the presence of Al, Na and Ca in the Mg-phyllosilicate phases. Such elements had been suspected but never quantitatively measured. The experimental results were then used to determine the thermodynamic solubility constants for each precipitated secondary phase at various temperatures. The calculated values were consistent with those available for sodium and magnesium saponites in the existing thermodynamic databases. - Highlights: • The international simple glass dissolution rate increases in presence of magnesium. • Mg added in solution combines with Si from glass to yield trioctahedral smectites. • Their calculated logK are close to smectite thermodynamic constants reported in databases. • It confirms assumptions on Mg-silicates phases made in previous geochemical modeling.

  12. Remarks on electromagnetic form factors of hadrons in the quark model

    International Nuclear Information System (INIS)

    Vainshtein, A.I.; Zakharov, V.I.

    1977-01-01

    Relations between the transversal and longitudinal parts of elastic and quasielastic form factors are studied within the quark model. It is shown that for an even number of the constituent quarks the longitudinal part dominates while for an odd number the transversal part is the largest one. Consequences form this result are considered for deuteron form factor and for matrix elements of the electromagnetic transitions between π, rho, A 1 mesons

  13. Leachability of radionuclides from cement solidified waste forms produced at operating nuclear power plants

    International Nuclear Information System (INIS)

    Croney, S.T.

    1985-03-01

    This study determined the leachability indexes of radionuclides contained in solidified liquid wastes from operating nuclear power plants. Different sizes of samples of cement-solidified liquid wastes were collected from two nuclear power plants - a pressurized water reactor and a boiling water reactor - to correlate radionuclide leaching from small- and full-sized (55-gallon) waste forms. Diffusion-based model analysis (ANS 16.1) of measured radionuclide leach data from both small- and full-sized samples was performed and indicate that leach data from small samples can be used to determine leachability indexes for full-sizes waste forms. The leachability indexes for cesium, strontium, and cobalt isotopes were determined for waste samples from both plants according to the models used for ANS 16.1. The leachability indexes for the pressurized water reactor samples were 6.4 for cesium, 7.1 for strontium, and 10.4 for cobalt. Leachability indexes for the boiling water reactor samples were 6.5 for cesium, 8.6 for strontium, and 11.1 for cobalt

  14. Form factors of Ising spin and disorder fields on the Poincare disc

    International Nuclear Information System (INIS)

    Doyon, Benjamin

    2004-01-01

    Using recent results concerning form factors of certain scaling fields in the massive Dirac theory on the Poincare disc, we find expressions for the form factors of Ising spin and disorder fields in the massive Majorana theory on the Poincare disc. In particular, we verify that these recent results agree with the factorization properties of the fields in the Dirac theory representing tensor products of spin and of disorder fields in the Majorana theory

  15. Ceramic Single Phase High-Level Nuclear Waste Forms: Hollandite, Perovskite, and Pyrochlore

    Science.gov (United States)

    Vetter, M.; Wang, J.

    2017-12-01

    The lack of viable options for the safe, reliable, and long-term storage of nuclear waste is one of the primary roadblocks of nuclear energy's sustainable future. The method being researched is the incorporation and immobilization of harmful radionuclides (Cs, Sr, Actinides, and Lanthanides) into the structure of glasses and ceramics. Borosilicate glasses are the main waste form that is accepted and used by today's nuclear industry, but they aren't the most efficient in terms of waste loading, and durability is still not fully understood. Synroc-phase ceramics (i.e. hollandite, perovskite, pyrochlore, zirconolite) have many attractive qualities that glass waste forms do not: high waste loading, moderate thermal expansion and conductivity, high chemical durability, and high radiation stability. The only downside to ceramics is that they are more complex to process than glass. New compositions can be discovered by using an Artificial Neural Network (ANN) to have more options to optimize the composition, loading for performance by analyzing the non-linear relationships between ionic radii, electronegativity, channel size, and a mineral's ability to incorporate radionuclides into its structure. Cesium can be incorporated into hollandite's A-site, while pyrochlore and perovskite can incorporate actinides and lanthanides into their A-site. The ANN is used to predict new compositions based on hollandite's channel size, as well as the A-O bond distances of pyrochlore and perovskite, and determine which ions can be incorporated. These new compositions will provide more options for more experiments to potentially improve chemical and thermodynamic properties, as well as increased waste loading capabilities.

  16. Human and social factors in the transportation of nuclear wastes

    International Nuclear Information System (INIS)

    Freudenburg, W.R.

    1991-01-01

    The main body of this report is a broad-based examination of human and social factors in the transportation of nuclear wastes. It deals with pair interested problems that, while familiar to the social science community, appear to have received little attention from the risk assessment community to data: The human and social attenuation of risk estimates, and the organizational amplification of risks. Second, given the special opportunities for learning that are presented by the recent Alaska oil spill, in particular, the Appendix to this report examines the issue of organizational foresight in the context of the Exxon oil spill

  17. Cerium, uranium, and plutonium behavior in glass-bonded sodalite, a ceramic nuclear waste form

    International Nuclear Information System (INIS)

    Lewis, M. A.; Lexa, D.; Morss, L. R.; Richmann, M. K.

    1999-01-01

    Glass-bonded sodalite is being developed as a ceramic waste form (CWF) to immobilize radioactive fission products, actinides, and salt residues from electrometallurgical treatment of spent nuclear reactor fuel. The CWF consists of about 75 mass % sodalite, 25 mass % glass, and small amounts of other phases. This paper presents some results and interpretation of physical measurements to characterize the CWF structure, and dissolution tests to measure the release of matrix components and radionuclides from the waste form. Tests have been carried out with specimens of the CWF that contain rare earths at concentrations similar to those expected in the waste form. Parallel tests have been carried out on specimens that have uranium or plutonium as well as the rare earths at concentrations similar to those expected in the waste forms; in these specimens UCl 3 forms UO 2 and PuCl 3 forms PuO 2 . The normalized releases of rare earths in dissolution tests were found to be much lower than those of matrix elements (B, Si, Al, Na). When there is no uranium in the CWF, the release of cerium is two to ten times lower than the release of the other rare earths. The low release of cerium may be due to its tetravalent state in uranium-free CWF. However, when there is uranium in the CWF, the release of cerium is similar to that of the other rare earths. This trivalent behavior of cerium is attributed to charge transfer or covalent interactions among cerium, uranium, and oxygen in (U,Ce)O 2

  18. A Factor Analytic Study of the Coopersmith Self-Esteem Inventory Adult Short Form.

    Science.gov (United States)

    Haines, Janet; Wilson, George V.

    1988-01-01

    A factor analysis was conducted on the Coopersmith Self-Esteem Inventory-Adult Short Form using 237 college students and 43 female office workers in Australia. Factors were found corresponding with three of the four subscales: general self, social self-peers, and home-parents (family). No factor related to the school-academic (work) subscale. (SLD)

  19. Nucleon electromagnetic form factors using lattice simulations at the physical point

    International Nuclear Information System (INIS)

    Alexandrou, C.; Cyprus Univ., Nicosia; Constantinou, M.; Hadjiyiannakou, K.; Kallidonis, C.; Koutsou, G.; Jansen, K.; Vaquero Aviles-Casco, A.

    2017-01-01

    We present results for the nucleon electromagnetic form factors using an ensemble of maximally twisted mass clover-improved fermions with pion mass of about 130 MeV. We use multiple sink-source separations and three analysis methods to probe ground-state dominance. We evaluate both the connected and disconnected contributions to the nucleon matrix elements. We find that the disconnected quark loop contributions to the isoscalar matrix elements are small giving an upper bound of up to 2% of the connected and smaller than its statistical error. We present results for the isovector and isoscalar electric and magnetic Sachs form factors and the corresponding proton and neutron form factors. By fitting the momentum dependence of the form factors to a dipole form or to the z-expansion we extract the nucleon electric and magnetic radii, as well as, the magnetic moment. We compare our results to experiment as well as to other recent lattice QCD calculations.

  20. Nucleon electromagnetic form factors using lattice simulations at the physical point

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrou, C. [The Cyprus Institute, Nicosia (Cyprus). Computation-based Science and Technology Research Center; Cyprus Univ., Nicosia (Cyprus). Dept. of Physics; Constantinou, M. [Temple Univ., Philadelphia, PA (United States). Dept. of Physics; Hadjiyiannakou, K.; Kallidonis, C.; Koutsou, G. [The Cyprus Institute, Nicosia (Cyprus). Computation-based Science and Technology Research Center; Jansen, K. [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany). John von Neumann-Inst. fuer Computing NIC; Vaquero Aviles-Casco, A. [Utah Univ., Salt Lake City, UT (United States). Dept. of Physics and Astronomy

    2017-09-20

    We present results for the nucleon electromagnetic form factors using an ensemble of maximally twisted mass clover-improved fermions with pion mass of about 130 MeV. We use multiple sink-source separations and three analysis methods to probe ground-state dominance. We evaluate both the connected and disconnected contributions to the nucleon matrix elements. We find that the disconnected quark loop contributions to the isoscalar matrix elements are small giving an upper bound of up to 2% of the connected and smaller than its statistical error. We present results for the isovector and isoscalar electric and magnetic Sachs form factors and the corresponding proton and neutron form factors. By fitting the momentum dependence of the form factors to a dipole form or to the z-expansion we extract the nucleon electric and magnetic radii, as well as, the magnetic moment. We compare our results to experiment as well as to other recent lattice QCD calculations.

  1. Factors affecting the cost and competitiveness of nuclear electricity

    International Nuclear Information System (INIS)

    Bertel, E.; Stevens, G.H.

    1996-01-01

    The general context in which are carried out the investment choices of the electric sector has evolved in a significant way during these last years and the changes are to a certain extent irreversible. Economic globalization, deregulation of the electricity market, privatisation of electricity producers, and increasing awareness of environmental issues are modifying the policy-making landscape and the criteria and priorities of decision-makers in the power sector. Competitiveness remains a cornerstone for evaluating and choosing alternative technologies in the process of planning and decision-making for electricity system expansion or power plant replacement. Nevertheless, the production costs analysis inserts factors which were not taking before into account as for instance social impacts, health and environmental effects. These new approaches better reveal the total costs of the different production means. They will certainly lead to different choices than those based on the whole comparison of direct costs supported by producers. The economic studies carried out by the Nuclear Energy Agency of the OECD (NEA) cover all the preceding aspects and give objective information on the competitiveness of nuclear electricity. The nuclear industry has today the necessary means to take up the challenges of the electricity new markets. (O.M.)

  2. Studies on human factors in nuclear power plants

    International Nuclear Information System (INIS)

    Tsukuda, H.; Miyaoka, S.

    1988-01-01

    In order to raise the reliability and safety of nuclear power plants to the highest possible level, improvements to the mechanical system alone are not sufficient. Human factors must be systematically analysed and the causes and mechanisms of human error clarified to allow the development of countermeasures that will reduce error as much as possible. The paper introduces research in two areas, fundamental clarification of human behavioural, physiological and psychological characteristics to aid in the development of preventive measures for reducing error, and studies involving analysis of actual cases of accidents and failures related to man along with development of countermeasures to prevent the recurrence of such cases. The paper especially considers the latter area. The Human Performance Evaluation System (HPES) developed by the Institute of Nuclear Power Operations (INPO) in the USA was applied on a trial basis to 31 recent accidents and failures at Japanese nuclear power plants. The effectiveness of and possible improvement to HPES were considered. Also, cases that were not directly linked to accidents or failures were analysed using a method developed independently in Japan using data collected from a survey of approximately 3,000 power plant personnel. Fundamental research on human behaviour, physiology and psychology are also introduced. (author). 4 figs

  3. An experimental survey of the factors that affect leaching from low-level radioactive waste forms

    International Nuclear Information System (INIS)

    Dougherty, D.R.; Pietrzak, R.F.; Fuhrmann, M.; Colombo, P.

    1988-09-01

    This report represents the results of an experimental survey of the factors that affect leaching from several types of solidified low-level radioactive waste forms. The goal of these investigations was to determine those factors that accelerate leaching without changing its mechanism(s). Typically, although not in every case,the accelerating factors include: increased temperature, increased waste loading (i.e., increased waste to binder ratio), and decreased size (i.e., decreased waste form volume to surface area ratio). Additional factors that were studied were: increased leachant volume to waste form surface area ratio, pH, leachant composition (groundwaters, natural and synthetic chelating agents), leachant flow rate or replacement frequency and waste form porosity and surface condition. Other potential factors, including the radiation environment and pressure, were omitted based on a survey of the literature. 82 refs., 236 figs., 13 tabs

  4. Asymptotic behavior of composite-particle form factors and the renormalization group

    International Nuclear Information System (INIS)

    Duncan, A.; Mueller, A.H.

    1980-01-01

    Composite-particle form factors are studied in the limit of large momentum transfer Q. It is shown that in models with spinor constituents and either scalar or gauge vector gluons, the meson electromagnetic form factor factorizes at large Q 2 and is given by independent light-cone expansions on the initial and final meson legs. The coefficient functions are shown to satisfy a Callan-Symanzik equation. When specialized to quantum chromodynamics, this equation leads to the asymptotic formula of Brodsky and Lepage for the pion electromagnetic form factor. The nucleon form factors G/sub M/(Q 2 ), G/sub E/(Q 2 ) are also considered. It is shown that momentum flows which contribute to subdominant logarithms in G/sub M/(Q 2 ) vitiate a conventional renormalization-group interpretation for this form factor. For large Q 2 , the electric form factor G/sub E/(Q 2 ) fails to factorize, so that a renormalization-group treatment seems even more unlikely in this case

  5. Human Factors Considerations in New Nuclear Power Plants: Detailed Analysis.

    Energy Technology Data Exchange (ETDEWEB)

    OHara,J.; Higgins, J.; Brown, W.; Fink, R.

    2008-02-14

    This Nuclear Regulatory Commission (NRC) sponsored study has identified human-performance issues in new and advanced nuclear power plants. To identify the issues, current industry developments and trends were evaluated in the areas of reactor technology, instrumentation and control technology, human-system integration technology, and human factors engineering (HFE) methods and tools. The issues were organized into seven high-level HFE topic areas: Role of Personnel and Automation, Staffing and Training, Normal Operations Management, Disturbance and Emergency Management, Maintenance and Change Management, Plant Design and Construction, and HFE Methods and Tools. The issues where then prioritized into four categories using a 'Phenomena Identification and Ranking Table' methodology based on evaluations provided by 14 independent subject matter experts. The subject matter experts were knowledgeable in a variety of disciplines. Vendors, utilities, research organizations and regulators all participated. Twenty issues were categorized into the top priority category. This Brookhaven National Laboratory (BNL) technical report provides the detailed methodology, issue analysis, and results. A summary of the results of this study can be found in NUREG/CR-6947. The research performed for this project has identified a large number of human-performance issues for new control stations and new nuclear power plant designs. The information gathered in this project can serve as input to the development of a long-term strategy and plan for addressing human performance in these areas through regulatory research. Addressing human-performance issues will provide the technical basis from which regulatory review guidance can be developed to meet these challenges. The availability of this review guidance will help set clear expectations for how the NRC staff will evaluate new designs, reduce regulatory uncertainty, and provide a well-defined path to new nuclear power plant

  6. Comparison of different boost transformations for the calculation of form factors in relativistic quantum mechanics

    International Nuclear Information System (INIS)

    Theussl, L.; Noguera, S.; Amghar, A.; Desplanques, B.

    2003-01-01

    The effect of different boost expressions, pertinent to the instant, front and point forms of relativistic quantum mechanics, is considered for the calculation of the ground-state form factor of a two-body system in simple scalar models. Results with a Galilean boost as well as an explicitly covariant calculation based on the Bethe-Salpeter approach are given for comparison. It is found that the present so-called point-form calculations of form factors strongly deviate from all the other ones. This suggests that the formalism which underlies them requires further elaboration. A proposition in this sense is made. (author)

  7. A measurement of the space-like pion electromagnetic form factor

    International Nuclear Information System (INIS)

    Amendolia, S.R.; Badelek, B.; Batignani, G.; Bedeschi, F.; Bertolucci, E.; Bettoni, D.; Bosisio, L.; Bradaschia, C.; Dell'Orso, M.; Fidecaro, F.; Foa, L.; Focardi, E.; Giazotto, A.; Giorgi, M.A.; Marrocchesi, P.S.; Menzione, A.; Ristori, L.; Scribano, A.; Tonelli, G.; Triggiani, G.; Codino, A.; Enorini, M.; Fabbri, F.L.; Laurelli, P.; Satta, L.; Spillantini, P.; Zallo, A.

    1986-01-01

    The pion form factor has been measured in the space-like q 2 region 0.014 to 0.26 (GeV/c) 2 by scattering 300 GeV pions from the electrons of a liquid hydrogen target. A detailed description is given of the apparatus, data analysis and corrections to the data. The mean square charge radius extracted from the data is model-dependent. We find that a form which includes a realistic description of the form factor phase gives a similar result to the naive pole form, and conclude π 2 >=0.439±0.008 fm 2 . (orig.)

  8. Strange mesons and kaon-to-pion transition form factors from holography

    International Nuclear Information System (INIS)

    Abidin, Zainul; Carlson, Carl E.

    2009-01-01

    We present a calculation of the K l3 transition form factors using the AdS/QCD correspondence. We also solidify and extend our ability to calculate quantities in the flavor-broken versions of AdS/QCD. The normalization of the form factors is a crucial ingredient for extracting |V us | from data, and the results obtained here agree well with results from chiral perturbation theory and lattice gauge theory. The slopes and curvature of the form factors agree well with the data, and with what results are available from other methods of calculation.

  9. The B → D*lv form factor at zero recoil

    International Nuclear Information System (INIS)

    Simone, J.N.; Hashimoto, S.; El-Khadra, A.X.; Kronfeld, A.S.; Mackenzie, P.B.; Ryan, S.M.

    2000-01-01

    We describe a model independent lattice QCD method for determining the deviation from unity for h A1 (1), the B → D*lv form factor at zero recoil. We extend the double ratio method previously used to determine the B → Dlv form factor. The bulk of statistical and systematic errors cancel in the double ratios we consider, yielding form factors which promise to reduce present theoretical uncertainties in the determination of parallel V cb parallel. We present results from a prototype calculation at a single lattice spacing corresponding to β = 5.7

  10. Delta and Omega electromagnetic form factors in a Dyson-Schwinger/Bethe-Salpeter approach

    Energy Technology Data Exchange (ETDEWEB)

    Diana Nicmorus, Gernot Eichmann, Reinhard Alkofer

    2010-12-01

    We investigate the electromagnetic form factors of the Delta and the Omega baryons within the Poincare-covariant framework of Dyson-Schwinger and Bethe-Salpeter equations. The three-quark core contributions of the form factors are evaluated by employing a quark-diquark approximation. We use a consistent setup for the quark-gluon dressing, the quark-quark bound-state kernel and the quark-photon interaction. Our predictions for the multipole form factors are compatible with available experimental data and quark-model estimates. The current-quark mass evolution of the static electromagnetic properties agrees with results provided by lattice calculations.

  11. On form factors of the conjugated field in the non-linear Schroedinger model

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.K.

    2011-05-15

    Izergin-Korepin's lattice discretization of the non-linear Schroedinger model along with Oota's inverse problem provides one with determinant representations for the form factors of the lattice discretized conjugated field operator. We prove that these form factors converge, in the zero lattice spacing limit, to those of the conjugated field operator in the continuous model. We also compute the large-volume asymptotic behavior of such form factors in the continuous model. These are in particular characterized by Fredholm determinants of operators acting on closed contours. We provide a way of defining these Fredholm determinants in the case of generic paramaters. (orig.)

  12. On the large-Q2 behavior of the pion transition form factor

    Directory of Open Access Journals (Sweden)

    Gernot Eichmann

    2017-11-01

    Full Text Available We study the transition of non-perturbative to perturbative QCD in situations with possible violations of scaling limits. To this end we consider the singly- and doubly-virtual pion transition form factor π0→γγ at all momentum scales of symmetric and asymmetric photon momenta within the Dyson–Schwinger/Bethe–Salpeter approach. For the doubly virtual form factor we find good agreement with perturbative asymptotic scaling laws. For the singly-virtual form factor our results agree with the Belle data. At very large off-shell photon momenta we identify a mechanism that introduces quantitative modifications to Efremov–Radyushkin–Brodsky–Lepage scaling.

  13. Interaction between droplets in a ternary microemulsion evaluated by the relative form factor method

    International Nuclear Information System (INIS)

    Nagao, Michihiro; Seto, Hideki; Yamada, Norifumi L.

    2007-01-01

    This paper describes the concentration dependence of the interaction between water droplets coated by a surfactant monolayer using the contrast variation small-angle neutron scattering technique. In the first part, we explain the idea of how to extract a relatively model free structure factor from the scattering data, which is called the relative form factor method. In the second part, the experimental results for the shape of the droplets (form factor) are described. In the third part the relatively model free structure factor is shown, and finally the concentration dependence of the interaction potential between droplets is discussed. The result indicates the validity of the relative form factor method, and the importance of the estimation of the model free structure factor to discuss the nature of structure formation in microemulsion systems

  14. Evolution of {sup 99}Tc Species in Cementitious Nuclear Waste Form

    Energy Technology Data Exchange (ETDEWEB)

    Um, Woo Yong; Westsik, Joseph H. [Pacific Northwest National Laboratory, Richland (United States)

    2011-05-15

    Technetium (Tc) is produced in large quantities as a fission product during the irradiation of {sup 235}U-enriched fuel for commercial power production and plutonium genesis for nuclear weapons. The most abundant isotope of Tc present in the wastes is {sup 99}Tc because of its high fission yield ({approx}6%) and long half-life (2.13x10{sup 5} years). During the Cold War era, generation of fissile {sup 239}Pu for use in America's atomic weapons arsenal yielded nearly 1900 kg of {sup 99}Tc at the U.S. Department of Energy's (DOE) Hanford Site in southeastern Washington State. Most of this {sup 99}Tc is present in fuel reprocessing wastes temporarily stored in underground tanks awaiting retrieval and permanent disposal. After the wastes are retrieved from the storage tanks, the bulk of the high-level waste (HLW) and lowactivity waste (LAW) stream is scheduled to be converted into a borosilicate glass waste form that will be disposed of in a shallow burial facility called the Integrated Disposal Facility (IDF) at the Hanford Site. Even with careful engineering controls, volatilization of a fraction of Tc during the vitrification of both radioactive waste streams is expected. Although this volatilized Tc can be captured in melter off-gas scrubbers and returned to the melter, some of the Tc is expected to become part of the secondary waste stream from the vitrification process. The off-gas scrubbers downstream from the melters will generate a high pH, sodium-ammonium carbonate solution containing the volatilized Tc and other fugitive species. Effective and cost-efficient disposal of Tc found in the off-gas scrubber solution remains difficult. A cementitious waste form (Cast Stone) is one of the nuclear waste form candidates being considered to solidify the secondary radioactive liquid waste that will be generated by the operation of the waste treatment plant (WTP) at the Hanford Site. Because Tc leachability from the waste form is closely related with Tc

  15. Inhibition of CRM1-mediated nuclear export of transcription factors by leukemogenic NUP98 fusion proteins.

    Science.gov (United States)

    Takeda, Akiko; Sarma, Nayan J; Abdul-Nabi, Anmaar M; Yaseen, Nabeel R

    2010-05-21

    NUP98 is a nucleoporin that plays complex roles in the nucleocytoplasmic trafficking of macromolecules. Rearrangements of the NUP98 gene in human leukemia result in the expression of numerous fusion oncoproteins whose effect on nucleocytoplasmic trafficking is poorly understood. The present study was undertaken to determine the effects of leukemogenic NUP98 fusion proteins on CRM1-mediated nuclear export. NUP98-HOXA9, a prototypic NUP98 fusion, inhibited the nuclear export of two known CRM1 substrates: mutated cytoplasmic nucleophosmin and HIV-1 Rev. In vitro binding assays revealed that NUP98-HOXA9 binds CRM1 through the FG repeat motif in a Ran-GTP-dependent manner similar to but stronger than the interaction between CRM1 and its export substrates. Two NUP98 fusions, NUP98-HOXA9 and NUP98-DDX10, whose fusion partners are structurally and functionally unrelated, interacted with endogenous CRM1 in myeloid cells as shown by co-immunoprecipitation. These leukemogenic NUP98 fusion proteins interacted with CRM1, Ran, and the nucleoporin NUP214 in a manner fundamentally different from that of wild-type NUP98. NUP98-HOXA9 and NUP98-DDX10 formed characteristic aggregates within the nuclei of a myeloid cell line and primary human CD34+ cells and caused aberrant localization of CRM1 to these aggregates. These NUP98 fusions caused nuclear accumulation of two transcription factors, NFAT and NFkappaB, that are regulated by CRM1-mediated export. The nuclear entrapment of NFAT and NFkappaB correlated with enhanced transcription from promoters responsive to these transcription factors. Taken together, the results suggest a new mechanism by which NUP98 fusions dysregulate transcription and cause leukemia, namely, inhibition of CRM1-mediated nuclear export with aberrant nuclear retention of transcriptional regulators.

  16. A novel waste form for disposal of spent-nuclear-fuel reprocessing waste: A vitrifiable cement

    International Nuclear Information System (INIS)

    Gougar, M.L.D.; Scheetz, B.E.; Siemer, D.D.

    1999-01-01

    A cement capable of being hot isostatically pressed into a glass ceramic has been proposed as the waste form for spent-nuclear-fuel reprocessing wastes at the Idaho National Engineering and Environmental Laboratory (INEEL). This intermediate cement, with a composition based on that of common glasses, has been designed and tested. The cement formulations included mixed INEEL wastes, blast furnace slag, reactive silica, and INEEL soil or vermiculite, which were activated with potassium or sodium hydroxide. Following autoclave processing, the cements were characterized. X-ray diffraction analysis revealed three notable crystalline phases: quartz, calcite, and fluorite. Results of compressive strength testing ranged from 1452 and 4163 psi, exceeding the US Nuclear Regulatory Commission (NRC)-suggested standard of >500 psi. From American National Standards Institute/American Nuclear Society 16.1-1986 leach testing, effective diffusivities for Cs were determined to be on the order of 10 -11 to 10 -10 cm 2 /s and for Sr were 10 -12 cm 2 /s, which are four orders of magnitude less than diffusivities in some other radwaste materials. Average leach indices (LI) were 9.6 and 11.9 for Cs and Sr, respectively, meeting the NRC Standard of LI > 6. The 28-day Materials Characterization Center-1 leach testing resulted in normalized elemental mass losses between 0.63 and 28 g/(m 2 ·day) for Cs and between 0.34 and 0.70 g/(m 2 ·day) industry-accepted standard while Cs losses indicate a process sensitive parameter

  17. Meson form factors and covariant three-dimensional formulation of composite model

    International Nuclear Information System (INIS)

    Skachkov, N.B.; Solovtsov, I.L.

    1978-01-01

    An approach is developed which is applied in the framework of the relativistic quark model to obtain explicit expressions for meson form factors in terms of covariant wave functions of the two-quark system. These wave functions obey the two-particle quasipotential equation in which the relative motion of quarks is singled out in a covariant way. The exact form of the wave functions is found using the transition to the relativistic configurational representation with the help of the harmonic analysis on the Lorentz group instead of the usual Fourier expansion and then solving the relativistic difference equation thus obtained. The expressions found for form factors are transformed into the three-dimensional covariant form which is a direct geometrical relativistic generalization of analogous expressions of the nonrelativistic quantum mechanics and provides the decrease of the meson form factor by the Fsub(π)(t) approximately t -1 law as -t infinity, in the Coulomb field

  18. Use of Emanation Thermal Analysis in the characterization of nuclear waste forms and their alteration products

    International Nuclear Information System (INIS)

    Balek, V; Malek, Z.; Banba, T.; Mitamura, H.; Vance, E.R.

    1999-01-01

    Emanation Thermal Analysis (ETA) was used for the characterization of thermal behavior of two nuclear waste glasses, basalt volcanic glass and perovskite ceramics before and after hydrolytic treatment. The release of radon, formed by the spontaneous α-decay of 228 Th and 224 Ra and incorporated into samples to a maximum depth of 100 nm from the surface due to the recoil, was measured during heating of the samples from 20 to 1200degC and subsequent cooling. Temperatures of the annealing of surface roughness, micro-cracks and other defects, produced by manufacture and/or by subsequent treatment of glass and ceramic samples, were determined using the ETA. Microstructure changes of glass corrosion accompanying their dehydration and thermal decomposition were characterized by the radon release rate changes. The effect of hydrolytic alteration on the thermal behavior of the nuclear waste glass was revealed by ETA in an early corrosion stage. In the alteration product of the perovskite ceramics the diffusion mobility of radon was assessed in the temperature range 1000-1200degC. The thermal stability of radiation-induced defects in perovskite ceramic powder bombarded by He + ions to doses of 10 14 and 10 16 ions/cm 2 was determined by means of ETA. (author)

  19. Effect of irradiation on the evolution of alteration layer formed during nuclear glass leaching

    International Nuclear Information System (INIS)

    Mougnaud, Sarah

    2016-01-01

    High-level radioactive waste (HLW) remaining after spent nuclear fuel reprocessing is immobilized within a glass matrix, eventually destined for geological disposal. Water intrusion into the repository is expected after several thousand years. The alteration of a non-radioactive surrogate for nuclear glass has been extensively studied and it has been determined that successive leaching mechanisms lead to the formation of a 'passivating' alteration layer and to the establishment of a residual rate regime in the long term. However, glass packages are submitted to the radioactivity of confined radioelements. This work focuses on the influence of irradiation on the alteration layer formed during the residual rate regime, in a structural and mechanistic point of view. Three focal areas have been selected. Non-radioactive simple glasses have been leached and externally irradiated in order to determine modifications induced by electronic effects (irradiations with electrons and alpha particles). The same type of glass samples have been previously irradiated with heavy ions and their leaching behavior have been studied in order to assess the impact of ballistic dose cumulated by the glass before water intrusion. Leaching behavior of a complex radioactive glass, doped with an alpha-emitter, has been studied to consider a more realistic situation. (author) [fr

  20. Gamma-radiolysis effects on leaching of nuclear fuel waste forms

    International Nuclear Information System (INIS)

    Tait, J.C.; Wilkin, D.L.; Hamon, R.F.

    1986-06-01

    Gamma-radiolysis experiments have been conducted on aqueous systems representative of those that might be found in a granite rock disposal vault for immobilized nuclear fuel recycle waste. Sealed capsules containing an air or an oxygen-free atmosphere, synthetic granite or chloride groundwaters, and components of the disposal system (granite, clay, metal containers and glass or glass-ceramic waste form) were irradiated by an external gamma field. Analysis of the gas phase showed the presence of H 2 gas in all capsules. Capsules containing graphite and air showed oxygen depletion. This depletion of O 2 is attributed to radiolytic reactions with iron species leached from the granite. Systems containing bentonite clay showed the production of CO 2 . A computer program, MAKSIMA-CHEMIST, was used to qualitatively predict the observed gas-phase composition by modelling the kinetics of the aqueous radiolysis reactions

  1. Determination of chemical forms of 14C in liquid discharges from nuclear power plants.

    Science.gov (United States)

    Svetlik, I; Fejgl, M; Povinec, P P; Kořínková, T; Tomášková, L; Pospíchal, J; Kurfiřt, M; Striegler, R; Kaufmanová, M

    2017-10-01

    Developments of radioanalytical methods for determination of radiocarbon in wastewaters from nuclear power plants (NPP) with pressurized light water reactors, which would distinguish between the dissolved organic and inorganic forms have been carried out. After preliminary tests, the method was used to process pilot samples from wastewater outlets from the Temelín and Dukovany NPPs (Czech Republic). The results of analysis of pilot water samples collected in 2015 indicate that the instantaneous 14 C releases into the water streams would be about 7.10 -5 (Temelín) and 4.10 -6 (Dukovany) of the total quantity of the 14 C liberated into the environment. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Relativistic corrections to the form factors of Bc into P-wave orbitally excited charmonium

    Science.gov (United States)

    Zhu, Ruilin

    2018-06-01

    We investigated the form factors of the Bc meson into P-wave orbitally excited charmonium using the nonrelativistic QCD effective theory. Through the analytic computation, the next-to-leading order relativistic corrections to the form factors were obtained, and the asymptotic expressions were studied in the infinite bottom quark mass limit. Employing the general form factors, we discussed the exclusive decays of the Bc meson into P-wave orbitally excited charmonium and a light meson. We found that the relativistic corrections lead to a large correction for the form factors, which makes the branching ratios of the decay channels B (Bc ± →χcJ (hc) +π± (K±)) larger. These results are useful for the phenomenological analysis of the Bc meson decays into P-wave charmonium, which shall be tested in the LHCb experiments.

  3. Applicability of perturbative QCD and NLO power corrections for the pion form factor

    International Nuclear Information System (INIS)

    Yeh Tsungwen

    2002-01-01

    As is well recognized, the asymptotic of the perturbative QCD prediction for the pion form factor is much smaller than the upper end of the data. We investigate this problem. We first evaluate the next-to-leading-order (NLO) power correction for the pion form factor. The corrected form factor contains nonperturbative parameters which are determined from a χ 2 fit to the data. Interpreting these parameters leads to the fact that the involved strong interaction coupling constant should be identified as an effective coupling constant under a nonperturbative QCD vacuum. If the scale associated with the effective coupling constant is identified as 2 Q 2 , then Q 2 , the momentum transfer square for the pion form factor to be measured, can have a value about 1 GeV 2 , and , the averaged momentum fraction variable, can locate around 0.5. This circumstance is consistent with the asymptotic model for the pion wave function

  4. Study of the electromagnetic form factors of Helium-3 and Tritium nuclei by electron scattering

    International Nuclear Information System (INIS)

    Amroun, A.

    1989-01-01

    Accurate measurements of the tritium electromagnetic form factor demonstrated that, when the exchange currents are included, the theoretical and the experimental data are in agreement. Similar calculations carried out on helium-3 were not satisfactory. In this investigation, a new electromagnetic form factor of helium-3 is measured. The transfer zone of the diffraction spectra concerning the first minimum and the second maximum is considered. The aim of the study is to test on both nuclei the validity and the uncertainties of the models. The scattering of electrons on helium-3 is analyzed. The experiment was performed in the Saclay linear accelerator. The isoscalar and isovector form factors could be differentiated. By comparing the theoretical and the experimental data, it is demonstrated that the use of three body forces in the calculations has no effect on the form factor results [fr

  5. The proton electromagnetic form factor F2 and quark orbital angular ...

    Indian Academy of Sciences (India)

    Protein; electromagnetic form factors; perturbative QCD; quark orbital angular momentum. ... Failures of the ASD approach to correctly predict ex- perimental ... The success of the formalism is the correct prediction of the Q2 scaling behavior of ...

  6. The three-loop form factor in N=4 super Yang-Mills theory

    Energy Technology Data Exchange (ETDEWEB)

    Gehrmann, Thomas [Universitaet Zuerich (Switzerland); Henn, Johannes [IAS Princeton (United States); Huber, Tobias [Universitaet Siegen (Germany)

    2012-07-01

    We present the calculation of the Sudakov form factor in N=4 super Yang-Mills theory to the three-loop order. At leading colour, the latter is expressed in terms of planar and non-planar loop integrals. We show that it is possible to choose a representation in which each loop integral has uniform transcendentality in the Riemann {zeta}-function. We comment on the expected exponentiation of the infrared divergences and the values of the three-loop cusp and collinear anomalous dimensions in dimensional regularisation. We also compare the form factor in N=4 super Yang-Mills to the leading transcendentality pieces of the quark and gluon form factor in QCD. Finally, we investigate the ultraviolet properties of the form factor in D>4 dimensions.

  7. Inelastic magnetic electron scattering form factors of the 26 Mg nucleus

    Indian Academy of Sciences (India)

    Magnetic electron scattering (3) form factors with core polarization effects, ... to 3+ states of the 26Mg nucleus have been studied using shell model calculations. ... The wave functions of the radial single-particle matrix elements have been ...

  8. Constraints on the [Formula: see text] form factor from analyticity and unitarity.

    Science.gov (United States)

    Ananthanarayan, B; Caprini, I; Kubis, B

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic [Formula: see text] form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the [Formula: see text] form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around [Formula: see text].

  9. Virtual photons in the pion form factors and the energy-momentum tensor

    Energy Technology Data Exchange (ETDEWEB)

    Kubis, Bastian E-mail: b.kubis@fz-juelich.de; Meissner, Ulf-G. E-mail: ulf-g.meissner@fz-juelich.de

    2000-05-22

    We evaluate the vector and scalar form factor of the pion in the presence of virtual photons at next-to-leading order in two-flavor chiral perturbation theory. We also consider the scalar and tensor pion form factors of the energy-momentum tensor. We find that the intrinsic electromagnetic corrections are very small for the vector as well as the charged pion scalar form factor. The scalar radius of the neutral pion is reduced by two percent. We perform infrared regularization by considering electron-positron annihilation into pions and the decay of a light Higgs boson into a pion pair. We discuss the detector resolution dependent contributions to the various form factors and pion radii.

  10. Constraints on the ωπ form factor from analyticity and unitarity

    International Nuclear Information System (INIS)

    Ananthanarayan, B.; Caprini, I.; Kubis, B.

    2014-01-01

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)

  11. Virtual photons in the pion form factors and the energy-momentum tensor

    International Nuclear Information System (INIS)

    Kubis, Bastian; Meissner, Ulf-G.

    2000-01-01

    We evaluate the vector and scalar form factor of the pion in the presence of virtual photons at next-to-leading order in two-flavor chiral perturbation theory. We also consider the scalar and tensor pion form factors of the energy-momentum tensor. We find that the intrinsic electromagnetic corrections are very small for the vector as well as the charged pion scalar form factor. The scalar radius of the neutral pion is reduced by two percent. We perform infrared regularization by considering electron-positron annihilation into pions and the decay of a light Higgs boson into a pion pair. We discuss the detector resolution dependent contributions to the various form factors and pion radii

  12. Constraints on the ωπ form factor from analyticity and unitarity

    Energy Technology Data Exchange (ETDEWEB)

    Ananthanarayan, B. [Indian Institute of Science, Centre for High Energy Physics, Bangalore (India); Caprini, I. [Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O.B. MG-6, Magurele (Romania); Kubis, B. [Universitaet Bonn, Helmholtz-Institut fuer Strahlen-und Kernphysik (Theorie) and Bethe Center for Theoretical Physics, Bonn (Germany)

    2014-12-01

    Motivated by the discrepancies noted recently between the theoretical calculations of the electromagnetic ωπ form factor and certain experimental data, we investigate this form factor using analyticity and unitarity in a framework known as the method of unitarity bounds. We use a QCD correlator computed on the spacelike axis by operator product expansion and perturbative QCD as input, and exploit unitarity and the positivity of its spectral function, including the two-pion contribution that can be reliably calculated using high-precision data on the pion form factor. From this information, we derive upper and lower bounds on the modulus of the ωπ form factor in the elastic region. The results provide a significant check on those obtained with standard dispersion relations, confirming the existence of a disagreement with experimental data in the region around 0.6 GeV. (orig.)

  13. Model for next-to-leading order threshold resummed form factors

    International Nuclear Information System (INIS)

    Aglietti, Ugo; Ricciardi, Giulia

    2004-01-01

    We present a model for next-to-leading order resummed threshold form factors based on a timelike coupling recently introduced in the framework of small x physics. Improved expressions for the form factors in N-space are obtained which are not plagued by Landau-pole singularities, as the included absorptive effects - usually neglected - act as regulators. The physical reason is that, because of faster decay of gluon jets, there is not enough resolution time to observe the Landau pole. Our form factors reduce to the standard ones when the absorptive parts related to the coupling are neglected. The inverse transform from N-space to x-space can be done directly without any prescription and we obtain analytical expressions for the form factors, which are well defined in all x-space

  14. Electric form factors of the octet baryons from lattice QCD and chiral extrapolation

    International Nuclear Information System (INIS)

    Shanahan, P.E.; Thomas, A.W.; Young, R.D.; Zanotti, J.M.; Pleiter, D.; Stueben, H.

    2014-03-01

    We apply a formalism inspired by heavy baryon chiral perturbation theory with finite-range regularization to dynamical 2+1-flavor CSSM/QCDSF/UKQCD Collaboration lattice QCD simulation results for the electric form factors of the octet baryons. The electric form factor of each octet baryon is extrapolated to the physical pseudoscalar masses, after finite-volume corrections have been applied, at six fixed values of Q 2 in the range 0.2-1.3 GeV 2 . The extrapolated lattice results accurately reproduce the experimental form factors of the nucleon at the physical point, indicating that omitted disconnected quark loop contributions are small. Furthermore, using the results of a recent lattice study of the magnetic form factors, we determine the ratio μ p G E p /G M p . This quantity decreases with Q 2 in a way qualitatively consistent with recent experimental results.

  15. Effects of Velocity-Dependent Force on the Magnetic Form Factors of Odd-Z Nuclei

    International Nuclear Information System (INIS)

    Tie-Kuang, Dong; Zhong-Zhou, Ren

    2008-01-01

    We investigate the effects of the velocity-dependent force on the magnetic form factors and magnetic moments of odd-Z nuclei. The form factors are calculated with the harmonic-oscillator wavefunctions. It is found that the contributions of the velocity-dependent force manifest themselves in the very large momentum transfer region (q ≥ 4fm- 1 ). In the low and medium q region the contributions of the velocity-dependent force are very small compared with those without this force. However, in the high-q region the contributions of the velocity-dependent force are larger than the normal form factors. The diffraction structures beyond the existing experimental data are found after the contributions of the velocity-dependent force are included. The formula of the correction to the single particle magnetic moment due to the velocity-dependent force is reproduced exactly in the long-wavelength limit (q = 0) of the M1 form factor

  16. Asymptotic dynamics of QCD, coherent states and the quark form factor

    International Nuclear Information System (INIS)

    Steiner, F.; Dahmen, H.D.

    1980-05-01

    The method of asymptotic dynamics for large times developed by Kulish and Fadde'ev for QED is applied to QCD. We study the solution and calculate the on shell quark form factor in leading logarithmic order. (orig.)

  17. Extrapolation of π-meson form factor, zeros in the analyticity domain

    International Nuclear Information System (INIS)

    Morozov, P.T.

    1978-01-01

    The problem of a stable extrapolation from the cut to an arbitrary interior of the analyticity domain for the pion form factor is formulated and solved. As it is shown a stable solution can be derived if module representations with the Karleman weight function are used as the analyticity conditions. The case when the form factor has zeros is discussed. If there are zeros in the complex plane they must be taken into account when determining the extrapolation function

  18. Measurement of the energy dependence of the form factor $f_{+}$ in $K^{0}_{e3}$ decay

    CERN Document Server

    Apostolakis, Alcibiades J; Backenstoss, Gerhard; Bargassa, P; Behnke, O; Benelli, A; Bertin, V; Blanc, F; Bloch, P; Carlson, P J; Carroll, M; Cawley, E; Chertok, M B; Danielsson, M; Dejardin, M; Derré, J; Ealet, A; Eleftheriadis, C; Fetscher, W; Fidecaro, Maria; Filipcic, A; Francis, D; Fry, J; Gabathuler, Erwin; Gamet, R; Gerber, H J; Go, A; Haselden, A; Hayman, P J; Henry-Coüannier, F; Hollander, R W; Jon-And, K; Kettle, P R; Kokkas, P; Kreuger, R; Le Gac, R; Leimgruber, F; Mandic, I; Manthos, N; Marel, Gérard; Mikuz, M; Miller, J; Montanet, François; Müller, A; Nakada, Tatsuya; Pagels, B; Papadopoulos, I M; Pavlopoulos, P; Polivka, G; Rickenbach, R; Roberts, B L; Ruf, T; Schäfer, M; Schaller, L A; Schietinger, T; Schopper, A; Tauscher, Ludwig; Thibault, C; Touchard, F; Touramanis, C; van Eijk, C W E; Vlachos, S; Weber, P; Wigger, O; Wolter, M; Zavrtanik, D; Zimmerman, D

    2000-01-01

    Neutral-kaon decays to \\pielnu\\ % recorded by the CPLEAR experimentwere analysed to determine the $q^2$ dependence of the \\Kzet\\ electroweak form factor $f_+$. Based on $365\\,612$ events,this form factor was found to have a linear dependence on $q^2$with a slope $\\lambda_+ = 0.0245 \\pm 0.0012_{\\text{stat}} \\pm 0.0022_{\\text{syst}}$.

  19. Relativistic two-fermion equations with form factors and anomalous magnetic moment interactions

    International Nuclear Information System (INIS)

    Ahmed, S.

    1977-04-01

    Relativistic equations for two-fermion systems are derived from quantum field theory taking into account the form factors of the particles. When the q 2 dependence of the form factors is disregarded, in the static approximation, the two-fermion equations with Coulomb and anomalous magnetic moment interactions are obtained. Separating the angular variables, a sixteen-component relativistic radial equation are finally given

  20. Proton and neutron charge form factors in soliton model with dilaton-quarkonium fields

    International Nuclear Information System (INIS)

    Magar, E.N.; Nikolaev, V.A.; Tkachev, O.G.; Novozhilov, V.Yu.

    1997-01-01

    Nucleon electromagnetic form factors are considered in the framework of the generalized Skyrme model with dilaton-quarkonium fields. In our first publication we got big discrepancy between calculated form factors and dipole approximation formula. Here we have reasonably good accordance between them in finite impulse region after vector meson dominance has been taken into account. Omega- and rho-mesons have been included only into hadron structure of the photon

  1. Expansion of X-ray form factor for close shell using uncorrelated wave function

    Energy Technology Data Exchange (ETDEWEB)

    AL-Robayi, Enas M. [Babylon University , College of Science for Women, laser Physics Department, Hilla (Iraq)

    2013-12-16

    The atomic scattering factor has been studied for Be+ve, and B+2ve ions using the uncorrelated wave function (Hartree-Fock (HF)) for inter particle electronic shells. The physical importance of this factor appears in its relation to several important atomic properties as, the coherent scattering intensity, the total scattering intensity, the incoherent scattering function, the coherent scattering cross section, the total incoherent cross section, the nuclear magnetic shielding constant, the geometrical structure factor. Also there is one atomic properties the one particle radial density distribution function D(r)has been studied using the partitioning technique.

  2. U1 small nuclear RNA variants differentially form ribonucleoprotein particles in vitro.

    Science.gov (United States)

    Somarelli, Jason A; Mesa, Annia; Rodriguez, Carol E; Sharma, Shalini; Herrera, Rene J

    2014-04-25

    The U1 small nuclear (sn)RNA participates in splicing of pre-mRNAs by recognizing and binding to 5' splice sites at exon/intron boundaries. U1 snRNAs associate with 5' splice sites in the form of ribonucleoprotein particles (snRNPs) that are comprised of the U1 snRNA and 10 core components, including U1A, U1-70K, U1C and the 'Smith antigen', or Sm, heptamer. The U1 snRNA is highly conserved across a wide range of taxa; however, a number of reports have identified the presence of expressed U1-like snRNAs in multiple species, including humans. While numerous U1-like molecules have been shown to be expressed, it is unclear whether these variant snRNAs have the capacity to form snRNPs and participate in splicing. The purpose of the present study was to further characterize biochemically the ability of previously identified human U1-like variants to form snRNPs and bind to U1 snRNP proteins. A bioinformatics analysis provided support for the existence of multiple expressed variants. In vitro gel shift assays, competition assays, and immunoprecipitations (IPs) revealed that the variants formed high molecular weight assemblies to varying degrees and associated with core U1 snRNP proteins to a lesser extent than the canonical U1 snRNA. Together, these data suggest that the human U1 snRNA variants analyzed here are unable to efficiently bind U1 snRNP proteins. The current work provides additional biochemical insights into the ability of the variants to assemble into snRNPs. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Meson form factors and covariant three-dimensional formulation of the composite model

    International Nuclear Information System (INIS)

    Skachkov, N.B.; Solovtsov, I.L.

    1979-01-01

    An apparatus is developed which allows within the relativistic quark model, to find explicit expressions for meson form factors in terms of the wave functions of two-quark system that obey the covariant two-particle quasipotential equation. The exact form of wave functions is obtained by passing to the relativistic configurational representation. As an example, the quark Coulomb interaction is considered

  4. Proton electromagnetic form factors: present status and future perspectives at PANDA

    Directory of Open Access Journals (Sweden)

    Tomasi-Gustafsson E.

    2015-01-01

    Full Text Available Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt. Measurements of the reaction p̅ + p → e+ + e− by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold, through the reaction p̅ + p → e+ + e− + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  5. Light meson form factors at high Q2 from lattice QCD

    Science.gov (United States)

    Koponen, Jonna; Zimermmane-Santos, André; Davies, Christine; Lepage, G. Peter; Lytle, Andrew

    2018-03-01

    Measurements and theoretical calculations of meson form factors are essential for our understanding of internal hadron structure and QCD, the dynamics that bind the quarks in hadrons. The pion electromagnetic form factor has been measured at small space-like momentum transfer |q2| theory is applicable. This leaves a gap in the intermediate Q2 where the form factors are not known. As a part of their 12 GeV upgrade Jefferson Lab will measure pion and kaon form factors in this intermediate region, up to Q2 of 6 GeV2. This is then an ideal opportunity for lattice QCD to make an accurate prediction ahead of the experimental results. Lattice QCD provides a from-first-principles approach to calculate form factors, and the challenge here is to control the statistical and systematic uncertainties as errors grow when going to higher Q2 values. Here we report on a calculation that tests the method using an ηs meson, a 'heavy pion' made of strange quarks, and also present preliminary results for kaon and pion form factors. We use the nf = 2 + 1 + 1 ensembles made by the MILC collaboration and Highly Improved Staggered Quarks, which allows us to obtain high statistics. The HISQ action is also designed to have small dicretisation errors. Using several light quark masses and lattice spacings allows us to control the chiral and continuum extrapolation and keep systematic errors in check. Warning, no authors found for 2018EPJWC.17506016.

  6. Cutting through form factors and cross sections of non-protected operators in N=4 SYM

    International Nuclear Information System (INIS)

    Nandan, Dhritiman; Sieg, Christoph; Wilhelm, Matthias; Yang, Gang

    2015-01-01

    We study the form factors of the Konishi operator, the prime example of non-protected operators in N=4 SYM theory, via the on-shell unitarity method. Since the Konishi operator is not protected by supersymmetry, its form factors share many features with amplitudes in QCD, such as the occurrence of rational terms and of UV divergences that require renormalization. A subtle point is that this operator depends on the spacetime dimension. This requires a modification when calculating its form factors via the on-shell unitarity method. We derive a rigorous prescription that implements this modification to all loop orders and obtain the two-point form factor up to two-loop order and the three-point form factor to one-loop order. From these form factors, we construct an IR-finite cross-section-type quantity, namely the inclusive decay rate of the (off-shell) Konishi operator to any final (on-shell) state. Via the optical theorem, it is connected to the imaginary part of the two-point correlation function. We extract the Konishi anomalous dimension up to two-loop order from it.

  7. Critical opalescence of the pion field and the M1 form factor of 12C: An investigation of the role of the rho meson

    International Nuclear Information System (INIS)

    Delorme, J.; Figureau, A.; Giraud, N.

    1980-01-01

    It is shown that the inelastic M1 form factor of 12 C can be interpreted by nuclear polarization phenomena with inclusion of the rho meson in the polarizing interaction playing an essential role at large momenta. Whereas much of the observed anomaly can be attributed to standard core polarization effects, a large opalescence of the pion field (a factor 4.5 enhancement) would be needed to get full agreement with experiment. (orig.)

  8. Critical opalescence of the pion field and the M1 form factor of 12C: an investigation of the role of the rho meson

    International Nuclear Information System (INIS)

    Delorme, J.; Figureau, A.; Giraud, A.

    1979-11-01

    It is shown that the inelastic M1 form factor of 12 C can be interpreted by nuclear polarization phenomena with inclusion of the rho meson in the polarizing interaction playing an essential role at large momenta. Whereas much of the observed anomaly can be attributed to standard core polarization effects, a large opalescence of the pion field (a factor 4.5 enhancement) would be needed to get full agreement with experiment

  9. Single-Spin Polarization Effects and the Determination of Timelike Proton Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Brodsky, S

    2003-10-24

    We show that measurements of the proton's polarization in e{sup +}e{sup -} {yields} p{bar p} strongly discriminate between analytic forms of models which fit the proton form factors in the spacelike region. In particular, the single-spin asymmetry normal to the scattering plane measures the relative phase difference between the timelike G{sub E} and G{sub M} form factors. The expected proton polarization in the timelike region is large, of order of several tens of percent.

  10. arXiv Isothermal compressibility of hadronic matter formed in relativistic nuclear collisions

    CERN Document Server

    Mukherjee, Maitreyee; Chatterjee, Arghya; Chatterjee, Sandeep; Adhya, Souvik Priyam; Thakur, Sanchari; Nayak, Tapan K.

    We present the first estimates of isothermal compressibility (\\kT) of hadronic matter formed in relativistic nuclear collisions (\\sNN=7.7~GeV to 2.76~TeV) using experimentally observed quantities. \\kT~is related to the fluctuation in particle multiplicity, temperature and volume of the system formed in the collisions. Multiplicity fluctuations are obtained from the event-by-event distributions of charged particle multiplicities in narrow centrality bins. The dynamical components of the fluctuations are extracted by removing the contributions to the fluctuations from the number of participating nucleons. From the available experimental data, a constant value of \\kT~has been observed as a function of collision energy. The results are compared with calculations from UrQMD, AMPT and EPOS event generators, and estimations of \\kT~are made for Pb-Pb collisions at the CERN Large Hadron Collider. A hadron resonance gas (HRG) model has been used to calculate \\kT~as a function of collision energy. Our results show a dec...

  11. Factor Structure and Psychometric Properties of the Young Schema Questionnaire (Short Form) in Chinese Undergraduate Students

    Science.gov (United States)

    Cui, Lixia; Lin, Wenwen; Oei, Tian P. S.

    2011-01-01

    This study investigated cross-cultural differences in the factor structure and psychometric properties of the Young Schema Questionnaire (short form; YSQ-SF). The participants were 712 Chinese undergraduate students. The total sample was randomly divided into two sub-samples. Exploratory Factor Analysis (EFA) was conducted on questionnaire results…

  12. Spontaneous magnetization of quantum XY-chain from finite chain form-factor

    International Nuclear Information System (INIS)

    Iorgov, N.Z.

    2010-01-01

    Using the explicit factorized formulas for matrix elements (form-factors) of the spin operators between vectors of the Hamiltonian of a finite quantum XY-chain in a transverse field, the spontaneous magnetization for σ x and σ y is re-derived in a simple way.

  13. Multilevel Confirmatory Factor Analysis of the Teacher My Class Inventory-Short Form

    Science.gov (United States)

    Villares, Elizabeth; Mariani, Melissa; Sink, Christopher A.; Colvin, Kimberly

    2016-01-01

    Researchers analyzed data from elementary teachers (N = 233) to further establish the psychometric soundness of the Teacher My Class Inventory-Short Form. Supporting previous psychometric research, confirmatory factor analyses findings supported the factorial validity of the hypothesized five-factor solution. Internal reliability estimates were…

  14. Influence factors on etching rate of PET nuclear pore membrane

    International Nuclear Information System (INIS)

    Zuo Zhenzhong; Wu Zhendong; Liang Haiying; Ju Wei; Chen Dongfeng; Fu Yuanyong; Qu Guopu

    2014-01-01

    Background: The nuclear pore membrane is a kind of liquid filtration material manufactured by irradiation and chemical etching. Various conditions in etch process have a great influence on etch rate. Purpose: The influence factors of concentration and temperature of etch solution and the irradiation energy of heavy ions on etch rate was studied. Methods: Four layers of PET (polyethylene terephthalate) films were stacked together and were irradiated with 140-MeV 32 S ions at room temperature under vacuum conditions. Utilizing conductivity measurement technique, the electrical current changes through the u:radiated PET film were monitored during etching, from which the breakthrough time and therefore the track etching rate was calculated. Results: The results show that there is an exponential correlation between etch rate and temperature, and a linear correlation between etch rate and concentration. The track etching rate increases linearly with energy loss rate. Empirical formula for the bulk etching rate as a function of etchant concentration and temperature was also established via fitting of measurements. Conclusion: It is concluded that by using 1.6-MeV·u -1 32 S ions, PET nuclear pore membrane with cylindrical pore shape can be prepared at 85℃ with etchant concentration of l mol·L -1 . (authors)

  15. A human factors design of a nuclear plant analyzer

    Energy Technology Data Exchange (ETDEWEB)

    Byeon, Seung Nam; Lee, Dong Hoon; Park, Chan Woo [Kyounghee Univ., Seoul (Korea, Republic of)

    2000-12-15

    The project consists of four key stages as follows : based on the review of various literature, human factors design principles and processes are identified, the literature reviewed in the project includes NUREG-0700, research papers for MMI, human factors handbooks, and laboratory reports, after the design principles and processes are determined, a design checklist is developed to evaluate the user interface of NPA, the design checklist consists of seven different categories such as display screen, menu interface, form-fillin, alphanumeric characters, symbols, color, and highlighting, NPA was tested with the design checklist for conformance to the human factors design principles, the expert reviews are performed to evaluate a graphic user interface of NPA, the application of the design checklist and the subjective opinion of the expert identify the design included in the user interface of NPA, based on the thorough analysis of design defects, design guidelines are recommended to improve the user interface of NPA.

  16. A human factors design of a nuclear plant analyzer

    International Nuclear Information System (INIS)

    Byeon, Seung Nam; Lee, Dong Hoon; Park, Chan Woo

    2000-12-01

    The project consists of four key stages as follows : based on the review of various literature, human factors design principles and processes are identified, the literature reviewed in the project includes NUREG-0700, research papers for MMI, human factors handbooks, and laboratory reports, after the design principles and processes are determined, a design checklist is developed to evaluate the user interface of NPA, the design checklist consists of seven different categories such as display screen, menu interface, form-fillin, alphanumeric characters, symbols, color, and highlighting, NPA was tested with the design checklist for conformance to the human factors design principles, the expert reviews are performed to evaluate a graphic user interface of NPA, the application of the design checklist and the subjective opinion of the expert identify the design included in the user interface of NPA, based on the thorough analysis of design defects, design guidelines are recommended to improve the user interface of NPA

  17. Electromagnetic and axial-vector form factors of the quarks and nucleon

    Science.gov (United States)

    Dahiya, Harleen; Randhawa, Monika

    2017-11-01

    In light of the improved precision of the experimental measurements and enormous theoretical progress, the nucleon form factors have been evaluated with an aim to understand how the static properties and dynamical behavior of nucleons emerge from the theory of strong interactions between quarks. We have analyzed the vector and axial-vector nucleon form factors (GE,Mp,n(Q2) and GAp,n(Q2)) using the spin observables in the chiral constituent quark model (χCQM) which has made a significant contribution to the unraveling of the internal structure of the nucleon in the nonperturbative regime. We have also presented a comprehensive analysis of the flavor decomposition of the form factors (GEq(Q2), GMq(Q2) and GAq(Q2) for q = u,d,s) within the framework of χCQM with emphasis on the extraction of the strangeness form factors which are fundamental to determine the spin structure and test the chiral symmetry breaking effects in the nucleon. The Q2 dependence of the vector and axial-vector form factors of the nucleon has been studied using the conventional dipole form of parametrization. The results are in agreement with the available experimental data.

  18. Charge form factors and alpha-cluster internal structure of 12C

    International Nuclear Information System (INIS)

    Luk'yanov, V.K.; Zemlyanaya, E.V.; Kadrev, D.N.; Antonov, A.N.; Spasova, K.; Anagnostatos, G.S.; Ginis, P.; Giapitzakis, J.

    1999-01-01

    The transition densities and form factors of 0 + , 2 + , and 3 - states in 12 C are calculated in alpha-cluster model using the triangle frame with clusters in the vertices. The wave functions of nucleons in the alpha clusters are taken as they were obtained in the framework of the models used for the description of the 4 He form factor and momentum distribution which are based on the one-body density matrix construction. They contain effects of the short-range NN correlations, as well as the d-shell admixtures in 4 He. Calculations and the comparison with the experimental data show that visible effects on the form and magnitude of the 12 C form factors take place, especially at relatively large momentum transfers

  19. DEVELOPMENT OF CERAMIC WASTE FORMS FOR AN ADVANCED NUCLEAR FUEL CYCLE

    Energy Technology Data Exchange (ETDEWEB)

    Marra, J.; Billings, A.; Brinkman, K.; Fox, K.

    2010-11-30

    A series of ceramic waste forms were developed and characterized for the immobilization of a Cesium/Lanthanide (CS/LN) waste stream anticipated to result from nuclear fuel reprocessing. Simple raw materials, including Al{sub 2}O{sub 3} and TiO{sub 2} were combined with simulated waste components to produce multiphase ceramics containing hollandite-type phases, perovskites (particularly BaTiO{sub 3}), pyrochlores and other minor metal titanate phases. Three fabrication methodologies were used, including melting and crystallizing, pressing and sintering, and Spark Plasma Sintering (SPS), with the intent of studying phase evolution under various sintering conditions. X-Ray Diffraction (XRD) and Scanning Electron Microscopy coupled with Energy Dispersive Spectroscopy (SEM/EDS) results showed that the partitioning of the waste elements in the sintered materials was very similar, despite varying stoichiometry of the phases formed. Identification of excess Al{sub 2}O{sub 3} via XRD and SEM/EDS in the first series of compositions led to a Phase II study, with significantly reduced Al{sub 2}O{sub 3} concentrations and increased waste loadings. The Phase II compositions generally contained a reduced amount of unreacted Al{sub 2}O{sub 3} as identified by XRD. Chemical composition measurements showed no significant issues with meeting the target compositions. However, volatilization of Cs and Mo was identified, particularly during melting, since sintering of the pressed pellets and SPS were performed at lower temperatures. Partitioning of some of the waste components was difficult to determine via XRD. SEM/EDS mapping showed that those elements, which were generally present in small concentrations, were well distributed throughout the waste forms.

  20. The NE11 experiment at SLAC and the neutron form factors

    International Nuclear Information System (INIS)

    Stuart, L.M.; Lung, A.; Bosted, P.E.

    1993-05-01

    The neutron electromagnetic form factors G En and G Mn , which reflect the charge and magnetization distributions within the neutron, are of fundamental importance for understanding nucleon structure, and are necessary for calculations of processes involving the electromagnetic interaction with complex nuclei. These quantities are functions of Q 2 , the four-momentum transfer squared. SLAC experiment NE11 has measured these form factors out to a Q 2 of 4.0 (GeV/c) 2 with high precision, and the results have been recently published. This paper provides some additional details on the extraction of G Mn and G En from the NE11 measurements. Several formalisms have been developed over the years which attempt to understand the nucleon form factors using basic physical principles. Vector Meson Dominance (VMD) models are based on superpositions of photon couplings to various vector mesons. These models generally involve free parameters which are fit to form factor data at low Q 2 , and are not expected to be valid at high Q 2 . For asymptotically large Q 2 , dimensional scaling methods and perturbative Quantum Chromodynamics (pQCD) predict form factor behavior at large Q 2 , but they do not make absolute magnitude predictions. To describe the form factor behavior at intermediate values of Q 2 , a hybrid model by Gari and Kruempelmann (GK) uses VMD constraints at low Q 2 and pQCD constraints at high Q 2 . Free parameters in the model are adjusted to fit existing form factor data. Other approaches include the use of QCD sum rules to make absolute predictions, diquark models, and relativistic constituent quark models

  1. Study of the in-medium nucleon electromagnetic form factors using a light-front nucleon wave function combined with the quark-meson coupling model

    Science.gov (United States)

    de Araújo, W. R. B.; de Melo, J. P. B. C.; Tsushima, K.

    2018-02-01

    We study the nucleon electromagnetic (EM) form factors in symmetric nuclear matter as well as in vacuum within a light-front approach using the in-medium inputs calculated by the quark-meson coupling model. The same in-medium quark properties are used as those used for the study of in-medium pion properties. The zero of the proton EM form factor ratio in vacuum, the electric to magnetic form factor ratio μpGEp (Q2) /GMp (Q2) (Q2 = -q2 > 0 with q being the four-momentum transfer), is determined including the latest experimental data by implementing a hard constituent quark component in the nucleon wave function. A reasonable fit is achieved for the ratio μpGEp (Q2) /GMp (Q2) in vacuum, and we predict that the Q02 value to cross the zero of the ratio to be about 15 GeV2. In addition the double ratio data of the proton EM form factors in 4He and H nuclei, [GEp4He (Q2) /G4HeMp (Q2) ] / [GEp1H (Q2) /GMp1H (Q2) ], extracted by the polarized (e → ,e‧ p →) scattering experiment on 4He at JLab, are well described. We also predict that the Q02 value satisfying μpGEp (Q02) /GMp (Q0 2) = 0 in symmetric nuclear matter, shifts to a smaller value as increasing nuclear matter density, which reflects the facts that the faster falloff of GEp (Q2) as increasing Q2 and the increase of the proton mean-square charge radius. Furthermore, we calculate the neutron EM form factor double ratio in symmetric nuclear matter for 0.1 neutron double ratio is enhanced relative to that in vacuum, while for the proton it is quenched, and agrees with an existing theoretical prediction.

  2. Data on the electromagnetic pion form factor and p-wave

    International Nuclear Information System (INIS)

    Dubnicka, S.; Meshcheryakov, V.A.; Milko, J.

    1980-01-01

    The pion form factor absolute value data (free of the omega meson contribution) are unified with the P-wave isovector ππ phase shift. The resultant real and imaginary parts of the pion form factor are described by means of the Pade approximation. All the data, which involve the pion form factor experimental points from the range of momenta - 0.8432 GeV 2 2 , the pion charge radius, and the P-wave isovector ππ phase shift in the elastic region (including also the generally accepted value of the scattering length) are mutually consistent. The data themselves through the Pade approximation reveal that the aforementioned consistency can be achieved only if the pion form factor left-hand cut from the second Riemann sheet is taken into account. Almost in all of the considered Pade approximations one stable pion form factor zero is found in the space-like region, which might indicate the existence of a diffraction minimum in the differential cross section for elastic e - π scattering as a consequence of the constituent structure of the pion like in the case of the electron elastic scattering on nuclei

  3. Feasibility studies of time-like proton electromagnetic form factors at PANDA-FAIR

    Energy Technology Data Exchange (ETDEWEB)

    Dbeyssi, Alaa; Capozza, Luigi; Deiseroth, Malte; Froehlich, Bertold; Khaneft, Dmitry; Mora Espi, Maria Carmen; Noll, Oliver; Rodriguez Pineiro, David; Valente, Roserio; Zambrana, Manuel; Zimmermann, Iris [Helmholtz-Institut Mainz, Mainz (Germany); Maas, Frank [Helmholtz-Institut Mainz, Mainz (Germany); Institute of Nuclear Physics, Mainz (Germany); PRISMA Cluster of Excellence, Mainz (Germany); Marchand, Dominique; Tomasi-Gustafsson, Egle; Wang, Ying [Institut de Physique Nucleaire, Orsay (France); Collaboration: PANDA-Collaboration

    2015-07-01

    Electromagnetic form factors are fundamental quantities which describe the intrinsic electric and magnetic distributions of hadrons. Time-like proton form factors are experimentally accessible through the annihilation processes anti p+p <-> e{sup +}+e{sup -}. Their measurement in the time-like region had been limited by the low statistics achieved by the experiments. This contribution reports on the results of Monte Carlo simulations for future measurements of electromagnetic proton form factors at PANDA (antiProton ANnihilation at DArmstadt). In frame of the PANDARoot software, the statistical precision at which the proton form factors will be determined is estimated. The signal (anti p+p → e{sup +}+e{sup -}) identification and the suppression of the main background process (anti p+p → π{sup +}+π{sup -}) are studied. Different methods have been used and/or developed to generate and analyse the processes of interest. The results show that time-like proton form factors will be measured at PANDA with unprecedented statistical accuracy.

  4. How well do we know the electromagnetic form factors of the proton?

    International Nuclear Information System (INIS)

    Arrington, J.

    2003-01-01

    Several experiments have extracted proton electromagnetic form factors from elastic cross section measurements using the Rosenbluth technique. Global analyses of these measurements indicate approximate scaling of the electric and magnetic form factors (μ p G E p /G M p ≅1), in contrast to recent polarization transfer measurements from Jefferson Lab. We present here a global reanalysis of the cross section data aimed at understanding the disagreement between the Rosenbluth extraction and the polarization transfer data. We find that the individual cross section measurements are self-consistent, and that the new global analysis yields results that are still inconsistent with polarization measurements. This discrepancy indicates a fundamental problem in one of the two techniques, or a significant error in polarization transfer or cross section measurements. An error in the polarization data would imply a large error in the extracted electric form factor, while an error in the cross sections implies an uncertainty in the extracted form factors, even if the form factor ratio is measured exactly

  5. Factors contributing to the nuclear caloric curve aspect

    International Nuclear Information System (INIS)

    Raduta, Al.H.; Raduta, Ad.R.

    1999-01-01

    After the first experimental evaluation of the nuclear caloric curve a large amount of theoretical work was concentrated to reproduce the transition-like plateau of the caloric curve from 5 MeV temperature. Both dynamical and statistical models have been employed in order to deduce the excitation energy dependence of the temperature of the equilibrated nuclear systems formed in violent heavy ion collisions. For describing such kind of systems a microcanonical model fully obeying the involved physical constrains seems to be the most appropriate option. However, the currently used statistical multifragmentation models (SMM and MMMC ) are not fully satisfying the microcanonical rules. For these reasons the nuclear caloric curve is studied in the present work from the point of view of a sharp microcanonical model. In this respect a detailed analysis concerning the contribution of the various energetic degrees of freedom (binding, Coulomb repulsive and internal excitation) to the curve aspect is performed. The method adopted here consists in suppressing each of the above-mentioned degrees of freedom once at a time keeping the rest of the system parameters unchanged. The Coulomb repulsive (V) and excitation (ε) degrees of freedom are suppressed by fixing the respective energies to zero. The binding degree of freedom (B) is 'suppressed' by fixing it to the constant value of - 8.5 MeV/nucleon for all fragments. The effect of the correlation between the Coulomb repulsive and the excitation degrees of freedom on the caloric curve aspect is also studied. The resulting caloric curves are denoted T -V , T -ε , T -B , T -Vε . One may observe that the suppression of the excitation degree of freedom has the effect of lifting and diminishing the plateau and the suppression of the Coulomb degree of freedom is lowering the plateau and almost washes-out the plateau-like region. The spectacular effect concerns the complementary moves T -Vε and - B: While the Vε couple suppression

  6. Ceramic nuclear waste forms. II. A ceramic-waste composite prepared by hot pressing. Progress report and preprint

    International Nuclear Information System (INIS)

    McCarthy, G.J.

    1975-01-01

    A feasibility study was conducted to determine whether nuclear waste calcine and a crystalline ceramic matrix can be fabricated by hot pressing into a composite waste form with suitable leaching resistance and thermal stability. It was found that a hard, dense composite could be formed using the typical commercial waste formulation PW-4b and a matrix of α-quartz with a small amount of a lead borosilicate glass added as a consolidation aide. Its density, waste loading, and leaching resistance are comparable to the glasses currently being considered for fixation of nuclear wastes. The hot pressed composite offers a closer approach to thermodynamic stability and improved thermal stability (in monolithic form) compared to glass waste forms. Recommendations for further optimization of the hot pressed waste form are given. (U.S.)

  7. Incorporating organizational factors into probabilistic safety assessment of nuclear power plants through canonical probabilistic models

    Energy Technology Data Exchange (ETDEWEB)

    Galan, S.F. [Dpto. de Inteligencia Artificial, E.T.S.I. Informatica (UNED), Juan del Rosal, 16, 28040 Madrid (Spain)]. E-mail: seve@dia.uned.es; Mosleh, A. [2100A Marie Mount Hall, Materials and Nuclear Engineering Department, University of Maryland, College Park, MD 20742 (United States)]. E-mail: mosleh@umd.edu; Izquierdo, J.M. [Area de Modelado y Simulacion, Consejo de Seguridad Nuclear, Justo Dorado, 11, 28040 Madrid (Spain)]. E-mail: jmir@csn.es

    2007-08-15

    The {omega}-factor approach is a method that explicitly incorporates organizational factors into Probabilistic safety assessment of nuclear power plants. Bayesian networks (BNs) are the underlying formalism used in this approach. They have a structural part formed by a graph whose nodes represent organizational variables, and a parametric part that consists of conditional probabilities, each of them quantifying organizational influences between one variable and its parents in the graph. The aim of this paper is twofold. First, we discuss some important limitations of current procedures in the {omega}-factor approach for either assessing conditional probabilities from experts or estimating them from data. We illustrate the discussion with an example that uses data from Licensee Events Reports of nuclear power plants for the estimation task. Second, we introduce significant improvements in the way BNs for the {omega}-factor approach can be constructed, so that parameter acquisition becomes easier and more intuitive. The improvements are based on the use of noisy-OR gates as model of multicausal interaction between each BN node and its parents.

  8. Incorporating organizational factors into probabilistic safety assessment of nuclear power plants through canonical probabilistic models

    International Nuclear Information System (INIS)

    Galan, S.F.; Mosleh, A.; Izquierdo, J.M.

    2007-01-01

    The ω-factor approach is a method that explicitly incorporates organizational factors into Probabilistic safety assessment of nuclear power plants. Bayesian networks (BNs) are the underlying formalism used in this approach. They have a structural part formed by a graph whose nodes represent organizational variables, and a parametric part that consists of conditional probabilities, each of them quantifying organizational influences between one variable and its parents in the graph. The aim of this paper is twofold. First, we discuss some important limitations of current procedures in the ω-factor approach for either assessing conditional probabilities from experts or estimating them from data. We illustrate the discussion with an example that uses data from Licensee Events Reports of nuclear power plants for the estimation task. Second, we introduce significant improvements in the way BNs for the ω-factor approach can be constructed, so that parameter acquisition becomes easier and more intuitive. The improvements are based on the use of noisy-OR gates as model of multicausal interaction between each BN node and its parents

  9. Factors relevant to the sealing of nuclear facilities

    International Nuclear Information System (INIS)

    1991-05-01

    This report reviews and summaries the factors to be considered in the design, construction and surveillance of confinement structures for damaged nuclear facilities. General engineering, design and environmental considerations are included, both from the standpoint of the mitigation of near-term effects by virtue of interim confinement, and from the standpoint of the acceptability of the structure for long-term confinement. Factors which influence optimization of the design and the construction sequence are reviewed, including the nature of the accident, natural conditions of the site, and thermal and radiation effects. Safety criteria are presented from the standpoint of regulatory requirements, radiological consequences, and monitoring/surveillance requirements for both interim and long-term confinement. Methodologies related to concrete fabrication technology and other construction techniques appropriate for building confinement structures are discussed. Long-term considerations relative to the future of the site for in-place storage/disposal of the waste, and possible future reuse of the site are also included

  10. Feasibility studies of time-like proton electromagnetic form factors at overlinePANDA at FAIR

    Science.gov (United States)

    Singh, B.; Erni, W.; Krusche, B.; Steinacher, M.; Walford, N.; Liu, B.; Liu, H.; Liu, Z.; Shen, X.; Wang, C.; Zhao, J.; Albrecht, M.; Erlen, T.; Fink, M.; Heinsius, F.; Held, T.; Holtmann, T.; Jasper, S.; Keshk, I.; Koch, H.; Kopf, B.; Kuhlmann, M.; Kümmel, M.; Leiber, S.; Mikirtychyants, M.; Musiol, P.; Mustafa, A.; Pelizäus, M.; Pychy, J.; Richter, M.; Schnier, C.; Schröder, T.; Sowa, C.; Steinke, M.; Triffterer, T.; Wiedner, U.; Ball, M.; Beck, R.; Hammann, C.; Ketzer, B.; Kube, M.; Mahlberg, P.; Rossbach, M.; Schmidt, C.; Schmitz, R.; Thoma, U.; Urban, M.; Walther, D.; Wendel, C.; Wilson, A.; Bianconi, A.; Bragadireanu, M.; Caprini, M.; Pantea, D.; Patel, B.; Czyzycki, W.; Domagala, M.; Filo, G.; Jaworowski, J.; Krawczyk, M.; Lisowski, F.; Lisowski, E.; Michałek, M.; Poznański, P.; Płażek, J.; Korcyl, K.; Kozela, A.; Kulessa, P.; Lebiedowicz, P.; Pysz, K.; Schäfer, W.; Szczurek, A.; Fiutowski, T.; Idzik, M.; Mindur, B.; Przyborowski, D.; Swientek, K.; Biernat, J.; Kamys, B.; Kistryn, S.; Korcyl, G.; Krzemien, W.; Magiera, A.; Moskal, P.; Pyszniak, A.; Rudy, Z.; Salabura, P.; Smyrski, J.; Strzempek, P.; Wronska, A.; Augustin, I.; Böhm, R.; Lehmann, I.; Nicmorus Marinescu, D.; Schmitt, L.; Varentsov, V.; Al-Turany, M.; Belias, A.; Deppe, H.; Dzhygadlo, R.; Ehret, A.; Flemming, H.; Gerhardt, A.; Götzen, K.; Gromliuk, A.; Gruber, L.; Karabowicz, R.; Kliemt, R.; Krebs, M.; Kurilla, U.; Lehmann, D.; Löchner, S.; Lühning, J.; Lynen, U.; Orth, H.; Patsyuk, M.; Peters, K.; Saito, T.; Schepers, G.; Schmidt, C. J.; Schwarz, C.; Schwiening, J.; Täschner, A.; Traxler, M.; Ugur, C.; Voss, B.; Wieczorek, P.; Wilms, A.; Zühlsdorf, M.; Abazov, V.; Alexeev, G.; Arefiev, V. A.; Astakhov, V.; Barabanov, M. Yu.; Batyunya, B. V.; Davydov, Y.; Dodokhov, V. Kh.; Efremov, A.; Fechtchenko, A.; Fedunov, A. G.; Galoyan, A.; Grigoryan, S.; Koshurnikov, E. K.; Lobanov, Y. Yu.; Lobanov, V. I.; Makarov, A. F.; Malinina, L. V.; Malyshev, V.; Olshevskiy, A. G.; Perevalova, E.; Piskun, A. A.; Pocheptsov, T.; Pontecorvo, G.; Rodionov, V.; Rogov, Y.; Salmin, R.; Samartsev, A.; Sapozhnikov, M. G.; Shabratova, G.; Skachkov, N. B.; Skachkova, A. N.; Strokovsky, E. A.; Suleimanov, M.; Teshev, R.; Tokmenin, V.; Uzhinsky, V.; Vodopianov, A.; Zaporozhets, S. A.; Zhuravlev, N. I.; Zorin, A. G.; Branford, D.; Glazier, D.; Watts, D.; Böhm, M.; Britting, A.; Eyrich, W.; Lehmann, A.; Pfaffinger, M.; Uhlig, F.; Dobbs, S.; Seth, K.; Tomaradze, A.; Xiao, T.; Bettoni, D.; Carassiti, V.; Cotta Ramusino, A.; Dalpiaz, P.; Drago, A.; Fioravanti, E.; Garzia, I.; Savrie, M.; Akishina, V.; Kisel, I.; Kozlov, G.; Pugach, M.; Zyzak, M.; Gianotti, P.; Guaraldo, C.; Lucherini, V.; Bersani, A.; Bracco, G.; Macri, M.; Parodi, R. F.; Biguenko, K.; Brinkmann, K.; Di Pietro, V.; Diehl, S.; Dormenev, V.; Drexler, P.; Düren, M.; Etzelmüller, E.; Galuska, M.; Gutz, E.; Hahn, C.; Hayrapetyan, A.; Kesselkaul, M.; Kühn, W.; Kuske, T.; Lange, J. S.; Liang, Y.; Metag, V.; Nanova, M.; Nazarenko, S.; Novotny, R.; Quagli, T.; Reiter, S.; Rieke, J.; Rosenbaum, C.; Schmidt, M.; Schnell, R.; Stenzel, H.; Thöring, U.; Ullrich, M.; Wagner, M. N.; Wasem, T.; Wohlfahrt, B.; Zaunick, H.; Ireland, D.; Rosner, G.; Seitz, B.; Deepak, P. N.; Kulkarni, A.; Apostolou, A.; Babai, M.; Kavatsyuk, M.; Lemmens, P. J.; Lindemulder, M.; Loehner, H.; Messchendorp, J.; Schakel, P.; Smit, H.; Tiemens, M.; van der Weele, J. C.; Veenstra, R.; Vejdani, S.; Dutta, K.; Kalita, K.; Kumar, A.; Roy, A.; Sohlbach, H.; Bai, M.; Bianchi, L.; Büscher, M.; Cao, L.; Cebulla, A.; Dosdall, R.; Gillitzer, A.; Goldenbaum, F.; Grunwald, D.; Herten, A.; Hu, Q.; Kemmerling, G.; Kleines, H.; Lehrach, A.; Nellen, R.; Ohm, H.; Orfanitski, S.; Prasuhn, D.; Prencipe, E.; Pütz, J.; Ritman, J.; Schadmand, S.; Sefzick, T.; Serdyuk, V.; Sterzenbach, G.; Stockmanns, T.; Wintz, P.; Wüstner, P.; Xu, H.; Zambanini, A.; Li, S.; Li, Z.; Sun, Z.; Xu, H.; Rigato, V.; Isaksson, L.; Achenbach, P.; Corell, O.; Denig, A.; Distler, M.; Hoek, M.; Karavdina, A.; Lauth, W.; Liu, Z.; Merkel, H.; Müller, U.; Pochodzalla, J.; Sanchez, S.; Schlimme, S.; Sfienti, C.; Thiel, M.; Ahmadi, H.; Ahmed, S.; Bleser, S.; Capozza, L.; Cardinali, M.; Dbeyssi, A.; Deiseroth, M.; Feldbauer, F.; Fritsch, M.; Fröhlich, B.; Jasinski, P.; Kang, D.; Khaneft, D.; Klasen, R.; Leithoff, H. H.; Lin, D.; Maas, F.; Maldaner, S.; Martínez, M.; Michel, M.; Mora Espí, M. C.; Morales Morales, C.; Motzko, C.; Nerling, F.; Noll, O.; Pflüger, S.; Pitka, A.; Rodríguez Piñeiro, D.; Sanchez-Lorente, A.; Steinen, M.; Valente, R.; Weber, T.; Zambrana, M.; Zimmermann, I.; Fedorov, A.; Korjik, M.; Missevitch, O.; Boukharov, A.; Malyshev, O.; Marishev, I.; Balanutsa, V.; Balanutsa, P.; Chernetsky, V.; Demekhin, A.; Dolgolenko, A.; Fedorets, P.; Gerasimov, A.; Goryachev, V.; Chandratre, V.; Datar, V.; Dutta, D.; Jha, V.; Kumawat, H.; Mohanty, A. K.; Parmar, A.; Roy, B.; Sonika, G.; Fritzsch, C.; Grieser, S.; Hergemöller, A.; Hetz, B.; Hüsken, N.; Khoukaz, A.; Wessels, J. P.; Khosonthongkee, K.; Kobdaj, C.; Limphirat, A.; Srisawad, P.; Yan, Y.; Barnyakov, M.; Barnyakov, A. Yu.; Beloborodov, K.; Blinov, A. E.; Blinov, V. E.; Bobrovnikov, V. S.; Kononov, S.; Kravchenko, E. A.; Kuyanov, I. A.; Martin, K.; Onuchin, A. P.; Serednyakov, S.; Sokolov, A.; Tikhonov, Y.; Atomssa, E.; Kunne, R.; Marchand, D.; Ramstein, B.; van de Wiele, J.; Wang, Y.; Boca, G.; Costanza, S.; Genova, P.; Montagna, P.; Rotondi, A.; Abramov, V.; Belikov, N.; Bukreeva, S.; Davidenko, A.; Derevschikov, A.; Goncharenko, Y.; Grishin, V.; Kachanov, V.; Kormilitsin, V.; Levin, A.; Melnik, Y.; Minaev, N.; Mochalov, V.; Morozov, D.; Nogach, L.; Poslavskiy, S.; Ryazantsev, A.; Ryzhikov, S.; Semenov, P.; Shein, I.; Uzunian, A.; Vasiliev, A.; Yakutin, A.; Tomasi-Gustafsson, E.; Roy, U.; Yabsley, B.; Belostotski, S.; Gavrilov, G.; Izotov, A.; Manaenkov, S.; Miklukho, O.; Veretennikov, D.; Zhdanov, A.; Makonyi, K.; Preston, M.; Tegner, P.; Wölbing, D.; Bäck, T.; Cederwall, B.; Rai, A. K.; Godre, S.; Calvo, D.; Coli, S.; De Remigis, P.; Filippi, A.; Giraudo, G.; Lusso, S.; Mazza, G.; Mignone, M.; Rivetti, A.; Wheadon, R.; Balestra, F.; Iazzi, F.; Introzzi, R.; Lavagno, A.; Olave, J.; Amoroso, A.; Bussa, M. P.; Busso, L.; De Mori, F.; Destefanis, M.; Fava, L.; Ferrero, L.; Greco, M.; Hu, J.; Lavezzi, L.; Maggiora, M.; Maniscalco, G.; Marcello, S.; Sosio, S.; Spataro, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Martin, A.; Calen, H.; Ikegami Andersson, W.; Johansson, T.; Kupsc, A.; Marciniewski, P.; Papenbrock, M.; Pettersson, J.; Schönning, K.; Wolke, M.; Galnander, B.; Diaz, J.; Pothodi Chackara, V.; Chlopik, A.; Kesik, G.; Melnychuk, D.; Slowinski, B.; Trzcinski, A.; Wojciechowski, M.; Wronka, S.; Zwieglinski, B.; Bühler, P.; Marton, J.; Steinschaden, D.; Suzuki, K.; Widmann, E.; Zmeskal, J.

    2016-10-01

    Simulation results for future measurements of electromagnetic proton form factors at overlinePANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel bar{p}p→ e+e- is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. bar{p}p→ π+π-, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. However, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance.

  11. Feasibility studies of time-like proton electromagnetic form factors at PANDA at FAIR

    Energy Technology Data Exchange (ETDEWEB)

    Singh, B. [Aligarth Muslim Univ., Aligarth (India). Physics Dept.; Erni, W.; Krusche, B. [Basel Univ. (Switzerland); Collaboration: The PANDA Collaboration; and others

    2016-10-15

    Simulation results for future measurements of electromagnetic proton form factors at PANDA(FAIR) within the PandaRoot software framework are reported. The statistical precision with which the proton form factors can be determined is estimated. The signal channel anti pp → e{sup +}e{sup -} is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. anti pp → π{sup +}π{sup -}, is studied. Furthermore, the background versus signal efficiency, statistical and systematical uncertainties on the extracted proton form factors are evaluated using two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. However, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam conditions and detector performance. (orig.)

  12. Strange and charge symmetry violating electromagnetic form factors of the nucleon

    International Nuclear Information System (INIS)

    Shanahan, P.E.

    2016-01-01

    We summarise recent work based on lattice QCD simulations of the electromagnetic form factors of the octet baryons from the CSSM/QCDSF/UKQCD collaborations. After an analysis of the simulation results using techniques to approach the infinite volume limit and the physical pseudoscalar masses at non-zero momentum transfer, the extrapolated proton and neutron form factors are found to be in excellent agreement with those extracted from experiment. Given the success of these calculations, we describe how the strange electromagnetic form factors may be estimated from these results under the same assumption of charge symmetry used in experimental determinations of those quantities. Motivated by the necessity of that assumption, we explore a method for determining the size of charge symmetry breaking effects using the same lattice results. (author)

  13. Electromagnetic and Scalar Pion form factor in the Kroll-Lee-Zumino model

    International Nuclear Information System (INIS)

    Dominguez, C.A.; Jottar, J.I.; Loewe, M.; Willers, B.

    2009-01-01

    The renormalizable Abelian quantum field theory model of Kroll, Lee, and Zumino is used at the one loop level to compute vertex corrections to the tree-level, Vector Meson Dominance (VMD) electromagnetic pion form factor. These corrections, together with the one-loop vacuum polarization contribution, imply a resulting electromagnetic pion form factor in excellent agreement with data in the whole range of accessible momentum transfers in the space-like region. The time-like form factor, which reproduces the Gounaris-Sakurai formula at and near the rho-meson peak, is unaffected by the vertex correction at order O(g 2 ). The KLZ model is also used to compute the scalar radius of the pion at the one loop level, finding π 2 > S =0.40fm 2 . This value implies for the low energy constant of chiral perturbation theory l-bar 4 =3.4

  14. Form factor of relativistic two-particle system and covariant hamiltonian formulation of quantum field theory

    International Nuclear Information System (INIS)

    Skachkov, N.; Solovtsov, I.

    1979-01-01

    Based on the hamiltonian formulation of quantum field theory proposed by Kadyshevsky the three-dimensional relativistic approach is developed for describing the form factors of composite systems. The main features of the diagram technique appearing in the covariant hamiltonian formulation of field theory are discussed. The three-dimensional relativistic equation for the vertex function is derived and its connection with that for the quasipotential wave function is found. The expressions are obtained for the form factor of the system through equal-time two-particle wave functions both in momentum and relativistic configurational representations. An explicit expression for the form factor is found for the case of two-particle interaction through the Coulomb potential

  15. Feasibility studies of time-like proton electromagnetic form factors at PANDA at FAIR

    CERN Document Server

    Singh, B.; Krusche, B.; Steinacher, M.; Walford, N.; Liu, B.; Liu, H.; Liu, Z.; Shen, X.; Wang, C.; Zhao, J.; Albrecht, M.; Erlen, T.; Fink, M.; Heinsius, F.; Held, T.; Holtmann, T.; Jasper, S.; Keshk, I.; Koch, H.; Kopf, B.; Kuhlmann, M.; Kümmel, M.; Leiber, S.; Mikirtychyants, M.; Musiol, P.; Mustafa, A.; Pelizäus, M.; Pychy, J.; Richter, M.; Schnier, C.; Schröder, T.; Sowa, C.; Steinke, M.; Triffterer, T.; Wiedner, U.; Ball, M.; Beck, R.; Hammann, C.; Ketzer, B.; Kube, M.; Mahlberg, P.; Rossbach, M.; Schmidt, C.; Schmitz, R.; Thoma, U.; Urban, M.; Walther, D.; Wendel, C.; Wilson, A.; Bianconi, A.; Bragadireanu, M.; Caprini, M.; Pantea, D.; Patel, B.; Czyzycki, W.; Domagala, M.; Filo, G.; Jaworowski, J.; Krawczyk, M.; Lisowski, F.; Lisowski, E.; Michałek, M.; Poznański, P.; Płażek, J.; Korcyl, K.; Kozela, A.; Kulessa, P.; Lebiedowicz, P.; Pysz, K.; Schäfer, W.; Szczurek, A.; Fiutowski, T.; Idzik, M.; Mindur, B.; Przyborowski, D.; Swientek, K.; Biernat, J.; Kamys, B.; Kistryn, S.; Korcyl, G.; Krzemien, W.; Magiera, A.; Moskal, P.; Pyszniak, A.; Rudy, Z.; Salabura, P.; Smyrski, J.; Strzempek, P.; Wronska, A.; Augustin, I.; Böhm, R.; Lehmann, I.; Marinescu, D. Nicmorus; Schmitt, L.; Varentsov, V.; Al-Turany, M.; Belias, A.; Deppe, H.; Dzhygadlo, R.; Ehret, A.; Flemming, H.; Gerhardt, A.; Götzen, K.; Gromliuk, A.; Gruber, L.; Karabowicz, R.; Kliemt, R.; Krebs, M.; Kurilla, U.; Lehmann, D.; Löchner, S.; Lühning, J.; Lynen, U.; Orth, H.; Patsyuk, M.; Peters, K.; Saito, T.; Schepers, G.; Schmidt, C.J.; Schwarz, C.; Schwiening, J.; Täschner, A.; Traxler, M.; Ugur, C.; Voss, B.; Wieczorek, P.; Wilms, A.; Zühlsdorf, M.; Abazov, V.; Alexeev, G.; Arefiev, V.A.; Astakhov, V.; Barabanov, M. Yu.; Batyunya, B.V.; Davydov, Y.; Dodokhov, V. Kh.; Efremov, A.; Fechtchenko, A.; Fedunov, A.G.; Galoyan, A.; Grigoryan, S.; Koshurnikov, E.K.; Lobanov, Y. Yu.; Lobanov, V.I.; Makarov, A.F.; Malinina, L.V.; Malyshev, V.; Olshevskiy, A.G.; Perevalova, E.; Piskun, A.A.; Pocheptsov, T.; Pontecorvo, G.; Rodionov, V.; Rogov, Y.; Salmin, R.; Samartsev, A.; Sapozhnikov, M.G.; Shabratova, G.; Skachkov, N.B.; Skachkova, A.N.; Strokovsky, E.A.; Suleimanov, M.; Teshev, R.; Tokmenin, V.; Uzhinsky, V.; Vodopianov, A.; Zaporozhets, S.A.; Zhuravlev, N.I.; Zorin, A.G.; Branford, D.; Glazier, D.; Watts, D.; Böhm, M.; Britting, A.; Eyrich, W.; Lehmann, A.; Pfaffinger, M.; Uhlig, F.; Dobbs, S.; Seth, K.; Tomaradze, A.; Xiao, T.; Bettoni, D.; Carassiti, V.; Cotta Ramusino, A.; Dalpiaz, P.; Drago, A.; Fioravanti, E.; Garzia, I.; Savrie, M.; Akishina, V.; Kisel, I.; Kozlov, G.; Pugach, M.; Zyzak, M.; Gianotti, P.; Guaraldo, C.; Lucherini, V.; Bersani, A.; Bracco, G.; Macri, M.; Parodi, R.F.; Biguenko, K.; Brinkmann, K.; Di Pietro, V.; Diehl, S.; Dormenev, V.; Drexler, P.; Düren, M.; Etzelmüller, E.; Galuska, M.; Gutz, E.; Hahn, C.; Hayrapetyan, A.; Kesselkaul, M.; Kühn, W.; Kuske, T.; Lange, J.S.; Liang, Y.; Metag, V.; Nanova, M.; Nazarenko, S.; Novotny, R.; Quagli, T.; Reiter, S.; Rieke, J.; Rosenbaum, C.; Schmidt, M.; Schnell, R.; Stenzel, H.; Thöring, U.; Ullrich, M.; Wagner, M.N.; Wasem, T.; Wohlfahrt, B.; Zaunick, H.; Ireland, D.; Rosner, G.; Seitz, B.; Deepak, P.N.; Kulkarni, A.; Apostolou, A.; Babai, M.; Kavatsyuk, M.; Lemmens, P.J.; Lindemulder, M.; Loehner, H.; Messchendorp, J.; Schakel, P.; Smit, H.; Tiemens, M.; van der Weele, J.C.; Veenstra, R.; Vejdani, S.; Dutta, K.; Kalita, K.; Kumar, A.; Roy, A.; Sohlbach, H.; Bai, M.; Bianchi, L.; Büscher, M.; Cao, L.; Cebulla, A.; Dosdall, R.; Gillitzer, A.; Goldenbaum, F.; Grunwald, D.; Herten, A.; Hu, Q.; Kemmerling, G.; Kleines, H.; Lehrach, A.; Nellen, R.; Ohm, H.; Orfanitski, S.; Prasuhn, D.; Prencipe, E.; Pütz, J.; Ritman, J.; Schadmand, S.; Sefzick, T.; Serdyuk, V.; Sterzenbach, G.; Stockmanns, T.; Wintz, P.; Wüstner, P.; Xu, H.; Zambanini, A.; Li, S.; Li, Z.; Sun, Z.; Rigato, V.; Isaksson, L.; Achenbach, P.; Corell, O.; Denig, A.; Distler, M.; Hoek, M.; Karavdina, A.; Lauth, W.; Merkel, H.; Müller, U.; Pochodzalla, J.; Sanchez, S.; Schlimme, S.; Sfienti, C.; Thiel, M.; Ahmadi, H.; Ahmed, S.; Bleser, S.; Capozza, L.; Cardinali, M.; Dbeyssi, A.; Deiseroth, M.; Feldbauer, F.; Fritsch, M.; Fröhlich, B.; Jasinski, P.; Kang, D.; Khaneft, D.; Klasen, R.; Leithoff, H.H.; Lin, D.; Maas, F.; Maldaner, S.; Marta, M.; Michel, M.; Espí, M. C. Mora; Morales Morales, C.; Motzko, C.; Nerling, F.; Noll, O.; Pflüger, S.; Pitka, A.; Piñeiro, D. Rodríguez; Sanchez-Lorente, A.; Steinen, M.; Valente, R.; Weber, T.; Zambrana, M.; Zimmermann, I.; Fedorov, A.; Korjik, M.; Missevitch, O.; Boukharov, A.; Malyshev, O.; Marishev, I.; Balanutsa, V.; Balanutsa, P.; Chernetsky, V.; Demekhin, A.; Dolgolenko, A.; Fedorets, P.; Gerasimov, A.; Goryachev, V.; Chandratre, V.; Datar, V.; Dutta, D.; Jha, V.; Kumawat, H.; Mohanty, A.K.; Parmar, A.; Roy, B.; Sonika, G.; Fritzsch, C.; Grieser, S.; Hergemöller, A.; Hetz, B.; Hüsken, N.; Khoukaz, A.; Wessels, J.P.; Khosonthongkee, K.; Kobdaj, C.; Limphirat, A.; Srisawad, P.; Yan, Y.; Barnyakov, M.; Barnyakov, A. Yu.; Beloborodov, K.; Blinov, A.E.; Blinov, V.E.; Bobrovnikov, V.S.; Kononov, S.; Kravchenko, E.A.; Kuyanov, I.A.; Martin, K.; Onuchin, A.P.; Serednyakov, S.; Sokolov, A.; Tikhonov, Y.; Atomssa, E.; Kunne, R.; Marchand, D.; Ramstein, B.; van de Wiele, J.; Wang, Y.; Boca, G.; Costanza, S.; Genova, P.; Montagna, P.; Rotondi, A.; Abramov, V.; Belikov, N.; Bukreeva, S.; Davidenko, A.; Derevschikov, A.; Goncharenko, Y.; Grishin, V.; Kachanov, V.; Kormilitsin, V.; Levin, A.; Melnik, Y.; Minaev, N.; Mochalov, V.; Morozov, D.; Nogach, L.; Poslavskiy, S.; Ryazantsev, A.; Ryzhikov, S.; Semenov, P.; Shein, I.; Uzunian, A.; Vasiliev, A.; Yakutin, A.; Tomasi-Gustafsson, E.; Roy, U.; Yabsley, B.; Belostotski, S.; Gavrilov, G.; Izotov, A.; Manaenkov, S.; Miklukho, O.; Veretennikov, D.; Zhdanov, A.; Makonyi, K.; Preston, M.; Tegner, P.; Wölbing, D.; Bäck, T.; Cederwall, B.; Rai, A.K.; Godre, S.; Calvo, D.; Coli, S.; De Remigis, P.; Filippi, A.; Giraudo, G.; Lusso, S.; Mazza, G.; Mignone, M.; Rivetti, A.; Wheadon, R.; Balestra, F.; Iazzi, F.; Introzzi, R.; Lavagno, A.; Olave, J.; Amoroso, A.; Bussa, M.P.; Busso, L.; De Mori, F.; Destefanis, M.; Fava, L.; Ferrero, L.; Greco, M.; Hu, J.; Lavezzi, L.; Maggiora, M.; Maniscalco, G.; Marcello, S.; Sosio, S.; Spataro, S.; Birsa, R.; Bradamante, F.; Bressan, A.; Martin, A.; Calen, H.; Andersson, W. Ikegami; Johansson, T.; Kupsc, A.; Marciniewski, P.; Papenbrock, M.; Pettersson, J.; Schönning, K.; Wolke, M.; Galnander, B.; Diaz, J.; Chackara, V. Pothodi; Chlopik, A.; Kesik, G.; Melnychuk, D.; Slowinski, B.; Trzcinski, A.; Wojciechowski, M.; Wronka, S.; Zwieglinski, B.; Bühler, P.; Marton, J.; Steinschaden, D.; Suzuki, K.; Widmann, E.; Zmeskal, J.

    2016-01-01

    The results of simulations for future measurements of electromagnetic form factors at \\PANDA (FAIR) within the PandaRoot software framework are reported. The statistical precision at which the proton form factors can be determined is estimated. The signal channel $\\bar p p \\to e^+ e^-$ is studied on the basis of two different but consistent procedures. The suppression of the main background channel, i.e. the $\\bar p p \\to \\pi^+ \\pi^-$, is studied. Furthermore, the background versus signal efficiency, statistic and systematic uncertainties on the extracted proton form factors are evaluated using to the two different procedures. The results are consistent with those of a previous simulation study using an older, simplified framework. However, a slightly better precision is achieved in the PandaRoot study in a large range of momentum transfer, assuming the nominal beam condition and detector performances.

  16. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    Energy Technology Data Exchange (ETDEWEB)

    Xiaohui Zhan

    2009-12-01

    A high precision measurement of the proton elastic form factor ratio µpGEp/GMp in the range Q2 = 0.3–0.7 GeV2/c2 was performed using recoil polarimetry in Jefferson Lab Hall A. In this low Q2 range, previous data from LEDEX [5] along with many fits and calculations [2, 3, 4] indicate substantial deviations of the ratio from unity. In this new measurement, with 80% polarized electron beam for 24 days, we are able to achieve <1% statistical uncertainty. Preliminary results are a few percent lower than expected from previous world data and fits, indicating a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the improved form factor measurements also have implications for DVCS, determinations of the proton Zemach radius and strangeness form factors through parity violation experiments.

  17. 1/mQ corrections to form factors and extraction of |Vcb|

    International Nuclear Information System (INIS)

    Liu, J.; Chao, K.

    1997-01-01

    Form factors for 0 - →0 - and 0 - →1 - mesonic transitions in the heavy quark limit and the 1/m Q corrections are analyzed model independently within the Bethe-Salpeter (BS) formalism. The analysis shows that the BS formalism has spin-flavor symmetry in the heavy quark limit and respects Luke's theorem when the 1/m Q corrections are taken into account. All form factors for B→D (*) transitions beyond the zero recoil point are estimated in a relativistic constituent quark model based on the BS formalism. Using these form factors we calculate the branching ratios for the semileptonic decays B→D (*) l + ν l and extract the Cabibbo-Kobayashi-Maskawa matrix element |V cb |. We get |V cb |=0.042±0.003 which is consistent with the current world average. copyright 1997 The American Physical Society

  18. Holographic estimate of the meson cloud contribution to nucleon axial form factor

    Science.gov (United States)

    Ramalho, G.

    2018-04-01

    We use light-front holography to estimate the valence quark and the meson cloud contributions to the nucleon axial form factor. The free couplings of the holographic model are determined by the empirical data and by the information extracted from lattice QCD. The holographic model provides a good description of the empirical data when we consider a meson cloud mixture of about 30% in the physical nucleon state. The estimate of the valence quark contribution to the nucleon axial form factor compares well with the lattice QCD data for small pion masses. Our estimate of the meson cloud contribution to the nucleon axial form factor has a slower falloff with the square momentum transfer compared to typical estimates from quark models with meson cloud dressing.

  19. Bethe Ansatz and exact form factors of the O(N) Gross Neveu-model

    International Nuclear Information System (INIS)

    Babujian, Hrachya M.; Foerster, Angela; Karowski, Michael

    2016-01-01

    We apply previous results on the O(N) Bethe Ansatz http://dx.doi.org/10.1088/1751-8113/45/5/055207, http://arxiv.org/abs/1204.3479, http://dx.doi.org/10.1007/JHEP11(2013)089 to construct a general form factor formula for the O(N) Gross-Neveu model. We examine this formula for several operators, such as the energy momentum, the spin-field and the current. We also compare these results with the 1/N expansion of this model and obtain full agreement. We discuss bound state form factors, in particular for the three particle form factor of the field. In addition for the two particle case we prove a recursion relation for the K-functions of the higher level Bethe Ansatz.

  20. New large-Nc relations for the electromagnetic nucleon-to-Δ form factors

    International Nuclear Information System (INIS)

    Vladimir Pascalutsa; Marc Vanderhaeghen

    2006-01-01

    We establish relations which express the three N → Δ transition form factors in terms of the nucleon form factors. These relations are based on the known large-N c relation between the N → Δ electric quadrupole moment and the neutron charge radius, and a newly derived large-N c relation between the electric quadrupole (E2) and Coulomb quadrupole (C2) transitions. Namely, in the large-N c limit we find C2=E2. We show that these relations provide predictions for the N → Δ electromagnetic form factors which are found to be in very good agreement with experiment for moderate momentum transfers. They also provide constraints for the N → Δ GPDs