Zhang, Meihua; Yu, Yunzhi; Miao, Yu
2012-08-01
To investigate the expression of receptor activator of nuclear factor kappaB ligand (RANKL) and osteoprotegerin (OPG) in periapical cyst and periapical granuloma by comparison with the expression in the normal periodontal tissue as control, and to identify their functional mechanism in the bone destruction of periapical cyst and granuloma. 20 periapical cyst tissues (cyst group), 20 periapical granuloma tissues (granuloma group), and 20 normal periodontal tissues (control group) were collected respectively. Immunohistochemical technology was performed to detect the expression of RANKL and OPG in above three groups. In cyst group, granuloma group and control group, the expression of RANKL were 75.00 +/- 7.54, 68.40 +/- 6.74 and 29.40 +/- 2.46, respectively. The expression of OPG were 38.10 +/- 7.09, 47.65 +/- 13.85 and 58.60 +/- 5.88, respectively. The differences among the three groups were statistically significant (Pcysts group were negatively correlated (r=-0.56, P=0.01) and were not correlated with granuloma and control group (P>0.05). RANKL and OPG play roles in the bone absorption of periapical disease. In periapical disease, abnormal expression of RANKL and OPG are detected, RANKL significantly increase, OPG decrease, bone absorption accelerate and osteolytic lesion are observed. In periapical cyst, the bone absorption is more active compared with periapical granuloma.
Baek, Jong Min; Kim, Ju-Young; Ahn, Sung-Jun; Cheon, Yoon-Hee; Yang, Miyoung; Oh, Jaemin; Choi, Min Kyu
2016-03-01
Dendrobium moniliforme (DM) is a well-known plant-derived extract that is widely used in Oriental medicine. DM and its chemical constituents have been reported to have a variety of pharmacological effects, including anti-oxidative, anti-inflammatory, and anti-tumor activities; however, no reports discuss the beneficial effects of DM on bone diseases such as osteoporosis. Thus, we investigated the relationship between DM and osteoclasts, cells that function in bone resorption. We found that DM significantly reduced receptor activator of nuclear factor kappa-B ligand (RANKL)-induced tartrate-resistant acid phosphatase (TRAP)-positive osteoclast formation; DM directly induced the down-regulation of c-Fos and nuclear factor of activated T cells c1 (NFATc1) without affecting other RANKL-dependent transduction pathways. In the later stages of osteoclast maturation, DM negatively regulated the organization of filamentous actin (F-actin), resulting in impaired bone-resorbing activity by the mature osteoclasts. In addition, micro-computed tomography (μ-CT) analysis of the murine model revealed that DM had a beneficial effect on lipopolysaccharide (LPS)-mediated bone erosion. Histological analysis showed that DM attenuated the degradation of trabecular bone matrix and formation of TRAP-positive osteoclasts in bone tissues. These results suggest that DM is a potential candidate for the treatment of metabolic bone disorders such as osteoporosis.
Directory of Open Access Journals (Sweden)
Jong Min Baek
2014-08-01
Full Text Available Aconitum pseudo-laeve var. erectum (APE has been widely shown in herbal medicine to have a therapeutic effect on inflammatory conditions. However, there has been no evidence on whether the extract of APE is involved in the biological bone metabolism process, particularly osteoclast-mediated bone resorption. In this study, we confirmed that the administration of APE could restore normal skeletal conditions in a murine model of lipopolysaccharide (LPS-induced bone loss via a decrease in the receptor activator of nuclear factor kappa-B ligand (RANKL/osteoprotegerin (OPG ratio and osteoclast number. We then investigated the effect of APE on the RANKL-induced formation and function of osteoclasts to elucidate its underlying molecular mechanisms. APE suppressed the formation of tartrate-resistant acid phosphatase (TRAP-positive cells, as well as the bone-resorbing activity of mature osteoclasts. Furthermore, APE attenuated nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1 and c-Fos without affecting any early signal pathway of osteoclastogenesis. Subsequently, APE significantly downregulated the expression of various genes exclusively expressed in osteoclasts. These results demonstrate that APE restores LPS-induced bone loss through a decrease of the serum RANKL/OPG ratio, and inhibits osteoclast differentiation and function, suggesting the promise of APE as a potential cure for various osteoclast-associated bone diseases.
Baek, Jong Min; Kim, Ju-Young; Yoon, Kwon-Ha; Oh, Jaemin; Lee, Myeung Su
2016-01-01
Ebselen is a non-toxic seleno-organic drug with anti-inflammatory and antioxidant properties that is currently being examined in clinical trials to prevent and treat various diseases, including atherosclerosis, stroke, and cancer. However, no reports are available for verifying the pharmacological effects of ebselen on major metabolic bone diseases such as osteoporosis. In this study, we observed that ebselen suppressed the formation of tartrate-resistant acid phosphatase (TRAP)-positive multinucleated cells in an osteoblast/osteoclast co-culture by regulating the ratio of receptor activator of nuclear factor kappa-B ligand (RANKL)/osteoprotegerin secreted by osteoblasts. In addition, ebselen treatment in the early stage of osteoclast differentiation inhibited RANKL-dependent osteoclastogenesis by decreasing the phosphorylation of IκB, PI3K, and Akt in early signaling pathways and by subsequently inducing c-Fos and nuclear factor of activated T-cells c1. Further, ebselen induced apoptosis of osteoclasts in the late stage of osteoclast differentiation. In addition, ebselen treatment suppressed filamentous actin ring formation and bone resorption activity of mature osteoclasts. Reflecting these in vitro effects, administration of ebselen recovered bone loss and its µ-CT parameters in lipopolysaccharide-mediated mouse model. Histological analysis confirmed that ebselen prevented trabecular bone matrix degradation and osteoclast formation in the bone tissues. Finally, it was proved that the anti-osteoclastogenic action of ebselen is achieved through targeting N-methyl-D-aspartate (NMDA) receptor. These results indicate that ebselen is a potentially safe drug for treating metabolic bone diseases such as osteoporosis.
Chapman, Neil R; Webster, Gill A; Gillespie, Peter J; Wilson, Brian J; Crouch, Dorothy H; Perkins, Neil D
2002-01-01
Members of both Myc and nuclear factor kappaB (NF-kappaB) families of transcription factors are found overexpressed or inappropriately activated in many forms of human cancer. Furthermore, NF-kappaB can induce c-Myc gene expression, suggesting that the activities of these factors are functionally linked. We have discovered that both c-Myc and v-Myc can induce a previously undescribed, truncated form of the RelA(p65) NF-kappaB subunit, RelA(p37). RelA(p37) encodes the N-terminal DNA binding and dimerization domain of RelA(p65) and would be expected to function as a trans-dominant negative inhibitor of NF-kappaB. Surprisingly, we found that RelA(p37) no longer binds to kappaB elements. This result is explained, however, by the observation that RelA(p37), but not RelA(p65), forms a high-molecular-mass complex with c-Myc. These results demonstrate a previously unknown functional and physical interaction between RelA and c-Myc with many significant implications for our understanding of the role that both proteins play in the molecular events underlying tumourigenesis. PMID:12027803
Energy Technology Data Exchange (ETDEWEB)
Baek, Jong Min; Park, Sun-Hyang; Cheon, Yoon-Hee; Ahn, Sung-Jun [Department of Anatomy, School of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Lee, Myeung Su [Division of Rheumatology, Department of Internal Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Institute for Skeletal Disease, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Oh, Jaemin, E-mail: jmoh@wku.ac.kr [Department of Anatomy, School of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Institute for Skeletal Disease, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of); Kim, Ju-Young, E-mail: kimjy1014@gmail.com [Imaging Science-based Lung and Bone Diseases Research Center, Wonkwang University, Iksan, Jeonbuk 570-749 (Korea, Republic of)
2015-05-29
Esculetin exerts various biological effects on anti-oxidation, anti-tumors, and anti-inflammation. However, the involvement of esculetin in the bone metabolism process, particularly osteoclast differentiation has not yet been investigated. In the present study, we first confirmed the inhibitory effect of esculetin on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast formation. We then revealed the relationship between esculetin and the expression of osteoclast-specific molecules to elucidate its underlying mechanisms. Esculetin interfered with the expression of c-Fos and nuclear factor of activated T cell c1 (NFATc1) both at the mRNA and protein level with no involvement in osteoclast-associated early signaling pathways, suppressing the expression of various transcription factors exclusively expressed in osteoclasts such as tartrate-resistant acid phosphatase (Trap), osteoclast-associated receptor (Oscar), dendritic cell-specific transmembrane protein (Dcstamp), osteoclast stimulatory transmembrane protein (Ocstamp), cathepsin K, αvβ3 integrin, and calcitonin receptor (Ctr). Additionally, esculetin inhibited the formation of filamentous actin (F-actin) ring-positive osteoclasts during osteoclast differentiation. However, the development of F-actin structures and subsequent bone resorbing activity of mature osteoclasts, which are observed in osteoclast/osteoblast co-culture systems were not affected by esculetin. Taken together, our results indicate for the first time that esculetin inhibits RANKL-mediated osteoclastogenesis via direct suppression of c-Fos and NFATc1 expression and exerts an inhibitory effect on actin ring formation during osteoclastogenesis. - Highlights: • We first investigated the effects of esculetin on osteoclast differentiation and function. • Our data demonstrate for the first time that esculetin can suppress osteoclastogenesis in vitro. • Esculetin acts as an inhibitor of c-Fos and NFATc1 activation.
Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation
International Nuclear Information System (INIS)
Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M.; Rodrigues, Michele A.; Gomes, Dawidson A.
2016-01-01
The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast, amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.
Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation
Energy Technology Data Exchange (ETDEWEB)
Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M. [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Rodrigues, Michele A. [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Department of General Pathology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil); Gomes, Dawidson A., E-mail: dawidson@ufmg.br [Department of Biochemistry and Immunology, Universidade Federal de Minas Gerais, Av. Antonio Carlos, 6627, Belo Horizonte, MG, 31270-901 (Brazil)
2016-09-09
The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast, amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.
Inhibition of nuclear factor kappa-B signaling reduces growth in medulloblastoma in vivo
Directory of Open Access Journals (Sweden)
Deckard Lindsey A
2011-04-01
Full Text Available Abstract Background Medulloblastoma is a highly malignant pediatric brain tumor that requires surgery, whole brain and spine irradiation, and intense chemotherapy for treatment. A more sophisticated understanding of the pathophysiology of medulloblastoma is needed to successfully reduce the intensity of treatment and improve outcomes. Nuclear factor kappa-B (NFκB is a signaling pathway that controls transcriptional activation of genes important for tight regulation of many cellular processes and is aberrantly expressed in many types of cancer. Methods To test the importance of NFκB to medulloblastoma cell growth, the effects of multiple drugs that inhibit NFκB, pyrrolidine dithiocarbamate, diethyldithiocarbamate, sulfasalazine, curcumin and bortezomib, were studied in medulloblastoma cell lines compared to a malignant glioma cell line and normal neurons. Expression of endogenous NFκB was investigated in cultured cells, xenograft flank tumors, and primary human tumor samples. A dominant negative construct for the endogenous inhibitor of NFκB, IκB, was prepared from medulloblastoma cell lines and flank tumors were established to allow specific pathway inhibition. Results We report high constitutive activity of the canonical NFκB pathway, as seen by Western analysis of the NFκB subunit p65, in medulloblastoma tumors compared to normal brain. The p65 subunit of NFκB is extremely highly expressed in xenograft tumors from human medulloblastoma cell lines; though, conversely, the same cells in culture have minimal expression without specific stimulation. We demonstrate that pharmacological inhibition of NFκB in cell lines halts proliferation and leads to apoptosis. We show by immunohistochemical stain that phosphorylated p65 is found in the majority of primary tumor cells examined. Finally, expression of a dominant negative form of the endogenous inhibitor of NFκB, dnIκB, resulted in poor xenograft tumor growth, with average tumor volumes
Involvement of nuclear factor {kappa}B in platelet CD40 signaling
Energy Technology Data Exchange (ETDEWEB)
Hachem, Ahmed [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Yacoub, Daniel [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Centre Hospitalier Universite de Montreal, 264 boul. Rene-Levesque est, Montreal, Quebec, Canada H2X 1P1 (Canada); Zaid, Younes [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Mourad, Walid [Universite de Montreal, Department of Medicine, 2900 boul. Edouard-Montpetit, Montreal, Quebec, Canada H3T 1J4 (Canada); Centre Hospitalier Universite de Montreal, 264 boul. Rene-Levesque est, Montreal, Quebec, Canada H2X 1P1 (Canada); Merhi, Yahye, E-mail: yahye.merhi@icm-mhi.org [Laboratory of Thrombosis and Hemostasis, Montreal Heart Institute, 5000 Belanger, Montreal, Quebec, Canada H1T 1C8 (Canada); Universite de Montreal, Department of Medicine, 2900 boul. Edouard-Montpetit, Montreal, Quebec, Canada H3T 1J4 (Canada)
2012-08-17
Highlights: Black-Right-Pointing-Pointer sCD40L induces TRAF2 association to CD40 and NF-{kappa}B activation in platelets. Black-Right-Pointing-Pointer I{kappa}B{alpha} phosphorylation downstream of CD40L/CD40 signaling is independent of p38 MAPK phosphorylation. Black-Right-Pointing-Pointer I{kappa}B{alpha} is required for sCD40L-induced platelet activation and potentiation of aggregation. -- Abstract: CD40 ligand (CD40L) is a thrombo-inflammatory molecule that predicts cardiovascular events. Platelets constitute the major source of soluble CD40L (sCD40L), which has been shown to potentiate platelet activation and aggregation, in a CD40-dependent manner, via p38 mitogen activated protein kinase (MAPK) and Rac1 signaling. In many cells, the CD40L/CD40 dyad also induces activation of nuclear factor kappa B (NF-{kappa}B). Given that platelets contain NF-{kappa}B, we hypothesized that it may be involved in platelet CD40 signaling and function. In human platelets, sCD40L induces association of CD40 with its adaptor protein the tumor necrosis factor receptor associated factor 2 and triggers phosphorylation of I{kappa}B{alpha}, which are abolished by CD40L blockade. Inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced I{kappa}B{alpha} phosphorylation without affecting p38 MAPK phosphorylation. On the other hand, inhibition of p38 MAPK phosphorylation has no effect on I{kappa}B{alpha} phosphorylation, indicating a divergence in the signaling pathway originating from CD40 upon its ligation. In functional studies, inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced platelet activation and potentiation of platelet aggregation in response to a sub-threshold concentration of collagen. This study demonstrates that the sCD40L/CD40 axis triggers NF-{kappa}B activation in platelets. This signaling pathway plays a critical role in platelet activation and aggregation upon sCD40L stimulation and may represent an important target against thrombo
Directory of Open Access Journals (Sweden)
Ayilam Ramachandran Rajalakshmy
Full Text Available Recent evidence suggests the neurotrophic potential of hepatitis C virus (HCV. HCV NS3 protein is one of the potent antigens of this virus mediating inflammatory response in different cell types. Microglia being the immune surveillance cells in the central nervous system (CNS, the inflammatory potential of NS3 on microglia was studied. Role of toll like receptor (TLR ligands Pam2CSK3 and Pam3CSK4 in controlling the NS3 mediated microglial inflammation was studied using microglial cell line CHME3.IL (Interleukin-8, IL-6, TNF-α (Tumor nicrosis factor alpha and IL-1β gene expressions were measured by semi quantitative RT-PCR (reverse transcription-PCR. ELISA was performed to detect IL-8, IL-6, TNF-α, IL-1β and IL-10 secretion. FACS (Flourescent activated cell sorting was performed to quantify TLR1, TLR2, TLR6, MyD88 (Myeloid differntiation factor 88, IkB-α (I kappaB alpha and pNF-κB (phosphorylated nuclear factor kappaB expression. Immunofluorescence staining was performed for MyD88, TLR6 and NF-κB (Nuclear factor kappaB. Student's t-test or One way analysis of variance with Bonferoni post hoc test was performed and p < 0.05 was considered significant.Microglia responded to NS3 by secreting IL-8, IL-6, TNF-α and IL-1β via TLR2 or TLR6 mediated MyD88/NF-κB pathway. Transcription factor NF-κB was involved in activating the cytokine gene expression and the resultant inflammatory response was controlled by NF-κB inhibitor, Ro106-9920, which is known to down regulate pro-inflammatory cytokine secretion. Activation of the microglia by TLR agonists Pam3CSK4 and Pam2CSK4 induced immune tolerance against NS3. TLR ligand treatment significantly down regulated pro-inflammatory cytokine secretion in the microglia. IL-10 secretion was suggested as the possible mechanism by which TLR agonists induced immune tolerance. NS3 as such was not capable of self-inducing immune tolerance in microglia.In conclusion, NS3 protein was capable of activating
Thyroid hormone and retinoic acid nuclear receptors: specific ligand-activated transcription factors
International Nuclear Information System (INIS)
Brtko, J.
1998-01-01
Transcriptional regulation by both the thyroid hormone and the vitamin A-derived 'retinoid hormones' is a critical component in controlling many aspects of higher vertebrate development and metabolism. Their functions are mediated by nuclear receptors, which comprise a large super-family of ligand-inducible transcription factors. Both the thyroid hormone and the retinoids are involved in a complex arrangement of physiological and development responses in many tissues of higher vertebrates. The functions of 3,5,3'-triiodothyronine (T 3 ), the thyromimetically active metabolite of thyroxine as well as all-trans retinoic acid, the biologically active vitamin A metabolite are mediated by nuclear receptor proteins that are members of the steroid/thyroid/retinoid hormone receptor family. The functions of all members of the receptor super family are discussed. (authors)
Parallel Assessment of Bone Mineral Density and RANKL/OPG Ratio in Saudi Females
AI Hassan; SA Eltarhouny; HE Hashem; SA Algaidi; AR Abdallah; AM Sandokji
2016-01-01
Background: Osteoporosis is a significant risk factor for morbidity, and its high prevalence among Saudi women should be considered to be a public health problem. Quantitative ultrasound was recommended for bone mineral density (BMD) screening. Receptor activator of nuclear factor kappa-B ligand (RANKL) and osteoprotegerin (OPG) and their ratio are critical for physiological bone remodelling, and related abnormalities may lead to several osteopathies. Methods: The BMD of 499 Saudi female...
DEFF Research Database (Denmark)
Sennels, H P; Jacobsen, Søren; Jensen, T
2007-01-01
Objective. Monitoring inflammatory diseases and osteoclastogenesis with osteopontin (OPN), osteoprotegerin (OPG), total soluble receptor activator of nuclear factor kappa B ligand (total sRANKL) and high-sensitivity C-reactive protein (hsCRP) has recently attracted increased interest. The purpose...
Identification of a novel A20-binding inhibitor of nuclear factor-kappa B activation termed ABIN-2.
Van Huffel, S; Delaei, F; Heyninck, K; De Valck, D; Beyaert, R
2001-08-10
The nuclear factor kappaB (NF-kappaB) plays a central role in the regulation of genes implicated in immune responses, inflammatory processes, and apoptotic cell death. The zinc finger protein A20 is a cellular inhibitor of NF-kappaB activation by various stimuli and plays a critical role in terminating NF-kappaB responses. The underlying mechanism for NF-kappaB inhibition by A20 is still unknown. A20 has been shown to interact with several proteins including tumor necrosis factor (TNF) receptor-associated factors 2 and 6, as well as the inhibitory protein of kappaB kinase (IKK) gamma protein. Here we report the cloning and characterization of ABIN-2, a previously unknown protein that binds to the COOH-terminal zinc finger domain of A20. NF-kappaB activation induced by TNF and interleukin-1 is inhibited by overexpression of ABIN-2. The latter also inhibits NF-kappaB activation induced by overexpression of receptor-interacting protein or TNF receptor-associated factor 2. In contrast, NF-kappaB activation by overexpression of IKKbeta or direct activators of the IKK complex, such as Tax, cannot be inhibited by ABIN-2. These results indicate that ABIN-2 interferes with NF-kappaB activation upstream of the IKK complex and that it might contribute to the NF-kappaB-inhibitory function of A20.
Sarlati, Fatemeh; Sattari, Mandana; Razzaghi, Shilan; Nasiri, Malihe
2012-01-01
Background: Osteoclastogenesis is coordinated by the interaction of three members of the tumor necrosis factor (TNF) superfamily: Osteoprotegerin (OPG)/receptor activator of nuclear factor kappa B ligand (RANKL)/receptor activator of nuclear factor kappa B (RANK). The aim of this study was to investigate RANKL and OPG levels, and their relative ratio in gingival crevicular fluid (GCF) of patients with chronic and aggressive periodontitis, as well as healthy controls. Materials and Methods: In this analytical study, GCF was obtained from healthy (n = 10), mild chronic periodontitis (n = 18), moderate chronic periodontitis (n = 18), severe chronic periodontitis (n = 20), and generalized aggressive periodontitis (n = 20) subjects. RANKL and OPG concentrations were measured by enzyme-linked immunosorbent assay. Statistical tests used were Kruskal–Wallis test, Mann–Whitney U rank sum test, and Spearman's rank correlation analysis. The level of statistical significance was set at P chronic periodontitis (mild, moderate, severe), and aggressive periodontitis (P = 0.41). There was statistically significant correlation between the concentration of sRANKL and Clinical Attachment Level (CAL) in moderate chronic periodontitis patients (R = 0.48, P = 0.04). There was also negative correlation between OPG concentration and CAL in moderate chronic periodontitis patients, although not significant (R = −0.13). Conclusion: RANKL was prominent in periodontitis sites, especially in moderate periodontitis patients, whereas OPG was not detectable in some diseased sites with bleeding on probing, supporting the role of these two molecules in the bone loss developed in this disease. PMID:23559954
International Nuclear Information System (INIS)
Karvonen, Ulla; Jaenne, Olli A.; Palvimo, Jorma J.
2006-01-01
In addition to chromosomal proteins, histone deacetylases (HDACs) target transcription factors in transcriptional repression. Here, we show that the class II HDAC family member HDAC7 is an efficient corepressor of the androgen receptor (AR). HDAC7 resided in the cytoplasm in the absence of AR or a cognate ligand, but hormone-occupancy of AR induced nuclear transfer of HDAC7. Nuclear colocalization pattern of AR and HDAC7 was dependent on the nature of the ligand. In the presence of testosterone, a portion of HDAC7 localized to pearl-like nuclear domains, whereas AR occupied with antagonistic ligands cyproterone acetate- or casodex (bicalutamide) recruited HDAC7 from these domains to colocalize with the receptor in speckles and nucleoplasm in a more complete fashion. Ectopic expression of PML-3 relieved the repressive effect of HDAC7 on AR function by sequestering HDAC7 to PML-3 domains. AR acetylation at Lys630/632/633 was not the target of HDAC7 repression, since repression of AR function was independent of these acetylation sites. Moreover, the deacetylase activity of HDAC7 was in part dispensable in the repression of AR function. In sum, our results identify HDAC7 as a novel AR corepressor whose subcellular and subnuclear compartmentalization can be regulated in an androgen-selective manner
Ligands specify estrogen receptor alpha nuclear localization and degradation
Directory of Open Access Journals (Sweden)
Caze-Subra Stéphanie
2010-12-01
Full Text Available Abstract Background The estrogen receptor alpha (ERα is found predominately in the nucleus, both in hormone stimulated and untreated cells. Intracellular distribution of the ERα changes in the presence of agonists but the impact of different antiestrogens on the fate of ERα is a matter of debate. Results A MCF-7 cell line stably expressing GFP-tagged human ERα (SK19 cell line was created to examine the localization of ligand-bound GFP-ERα. We combined digitonin-based cell fractionation analyses with fluorescence and immuno-electron microscopy to determine the intracellular distribution of ligand-bound ERα and/or GFP-ERα. Using fluorescence- and electron microscopy we demonstrate that both endogenous ERα and GFP-ERα form numerous nuclear focal accumulations upon addition of agonist, 17β-estradiol (E2, and pure antagonists (selective estrogen regulator disruptor; SERD, ICI 182,780 or RU58,668, while in the presence of partial antagonists (selective estrogen regulator modulator; SERM, 4-hydroxytamoxifen (OHT or RU39,411, diffuse nuclear staining persisted. Digitonin based cell fractionation analyses confirmed that endogenous ERα and GFP-ERα predominantly reside in the nuclear fraction. Overall ERα protein levels were reduced after estradiol treatment. In the presence of SERMs ERα was stabilized in the nuclear soluble fraction, while in the presence of SERDs protein levels decreased drastically and the remaining ERα was largely found in a nuclear insoluble fraction. mRNA levels of ESR1 were reduced compared to untreated cells in the presence of all ligands tested, including E2. E2 and SERDs induced ERα degradation occurred in distinct nuclear foci composed of ERα and the proteasome providing a simple explanation for ERα sequestration in the nucleus. Conclusions Our results indicate that chemical structure of ligands directly affect the nuclear fate and protein turnover of the estrogen receptor alpha independently of their impact on
Identification of VDR Antagonists among Nuclear Receptor Ligands Using Virtual Screening
Directory of Open Access Journals (Sweden)
Kelly Teske
2014-04-01
Full Text Available Herein, we described the development of two virtual screens to identify new vitamin D receptor (VDR antagonists among nuclear receptor (NR ligands. Therefore, a database of 14330 nuclear receptor ligands and their NR affinities was assembled using the online available “Binding Database.” Two different virtual screens were carried out in conjunction with a reported VDR crystal structure applying a stringent and less stringent pharmacophore model to filter docked NR ligand conformations. The pharmacophore models were based on the spatial orientation of the hydroxyl functionalities of VDR's natural ligands 1,25(OH2D3 and 25(OH2D3. The first virtual screen identified 32 NR ligands with a calculated free energy of VDR binding of more than -6.0 kJ/mol. All but nordihydroguaiaretic acid (NDGA are VDR ligands, which inhibited the interaction between VDR and coactivator peptide SRC2-3 with an IC50 value of 15.8 μM. The second screen identified 162 NR ligands with a calculated free energy of VDR binding of more than -6.0 kJ/mol. More than half of these ligands were developed to bind VDR followed by ERα/β ligands (26%, TRα/β ligands (7%, and LxRα/β ligands (7%. The binding between VDR and ERα ligand H6036 as well as TRα/β ligand triiodothyronine and a homoserine analog thereof was confirmed by fluorescence polarization.
Gong, Wei; Dou, Huan; Liu, Xianqin; Sun, Lingyun; Hou, Yayi
2012-10-01
1. In the present study, we investigated the effects of technetium-99 conjugated with methylene diphosphonate ((99)Tc-MDP), an agent used in radionuclide therapy, on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis and explored the underlying mechanisms. 2. The murine macrophage cell line RAW264.7 and bone marrow-derived-macrophages from C57BL/6 mice (BMM) were used as models for osteoclastogenesis in vitro. The expression of some key factors in RANKL (50 ng/mL)-induced osteoclastogenesis in RAW264.7 cells was investigated by flow cytometry and real-time reverse transcription-polymerase chain reaction (RT-PCR). To detect multinucleated osteoclast formation, RAW264.7 cells were induced with RANKL for 4 days, whereas BMM were induced by 50 ng/mL RANKL and 20 ng/mL macrophage colony-stimulating factor for 7 days, before being stained with tartrate-resistant acid phosphatase. 3. Osteoclastogenesis was evaluated using the osteoclast markers CD51, matrix metalloproteinase (MMP)-9 and cathepsin K. At 0.01 μg/mL, (99)Tc-MDP significantly inhibited RANKL-induced osteoclastogenesis without any cytotoxicity. In addition, (99)Tc-MDP abolished the appearance of multinucleated osteoclasts. 4. Real-time RT-PCR analysis of transcription factor expression revealed that (99)Tc-MDP inhibited the expression of c-Fos and nuclear factor of activated T cells. In addition, (99)Tc-MDP inhibited the expression of the inflammatory factors interleukin (IL)-6, tumour necrosis factor-α and IL-1β. Finally, (99)Tc-MDP inhibited the activation of mitogen-activated protein kinases in RAW264.7 cells following RANKL stimulation. 5. In conclusion, (99)Tc-MDP possesses anti-osteoclastogenic activity against RANKL-induced osteoclast formation. © 2012 The Authors Clinical and Experimental Pharmacology and Physiology © 2012 Wiley Publishing Asia Pty Ltd.
Arslan, Muyesser Sayki; Tutal, Esra; Sahin, Mustafa; Karakose, Melia; Ucan, Bekir; Ozturk, Gulfer; Cakal, Erman; Biyikli Gencturk, Zeynep; Ozbek, Mustafa; Delibasi, Tuncay
2017-02-01
Osteoprotegerin has been shown to be increased in cardiovascular disorders and type 2 diabetes mellitus. Prediabetes represents a high risk condition for diabetes and diabetic complications. Therefore, we aimed to find the relationship between prediabetes and osteoprotegerin with nuclear factor-B ligand, carotid intima media thickness, and metabolic markers. A total of 54 participants with prediabetes including impaired fasting glucose (n = 21), impaired glucose tolerance (n = 8), impaired fasting glucose and impaired glucose tolerance (n = 25), and 60 healthy individuals as a control were admitted to the study. Metabolic and anthropometric parameters, insulin resistance variables, osteoprotegerin, and nuclear factor-B ligand markers, carotid intima media thickness were examined at baseline for all participants. To evaluate the effect of therapy we determined the same parameters after the end of the study. Measurements of waist circumference, body mass index, body fat percentage and levels of fasting blood glucose, fasting insulin, homeostatic model assessment of insulin resistance, triglyceride levels and hsCRP and carotid intima media thickness were significantly higher in patients with prediabetes (p 0.05). Patients with prediabetes were under lifestyle interventions with (group 1, n = 33) or without metformin (group 2, n = 21) therapy. Baseline anthropometric and metabolic characteristics were not found statistically different in group 1 and group 2. Mean follow up period of the patients were 7.9 ± 2.2 month (min-max: 6-12 months). After the follow up period we evaluated the same parameters and found significant differences between waist circumference, body mass index, body fat percentage, fasting insulin, homeostatic model assessment of insulin resistance, and osteoprotegerin levels (p prediabetes was associated with a significant decrease in osteoprotegerin and certain metabolic variables together with an increase in nuclear
Sriwijitkamol, Apiradee; Christ-Roberts, Christine; Berria, Rachele; Eagan, Phyllis; Pratipanawatr, Thongchai; DeFronzo, Ralph A; Mandarino, Lawrence J; Musi, Nicolas
2006-03-01
Skeletal muscle insulin resistance plays a key role in the pathogenesis of type 2 diabetes. It recently has been hypothesized that excessive activity of the inhibitor of kappaB (IkappaB)/nuclear factor kappaB (NFkappaB) inflammatory pathway is a mechanism underlying skeletal muscle insulin resistance. However, it is not known whether IkappaB/NFkappaB signaling in muscle from subjects with type 2 diabetes is abnormal. We studied IkappaB/NFkappaB signaling in vastus lateralis muscle from six subjects with type 2 diabetes and eight matched control subjects. Muscle from type 2 diabetic subjects was characterized by a 60% decrease in IkappaB beta protein abundance, an indicator of increased activation of the IkappaB/NFkappaB pathway. IkappaB beta abundance directly correlated with insulin-mediated glucose disposal (Rd) during a hyperinsulinemic (40 mU x m(-2) x min(-1))-euglycemic clamp (r = 0.63, P = 0.01), indicating that increased IkappaB/NFkappaB pathway activity is associated with muscle insulin resistance. We also investigated whether reversal of this abnormality could be a mechanism by which training improves insulin sensitivity. In control subjects, 8 weeks of aerobic exercise training caused a 50% increase in both IkappaB alpha and IkappaB beta protein. In subjects with type 2 diabetes, training increased IkappaB alpha and IkappaB beta protein to levels comparable with that of control subjects, and these increments were accompanied by a 40% decrease in tumor necrosis factor alpha muscle content and a 37% increase in insulin-stimulated glucose disposal. In summary, subjects with type 2 diabetes have reduced IkappaB protein abundance in muscle, suggesting excessive activity of the IkappaB/NFkappaB pathway. Moreover, this abnormality is reversed by exercise training.
Takegahara, Noriko; Kim, Hyunsoo; Mizuno, Hiroki; Sakaue-Sawano, Asako; Miyawaki, Atsushi; Tomura, Michio; Kanagawa, Osami; Ishii, Masaru; Choi, Yongwon
2016-01-01
Osteoclasts are specialized polyploid cells that resorb bone. Upon stimulation with receptor activator of nuclear factor-κB ligand (RANKL), myeloid precursors commit to becoming polyploid, largely via cell fusion. Polyploidization of osteoclasts is necessary for their bone-resorbing activity, but the mechanisms by which polyploidization is controlled remain to be determined. Here, we demonstrated that in addition to cell fusion, incomplete cytokinesis also plays a role in osteoclast polyploidization. In in vitro cultured osteoclasts derived from mice expressing the fluorescent ubiquitin-based cell cycle indicator (Fucci), RANKL induced polyploidy by incomplete cytokinesis as well as cell fusion. Polyploid cells generated by incomplete cytokinesis had the potential to subsequently undergo cell fusion. Nuclear polyploidy was also observed in osteoclasts in vivo, suggesting the involvement of incomplete cytokinesis in physiological polyploidization. Furthermore, RANKL-induced incomplete cytokinesis was reduced by inhibition of Akt, resulting in impaired multinucleated osteoclast formation. Taken together, these results reveal that RANKL-induced incomplete cytokinesis contributes to polyploidization of osteoclasts via Akt activation. PMID:26670608
Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu
2014-10-27
The evaluation of virtual ligand screening methods is of major importance to ensure their reliability. Taking into account the agonist/antagonist pharmacological profile should improve the quality of the benchmarking data sets since ligand binding can induce conformational changes in the nuclear receptor structure and such changes may vary according to the agonist/antagonist ligand profile. We indeed found that splitting the agonist and antagonist ligands into two separate data sets for a given nuclear receptor target significantly enhances the quality of the evaluation. The pharmacological profile of the ligand bound in the binding site of the target structure was also found to be an additional critical parameter. We also illustrate that active compound data sets for a given pharmacological activity can be used as a set of experimentally validated decoy ligands for another pharmacological activity to ensure a reliable and challenging evaluation of virtual screening methods.
Takegahara, Noriko; Kim, Hyunsoo; Mizuno, Hiroki; Sakaue-Sawano, Asako; Miyawaki, Atsushi; Tomura, Michio; Kanagawa, Osami; Ishii, Masaru; Choi, Yongwon
2016-02-12
Osteoclasts are specialized polyploid cells that resorb bone. Upon stimulation with receptor activator of nuclear factor-κB ligand (RANKL), myeloid precursors commit to becoming polyploid, largely via cell fusion. Polyploidization of osteoclasts is necessary for their bone-resorbing activity, but the mechanisms by which polyploidization is controlled remain to be determined. Here, we demonstrated that in addition to cell fusion, incomplete cytokinesis also plays a role in osteoclast polyploidization. In in vitro cultured osteoclasts derived from mice expressing the fluorescent ubiquitin-based cell cycle indicator (Fucci), RANKL induced polyploidy by incomplete cytokinesis as well as cell fusion. Polyploid cells generated by incomplete cytokinesis had the potential to subsequently undergo cell fusion. Nuclear polyploidy was also observed in osteoclasts in vivo, suggesting the involvement of incomplete cytokinesis in physiological polyploidization. Furthermore, RANKL-induced incomplete cytokinesis was reduced by inhibition of Akt, resulting in impaired multinucleated osteoclast formation. Taken together, these results reveal that RANKL-induced incomplete cytokinesis contributes to polyploidization of osteoclasts via Akt activation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Optimizing the protein switch: altering nuclear import and export signals, and ligand binding domain
Kakar, Mudit; Davis, James R.; Kern, Steve E.; Lim, Carol S.
2007-01-01
Ligand regulated localization controllable protein constructs were optimized in this study. Several constructs were made from a classical nuclear export signal (HIV-rev, MAPKK, or progesterone receptor) in combination with a SV40 T-antigen type nuclear import signal. Different ligand binding domains (LBDs from glucocorticoid receptor or progesterone receptor) were also tested for their ability to impart control over localization of proteins. This study was designed to create constructs which are cytoplasmic in the absence of ligand and nuclear in the presence of ligand, and also to regulate the amount of protein translocating to the nucleus on ligand induction. The balance between the strengths of import and export signals was critical for overall localization of proteins. The amount of protein entering the nucleus was also affected by the dose of ligand (10-100nM). However, the overall import characteristics were determined by the strengths of localization signals and the inherent localization properties of the LBD used. This study established that the amount of protein present in a particular compartment can be regulated by the use of localization signals of various strengths. These optimized localization controllable protein constructs can be used to correct for diseases due to aberrant localization of proteins. PMID:17574289
Directory of Open Access Journals (Sweden)
Haidi Bi
2017-12-01
Full Text Available Osteoclasts, the only cells with bone resorption functions in vivo, maintain the balance of bone metabolism by cooperating with osteoblasts, which are responsible for bone formation. Excessive activity of osteoclasts causes many diseases such as osteoporosis, periprosthetic osteolysis, bone tumors, and Paget’s disease. In contrast, osteopetrosis results from osteoclast deficiency. Available strategies for combating over-activated osteoclasts and the subsequently induced diseases can be categorized into three approaches: facilitating osteoclast apoptosis, inhibiting osteoclastogenesis, and impairing bone resorption. Bisphosphonates are representative molecules that function by triggering osteoclast apoptosis. New drugs, such as tumor necrosis factor and receptor activator of nuclear factor kappa-B ligand (RANKL inhibitors (e.g., denosumab have been developed for targeting the receptor activator of nuclear factor kappa-B /RANKL/osteoprotegerin system or CSF-1/CSF-1R axis, which play critical roles in osteoclast formation. Furthermore, vacuolar (H+-ATPase inhibitors, cathepsin K inhibitors, and glucagon-like peptide 2 impair different stages of the bone resorption process. Recently, significant achievements have been made in this field. The aim of this review is to provide an updated summary of the current progress in research involving osteoclast-related diseases and of the development of targeted inhibitors of osteoclast formation.
Orphan nuclear receptor TR4 and fibroblast growth factor 1 in metabolism
Liu, Weilin
2016-01-01
Metabolic homeostasis is achieved, in part, through the coordinated activities of members of the Nuclear Receptor (NR) family, a superfamily of ligand-modulated transcription factors (TFs) that mediate responses to a wide range of lipophilic signaling molecules including lipids, steroids, retinoids,
Leoncini, Andrea
2017-01-01
The research topic of this thesis concerns the synthesis and evaluation of new diglycolamide (DGA) ligands for the extraction and (potential) separation of actinide and lanthanide ions from bulk spent nuclear fuel. This work was aimed at the development of new pre-organised ligands with improved
Richardson, Jaime Stella Moses; Aminudin, Norhaniza; Abd Malek, Sri Nurestri
2017-10-01
transducer and activation of transcription 3, and extrinsic apoptotic pathway and also its ability to arrest cell cycle in S phase. This compound was from the leaves of Ruta angustifolia L. Pers. It provides new insight on the ability of this plant in suppressing certain cancers, especially the nonsmall cell lung carcinoma according to this study. Abbreviations used: °C: Degree Celsius, ANOVA: Analysis of variance, ATCC: American Type Culture Collection, BCL-2: B-Cell CLL/Lymphoma 2, Bcl-xL: B-cell lymphoma extra-large, BH3: Bcl-2 homology 3, BID: BH3-interacting domain death agonist, BIR: Baculovirus inhibitor of apoptosis protein repeat, Caspases: Cysteinyl aspartate-specific proteases, CDK: Cyclin-dependent kinase, CO 2 : Carbon dioxide, CST: Cell signaling technologies, DISC: Death-inducing signaling complex, DMSO: Dimethyl sulfoxide, DNA: Deoxyribonucleic acid, DR4: Death receptor 4, DR5: Death receptor 5, E1a: Adenovirus early region 1A, ECL: Enhanced chemiluminescence, EDTA: Ethylenediaminetetraacetic acid, ELISA: Enzyme-linked immunosorbent assay, etc.: Etcetera, FADD: Fas-associated protein with death domain, FBS: Fetal bovine serum, FITC: Fluorescein isothiocyanate, G1: Gap 1, G2: Gap 2, HPLC: High-performance liquid chromatography, HRP: Horseradish peroxidase, IAPs: Inhibitor of apoptosis proteins, IC50: Inhibitory concentration at half maximal inhibitory, IKK-α: Inhibitor of nuclear factor kappa-B kinase subunit alpha, IKK-β: Inhibitor of nuclear factor kappa-B kinase subunit beta, IKK-γ: Inhibitor of nuclear factor kappa-B kinase subunit gamma, IKK: IκB kinase, IkBα: Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha, m: Meter, M: Mitotic, mm: Millimeter, mRNA: Messenger ribonucleic acid, NaCl: Sodium chloride, NaVO4: Sodium orthovanadate, NEMO: NF-Kappa-B essential modulator, NF-κB: Nuclear factor kappa-light chain-enhancer of activated B cells, NSCLC: Nonsmall cell lung carcinoma, PBS: Phosphate buffered saline, PGE2
Antidiabetic actions of a phosphatidylcholine ligand for nuclear receptor LRH-1
Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L.; Busby, Scott A.; Griffin, Patrick R.; Pathak, Manish C.; Ortlund, Eric A.; Moore, David D.
2011-01-01
Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (NR5A2) regulates bile acid biosynthesis1,2. Structural studies have identified phospholipids as potential LRH-1 ligands3–5, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine, DLPC) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signaling pathway that regulates bile acid metabolism and glucose homeostasis. PMID:21614002
Directory of Open Access Journals (Sweden)
Frank Zach
Full Text Available In vitro differentiation into functional osteoclasts is routinely achieved by incubation of embryonic stem cells, induced pluripotent stem cells, or primary as well as cryopreserved spleen and bone marrow-derived cells with soluble receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor. Additionally, osteoclasts can be derived from co-cultures with osteoblasts or by direct administration of soluble receptor activator of nuclear factor kappa-B ligand to RAW 264.7 macrophage lineage cells. However, despite their benefits for osteoclast-associated research, these different methods have several drawbacks with respect to differentiation yields, time and animal consumption, storage life of progenitor cells or the limited potential for genetic manipulation of osteoclast precursors. In the present study, we therefore established a novel protocol for the differentiation of osteoclasts from murine ER-Hoxb8-immortalized myeloid stem cells. We isolated and immortalized bone marrow cells from wild type and genetically manipulated mouse lines, optimized protocols for osteoclast differentiation and compared these cells to osteoclasts derived from conventional sources. In vitro generated ER-Hoxb8 osteoclasts displayed typical osteoclast characteristics such as multi-nucleation, tartrate-resistant acid phosphatase staining of supernatants and cells, F-actin ring formation and bone resorption activity. Furthermore, the osteoclast differentiation time course was traced on a gene expression level. Increased expression of osteoclast-specific genes and decreased expression of stem cell marker genes during differentiation of osteoclasts from ER-Hoxb8-immortalized myeloid progenitor cells were detected by gene array and confirmed by semi-quantitative and quantitative RT-PCR approaches. In summary, we established a novel method for the quantitative production of murine bona fide osteoclasts from ER-Hoxb8 stem cells generated from
Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi
2012-11-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.
Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A; Manna, Sunil K
2010-02-19
The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor kappaB (NF-kappaB) and also expression of NF-kappaB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-kappaB (IkappaB alpha) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IkappaB alpha kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-kappaB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy.
International Nuclear Information System (INIS)
Ghanty, Tapan K.
2016-01-01
In recent years, considerable attention has been given to understand the coordination chemistry of trivalent lanthanide (Ln) and actinide (An) with various ligands because of its close link with the nuclear waste management processes. It is well known that lanthanide-actinide separation is a challenging and difficult task because of very similar chemical properties of these two series of ions, which are associated with similar ionic radii and coordination numbers. Recently, we have introduced a new concept, 'intra-ligand synergism', where hard donor atom, such as, oxygen preferentially binds to trivalent actinides (An(III)) as compared to the valence iso-electronic trivalent lanthanides (Ln(III)) in presence of another soft donor centre. In the present work, the conventional concept of selective complexation of actinides with soft donor ligands (either S or N donor) has been modified through exploiting this concept, and thereby the higher selectivity of 1,10-phenanthroline-2,9-dicarboxylamide (PDAM) based ligands, namely PDAM and its isobutyl and decyl derivatives towards Am(III) ion has been predicted theoretically through density functional calculations. Subsequently, several such amide derivatives have been synthesized to optimize the solubility of the ligands in organic phase. Finally, solvent extraction experiments have been carried out to validate the theoretical prediction on the selectivity of oxygen donor ligands towards Am(III) as compared to Eu(III), and a maximum separation factor of about 51 has been achieved experimentally using 2,9-bis(N-decylaminocarbonyl)-1,10-phenanthroline ligand. The separation factor is increased with the decrease in pH, which is very interesting since extraction of the Am 3+ ion is considered to be important under highly acidic conditions from the nuclear waste management point of view. (author)
Directory of Open Access Journals (Sweden)
Doaa M. Samy
2016-09-01
Full Text Available Secondary damage after acute spinal cord compression injury (SCCI exacerbates initial insult. Nuclear factor kappa-B (NF-κB-p65 activation is involved in SCCI deleterious effects. Agmatine (Agm showed neuroprotection against various CNS injuries. However, Agm impact on NF-κB signaling in acute SCCI remains to be investigated. The present study compared the effectiveness of Agm therapy and decompression laminectomy (DL in functional recovery, oxidative stress, inflammatory and apoptotic responses, and modulation of NF-κB activation in acute SCCI rat model. Rats were either sham-operated or subjected to SCCI at T8–9, using 2-Fr. catheter. SCCI rats were randomly treated with DL at T8–9, intraperitoneal Agm (100 mg/kg/day, combined (DL/Agm treatment or saline (n = 16/group. After 28-days of neurological follow-up, spinal cords were either subjected to biochemical measurement of oxidative stress and inflammatory markers or histopathology and immuno-histochemistry for NF-κB-p65 and caspase-3 expression (n = 8/group. Agm was comparable to DL in facilitating neurological functions recovery, reducing inflammation (TNF-α/interleukin-6, and apoptosis. Agm was distinctive in combating oxidative stress. Agm neuroprotective effects were paralleled with inhibition of NF-κB-p65 nuclear translocation. Combined pharmacological and surgical interventions were proved superior in functional recovery. In conclusion, present research suggested a new mechanism for Agm neuroprotection in rats SCCI through inhibition of NF-κB activation.
Directory of Open Access Journals (Sweden)
Hakan Yavuzer
2017-12-01
Full Text Available Aim: In order to analyze the relationship of Hashimoto’s thyroiditis with vitamin D and osteoclastogenic markers, we investigated vitamin D, osteoprotegerin (OPG and receptor activator of nuclear factor ligand (RANKL levels in patients over 60 years with and without Hashimoto’s thyroiditis. Methods: Eighty three female patients (49 with and 34 without Hashimoto’s thyroiditis, who attended the endocrinology and geriatrics departments between May 2013 and October 2013 were included in the study. Results: There was no statistically significant difference in the levels of vitamin D, OPG and RANKL between the groups. Vitamin D was significantly correlated with OPG and RANKL in patients with Hashimoto’s thyroiditis. In addition, a significant relationship was found between OPG and RANKL levels. Of the patients with Hashimoto’s thyroiditis, 33 were autoantibody-positive and 16 were negative. Vitamin D, OPG and RANKL levels were significantly lower in antibody-positive patients than in negative subjects. Conclucion: There were no differences in vitamin D, OPG and RANKL levels between patients with and without Hashimoto’s thyroidits. Autoantibody-positive Hashimoto’s thyroiditis group had statistically significantly lower vitamin D, OPG and RANKL levels. This reverse correlation suggests that autoantibodies may have an effect on osteoclastogenesis.
Alpha Radiolysis of Nuclear Solvent Extraction Ligands Used for An(III) and Ln(III) Separations
Energy Technology Data Exchange (ETDEWEB)
Mezyk, Stephen P. [California State Univ. (CalState), Long Beach, CA (United States); Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Nilsson, Mikael [Univ. of California, Irvine, CA (United States)
2016-08-01
This document is the final report for the Nuclear Energy Universities Program (NEUP) grant 10-910 (DE-AC07-05ID14517) “Alpha Radiolysis of Nuclear Solvent Extraction Ligands used for An(III) and Ln(III) Separations”. The goal of this work was to obtain a quantitative understanding of the impacts of both low Linear Energy Transfer (LET, gamma-rays) and high LET (alpha particles) radiation chemistry occurring in future large-scale separations processes. This quantitative understanding of the major radiation effects on diluents and ligands is essential for optimal process implementation, and could result in significant cost savings in the future.
FTZ-Factor1 and Fushi tarazu interact via conserved nuclear receptor and coactivator motifs
Schwartz, Carol J.E.; Sampson, Heidi M.; Hlousek, Daniela; Percival-Smith, Anthony; Copeland, John W.R.; Simmonds, Andrew J.; Krause, Henry M.
2001-01-01
To activate transcription, most nuclear receptor proteins require coactivators that bind to their ligand-binding domains (LBDs). The Drosophila FTZ-Factor1 (FTZ-F1) protein is a conserved member of the nuclear receptor superfamily, but was previously thought to lack an AF2 motif, a motif that is required for ligand and coactivator binding. Here we show that FTZ-F1 does have an AF2 motif and that it is required to bind a coactivator, the homeodomain-containing protein Fushi tarazu (FTZ). We also show that FTZ contains an AF2-interacting nuclear receptor box, the first to be found in a homeodomain protein. Both interaction motifs are shown to be necessary for physical interactions in vitro and for functional interactions in developing embryos. These unexpected findings have important implications for the conserved homologs of the two proteins. PMID:11157757
Kim, A-Ram; Kim, Hyuk Soon; Lee, Jeong Min; Choi, Jung Ho; Kim, Se Na; Kim, Do Kyun; Kim, Ji Hyung; Mun, Se Hwan; Kim, Jie Wan; Jeon, Hyun Soo; Kim, Young Mi; Choi, Wahn Soo
2012-05-05
Osteoclasts, multinucleated bone-resorbing cells, are closely associated with bone diseases such as rheumatoid arthritis and osteoporosis. Osteoclasts are derived from hematopoietic precursor cells, and their differentiation is mediated by two cytokines, including macrophage colony stimulating factor and receptor activator of nuclear factor κB ligand (RANKL). Previous studies have shown that arctigenin exhibits an anti-inflammatory effect. However, the effect of arctigenin on osteoclast differentiation is yet to be elucidated. In this study, we found that arctigenin inhibited RANKL-mediated osteoclast differentiation in bone marrow macrophages in a dose-dependent manner and suppressed RANKL-mediated bone resorption. Additionally, the expression of typical marker proteins, such as NFATc1, c-Fos, TRAF6, c-Src, and cathepsin K, were significantly inhibited. Arctigenin inhibited the phosphorylation of Erk1/2, but not p38 and JNK, in a dose-dependent manner. Arctigenin also dramatically suppressed immunoreceptor tyrosine-based activation motif-mediated costimulatory signaling molecules, including Syk and PLCγ2, and Gab2. Notably, arctigenin inhibited the activation of Syk through RANKL stimulation. Furthermore, arctigenin prevented osteoclast differentiation in the calvarial bone of mice following stimulation with lipopolysaccharide. Our results show that arctigenin inhibits osteoclast differentiation in vitro and in vivo. Therefore, arctigenin may be useful for treating rheumatoid arthritis and osteoporosis. Copyright © 2012 Elsevier B.V. All rights reserved.
Saber, Sameh; Mahmoud, Amr A A; Helal, Noha S; El-Ahwany, Eman; Abdelghany, Rasha H
2018-06-01
Therapeutic interventions for liver fibrosis are still limited due to the complicated molecular pathogenesis. Renin-angiotensin system (RAS) seems to contribute to the development of hepatic fibrosis. Therefore, we aimed to examine the effect of RAS inhibition on CCl 4 -induced liver fibrosis. Mice were treated with silymarin (30 mg·kg -1 ), perindopril (1 mg·kg -1 ), fosinopril (2 mg·kg -1 ), or losartan (10 mg·kg -1 ). The administration of RAS inhibitors improved liver histology and decreased protein expression of alpha smooth muscle actin (α-SMA) and hepatic content of hydroxyproline. These effects found to be mediated via inactivation of nuclear transcription factor kappa B (NFκB) pathway by the inhibition of NFκB p65 phosphorylation at the Ser536 residue and phosphorylation-induced degradation of nuclear factor kappa-B inhibitor alpha (NFκBia) subsequently inhibited NFκB-induced TNF-α and TGF-β1, leading to lower levels of tissue inhibitor of metalloproteinase-1 (TIMP-1) and vascular endothelial growth factor (VEGF). We concluded that the tissue affinity of the angiotensin converting enzyme inhibitors (ACEIs) has no impact on its antifibrotic activity and that interfering the RAS either through the inhibition of ACE or the blockade of AT1R has the same therapeutic benefit. These results suggest RAS inhibitors as promising candidates for further clinical trials in the management of hepatic fibrosis.
DEFF Research Database (Denmark)
Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe
2013-01-01
after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist....... Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown...... fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand...
PPARγ and Its Ligands: Potential Antitumor Agents in the Digestive System.
Shu, Linjing; Huang, Renhuan; Wu, Songtao; Chen, Zhaozhao; Sun, Ke; Jiang, Yan; Cai, Xiaoxiao
2016-01-01
Peroxisome proliferator-activated receptor γ (PPARγ) is a versatile member of the ligand-activated nuclear hormone receptor superfamily of transcription factors, with expression in several different cell lines, especially in the digestive system. After being activated by its ligand, PPARγ can suppress the growth of oral, esophageal, gastric, colorectal, liver, biliary, and pancreatic tumor cells, suggesting that PPARγ ligand is a potential anticancer agent in PPARγ-expressing tumors. This review highlights key advances in understanding the effects of PPARγ ligands in the treatment of tumors in the digestive system.
Immunodeficiency associated with a nonsense mutation of IKBKB
DEFF Research Database (Denmark)
Nielsen, Christian; Jakobsen, Marianne A; Larsen, Martin Jakob
2014-01-01
We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory insufficie......We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory...... no explanation before whole exome sequencing revealed a novel mutation abrogating signaling through the canonical NF-κB pathway....
Nuclear receptor ligand-binding domains: reduction of helix H12 dynamics to favour crystallization
Energy Technology Data Exchange (ETDEWEB)
Nahoum, Virginie; Lipski, Alexandra; Quillard, Fabien; Guichou, Jean-François [INSERM, U554, 34090 Montpellier (France); Université de Montpellier, CNRS, UMR5048, Centre de Biochimie Structurale (CBS), 34090 Montpellier (France); Boublik, Yvan [CNRS, UMR5237, Centre de Recherche de Biochimie Macromoléculaire (CRBM), 34293 Montpellier (France); Pérez, Efrèn [Universidade de Vigo, Departamento de Quimica Organica, Facultad de Química, 36310 Vigo (Spain); Germain, Pierre [Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), BP 10142, 67404 Illkirch CEDEX (France); Lera, Angel R. de [Universidade de Vigo, Departamento de Quimica Organica, Facultad de Química, 36310 Vigo (Spain); Bourguet, William, E-mail: bourguet@cbs.cnrs.fr [INSERM, U554, 34090 Montpellier (France); Université de Montpellier, CNRS, UMR5048, Centre de Biochimie Structurale (CBS), 34090 Montpellier (France)
2008-07-01
Attempts have been made to crystallize the ligand-binding domain of the human retinoid X receptor in complex with a variety of newly synthesized ligands. An inverse correlation was observed between the ‘crystallizability’ and the structural dynamics of the various receptor–ligand complexes. Crystallization trials of the human retinoid X receptor α ligand-binding domain (RXRα LBD) in complex with various ligands have been carried out. Using fluorescence anisotropy, it has been found that when compared with agonists these small-molecule effectors enhance the dynamics of the RXRα LBD C-terminal helix H12. In some cases, the mobility of this helix could be dramatically reduced by the addition of a 13-residue co-activator fragment (CoA). In keeping with these observations, crystals have been obtained of the corresponding ternary RXRα LBD–ligand–CoA complexes. In contrast, attempts to crystallize complexes with a highly mobile H12 remained unsuccessful. These experimental observations substantiate the previously recognized role of co-regulator fragments in facilitating the crystallization of nuclear receptor LBDs.
Directory of Open Access Journals (Sweden)
Lasse Henriksen
Full Text Available The epidermal growth factor receptor (EGFR regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF and transforming growth factor-α (TGF-α. For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF or betacellulin (BTC was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown.
Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther
2013-01-01
The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148
Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan
2018-01-01
Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hunt, J Porter; Schinn, Song-Min; Jones, Matthew D; Bundy, Bradley C
2017-12-04
Endocrine disrupting chemicals (EDC) are structurally diverse compounds that can interact with nuclear hormone receptors, posing significant risk to human and ecological health. Unfortunately, many conventional biosensors have been too structure-specific, labor-intensive or laboratory-oriented to detect broad ranges of EDC effectively. Recently, several technological advances are providing more rapid, portable, and affordable detection of endocrine-disrupting activity through ligand-nuclear hormone receptor interactions. Here, we overview these recent advances applied to EDC biosensors - including cell lyophilization, cell immobilization, cell-free systems, smartphone-based signal detection, and improved competitive binding assays.
Fredriksson, Lisa; Herpers, Bram; Benedetti, Giulia; Matadin, Quraisha; Puigvert, Jordi C; de Bont, Hans; Dragovic, Sanja; Vermeulen, Nico P E; Commandeur, Jan N M; Danen, Erik; de Graauw, Marjo; van de Water, Bob
2011-06-01
Drug-induced liver injury (DILI) is an important clinical problem. It involves crosstalk between drug toxicity and the immune system, but the exact mechanism at the cellular hepatocyte level is not well understood. Here we studied the mechanism of crosstalk in hepatocyte apoptosis caused by diclofenac and the proinflammatory cytokine tumor necrosis factor α (TNF-α). HepG2 cells were treated with diclofenac followed by TNF-α challenge and subsequent evaluation of necrosis and apoptosis. Diclofenac caused a mild apoptosis of HepG2 cells, which was strongly potentiated by TNF-α. A focused apoptosis machinery short interference RNA (siRNA) library screen identified that this TNF-α-mediated enhancement involved activation of caspase-3 through a caspase-8/Bid/APAF1 pathway. Diclofenac itself induced sustained activation of c-Jun N-terminal kinase (JNK) and inhibition of JNK decreased both diclofenac and diclofenac/TNF-α-induced apoptosis. Live cell imaging of GFPp65/RelA showed that diclofenac dampened the TNF-α-mediated nuclear factor kappaB (NF-κB) translocation oscillation in association with reduced NF-κB transcriptional activity. This was associated with inhibition by diclofenac of the TNF-α-induced phosphorylation of the inhibitor of NF-κB alpha (IκBα). Finally, inhibition of IκB kinase β (IKKβ) with BMS-345541 as well as stable lentiviral short hairpin RNA (shRNA)-based knockdown of p65/RelA sensitized hepatocytes towards diclofenac/TNF-α-induced cytotoxicity. Together, our data suggest a model whereby diclofenac-mediated stress signaling suppresses TNF-α-induced survival signaling routes and sensitizes cells to apoptosis. Copyright © 2011 American Association for the Study of Liver Diseases.
Mahanti, Parag; Bose, Neelanjan; Bethke, Axel; Judkins, Joshua C.; Wollam, Joshua; Dumas, Kathleen J.; Zimmerman, Anna M.; Campbell, Sydney L.; Hu, Patrick J.; Antebi, Adam; Schroeder, Frank C.
2014-01-01
SUMMARY Small-molecule ligands of nuclear hormone receptors (NHRs) govern the transcriptional regulation of metazoan development, cell differentiation, and metabolism. However, the physiological ligands of many NHRs remain poorly characterized primarily due to lack of robust analytical techniques. Using comparative metabolomics, we identified endogenous steroids that act as ligands of the C. elegans NHR, DAF-12, a vitamin-D and liver-X receptor homolog regulating larval development, fat metabolism, and lifespan. The identified molecules feature unexpected chemical modifications and include only one of two DAF-12 ligands reported earlier, necessitating a revision of previously proposed ligand biosynthetic pathways. We further show that ligand profiles are regulated by a complex enzymatic network including the Rieske oxygenase DAF-36, the short-chain dehydrogenase DHS-16, and the hydroxysteroid dehydrogenase, HSD-1. Our results demonstrate the advantages of comparative metabolomics over traditional candidate-based approaches and provide a blueprint for the identification of ligands for other C. elegans and mammalian NHRs. PMID:24411940
Bilyeu, Jennifer D; Panta, Ganesh R; Cavin, Lakita G; Barrett, Christina M; Turner, Eddie J; Sweatman, Trevor W; Israel, Mervyn; Lothstein, Leonard; Arsura, Marcello
2004-04-01
Nuclear factor kappaB (NF-kappaB) has been implicated in inducible chemoresistance against anthracyclines. In an effort to improve the cytotoxicity of anthracyclines while reducing their cardiotoxic effects, we have developed a novel class of extranuclear-localizing 14-O-acylanthracyclines that bind to the phorbol ester/diacylglycerol-binding C1b domain of conventional and novel protein kinase C (PKC) isoforms, thereby promoting an apoptotic response. Because PKCs have been shown to be involved in NF-kappaB activation, in this report, we determined the mechanism of NF-kappaB activation by N-benzyladriamycin-14-valerate (AD 198) and N-benzyladriamycin-14-pivalate (AD 445), two novel 14-O-acylanthracylines. We show that the induction of NF-kappaB activity in response to drug treatment relies on the activation of PKC-delta and NF-kappaB-activating kinase (NAK), independent of ataxia telengectasia mutated and p53 activities. In turn, NAK activates the IKK complex through phosphorylation of the IKK-2 subunit. We find that neither NF-kappaB activation nor ectopic expression of Bcl-X(L) confers protection from AD 198-induced cell killing. Overall, our data indicate that activation of novel PKC isoforms by cytoplasmic-targeted 14-O-acylanthracyclines promotes an apoptotic response independent of DNA damage, which is unimpeded by inducible activation of NF-kappaB.
Energy Technology Data Exchange (ETDEWEB)
Veggiani, Gianluca; Ossolengo, Giuseppe; Aliprandi, Marisa; Cavallaro, Ugo [IFOM-IEO Campus, Via Adamello 16, 20139 Milano (Italy); Marco, Ario de, E-mail: ario.demarco@ung.si [IFOM-IEO Campus, Via Adamello 16, 20139 Milano (Italy); Dept. Environmental Sciences, University of Nova Gorica (UNG), Vipavska 13, P.O. Box 301-SI-5000, Rozna Dolina, Nova Gorica (Slovenia)
2011-05-20
Highlights: {yields} Recombinant antibodies for FGFR1 were isolated from a llama naive library in VHH format. {yields} These antibodies compete with the natural ligand FGF-2 for the same epitope on FGFR1. {yields} The antibody competition inhibits the FGF-2-dependent internalization of FGFR1. -- Abstract: Single-domain antibodies in VHH format specific for fibroblast growth factor receptor 1 (FGFR1) were isolated from a phage-display llama naive library. In particular, phage elution in the presence of the natural receptor ligand fibroblast growth factor (FGF) allowed for the identification of recombinant antibodies that compete with FGF for the same region on the receptor surface. These antibodies posses a relatively low affinity for FGFR1 and were never identified when unspecific elution conditions favoring highly affine binders were applied to panning procedures. Two populations of competitive antibodies were identified that labeled specifically the receptor-expressing cells in immunofluorescence and recognize distinct epitopes. Antibodies from both populations effectively prevented FGF-dependent internalization and nuclear accumulation of the receptor in cultured cells. This achievement indicates that these antibodies have a capacity to modulate the receptor physiology and, therefore, constitute powerful reagents for basic research and a potential lead for therapeutic applications.
International Nuclear Information System (INIS)
Veggiani, Gianluca; Ossolengo, Giuseppe; Aliprandi, Marisa; Cavallaro, Ugo; Marco, Ario de
2011-01-01
Highlights: → Recombinant antibodies for FGFR1 were isolated from a llama naive library in VHH format. → These antibodies compete with the natural ligand FGF-2 for the same epitope on FGFR1. → The antibody competition inhibits the FGF-2-dependent internalization of FGFR1. -- Abstract: Single-domain antibodies in VHH format specific for fibroblast growth factor receptor 1 (FGFR1) were isolated from a phage-display llama naive library. In particular, phage elution in the presence of the natural receptor ligand fibroblast growth factor (FGF) allowed for the identification of recombinant antibodies that compete with FGF for the same region on the receptor surface. These antibodies posses a relatively low affinity for FGFR1 and were never identified when unspecific elution conditions favoring highly affine binders were applied to panning procedures. Two populations of competitive antibodies were identified that labeled specifically the receptor-expressing cells in immunofluorescence and recognize distinct epitopes. Antibodies from both populations effectively prevented FGF-dependent internalization and nuclear accumulation of the receptor in cultured cells. This achievement indicates that these antibodies have a capacity to modulate the receptor physiology and, therefore, constitute powerful reagents for basic research and a potential lead for therapeutic applications.
Bone Canopies in Pediatric Renal Osteodystrophy
DEFF Research Database (Denmark)
Pereira, Renata C; Levin Andersen, Thomas; Friedman, Peter A
2016-01-01
Pediatric renal osteodystrophy (ROD) is characterized by changes in bone turnover, mineralization, and volume that are brought about by alterations in bone resorption and formation. The resorptive and formative surfaces on the cancellous bone are separated from the marrow cavity by canopies...... and their association with biochemical and bone histomorphometric parameters in 106 pediatric chronic kidney disease (CKD) patients (stage 2-5) across the spectrum of ROD. Canopies in CKD patients often appeared as thickened multilayered canopies, similar to previous reports in patients with primary hyperparathyroidism....... This finding contrasts with the thin appearance reported in healthy individuals with normal kidney function. Furthermore, canopies in pediatric CKD patients showed immunoreactivity to the PTH receptor (PTHR1) as well as to the receptor activator of nuclear factor kappa-B ligand (RANKL). The number of surfaces...
RANK/RANK-Ligand/OPG: Ein neuer Therapieansatz in der Osteoporosebehandlung
Directory of Open Access Journals (Sweden)
Preisinger E
2007-01-01
Full Text Available Die Erforschung der Kopplungsmechanismen zur Osteoklastogenese, Knochenresorption und Remodellierung eröffnete neue mögliche Therapieansätze in der Behandlung der Osteoporose. Eine Schlüsselrolle beim Knochenabbau spielt der RANK- ("receptor activator of nuclear factor (NF- κB"- Ligand (RANKL. Durch die Bindung von RANKL an den Rezeptor RANK wird die Knochenresorption eingeleitet. OPG (Osteoprotegerin sowie der für den klinischen Gebrauch entwickelte humane monoklonale Antikörper (IgG2 Denosumab blockieren die Bindung von RANK-Ligand an RANK und verhindern den Knochenabbau.
Kanatli, Irem; Akkaya, Bahar; Uysal, Hilmi; Kahraman, Sevim; Sanlioglu, Ahter Dilsad
2017-02-01
Myasthenia Gravis is an autoantibody-mediated, neuromuscular junction disease, and is usually associated with thymic abnormalities presented as thymic tumors (~10%) or hyperplastic thymus (~65%). The exact role of thymus in Myasthenia Gravis development is not clear, yet many patients benefit from thymectomy. The apoptotic ligand TNF-Related Apoptosis-Inducing Ligand is thought to be involved in the regulation of thymocyte counts, although conflicting results are reported. We investigated differential expression profiles of TNF-Related Apoptosis-Inducing Ligand and its transmembrane receptors, Nuclear Factor-kB activation status, and apoptotic cell counts in healthy thymic tissue and pathological thymus from Myasthenia Gravis patients. All tissues expressed TNF-Related Apoptosis-Inducing Ligand and its receptors, with hyperplastic tissue having the highest expression levels of death receptors DR4 and DR5. No detectable Nuclear Factor-kB activation, at least via the canonical Protein Kinase A-mediated p65 Ser276 phosphorylation, was evident in any of the tissues studied. Apoptotic cell counts were higher in MG-associated tissue compared to the normal thymus. Possible use of the TNF-Related Apoptosis-Inducing Ligand within the concept of an apoptotic ligand-mediated medical thymectomy in thymoma- or thymic hyperplasia-associated Myasthenia Gravis is also discussed. Copyright © 2016 Elsevier B.V. All rights reserved.
Dynamic regulation of Drosophila nuclear receptor activity in vivo.
Palanker, Laura; Necakov, Aleksandar S; Sampson, Heidi M; Ni, Ruoyu; Hu, Chun; Thummel, Carl S; Krause, Henry M
2006-09-01
Nuclear receptors are a large family of transcription factors that play major roles in development, metamorphosis, metabolism and disease. To determine how, where and when nuclear receptors are regulated by small chemical ligands and/or protein partners, we have used a 'ligand sensor' system to visualize spatial activity patterns for each of the 18 Drosophila nuclear receptors in live developing animals. Transgenic lines were established that express the ligand binding domain of each nuclear receptor fused to the DNA-binding domain of yeast GAL4. When combined with a GAL4-responsive reporter gene, the fusion proteins show tissue- and stage-specific patterns of activation. We show that these responses accurately reflect the presence of endogenous and exogenously added hormone, and that they can be modulated by nuclear receptor partner proteins. The amnioserosa, yolk, midgut and fat body, which play major roles in lipid storage, metabolism and developmental timing, were identified as frequent sites of nuclear receptor activity. We also see dynamic changes in activation that are indicative of sweeping changes in ligand and/or co-factor production. The screening of a small compound library using this system identified the angular psoralen angelicin and the insect growth regulator fenoxycarb as activators of the Ultraspiracle (USP) ligand-binding domain. These results demonstrate the utility of this system for the functional dissection of nuclear receptor pathways and for the development of new receptor agonists and antagonists that can be used to modulate metabolism and disease and to develop more effective means of insect control.
Thioesterase activity and acyl-CoA/fatty acid cross-talk of hepatocyte nuclear factor-4{alpha}.
Hertz, Rachel; Kalderon, Bella; Byk, Tamara; Berman, Ina; Za'tara, Ghadeer; Mayer, Raphael; Bar-Tana, Jacob
2005-07-01
Hepatocyte nuclear factor-4alpha (HNF-4alpha) activity is modulated by natural and xenobiotic fatty acid and fatty acyl-CoA ligands as a function of their chain length, unsaturation, and substitutions. The acyl-CoA site of HNF-4alpha is reported here to consist of the E-F domain, to bind long-chain acyl-CoAs but not the respective free acids, and to catalyze the hydrolysis of bound fatty acyl-CoAs. The free acid pocket, previously reported in the x-ray structure of HNF-4alpha E-domain, entraps fatty acids but excludes acyl-CoAs. The acyl-CoA and free acid sites are distinctive and noncongruent. Free fatty acid products of HNF-4alpha thioesterase may exchange with free acids entrapped in the fatty acid pocket of HNF-4alpha. Cross-talk between the acyl-CoA and free fatty acid binding sites is abrogated by high affinity, nonhydrolyzable acyl-CoA ligands of HNF-4alpha that inhibit its thioesterase activity. Hence, HNF-4alpha transcriptional activity is controlled by its two interrelated acyl ligands and two binding sites interphased in tandem by the thioesterase activity. The acyl-CoA/free-acid and receptor/enzyme duality of HNF-4alpha extends the paradigm of nuclear receptors.
Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.
Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F
2014-10-17
The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.
Energy Technology Data Exchange (ETDEWEB)
Higginson, Matthew A.; Livens, Francis R.; Heath, Sarah L. [Manchester Univ. (United Kingdom). Centre for Radiochemistry Research; Thompson, Paul; Marsden, Olivia J. [AWE, Aldermaston, Reading (United Kingdom); Harwood, Laurence M.; Hudson, Michael J. [Reading Univ. (United Kingdom). Dept. of Chemistry; Lewis, Frank W. [Reading Univ. (United Kingdom). Dept. of Chemistry; Northumbria Univ., Newcastle upon Tyne (United Kingdom). Dept. of Chemical and Forensic Sciences
2015-07-01
In analysis of complex nuclear forensic samples containing lanthanides, actinides and matrix elements, rapid selective extraction of Am/Cm for quantification is challenging, in particular due the difficult separation of Am/Cm from lanthanides. Here we present a separation process for Am/Cm(III) which is achieved using a combination of AG1-X8 chromatography followed by Am/Cm extraction with a triazine ligand. The ligands tested in our process were CyMe{sub 4}-BTPhen, CyMe{sub 4}-BTBP, CA-BTP and CA-BTPhen. Our process allows for purification and quantification of Am and Cm (recoveries 80% - 100%) and other major actinides in < 2 d without the use of multiple columns or thiocyanate. The process is unaffected by high level Ca(II)/Fe(III)/Al(III) (10 mg mL{sup -1}) and thus requires little pre-treatment of samples.
Embryonic expression of the transforming growth factor beta ligand and receptor genes in chicken.
Cooley, James R; Yatskievych, Tatiana A; Antin, Parker B
2014-03-01
Transforming growth factor-beta (TGFβ) signaling regulates a myriad of biological processes during embryogenesis, in the adult, and during the manifestation of disease. TGFβ signaling is propagated through one of three TGFβ ligands interacting with Type I and Type II receptors, and Type III co-receptors. Although TGFβ signaling is regulated partly by the combinatorial expression patterns of TGFβ receptors and ligands, a comprehensive gene expression analysis has not been published. Here we report the embryonic mRNA expression patterns in chicken embryos of the canonical TGFβ ligands (TGFB1, TGFB2, and TGFB3) and receptors (TGFBR1, TGFBR2, TGFBR3), plus the Activin A receptor, type 1 (ACVR1) and co receptor Endoglin (ENG) that also transduce TGFβ signaling. TGFB ligands and receptors show dynamic and frequently overlapping expression patterns in numerous embryonic cell layers and structures. Integrating expression information identifies combinations of ligands and receptors that are involved in specific developmental processes including somitogenesis, cardiogenesis and vasculogenesis. Copyright © 2013 Wiley Periodicals, Inc.
Garapaty, Shivani; Mahajan, Muktar A; Samuels, Herbert H
2008-03-14
CCR4-NOT is an evolutionarily conserved, multicomponent complex known to be involved in transcription as well as mRNA degradation. Various subunits (e.g. CNOT1 and CNOT7/CAF1) have been reported to be involved in influencing nuclear hormone receptor activities. Here, we show that CCR4/CNOT6 and RCD1/CNOT9, members of the CCR4-NOT complex, potentiate nuclear receptor activity. RCD1 interacts in vivo and in vitro with NIF-1 (NRC-interacting factor), a previously characterized nuclear receptor cotransducer that activates nuclear receptors via its interaction with NRC. As with NIF-1, RCD1 and CCR4 do not directly associate with nuclear receptors; however, they enhance ligand-dependent transcriptional activation by nuclear hormone receptors. CCR4 mediates its effect through the ligand binding domain of nuclear receptors and small interference RNA-mediated silencing of endogenous CCR4 results in a marked decrease in nuclear receptor activation. Furthermore, knockdown of CCR4 results in an attenuated stimulation of RARalpha target genes (e.g. Sox9 and HoxA1) as shown by quantitative PCR assays. The silencing of endogenous NIF-1 also resulted in a comparable decrease in the RAR-mediated induction of both Sox9 and HoxA1. Furthermore, CCR4 associates in vivo with NIF-1. In addition, the CCR4-enhanced transcriptional activation by nuclear receptors is dependent on NIF-1. The small interference RNA-mediated knockdown of NIF-1 blocks the ligand-dependent potentiating effect of CCR4. Our results suggest that CCR4 plays a role in the regulation of certain endogenous RARalpha target genes and that RCD1 and CCR4 might mediate their function through their interaction with NIF-1.
A live zebrafish-based screening system for human nuclear receptor ligand and cofactor discovery.
Tiefenbach, Jens; Moll, Pamela R; Nelson, Meryl R; Hu, Chun; Baev, Lilia; Kislinger, Thomas; Krause, Henry M
2010-03-22
Nuclear receptors (NRs) belong to a superfamily of transcription factors that regulate numerous homeostatic, metabolic and reproductive processes. Taken together with their modulation by small lipophilic molecules, they also represent an important and successful class of drug targets. Although many NRs have been targeted successfully, the majority have not, and one third are still orphans. Here we report the development of an in vivo GFP-based reporter system suitable for monitoring NR activities in all cells and tissues using live zebrafish (Danio rerio). The human NR fusion proteins used also contain a new affinity tag cassette allowing the purification of receptors with bound molecules from responsive tissues. We show that these constructs 1) respond as expected to endogenous zebrafish hormones and cofactors, 2) facilitate efficient receptor and cofactor purification, 3) respond robustly to NR hormones and drugs and 4) yield readily quantifiable signals. Transgenic lines representing the majority of human NRs have been established and are available for the investigation of tissue- and isoform-specific ligands and cofactors.
A live zebrafish-based screening system for human nuclear receptor ligand and cofactor discovery.
Directory of Open Access Journals (Sweden)
Jens Tiefenbach
2010-03-01
Full Text Available Nuclear receptors (NRs belong to a superfamily of transcription factors that regulate numerous homeostatic, metabolic and reproductive processes. Taken together with their modulation by small lipophilic molecules, they also represent an important and successful class of drug targets. Although many NRs have been targeted successfully, the majority have not, and one third are still orphans. Here we report the development of an in vivo GFP-based reporter system suitable for monitoring NR activities in all cells and tissues using live zebrafish (Danio rerio. The human NR fusion proteins used also contain a new affinity tag cassette allowing the purification of receptors with bound molecules from responsive tissues. We show that these constructs 1 respond as expected to endogenous zebrafish hormones and cofactors, 2 facilitate efficient receptor and cofactor purification, 3 respond robustly to NR hormones and drugs and 4 yield readily quantifiable signals. Transgenic lines representing the majority of human NRs have been established and are available for the investigation of tissue- and isoform-specific ligands and cofactors.
Edwards, Alyn C; Mocilac, Pavle; Geist, Andreas; Harwood, Laurence M; Sharrad, Clint A; Burton, Neil A; Whitehead, Roger C; Denecke, Melissa A
2017-05-02
The first hydrophilic, 1,10-phenanthroline derived ligands consisting of only C, H, O and N atoms for the selective extraction of Am(iii) from spent nuclear fuel are reported herein. One of these 2,9-bis-triazolyl-1,10-phenanthroline (BTrzPhen) ligands combined with a non-selective extracting agent, was found to exhibit process-suitable selectivity for Am(iii) over Eu(iii) and Cm(iii), providing a clear step forward.
Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.
Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L
2013-01-22
We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.
Dull, Angie; Goncharova, Ekaterina; Hager, Gordon; McMahon, James B
2010-11-01
We have developed a robust high-content assay to screen for novel estrogen receptor alpha (ERα) agonists and antagonists by quantitation of cytoplasmic to nuclear translocation of an estrogen receptor chimera in 384-well plates. The screen utilizes a green fluorescent protein tagged-glucocorticoid/estrogen receptor (GFP-GRER) chimera which consisted of the N-terminus of the glucocorticoid receptor fused to the human ER ligand binding domain. The GFP-GRER exhibited cytoplasmic localization in the absence of ERα ligands, and translocated to the nucleus in response to stimulation with ERα agonists or antagonists. The BD Pathway 435 imaging system was used for image acquisition, analysis of translocation dynamics, and cytotoxicity measurements. The assay was validated with known ERα agonists and antagonists, and the Library of Pharmacologically Active Compounds (LOPAC 1280). Additionally, screening of crude natural product extracts demonstrated the robustness of the assay, and the ability to quantitate the effects of toxicity on nuclear translocation dynamics. The GFP-GRER nuclear translocation assay was very robust, with z' values >0.7, CVs screening of natural product extracts. This assay has been developed for future primary screening of synthetic, pure natural products, and natural product extracts libraries available at the National Cancer Institute at Frederick. Copyright © 2010 Elsevier Ltd. All rights reserved.
Rutin has anti-asthmatic effects in an ovalbumin-induced asthmatic ...
African Journals Online (AJOL)
Purpose: To investigate the anti-asthmatic effects of the flavonoid rutin in an ovalbumin (OVA)-induced asthmatic mouse ... protection in asthmatic mice, via downregulation of inflammatory ..... cytokine production by bone marrow-derived dendritic cells stimulated with ... Increased nuclear factor kappaB activity in milk cells of.
Interaction of calreticulin with CD40 ligand, TRAIL and Fas ligand
DEFF Research Database (Denmark)
Duus, K; Pagh, R T; Holmskov, U
2007-01-01
is utilized by many other functionally diverse molecules and in this work the interaction of calreticulin with C1q and structurally similar molecules was investigated. In addition to C1q and MBL, CD40 ligand (CD40L), tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas ligand (FasL) were...... found to bind calreticulin strongly. A low level or no binding was observed for adiponectin, tumour necrosis factor-alpha (TNF-alpha), CD30L, surfactant protein-A and -D and collagen VIII. The interaction with calreticulin required a conformational change in CD40L, TRAIL and FasL and showed the same...
Czech Academy of Sciences Publication Activity Database
Brabec, Viktor; Kašpárková, Jana; Kostrhunová, Hana; Farrell, N.P.
2016-01-01
Roč. 6, AUG2016 (2016), č. článku 28474. ISSN 2045-2322 R&D Projects: GA MŠk(CZ) LH13096 Institutional support: RVO:68081707 Keywords : interstrand cross-links * group domain proteins Subject RIV: BO - Biophysics Impact factor: 4.259, year: 2016
Poornima, Indu G; Mackey, Rachel H; Buhari, Alhaji M; Cauley, Jane A; Matthews, Karen A; Kuller, Lewis H
2014-07-01
This study evaluates the relationship of blood osteoprotegerin (OPG) and receptor activator of nuclear κ-B ligand (RANKL) levels with coronary artery calcium (CAC) and cardiovascular risk factors in two studies of postmenopausal women. OPG, a marker of bone turnover, and its ligand, RANKL, may contribute to cardiovascular disease risk. We tested the hypothesis that serum OPG and RANKL levels were associated with CAC and cardiovascular disease risk factors among postmenopausal women in the Women On the Move through Activity and Nutrition Study (WOMAN Study; n = 86; mean [SD], age 58 [2.9] y) and replicated our findings in the Healthy Women Study (HWS; n = 205; mean [SD] age, 61 [2.3] y). Serum OPG, total RANKL, and CAC were measured at baseline and 48 months in the WOMAN Study and on the eighth postmenopausal visit in the HWS. In the WOMAN Study, higher OPG was associated with higher CAC, and higher total RANKL was associated with lower CAC and triglycerides. In the HWS, higher total RANKL was also associated with lower CAC and triglycerides. In logistic regression models adjusted for body mass index and triglycerides, the odds ratios (95% CIs) for CAC per unit increase in OPG were 1.78 (1.17-2.73) for the WOMAN Study and 1.02 (0.84-1.24) for the HWS, and the odds ratios (95% CIs) for CAC per unit increase in log total RANKL were 0.86 (0.64-1.17) for the WOMAN Study and 0.83 (0.72-0.96) for the HWS. The inverse association of total RANKL with CAC and triglycerides is a new finding and may have important implications given the increasing use of drugs that modify total RANKL and its receptor, receptor activator of nuclear κ-B.
Nadra, Imad; Boccaccini, Aldo R; Philippidis, Pandelis; Whelan, Linda C; McCarthy, Geraldine M; Haskard, Dorian O; Landis, R Clive
2008-01-01
Macrophages may promote a vicious cycle of inflammation and calcification in the vessel wall by ingesting neointimal calcific deposits (predominantly hydroxyapatite) and secreting tumor necrosis factor (TNF)alpha, itself a vascular calcifying agent. Here we have investigated whether particle size affects the proinflammatory potential of hydroxyapatite crystals in vitro and whether the nuclear factor (NF)-kappaB pathway plays a role in the macrophage TNFalpha response. The particle size and nano-topography of nine different crystal preparations was analyzed by X-ray diffraction, Raman spectroscopy, scanning electron microscopy and gas sorbtion analysis. Macrophage TNFalpha secretion was inversely related to hydroxyapatite particle size (P=0.011, Spearman rank correlation test) and surface pore size (P=0.014). A necessary role for the NF-kappaB pathway was demonstrated by time-dependent I kappaB alpha degradation and sensitivity to inhibitors of I kappaB alpha degradation. To test whether smaller particles were intrinsically more bioactive, their mitogenic activity on fibroblast proliferation was examined. This showed close correlation between TNFalpha secretion and crystal-induced fibroblast proliferation (P=0.007). In conclusion, the ability of hydroxyapatite crystals to stimulate macrophage TNFalpha secretion depends on NF-kappaB activation and is inversely related to particle and pore size, with crystals of 1-2 microm diameter and pore size of 10-50 A the most bioactive. Microscopic calcific deposits in early stages of atherosclerosis may therefore pose a greater inflammatory risk to the plaque than macroscopically or radiologically visible deposits in more advanced lesions.
International Nuclear Information System (INIS)
Guyon, Vincent
1992-01-01
In the field of metal extraction from the solutions of nuclear fuel reprocessing, new specific complexing agents that are more efficient than tributyl phosphate must possess a high lipophilic character. The use of lipophilic crown ethers and thia-ligands has eliminated the problem related to their loss in the aqueous media. Moreover, it has made their complexes more soluble in organic solvents. The increase of lipophilic character of monocyclic polyethers has been realized with the addition of an alkyl chain and the development of a new process has made possible the separation of cis-syn-cis and cis-anti-cis isomers of dicyclohexano 18 crown 6 on an industrial scale. The creation of a rapid NMR method of analysis has permitted to study the extracting capacity of those crown ethers in relation to monovalent and divalent cations in nitric acid media and also to demonstrate the influence brought by different substituents. Some new lipophilic thia-ligands (macrocycles and podands) have also been prepared and the study of palladium extraction in nitric acid media by these compounds has led to a better understanding of the relation between the structure and the extracting capacity. Of easy access, some podands have an extracting selectivity and an extracting kinetic for this metal which are highly superior than those of dialkyl sulphides actually employed in the industry. This makes their use possible in the nuclear area. (author) [fr
Synthetic NCAM-derived Ligands of the Fibroblast Growth Factor Receptor
DEFF Research Database (Denmark)
Hansen, Stine; Li, Shizhong; Bock, Elisabeth
2008-01-01
The neural cell adhesion molecule (NCAM) responds to cues in the external environment and transmits signals to the cell through extracellular and intracellular interactions with a number of other signal transduction molecules. One such NCAM interaction partner is the fibroblast growth factor...... various FN3 module loop regions, have been identified as FGFR ligands. All four peptides activate FGFR and differentially modulate a number of neuronal functions, such as differentiation, survival, and synaptic changes that are important for learning, memory, and neuronal regeneration....
QSAR studies of multidentate nitrogen ligands used in lanthanide and actinide extraction processes
International Nuclear Information System (INIS)
Drew, Michael G.B.; Hudson, Michael J.; Youngs, Tristan G.A.
2004-01-01
Quantitative structure activity relationships (QSARs) have been developed to optimise the choice of nitrogen heterocyclic molecules that can be used to separate the minor actinides such as americium(III) from europium(III) in the aqueous PUREX raffinate of nuclear waste. Experimental data on distribution coefficients and separation factors (SFs) for 47 such ligands have been obtained and show SF values ranging from 0.61 to 100. The ligands were divided into a training set of 36 molecules to develop the QSAR and a test set of 11 molecules to validate the QSAR. Over 1500 molecular descriptors were calculated for each heterocycle and the Genetic Algorithm was used to select the most appropriate for use in multiple regression equations. Equations were developed fitting the separation factors to 6-8 molecular descriptors which gave r 2 values of >0.8 for the training set and values of >0.7 for the test set, thus showing good predictive quality. The descriptors used in the equations were primarily electronic and steric. These equations can be used to predict the separation factors of nitrogen heterocycles not yet synthesised and/or tested and hence obtain the most efficient ligands for lanthanide and actinide separation
Energy Technology Data Exchange (ETDEWEB)
Hay, B.P. [Pacific Northwest National Lab., Richland, WA (United States)
1997-10-01
The purpose of this work is to develop and implement a molecular design basis for selecting organic ligands that would be used in the cost-effective removal of specific radionuclides from nuclear waste streams. Organic ligands with metal ion specificity are critical components in the development of solvent extraction and ion exchange processes that are highly selective for targeted radionuclides. The traditional approach to the development of such ligands involves lengthy programs of organic synthesis and testing, which in the absence of reliable methods for screening compounds before synthesis, results in wasted research effort. The author`s approach breaks down and simplifies this costly process with the aid of computer-based molecular modeling techniques. Commercial software for organic molecular modeling is being configured to examine the interactions between organic ligands and metal ions, yielding an inexpensive, commercially or readily available computational tool that can be used to predict the structures and energies of ligand-metal complexes. Users will be able to correlate the large body of existing experimental data on structure, solution binding affinity, and metal ion selectivity to develop structural design criteria. These criteria will provide a basis for selecting ligands that can be implemented in separations technologies through collaboration with other DOE national laboratories and private industry. The initial focus will be to select ether-based ligands that can be applied to the recovery and concentration of the alkali and alkaline earth metal ions including cesium, strontium, and radium.
International Nuclear Information System (INIS)
Vincent, Jeremy; Shan, Li; Fan, Ming; Brunzelle, Joseph S.; Forman, Barry M.; Fernandez, Elias J.
2004-01-01
The purification and structure determination of the murine constitutive androstane receptor bound to its inverse agonist/antagonist androstenol is described. The constitutive androstane receptor (CAR) is a member of the nuclear receptor superfamily. In contrast to classical nuclear receptors, which possess small-molecule ligand-inducible activity, CAR exhibits constitutive transcriptional activity in the apparent absence of ligand. CAR is among the most important transcription factors; it coordinately regulates the expression of microsomal cytochrome P450 genes and other drug-metabolizing enzymes. The murine CAR ligand-binding domain (LBD) was coexpressed with the steroid receptor coactivator protein (SRC-1) receptor-interacting domain (RID) in Escherichia coli. The mCAR LBD subunit was purified away from SRC-1 by affinity, anion-exchange and size-exclusion chromatography, crystallized with androstenol and the structure of the complex determined by molecular replacement
Dietary modification of metabolic pathways via nuclear hormone receptors.
Caiozzi, Gianella; Wong, Brian S; Ricketts, Marie-Louise
2012-10-01
Nuclear hormone receptors (NHRs), as ligand-dependent transcription factors, have emerged as important mediators in the control of whole body metabolism. Because of the promiscuous nature of several members of this superfamily that have been found to bind ligand with lower affinity than the classical steroid NHRs, they consequently display a broader ligand selectivity. This promiscuous nature has facilitated various bioactive dietary components being able to act as agonist ligands for certain members of the NHR superfamily. By binding to these NHRs, bioactive dietary components are able to mediate changes in various metabolic pathways, including, glucose, cholesterol and triglyceride homeostasis among others. This review will provide a general overview of the nuclear hormone receptors that have been shown to be activated by dietary components. The physiological consequences of such receptor activation by these dietary components will then be discussed in more detail. Copyright © 2012 John Wiley & Sons, Ltd.
PPARα ligands activate antioxidant enzymes and suppress hepatic fibrosis in rats
International Nuclear Information System (INIS)
Toyama, Tetsuya; Nakamura, Hideki; Harano, Yuichi; Yamauchi, Norihito; Morita, Atsuhiro; Kirishima, Toshihiko; Minami, Masahito; Itoh, Yoshito; Okanoue, Takeshi
2004-01-01
Oxidative stress is a major pathogenetic factor in hepatic fibrosis. Peroxisome proliferator-activated receptor α (PPARα) is a nuclear receptor which is known to affect oxidative stress and PPARα ligands may have rescue effects on hepatic fibrosis. We tested this hypothesis using rat thioacetamide (TAA) models of liver cirrhosis. Rats were given intraperitoneal injection of TAA and treated with a diet containing one of the two PPARα ligands, Wy-14,643 (WY) or fenofibrate. WY treatment dramatically reduced hepatic fibrosis and also prevented the inhibition catalase of mRNA expression caused by TAA. Correspondingly, catalase activity increased in the TAA + WY group but decreased in the control TAA group. The antifibrotic action of fenofibrate in the TAA model was comparable with that of WY. PPARα ligands have an antifibrotic action in the rat TAA model of liver cirrhosis, probably due to an antioxidant effect of enhanced catalase expression and activity in the liver
The chemistry of separations ligand degradation by organic radical cations
International Nuclear Information System (INIS)
Mezyk, S.P.; Horne, G.P.; Mincher, B.J.; Zalupski, P.R.; Cook, A.R.; Wishart, J.F.
2016-01-01
Solvent based extractions of used nuclear fuel use designer ligands in an organic phase extracting ligand complexed metal ions from an acidic aqueous phase. These extractions will be performed in highly radioactive environments, and the radiation chemistry of all these complexing agents and their diluents will play a major role in determining extraction efficiency, separation factors, and solvent-recycle longevity. Although there has been considerable effort in investigating ligand damage occurring in acidic water radiolysis conditions, only minimal fundamental kinetic and mechanistic data has been reported for the degradation of extraction ligands in the organic phase. Extraction solvent phases typically use normal alkanes such as dodecane, TPH, and kerosene as diluents. The radiolysis of such diluents produce a mixture of radical cations (R"."+), carbon-centered radicals (R".), solvated electrons, and molecular products such as hydrogen. Typically, the radical species will preferentially react with the dissolved oxygen present to produce relatively inert peroxyl radicals. This isolates the alkane radical cation species, R"."+ as the major radiolytically-induced organic species that can react with, and degrade, extraction agents in this phase. Here we report on our recent studies of organic radical cation reactions with 2 ligands: CMPO and TODGA. Elucidating these parameters, and combining them with the known acidic aqueous phase chemistry, will allow a full, fundamental, understanding of the impact of radiation on solvent extraction based separation processes to be achieved. (authors)
International Nuclear Information System (INIS)
Karagiannis, T.C.; Lobachevsky, P.N.; Martin, R.F.
2000-01-01
Full text: Iodine-125 decays by orbital electron capture and internal conversion resulting in the emission of numerous Auger electrons which produce a highly localised radiochemical damage in the immediate vicinity of the site of decay. Given the requirement to deliver 125 I to the nuclear DNA, a minor groove binding bibenzimidazole, 125 I-iodoHoechst 33258 was investigated. It has been noted that this analogue may be prone to de-iodination in vitro and in vivo, given the presence of an orthoiodophenol moiety which is analogous to that in thyroxins. Therefore, an 125 I -iodoHoechst analogue without the hydroxyl group was also studied. The 125 I -iodoHoechst 33258 analogue was prepared by direct iodination of Hoechst 33258 and 125 I iodoHoechst was prepared by demetallation of a trimethylstannyl precursor. DNA binding studies indicated that both iodo-analogues bind to calf thymus DNA, K D = 89 ± 30nM, n = 0.018 bp - 1 for iodoHoechst 33258 and K D = 121 ± 31nM, n = 0.024 bp -1 for iodoHoechst. Similarly, nuclear localization following incubation with 5μM of either ligand at 37 deg C was observed in K562 cells by fluorescence microscopy. Flow cytometry was used to investigate the kinetics of drug uptake and efflux in K562 cells. The results indicated that when 10 6 cells were incubated with 5μM ligand at 37 deg C, the uptake reached a plateau at approximately 43 minutes for iodoHoechst 33258 and approximately 52 minutes for iodoHoechst. Ligand efflux results indicated two-phase kinetics. The initial phase which involves 50-60% of drug was characterised by a half-life time (t 1/2 ) of 55.4 minutes for efflux of iodoHoechst 33258 and a t 1/2 of 10.3 minutes for efflux of iodoHoechst, at 37 deg C. Furthermore, the results suggested that the DNA binding sites in a 10 6 cell/ml suspension were saturated by incubation with 3μM iodoHoechst 33258 and 5μM iodoHoechst. In the initial cytotoxicity experiments using 125 I-iodoHoechst 33258, K562 cells were incubated for 1
DEFF Research Database (Denmark)
Knudsen, Kirsten Quyen Nguyen; Olesen, Ping; Ledet, Thomas
2007-01-01
The bone-related protein osteoprotegerin (OPG) may be involved in the development of vascular calcifications, especially in diabetes, where it has been found in increased amounts in the arterial wall. Experimental studies suggest that members of the TGF-superfamily are involved in the transformat......The bone-related protein osteoprotegerin (OPG) may be involved in the development of vascular calcifications, especially in diabetes, where it has been found in increased amounts in the arterial wall. Experimental studies suggest that members of the TGF-superfamily are involved...... in the transformation of human vascular smooth muscle cells (HVSMC) to osteoblast-like cells. In this study, we evaluated the effect of BMP-2, BMP-7 and transforming growth factor beta (TGF-beta1) on the secretion and mRNA expression of OPG and its ligands receptor activator of nuclear factor-kappabeta ligand (RANKL......) and TNF-related apoptosis-inducing ligand (TRAIL) in HVSMC. All three growth factors decreased OPG protein production significantly; these results were paralleled by reduced OPG mRNA expression. TRAIL mRNA levels were also decreased. RANKL mRNA expression declined when treated with TGF-beta1 but were...
International Nuclear Information System (INIS)
Han, Ji Seung; Crowe, David L
2010-01-01
The peroxisome proliferator activated receptor (PPAR) subgroup of the nuclear hormone receptor superfamily is activated by a variety of natural and synthetic ligands. PPARs can heterodimerize with retinoid X receptors, which have homology to other members of the nuclear receptor superfamily. Ligand binding to PPAR/RXRs results in recruitment of transcriptional coactivator proteins such as steroid receptor coactivator 1 (SRC-1) and CREB binding protein (CBP). Both SRC-1 and CBP are histone acetyltransferases, which by modifying nucleosomal histones, produce more open chromatin structure and increase transcriptional activity. Nuclear hormone receptors can recruit limiting amounts of coactivators from other transcription factor binding sites such as AP-1, thereby inhibiting the activity of AP-1 target genes. PPAR and RXR ligands have been used in experimental breast cancer therapy. The role of coactivator expression in mammary tumorigenesis and response to drug therapy has been the subject of recent studies. We examined the effects of loss of SRC-1 on MMTV-neu mediated mammary tumorigenesis. SRC-1 null mutation in mammary tumor prone mice increased the tumor latency period, reduced tumor proliferation index and metastasis, inhibited response to PPAR and RXR ligands, and induced genes involved in mammary gland differentiation. We also examined human breast cancer cell lines overexpressing SRC-1 or CBP. Coactivator overexpression increased cellular proliferation with resistance to PPAR and RXR ligands and remodeled chromatin of the proximal epidermal growth factor receptor promoter. These results indicate that histone acetyltransferases play key roles in mammary tumorigenesis and response to anti-proliferative therapies
Synthesis of novel '4+1' Tc(III)/Re(III) mixed-ligand complexes with dendritically modified ligands
International Nuclear Information System (INIS)
Gniazdowska, E.; Kuenstler, J.U.; Stephan, H.; Pietzsch, H.J.
2006-01-01
Coordination chemistry of technetium and rhenium attracts a considerable interest due to the nuclear medicine applications of their radionuclides. Inert, so-called '3+1' or '4+1' technetium/rhenium mixed-ligand complexes open a new way to application of 99 mTc/ 188 Re labeled compounds in tumor diagnosis and therapy. In the presented paper, authors describe the synthesis and study of novel 99 mTc/ 188 Re complexes with dendritically functionalized tetradentate (tripodal chelator 2,2',2''-nitrilotris(ethanethiol), NS 3 and carboxyl group-bearing ligand, NS 3 (COOH) 3 ) and monodentate (dendritically modified isocyanide, CN-R(COOMe) 3 and isocyanide-modified peptide, CN-GGY) ligands. To verify the identity of the prepared n.c.a. complexes, non-radioactive analogous '4+1' Re compounds were synthesized. The experimental data show that a dendritic modification of the tetradentate/monodentate ligands changes the complex lipophilicity and does not influence its stability
Zhi, Yunlai; Lu, Hongting; Duan, Yuhe; Sun, Weisheng; Guan, Ge; Dong, Qian; Yang, Chuanmin
2015-02-01
Metastasis is a hallmark of malignant neuroblastoma and is the main reason for therapeutic failure and recurrence of the tumor. The CXC chemokine receptor-4 (CXCR4), a Gi protein-coupled receptor for the ligand CXCL12/stromal cell-derived factor-1α (SDF-1α), is expressed in various types of tumor. This receptor mediates the homing of tumor cells to specific organs that express the ligand, CXCL12, for this receptor and plays an important role in tumor growth, invasion, metastasis and angiogenesis. In the present study, the inflammatory cytokine, tumor necrosis factor‑α (TNF‑α) upregulated CXCR4 expression in neuroblastoma cells and increased migration to the CXCR4 ligand SDF‑1α. In addition, this effect was dependent upon NF-κB transcriptional activity, as blocking the NF-κB pathway with pyrrolidinedithiocarbamic acid ammonium salt suppressed TNF-α‑induced upregulation of CXCR4 expression and reduced the migration towards the CXCR4 ligand, SDF-1α. Treating neuroblastoma cells with TNF-α resulted in the activation of nuclear factor-kappa B (NF-κB) and subsequently, the translocation of NF-κB from the cytoplasm to the nucleus. Using immunohistochemistry, NF‑κB and CXCR4 were significantly correlated with each other (P=0.0052, Fisher's exact test) in a cohort of neuroblastoma samples (n=80). The present study indicates that the inflammatory cytokine, TNF-α, partially functions through the NF‑κB signaling pathway to upregulate CXCR4 expression to foster neuroblastoma cell metastasis. These findings indicate that effective inhibition of neuroblastoma metastasis should be directed against the inflammatory cytokine-induced NF‑κB/CXCR4/SDF‑1α signaling pathway.
Energy Technology Data Exchange (ETDEWEB)
Oh, Se Jeong [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Gu, Dong Ryun [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Jin, Su Hyun [Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Park, Keun Ha [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Lee, Seoung Hoon, E-mail: leesh2@wku.ac.kr [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Wonkwang Institute of Biomaterials and Implant, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of)
2016-06-17
Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.
International Nuclear Information System (INIS)
Oh, Se Jeong; Gu, Dong Ryun; Jin, Su Hyun; Park, Keun Ha; Lee, Seoung Hoon
2016-01-01
Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.
Preparation, Spectroscopic Investigation and Biological Activity of New Mixed Ligand Chelates
International Nuclear Information System (INIS)
Alassbaly, F.S.; Ajaily, M.M.E.
2014-01-01
Preparation and investigation of new Co(II), Ni(II), Zn(II) and Cr(III) chelates with mixed ligands including Schiff base (L1) formed from the condensation of 4-dimethylaminobenzaldehyde with 2-aminophenol and anthranilic acid (L2) were studied. The obtained Schiff base and mixed ligand chelates were subjected to several physiochemical techniques, in terms of CHN elemental analyses, molar conductivity, magnetic moment measurements, infrared, proton nuclear magnetic resonance, electronic and mass spectra. The analytical data showed the formation of the Schiff base compound and the ratio of metal to ligands of the chelates are 1:1:1(M:L1:L2). The infrared spectral data exhibited that the used ligands behaving as bidentate ligands towards the metal ions. The proton nuclear magnetic resonance spectral data showed the signals of the active groups in the ligands which entered in chelation with Zn(II) metal ion. The electronic spectral results showed the existence of pie (phenyl ring) and n = pie (C=N) of the ligands and suggested the geometrical structures of the chelates. Meanwhile, the mass spectral data revealed the fragmentations of the Schiff base, anthranilic acid and their Ni(II) mixed ligand chelate has been preformed the only chelate conducted for justification. All the prepared mixed chelates were non-electrolyte in nature. The antibacterial activity of the Schiff base, anthranilic acid, metal salts and mixed ligand chelates were studied and found to be that mixed ligand chelates have the most biological activity in comparison to the free ligands and salts. (author)
RelA NF-κB subunit activation as a therapeutic target in diffuse large B-cell lymphoma
DEFF Research Database (Denmark)
Zhang, Mingzhi; Xu-Monette, Zijun Y; Li, Ling
2016-01-01
It has been well established that nuclear factor kappa-B (NF-κB) activation is important for tumor cell growth and survival. RelA/p65 and p50 are the most common NF-kB subunits and involved in the classical NF-kB pathway. However, the prognostic and biological significance of RelA/p65 is equivoca...
Hu, Juhua; Li, Qian; Wang, Yanqing; Li, Song
2015-06-01
This study aimed to detect the immunoexpression of interleukin-21 (IL-21) and receptor activator. of nuclear factor KB ligand (RANKL) in periapical granulomas (PGs) and radicular cysts (RCs). The interaction of IL-21 with RANKL and its role in periapical pathogenesis were also speculated. A total of 32 PGs and 23 RCs were selected as experimental samples. Lesion size and occurrence of tenderness were recorded. Up to 10 healthy gingival tissues were collected as normal control samples. All tissues were subjected to immunohistocheincal analysis with anti-human IL-21 and RANKL polyclonal antibodies. The correlations of IL-21 with RANKL, lesion size, and the occurrence of tenderness of the PGs and RCs were evaluated. IL-21-positive cells were detected in all periapical lesion tissues but not in normal tissues. In the cyst group and granuloma group, the corresponding expression levels of IL-21 were 59.92±6.57 and 36.80± 6.81, whereas those of RANKL were 68.81±18.59 and 36.12±14.87, respectively. Moreover, t-test revealed a significantly higher expression of IL-21 and RANKL in RCs than in PGs (P<0.05). IL-21 and RANKL were positively correlated in both PGs and RCs (P<0.05). Furthermore, IL-21 was correlated with lesion size (P<0.05). This study demonstrated that IL-21 is potentially involved in the pathogenesis of apical periodontitis lesions. A role in the exacerbation of chronic inflammation, as well as in bone resorption, is suspected. Further studies are required to elucidate the specific functions of IL-21 in periradicular inflammatory processes.
Pepene, Carmen Emanuela; Ilie, Ioana Rada; Marian, Ioan; Duncea, Ileana
2011-01-01
There is plenty of evidence that osteoprotegerin (OPG) is linked to subclinical vascular damage and predicts cardiovascular disease in high-risk populations. Our aim is to investigate the relationships of OPG/free soluble receptor activator of nuclear factor κB ligand (sRANKL) to insulin resistance, brachial artery flow-mediated vasodilation (FMD), and the carotid artery intima-media thickness (CIMT) in polycystic ovary syndrome (PCOS), a disorder characterized by hyperandrogenism, impaired glucose control, and endothelial injury. A cross-sectional, observational study. Hormonal and metabolic profiles, FMD, CIMT, serum OPG, and ampli-sRANKL were assessed in 64 young PCOS patients and 20 controls of similar age. Body composition was measured by dual energy X-ray absorptiometry. OPG was significantly lower in PCOS and related negatively to free testosterone and positively to estradiol (E(2)) levels. In multivariate analysis, OPG but not ampli-sRANKL correlated positively to fasting insulin, insulin sensitivity indices, and FMD. Neither OPG nor ampli-sRANKL was associated with CIMT. Significantly lower adjusted FMD values were demonstrated in women in the upper OPG quartile group (>2.65 pmol/l) compared with all other quartile groups together (P=0.012). In PCOS, multiple regression analysis retained E(2)/sex hormone-binding globulin ratio, fat mass, and homeostasis model assessment of insulin resistance as independent predictors of OPG. In PCOS, circulating OPG is related to both endothelial dysfunction and insulin resistance, independent of obesity and androgen excess, suggesting OPG as a useful biomarker of these effects. Further studies are needed to evaluate OPG in relation to cardiovascular events and cardiovascular mortality in PCOS.
The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor
Energy Technology Data Exchange (ETDEWEB)
Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong; Chan, Cee-Wah; Tanabe, Osamu; Kruse, Schoen W.; Reynolds, Ross; Engel, James Douglas; Xu, H. Eric (Michigan-Med); (Van Andel)
2015-11-30
Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibits constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.
NR4A nuclear receptors are orphans but not lonesome.
Kurakula, Kondababu; Koenis, Duco S; van Tiel, Claudia M; de Vries, Carlie J M
2014-11-01
The NR4A subfamily of nuclear receptors consists of three mammalian members: Nur77, Nurr1, and NOR-1. The NR4A receptors are involved in essential physiological processes such as adaptive and innate immune cell differentiation, metabolism and brain function. They act as transcription factors that directly modulate gene expression, but can also form trans-repressive complexes with other transcription factors. In contrast to steroid hormone nuclear receptors such as the estrogen receptor or the glucocorticoid receptor, no ligands have been described for the NR4A receptors. This lack of known ligands might be explained by the structure of the ligand-binding domain of NR4A receptors, which shows an active conformation and a ligand-binding pocket that is filled with bulky amino acid side-chains. Other mechanisms, such as transcriptional control, post-translational modifications and protein-protein interactions therefore seem to be more important in regulating the activity of the NR4A receptors. For Nur77, over 80 interacting proteins (the interactome) have been identified so far, and roughly half of these interactions has been studied in more detail. Although the NR4As show some overlap in interacting proteins, less information is available on the interactome of Nurr1 and NOR-1. Therefore, the present review will describe the current knowledge on the interactomes of all three NR4A nuclear receptors with emphasis on Nur77. Copyright © 2014 Elsevier B.V. All rights reserved.
The chemistry of separations ligand degradation by organic radical cations
Energy Technology Data Exchange (ETDEWEB)
Mezyk, S.P.; Horne, G.P. [California State University at Long Beach, Long Beach, CA 90840 (United States); Mincher, B.J.; Zalupski, P.R. [Idaho National Laboratory, Idaho Falls, ID 83415 (United States); Cook, A.R.; Wishart, J.F. [Chemistry Department, Brookhaven National Laboratory, New York, 11973 (United States)
2016-07-01
Solvent based extractions of used nuclear fuel use designer ligands in an organic phase extracting ligand complexed metal ions from an acidic aqueous phase. These extractions will be performed in highly radioactive environments, and the radiation chemistry of all these complexing agents and their diluents will play a major role in determining extraction efficiency, separation factors, and solvent-recycle longevity. Although there has been considerable effort in investigating ligand damage occurring in acidic water radiolysis conditions, only minimal fundamental kinetic and mechanistic data has been reported for the degradation of extraction ligands in the organic phase. Extraction solvent phases typically use normal alkanes such as dodecane, TPH, and kerosene as diluents. The radiolysis of such diluents produce a mixture of radical cations (R{sup .+}), carbon-centered radicals (R{sup .}), solvated electrons, and molecular products such as hydrogen. Typically, the radical species will preferentially react with the dissolved oxygen present to produce relatively inert peroxyl radicals. This isolates the alkane radical cation species, R{sup .+} as the major radiolytically-induced organic species that can react with, and degrade, extraction agents in this phase. Here we report on our recent studies of organic radical cation reactions with 2 ligands: CMPO and TODGA. Elucidating these parameters, and combining them with the known acidic aqueous phase chemistry, will allow a full, fundamental, understanding of the impact of radiation on solvent extraction based separation processes to be achieved. (authors)
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Swain, A.D.
1981-01-01
This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants. (orig.) [de
Factors affecting nuclear development
International Nuclear Information System (INIS)
Stevens, G.H.; Girouard, P.
1995-01-01
Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos
Power peaking nuclear reliability factors
International Nuclear Information System (INIS)
Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.
1977-11-01
The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly
An NMR strategy for fragment-based ligand screening utilizing a paramagnetic lanthanide probe
International Nuclear Information System (INIS)
Saio, Tomohide; Ogura, Kenji; Shimizu, Kazumi; Yokochi, Masashi; Burke, Terrence R.; Inagaki, Fuyuhiko
2011-01-01
A nuclear magnetic resonance-based ligand screening strategy utilizing a paramagnetic lanthanide probe is presented. By fixing a paramagnetic lanthanide ion to a target protein, a pseudo-contact shift (PCS) and a paramagnetic relaxation enhancement (PRE) can be observed for both the target protein and its bound ligand. Based on PRE and PCS information, the bound ligand is then screened from the compound library and the structure of the ligand–protein complex is determined. PRE is an isotropic paramagnetic effect observed within 30 Å from the lanthanide ion, and is utilized for the ligand screening in the present study. PCS is an anisotropic paramagnetic effect providing long-range (∼40 Å) distance and angular information on the observed nuclei relative to the paramagnetic lanthanide ion, and utilized for the structure determination of the ligand–protein complex. Since a two-point anchored lanthanide-binding peptide tag is utilized for fixing the lanthanide ion to the target protein, this screening method can be generally applied to non-metal-binding proteins. The usefulness of this strategy was demonstrated in the case of the growth factor receptor-bound protein 2 (Grb2) Src homology 2 (SH2) domain and its low- and high-affinity ligands.
Determination of ligand binding modes in weak protein–ligand complexes using sparse NMR data
Energy Technology Data Exchange (ETDEWEB)
Mohanty, Biswaranjan; Williams, Martin L.; Doak, Bradley C.; Vazirani, Mansha; Ilyichova, Olga [Monash University, Medicinal Chemistry, Monash Institute of Pharmaceutical Sciences (Australia); Wang, Geqing [La Trobe University, La Trobe Institute for Molecular Bioscience (Australia); Bermel, Wolfgang [Bruker Biospin GmbH (Germany); Simpson, Jamie S.; Chalmers, David K. [Monash University, Medicinal Chemistry, Monash Institute of Pharmaceutical Sciences (Australia); King, Glenn F. [The University of Queensland, Institute for Molecular Bioscience (Australia); Mobli, Mehdi, E-mail: m.mobli@uq.edu.au [The University of Queensland, Centre for Advanced Imaging (Australia); Scanlon, Martin J., E-mail: martin.scanlon@monash.edu [Monash University, Medicinal Chemistry, Monash Institute of Pharmaceutical Sciences (Australia)
2016-11-15
We describe a general approach to determine the binding pose of small molecules in weakly bound protein–ligand complexes by deriving distance constraints between the ligand and methyl groups from all methyl-containing residues of the protein. We demonstrate that using a single sample, which can be prepared without the use of expensive precursors, it is possible to generate high-resolution data rapidly and obtain the resonance assignments of Ile, Leu, Val, Ala and Thr methyl groups using triple resonance scalar correlation data. The same sample may be used to obtain Met {sup ε}CH{sub 3} assignments using NOESY-based methods, although the superior sensitivity of NOESY using [U-{sup 13}C,{sup 15}N]-labeled protein makes the use of this second sample more efficient. We describe a structural model for a weakly binding ligand bound to its target protein, DsbA, derived from intermolecular methyl-to-ligand nuclear Overhauser enhancements, and demonstrate that the ability to assign all methyl resonances in the spectrum is essential to derive an accurate model of the structure. Once the methyl assignments have been obtained, this approach provides a rapid means to generate structural models for weakly bound protein–ligand complexes. Such weak complexes are often found at the beginning of programs of fragment based drug design and can be challenging to characterize using X-ray crystallography.
Study of the stability of organic ligands usable for the spent nuclear fuel reprocessing
International Nuclear Information System (INIS)
Draye, Micheline
1994-01-01
The first part of this research thesis on the stability of organic ligands in radioactive environment, reports the study of the stability of the dicyclohexano-18-crown-6 (DCH18C6) in radioactive environment by using several analytical techniques (nuclear magnetic resonance or NMR, X-ray diffraction, Fourier transform infrared spectroscopy or FTIR, gas chromatography or GC, and coupled gas chromatography/mass spectroscopy). The seven main radiolysis products of DCH18C6 are identified and then synthesised to be tested in radioactive environment. These products are soluble in nitric medium, and partially precipitate plutonium, but cannot in any case disturb the reprocessing process based on a continuous extraction system. Chemical yields are computed and DCH18C6 appears to be a serious candidate for the reprocessing of spent nuclear fuels. The second part reports the study of the stability of the poly(4-vinylpyridine) or P4VP in radioactive environment. It appears that gamma radiations produce radicals in the P4VP which recombine in function of the irradiation dose. However, this material is very stable in acid environment and radioactive environment [fr
Surface sensitivity of nuclear-knock-out form factors
International Nuclear Information System (INIS)
Fratamico, G.
1984-01-01
A numerical calculation has been performed to investigate the sensitivity of nuclear-knock-out form factors to nuclear-surface behaviour of bound-state wave functions. The result of our investigation suggests that one can extract the bound-state behaviour at the surface from experimental information on nuclear-knock-out form factors
Regulation of vacuolar H{sup +}-ATPase in microglia by RANKL
Energy Technology Data Exchange (ETDEWEB)
Serrano, Eric M.; Ricofort, Ryan D.; Zuo, Jian [Department of Orthodontics, University of Florida College of Dentistry, Gainesville, FL 32610 (United States); Ochotny, Noelle [Department of Pharmacology, University of Toronto, Toronto, Ont., Canada M5G 1G6 (Canada); Manolson, Morris F. [Faculty of Dentistry, University of Toronto, Toronto, Ont., Canada M5G 1G6 (Canada); Holliday, L. Shannon, E-mail: sholliday@dental.ufl.edu [Department of Orthodontics, University of Florida College of Dentistry, Gainesville, FL 32610 (United States); Department of Anatomy and Cell Biology, University of Florida College of Medicine, Gainesville, FL 32610 (United States)
2009-11-06
Vacuolar H{sup +}-ATPases (V-ATPases) are large electrogenic proton pumps composed of numerous subunits that play vital housekeeping roles in the acidification of compartments of the endocytic pathway. Additionally, V-ATPases play specialized roles in certain cell types, a capacity that is linked to cell type selective expression of isoforms of some of the subunits. We detected low levels of the a3 isoform of the a-subunit in mouse brain extracts. Examination of various brain-derived cell types by immunoblotting showed a3 was expressed in the N9 microglia cell line and in primary microglia, but not in other cell types. The expression of a3 in osteoclasts requires stimulation by Receptor Activator of Nuclear Factor {kappa}B-ligand (RANKL). We found that Receptor Activator of Nuclear Factor {kappa}B (RANK) was expressed by microglia. Stimulation of microglia with RANKL triggered increased expression of a3. V-ATPases in microglia were shown to bind microfilaments, and stimulation with RANKL increased the proportion of V-ATPase associated with the detergent-insoluble cytoskeletal fraction and with actin. In summary, microglia express the a3-subunit of V-ATPase. The expression of a3 and the interaction between V-ATPases and microfilaments was modulated by RANKL. These data suggest a novel molecular pathway for regulating microglia.
Human factors in nuclear power plant operations
International Nuclear Information System (INIS)
Swain, A.D.
1980-08-01
This report describes some of the human factors problems in nuclear power plants and the technology that can be employed to reduce those problems. Many of the changes to improve the human factors in existing plants are inexpensive, and the expected gain in human reliability is substantial. The human factors technology is well-established and there are practitioners in most countries that have nuclear power plants
New pinene-derived pyridines as bidentate chiral ligands
Czech Academy of Sciences Publication Activity Database
Malkov, A. V.; Stewart-Liddon, A.; Teplý, Filip; Kobr, L.; Muir, K. W.; Haigh, D.; Kočovský, P.
2008-01-01
Roč. 64, č. 18 (2008), s. 4011-4025 ISSN 0040-4020 Institutional research plan: CEZ:AV0Z40550506 Keywords : chiral ligands * transition metal catalysis * asymmetric catalysis * pyridine ligands * oxazoline ligands Subject RIV: CC - Organic Chemistry Impact factor: 2.897, year: 2008
Ligand Binding Domain Protein in Tetracycline-Inducible Expression ...
African Journals Online (AJOL)
binding domain proteins in E. coli using a tetracycline inducible system. To allow for ... development of molecular ligands with improved therapeutic windows. Keywords: Nuclear receptor ..... functional recombinant cannabinoid receptor CB2 in ...
Brasilino, Matheus da Silva; Stringhetta-Garcia, Camila Tami; Pereira, Camila Scacco; Pereira, Ariana Aparecida Ferreira; Stringhetta, Karina; Leopoldino, Andréia Machado; Crivelini, Marcelo Macedo; Ervolino, Edilson; Dornelles, Rita Cássia Menegati; de Melo Stevanato Nakamune, Ana Cláudia; Chaves-Neto, Antonio Hernandes
2018-04-01
The objective of this study was to investigate the effects of mate tea (MT) [Ilex paraguariensis] on alveolar socket healing after tooth extraction. Sixteen male rats were divided into MT and control groups. MT was administered by intragastric gavage at a dose of 20 mg/kg/day for 28 days before and 28 days after right maxillary incisor extraction. The control group received an equal volume of water. Histopathological and histometric analysis of the neoformed bone area and osteocyte density were performed, as well as immunohistochemical analysis of osteocalcin (OCN), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegerin (OPG), tartrate-resistant acid phosphatase (TRAP), and manganese superoxide dismutase (MnSOD) in the alveolar socket. Calcium, phosphorus, alkaline phosphatase (ALP) activity, total antioxidant capacity (TAC), and malondialdehyde (MDA) were measured in plasma, whereas TRAP activity was determined in serum. Histometry evidenced an increase in bone area (P alveolar socket healing on day 28 after tooth extraction. Regular MT ingestion improves the antioxidant defenses and bone formation, which is beneficial for alveolar socket bone healing after tooth extraction.
Future of bisphosphonates and denosumab for men with advanced prostate cancer
International Nuclear Information System (INIS)
Iranikhah, Maryam; Stricker, Steve; Freeman, Maisha Kelly
2014-01-01
Prostate cancer is the most common cancer occurring in American men of all races. It is also the second leading cause of cancer death among men in the USA. Bone metastasis is a frequent occurrence in men with advanced prostate cancer, with skeletal-related events being a common complication and having negative consequences, leading to severe pain, increased health care costs, increased risk of death, and decreased quality of life for patients. Bone loss can also result from antiandrogen therapy, which can further contribute to skeletal-related events. Treatment with antiresorptive agents bisphosphonates, and the newly approved denosumab, a receptor activator of nuclear factor kappa-B ligand (RANK-L) inhibitor, has been shown to reduce the risk of skeletal-related complications and prevent treatment-induced bone loss in patients with advanced prostate cancer. This review discusses the role of antiresorptive agents bisphosphonates and RANK-L inhibitor in the current treatment of advanced prostate cancer by examining the primary literature and also focuses on the likely role of the bisphosphonates in the treatment of advanced prostate cancer in the future
Targeted delivery of curcumin for treating type 2 diabetes.
Maradana, Muralidhara Rao; Thomas, Ranjeny; O'Sullivan, Brendan J
2013-09-01
Type 2 diabetes is a chronic condition in which cells have reduced insulin signalling, leading to hyperglycemia and long-term complications, including heart, kidney and liver disease. Macrophages activated by dying or stressed cells, induce the transcription factor nuclear factor kappa-B leading to the production of pro-inflammatory cytokines including TNF and IL-6. These inflammatory macrophages in liver and adipose tissue promote insulin resistance, and medications which reduce inflammation and enhance insulin signalling improve glucose control. Curcumin is an anti-oxidant and nuclear factor kappa-B inhibitor derived from turmeric. A number of studies have shown that dietary curcumin reduces inflammation and delays or prevents obesity-induced insulin resistance and associated complications, including atherosclerosis and immune mediate liver disease. Unfortunately dietary curcumin is poorly absorbed by the digestive system and undergoes glucuronidation and excretion rather than being released into the serum and systemically distributed. This confounds understanding of how dietary curcumin exerts its beneficial effects in type 2 diabetes and associated diseases. New improved methods of delivering curcumin are being developed including nanoparticles and lipid/liposome formulations that increase absorption and bioavailability of curcumin. Development and refinement of these technologies will enable cell-directed targeting of curcumin and improved therapeutic outcome. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rational Ligand Design for U(VI) and Pu(IV)
International Nuclear Information System (INIS)
Szigethy, Geza
2009-01-01
Nuclear power is an attractive alternative to hydrocarbon-based energy production at a time when moving away from carbon-producing processes is widely accepted as a significant developmental need. Hence, the radioactive actinide power sources for this industry are necessarily becoming more widespread, which is accompanied by the increased risk of exposure to both biological and environmental systems. This, in turn, requires the development of technology designed to remove such radioactive threats efficiently and selectively from contaminated material, whether that be contained nuclear waste streams or the human body. Raymond and coworkers (University of California, Berkeley) have for decades investigated the interaction of biologically-inspired, hard Lewis-base ligands with high-valent, early-actinide cations. It has been established that such ligands bind strongly to the hard Lewis-acidic early actinides, and many poly-bidentate ligands have been developed and shown to be effective chelators of actinide contaminants in vivo. Work reported herein explores the effect of ligand geometry on the linear U(IV) dioxo dication (uranyl, UO 2 2+ ). The goal is to utilize rational ligand design to develop ligands that exhibit shape selectivity towards linear dioxo cations and provides thermodynamically favorable binding interactions. The uranyl complexes with a series of tetradentate 3-hydroxy-pyridin-2-one (3,2-HOPO) ligands were studied in both the crystalline state as well as in solution. Despite significant geometric differences, the uranyl affinities of these ligands vary only slightly but are better than DTPA, the only FDA-approved chelation therapy for actinide contamination. The terepthalamide (TAM) moiety was combined into tris-beidentate ligands with 1,2- and 3,2-HOPO moieties were combined into hexadentate ligands whose structural preferences and solution thermodynamics were measured with the uranyl cation. In addition to achieving coordinative saturation, these
Rational Ligand Design for U(VI) and Pu(IV)
Energy Technology Data Exchange (ETDEWEB)
Szigethy, Geza [Univ. of California, Berkeley, CA (United States)
2009-08-12
Nuclear power is an attractive alternative to hydrocarbon-based energy production at a time when moving away from carbon-producing processes is widely accepted as a significant developmental need. Hence, the radioactive actinide power sources for this industry are necessarily becoming more widespread, which is accompanied by the increased risk of exposure to both biological and environmental systems. This, in turn, requires the development of technology designed to remove such radioactive threats efficiently and selectively from contaminated material, whether that be contained nuclear waste streams or the human body. Raymond and coworkers (University of California, Berkeley) have for decades investigated the interaction of biologically-inspired, hard Lewis-base ligands with high-valent, early-actinide cations. It has been established that such ligands bind strongly to the hard Lewis-acidic early actinides, and many poly-bidentate ligands have been developed and shown to be effective chelators of actinide contaminants in vivo. Work reported herein explores the effect of ligand geometry on the linear U(IV) dioxo dication (uranyl, UO2 2+). The goal is to utilize rational ligand design to develop ligands that exhibit shape selectivity towards linear dioxo cations and provides thermodynamically favorable binding interactions. The uranyl complexes with a series of tetradentate 3-hydroxy-pyridin-2-one (3,2-HOPO) ligands were studied in both the crystalline state as well as in solution. Despite significant geometric differences, the uranyl affinities of these ligands vary only slightly but are better than DTPA, the only FDA-approved chelation therapy for actinide contamination. The terepthalamide (TAM) moiety was combined into tris-beidentate ligands with 1,2- and 3,2-HOPO moieties were combined into hexadentate ligands whose structural preferences and solution thermodynamics were measured with the uranyl cation. In addition to achieving coordinative
Griffith, Thomas S; Fialkov, Jonathan M; Scott, David L; Azuhata, Takeo; Williams, Richard D; Wall, Nathan R; Altieri, Dario C; Sandler, Anthony D
2002-06-01
The lack of effective therapy for disseminated renal cell carcinoma (RCC) has stimulated the search for novel treatments including immunotherapeutic strategies. However, poor therapeutic responses and marked toxicity associated with immunological agents has limited their use. The tumor necrosis factor family member tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/Apo-2 ligand induces apoptosis in a variety of tumor cell types, while having little cytotoxic activity against normal cells. In this study the activation and regulation of TRAIL-induced apoptosis and TRAIL receptor expression in human RCC cell lines and pathologic specimens was examined. TRAIL induced caspase-mediated apoptotic death of RCC cells with variable sensitivities among the cell lines tested. Compared with TRAIL-sensitive RCC cell lines (A-498, ACHN, and 769-P), the TRAIL-resistant RCC cell line (786-O) expressed lesser amounts of the death-inducing TRAIL receptors, and greater amounts of survivin, an inhibitor of apoptosis. Incubation of 786-O with actinomycin D increased the expression of the death-inducing TRAIL receptors and, concomitantly, decreased the intracellular levels of survivin, resulting in TRAIL-induced apoptotic death. The link between survivin and TRAIL regulation was confirmed when an increase in TRAIL resistance was observed after overexpression of survivin in the TRAIL-sensitive, survivin-negative RCC line A-498. These findings, along with our observation that TRAIL receptors are expressed in RCC tumor tissue, suggest that TRAIL may be useful as a therapeutic agent for RCC and that survivin may partially regulate TRAIL-induced cell death.
Directory of Open Access Journals (Sweden)
M-T. Jiang
2018-02-01
Full Text Available A series of titanium complexes bearing substituted diphenolate ligands (RCH(phenolate2, where R = H, CH3, o-OTs-phenyl, o-F-phenyl, o-OMe-phenyl, 2,4-OMe-phenyl was synthesized and studied as catalysts for the ring opening polymerization of L-lactide and ε-caprolactone. Ligands were designed to probe the role of chelate effect and steric effect in the catalytic performance. From the structure of triphenolate (with one extra coordination site than diphenolate ligand Ti complex, TriOTiOiPr2, we found no additional chelation to influence the catalytic activity of Ti complexes. It was found that bulky aryl groups in the diphenolate ligands decreased the rate of polymerization most. We conclude that steric effect is the most controlling factor in these polymerization reactions by using Ti complexes bearing diphenolate ligands as catalysts since it is responsible for the exclusion of needed space for incoming monomer by the bulky substituents on the catalyst.
Molecular pathways: the role of NR4A orphan nuclear receptors in cancer.
LENUS (Irish Health Repository)
Mohan, Helen M
2012-06-15
Nuclear receptors are of integral importance in carcinogenesis. Manipulation of classic ligand-activated nuclear receptors, such as estrogen receptor blockade in breast cancer, is an important established cancer therapy. Orphan nuclear receptors, such as nuclear family 4 subgroup A (NR4A) receptors, have no known natural ligand(s). These elusive receptors are increasingly recognized as molecular switches in cell survival and a molecular link between inflammation and cancer. NR4A receptors act as transcription factors, altering expression of downstream genes in apoptosis (Fas-ligand, TRAIL), proliferation, DNA repair, metabolism, cell migration, inflammation (interleukin-8), and angiogenesis (VEGF). NR4A receptors are modulated by multiple cell-signaling pathways, including protein kinase A\\/CREB, NF-κB, phosphoinositide 3-kinase\\/AKT, c-jun-NH(2)-kinase, Wnt, and mitogen-activated protein kinase pathways. NR4A receptor effects are context and tissue specific, influenced by their levels of expression, posttranslational modification, and interaction with other transcription factors (RXR, PPAR-Υ). The subcellular location of NR4A "nuclear receptors" is also important functionally; novel roles have been described in the cytoplasm where NR4A proteins act both indirectly and directly on the mitochondria to promote apoptosis via Bcl-2. NR4A receptors are implicated in a wide variety of malignancies, including breast, lung, colon, bladder, and prostate cancer; glioblastoma multiforme; sarcoma; and acute and\\/or chronic myeloid leukemia. NR4A receptors modulate response to conventional chemotherapy and represent an exciting frontier for chemotherapeutic intervention, as novel agents targeting NR4A receptors have now been developed. This review provides a concise clinical overview of current knowledge of NR4A signaling in cancer and the potential for therapeutic manipulation.
Identification and characterization of PPARα ligands in the hippocampus.
Roy, Avik; Kundu, Madhuchhanda; Jana, Malabendu; Mishra, Rama K; Yung, Yeni; Luan, Chi-Hao; Gonzalez, Frank J; Pahan, Kalipada
2016-12-01
Peroxisome proliferator-activated receptor-α (PPARα) regulates hepatic fatty acid catabolism and mediates the metabolic response to starvation. Recently we found that PPARα is constitutively activated in nuclei of hippocampal neurons and controls plasticity via direct transcriptional activation of CREB. Here we report the discovery of three endogenous PPARα ligands-3-hydroxy-(2,2)-dimethyl butyrate, hexadecanamide, and 9-octadecenamide-in mouse brain hippocampus. Mass spectrometric detection of these compounds in mouse hippocampal nuclear extracts, in silico interaction studies, time-resolved FRET analyses, and thermal shift assay results clearly indicated that these three compounds served as ligands of PPARα. Site-directed mutagenesis studies further revealed that PPARα Y464 and Y314 are involved in binding these hippocampal ligands. Moreover, these ligands activated PPARα and upregulated the synaptic function of hippocampal neurons. These results highlight the discovery of hippocampal ligands of PPARα capable of modulating synaptic functions.
Kim, Byung Hak; Hong, Seong Su; Kwon, Soon Woo; Lee, Hwa Young; Sung, Hyeran; Lee, In-Jeong; Hwang, Bang Yeon; Song, Sukgil; Lee, Chong-Kil; Chung, Daehyun; Ahn, Byeongwoo; Nam, Sang-Yoon; Han, Sang-Bae; Kim, Youngsoo
2008-11-01
Diarctigenin was previously isolated as an inhibitor of nitric oxide (NO) production in macrophages from the seeds of Arctium lappa used as an alternative medicine for the treatment of inflammatory disorders. However, little is known about the molecular basis of these effects. Here, we demonstrated that diarctigenin inhibited the production of NO, prostaglandin E(2), tumor necrosis factor-alpha, and interleukin (IL)-1beta and IL-6 with IC(50) values of 6 to 12 miciroM in zymosan- or lipopolysaccharide-(LPS) activated macrophages. Diarctigenin attenuated zymosan-induced mRNA synthesis of inducible NO synthase (iNOS) and also inhibited promoter activities of iNOS and cytokine genes in the cells. Because nuclear factor (NF)-kappaB plays a pivotal role in inflammatory gene transcription, we next investigated the effect of diarctigenin on NF-kappaB activation. Diarctigenin inhibited the transcriptional activity and DNA binding ability of NF-kappaB in zymosan-activated macrophages but did not affect the degradation and phosphorylation of inhibitory kappaB (IkappaB) proteins. Moreover, diarctigenin suppressed expression vector NF-kappaB p65-elicited NF-kappaB activation and also iNOS promoter activity, indicating that the compound could directly target an NF-kappa-activating signal cascade downstream of IkappaB degradation and inhibit NF-kappaB-regulated iNOS expression. Diarctigenin also inhibited the in vitro DNA binding ability of NF-kappaB but did not affect the nuclear import of NF-kappaB p65 in the cells. Taken together, diarctigenin down-regulated zymosan- or LPS-induced inflammatory gene transcription in macrophages, which was due to direct inhibition of the DNA binding ability of NF-kappaB. Finally, this study provides a pharmacological potential of diarctigenin in the NF-kappaB-associated inflammatory disorders.
PPARγ ligand ciglitazone inhibits TNFα-induced ICAM-1 in human airway smooth muscle cells
Directory of Open Access Journals (Sweden)
Chien-Da Huang
2014-08-01
Full Text Available Background: Modification of human airway smooth muscle (ASM function by proinflammatory cytokines has been regarded as a potential mechanism underlying bronchial hyperresponsiveness in asthma. Human ASM cells express intercellular adhesion molecule (ICAM-1 in response to cytokines. Synthetic ligands for peroxisome proliferator-activated receptor (PPARγ reportedly possess anti-inflammatory and immunomodulatory properties. In this study, we examined whether ciglitazone, a synthetic PPARγ ligand, can modulate the basal and tumor necrosis factor (TNFα-induced ICAM1 gene expression in human ASM cells. Methods: Human ASM cells were treated with TNFα. ICAM-1 expression was assessed by flow cytometry and reverse transcriptase-polymerase chain reaction (RT-PCR analysis. PPARγ activity was inhibited by target-specific small interfering (si RNA targeting PPARγ and GW9662, a PPARγ antagonist. Activity of nuclear factor (NF-κB was assessed by using immunoblot analysis, immune-confocal images, and electrophoretic mobility shift assay (EMSA. Results: By flow cytometry, ciglitazone alone had no effect on ICAM-1 expression in ASM cells, but inhibited ICAM-1 expression in response to TNFα (10 ng/ml in a dose-dependent manner (1-10 μM. It also inhibited TNFα-induced ICAM1 gene expression by RT-PCR analysis. Knockdown of PPARγ gene by target-specific siRNA targeting PPARγ enhanced ICAM-1 expression and the inhibitory effect of ciglitazone on TNFα-induced ICAM-1 expression was reversed by PPARγ siRNA and GW9662. SN-50 (10 μg/ml, an inhibitor for nuclear translocation of NF-κB, inhibited TNFα-induced ICAM-1 expression. Ciglitazone did not prevent TNFα-induced degradation of the cytosolic inhibitor of NF-κB (IκB, but inhibited the nuclear translocation of p65 induced by TNFα and suppressed the NF-κB/DNA binding activity. Conclusion: These findings suggest that ciglitazone inhibits TNFα-induced ICAM1 gene expression in human ASM cells through
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Pack, R.W.
1978-01-01
The Electric Power Research Institute has started research in human factors in nuclear power plants. One project, completed in March 1977, reviewed human factors problems in operating power plants and produced a report evaluating those problems. A second project developed computer programs for evaluating operator performance on training simulators. A third project is developing and evaluating control-room design approaches. A fourth project is reviewing human factors problems associated with power-plant maintainability and instrumentation and control technician activities. Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. The Electric Power Research Institute (EPRI) has undertaken four projects studying the application of human factors engineering principles to nuclear power plants. (author)
Designer TGFβ superfamily ligands with diversified functionality.
Directory of Open Access Journals (Sweden)
George P Allendorph
Full Text Available Transforming Growth Factor--beta (TGFβ superfamily ligands, including Activins, Growth and Differentiation Factors (GDFs, and Bone Morphogenetic Proteins (BMPs, are excellent targets for protein-based therapeutics because of their pervasiveness in numerous developmental and cellular processes. We developed a strategy termed RASCH (Random Assembly of Segmental Chimera and Heteromer, to engineer chemically-refoldable TGFβ superfamily ligands with unique signaling properties. One of these engineered ligands, AB208, created from Activin-βA and BMP-2 sequences, exhibits the refolding characteristics of BMP-2 while possessing Activin-like signaling attributes. Further, we find several additional ligands, AB204, AB211, and AB215, which initiate the intracellular Smad1-mediated signaling pathways more strongly than BMP-2 but show no sensitivity to the natural BMP antagonist Noggin unlike natural BMP-2. In another design, incorporation of a short N-terminal segment from BMP-2 was sufficient to enable chemical refolding of BMP-9, without which was never produced nor refolded. Our studies show that the RASCH strategy enables us to expand the functional repertoire of TGFβ superfamily ligands through development of novel chimeric TGFβ ligands with diverse biological and clinical values.
International Nuclear Information System (INIS)
Camaioni, D.M.; Colton, N.G.; Bruening, R.L.
1992-01-01
This report describes the testing of some novel separations materials known as SuperLig trademark materials for their ability to separate efficiently and selectively certain metal ions from a synthetic, nonradioactive nuclear waste solution. The materials, developed and patented by IBC Advanced Technologies, are highly selective macrocyclic ligands that have been covalently bonded to silica gel. The SuperLig trademark materials that were tested are: (1) SuperLig trademark 601 for barium (Ba 2+ ) and strontium (Sr 2+ ) separation, (2) SuperLig trademark 602 for cesium (Cs + ) and rubidium (Rb + ) separation, (3) SuperLig trademark 27 for palladium (Pd 2+ ) separation, and (4) SuperLig trademark II for silver (Ag + ) and ruthenium (Ru 3+ ) separation. Our observations show that the technology for separating metal ions using silica-bonded macrocycles is essentially sound and workable to varying degrees of success that mainly depend on the affinity of the macrocycle for the metal ion of interest. It is expected that ligands will be discovered or synthesized that are amenable to separating metal ions of interest using this technology. Certainly more development, testing, and evaluation is warranted. 3 figs., 11 tabs
Importance of human factors on nuclear installations safety
International Nuclear Information System (INIS)
Caruso, G.J.
1990-01-01
Actually, installations safety and, in particular the nuclear installations infer a strong incidence in human factors related to the design and operation of such installations. In general, the experience aims to that the most important accidents have happened as result of the components' failures combination and human failures in the operation of safety systems. Human factors in the nuclear installations may be divided into two areas: economy and human reliability. Human factors treatments for the safety evaluation of the nuclear installations allow to diagnose the weak points of man-machine interaction. (Author) [es
Vogeler, Susanne; Galloway, Tamara S; Lyons, Brett P; Bean, Tim P
2014-05-15
Nuclear receptors are a superfamily of transcription factors important in key biological, developmental and reproductive processes. Several of these receptors are ligand- activated and through their ability to bind endogenous and exogenous ligands, are potentially vulnerable to xenobiotics. Molluscs are key ecological species in defining aquatic and terrestrial habitats and are sensitive to xenobiotic compounds in the environment. However, the understanding of nuclear receptor presence, function and xenobiotic disruption in the phylum Mollusca is limited. Here, forty-three nuclear receptor sequences were mined from the genome of the Pacific oyster, Crassostrea gigas. They include members of NR0-NR5 subfamilies, notably lacking any NR6 members. Phylogenetic analyses of the oyster nuclear receptors have been conducted showing the presence of a large novel subfamily group not previously reported, which is named NR1P. Homologues to all previous identified nuclear receptors in other mollusc species have also been determined including the putative heterodimer partner retinoid X receptor, estrogen receptor and estrogen related receptor. C. gigas contains a highly diverse set of nuclear receptors including a novel NR1 group, which provides important information on presence and evolution of this transcription factor superfamily in invertebrates. The Pacific oyster possesses two members of NR3, the sex steroid hormone receptor analogues, of which there are 9 in humans. This provides increasing evidence that steroid ligand specific expansion of this family is deuterostome specific. This new knowledge on divergence and emergence of nuclear receptors in C. gigas provides essential information for studying regulation of molluscan gene expression and the potential effects of xenobiotics.
Human factor problem in nuclear power generation
International Nuclear Information System (INIS)
Yoshino, Kenji; Fujimoto, Junzo
1999-01-01
Since a nuclear power plant accident at Threemile Island in U.S.A. occurred in March, 1979, twenty years have passed. After the accident, the human factor problem became focussed in nuclear power, to succeed its research at present. For direct reason of human error, most of factors at individual level or work operation level are often listed at their center. Then, it is natural that studies on design of a machine or apparatus suitable for various human functions and abilities and on improvement of relationship between 'human being and machine' and 'human being and working environment' are important in future. Here was, as first, described on outlines of the human factor problem in a nuclear power plant developed at a chance of past important accident, and then was described on educational training for its countermeasure. At last, some concrete researching results obtained by human factor research were introduced. (G.K.)
International Nuclear Information System (INIS)
Kassebaum, J.W.
1988-01-01
The author has measured the hydrogen/deuterium fractionation factor for the rapidly exchanging aqueous ligands of cobalt in Co(H 2 O) 6 2+ and in three Co(II)-substituted isozymes of carbonic anhydrase. The fractionation factor was determined from NMR relaxation rates at 300 MHz of the protons of water in mixed solutions of H 2 O and D 2 O containing these complexes. In each case, the paramagnetic contribution to 1/T 2 was greater than to 1/T 1 , consistent with a chemical shift mechanism affecting 1/T 2 . The fractionation factors obtained from T 2 were 0.73 ± 0.02 for Co(H 2 O) 6 2+ , 0.72 ± 0.02 for Co(II)-substituted carbonic anhydrase I, 0.77 ± 0.01 for Co(II)-substituted carbonic anhydrase II, and 1.00 ± 0.07 for Co(Il)-substituted carbonic anhydrase III. He concluded that fractionation factors in these cases determined from T 1 and T 2 measured isotope preferences for different populations of ligand sites. Since T 2 has a large contribution from a chemical shift mechanism, the fractionation factor determined from T 2 has a large contribution of the fractionation of inner shell ligands. The fractionation factor of Co(H 2 O) 6 2+ was used to interpret the solvent hydrogen isotope effects on the formation of complexes of cobalt with the bidentate ligands glycine, N,N-dimethylglycine, and acetylacetone. The contribution of the fractionation factor of the inner water shell in Co(H 2 O) 6 2+ did not account completely for the measured isotope effect, and that the hydrogen/deuterium fractionation of outer shell water makes a large contribution to the isotope effect on the formation of these complexes
Multiple functions and essential roles of nuclear receptor coactivators of bHLH-PAS family.
Pecenova, L; Farkas, Robert
2016-07-01
Classical non-peptide hormones, such as steroids, retinoids, thyroid hormones, vitamin D3 and their derivatives including prostaglandins, benzoates, oxysterols, and bile acids, are collectively designated as small lipophilic ligands, acting via binding to the nuclear receptors (NRs). The NRs form a large superfamily of transcription factors that participate virtually in every key biological process. They control various aspects of animal development, fertility, gametogenesis, and numerous metabolic pathways, and can be misregulated in many types of cancers. Their enormous functional plasticity, as transcription factors, relates in part to NR-mediated interactions with plethora of coregulatory proteins upon ligand binding to their ligand binding domains (LBD), or following covalent modification. Here, we review some general views of a specific group of NR coregulators, so-called nuclear receptor coactivators (NRCs) or steroid receptor coactivators (SRCs) and highlight some of their unique functions/roles, which are less extensively mentioned and discussed in other reviews. We also try to pinpoint few neglected moments in the cooperative action of SRCs, which may also indicate their variable roles in the hormone-independent signaling pathways.
Gawlas, K.; Stunnenberg, H.G.
2001-01-01
An important model system for studying the process leading to productive transcription is provided by the superfamily of nuclear receptors, which are for the most part ligand-controlled transcription factors. Over the past years several 'orphan' nuclear receptors have been isolated for which no
Synergistic Effects of PPARγ Ligands and Retinoids in Cancer Treatment
Directory of Open Access Journals (Sweden)
Masahito Shimizu
2008-01-01
Full Text Available Peroxisome proliferator-activated receptors (PPARs are members of the nuclear receptor superfamily. The activation of PPARs by their specific ligands is regarded as one of the promising strategies to inhibit cancer cell growth. However, recent clinical trials targeting several common cancers showed no beneficial effect when PPAR ligands are used as a monotherapy. Retinoid X receptors (RXRs, which play a critical role in normal cell proliferation as a master regulator for nuclear receptors, preferentially form heterodimers with PPARs. A malfunction of RXRα due to phosphorylation by the Ras/MAPK signaling pathway is associated with the development of certain types of human malignancies. The activation of PPARγ/RXR heterodimer by their respective ligands synergistically inhibits cell growth, while inducing apoptosis in human colon cancer cells when the phosphorylation of RXRα was inhibited. We herein review the synergistic antitumor effects produced by the combination of the PPAR, especially PPARγ, ligands plus other agents, especially retinoids, in a variety of human cancers. We also focus on the phosphorylation of RXRα because the inhibition of RXRα phosphorylation and the restoration of its physiological function may activate PPAR/RXR heterodimer and, therefore, be a potentially effective and critical strategy for the inhibition of cancer cell growth.
The Notch ligand Delta-like 1 integrates inputs from TGFbeta/Activin and Wnt pathways
Energy Technology Data Exchange (ETDEWEB)
Bordonaro, Michael, E-mail: mbordonaro@tcmedc.org; Tewari, Shruti, E-mail: stewari@tcmedc.org; Atamna, Wafa, E-mail: watamna@tcmedc.org; Lazarova, Darina L., E-mail: dlazarova@tcmedc.org
2011-06-10
Unlike the well-characterized nuclear function of the Notch intracellular domain, it has been difficult to identify a nuclear role for the ligands of Notch. Here we provide evidence for the nuclear function of the Notch ligand Delta-like 1 in colon cancer (CC) cells exposed to butyrate. We demonstrate that the intracellular domain of Delta-like 1 (Dll1icd) augments the activity of Wnt signaling-dependent reporters and that of the promoter of the connective tissue growth factor (CTGF) gene. Data suggest that Dll1icd upregulates CTGF promoter activity through both direct and indirect mechanisms. The direct mechanism is supported by co-immunoprecipitation of endogenous Smad2/3 proteins and Dll1 and by chromatin immunoprecipitation analyses that revealed the occupancy of Dll1icd on CTGF promoter sequences containing a Smad binding element. The indirect upregulation of CTGF expression by Dll1 is likely due to the ability of Dll1icd to increase Wnt signaling, a pathway that targets CTGF. CTGF expression is induced in butyrate-treated CC cells and results from clonal growth assays support a role for CTGF in the cell growth-suppressive role of butyrate. In conclusion, integration of the Notch, Wnt, and TGFbeta/Activin signaling pathways is in part mediated by the interactions of Dll1 with Smad2/3 and Tcf4.
Energy Technology Data Exchange (ETDEWEB)
Jing, Wang; Chunhua, Ma, E-mail: machunhuabest@126.com; Shumin, Wang, E-mail: wangshuminch@126.com
2015-06-01
The purpose of the present study was to investigate the protective role of acteoside (AC) on lipopolysaccharide (LPS)-induced acute lung injury (ALI). BalB/c mice intraperitoneally received AC (30, and 60 mg/kg) or dexamethasone (2 mg/kg) 2 h prior to or after intratracheal instillation of LPS. Treatment with AC significantly decreased lung wet-to-dry weight (W/D) ratio and lung myeloperoxidase (MPO) activity and ameliorated LPS-induced lung histopathological changes. In addition, AC increased super oxide dismutase (SOD) level and inhibited malondialdehyde (MDA) content, total cell and neutrophil infiltrations, and levels of proinflammatory cytokines including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) in bronchoalveolar lavage fluid (BALF) in LPS-stimulated mice. Furthermore, we demonstrated that AC inhibited the phosphorylation of IκBα, nuclear factor-κB (NF-κB) p65, inhibitor of nuclear factor kappa-B kinase-α (IKK-α) and inhibitor of nuclear factor kappa-B kinase-β (IKKβ) in LPS-induced inflammation in A549 cells. Our data suggested that LPS evoked the inflammatory response in lung epithelial cells A549. The experimental results indicated that the protective mechanism of AC might be attributed partly to the inhibition of proinflammatory cytokine production and NF-κB activation. - Highlights: • Acteoside inhibited inflammation in LPS-induced lung injury in mice. • Acteoside inhibited inflammation in lung epithelial cells A549. • Acteoside inhibited NF-kB activation in LPS-induced mice and lung epithelial cells A549.
Katz, D; Niederberger, C; Slaughter, G R; Cooney, A J
1997-10-01
Nuclear receptors, such as those for androgens, estrogens, and progesterones, control many reproductive processes. Proteins with structures similar to these receptors, but for which ligands have not yet been identified, have been termed orphan nuclear receptors. One of these orphans, germ cell nuclear factor (GCNF), has been shown to be germ cell specific in the adult and, therefore, may also participate in the regulation of reproductive functions. In this paper, we examine more closely the expression patterns of GCNF in germ cells to begin to define spatio-temporal domains of its activity. In situ hybridization showed that GCNF messenger RNA (mRNA) is lacking in the testis of hypogonadal mutant mice, which lack developed spermatids, but is present in the wild-type testis. Thus, GCNF is, indeed, germ cell specific in the adult male. Quantitation of the specific in situ hybridization signal in wild-type testis reveals that GCNF mRNA is most abundant in stage VII round spermatids. Similarly, Northern analysis and specific in situ hybridization show that GCNF expression first occurs in testis of 20-day-old mice, when round spermatids first emerge. Therefore, in the male, GCNF expression occurs postmeiotically and may participate in the morphological changes of the maturing spermatids. In contrast, female expression of GCNF is shown in growing oocytes that have not completed the first meiotic division. Thus, GCNF in the female is expressed before the completion of meiosis. Finally, the nature of the two different mRNAs that hybridize to the GCNF complementary DNA was studied. Although both messages contain the DNA binding domain, only the larger message is recognized by a probe from the extreme 3' untranslated region. In situ hybridization with these differential probes demonstrates that both messages are present in growing oocytes. In addition, the coding region and portions of the 3' untranslated region of the GCNF complementary DNA are conserved in the rat.
Energy Technology Data Exchange (ETDEWEB)
Arnold, John [Univ. of California, Berkeley, CA (United States)
2015-01-21
The uranyl cation (UO₂²⁺) is the most abundant form of uranium on the planet. It is estimated that 4.5 billion tons of uranium in this form exist in sea water. The ability to bind and extract the uranyl cation from aqueous solution while separating it from other elements would provide a limitless source of nuclear fuel. A large body of research concerns the selective recognition and extraction of uranyl. A stable molecule, the cation has a linear O=U=O geometry. The short U-O bonds (1.78 Å) arise from the combination of uranium 5f/6d and oxygen 2p orbitals. Due to the oxygen moieties being multiply bonded, these sites were not thought to be basic enough for Lewis acidic coordination to be a viable approach to sequestration. The goal of this research is thus to broaden the coordination chemistry of the uranyl ion by studying new ligand systems via synthetic, structural, thermodynamic and computational methods. It is anticipated that this fundamental science will find use beyond actinide separation technologies in areas such as nuclear waste remediation and nuclear materials. The focus of this study is to synthesize uranyl complexes incorporating amidinate and guanidinate ligands. Both synthetic and computational methods are used to investigate novel equatorial ligand coordination and how this affects the basicity of the oxo ligands. Such an understanding will later apply to designing ligands incorporating functionalities that can bind uranyl both equatorially and axially for highly selective sequestration. Efficient and durable chromatography supports for lanthanide separation will be generated by (1) identifying robust peptoid-based ligands capable of binding different lanthanides with variable affinities, and (2) developing practical synthetic methods for the attachment of these ligands to Dowex ion exchange resins.
International Nuclear Information System (INIS)
Arnold, John
2015-01-01
The uranyl cation (UO 2 2+ ) is the most abundant form of uranium on the planet. It is estimated that 4.5 billion tons of uranium in this form exist in sea water. The ability to bind and extract the uranyl cation from aqueous solution while separating it from other elements would provide a limitless source of nuclear fuel. A large body of research concerns the selective recognition and extraction of uranyl. A stable molecule, the cation has a linear O=U=O geometry. The short U-O bonds (1.78 Å) arise from the combination of uranium 5f/6d and oxygen 2p orbitals. Due to the oxygen moieties being multiply bonded, these sites were not thought to be basic enough for Lewis acidic coordination to be a viable approach to sequestration. The goal of this research is thus to broaden the coordination chemistry of the uranyl ion by studying new ligand systems via synthetic, structural, thermodynamic and computational methods. It is anticipated that this fundamental science will find use beyond actinide separation technologies in areas such as nuclear waste remediation and nuclear materials. The focus of this study is to synthesize uranyl complexes incorporating amidinate and guanidinate ligands. Both synthetic and computational methods are used to investigate novel equatorial ligand coordination and how this affects the basicity of the oxo ligands. Such an understanding will later apply to designing ligands incorporating functionalities that can bind uranyl both equatorially and axially for highly selective sequestration. Efficient and durable chromatography supports for lanthanide separation will be generated by (1) identifying robust peptoid-based ligands capable of binding different lanthanides with variable affinities, and (2) developing practical synthetic methods for the attachment of these ligands to Dowex ion exchange resins.
Human factors in nuclear safety oversight
International Nuclear Information System (INIS)
Taylor, K.
1989-01-01
The mission of the nuclear safety oversight function at the Savannah River Plant is to enhance the process and nuclear safety of site facilities. One of the major goals surrounding this mission is the reduction of human error. It is for this reason that several human factors engineers are assigned to the Operations assessment Group of the Facility Safety Evaluation Section (FSES). The initial task of the human factors contingent was the design and implementation of a site wide root cause analysis program. The intent of this system is to determine the most prevalent sources of human error in facility operations and to assist in determining where the limited human factors resources should be focused. In this paper the strategy used to educate the organization about the field of human factors is described. Creating an awareness of the importance of human factors engineering in all facets of design, operation, and maintenance is considered to be an important step in reducing the rate of human error
Effects of coumestrol on lipid and glucose metabolism as a farnesoid X receptor ligand
International Nuclear Information System (INIS)
Takahashi, Miki; Kanayama, Tomohiko; Yashiro, Takuya; Kondo, Hidehiko; Murase, Takatoshi; Hase, Tadashi; Tokimitsu, Ichiro; Nishikawa, Jun-ichi; Sato, Ryuichiro
2008-01-01
In the course of an effort to identify novel agonists of the farnesoid X receptor (FXR), coumestrol was determined to be one such ligand. Reporter and in vitro coactivator interaction assays revealed that coumestrol bound and activated FXR. Treatment of Hep G2 cells with coumestrol stimulated the expression of FXR target genes, thereby regulating the expression of target genes of the liver X receptor and hepatocyte nuclear factor-4α. Through these actions, coumestrol is expected to exert beneficial effects on lipid and glucose metabolism
Charge-Transfer Effects in Ligand Exchange Reactions of Au25 Monolayer-Protected Clusters.
Carducci, Tessa M; Blackwell, Raymond E; Murray, Royce W
2015-04-16
Reported here are second-order rate constants of associative ligand exchanges of Au25L18 nanoparticles (L = phenylethanethiolate) of various charge states, measured by proton nuclear magnetic resonance at room temperature and below. Differences in second-order rate constants (M(-1) s(-1)) of ligand exchange (positive clusters ∼1.9 × 10(-5) versus negative ones ∼1.2 × 10(-4)) show that electron depletion retards ligand exchange. The ordering of rate constants between the ligands benzeneselenol > 4-bromobenzene thiol > benzenethiol reveals that exchange is accelerated by higher acidity and/or electron donation capability of the incoming ligand. Together, these observations indicate that partial charge transfer occurs between the nanoparticle and ligand during the exchange and that this is a rate-determining effect in the process.
Son, Young Jun; Han, Jihye; Lee, Jae Yeon; Kim, HaHyung; Chun, Taehoon
2015-06-01
Soluble human receptor activator of nuclear factor kappa B fusion immunoglobulin (hRANK-Ig) has been considered as one of the therapeutic agents to treat osteoporosis or diseases associated with bone destruction by blocking the interaction between RANK and the receptor activator of nuclear factor kappa B ligand (RANKL). However, no scientific record showing critical amino acid residues within the structural interface between the human RANKL and RANK complex is yet available. In this study, we produced several mutants of hRANK-Ig by replacement of amino acid residue(s) and tested whether the mutants had increased binding affinity to human RANKL. Based on the results from flow cytometry and surface plasmon resonance analyses, the replacement of E(125) with D(125), or E(125) and C(127) with D(125) and F(127) within loop 3 of cysteine-rich domain 3 of hRANK-Ig increases binding affinity to human RANKL over the wild-type hRANK-Ig. This result may provide the first example of improvement in the efficacy of hRANK-Ig by protein engineering and may give additional information to understand a more defined structural interface between hRANK and RANKL.
Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.
Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu
2018-01-20
The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.
Human Factor on Gravelines Nuclear Power Plants
International Nuclear Information System (INIS)
Duboc, Gerard
1998-01-01
In a first part, the documents describes the commitments by EDF nuclear power plan operations to demands made by the Safety Authority regarding actions in the field of human factors (concerns expressed by the Authority, in-depth analysis, positions on different points raised by the Authority). In a second part, it presents the various actions undertaken in the Gravelines nuclear power station regarding human factors: creation of an 'operator club' (mission and objectives, methods and means, first meetings, tracking file), development of risk analysis strategy, setting up of a human factor engineering mission and example of action in case of a significant event
Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost
2003-01-01
Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis
Characterization of Colloidal Quantum Dot Ligand Exchange by X-ray Photoelectron Spectroscopy
Atewologun, Ayomide; Ge, Wangyao; Stiff-Roberts, Adrienne D.
2013-05-01
Colloidal quantum dots (CQDs) are chemically synthesized semiconductor nanoparticles with size-dependent wavelength tunability. Chemical synthesis of CQDs involves the attachment of long organic surface ligands to prevent aggregation; however, these ligands also impede charge transport. Therefore, it is beneficial to exchange longer surface ligands for shorter ones for optoelectronic devices. Typical characterization techniques used to analyze surface ligand exchange include Fourier-transform infrared spectroscopy, x-ray diffraction, transmission electron microscopy, and nuclear magnetic resonance spectroscopy, yet these techniques do not provide a simultaneously direct, quantitative, and sensitive method for evaluating surface ligands on CQDs. In contrast, x-ray photoelectron spectroscopy (XPS) can provide nanoscale sensitivity for quantitative analysis of CQD surface ligand exchange. A unique aspect of this work is that a fingerprint is identified for shorter surface ligands by resolving the regional XPS spectrum corresponding to different types of carbon bonds. In addition, a deposition technique known as resonant infrared matrix-assisted pulsed laser evaporation is used to improve the CQD film uniformity such that stronger XPS signals are obtained, enabling more accurate analysis of the ligand exchange process.
International Nuclear Information System (INIS)
Li Tianshu
2013-01-01
Based on years of knowledge in nuclear safety supervision and experience of investigating and dealing with violation events in repair welding of DFHM, this paper analyzes major faults in manufacturing and maintaining activities of nuclear safety equipment in relation to human and organizational factors. It could be deducted that human and organizational factors has definitely become key features in the development of nuclear energy and technology. Some feasible measures to reinforce supervision on nuclear safety equipment activities have also been proposed. (author)
Energy Technology Data Exchange (ETDEWEB)
Bhattarai, Govinda; Lee, Young-Hee [Department of Oral Biochemistry, Institute of Oral Bioscience, School of Dentistry, Chonbuk National University, Jeonju (Korea, Republic of); Lee, Min-Ho [Department of Dental Materials, Institute of Oral Bioscience, School of Dentistry, Chonbuk National University, Jeonju (Korea, Republic of); Park, Il-Song [Division of Advanced Materials Engineering, Research Center for Advanced Materials, Development and Institute of Biodegradable Materials, Chonbuk National University, Jeonju 561-756 (Korea, Republic of); Yi, Ho-Keun, E-mail: yihokn@chonbuk.ac.kr [Department of Oral Biochemistry, Institute of Oral Bioscience, School of Dentistry, Chonbuk National University, Jeonju (Korea, Republic of)
2015-10-01
Insulin like growth factor binding protein-3 (IGFBP-3) in bone cells and its utilization in dental implants have not been well studied. The aim of this study was to determine the osteogenic efficacy of chitosan gold nanoparticles (Ch-GNPs) conjugated with IGFBP-3 coated titanium (Ti) implants. Ch-GNPs were conjugated with IGFBP-3 plasmid DNA through a coacervation process. Conjugation was cast over Ti surfaces, and cells were seeded on coated surfaces. For in vitro analysis the expression of different proteins was analyzed by immunoblotting. For in vivo analysis, Ch-GNP/IGFBP-3 coated implants were installed in rat mandibles. Four weeks post-implantation, mandibles were examined by microcomputed tomography (μCT), immunohistochemistry, hematoxylin & eosin and tartrate resistance acid phosphatase staining. In vitro overexpressed Ch-GNP/IGFBP-3 coated Ti surfaces was associated with activation of extracellular signal related kinase (ERK), inhibition of the stress activated protein c-Jun N-terminal kinase (JNK) and enhanced bone morphogenetic protein (BMP)-2 and 7 compared to control. Further, in vivo, Ch-GNP/IGFBP-3 coated implants were associated with inhibition of implant induced osteoclastogenesis molecules, receptor activator of nuclear factor kappa-B ligand (RANKL) and enhanced expression of osteogenic molecules including BMP2/7 and osteopontin (OPN). The μCT analysis demonstrated that IGFBP-3 increased the volume of newly formed bone surrounding the implants compared to control (n = 5; p < 0.05). These results support the view that IGFBP-3 overexpression diminishes osteoclastogenesis and enhances osteogenesis of Ti implants, and can serve as a potent molecule for the development of good implantation. - Highlights: • Chitosan gold nanoparticles were conjugated with IGFBP-3 and coated onto surface of the titanium implants for gene delivery to bone. • Implants were inserted in rat mandible for 4 weeks. • Parameters studied: histopathology and radiology.
International Nuclear Information System (INIS)
Bhattarai, Govinda; Lee, Young-Hee; Lee, Min-Ho; Park, Il-Song; Yi, Ho-Keun
2015-01-01
Insulin like growth factor binding protein-3 (IGFBP-3) in bone cells and its utilization in dental implants have not been well studied. The aim of this study was to determine the osteogenic efficacy of chitosan gold nanoparticles (Ch-GNPs) conjugated with IGFBP-3 coated titanium (Ti) implants. Ch-GNPs were conjugated with IGFBP-3 plasmid DNA through a coacervation process. Conjugation was cast over Ti surfaces, and cells were seeded on coated surfaces. For in vitro analysis the expression of different proteins was analyzed by immunoblotting. For in vivo analysis, Ch-GNP/IGFBP-3 coated implants were installed in rat mandibles. Four weeks post-implantation, mandibles were examined by microcomputed tomography (μCT), immunohistochemistry, hematoxylin & eosin and tartrate resistance acid phosphatase staining. In vitro overexpressed Ch-GNP/IGFBP-3 coated Ti surfaces was associated with activation of extracellular signal related kinase (ERK), inhibition of the stress activated protein c-Jun N-terminal kinase (JNK) and enhanced bone morphogenetic protein (BMP)-2 and 7 compared to control. Further, in vivo, Ch-GNP/IGFBP-3 coated implants were associated with inhibition of implant induced osteoclastogenesis molecules, receptor activator of nuclear factor kappa-B ligand (RANKL) and enhanced expression of osteogenic molecules including BMP2/7 and osteopontin (OPN). The μCT analysis demonstrated that IGFBP-3 increased the volume of newly formed bone surrounding the implants compared to control (n = 5; p < 0.05). These results support the view that IGFBP-3 overexpression diminishes osteoclastogenesis and enhances osteogenesis of Ti implants, and can serve as a potent molecule for the development of good implantation. - Highlights: • Chitosan gold nanoparticles were conjugated with IGFBP-3 and coated onto surface of the titanium implants for gene delivery to bone. • Implants were inserted in rat mandible for 4 weeks. • Parameters studied: histopathology and radiology.
Directory of Open Access Journals (Sweden)
Sean Ekins
2009-12-01
Full Text Available Transcriptional regulation of some genes involved in xenobiotic detoxification and apoptosis is performed via the human pregnane X receptor (PXR which in turn is activated by structurally diverse agonists including steroid hormones. Activation of PXR has the potential to initiate adverse effects, altering drug pharmacokinetics or perturbing physiological processes. Reliable computational prediction of PXR agonists would be valuable for pharmaceutical and toxicological research. There has been limited success with structure-based modeling approaches to predict human PXR activators. Slightly better success has been achieved with ligand-based modeling methods including quantitative structure-activity relationship (QSAR analysis, pharmacophore modeling and machine learning. In this study, we present a comprehensive analysis focused on prediction of 115 steroids for ligand binding activity towards human PXR. Six crystal structures were used as templates for docking and ligand-based modeling approaches (two-, three-, four- and five-dimensional analyses. The best success at external prediction was achieved with 5D-QSAR. Bayesian models with FCFP_6 descriptors were validated after leaving a large percentage of the dataset out and using an external test set. Docking of ligands to the PXR structure co-crystallized with hyperforin had the best statistics for this method. Sulfated steroids (which are activators were consistently predicted as non-activators while, poorly predicted steroids were docked in a reverse mode compared to 5alpha-androstan-3beta-ol. Modeling of human PXR represents a complex challenge by virtue of the large, flexible ligand-binding cavity. This study emphasizes this aspect, illustrating modest success using the largest quantitative data set to date and multiple modeling approaches.
The significance of human factors in nuclear activities
International Nuclear Information System (INIS)
Weil, L.; Berg, H.P.
1999-01-01
Human factors is an aspect increasingly investigated in the last few years in efforts and programmes for enhancing the operational safety of nuclear systems. Methodology has been elaborated for analysis and evaluation of human reliability, or development of instruments supporting the decisions to be taken by the operators at the man-control room interface of nuclear installations, as well as initial approaches to introduce organisational factors which may influence the man-machine function allocation, and thus are an element of the safety culture concept. The significance of human factors in nuclear activities, as well as activities at the national and international level for optimisation of the man-machine interface and the man-organisation interface are discussed. (orig./CB) [de
Human factors in nuclear power plants
International Nuclear Information System (INIS)
Hennig, J.; Bohr, E.
1976-04-01
This annotated bibliography is a first attempt to give a survey of the kind of literature which is relevant for the ergonomic working conditions in nuclear power plants. Such a survey seems to be useful in view of the fact that the 'factor human being' comes recently more and more to the fore in nuclear power plants. In this context, the necessity is often pointed out to systematically include our knowledge of the performance capacity and limits of human beings when designing the working conditions for the personnel of nuclear power plants. For this reason, the bibliography is so much intended for the ergonomics experts as for the experts of nuclear engineering. (orig./LN) [de
Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem-cell self-renewal.
Yan, Kelley S; Janda, Claudia Y; Chang, Junlei; Zheng, Grace X Y; Larkin, Kathryn A; Luca, Vincent C; Chia, Luis A; Mah, Amanda T; Han, Arnold; Terry, Jessica M; Ootani, Akifumi; Roelf, Kelly; Lee, Mark; Yuan, Jenny; Li, Xiao; Bolen, Christopher R; Wilhelmy, Julie; Davies, Paige S; Ueno, Hiroo; von Furstenberg, Richard J; Belgrader, Phillip; Ziraldo, Solongo B; Ordonez, Heather; Henning, Susan J; Wong, Melissa H; Snyder, Michael P; Weissman, Irving L; Hsueh, Aaron J; Mikkelsen, Tarjei S; Garcia, K Christopher; Kuo, Calvin J
2017-05-11
The canonical Wnt/β-catenin signalling pathway governs diverse developmental, homeostatic and pathological processes. Palmitoylated Wnt ligands engage cell-surface frizzled (FZD) receptors and LRP5 and LRP6 co-receptors, enabling β-catenin nuclear translocation and TCF/LEF-dependent gene transactivation. Mutations in Wnt downstream signalling components have revealed diverse functions thought to be carried out by Wnt ligands themselves. However, redundancy between the 19 mammalian Wnt proteins and 10 FZD receptors and Wnt hydrophobicity have made it difficult to attribute these functions directly to Wnt ligands. For example, individual mutations in Wnt ligands have not revealed homeostatic phenotypes in the intestinal epithelium-an archetypal canonical, Wnt pathway-dependent, rapidly self-renewing tissue, the regeneration of which is fueled by proliferative crypt Lgr5 + intestinal stem cells (ISCs). R-spondin ligands (RSPO1-RSPO4) engage distinct LGR4-LGR6, RNF43 and ZNRF3 receptor classes, markedly potentiate canonical Wnt/β-catenin signalling, and induce intestinal organoid growth in vitro and Lgr5 + ISCs in vivo. However, the interchangeability, functional cooperation and relative contributions of Wnt versus RSPO ligands to in vivo canonical Wnt signalling and ISC biology remain unknown. Here we identify the functional roles of Wnt and RSPO ligands in the intestinal crypt stem-cell niche. We show that the default fate of Lgr5 + ISCs is to differentiate, unless both RSPO and Wnt ligands are present. However, gain-of-function studies using RSPO ligands and a new non-lipidated Wnt analogue reveal that these ligands have qualitatively distinct, non-interchangeable roles in ISCs. Wnt proteins are unable to induce Lgr5 + ISC self-renewal, but instead confer a basal competency by maintaining RSPO receptor expression that enables RSPO ligands to actively drive and specify the extent of stem-cell expansion. This functionally non-equivalent yet cooperative interaction
Directory of Open Access Journals (Sweden)
R. Golbedaghi
2014-01-01
Full Text Available The complex formation between a newly synthesized tripodal ligand and the cation Cu2+ in water and surfactant media was studied spectrophotometrically using rank annihilation factor analysis (RAFA. According to molar ratio data the stoichiometry of complexation between the ligand and the cation Cu2+ was 1:1. Formation constant of this complex was derived using RAFA on spectrophotometric data. The performance of the method has been evaluated by using synthetic data. Also concentration and spectral profiles of ligand and complex can be obtained by using the stability constant and appropriate equations. The effect of surfactants such as sodium dodecyl sulfate (SDS, cetyltrimethylammonium bromide (CTAB and Triton X-100 on complex formation constant of Cu2+ with the ligand was investigated.
Osteoprotegerin as a Marker of Atherosclerosis in Diabetic Patients
Directory of Open Access Journals (Sweden)
Areti Augoulea
2013-01-01
Full Text Available Atherosclerosis is the principal cause of cardiovascular disease (CVD and has many risk factors, among which is diabetes. Osteoprotegerin (OPG is a soluble glycoprotein, involved in bone metabolism. OPG is also found in other tissues, and studies have shown that it is expressed in vascular smooth muscle cells. OPG has been implicated in various inflammations and also has been linked to diabetes mellitus. Increased serum OPG levels were found in patients with diabetes and poor glycemic control. Furthermore, prepubertal children with type 1 diabetes have significantly increased OPG levels. Receptor activator of nuclear factor kappa-B ligand (RANKL is not found in the vasculature in normal conditions, but may appear in calcifying areas. OPG and RANKL are important regulators of mineral metabolism in both bone and vascular tissues. Few data are available on the relationship between plasma OPG/RANKL levels and endothelial dysfunction as assessed using noninvasive methods like ultrasound indexes, neither in the general population nor, more specifically, in diabetic patients. The aim of our review study was to investigate, based on the existing data, these interrelationships in order to identify a means of predicting, via noninvasive methods, later development of endothelial dysfunction and vascular complications in diabetic patients.
In vitro osteoclastogenesis on textile chitosan scaffold
Directory of Open Access Journals (Sweden)
C Heinemann
2010-02-01
Full Text Available Textile chitosan fibre scaffolds were evaluated in terms of interaction with osteoclast-like cells, derived from human primary monocytes. Part of the scaffolds was further modified by coating with fibrillar collagen type I in order to make the surface biocompatible. Monocytes were cultured directly on the scaffolds in the presence of macrophage colony stimulating factor (M-CSF and receptor activator of nuclear factor kappaB ligand (RANKL for up to 18 days. Confocal laser scanning microscopy (CLSM as well as scanning electron microscopy (SEM revealed the formation of multinuclear osteoclast-like cells on both the raw chitosan fibres and the collagen-coated scaffolds. The modified surface supported the osteoclastogenesis. Differentiation towards the osteoclastic lineage was confirmed by the microscopic detection of cathepsin K, tartrate resistant acid phosphatase (TRAP, acidic compartments using 3-(2,4-dinitroanillino-3’-amino-N-methyldipropylamine (DAMP, immunological detection of TRAP isoform 5b, and analysis of gene expression of the osteoclastic markers TRAP, cathepsin K, vitronectin receptor, and calcitonin receptor using reverse transcription-polymerase chain reaction (RT-PCR. The feature of the collagen-coated but also of the raw chitosan fibre scaffolds to support attachment and differentiation of human monocytes facilitates cell-induced material resorption – one main requirement for successful bone tissue engineering.
The human factor in the nuclear industry
International Nuclear Information System (INIS)
Colas, Armand
1998-01-01
After having evoked the progressive reduction and stabilization of significant incidents occurring every year in French nuclear power plants, and the challenges faced by nuclear energy (loss of public confidence, loss of competitiveness), and then outlined the importance of safety to overcome these challenges, the author comments EDF's approach to the human factor. He first highlights the importance of information and communication towards the population. He briefly discusses the meaning of human factors for the nuclear industry, sometimes perceived as the contribution people to the company's safety and performance. He comments the evolution observed in the perception of human error in different industrial or technical environments and situations, and outlines what is at stake to reduce the production of faults and organize a 'hunt for latent defects'
Identification of ligands for DAF-12 that govern dauer formation and reproduction in C. elegans.
Motola, Daniel L; Cummins, Carolyn L; Rottiers, Veerle; Sharma, Kamalesh K; Li, Tingting; Li, Yong; Suino-Powell, Kelly; Xu, H Eric; Auchus, Richard J; Antebi, Adam; Mangelsdorf, David J
2006-03-24
In response to environmental and dietary cues, the C. elegans orphan nuclear receptor, DAF-12, regulates dauer diapause, reproductive development, fat metabolism, and life span. Despite strong evidence for hormonal control, the identification of the DAF-12 ligand has remained elusive. In this work, we identified two distinct 3-keto-cholestenoic acid metabolites of DAF-9, a cytochrome P450 involved in hormone production, that function as ligands for DAF-12. At nanomolar concentrations, these steroidal ligands (called dafachronic acids) bind and transactivate DAF-12 and rescue the hormone deficiency of daf-9 mutants. Interestingly, DAF-9 has a biochemical activity similar to mammalian CYP27A1 catalyzing addition of a terminal acid to the side chain of sterol metabolites. Together, these results define the first steroid hormones in nematodes as ligands for an invertebrate orphan nuclear receptor and demonstrate that steroidal regulation of reproduction, from biology to molecular mechanism, is conserved from worms to humans.
Factor of radioactive waste on nuclear power program
International Nuclear Information System (INIS)
Syed Abdul Malik Syed Zain
2009-01-01
Global warming phenomena and rising oil prices have brought the excitement of open space use of nuclear power. Arguments in favor of this technology range in terms of more environmentally friendly, energy diversification and cost efficiency has prompted the government to widen the choice of nuclear power be considered as a serious alternative. Despite the attractive factors to the use of these powers, there are also factors that stem from the continued development of nuclear power. These include the factor of safety, security, security of fuel supply, and public attention is often associated with radioactive waste management. This article attempts to debate specific to radioactive waste management factors that impact on public acceptance of a country's nuclear power program, especially in Malaysia. Starting from the absence of radioactive waste management policy to model uncertainty of the landfill and complications in selecting a repository site shows the basic infrastructure is still lacking. In addition, previous experience handling thorium waste has not reached a final settlement after several years of implementation. It reinforced the perception about the level of public confidence in the competence and attitude of local workers who are not very encouraging to pursue this advanced.
Factors influencing chemical durability of nuclear waste glasses
International Nuclear Information System (INIS)
Feng, Xiangdong; Bates, J.K.
1993-01-01
A short summary is given of our studies on the major factors that affect the chemical durability of nuclear waste glasses. These factors include glass composition, solution composition, SA/V (ratio of glass surface area to the volume of solution), radiation, and colloidal formation. These investigations have enabled us to gain a better understanding of the chemical durability of nuclear waste glasses and to accumulate.a data base for modeling the long-term durability of waste glass, which will be used in the risk assessment of nuclear waste disposal. This knowledge gained also enhances our ability to formulate optimal waste glass compositions
Directory of Open Access Journals (Sweden)
Małgorzata Wegner
2015-08-01
Full Text Available Diabetes is a chronic, metabolic disease. Over 347 million people worldwide have diabetes. Chronic complications (retinopathy, nephropathy or neuropathy are the major dangerous outcome of this disease. Recent studies indicate a significant role of epigenetic regulation in the development of chronic complications in patients with diabetes. Hyperglycemia could cause abnormal regulation of the activity of enzymes participating in the post-translational histone modifications (PTHMs and initiation of changes in patterns of DNA methylation. It leads to modification of chromatin structure. These epigenetic abnormalities result in changes in the expression of genes involved in development of chronic inflammation, such as NF-KAPPAB (nuclear factor kappaB gene, TNFα (tumor necrosis factor a gene, IL6 (interleukin 6 gene or MCP1 (monocyte chemoattractant protein 1 gene. It enhances endothelial cell dysfunction, which plays an important role in development of chronic, diabetic complications. In addition, caused by hyperglycemia epigenetic modifications changes in structure of chromatin explains “metabolic memory”, a phenomenon of presence of pathological pathways related to the prolonged hyperglycemia in the past, despite maintaining good metabolic control later on.
Shen, Lu; Decker, Caitlin G; Maynard, Heather D; Levine, Alex J
2016-09-01
We present here the calculation of the mean time to capture of a tethered ligand to the receptor. This calculation is then used to determine the shift in the partitioning between (1) free, (2) singly bound, and (3) doubly bound ligands in chemical equilibrium as a function of the length of the tether. These calculations are used in the research article Fibroblast Growth Factor 2 Dimer with Superagonist in vitro Activity Improves Granulation Tissue Formation During Wound Healing (Decker et al., in press [1]) to explain quantitatively how changes in polymeric linker length in the ligand dimers modifies the efficacy of these molecules relative to that of free ligands.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Human and organizational factors in nuclear safety
International Nuclear Information System (INIS)
Garcia, A.; Barrientos, M.; Gil, B.
2015-01-01
Nuclear installations are socio technical systems where human and organizational factors, in both utilities and regulators, have a significant impact on safety. Three Mile Island (TMI) accident, original of several initiatives in the human factors field, nevertheless became a lost opportunity to timely acquire lessons related to the upper tiers of the system. Nowadays, Spanish nuclear installations have integrated in their processes specialists and activities in human and organizational factors, promoted by the licensees After many years of hard work, Spanish installations have achieved a better position to face new challenges, such as those posed by Fukushima. With this experience, only technology-centered action plan would not be acceptable, turning this accident in yet another lost opportunity. (Author)
Uranium, a factor limiting nuclear energy?
International Nuclear Information System (INIS)
Ohnemus, J.
2006-01-01
Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)
Uranium, a factor limiting nuclear energy?
International Nuclear Information System (INIS)
2006-01-01
Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this step was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken into account: stocks, resources, and reserves. To clarify the situation, this article outlines important aspects of short and long term uranium supplies, and analyzes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the influence of the price of uranium on the cost of electricity generation? Among other results, it is found that comprehensive sources of low-price uranium and nuclear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig./GL)
BONE METABOLISM AND ITS REGULATION IN PATIENTS WITH ANKYLOSING SPONDYLITIS
Directory of Open Access Journals (Sweden)
O. V. Bugrova
2016-01-01
Full Text Available Osteoporosis in ankylosing spondylitis (AS may exacerbate pain and functional disorders and increases the risk of fractures. The mechanisms of its development in AS have not been adequately studied.Objective: to study bone mineral density (BMD and its regulation in patients with AS.Subjects and methods. 70 patients (mean age, 43.2±9.2 years with a documented diagnosis of AS (mean disease duration, 17.1±7.8 years and a control group of 30 healthy individuals were examined. All the patients underwent estimation of BMD and the serum concentrations of osteocalcin, CrossLaps, and key regulators of osteoclastogenesis, such as osteoprotegerin (OPG and a receptor activator of nuclear factor kappa-B ligand (RANKL by an enzyme immunoassay. Results and discussion. In patients with AS, bone metabolism was characterized by a decrease in bone formation and by some increase in bone tissue degradation especially in high AS activity. These patients showed the elevated levels of the major blocker of osteoclastogenesis OPG and the OPG/RANKL ratio, which can cause the process of ossification characteristic of AS.
Development of human factors engineering guide for nuclear power project
International Nuclear Information System (INIS)
Wu Dangshi; Sheng Jufang
1997-01-01
'THE PRACTICAL GUIDE FOR APPLICATION OF HUMAN FACTORS ENGINEERING TO NUCLEAR POWER PROJECT (First Draft, in Chinese)', which was developed under a research program sponsored by National Nuclear Safety Administration (NNSA) is described briefly. It is hoped that more conscious, more systematical and more comprehensive application of Human Factors Engineering to the nuclear power projects from the preliminary feasibility studies up to the commercial operation will benefit the safe, efficient and economical operations of nuclear power plants in China
U.S. Nuclear Regulatory Commission human factors program plan
International Nuclear Information System (INIS)
1986-04-01
The purpose of the U.S. Nuclear Regulatory Commission (NRC) Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design and operation of nuclear facilities. This revised plan addresses human factors issues related to the operation of nuclear power plants (NPPs). The three issues of concern are (1) the activities planned to provide the technical bases to resolve the remaining tasks related to human factors as described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the need to address the additional human factors efforts that were identified during implementation of the Action Plan; and (3) the actual fulfillment of those developmental activities specified in Revision 1 of this plan. The plan represents a systematic approach for addressing high priority human factors concerns important to NPP safety in FY 1986 through 1987
Stochastic differentiation into an osteoclast lineage from cloned macrophage-like cells
Energy Technology Data Exchange (ETDEWEB)
Hayashi, Shin-Ichi, E-mail: shayashi@med.tottori-u.ac.jp [Division of Immunology, Department of Molecular and Cellular Biology, School of Life Science, Faculty of Medicine, Tottori University, 86 Nishi-Cho, Yonago, Tottori 683-8503 (Japan); Murata, Akihiko; Okuyama, Kazuki; Shimoda, Yuhki; Hikosaka, Mari [Division of Immunology, Department of Molecular and Cellular Biology, School of Life Science, Faculty of Medicine, Tottori University, 86 Nishi-Cho, Yonago, Tottori 683-8503 (Japan); Yasuda, Hisataka [Planning and Development, Bioindustry Division, Oriental Yeast Co., Ltd, Itabashi-Ku, Tokyo 174-8505 (Japan); Yoshino, Miya [Division of Immunology, Department of Molecular and Cellular Biology, School of Life Science, Faculty of Medicine, Tottori University, 86 Nishi-Cho, Yonago, Tottori 683-8503 (Japan)
2012-11-16
Highlights: Black-Right-Pointing-Pointer The frequency of C7 differentiation into osteoclast was low and constant. Black-Right-Pointing-Pointer Only extended C7 cell cultures exponentially increased osteoclast+ cultures. Black-Right-Pointing-Pointer C7 cell differentiation into committed osteoclast precursors is on 'autopilot'. Black-Right-Pointing-Pointer The system may maintain the stem cell self-renewal and differentiation. -- Abstract: Differentiation into osteoclasts is induced by a macrophage colony-stimulating factor and receptor activator of nuclear-factor {kappa}B ligand. The macrophage-like cell line, C7 has the potential to differentiate into osteoclasts when it is cultured with both factors for 6 days. Although C7 is an established cell line, the frequency of differentiation into this lineage was less than 10%, and the ratio was maintained at a constant level, even after repeated cloning. In this study, to increase the differentiation of C7 cells to osteoclasts, C7 derivative treatments with several activators and/or inhibitors were performed for 3 days prior to setting osteoclast induction analysis; however, a reagent to significantly up-regulate the frequency of differentiation was not found. Only extended cultures for osteoclastogenesis exponentially increased the frequency of osteoclast precursors. It is likely that C7 cell differentiation into committed osteoclast precursors is on 'autopilot' rather than requiring specific signals to drive this process.
Effects of pulpectomy on the amount of root resorption during orthodontic tooth movement.
Kaku, Masato; Sumi, Hiromi; Shikata, Hanaka; Kojima, Shunichi; Motokawa, Masahide; Fujita, Tadashi; Tanimoto, Kotaro; Tanne, Kazuo
2014-03-01
Previous studies have revealed that orthodontic force affects dental pulp via the rupture of blood vessels and vacuolization of pulp tissues. We hypothesized that pulp tissues express inflammatory cytokines and regulators of odontoclast differentiation after excess orthodontic force. The purpose of this study was to investigate the effects of tensile force in human pulp cells and to measure inflammatory root resorption during tooth movement in pulpless rat teeth. After cyclic tensile force application in human pulp cells, gene expression and protein concentration of macrophage colony-stimulating factor, receptor activator of nuclear factor kappa-B ligand, interleukin-1 beta, and tumor necrosis factor alpha were determined by real-time polymerase chain reaction and enzyme-linked immunoassay. Moreover, the role of the stretch-activated channel was evaluated by gadolinium (Gd(3+)) treatment. The upper right first molars of 7-week Wistar rats were subjected to pulpectomy and root canal filling followed by mesial movement for 6 months. The expression of cytokine messenger RNAs and proteins in the experimental group peaked with loading at 10-kPa tensile force after 48 hours (P root resorption was significantly larger in the control teeth than the pulpectomized teeth (P root resorption during tooth movement. It also suggests that root canal treatment is effective for progressive severe inflammatory root resorption during tooth movement. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wen Lili; Wang Dong'e; Wang Chenggang; Wang Feng; Li Dongfeng; Deng Kejian
2009-01-01
A new metal-organic framework, [Zn 5 (trencba) 2 (OH) 2 Cl 2 .4H 2 O] (1) [H 3 trencba=N,N,N',N',N'',N''-tris[(4-carboxylate-2-yl)methyl]-tris (2-aminoethyl)amine], constructed from a flexible tripodal ligand based on C 3 symmetric tris(2-aminoethyl)amine, has been synthesized hydrothermally and characterized by elemental analysis, IR, TG, XRD and single-crystal X-ray diffraction analysis. Compound 1 contains an unprecedented linear penta-nuclear zinc cluster fragment. Each ligand links four penta-nuclear fragments, and every fragment links eight ligands to generate a three-dimensional non-interpenetrated porous framework. The uncoordinated water molecules were observed trapped in the void pores. Compound 1 represents the first example of (6,8)-connected 3D bi-nodal framework based on a single kind of organic ligand. The photoluminescence measurements showed that complex 1 exhibits relatively stronger blue emissions at room temperature than that of the ligand. - Graphical abstract: The MOF [Zn 5 (trencba) 2 (OH) 2 Cl 2 .4H 2 O] (H 3 trencba=N,N,N',N',N',N'-tris[(4-carboxylate-2-yl)methyl]-tris (2-aminoethyl)amine) reveals a (6,8)-connected bi-nodal three-dimensional porous framework with unprecedented penta-nuclear fragment, which appears to be a good candidate of hybrid inorganic-organic photoactive materials
Synthesis and evaluation of potential ligands for nuclear waste processing
Iqbal, M.
2012-01-01
The research presented in this thesis deals with the synthesis and evaluation of new potential ligands for the complexation of actinide and lanthanide ions either for their extraction from bulk radioactive waste or their stripping from an extracted organic phase for final processing of the waste. In
DEFF Research Database (Denmark)
Engström, Maria; Karlsson, Richard; Jönsson, Jan-Ingvar
2003-01-01
OBJECTIVE: Kit ligand (KL) is a major survival factor for hematopoietic stem cells. Although anti-apoptotic bcl-2 family members are expressed in these cells, the survival effects by KL appear to involve other mechanisms. Survival signals can also be elicited by the activation of phosphatidylinos......OBJECTIVE: Kit ligand (KL) is a major survival factor for hematopoietic stem cells. Although anti-apoptotic bcl-2 family members are expressed in these cells, the survival effects by KL appear to involve other mechanisms. Survival signals can also be elicited by the activation......, immunofluorescence, and subcellular fractionation, we analyzed the effects of KL on PKB and different forkhead family members in two factor-dependent cell lines, FDCP-mix and FDC-P1, as well as primary mouse bone marrow-derived Lin(-) progenitors. Forced overexpression of triple mutated form of FoxO3 by retroviral...
US Nuclear Regulatory Commission human-factors program plan
International Nuclear Information System (INIS)
1983-08-01
The purpose of the NRC Human Factors Program Plan is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This initial plan addresses nuclear power plants (NPP) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, The NRC Action Plan Developed as a Result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements, and (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-83 through FY-85 time frame
Organizational factors in nuclear safety
International Nuclear Information System (INIS)
Wilpert, Bernhard
2000-01-01
The overall picture of factors which contributed to the event presents a panorama of a NPP where organizational and managerial characteristics were intricately intertwined and emerged as crucial for a general deterioration of the plant's capabilities to continually correct its deficiencies and optimize its operations. In the following author shall attempt to first cover various important efforts to modeling organizational factors relevant to safety. The second part of my presentation will offer an attempt towards an integrative model. The third part concludes with an agenda for research and practice. Most of the twelve different approaches above attempt to consider safety relevant organizational factors by way of pragmatic classifications. Together with their sub-categories we can count close to 160 different factors on various levels of abstraction. This is tantamount to say that most approaches lack systematic theoretical underpinnings. Thus then arises the question whether we need to develop a generic model, which promises to encompass these three major approaches altogether. Practical issues emerge particularly in the domain of organizational development, i.e. the goal oriented efforts to change the structures and the functioning of nuclear operations in such a way that the desired outputs in terms safety and reliability result in a sustained fashion. Again, these practical concerns are intimately related to developments and advances in theory and methodology. Only a close cooperation among scientists from various disciplines and of practitioners holds the promise of adequately understanding and use of organizational factors in future improving the safety record of nuclear industry worldwide. (S.Y.)
Directory of Open Access Journals (Sweden)
Jingyu He
2018-02-01
Full Text Available The iridoids of Hedyotis diffusa Willd play an important role in the anti-inflammatory process, but the specific iridoid with anti-inflammatory effect and its mechanism has not be thoroughly studied. An iridoid compound named scandoside (SCA was isolated from H. diffusa and its anti-inflammatory effect was investigated in lipopolysaccharide (LPS-induced RAW 264.7 macrophages. Its anti-inflammatory mechanism was confirmed by in intro experiments and molecular docking analyses. As results, SCA significantly decreased the productions of nitric oxide (NO, prostaglandin E2 (PGE2, tumor necrosis factor-α (TNF-α and interleukin-6 (IL-6 and inhibited the levels of inducible nitric oxide synthase (iNOS, cyclooxygenase-2 (COX-2, TNF-α and IL-6 messenger RNA (mRNA expression in LPS-induced RAW 264.7 macrophages. SCA treatment suppressed the phosphorylation of inhibitor of nuclear transcription factor kappa-B alpaha (IκB-α, p38, extracellular signal-regulated kinase (ERK and c-Jun N-terminal kinase (JNK. The docking data suggested that SCA had great binding abilities to COX-2, iNOS and IκB. Taken together, the results indicated that the anti-inflammatory effect of SCA is due to inhibition of pro-inflammatory cytokines and mediators via suppressing the nuclear transcription factor kappa-B (NF-κB and mitogen-activated protein kinase (MAPK signaling pathways, which provided useful information for its application and development.
Energy Technology Data Exchange (ETDEWEB)
Arnold, John [Univ. of California, Berkeley, CA (United States)
2017-12-06
The uranyl cation (UO22+) is the most abundant form of uranium on the planet. It is estimated that 4.5 billion tons of uranium in this form exist in sea water. The ability to bind and extract the uranyl cation from aqueous solution while separating it from other elements would provide a limitless source of nuclear fuel. A large body of research concerns the selective recognition and extraction of uranyl. A stable molecule, the cation has a linear O=U=O geometry. The short U-O bonds (1.78 Å) arise from the combination of uranium 5f/6d and oxygen 2p orbitals. Due to the oxygen moieties being multiply bonded, these sites were not thought to be basic enough for Lewis acidic coordination to be a viable approach to sequestration. We believe that the goal of developing a practical system for uranium separation from seawater will not be attained without new insights into our existing fundamental knowledge of actinide chemistry. We posit that detailed studies of the kinetic and thermodynamic factors that influence interactions between f-elements and ligands with a range of donor atoms is essential to any major advance in this important area. The goal of this research is thus to broaden the coordination chemistry of the uranyl ion by studying new ligand systems via synthetic, structural, thermodynamic and computational methods. We anticipate that this fundamental science will find use beyond actinide separation technologies in areas such as nuclear waste remediation and nuclear materials.
The Nuclear Energy Factor In Indian Politics
Directory of Open Access Journals (Sweden)
A. A. Boyko
2017-01-01
Full Text Available Nuclear energy is a key branch of the world power system. The nuclear energy development is viewed by India as one of the ways to resolve the problem of the energy supply. In 2008 the country gained more opportunities for developing nuclear power sector and solving the national power deficit problem after NSG lifted restrictions on nuclear trade. This resulted in foreign companies emerging on the Indian nuclear market. In 2011 after the major emergency at Fukushima Daiichi Nuclear Power Plant in Japan India faced numerous anti-nuclear protests backed by NGOs, including those with foreign funding, and political parties. The article deals with the question of the political role this anti-nuclear opposition plays in India. According to some researchers the protests are organized by the competitors in order to compromise the business of a Russian company Rosatom in India. However, such demonstrations are spread throughout the country and directed against the competitors of Rosatom as well. The article comes to conclusion that the protests are just a reflection of the political fights in India where nuclear energy is a significant political factor.
Regulation of the ligand-dependent activation of the epidermal growth factor receptor by calmodulin
DEFF Research Database (Denmark)
Li, Hongbing; Panina, Svetlana; Kaur, Amandeep
2012-01-01
Calmodulin (CaM) is the major component of calcium signaling pathways mediating the action of various effectors. Transient increases in the intracellular calcium level triggered by a variety of stimuli lead to the formation of Ca2+/CaM complexes, which interact with and activate target proteins....... In the present study the role of Ca2+/CaM in the regulation of the ligand-dependent activation of the epidermal growth factor receptor (EGFR) has been examined in living cells. We show that addition of different cell permeable CaM antagonists to cultured cells or loading cells with a Ca2+ chelator inhibited...
Clinical validation of nuclear factor kappa B expression in invasive breast cancer.
Agrawal, Anil Kumar; Pielka, Ewa; Lipinski, Artur; Jelen, Michal; Kielan, Wojciech; Agrawal, Siddarth
2018-01-01
Breast cancer is the most commonly diagnosed cancer in Polish women. The expression of transcription nuclear factor kappa B, a key inducer of inflammatory response promoting carcinogenesis and cancer progression in breast cancer, is not well-established. We assessed the nuclear factor kappa B expression in a total of 119 invasive breast carcinomas and 25 healthy control samples and correlated this expression pattern with several clinical and pathologic parameters including histologic type and grade, tumor size, lymph node status, estrogen receptor status, and progesterone receptor status. The data used for the analysis were derived from medical records. An immunohistochemical analysis of nuclear factor kappa B, estrogen receptor, and progesterone receptor was carried out and evaluation of stainings was performed. The expression of nuclear factor kappa B was significantly higher than that in the corresponding healthy control samples. No statistical difference was demonstrated in nuclear factor kappa B expression in relation to age, menopausal status, lymph node status, tumor size and location, grade and histologic type of tumor, and hormonal status (estrogen receptor and progesterone receptor). Nuclear factor kappa B is significantly overexpressed in invasive breast cancer tissues. Although nuclear factor kappa B status does not correlate with clinicopathological findings, it might provide important additional information on prognosis and become a promising object for targeted therapy.
Maturing of the nuclear receptor family.
Lazar, Mitchell A
2017-04-03
Members of the nuclear receptor (NR) superfamily of ligand-regulated transcription factors play important roles in reproduction, development, and physiology. In humans, genetic mutations in NRs are causes of rare diseases, while hormones and drugs that target NRs are in widespread therapeutic use. The present issue of the JCI includes a series of Review articles focused on specific NRs and their wide range of biological functions. Here I reflect on the past, present, and potential future highlights of research on the NR superfamily.
Kit ligand promotes first polar body extrusion of mouse preovulatory oocytes
Directory of Open Access Journals (Sweden)
Ye Yinghui
2009-04-01
Full Text Available Abstract Background Shortly after stimulation by the preovulatory surge of luteinizing hormone (LH, oocytes arrested at the late prophase I resume meiosis characterized by germinal vesicle breakdown (GVBD, chromosome condensation, and extrusion of the first polar body in preparation for fertilization and early embryonic development. However, oocytes express few or no LH receptors and are insensitive to direct LH stimulation. Thus, factors released by granulosa or theca cells expect to convey the LH stimuli to oocytes. To identify candidate ligand-receptor pairs potentially involved in the process of oocyte maturation, we performed DNA microarray analyses of ovarian transcripts in mice and identified Kit ligand (Kitl as an ovarian factor stimulated by the LH/hCG surge. The purpose of this study is to investigate the roles of KITL in the nuclear and cytoplasmic maturation of preovulatory mouse oocytes. Methods The levels of Kitl and c-kit transcripts in mouse ovaries and isolated ovarian cells were determined by real-time RT-PCR, while expression of KITL protein was examined by immunohistochemistry. Follicle culture, cumulus-oocyte complexes (COC and denuded oocytes culture were used to evaluate the effect of KITL on mouse oocyte nuclear maturation. To assess the effect of KITL treatment on the cytoplasmic maturation of preovulatory oocytes, we performed in vitro maturation of oocytes followed by in vitro fertilization. Results Major increase of Kitl transcripts in granulosa cells and mouse ovaries, and predominant expression of c-kit in preovulatory oocytes were identified by real-time RT-PCR. Predominant expression of KITL protein was found in granulosa cells of preovulatory and small antral follicles at 4 h after hCG treatment. In vitro cultures demonstrated that treatment with KITL enhanced first polar body extrusion in a dose-dependent manner. Moreover, treatment of COC with KITL enhanced first polar body extrusion with increase in cyclin B1
Uranium - a factor limiting nuclear energy?
International Nuclear Information System (INIS)
Ohnemus, J.
2006-01-01
Nuclear power has been back as a topic of public debate since early this year. A special subject under discussion is the extension of nuclear power plant life. Hardly had it been on the agenda, when interested parties announced that this st ep was impossible because uranium reserves were no longer sufficient. A variety of terms are being used in this discussion without their meaning being taken int o account: stocks, resources, and reserves. To clarify the situation, this artic le outlines important aspects of short and long term uranium supplies, and analy zes their meaning. Here are some of the most important issues under consideration: - For what period of time is there really enough uranium? - Is uranium becoming the limiting factor in the use of nuclear power? - Is uranium really a 'sustainable' energy resource? - Will higher prices extend the range? - What is the in fluence of the price of uranium on the cost of electricity generation? Among oth er results, it is found that comprehensive sources of low-price uranium and nucl ear fuels are, or can be made, available worldwide. Consequently, the 'range' is beyond the time frames currently mentioned, also as a function of technological factors, i.e. reaching several hundred years. It is also important to note that nuclear power - ensures greater independence of volatile imported sources, - guarantees reliably low electricity prices, - has a huge potential of environmental protection, and - is a clean source of energy. (orig.)
Sledování markerů oxidačního stresu u modelu chronického zánětu tlustého střeva
Hocková, Erika
2010-01-01
Crohn's disease and ulcerative colitis are both entities of inflammatory bowel disease (IBD). The nuclear transcription factor kappaB (NFκB) family consists of five different members, which are namely p65 (RelA), c-Rel, RelB, p50 and p52. NFκB has ability to promote the expression of various proinflammatory genes, to influence the course of mucosal inflammation and to mediate different cell-type specific effects. Bilirubin is an endogenous substance with anti-oxidative and anti-inflammatory e...
Separating form factor and nuclear model effects in quasielastic neutrino-nucleus scattering
Wieske, Joseph
2017-09-01
When studying neutrino oscillations an understanding of charged current quasielastic (CCQE) neutrino-nucleus scattering is imperative. This interaction depends on a nuclear model as well as knowledge of form factors. In the past, CCQE data from the MiniBooNE experiment was analyzed assuming the Relativistic Fermi Gas (RFG) nuclear model, an axial dipole form factor in, and using the the z-expansion for the axial form factor in. We present the first analysis that combines a non-RFG nuclear model, in particular the Correlated Fermi Gas nuclear model (CFG) of, and the z expansion for the axial form factor. This will allow us to separate form factor and nuclear model effects in CCQE scattering. This project was supported through the Wayne State University REU program under NSF Grant PHY-1460853 and by the DOE Grant DE-SC0007983.
Parallel Assessment of Bone Mineral Density and RANKL/OPG Ratio in Saudi Females
Directory of Open Access Journals (Sweden)
AI Hassan
2016-02-01
Full Text Available Background: Osteoporosis is a significant risk factor for morbidity, and its high prevalence among Saudi women should be considered to be a public health problem. Quantitative ultrasound was recommended for bone mineral density (BMD screening. Receptor activator of nuclear factor kappa-B ligand (RANKL and osteoprotegerin (OPG and their ratio are critical for physiological bone remodelling, and related abnormalities may lead to several osteopathies. Methods: The BMD of 499 Saudi females aged 20 to 65 years was measured using quantitative ultrasound from the beginning of October 2013 to the end of March 2014 at the female medical unit of Taibah University, Madinah, KSA. Possible associated risk factors for low BMD were studied. Blood RANKL and OPG were measured by enzyme-linked immunosorbent assay (ELISA. Results: No significant differences were found between participants with normal and low BMD regarding the studied risk factors. However, there was a significant association (p < 0.05 between BMD and regular physical activity among participants aged 20 years to less than 35 years, and women aged 35–50 years with higher body mass index (BMI had higher BMD. The RANKL/OPG ratio was inversely associated (p = 0.04 with BMD. Conclusions: Regular physical activity is crucial for maximizing BMD in young females and decreasing the possibility of developing osteoporosis with ageing. The RANKL/OPG ratio might be considered a useful and easy-to-use tool for the prediction of low BMD.
Ferguson, Sarah; Kiswandhi, Andhika; Niedbalski, Peter; Parish, Christopher; Kovacs, Zoltan; Lumata, Lloyd
Dissolution dynamic nuclear polarization (DNP) is a rapidly emerging physics technique used to enhance the signal strength in nuclear magnetic resonance (NMR) and imaging (MRI) experiments for nuclear spins such as yttrium-89 by >10,000-fold. One of the most common and stable MRI contrast agents used in the clinic is Gd-DOTA. In this work, we have investigated the binding of the yttrium and DOTA ligand as a model for complexation of Gd ion and DOTA ligand. The macrocyclic ligand DOTA is special because its complexation with lanthanide ions such as Gd3+ or Y3+ is highly pH dependent. Using this physics technology, we have tracked the complexation kinetics of hyperpolarized Y-triflate and DOTA ligand in real-time and detected the Y-DOTA intermediates. Different kinds of buffers were used (lactate, acetate, citrate, oxalate) and the pseudo-first order complexation kinetic calculations will be discussed. The authors would like to acknowledge the support by US Dept of Defense Award No. W81XWH-14-1-0048 and Robert A. Welch Foundation Grant No. AT-1877.
International Nuclear Information System (INIS)
Chen, Pei-Lin; Easton, Alexander S.
2010-01-01
Tumor necrosis factor (TNF) and its related ligands TNF-related apoptosis inducing ligand (TRAIL) and Fas ligand (FasL) play roles in the regulation of vascular responses, but their effect on the formation of new blood vessels (angiogenesis) is unclear. Therefore, we have examined the effects of these ligands on angiogenesis modeled with primary cultures of human umbilical vein endothelial cells (HUVEC). To examine angiogenesis in the context of the central nervous system, we have also modeled cerebral angiogenesis with the human brain endothelial cell line hCMEC/D3. Parameters studied were bromodeoxyuridine (BrdU) incorporation and cell number (MTT) assay (to assess endothelial proliferation), scratch assay (migration) and networks on Matrigel (tube formation). In our hands, neither TRAIL nor FasL (1, 10, and 100 ng/ml) had an effect on parameters of angiogenesis in the HUVEC model. In hCMEC/D3 cells by contrast, TRAIL inhibited all parameters (10-100 ng/ml, 24 h). This was due to apoptosis, since its action was blocked by the pan-caspase inhibitor zVADfmk (5 x 10 -5 mol/l) and TRAIL increased caspase-3 activity 1 h after application. However FasL (100 ng/ml) increased BrdU uptake without other effects. We conclude that TRAIL has different effects on in vitro angiogenesis depending on which model is used, but that FasL is generally ineffective when applied in vitro. The data suggest that TRAIL primarily influences angiogenesis by the induction of vascular endothelial apoptosis, leading to vessel regression.
Human factor analysis and preventive countermeasures in nuclear power plant
International Nuclear Information System (INIS)
Li Ye
2010-01-01
Based on the human error analysis theory and the characteristics of maintenance in a nuclear power plant, human factors of maintenance in NPP are divided into three different areas: human, technology, and organization. Which is defined as individual factors, including psychological factors, physiological characteristics, health status, level of knowledge and interpersonal skills; The technical factors including technology, equipment, tools, working order, etc.; The organizational factors including management, information exchange, education, working environment, team building and leadership management,etc The analysis found that organizational factors can directly or indirectly affect the behavior of staff and technical factors, is the most basic human error factor. Based on this nuclear power plant to reduce human error and measures the response. (authors)
Selective oxoanion separation using a tripodal ligand
Energy Technology Data Exchange (ETDEWEB)
Custelcean, Radu; Moyer, Bruce A.; Rajbanshi, Arbin
2016-02-16
The present invention relates to urea-functionalized crystalline capsules self-assembled by sodium or potassium cation coordination and by hydrogen-bonding water bridges to selectively encapsulate tetrahedral divalent oxoanions from highly competitive aqueous alkaline solutions and methods using this system for selective anion separations from industrial solutions. The method involves competitive crystallizations using a tripodal tris(urea) functionalized ligand and, in particular, provides a viable approach to sulfate separation from nuclear wastes.
Lin, Ying-Ting
2013-04-30
A tandem technique of hard equipment is often used for the chemical analysis of a single cell to first isolate and then detect the wanted identities. The first part is the separation of wanted chemicals from the bulk of a cell; the second part is the actual detection of the important identities. To identify the key structural modifications around ligand binding, the present study aims to develop a counterpart of tandem technique for cheminformatics. A statistical regression and its outliers act as a computational technique for separation. A PPARγ (peroxisome proliferator-activated receptor gamma) agonist cellular system was subjected to such an investigation. Results show that this tandem regression-outlier analysis, or the prioritization of the context equations tagged with features of the outliers, is an effective regression technique of cheminformatics to detect key structural modifications, as well as their tendency of impact to ligand binding. The key structural modifications around ligand binding are effectively extracted or characterized out of cellular reactions. This is because molecular binding is the paramount factor in such ligand cellular system and key structural modifications around ligand binding are expected to create outliers. Therefore, such outliers can be captured by this tandem regression-outlier analysis.
Mitochondria mediate tumor necrosis factor-alpha/NF-kappaB signaling in skeletal muscle myotubes
Li, Y. P.; Atkins, C. M.; Sweatt, J. D.; Reid, M. B.; Hamilton, S. L. (Principal Investigator)
1999-01-01
Tumor necrosis factor-alpha (TNF-alpha) is implicated in muscle atrophy and weakness associated with a variety of chronic diseases. Recently, we reported that TNF-alpha directly induces muscle protein degradation in differentiated skeletal muscle myotubes, where it rapidly activates nuclear factor kappaB (NF-kappaB). We also have found that protein loss induced by TNF-alpha is NF-kappaB dependent. In the present study, we analyzed the signaling pathway by which TNF-alpha activates NF-kappaB in myotubes differentiated from C2C12 and rat primary myoblasts. We found that activation of NF-kappaB by TNF-alpha was blocked by rotenone or amytal, inhibitors of complex I of the mitochondrial respiratory chain. On the other hand, antimycin A, an inhibitor of complex III, enhanced TNF-alpha activation of NK-kappaB. These results suggest a key role of mitochondria-derived reactive oxygen species (ROS) in mediating NF-kappaB activation in muscle. In addition, we found that TNF-alpha stimulated protein kinase C (PKC) activity. However, other signal transduction mediators including ceramide, Ca2+, phospholipase A2 (PLA2), and nitric oxide (NO) do not appear to be involved in the activation of NF-kappaB.
Nuclear modification factor using Tsallis non-extensive statistics
Energy Technology Data Exchange (ETDEWEB)
Tripathy, Sushanta; Garg, Prakhar; Kumar, Prateek; Sahoo, Raghunath [Indian Institute of Technology Indore, Discipline of Physics, School of Basic Sciences, Simrol (India); Bhattacharyya, Trambak; Cleymans, Jean [University of Cape Town, UCT-CERN Research Centre and Department of Physics, Rondebosch (South Africa)
2016-09-15
The nuclear modification factor is derived using Tsallis non-extensive statistics in relaxation time approximation. The variation of the nuclear modification factor with transverse momentum for different values of the non-extensive parameter, q, is also observed. The experimental data from RHIC and LHC are analysed in the framework of Tsallis non-extensive statistics in a relaxation time approximation. It is shown that the proposed approach explains the R{sub AA} of all particles over a wide range of transverse momentum but does not seem to describe the rise in R{sub AA} at very high transverse momenta. (orig.)
Geologic factors in nuclear waste disposal
International Nuclear Information System (INIS)
Towse, D.
1978-07-01
The study of geosciences and their relation to nuclear waste disposal and management entails analyzing the hydrology, chemistry, and geometry of the nuclear waste migration process. Hydrologic effects are determined by analyzing the porosity and permeability (natural and induced) of rock as well as pressures and gradients, dispersion, and aquifer length of the system. Chemistry parameters include radionuclide retardation factors and waste dissolution rate. Geometric parameters (i.e., parameters with dimension) evaluated include repository layer thickness, fracture zone area, tunnel length, and aquifer length. The above parameters act as natural barriers or controls to nuclear waste migration, and are evaluated in three potential geologic media: salt, shale, and crystalline rock deposits. Parametric values are assigned that correspond to many existing situations. These values, in addition to other important inputs, are lumped as a hydrology input into a computer simulation program used to model and calculate nuclear waste migration from the repository to the biosphere, and potential individual and population dose and radiation effects. These results are preliminary and show trends only; they do not represent an actual risk analysis
Lanthanide and actinide complexation studies with tetradentate 'N' donor ligands
International Nuclear Information System (INIS)
Bhattacharyya, A.; Mohapatra, M.; Mohapatra, P.K.; Rawat, N.; Tomar, B.S.; Gadly, T.; Ghosh, S.K.; Manna, D.; Ghanty, T.K.
2014-01-01
Because of their similar charge and chemical behaviour separation of trivalent actinides and lanthanides is an important and challenging task in nuclear fuel cycle. Soft (S,N) donor ligands show selectivity towards the trivalent actinides over the lanthanides. Out of various 'N' donor ligands studied, bis(1,2,4)triazinyl bipyridine (BTBP) and bis(1,2,4)triazinyl phenanthroline (BTPhen) were found to be most promising. In order to understand the separation behaviour of these ligands, their complexation studies with these 'f' block elements are essential. In the present work, complexation studies of various lanthanide ions (La 3+ , Eu 3+ and Er 3+ ) was studied with ethyl derivatives of BTBP (C 2 BTBP) and BTBPhen (C 2 BTPhen) and pentyl derivative of BTBP (C 5 BTBP) in acetonitrile medium using UV-Vis spectrophotometry, fluorescence spectroscopy and solution calorimetry. Computational studies were also carried out to understand the experimental results
US Nuclear Regulatory Commission Human Factors Program Plan. Revision 1
International Nuclear Information System (INIS)
1984-09-01
The purpose of the NRC Human Factors Program Plan (NUREG-0985) is to ensure that proper consideration is given to human factors in the design, operation, and maintenance of nuclear facilities. This revised plan addresses nuclear power plants (NPPs) and describes (1) the technical assistance and research activities planned to provide the technical bases for the resolution of the remaining human factors related tasks described in NUREG-0660, THE NRC Action Plan developed as a result of the TMI-2 Accident, and NUREG-0737, Clarification of TMI Action Plan Requirements; (2) the additional human factors efforts identified during implementation of the Action Plan that should receive NRC attention; (3) conduct of developmental activities specified in NUREG-0985 during FY-83; and (4) the impact of Section 306 of the Nuclear Waste Policy Act of 1982, PL 97-425. The plan represents a systematic and comprehensive approach for addressing human factors concerns important to NPP safety in the FY-84 through FY-86 time frame
Two novel mixed-ligand complexes containing organosulfonate ligands.
Li, Mingtian; Huang, Jun; Zhou, Xuan; Fang, Hua; Ding, Liyun
2008-07-01
The structures reported herein, viz. bis(4-aminonaphthalene-1-sulfonato-kappaO)bis(4,5-diazafluoren-9-one-kappa(2)N,N')copper(II), [Cu(C(10)H(8)NO(3)S)(2)(C(11)H(6)N(2)O)(2)], (I), and poly[[[diaquacadmium(II)]-bis(mu-4-aminonaphthalene-1-sulfonato)-kappa(2)O:N;kappa(2)N:O] dihydrate], {[Cd(C(10)H(8)NO(3)S)(2)(H(2)O)(2)].2H(2)O}(n), (II), are rare examples of sulfonate-containing complexes where the anion does not fulfill a passive charge-balancing role, but takes an active part in coordination as a monodentate and/or bridging ligand. Monomeric complex (I) possesses a crystallographic inversion center at the Cu(II) atom, and the asymmetric unit contains one-half of a Cu atom, one complete 4-aminonaphthalene-1-sulfonate (ans) ligand and one 4,5-diazafluoren-9-one (DAFO) ligand. The Cu(II) atom has an elongated distorted octahedral coordination geometry formed by two O atoms from two monodentate ans ligands and by four N atoms from two DAFO molecules. Complex (II) is polymeric and its crystal structure is built up by one-dimensional chains and solvent water molecules. Here also the cation (a Cd(II) atom) lies on a crystallographic inversion center and adopts a slightly distorted octahedral geometry. Each ans anion serves as a bridging ligand linking two Cd(II) atoms into one-dimensional infinite chains along the [010] direction, with each Cd(II) center coordinated by four ans ligands via O and N atoms and by two aqua ligands. In both structures, there are significant pi-pi stacking interactions between adjacent ligands and hydrogen bonds contribute to the formation of two- and three-dimensional networks.
Directory of Open Access Journals (Sweden)
Weber Katherine P
2012-06-01
Full Text Available Abstract Background The nuclear receptors (NRs are an important class of transcription factors that are conserved across animal phyla. Canonical NRs consist of a DNA-binding domain (DBD and ligand-binding domain (LBD. While most animals have 20–40 NRs, nematodes of the genus Caenorhabditis have experienced a spectacular proliferation and divergence of NR genes. The LBDs of evolutionarily-conserved Caenorhabditis NRs have diverged sharply from their Drosophila and vertebrate orthologs, while the DBDs have been strongly conserved. The NR2E family of NRs play critical roles in development, especially in the nervous system. In this study, we explore the phylogenetics and function of the NR2E family of Caenorhabditis elegans, using an in vivo assay to test LBD function. Results Phylogenetic analysis reveals that the NR2E family of NRs consists of three broadly-conserved clades of orthologous NRs. In C. elegans, these clades are defined by nhr-67, fax-1 and nhr-239. The vertebrate orthologs of nhr-67 and fax-1 are Tlx and PNR, respectively. While the nhr-239 clade includes orthologs in insects (Hr83, an echinoderm, and a hemichordate, the gene appears to have been lost from vertebrate lineages. The C. elegans and C. briggsae nhr-239 genes have an apparently-truncated and highly-diverged LBD region. An additional C. elegans NR2E gene, nhr-111, appears to be a recently-evolved paralog of fax-1; it is present in C. elegans, but not C. briggsae or other animals with completely-sequenced genomes. Analysis of the relatively unstudied nhr-111 and nhr-239 genes demonstrates that they are both expressed—nhr-111 very broadly and nhr-239 in a small subset of neurons. Analysis of the FAX-1 LBD in an in vivo assay revealed that it is not required for at least some developmental functions. Conclusions Our analysis supports three conserved clades of NR2E receptors, only two of which are represented in vertebrates, indicating three ancestral NR2E genes in the
Human factors methods in DOE nuclear facilities
International Nuclear Information System (INIS)
Bennett, C.T.; Banks, W.W.; Waters, R.J.
1993-01-01
The US Department of Energy (DOE) is in the process of developing a series of guidelines for the use of human factors standards, procedures, and methods to be used in nuclear facilities. This paper discusses the philosophy and process being used to develop a DOE human factors methods handbook to be used during the design cycle. The following sections will discuss: (1) basic justification for the project; (2) human factors design objectives and goals; and (3) role of human factors engineering (HFE) in the design cycle
Ligand and proton exchange dynamics in recombinant human myoglobin mutants.
Lambright, D G; Balasubramanian, S; Boxer, S G
1989-05-05
Site-specific mutants of human myoglobin have been prepared in which lysine 45 is replaced by arginine (K45R) and aspartate 60 by glutamate (D60E), in order to examine the influence of these residues and their interaction on the dynamics of the protein. These proteins were studied by a variety of methods, including one and two-dimensional proton nuclear magnetic resonance spectroscopy, exchange kinetics for the distal and proximal histidine NH protons as a function of pH in the met cyano forms, flash photolysis of the CO forms, and ligand replacement kinetics. The electronic absorption and proton nuclear magnetic resonance spectra of the CO forms of these proteins are virtually identical, indicating that the structure of the heme pocket is unaltered by these mutations. There are, however, substantial changes in the dynamics of both CO binding and proton exchange for the mutant K45R, whereas the mutant D60E exhibits behavior indistinguishable from the reference human myoglobin. K45R has a faster CO bimolecular recombination rate and slower CO off-rate relative to the reference. The kinetics for CO binding are independent of pH (6.5 to 10) as well as ionic strength (0 to 1 M-NaCl). The exchange rate for the distal histidine NH is substantially lower for K45R than the reference, whereas the proximal histidine NH exchange rate is unaltered. The exchange behavior of the human proteins is similar to that reported for a comparison of the exchange rates for myoglobins having lysine at position 45 with sperm whale myoglobin, which has arginine at this position. This indicates that the differences in exchange rates reflects largely the Lys----Arg substitution. The lack of a simple correlation for the CO kinetics with this substitution means that these are sensitive to other factors as well. Specific kinetic models, whereby substitution of arginine for lysine at position 45 can affect ligand binding dynamics, are outlined. These experiments demonstrate that a relatively
Effects of extracellular magnesium on the differentiation and function of human osteoclasts.
Wu, Lili; Luthringer, Bérengère J C; Feyerabend, Frank; Schilling, Arndt F; Willumeit, Regine
2014-06-01
Magnesium-based implants have been shown to influence the surrounding bone structure. In an attempt to partially reveal the cellular mechanisms involved in the remodelling of magnesium-based implants, the influence of increased extracellular magnesium content on human osteoclasts was studied. Peripheral blood mononuclear cells were driven towards an osteoclastogenesis pathway via stimulation with receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor for 28 days. Concomitantly, the cultures were exposed to variable magnesium concentrations (from either magnesium chloride or magnesium extracts). Osteoclast proliferation and differentiation were evaluated based on cell metabolic activity, total protein content, tartrate-resistant acid phosphatase activity, cathepsin K and calcitonin receptor immunocytochemistry, and cellular ability to form resorption pits. While magnesium chloride first enhanced and then opposed cell proliferation and differentiation in a concentration-dependent manner (peaking between 10 and 15mM magnesium chloride), magnesium extracts (with lower magnesium contents) appeared to decrease cell metabolic activity (≈50% decrease at day 28) while increasing osteoclast activity at a lower concentration (twofold higher). Together, the results indicated that (i) variations in the in vitro extracellular magnesium concentration affect osteoclast metabolism and (ii) magnesium extracts should be used preferentially in vitro to more closely mimic the in vivo environment. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Giridhar, J.; Rathinavelu, A.; Isom, G.E.
1990-01-01
ANF is a peptide hormone secreted by the heart and produces potent diuresis and vascular smooth muscle relaxation. It is well known that Cd produces cardiovascular toxicity and is implicated in the pathogenesis of hypertension. Hence the effects of Cd on ANF receptor dynamics and ligand binding were studied in PC12 cells. Receptor internalization using 125 I-ANF as the ligand at 37 degree C displayed a decrease in endocytic rate constants (ERC) when either preincubated with Cd (500 μM for 30 min, ERC = 0.183/min) or coincubated with Cd (500 μM, ERC = 0.196) when compared to control value (ERC = 0.259/min). Ligand binding ( 125 I-ANF) was changed by Cd as reflected by a decrease in the number of binding sites/cell in both Cd preincubated (Kd = 3.81 x 10 -10 M, B max = 1 x 10 -10 M, binding sites/cell = 9333) and coincubated cells (Kd = 1.76 x 10 -10 M, B max = 3.92 x 10 -11 M, binding sites/cell = 5960) from control (Kd = 3.87 x 10 -10 M, B max = 9.58 x 10 -11 M, binding sites/cell = 12141). Photoaffinity labelling with 125 I-ANF as the ligand was used to measure receptor subtype binding. Coincubation of cells with Cd (500 μM) and ligand decreased both high and low mol. wt. receptor binding, whereas preincubation with Cd (500μM) for 60 min produced a slight decrease in binding of both receptor subtypes. These results indicate that the cardiovascular toxicity of Cd may be partially mediated by altered ANF receptor function
International Nuclear Information System (INIS)
Yoon, Hana; Oh, Young Taek; Lee, Jung Yeon; Choi, Ji Hyun; Lee, Ju Hie; Baik, Hyung Hwan; Kim, Sung Soo; Choe, Wonchae; Yoon, Kyung-Sik; Ha, Joohun; Kang, Insug
2008-01-01
AMP-activated protein kinase (AMPK) is a key regulator of energy homeostasis. Kainic acid (KA), a prototype excitotoxin is known to induce brain-derived neurotrophic factor (BDNF) in brain. In this study, we examined the role of AMPK in KA-induced BDNF expression in C6 glioma cells. We showed that KA and KA receptor agonist induced activation of AMPK and KA-induced AMPK activation was blocked by inhibition of Ca 2+ /calmodulin-dependent protein kinase kinase (CaMKK) β. We then showed that inhibition of AMPK by compound C, a selective inhibitor of AMPK, or small interfering RNA of AMPKα1 blocked KA-induced BDNF mRNA and protein expression. Inhibition of AMPK blocked KA-induced phosphorylation of CaMKII and I kappaB kinase (IKK) in C6 cells. Finally, we showed that inhibition of AMPK reduced DNA binding and transcriptional activation of nuclear factor-kappaB (NF-κB) in KA-treated cells. These results suggest that AMPK mediates KA-induced BDNF expression by regulating NF-κB activation
Ligand recognition by RAR and RXR receptors: binding and selectivity.
Sussman, Fredy; de Lera, Angel R
2005-10-06
Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.
Brennenstuhl, Heiko; Armento, Angela; Braczysnki, Anne Kristin; Mittelbronn, Michel; Naumann, Ulrike
2015-11-01
The inhibitor of nuclear factor kappa B zeta (IκBζ) is an atypical member of the IκB protein family. Its function in regulating the activity of the transcription factor nuclear factor kappa B (NFκB) as well as its involvement in cancer-associated processes is poorly understood. In glioma patients, enhanced expression of IκBζ in tumor specimen is associated with poor prognosis. Here we report that IκBζ is upregulated in a glioma cell line resistant towards NFκB-dependent non-apoptotic cell death. Upon γ-irradiation of glioma cells, IκBζ expression is enhanced, and subsequently serves as a transcriptional activator of the tumor promoting cytokines interleukin (IL-6), IL-8 and chemokine (C-X-C motif) ligand 1 (CXCL1) that are known to be involved in glioma associated inflammatory processes. In contrast, shRNA-mediated knockdown of IκBζ reduces the expression of the aforementioned cytokines. We propose a previously unappreciated role of IκBζ in the inflammatory micromilieu as well as progression in glioma.
Nuclear modification factor for J/ψ production in nucleus-nucleus collisions
International Nuclear Information System (INIS)
Xu Xiaoming; Zhou Jie
2011-01-01
The STAR Collaboration has offered an eminent nuclear modification factor of J/ψ at high p T and midrapidity produced in Cu-Cu collisions at √ s NN= 200 GeV. Recalling a prediction, we can understand that the feature of high-p T nuclear modification factor is related to cc produced by 2 → 1 and 2 → 2 partonic processes in deconfined matter, particularly in the prethermal stage and to the recombination of c and c-bar. The nuclear modification factor at high p T is sensitive to the earliest form of deconfined matter that does not have a temperature.(authors)
Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡
Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.
2013-01-01
We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163
Goto, Tsuyoshi; Kim, Young-Il; Takahashi, Nobuyuki; Kawada, Teruo
2013-01-01
Obesity causes excess fat accumulation in various tissues, most notoriously in the adipose tissue, along with other insulin-responsive organs such as skeletal muscle and the liver, which predisposes an individual to the development of metabolic abnormalities. The molecular mechanisms underlying obesity-induced metabolic abnormalities have not been completely elucidated; however, in recent years, the search for therapies to prevent the development of obesity and obesity-associated metabolic disorders has increased. It is known that several nuclear receptors, when activated by specific ligands, regulate carbohydrate and lipid metabolism at the transcriptional level. The expression of lipid metabolism-related enzymes is directly regulated by the activity of various nuclear receptors via their interaction with specific response elements in promoters of those genes. Many natural compounds act as ligands of nuclear receptors and regulate carbohydrate and lipid metabolism by regulating the activities of these nuclear receptors. In this review, we describe our current knowledge of obesity, the role of lipid-sensing nuclear receptors in energy metabolism, and several examples of food factors that act as agonists or antagonists of nuclear receptors, which may be useful for the management of obesity and the accompanying energy metabolism abnormalities. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Research of human factor in nuclear power plants
International Nuclear Information System (INIS)
Nopp, I.
1983-01-01
The question is discussed of the study of the human factor with regard to the reliability of nuclear power plant operation. The reliability of the human factor is the result of the functional fitness, motivation, working conditions and working regime of personnel. (J.B.)
Ravindranath, Pradeep Anand; Sanner, Michel F.
2016-01-01
Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702
Human factor engineering applied to nuclear power plant design
International Nuclear Information System (INIS)
Manrique, A.; Valdivia, J.C.; Jimenez, A.
2001-01-01
For the design and construction of new nuclear power plants as well as for maintenance and operation of the existing ones new man-machine interface designs and modifications are been produced. For these new designs Human Factor Engineering must be applied the same as for any other traditional engineering discipline. Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. Additionally, the big saving achieved by a nuclear power plant having an operating methodology which significantly decreases the risk of operating errors makes it necessary and almost vital its implementation. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. (author)
Nuclear translocation of the cytoplasmic domain of HB-EGF induces gastric cancer invasion
Directory of Open Access Journals (Sweden)
Shimura Takaya
2012-05-01
Full Text Available Abstract Background Membrane-anchored heparin-binding epidermal growth factor-like growth factor (proHB-EGF yields soluble HB-EGF, which is an epidermal growth factor receptor (EGFR ligand, and a carboxy-terminal fragment of HB-EGF (HB-EGF-CTF after ectodomain shedding. We previously reported that HB-EGF-CTF and unshed proHB-EGF which has the cytoplasmic domain of proHB-EGF (HB-EGF-C, translocate from the plasma membrane to the nucleus and regulate cell cycle after shedding stimuli. However, the significance of nuclear exported HB-EGF-C in human gastric cancer is unclear. Methods We investigated the relationship between intracellular localization of HB-EGF-C and clinical outcome in 96 gastric cancer patients treated with gastrectomy. Moreover, we established stable gastric cancer cell lines overexpressing wild-type HB-EGF (wt-HB-EGF and mutated HB-EGF (HB-EGF-mC, which prevented HB-EGF-C nuclear translocation after shedding. Cell motility between these 2 gastric cancer cell lines was investigated using a transwell invasion assay and a wound healing assay. Results Of the 96 gastric cancer cases, HB-EGF-C immunoreactivity was detected in both the nucleus and cytoplasm in 19 cases (19.8 % and in the cytoplasm only in 25 cases (26.0 %. The nuclear immunoreactivity of HB-EGF-C was significantly increased in stage pT3/4 tumors compared with pT1/2 tumors (T1/2 vs. T3/4: 11.1 % vs. 36.4 %, P Conclusions Both the function of HB-EGF as an EGFR ligand and a novel signal for HB-EGF-C nuclear translocation induce gastric cancer growth, whereas HB-EGF-C nuclear translocation independently plays a critical role in gastric cancer invasion. The present study demonstrated that HB-EGF-C nuclear translocation might be crucial in gastric cancer invasion. HB-EGF-C nuclear translocation may offer a prognostic marker and a new molecular target for gastric cancer therapy.
Force loading explains spatial sensing of ligands by cells
Oria, Roger; Wiegand, Tina; Escribano, Jorge; Elosegui-Artola, Alberto; Uriarte, Juan Jose; Moreno-Pulido, Cristian; Platzman, Ilia; Delcanale, Pietro; Albertazzi, Lorenzo; Navajas, Daniel; Trepat, Xavier; García-Aznar, José Manuel; Cavalcanti-Adam, Elisabetta Ada; Roca-Cusachs, Pere
2017-12-01
Cells can sense the density and distribution of extracellular matrix (ECM) molecules by means of individual integrin proteins and larger, integrin-containing adhesion complexes within the cell membrane. This spatial sensing drives cellular activity in a variety of normal and pathological contexts. Previous studies of cells on rigid glass surfaces have shown that spatial sensing of ECM ligands takes place at the nanometre scale, with integrin clustering and subsequent formation of focal adhesions impaired when single integrin-ligand bonds are separated by more than a few tens of nanometres. It has thus been suggested that a crosslinking ‘adaptor’ protein of this size might connect integrins to the actin cytoskeleton, acting as a molecular ruler that senses ligand spacing directly. Here, we develop gels whose rigidity and nanometre-scale distribution of ECM ligands can be controlled and altered. We find that increasing the spacing between ligands promotes the growth of focal adhesions on low-rigidity substrates, but leads to adhesion collapse on more-rigid substrates. Furthermore, disordering the ligand distribution drastically increases adhesion growth, but reduces the rigidity threshold for adhesion collapse. The growth and collapse of focal adhesions are mirrored by, respectively, the nuclear or cytosolic localization of the transcriptional regulator protein YAP. We explain these findings not through direct sensing of ligand spacing, but by using an expanded computational molecular-clutch model, in which individual integrin-ECM bonds—the molecular clutches—respond to force loading by recruiting extra integrins, up to a maximum value. This generates more clutches, redistributing the overall force among them, and reducing the force loading per clutch. At high rigidity and high ligand spacing, maximum recruitment is reached, preventing further force redistribution and leading to adhesion collapse. Measurements of cellular traction forces and actin flow speeds
Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun
2010-02-05
Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.
Nuclear energy - stabilising factor in the world economy
International Nuclear Information System (INIS)
Legassov, V.; Feoktistov, L.; Kouzmine, I.
1986-01-01
One of the most important factors for international stability is the development of the economy, reducing the risk of local armed conflicts which could escalate into world-wide nuclear war. Economic progress which plays such a vital part is in turn heavily dependent on energy supplies. The article takes a brief look at the role of nuclear power in this context. (B.M.S.)
Human Factors in Nuclear Reactor Accidents
International Nuclear Information System (INIS)
Mustafa, M.E.
2016-01-01
While many people would blame nature for the disaster of the “Fukushima Daiichi” accident, experts considered this accident to be also a human-induced disaster. This confirmed the importance of human errors which have been getting a growing interest in the nuclear field after the Three Mile Island accident. Personnel play an important role in design, operation, maintenance, planning, and management. The interface between machine and man is known as a human factor. In the present work, the human factors that have to be considered were discussed. The effect of the control room configuration and equipment design effect on the human behavior was also discussed. Precise reviewing of person’s qualifications and experience was focused. Insufficient training has been a major cause of human error in the nuclear field. The effective training issues were introduced. Avoiding complicated operational processes and non responsive management systems was stressed. Distinguishing between the procedures for normal and emergency operations was emphasised. It was stated that human error during maintenance and testing activities could cause a serious accident. This is because safety systems do not cover much more risk probabilities in the maintenance and testing activities like they do in the normal operation. In nuclear industry, the need for a classification and identification of human errors has been well recognised. As a result of this, human reliability must be assessed. These errors are analyzed by a probabilistic safety assessment which deals with errors in reading, listening and implementing procedures but not with cognitive errors. Much efforts must be accomplished to consider cognitive errors in the probabilistic safety assessment. The ways of collecting human factor data were surveyed. The methods for identifying safe designs, helping decision makers to predict how proposed or current policies will affect safety, and comprehensive understanding of the relationship
Macrophage fusion is controlled by the cytoplasmic protein tyrosine phosphatase PTP-PEST/PTPN12.
Rhee, Inmoo; Davidson, Dominique; Souza, Cleiton Martins; Vacher, Jean; Veillette, André
2013-06-01
Macrophages can undergo cell-cell fusion, leading to the formation of multinucleated giant cells and osteoclasts. This process is believed to promote the proteolytic activity of macrophages toward pathogens, foreign bodies, and extracellular matrices. Here, we examined the role of PTP-PEST (PTPN12), a cytoplasmic protein tyrosine phosphatase, in macrophage fusion. Using a macrophage-targeted PTP-PEST-deficient mouse, we determined that PTP-PEST was not needed for macrophage differentiation or cytokine production. However, it was necessary for interleukin-4-induced macrophage fusion into multinucleated giant cells in vitro. It was also needed for macrophage fusion following implantation of a foreign body in vivo. Moreover, in the RAW264.7 macrophage cell line, PTP-PEST was required for receptor activator of nuclear factor kappa-B ligand (RANKL)-triggered macrophage fusion into osteoclasts. PTP-PEST had no impact on expression of fusion mediators such as β-integrins, E-cadherin, and CD47, which enable macrophages to become fusion competent. However, it was needed for polarization of macrophages, migration induced by the chemokine CC chemokine ligand 2 (CCL2), and integrin-induced spreading, three key events in the fusion process. PTP-PEST deficiency resulted in specific hyperphosphorylation of the protein tyrosine kinase Pyk2 and the adaptor paxillin. Moreover, a fusion defect was induced upon treatment of normal macrophages with a Pyk2 inhibitor. Together, these data argue that macrophage fusion is critically dependent on PTP-PEST. This function is seemingly due to the ability of PTP-PEST to control phosphorylation of Pyk2 and paxillin, thereby regulating cell polarization, migration, and spreading.
Review of EPRI Nuclear Human Factors Program
International Nuclear Information System (INIS)
Hanes, L.F.; O'Brien, J.F.
1996-01-01
The Electric Power Research Institute (EPRI) Human Factors Program, which is part of the EPRI Nuclear Power Group, was established in 1975. Over the years, the Program has changed emphasis based on the shifting priorities and needs of the commercial nuclear power industry. The Program has produced many important products that provide significant safety and economic benefits for EPRI member utilities. This presentation will provide a brief history of the Program and products. Current projects and products that have been released recently will be mentioned
Nuclear Regulatory Commission Human Factors Program Plan. Revision 2
International Nuclear Information System (INIS)
1986-04-01
This document is the Second Annual Revision to the NRC Human Factors Program Plan. The first edition was published in August 1983. Revision 1 was published in July of 1984. Purpose of the NRC Human Factors Program is to ensure that proper consideration is given to human factors in the design and operation of nuclear power plants. This document describes the plans of the Office of Nuclear Reactor Regulation to address high priority human factors concerns of importance to reactor safety in FY 1986 and FY 1987. Revision 2 of the plan incorporates recent Commission decisions and policies bearing on the human factors aspects of reactor safety regulation. With a few exceptions, the principal changes from prior editions reflect a shift from developing new requirements to staff evaluation of industry progress in resolving human factors issues. The plan addresses seven major program elements: (1) Training, (2) Licensing Examinations, (3) Procedures, (4) Man-Machine Interface, (5) Staffing and Qualifications, (6) Management and Organization, and (7) Human Performance
Ligand Depot: a data warehouse for ligands bound to macromolecules.
Feng, Zukang; Chen, Li; Maddula, Himabindu; Akcan, Ozgur; Oughtred, Rose; Berman, Helen M; Westbrook, John
2004-09-01
Ligand Depot is an integrated data resource for finding information about small molecules bound to proteins and nucleic acids. The initial release (version 1.0, November, 2003) focuses on providing chemical and structural information for small molecules found as part of the structures deposited in the Protein Data Bank. Ligand Depot accepts keyword-based queries and also provides a graphical interface for performing chemical substructure searches. A wide variety of web resources that contain information on small molecules may also be accessed through Ligand Depot. Ligand Depot is available at http://ligand-depot.rutgers.edu/. Version 1.0 supports multiple operating systems including Windows, Unix, Linux and the Macintosh operating system. The current drawing tool works in Internet Explorer, Netscape and Mozilla on Windows, Unix and Linux.
Personality Factors and Nuclear Power Plant Operators: Initial License Success
DeVita-Cochrane, Cynthia
Commercial nuclear power utilities are under pressure to effectively recruit and retain licensed reactor operators in light of poor candidate training completion rates and recent candidate failures on the Nuclear Regulatory Commission (NRC) license exam. One candidate failure can cost a utility over $400,000, making the successful licensing of new operators a critical path to operational excellence. This study was designed to discover if the NEO-PI-3, a 5-factor measure of personality, could improve selection in nuclear utilities by identifying personality factors that predict license candidate success. Two large U.S. commercial nuclear power corporations provided potential participant contact information and candidate results on the 2014 NRC exam from their nuclear power units nation-wide. License candidates who participated (n = 75) completed the NEO-PI-3 personality test and results were compared to 3 outcomes on the NRC exam: written exam, simulated operating exam, and overall exam result. Significant correlations were found between several personality factors and both written and operating exam outcomes on the NRC exam. Further, a regression analysis indicated that personality factors, particularly Conscientiousness, predicted simulated operating exam scores. The results of this study may be used to support the use of the NEO-PI-3 to improve operator selection as an addition to the current selection protocol. Positive social change implications from this study include support for the use of a personality measure by utilities to improve their return-on-investment in candidates and by individual candidates to avoid career failures. The results of this study may also positively impact the public by supporting the safe and reliable operation of commercial nuclear power utilities in the United States.
Using chemical shift perturbation to characterise ligand binding.
Williamson, Mike P
2013-08-01
Chemical shift perturbation (CSP, chemical shift mapping or complexation-induced changes in chemical shift, CIS) follows changes in the chemical shifts of a protein when a ligand is added, and uses these to determine the location of the binding site, the affinity of the ligand, and/or possibly the structure of the complex. A key factor in determining the appearance of spectra during a titration is the exchange rate between free and bound, or more specifically the off-rate koff. When koff is greater than the chemical shift difference between free and bound, which typically equates to an affinity Kd weaker than about 3μM, then exchange is fast on the chemical shift timescale. Under these circumstances, the observed shift is the population-weighted average of free and bound, which allows Kd to be determined from measurement of peak positions, provided the measurements are made appropriately. (1)H shifts are influenced to a large extent by through-space interactions, whereas (13)Cα and (13)Cβ shifts are influenced more by through-bond effects. (15)N and (13)C' shifts are influenced both by through-bond and by through-space (hydrogen bonding) interactions. For determining the location of a bound ligand on the basis of shift change, the most appropriate method is therefore usually to measure (15)N HSQC spectra, calculate the geometrical distance moved by the peak, weighting (15)N shifts by a factor of about 0.14 compared to (1)H shifts, and select those residues for which the weighted shift change is larger than the standard deviation of the shift for all residues. Other methods are discussed, in particular the measurement of (13)CH3 signals. Slow to intermediate exchange rates lead to line broadening, and make Kd values very difficult to obtain. There is no good way to distinguish changes in chemical shift due to direct binding of the ligand from changes in chemical shift due to allosteric change. Ligand binding at multiple sites can often be characterised, by
Quality management in the nuclear industry: the human factor
International Nuclear Information System (INIS)
1990-01-01
In the nuclear industry it is vital to understand the 'human factor' with regard to plant performance and plant safety. A proper management system ensures that personnel perform their duties correctly. 'Quality Management in the Nuclear Industry: the Human Factor', was a conference organized by the Institution of Mechanical Engineers in October 1990. The conference covered a wide range of topics on an international level including: standards, licensing and regulatory procedures; selection assessment and training of personnel; feedback from experience of good practice and of deviations; management and support of personnel performance; modelling and evaluation of human factors. The papers presented at the conference are contained in this volume. All twenty papers are indexed separately. (author)
International Nuclear Information System (INIS)
Dietz, Marina S; Haße, Daniel; Ferraris, Davide M; Göhler, Antonia; Niemann, Hartmut H; Heilemann, Mike
2013-01-01
The human receptor tyrosine kinase MET and its ligand hepatocyte growth factor/scatter factor are essential during embryonic development and play an important role during cancer metastasis and tissue regeneration. In addition, it was found that MET is also relevant for infectious diseases and is the target of different bacteria, amongst them Listeria monocytogenes that induces bacterial uptake through the surface protein internalin B. Binding of ligand to the MET receptor is proposed to lead to receptor dimerization. However, it is also discussed whether preformed MET dimers exist on the cell membrane. To address these issues we used single-molecule fluorescence microscopy techniques. Our photobleaching experiments show that MET exists in dimers on the membrane of cells in the absence of ligand and that the proportion of MET dimers increases significantly upon ligand binding. Our results indicate that partially preformed MET dimers may play a role in ligand binding or MET signaling. The addition of the bacterial ligand internalin B leads to an increase of MET dimers which is in agreement with the model of ligand-induced dimerization of receptor tyrosine kinases.
Troib, Ariel; Guterman, Mayan; Rabkin, Ralph; Landau, Daniel; Segev, Yael
2016-08-01
Childhood chronic kidney disease (CKD) is associated with both short stature and abnormal bone mineralization. Normal longitudinal growth depends on proper maturation of epiphyseal growth plate (EGP) chondrocytes, leading to the formation of trabecular bone in the primary ossification centre. We have recently shown that linear growth impairment in CKD is associated with impaired EGP growth hormone (GH) receptor signalling and that exercise improved insulin-like growth factor I (IGF-I) signalling in CKD-related muscle atrophy. In this study, 20-day-old rats underwent 5/6 nephrectomy (CKD) or sham surgery (C) and were exercised with treadmill, with or without GH supplementation. CKD-related growth retardation was associated with a widened EGP hypertrophic zone. This was not fully corrected by exercise (except for tibial length). Exercise in CKD improved the expression of EGP key factors of endochondral ossification such as IGF-I, vascular endothelial growth factor (VEGF), receptor activator of nuclear factor kappa-B ligand (RANKL) and osteocalcin. Combining GH treatment with treadmill exercise for 2 weeks improved the decreased trabecular bone volume in CKD, as well as the expression of growth plate runt-related transcription factor 2, RANKL, metalloproteinase 13 and VEGF, while GH treatment alone could not do that. Treadmill exercise improves tibial bone linear growth, as well as growth plate local IGF-I. When combined with GH treatment, running exercise shows beneficial effects on trabecular bone formation, suggesting the potential benefit of this combination for CKD-related short stature and bone disease. © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.
Effects of PPARγ ligands on vascular tone.
Salomone, Salvatore; Drago, Filippo
2012-06-01
Peroxisome Proliferator-Activated Receptor γ (PPARγ), originally described as a transcription factor for genes of carbohydrate and lipid metabolism, has been more recently studied in the context of cardiovascular pathophysiology. Here, we review the available data on PPARγ ligands as modulator of vascular tone. PPARγ ligands include: thiazolidinediones (used in the treatment of type 2 diabetes mellitus), glitazars (bind and activate both PPARγ and PPARα), and other experimental drugs (still in development) that exploit the chemistry of thiazolidinediones as a scaffold for PPARγ-independent pharmacological properties. In this review, we examine both short (mostly from in vitro data)- and long (mostly from in vivo data)-term effects of PPARγ ligands that extend from PPARγ-independent vascular effects to PPARγ-dependent gene expression. Because endothelium is a master regulator of vascular tone, we have attempted to differentiate between endothelium-dependent and endothelium-independent effects of PPARγ ligands. Based on available data, we conclude that PPARγ ligands appear to influence vascular tone in different experimental paradigms, most often in terms of vasodilatation (potentially increasing blood flow to some tissues). These effects on vascular tone, although potentially beneficial, must be weighed against specific cardiovascular warnings that may apply to some drugs, such as rosiglitazone.
International Nuclear Information System (INIS)
Hopkins, C.O.; Snyder, H.L.; Price, H.E.; Hornick, R.J.; Mackie, R.R.; Smillie, R.J.; Sugarman, R.C.
1982-08-01
This comprehensive long-range human factors plan for nuclear reactor regulation was developed by a Study Group of the Human Factors Society, Inc. This Study Group was selected by the Executive Council of the Society to provide a balanced, experienced human factors perspective to the applications of human factors scientific and engineering knowledge to nuclear power generation. The report is presented in three volumes. Volume 1 contains an Executive Summary of the 18-month effort and its conclusions. Volume 2 summarizes all known nuclear-related human factors activities, evaluates these activities wherever adequate information is available, and describes the recommended long-range (10-year) plan for human factors in regulation. Volume 3 elaborates upon each of the human factors issues and areas of recommended human factors involvement contained in the plan, and discusses the logic that led to the recommendations
International Nuclear Information System (INIS)
Biswas, Arunima; Pasquel, Danielle; Tyagi, Rakesh Kumar; Mani, Sridhar
2011-01-01
Research highlights: → Pregnane X receptor (PXR), a major regulatory protein, is modified by acetylation. → PXR undergoes dynamic deacetylation upon ligand-mediated activation. → SIRT1 partially mediates PXR deacetylation. → PXR deacetylation per se induces lipogenesis mimicking ligand-mediated activation. -- Abstract: Pregnane X receptor (PXR), like other members of its class of nuclear receptors, undergoes post-translational modification [PTM] (e.g., phosphorylation). However, it is unknown if acetylation (a major and common form of protein PTM) is observed on PXR and, if it is, whether it is of functional consequence. PXR has recently emerged as an important regulatory protein with multiple ligand-dependent functions. In the present work we show that PXR is indeed acetylated in vivo. SIRT1 (Sirtuin 1), a NAD-dependent class III histone deacetylase and a member of the sirtuin family of proteins, partially mediates deacetylation of PXR. Most importantly, the acetylation status of PXR regulates its selective function independent of ligand activation.
Energy Technology Data Exchange (ETDEWEB)
McPherson, D.W.; Luo, H.; Knapp, F.F. Jr.
1994-06-01
Alterations in the density of acetylcholinergic muscarinic receptors (m-AChR) have been observed in various dementias. This has spurred interest in the development of radiohalogenated ligands which can be used for the non-invasive in vivo detection of m-AChR by nuclear medicine techniques. We have developed a new ligand 1-azabicyclo[2.2.2]oct-3-yl ({alpha}-hydroxy-{alpha}-(1-iodo-1-propen-3-yl)-{alpha}-phenylacetate (IQNP,12) which demonstrates high affinity for the muscarinic receptor. When labeled with radioiodine it has been shown to be selective and specific for m-ACHR. Initial studies on the separation and in vivo evaluation of the various isomers of IQNP have shown that the stereochemistry of the chiral centers and the configuration around the double bond play an important role in m-AChR subtype specificity. In vivo evaluation of these stereoisomers demonstrate that E-(R,R)-IQNP has a high affinity for the M{sub 1} muscarinic subtype while Z-(R,R)-IQNP demonstrate a high affinity for M{sub 1} and M{sub 2} receptor subtypes. These data demonstrate IQNP (12) has potential for use in the non-evasive in vivo detection of m-AChR by single photon emission computed tomography (SPECT). A brominated analogue, ``BrQNP,`` in which the iodine has been replaced by a bromine atom, has also been prepared and was shown to block the in vivo uptake of IQNP in the brain and heart and therefore has potential for positron emission tomographic (PET) studies of m-AChR.
Finkernagel, Florian; Lieber, Sonja; Schnitzer, Evelyn; Legrand, Nathalie; Schober, Yvonne; Nockher, W. Andreas; Toth, Philipp M.; Diederich, Wibke E.; Nist, Andrea; Stiewe, Thorsten; Wagner, Uwe; Reinartz, Silke; Müller-Brüsselbach, Sabine; Müller, Rolf
2015-01-01
The nuclear receptor peroxisome proliferator-activated receptor β/δ (PPARβ/δ) is a lipid ligand-inducible transcription factor associated with macrophage polarization. However, its function in tumor-associated macrophages (TAMs) has not been investigated to date. Here, we report the PPARβ/δ-regulated transcriptome and cistrome for TAMs from ovarian carcinoma patients. Comparison with monocyte-derived macrophages shows that the vast majority of direct PPARβ/δ target genes are upregulated in TAMs and largely refractory to synthetic agonists, but repressible by inverse agonists. Besides genes with metabolic functions, these include cell type-selective genes associated with immune regulation and tumor progression, e.g., LRP5, CD300A, MAP3K8 and ANGPTL4. This deregulation is not due to increased expression of PPARβ/δ or its enhanced recruitment to target genes. Instead, lipidomic analysis of malignancy-associated ascites revealed high concentrations of polyunsaturated fatty acids, in particular linoleic acid, acting as potent PPARβ/δ agonists in macrophages. These fatty acid ligands accumulate in lipid droplets in TAMs, thereby providing a reservoir of PPARβ/δ ligands. These observations suggest that the deregulation of PPARβ/δ target genes by ligands of the tumor microenvironment contributes to the pro-tumorigenic polarization of ovarian carcinoma TAMs. This conclusion is supported by the association of high ANGPTL4 expression with a shorter relapse-free survival in serous ovarian carcinoma. PMID:25968567
Human factors guidelines for nuclear power plant applications
International Nuclear Information System (INIS)
Ketchel, J.
1993-01-01
In 1989, Waters et al. reported to the Human Factors Society on developing human factors criteria for a new reactor plant. They correctly indicated that much of the guidance documentation in human factors engineering has derived from MIL-STD-1472 and its antecedents. Guidelines for human-computer interface have sprung primarily from the Smith and Mosier compendium and its source documents. NUREG-0700, which is currently being updated, was developed by the US Nuclear Regulatory Commission (NRC) as a general evaluation guide for inspecting control rooms. In addition, the Electric Power Research Institute, Institute of Nuclear Power Operations, US Department of Energy, the NRC, and others have published a number of specialized documents on a range of subjects. The number of guidelines and standards has grown in the past few years to an impressive number, including those published by international organizations and professional societies. This paper provides an update on current efforts to provide appropriate guidance for the power industry and, perhaps more importantly, offers a perspective on how users should think about using the available materials and what else is needed. The Electric Power Research Institute (EPRI) continues to be one of the principal participants in providing guidance to the utilities. Human factors guidelines is indeed a timely topic, currently of great interest to EPRI's constituents and to designers of new and upgraded nuclear power plants (NPMs) in the Advanced Light Water Reactor and the Instrumentation and Control Upgrade Initiative programs
Human factors design guidelines for maintainability of Department of Energy nuclear facilities
Energy Technology Data Exchange (ETDEWEB)
Bongarra, J.P. Jr.; VanCott, H.P.; Pain, R.F.; Peterson, L.R.; Wallace, R.I.
1985-06-18
Intent of these guidelines is to provide design and design review teams of DOE nuclear facilities with human factors principles to enhance the design and aid in the inspection of DOE nuclear facilities, systems, and equipment. These guidelines are concerned with design features of DOE nuclear facilities which can potentially affect preventive and corrective maintenance of systems within DOE nuclear facilities. Maintenance includes inspecting, checking, troubleshooting, adjusting, replacing, repairing, and servicing activities. Other factors which influence maintainability such as repair and maintenance suport facilities, maintenance information, and various aspects of the environment are also addressed.
Human factors design guidelines for maintainability of Department of Energy nuclear facilities
International Nuclear Information System (INIS)
Bongarra, J.P. Jr.; VanCott, H.P.; Pain, R.F.; Peterson, L.R.; Wallace, R.I.
1985-01-01
Intent of these guidelines is to provide design and design review teams of DOE nuclear facilities with human factors principles to enhance the design and aid in the inspection of DOE nuclear facilities, systems, and equipment. These guidelines are concerned with design features of DOE nuclear facilities which can potentially affect preventive and corrective maintenance of systems within DOE nuclear facilities. Maintenance includes inspecting, checking, troubleshooting, adjusting, replacing, repairing, and servicing activities. Other factors which influence maintainability such as repair and maintenance suport facilities, maintenance information, and various aspects of the environment are also addressed
Impact of protein and ligand impurities on ITC-derived protein-ligand thermodynamics.
Grüner, Stefan; Neeb, Manuel; Barandun, Luzi Jakob; Sielaff, Frank; Hohn, Christoph; Kojima, Shun; Steinmetzer, Torsten; Diederich, François; Klebe, Gerhard
2014-09-01
The thermodynamic characterization of protein-ligand interactions by isothermal titration calorimetry (ITC) is a powerful tool in drug design, giving valuable insight into the interaction driving forces. ITC is thought to require protein and ligand solutions of high quality, meaning both the absence of contaminants as well as accurately determined concentrations. Ligands synthesized to deviating purity and protein of different pureness were titrated by ITC. Data curation was attempted also considering information from analytical techniques to correct stoichiometry. We used trypsin and tRNA-guanine transglycosylase (TGT), together with high affinity ligands to investigate the effect of errors in protein concentration as well as the impact of ligand impurities on the apparent thermodynamics. We found that errors in protein concentration did not change the thermodynamic properties obtained significantly. However, most ligand impurities led to pronounced changes in binding enthalpy. If protein binding of the respective impurity is not expected, the actual ligand concentration was corrected for and the thus revised data compared to thermodynamic properties obtained with the respective pure ligand. Even in these cases, we observed differences in binding enthalpy of about 4kJ⋅mol(-1), which is considered significant. Our results indicate that ligand purity is the critical parameter to monitor if accurate thermodynamic data of a protein-ligand complex are to be recorded. Furthermore, artificially changing fitting parameters to obtain a sound interaction stoichiometry in the presence of uncharacterized ligand impurities may lead to thermodynamic parameters significantly deviating from the accurate thermodynamic signature. Copyright © 2014 Elsevier B.V. All rights reserved.
Affinity purification using recombinant PXR as a tool to characterize environmental ligands.
Dagnino, Sonia; Bellet, Virginie; Grimaldi, Marina; Riu, Anne; Aït-Aïssa, Sélim; Cavaillès, Vincent; Fenet, Hélène; Balaguer, Patrick
2014-02-01
Many environmental endocrine disrupting compounds act as ligands for nuclear receptors. The human pregnane X receptor (hPXR), for instance, is activated by a variety of environmental ligands such as steroids, pharmaceutical drugs, pesticides, alkylphenols, polychlorinated biphenyls and polybromo diethylethers. Some of us have previously reported the occurrence of hPXR ligands in environmental samples but failed to identify them. The aim of this study was to test whether a PXR-affinity column, in which recombinant hPXR was immobilized on solid support, could help the purification of these chemicals. Using PXR ligands of different affinity (10 nM < EC50 < 10 μM), we demonstrated that the PXR-affinity preferentially column captured ligands with medium to high affinities (EC50 < 1 μM). Furthermore, by using the PXR-affinity column to analyze an environmental sample containing ERα, AhR, AR, and PXR activities, we show that (i) half of the PXR activity of the sample was due to compounds with medium to high affinity for PXR and (ii) PXR shared ligands with ERα, AR, and AhR. These findings demonstrate that the newly developed PXR-affinity column coupled to reporter cell lines represents a valuable tool for the characterization of the nature of PXR active compounds and should therefore guide and facilitate their further analysis. Copyright © 2012 Wiley Periodicals, Inc., a Wiley company.
Non-innocent Redox Behavior of Amidinato Ligands: Spectroscopic Evidence for Amidinyl Complexes
Czech Academy of Sciences Publication Activity Database
Ehret, F.; Bubrin, M.; Záliš, Stanislav; Kaim, W.
2014-01-01
Roč. 640, č. 14 (2014), s. 2781-2787 ISSN 0044-2313 Grant - others:COST(XE) CM1202 Institutional support: RVO:61388955 Keywords : Amidinato ligands * Non-innocent ligands * Ruthenium Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.160, year: 2014
Ligand induced shape transformation of thorium dioxide nanocrystals.
Wang, Gaoxue; Batista, Enrique R; Yang, Ping
2018-04-27
Nanocrystals (NCs) with size and shape dependent properties are a thriving research field. Remarkable progress has been made in the controlled synthesis of NCs of stable elements in the past two decades; however, the knowledge of the NCs of actinide compounds has been considerably limited due the difficulties in handling them both experimentally and theoretically. Actinide compounds, especially actinide oxides, play a critical role in many stages of the nuclear fuel cycle. Recently, a non-aqueous surfactant assisted approach has been developed for the synthesis of actinide oxide NCs with different morphologies, but an understanding of its control factors is still missing to date. Herein we present a comprehensive study on the low index surfaces of thorium dioxide (ThO2) and their interactions with relevant surfactant ligands using density functional calculations. A systematic picture on the thermodynamic stability of ThO2 NCs of different sizes and shapes is obtained employing empirical models based on the calculated surface energies. It is found that bare ThO2 NCs prefer the octahedral shape terminated by (111) surfaces. Oleic acid displays selective adsorption on the (110) surface, leading to the shape transformation from octahedrons to nanorods. Other ligands such as acetylacetone, oleylamine, and trioctylphosphine oxide do not modify the equilibrium shape of ThO2 NCs. This work provides atomic level insights into the anisotropic growth of ThO2 NCs that was recently observed in experiments, and thus may contribute to the controlled synthesis of actinide oxide NCs with well-defined size and shape for future applications.
Key Factors for Nuclear Being Economic after Fukushima
Energy Technology Data Exchange (ETDEWEB)
Roh, Myung Sub; Park, Seo Yeon [KEPCO International Nuclear Graduate School, Ulju (Korea, Republic of)
2012-05-15
It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc
Key Factors for Nuclear Being Economic after Fukushima
International Nuclear Information System (INIS)
Roh, Myung Sub; Park, Seo Yeon
2012-01-01
It is hard to overstate the importance of electricity to the standard of living and the quality of life in a country. Electricity demand grows with population and with the changing nature, level and composition of economic and social activity. Civilization, industrialization and urbanization are, of course, key factors. It, historically, has shown that each major nuclear accident has caused a re-examination of the risk of nuclear power leading to more stringent safety requirement and higher costs. The Fukushima accident and its likely impact on future nuclear power development are difficult to foresee. The accident was a tragedy for the people affected and seriously undermined public confidence in the safety of nuclear power. A number of countries announced reviews of their programs, some took steps toward phasing out nuclear power entirely, and others reemphasized their expansion plans. The Korean nuclear community is carry out many ambitious projects for last three decades continuously and facing the another challenges relating to the future nuclear power economics and difficulty in financing new investment. In order to meet the above economic objective, it is strongly recommended that great emphasis should be placed on maintaining the nuclear economics without jeopardizing safety such as design simplification, standardization, shortening of construction period, increased availability, etc
Nuclear receptors and nonalcoholic fatty liver disease1
Cave, Matthew C.; Clair, Heather B.; Hardesty, Josiah E.; Falkner, K. Cameron; Feng, Wenke; Clark, Barbara J.; Sidey, Jennifer; Shi, Hongxue; Aqel, Bashar A.; McClain, Craig J.; Prough, Russell A.
2016-01-01
Nuclear receptors are transcription factors which sense changing environmental or hormonal signals and effect transcriptional changes to regulate core life functions including growth, development, and reproduction. To support this function, following ligand-activation by xenobiotics, members of subfamily 1 nuclear receptors (NR1s) may heterodimerize with the retinoid X receptor (RXR) to regulate transcription of genes involved in energy and xenobiotic metabolism and inflammation. Several of these receptors including the peroxisome proliferator-activated receptors (PPARs), the pregnane and xenobiotic receptor (PXR), the constitutive androstane receptor (CAR), the liver X receptor (LXR) and the farnesoid X receptor (FXR) are key regulators of the gut:liver:adipose axis and serve to coordinate metabolic responses across organ systems between the fed and fasting states. Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease and may progress to cirrhosis and even hepatocellular carcinoma. NAFLD is associated with inappropriate nuclear receptor function and perturbations along the gut:liver:adipose axis including obesity, increased intestinal permeability with systemic inflammation, abnormal hepatic lipid metabolism, and insulin resistance. Environmental chemicals may compound the problem by directly interacting with nuclear receptors leading to metabolic confusion and the inability to differentiate fed from fasting conditions. This review focuses on the impact of nuclear receptors in the pathogenesis and treatment of NAFLD. Clinical trials including PIVENS and FLINT demonstrate that nuclear receptor targeted therapies may lead to the paradoxical dissociation of steatosis, inflammation, fibrosis, insulin resistance, dyslipidemia and obesity. Novel strategies currently under development (including tissue-specific ligands and dual receptor agonists) may be required to separate the beneficial effects of nuclear receptor activation from unwanted metabolic
Human factors aspects of advanced instrumentation in the nuclear industry
International Nuclear Information System (INIS)
Carter, R.J.
1989-01-01
An important consideration in regards to the use of advanced instrumentation in the nuclear industry is the interface between the instrumentation system and the human. A survey, oriented towards identifying the human factors aspects of digital instrumentation, was conducted at a number of United States (US) and Canadian nuclear vendors and utilities. Human factors issues, subsumed under the categories of computer-generated displays, controls, organizational support, training, and related topics were identified. 20 refs., 2 tabs
Factor Analysis and Framework Development for Incorporating Public Trust on Nuclear Safety issues
Energy Technology Data Exchange (ETDEWEB)
Cho, Seongkyung; Lee, Gyebong [The Myongji Univ., Seoul (Korea, Republic of); Lee, Gihyung; Lee, Gyehwi; Jeong, Jina [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)
2014-05-15
The Korea Institute of Nuclear Safety (KINS), a regulatory expert organization in charge of nuclear safety in Korea, realized that a more fundamental and systematic analysis of activities is needed to actively meet the greater variety of concerns people have and increase the reliability of the results of regulation. Nuclear safety, a highly specialized field, has previously been discussed primarily from the viewpoint of the engineers who deal with the technology, but now 'public trust in nuclear safety' has to be viewed from the standpoint of the general public and from the socio-cultural perspective. Specific measures must be taken to examine which factors affect public trust and how we can secure and reproduce those factors to gain it. Also, an efficient system for incorporating public trust in nuclear safety must be established. In this study, various case studies were examined to identify the factors that affect public trust in nuclear safety. First, nuclear safety laws and information disclosure systems of major countries were examined by investigating data and conducting in-depth interviews. To explore a public framework concerning nuclear safety, big data of social media were analyzed. Also, Q methodology was used to analyze the risk schemata of the opinion leaders living in areas near nuclear power plants. Several surveys were conducted to analyze the amount of trust the public had in nuclear safety as well as their awareness of nuclear safety issues. Based on these analyses, factors affecting public trust in nuclear safety were extracted, and measures to build systems incorporating public trust in nuclear safety were proposed. This study addresses the public trust in nuclear safety on condition that the safety is ensured technically and mechanically.
Factor Analysis and Framework Development for Incorporating Public Trust on Nuclear Safety issues
International Nuclear Information System (INIS)
Cho, Seongkyung; Lee, Gyebong; Lee, Gihyung; Lee, Gyehwi; Jeong, Jina
2014-01-01
The Korea Institute of Nuclear Safety (KINS), a regulatory expert organization in charge of nuclear safety in Korea, realized that a more fundamental and systematic analysis of activities is needed to actively meet the greater variety of concerns people have and increase the reliability of the results of regulation. Nuclear safety, a highly specialized field, has previously been discussed primarily from the viewpoint of the engineers who deal with the technology, but now 'public trust in nuclear safety' has to be viewed from the standpoint of the general public and from the socio-cultural perspective. Specific measures must be taken to examine which factors affect public trust and how we can secure and reproduce those factors to gain it. Also, an efficient system for incorporating public trust in nuclear safety must be established. In this study, various case studies were examined to identify the factors that affect public trust in nuclear safety. First, nuclear safety laws and information disclosure systems of major countries were examined by investigating data and conducting in-depth interviews. To explore a public framework concerning nuclear safety, big data of social media were analyzed. Also, Q methodology was used to analyze the risk schemata of the opinion leaders living in areas near nuclear power plants. Several surveys were conducted to analyze the amount of trust the public had in nuclear safety as well as their awareness of nuclear safety issues. Based on these analyses, factors affecting public trust in nuclear safety were extracted, and measures to build systems incorporating public trust in nuclear safety were proposed. This study addresses the public trust in nuclear safety on condition that the safety is ensured technically and mechanically
The human factor and organization to support nuclear power plant operators
International Nuclear Information System (INIS)
Naumov, V.I.
1993-01-01
Analysis reveals three basic factors which affect the safety of nuclear power reactors: (1) Internal physical properties of the reactor which provide self protection under breakdown and accident conditions; (2) The reliability of technical systems which provide monitoring, control, accident prevention, heat release, and localization of hazardous products during accidents; (3) Reliability of the reactor control personnel. The last of these factors is usually called the human factor. From published data, this factor makes a large contribution to the downtime and accident statistics at nuclear power plants: from 30 to 80% in various countries. Today the importance of the human factor in operating a nuclear power units is rather well recognized. Current ideas on how to increase the reliability of a human operator are reflected in IAEA recommendations and domestic official documents. The concept of 'a culture of safety' is introduced. Basic types of actions to increase the reliability of personnel who control a nuclear reactor are discussed, including: (1) The qualifying and psychological selection and the training of candidates on the operator's obligations. (2) The automation of routine operations which do not require the operator's intellect. (3) Perfecting the work place, information input to the operator, and the organization of the controls
International Nuclear Information System (INIS)
Kumar, Abhinav; Chiu, Hsiu-Ju; Axelrod, Herbert L.; Morse, Andrew; Elsliger, Marc-André; Wilson, Ian A.; Deacon, Ashley
2010-01-01
A survey of the types and frequency of ligands that are bound to PSI structures is analyzed as well as their utility in functional annotation of previously uncharacterized proteins. Approximately 65% of PSI structures report some type of ligand(s) that is bound in the crystal structure. Here, a description is given of how such ligands are handled and analyzed at the JCSG and a survey of the types, variety and frequency of ligands that are observed in the PSI structures is also compiled and analyzed, including illustrations of how these bound ligands have provided functional clues for annotation of proteins with little or no previous experimental characterization. Furthermore, a web server was developed as a tool to mine and analyze the PSI structures for bound ligands and other identifying features
International Nuclear Information System (INIS)
Hopkins, C.O.; Snyder, H.L.; Price, H.E.; Hornick, R.J.; Mackie, R.R.; Smillie, R.J.; Sugarman, R.C.
1982-08-01
This comprehensive long-range human factors plan for nuclear reactor regulation was developed by a Study Group of the Human Factors Society, Inc. This Study Group was selected by the Executive Council of the Society to provide a balanced, experienced human factors perspective to the applications of human factors scientific and engineering knowledge to nuclear power generation. The report is presented in three volumes. Volume 1 contains an Executive Summary of the 18-month effort and its conclusions. Volume 2 summarizes all known nuclear-related human factors activities, evaluates these activities wherever adequate information is available, and describes the recommended long-range (10-year) plan for human factors in regulation. Volume 3 elaborates upon each of the human factors issues and areas of recommended human factors involvement contained in the plan, and discusses the logic that led to the recommendations
Polymorphisms in NFkB, PXR, LXR and risk of colorectal cancer in a prospective study of Danes
International Nuclear Information System (INIS)
Andersen, Vibeke; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla
2010-01-01
Transcription factors and nuclear receptors constitute a link between exposure to heterocyclic amines and polycyclic aromatic hydrocarbons from meat and tobacco smoke and colorectal cancer (CRC) risk. The aim of this study was to investigate if polymorphisms in nuclear factor kappa-B, pregnane X receptor, and liver X receptor were associated with risk of CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The polymorphisms nuclear factor kappa-B (NFkB, NFKB1) -94 insertion/deletion ATTG (rs28362491), pregnane X receptor (PXR, NR1I2) A-24381C (rs1523127), C8055T (rs2276707), A7635G (rs6785049), liver X receptor (LXR-β, NR1H3) C-rs1405655T, T-rs2695121C were assessed together with lifestyle factors in a nested case-cohort study of 378 CRC cases and 756 random participants from the Danish prospective Diet, Cancer and Health study of 57,053 persons. Carriers of NFkB -94deletion were at 1.45-fold higher risk of CRC than homozygous carriers of the insertion allele (incidence rate ratio (IRR) = 1.45, 95% confidence interval (95% CI): 1.10-1.92). There was interaction between this polymorphism and intake of red and processed meat in relation to CRC risk. Carriers of NFkB -94deletion were at 3% increased risk pr 25 gram meat per day (95% CI: 0.98-1.09) whereas homozygous carriers of the insertion were not at increased risk (p for interaction = 0.03). PXR and LXR polymorphisms were not associated with CRC risk. There was no interaction between use of nonsteroid antiinflammatory drugs (NSAID) or smoking status and NFkB, PXR or LXR polymorphisms. A polymorphism in NFkB was associated with CRC risk and there was interaction between this polymorphism and meat intake in relation to CRC risk. This study suggests a role for NFkB in CRC aetiology
Polymorphisms in NFkB, PXR, LXR and risk of colorectal cancer in a prospective study of Danes
Directory of Open Access Journals (Sweden)
Andersen Vibeke
2010-09-01
Full Text Available Abstract Background Transcription factors and nuclear receptors constitute a link between exposure to heterocyclic amines and polycyclic aromatic hydrocarbons from meat and tobacco smoke and colorectal cancer (CRC risk. The aim of this study was to investigate if polymorphisms in nuclear factor kappa-B, pregnane X receptor, and liver X receptor were associated with risk of CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The polymorphisms nuclear factor kappa-B (NFkB, NFKB1 -94 insertion/deletion ATTG (rs28362491, pregnane X receptor (PXR, NR1I2 A-24381C (rs1523127, C8055T (rs2276707, A7635G (rs6785049, liver X receptor (LXR-β, NR1H3 C-rs1405655T, T-rs2695121C were assessed together with lifestyle factors in a nested case-cohort study of 378 CRC cases and 756 random participants from the Danish prospective Diet, Cancer and Health study of 57,053 persons. Results Carriers of NFkB -94deletion were at 1.45-fold higher risk of CRC than homozygous carriers of the insertion allele (incidence rate ratio (IRR = 1.45, 95% confidence interval (95% CI: 1.10-1.92. There was interaction between this polymorphism and intake of red and processed meat in relation to CRC risk. Carriers of NFkB -94deletion were at 3% increased risk pr 25 gram meat per day (95% CI: 0.98-1.09 whereas homozygous carriers of the insertion were not at increased risk (p for interaction = 0.03. PXR and LXR polymorphisms were not associated with CRC risk. There was no interaction between use of nonsteroid antiinflammatory drugs (NSAID or smoking status and NFkB, PXR or LXR polymorphisms. Conclusions A polymorphism in NFkB was associated with CRC risk and there was interaction between this polymorphism and meat intake in relation to CRC risk. This study suggests a role for NFkB in CRC aetiology.
Directory of Open Access Journals (Sweden)
Reza Golbedaghi
2017-05-01
Full Text Available The complex formation between a new synthesized tripodal ligand (L22py and the cation Co2+ in water was studied spectrophotometrically using rank annihilation factor analysis (RAFA. According to molar ratio data the stoichiometry of complexation between the ligand and the cation Co2+ was 1:1. Formation constant of this complex was derived using RAFA on spectrophotometric data. In this process the contribution of ligand is removed from the absorbance data matrix when the complex stability constant acts as an optimizing object and simply combined with the pure spectrum of ligand, the rank of original data matrix can be reduced by one by annihilating the information of the ligand from the original data matrix. The effect of ethanol, dimethylformamide (DMF and acetonitrile (AN was investigated on the formation constant of the Co2+ complex. Complex formation constant in water was estimated as log Kf = 5.09 ± 0.02. In mixtures of solvents of water and DMF and water and AN, the formation constant of the complex was increased because of lowering donor number of the solvent and in mixture of water and ethanol, the complex formation constant was decreased because of lowering of dielectric constant of the solvent.
Energy Technology Data Exchange (ETDEWEB)
Komatsu, Tetsuro [Microbiologie Fondamentale et Pathogénicité, MFP CNRS UMR 5234, Université de Bordeaux, Bordeaux 33076 (France); Department of Infection Biology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575 (Japan); Will, Hans [Department of Tumor Biology, University Hospital Hamburg-Eppendorf, 20246 Hamburg (Germany); Nagata, Kyosuke [Department of Infection Biology, Faculty of Medicine, University of Tsukuba, Tsukuba 305-8575 (Japan); Wodrich, Harald, E-mail: harald.wodrich@u-bordeaux.fr [Microbiologie Fondamentale et Pathogénicité, MFP CNRS UMR 5234, Université de Bordeaux, Bordeaux 33076 (France)
2016-04-22
Recent studies involving several viral systems have highlighted the importance of cellular intrinsic defense mechanisms through nuclear antiviral proteins that restrict viral propagation. These factors include among others components of PML nuclear bodies, the nuclear DNA sensor IFI16, and a potential restriction factor PHF13/SPOC1. For several nuclear replicating DNA viruses, it was shown that these factors sense and target viral genomes immediately upon nuclear import. In contrast to the anticipated view, we recently found that incoming adenoviral genomes are not targeted by PML nuclear bodies. Here we further explored cellular responses against adenoviral infection by focusing on specific conditions as well as additional nuclear antiviral factors. In line with our previous findings, we show that neither interferon treatment nor the use of specific isoforms of PML nuclear body components results in co-localization between incoming adenoviral genomes and the subnuclear domains. Furthermore, our imaging analyses indicated that neither IFI16 nor PHF13/SPOC1 are likely to target incoming adenoviral genomes. Thus our findings suggest that incoming adenoviral genomes may be able to escape from a large repertoire of nuclear antiviral mechanisms, providing a rationale for the efficient initiation of lytic replication cycle. - Highlights: • Host nuclear antiviral factors were analyzed upon adenovirus genome delivery. • Interferon treatments fail to permit PML nuclear bodies to target adenoviral genomes. • Neither Sp100A nor B targets adenoviral genomes despite potentially opposite roles. • The nuclear DNA sensor IFI16 does not target incoming adenoviral genomes. • PHF13/SPOC1 targets neither incoming adenoviral genomes nor genome-bound protein VII.
International Nuclear Information System (INIS)
Komatsu, Tetsuro; Will, Hans; Nagata, Kyosuke; Wodrich, Harald
2016-01-01
Recent studies involving several viral systems have highlighted the importance of cellular intrinsic defense mechanisms through nuclear antiviral proteins that restrict viral propagation. These factors include among others components of PML nuclear bodies, the nuclear DNA sensor IFI16, and a potential restriction factor PHF13/SPOC1. For several nuclear replicating DNA viruses, it was shown that these factors sense and target viral genomes immediately upon nuclear import. In contrast to the anticipated view, we recently found that incoming adenoviral genomes are not targeted by PML nuclear bodies. Here we further explored cellular responses against adenoviral infection by focusing on specific conditions as well as additional nuclear antiviral factors. In line with our previous findings, we show that neither interferon treatment nor the use of specific isoforms of PML nuclear body components results in co-localization between incoming adenoviral genomes and the subnuclear domains. Furthermore, our imaging analyses indicated that neither IFI16 nor PHF13/SPOC1 are likely to target incoming adenoviral genomes. Thus our findings suggest that incoming adenoviral genomes may be able to escape from a large repertoire of nuclear antiviral mechanisms, providing a rationale for the efficient initiation of lytic replication cycle. - Highlights: • Host nuclear antiviral factors were analyzed upon adenovirus genome delivery. • Interferon treatments fail to permit PML nuclear bodies to target adenoviral genomes. • Neither Sp100A nor B targets adenoviral genomes despite potentially opposite roles. • The nuclear DNA sensor IFI16 does not target incoming adenoviral genomes. • PHF13/SPOC1 targets neither incoming adenoviral genomes nor genome-bound protein VII.
Ligand photo-isomerization triggers conformational changes in iGluR2 ligand binding domain.
Directory of Open Access Journals (Sweden)
Tino Wolter
Full Text Available Neurological glutamate receptors bind a variety of artificial ligands, both agonistic and antagonistic, in addition to glutamate. Studying their small molecule binding properties increases our understanding of the central nervous system and a variety of associated pathologies. The large, oligomeric multidomain membrane protein contains a large and flexible ligand binding domains which undergoes large conformational changes upon binding different ligands. A recent application of glutamate receptors is their activation or inhibition via photo-switchable ligands, making them key systems in the emerging field of optochemical genetics. In this work, we present a theoretical study on the binding mode and complex stability of a novel photo-switchable ligand, ATA-3, which reversibly binds to glutamate receptors ligand binding domains (LBDs. We propose two possible binding modes for this ligand based on flexible ligand docking calculations and show one of them to be analogues to the binding mode of a similar ligand, 2-BnTetAMPA. In long MD simulations, it was observed that transitions between both binding poses involve breaking and reforming the T686-E402 protein hydrogen bond. Simulating the ligand photo-isomerization process shows that the two possible configurations of the ligand azo-group have markedly different complex stabilities and equilibrium binding modes. A strong but slow protein response is observed after ligand configuration changes. This provides a microscopic foundation for the observed difference in ligand activity upon light-switching.
Availability improvement factors at Taipower's nuclear power plant system
International Nuclear Information System (INIS)
Chen, J.H.
1985-01-01
Sufficient electricity to meet the needs of a growing industrial economy, is one of the most important factors in the total economic development of a nation. Currently, nuclear power is considered one of the most economical and available sources of energy. To keep pace with Taiwan's rapid economic development, while also observing our government's policy of diversifying the requirements for imported forms of energy, Taiwan Power Company has embarked upon an ambitious of nuclear power plant construction. This paper discusses the improvement of Taiwan's nuclear power plants. At the present time, Taipower has completed three nuclear power plants. Two of these are located in northern Taiwan, along the East China Sea, while the third is on the southern tip of Taiwan, bordering the South China Sea. These three plants, each with two nuclear generating units, comprise a total nuclear generating capacity of 5144 MWe
Capacity factor of nuclear power stations in Japan in fiscal year 1984
International Nuclear Information System (INIS)
Agawa, Takashi
1985-01-01
In Japan presently a total of 28 nuclear power plants are in operation with aggregate capacity 20,561 MW, 22 % of the total power generation. Around 1975 there occurred such as stress corrosion cracking and to repair them much time was consumed, leading to the low capacity factor. With such troubles removed, in fiscal 1984, the capacity factor on average of the nuclear power stations is 73.9 %, the highest so far. Contributing to this are long period of the continuous operation, short period of the periodical inspection and increase in the in-operation capacity factor. Contents are the following : construction state of nuclear power stations, operation state in fiscal 1984, causes leading to the high capacity factor, future directions. (Mori, K.)
Nuclear safety and human factors: the French factory of expertise
International Nuclear Information System (INIS)
Rolina, G.
2009-01-01
The French regulation of the nuclear safety is based on the maintaining of a deep technical dialogue between the nuclear safety authority, the I.R.S.N. (Institute of radiation protection and nuclear safety) and the nuclear operators. This type of risk management is called 'french coking' by the Anglo-Saxons, followers of stricter regulatory approach, more readable by the civil society. This technical dialogue is not without quality, especially in the field of human and organizational factors where it allows to improve the know how situation that stays incomplete. (N.C.)
Human factor in the process of nuclear power development
International Nuclear Information System (INIS)
Enenkl, V.
The building up of nuclear power requires the training not only of personnel but of the whole population as well. Professional workers in nuclear power facilities production and personnel operating the equipment of nuclear power plants must be on a high technical and managerial level. The important quality of such personnel is their reliability and responsibility. The human factor influences the level, quality and thereby also the service-life of the machines and equipment and their operation. The improvement of the quality of work in nuclear power production depends on upgrading the scientific and technical level of workers and personnel, their training, in-service education and the raising of the social standing. (B.H.)
DEFF Research Database (Denmark)
Krogsdam, Anne-M; Nielsen, Curt A F; Neve, Søren
2002-01-01
delta-RXR alpha heterodimer bound to an acyl-CoA oxidase (ACO)-type peroxisome-proliferator response element recruited a glutathione S-transferase-NCoR fusion protein in a ligand-independent manner. Contrasting with most other nuclear receptors, PPAR delta was found to interact equally well......The nuclear receptor corepressor (NCoR) was isolated as a peroxisome-proliferator-activated receptor (PPAR) delta interacting protein using the yeast two-hybrid system. NCoR interacted strongly with the ligand-binding domain of PPAR delta, whereas interactions with the ligand-binding domains...
Pokemon decreases the transcriptional activity of RARα in the absence of ligand.
Yang, Yutao; Li, Yueting; Di, Fei; Cui, Jiajun; Wang, Yue; David Xu, Zhi-Qing
2016-12-20
Pokemon is a transcriptional repressor that belongs to the POZ and Krüppel (POK) protein family. In this study, we investigated the potential interaction between Pokemon and retinoic acid receptor alpha (RARα) and determined the role of Pokemon in regulation of RARα transcriptional activity in the absence of ligand. We found that Pokemon could directly interact with RARα. Moreover, we demonstrated that Pokemon could decrease the transcriptional activity of RARα in the absence of ligand. Furthermore, we showed that Pokemon could repress the transcriptional activity of RARα by increasing the recruitment of nuclear receptor co-repressor (NCoR) and silencing mediator of retinoic acid and thyroid hormone receptor (SMRT) to the retinoic acid response element (RARE) element. Taken together, these data suggest that Pokemon is a novel partner of RARα that acts as a co-repressor to regulate RARα transcriptional activity in the absence of ligand.
Involvement of nuclear factor κB in platelet CD40 signaling
International Nuclear Information System (INIS)
Hachem, Ahmed; Yacoub, Daniel; Zaid, Younes; Mourad, Walid; Merhi, Yahye
2012-01-01
Highlights: ► sCD40L induces TRAF2 association to CD40 and NF-κB activation in platelets. ► IκBα phosphorylation downstream of CD40L/CD40 signaling is independent of p38 MAPK phosphorylation. ► IκBα is required for sCD40L-induced platelet activation and potentiation of aggregation. -- Abstract: CD40 ligand (CD40L) is a thrombo-inflammatory molecule that predicts cardiovascular events. Platelets constitute the major source of soluble CD40L (sCD40L), which has been shown to potentiate platelet activation and aggregation, in a CD40-dependent manner, via p38 mitogen activated protein kinase (MAPK) and Rac1 signaling. In many cells, the CD40L/CD40 dyad also induces activation of nuclear factor kappa B (NF-κB). Given that platelets contain NF-κB, we hypothesized that it may be involved in platelet CD40 signaling and function. In human platelets, sCD40L induces association of CD40 with its adaptor protein the tumor necrosis factor receptor associated factor 2 and triggers phosphorylation of IκBα, which are abolished by CD40L blockade. Inhibition of IκBα phosphorylation reverses sCD40L-induced IκBα phosphorylation without affecting p38 MAPK phosphorylation. On the other hand, inhibition of p38 MAPK phosphorylation has no effect on IκBα phosphorylation, indicating a divergence in the signaling pathway originating from CD40 upon its ligation. In functional studies, inhibition of IκBα phosphorylation reverses sCD40L-induced platelet activation and potentiation of platelet aggregation in response to a sub-threshold concentration of collagen. This study demonstrates that the sCD40L/CD40 axis triggers NF-κB activation in platelets. This signaling pathway plays a critical role in platelet activation and aggregation upon sCD40L stimulation and may represent an important target against thrombo-inflammatory disorders.
Correction factors for photon spectrometry in nuclear parameters study
International Nuclear Information System (INIS)
Patrao, Karla Cristina de Souza
2004-10-01
The goal of this work was the determination, using metrologic severity, the factors of correction for coincidences XX, Xγ and γγ and the factors of transference of efficiency for use in gamma spectrometry. On this way, it was carried through by determination of nuclear parameters of a nuclide used in medicine diagnostic ( 201 Tl) and the standardization of two environmental samples, of regular and irregular geometry, proceeding from the residual (ashes and slag) from the nuclear industry. The results shows that this adopted methodology is valid, and it allows its application for many different nuclides, including complex decay schema nuclides, using only photons spectrometry techniques on semiconductor detectors. (author)
Therapeutic Effect of Cistanoside A on Bone Metabolism of Ovariectomized Mice
Directory of Open Access Journals (Sweden)
Xiaoxue Xu
2017-01-01
Full Text Available Cistanoside A (Cis A, an active phenylethanoid glycoside isolated from Cistanche deserticola Y. C. Ma, has received our attention because of its possible role in the treatment of osteoporosis. In the present study, we evaluated the effects of Cis A on an ovariectomized (OVX mice model and investigated its underlying molecular mechanisms of action. After 12 weeks of orally-administrated intervention, Cis A (20, 40 and 80 mg/kg body weight/day exhibited significant antiosteoporotic effects on OVX mice, evidenced by enhanced bone strength, bone mineral density and improved trabecular bone microarchitecture. Meanwhile, the activities of bone resorption markers, including tartrate-resistant acid phosphatase (TRAP, deoxypyridinoline (DPD and cathepsin K, were decreased, and the bioactivity of bone formation marker alkaline phosphatase (ALP was increased. Mechanistically, Cis A inhibited the expression of TNF-receptor associated factor 6 (TRAF6, an upstream molecule that is shared by both nuclear factor kappa-light chain enhancer of activated B cells (NF-κB and phosphatidylinositol 3-kinase (PI3K/Akt pathways and subsequently suppressed the levels of receptor activators of nuclear factor kappaB ligand (RANKL, downregulated the expression of NF-κB and upregulated osteoprotegerin (OPG, PI3K and Akt, which means Cis A possessed antiosteoporotic activity in ovariectomized mice via TRAF6-mediated NF-kappaB inactivation and PI3K/Akt activation. Put together, we present novel findings that Cis A, by downregulating TRAF6, coordinates the inhibition of NF-κB and stimulation of PI3K/Akt pathways to promote bone formation and prevent bone resorption. These data demonstrated the potential of Cis A as a promising agent for the treatment of osteoporosis disease.
Directory of Open Access Journals (Sweden)
Leo Veenman
2016-06-01
Full Text Available The 18 kDa translocator protein (TSPO is highly 0conserved in eukaryotes and prokaryotes. Since its discovery in 1977, numerous studies established the TSPO’s importance for life essential functions. For these studies, synthetic TSPO ligands typically are applied. Tetrapyrroles present endogenous ligands for the TSPO. Tetrapyrroles are also evolutionarily conserved and regulate multiple functions. TSPO and tetrapyrroles regulate each other. In animals TSPO-tetrapyrrole interactions range from effects on embryonic development to metabolism, programmed cell death, response to stress, injury and disease, and even to life span extension. In animals TSPOs are primarily located in mitochondria. In plants TSPOs are also present in plastids, the nuclear fraction, the endoplasmic reticulum, and Golgi stacks. This may contribute to translocation of tetrapyrrole intermediates across organelles’ membranes. As in animals, plant TSPO binds heme and protoporphyrin IX. TSPO-tetrapyrrole interactions in plants appear to relate to development as well as stress conditions, including salt tolerance, abscisic acid-induced stress, reactive oxygen species homeostasis, and finally cell death regulation. In bacteria, TSPO is important for switching from aerobic to anaerobic metabolism, including the regulation of photosynthesis. As in mitochondria, in bacteria TSPO is located in the outer membrane. TSPO-tetrapyrrole interactions may be part of the establishment of the bacterial-eukaryote relationships, i.e., mitochondrial-eukaryote and plastid-plant endosymbiotic relationships.
Directory of Open Access Journals (Sweden)
Stéphanie Pérot
Full Text Available Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely
Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude
2013-01-01
Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket
Role of ligand-ligand vs. core-core interactions in gold nanoclusters.
Milowska, Karolina Z; Stolarczyk, Jacek K
2016-05-14
The controlled assembly of ligand-coated gold nanoclusters (NCs) into larger structures paves the way for new applications ranging from electronics to nanomedicine. Here, we demonstrate through rigorous density functional theory (DFT) calculations employing novel functionals accounting for van der Waals forces that the ligand-ligand interactions determine whether stable assemblies can be formed. The study of NCs with different core sizes, symmetry forms, ligand lengths, mutual crystal orientations, and in the presence of a solvent suggests that core-to-core van der Waals interactions play a lesser role in the assembly. The dominant interactions originate from combination of steric effects, augmented by ligand bundling on NC facets, and related to them changes in electronic properties induced by neighbouring NCs. We also show that, in contrast to standard colloidal theory approach, DFT correctly reproduces the surprising experimental trends in the strength of the inter-particle interaction observed when varying the length of the ligands. The results underpin the importance of understanding NC interactions in designing gold NCs for a specific function.
O-fucosylation of the notch ligand mDLL1 by POFUT1 is dispensable for ligand function.
Directory of Open Access Journals (Sweden)
Julia Müller
Full Text Available Fucosylation of Epidermal Growth Factor-like (EGF repeats by protein O-fucosyltransferase 1 (POFUT1 in vertebrates, OFUT1 in Drosophila is pivotal for NOTCH function. In Drosophila OFUT1 also acts as chaperone for Notch independent from its enzymatic activity. NOTCH ligands are also substrates for POFUT1, but in Drosophila OFUT1 is not essential for ligand function. In vertebrates the significance of POFUT1 for ligand function and subcellular localization is unclear. Here, we analyze the importance of O-fucosylation and POFUT1 for the mouse NOTCH ligand Delta-like 1 (DLL1. We show by mass spectral glycoproteomic analyses that DLL1 is O-fucosylated at the consensus motif C²XXXX(S/TC³ (where C² and C³ are the second and third conserved cysteines within the EGF repeats found in EGF repeats 3, 4, 7 and 8. A putative site with only three amino acids between the second cysteine and the hydroxy amino acid within EGF repeat 2 is not modified. DLL1 proteins with mutated O-fucosylation sites reach the cell surface and accumulate intracellularly. Likewise, in presomitic mesoderm cells of POFUT1 deficient embryos DLL1 is present on the cell surface, and in mouse embryonic fibroblasts lacking POFUT1 the same relative amount of overexpressed wild type DLL1 reaches the cell surface as in wild type embryonic fibroblasts. DLL1 expressed in POFUT1 mutant cells can activate NOTCH, indicating that POFUT1 is not required for DLL1 function as a Notch ligand.
Statistical factors affecting the success of nuclear operations
International Nuclear Information System (INIS)
Sunder, S.; Stephenson, J.R.; Hochman, D.
1999-01-01
In this article, the authors present a statistical analysis to determine the operational, financial, technical, and managerial factors that most significantly affect the success of nuclear operations. The study analyzes data for over 70 nuclear plants and 40 operating companies over a period of five years in order to draw conclusions that they hope will be of interest to utility companies and public utility commissions as they seek ways to improve rates of success in nuclear operations. Some of these conclusions will not be surprising--for example, that older plants have heavier maintenance requirements--but others are less intuitive. For instance, the observation that operators of fewer plants have lower costs suggests that any experience curve benefits associated with managing multiple nuclear facilities is overshadowed by the logistic problems of multiple facilities. After presenting a brief history of nuclear power in America, the authors outline the motivations of the study and the methodology of their analysis. They end the article with the results of the study and discuss some of the managerial implications of these findings
Chemical effects of nuclear transformations
Energy Technology Data Exchange (ETDEWEB)
Bulbulian, S
1982-06-01
A brief survey of the present state of knowledge on the chemical effects of nuclear transformations is presented. The recoil energy produced by these transformations in the nuclide is often sufficiently high to disrupt the chemical ligands between these particular atoms affected by the nuclear transformations, while the rest of their molecules. It also contains a discussion of the different annealing processes that produce the cancellation of the chemical change produced by the nuclear transformation.
A report on human factors in nuclear safety
International Nuclear Information System (INIS)
1983-03-01
Following the Three Mile Island incident of 1979, studies were undertaken by the Atomic Energy Control Board (AECB), in-house and through outside consultants, to address the role of human factors in the regulatory process. This report by the Advisory Committee on Nuclear Safety (ACNS) comments briefly on these studies and offers suggestions which would promote a more formal treatment of human factors by the AECB
Human factors engineering applied to Control Centre Design of a research nuclear reactor
Energy Technology Data Exchange (ETDEWEB)
Farias, Larissa P. de; Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R., E-mail: larissapfarias@ymail.com [Instituto de Engenharia Nuclear (DENN/SEESC/IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Lab, de Usabilidade e Confiabilidade Humana; Monteiro, Beany G. [Universidade Federal do Rio Janeiro (UFRJ), Rio Janeiro, RJ (Brazil). Departamento de Desenho Industrial
2017-07-01
The Human Factors Engineering (HFE) program is an essential aspect for the design of nuclear installations. The overall aim of the HFE program is the improvement of the operational reliability and safety of plant operation. The HFE program main purpose is to ensure that human factor practices are incorporated into the plant design, emphasizing man-machine interface issues and design improvement of the nuclear reactor Control Centre. The Control Centre of nuclear reactor is a combination of control rooms, control suites and local control stations, which are functionally connected and located on the reactor site. The objective of this paper is to present a design approach for the Control Centre of a nuclear reactor used to produce radioisotopes and for nuclear research, including human factor issues. The design approach is based on participatory design principles, using human factor standards, ergonomic guidelines, and the participation of a multidisciplinary team during all design phases. Using the information gathered, an initial sketch 3D of the Control Centre was developed. (author)
Human factors engineering applied to Control Centre Design of a research nuclear reactor
International Nuclear Information System (INIS)
Farias, Larissa P. de; Santos, Isaac J.A. Luquetti dos; Carvalho, Paulo V.R.; Monteiro, Beany G.
2017-01-01
The Human Factors Engineering (HFE) program is an essential aspect for the design of nuclear installations. The overall aim of the HFE program is the improvement of the operational reliability and safety of plant operation. The HFE program main purpose is to ensure that human factor practices are incorporated into the plant design, emphasizing man-machine interface issues and design improvement of the nuclear reactor Control Centre. The Control Centre of nuclear reactor is a combination of control rooms, control suites and local control stations, which are functionally connected and located on the reactor site. The objective of this paper is to present a design approach for the Control Centre of a nuclear reactor used to produce radioisotopes and for nuclear research, including human factor issues. The design approach is based on participatory design principles, using human factor standards, ergonomic guidelines, and the participation of a multidisciplinary team during all design phases. Using the information gathered, an initial sketch 3D of the Control Centre was developed. (author)
Human factors engineering plan for reviewing nuclear plant modernization programs
International Nuclear Information System (INIS)
O'Hara, John; Higgins, James
2004-12-01
The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation
Human factors engineering plan for reviewing nuclear plant modernization programs
Energy Technology Data Exchange (ETDEWEB)
O' Hara, John; Higgins, James [Brookhaven National Laboratory, Upton, NY (United States)
2004-12-01
The Swedish Nuclear Power Inspectorate reviews the human factors engineering (HFE) aspects of nuclear power plants (NPPs) involved in the modernization of the plant systems and control rooms. The purpose of a HFE review is to help ensure personnel and public safety by verifying that accepted HFE practices and guidelines are incorporated into the program and nuclear power plant design. Such a review helps to ensure the HFE aspects of an NPP are developed, designed, and evaluated on the basis of a structured top-down system analysis using accepted HFE principles. The review addresses eleven HFE elements: HFE Program Management, Operating Experience Review, Functional Requirements Analysis and Allocation, Task Analysis, Staffing, Human Reliability Analysis, Human-System Interface Design, Procedure Development, Training Program Development, Human Factors Verification and Validation, and Design Implementation.
Du, Miao; Bu, Xian-He; Guo, Ya-Mei; Ribas, Joan
2004-03-19
The construction of two unique, high-nuclearity Cu(II) supramolecular aggregates with tetrahedral or octahedral cage units, [(mu(3)-Cl)[Li subset Cu(4)(mu-L(1))(3)](3)](ClO(4))(8)(H(2)O)(4.5) (1) and [[Na(2) subset Cu(12)(mu-L(2))(8)(mu-Cl)(4)](ClO(4))(8)(H(2)O)(10)(H(3)O(+))(2)](infinity) (2) by alkali-metal-templated (Li(+) or Na(+)) self-assembly, was achieved by the use of two newly designed carboxylic-functionalized diazamesocyclic ligands, N,N'-bis(3-propionyloxy)-1,4-diazacycloheptane (H(2)L(1)) or 1,5-diazacyclooctane-N,N'-diacetate acid (H(2)L(2)). Complex 1 crystallizes in the trigonal R3c space group (a = b = 20.866(3), c = 126.26(4) A and Z = 12), and 2 in the triclinic P1 space group (a = 13.632(4), b = 14.754(4), c = 19.517(6) A, alpha = 99.836(6), beta = 95.793(5), gamma = 116.124(5) degrees and Z = 1). By subtle variation of the ligand structures and the alkali-metal templates, different polymeric motifs were obtained: a dodecanuclear architecture 1 consisting of three Cu(4) tetrahedral cage units with a Li(+) template, and a supramolecular chain 2 consisting of two crystallographically nonequivalent octahedral Cu(6) polyhedra with a Na(+) template. The effects of ligand functionality and alkali metal template ions on the self-assembly processes of both coordination supramolecular aggregates, and their magnetic behaviors are discussed in detail.
Nuclear translocation of the cytoplasmic domain of HB-EGF induces gastric cancer invasion.
Shimura, Takaya; Yoshida, Michihiro; Fukuda, Shinji; Ebi, Masahide; Hirata, Yoshikazu; Mizoshita, Tsutomu; Tanida, Satoshi; Kataoka, Hiromi; Kamiya, Takeshi; Higashiyama, Shigeki; Joh, Takashi
2012-05-30
Membrane-anchored heparin-binding epidermal growth factor-like growth factor (proHB-EGF) yields soluble HB-EGF, which is an epidermal growth factor receptor (EGFR) ligand, and a carboxy-terminal fragment of HB-EGF (HB-EGF-CTF) after ectodomain shedding. We previously reported that HB-EGF-CTF and unshed proHB-EGF which has the cytoplasmic domain of proHB-EGF (HB-EGF-C), translocate from the plasma membrane to the nucleus and regulate cell cycle after shedding stimuli. However, the significance of nuclear exported HB-EGF-C in human gastric cancer is unclear. We investigated the relationship between intracellular localization of HB-EGF-C and clinical outcome in 96 gastric cancer patients treated with gastrectomy. Moreover, we established stable gastric cancer cell lines overexpressing wild-type HB-EGF (wt-HB-EGF) and mutated HB-EGF (HB-EGF-mC), which prevented HB-EGF-C nuclear translocation after shedding. Cell motility between these 2 gastric cancer cell lines was investigated using a transwell invasion assay and a wound healing assay. Of the 96 gastric cancer cases, HB-EGF-C immunoreactivity was detected in both the nucleus and cytoplasm in 19 cases (19.8 %) and in the cytoplasm only in 25 cases (26.0 %). The nuclear immunoreactivity of HB-EGF-C was significantly increased in stage pT3/4 tumors compared with pT1/2 tumors (T1/2 vs. T3/4: 11.1 % vs. 36.4 %, P Gastric cancer cell invasion obviously increased in wt-HB-EGF-expressing cells, but invasion in HB-EGF-mC-expressing cells showed a slight increase compared with control cells. Moreover, wt-HB-EGF overexpression increased the effectiveness of wound healing, but had no significant effect in HB-EGF-mC-expressing cells. Both the function of HB-EGF as an EGFR ligand and a novel signal for HB-EGF-C nuclear translocation induce gastric cancer growth, whereas HB-EGF-C nuclear translocation independently plays a critical role in gastric cancer invasion. The present study demonstrated that HB-EGF-C nuclear translocation
International Nuclear Information System (INIS)
Nakamura, Ryosuke; Kayamori, Kou; Oue, Erika; Sakamoto, Kei; Harada, Kiyoshi; Yamaguchi, Akira
2015-01-01
Transforming growth factor beta (TGF-β) plays a significant role in the regulation of the tumor microenvironment. To explore the role of TGF-β in oral cancer-induced bone destruction, we investigated the immunohistochemical localization of TGF-β and phosphorylated Smad2 (p-Smad2) in 12 surgical specimens of oral squamous cell carcinoma (OSCC). These studies revealed TGF-β and p-Smad2 expression in cancer cells in all tested cases. Several fibroblasts located between cancer nests and resorbing bone expressed TGF-β in 10 out of 12 cases and p-Smad2 in 11 out of 12 cases. Some osteoclasts also exhibited p ∼ Smad2 expression. The OSCC cell line, HSC3, and the bone marrow-derived fibroblastic cell line, ST2, synthesized substantial levels of TGF-β. Culture media derived from HSC3 cells could stimulate Tgf-β1 mRNA expression in ST2 cells. Recombinant TGF-β1 could stimulate osteoclast formation induced by receptor activator of nuclear factor kappa-B ligand (RANKL) in RAW264 cells. TGF-β1 could upregulate the expression of p-Smad2 in RAW264 cells, and this action was suppressed by the addition of a neutralizing antibody against TGF-β or by SB431542. Transplantation of HSC3 cells onto the calvarial region of athymic mice caused bone destruction, associated with the expression of TGF-β and p-Smad2 in both cancer cells and stromal cells. The bone destruction was substantially inhibited by the administration of SB431542. The present study demonstrated that TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC-induced bone destruction. - Highlights: • Cancer cell, fibroblastic cells, and osteoclasts at bone resorbing area by oral cancer exhibited TGF-β and p-Smad2. • TGF-β1 stimulated osteoclastogenesis induced by RAKL in RAW264 cell. • Xenograft model of oral cancer-induced bone resorption was substantially inhibited by SB431542. • TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC
Energy Technology Data Exchange (ETDEWEB)
Nakamura, Ryosuke [Department of Oral Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Department of Maxillofacial Surgery, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Kayamori, Kou [Department of Oral Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Oue, Erika [Department of Oral Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Department of Maxillofacial Surgery, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Sakamoto, Kei [Department of Oral Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Harada, Kiyoshi [Department of Maxillofacial Surgery, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan); Yamaguchi, Akira, E-mail: akira.mpa@tmd.ac.jp [Department of Oral Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo (Japan)
2015-03-20
Transforming growth factor beta (TGF-β) plays a significant role in the regulation of the tumor microenvironment. To explore the role of TGF-β in oral cancer-induced bone destruction, we investigated the immunohistochemical localization of TGF-β and phosphorylated Smad2 (p-Smad2) in 12 surgical specimens of oral squamous cell carcinoma (OSCC). These studies revealed TGF-β and p-Smad2 expression in cancer cells in all tested cases. Several fibroblasts located between cancer nests and resorbing bone expressed TGF-β in 10 out of 12 cases and p-Smad2 in 11 out of 12 cases. Some osteoclasts also exhibited p ∼ Smad2 expression. The OSCC cell line, HSC3, and the bone marrow-derived fibroblastic cell line, ST2, synthesized substantial levels of TGF-β. Culture media derived from HSC3 cells could stimulate Tgf-β1 mRNA expression in ST2 cells. Recombinant TGF-β1 could stimulate osteoclast formation induced by receptor activator of nuclear factor kappa-B ligand (RANKL) in RAW264 cells. TGF-β1 could upregulate the expression of p-Smad2 in RAW264 cells, and this action was suppressed by the addition of a neutralizing antibody against TGF-β or by SB431542. Transplantation of HSC3 cells onto the calvarial region of athymic mice caused bone destruction, associated with the expression of TGF-β and p-Smad2 in both cancer cells and stromal cells. The bone destruction was substantially inhibited by the administration of SB431542. The present study demonstrated that TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC-induced bone destruction. - Highlights: • Cancer cell, fibroblastic cells, and osteoclasts at bone resorbing area by oral cancer exhibited TGF-β and p-Smad2. • TGF-β1 stimulated osteoclastogenesis induced by RAKL in RAW264 cell. • Xenograft model of oral cancer-induced bone resorption was substantially inhibited by SB431542. • TGF-β synthesized by both cancer cells and stromal cells participates in the OSCC
TIF1alpha: a possible link between KRAB zinc finger proteins and nuclear receptors
DEFF Research Database (Denmark)
Le Douarin, B; You, J; Nielsen, Anders Lade
1998-01-01
Ligand-induced gene activation by nuclear receptors (NRs) is thought to be mediated by transcriptional intermediary factors (TIFs), that interact with their ligand-dependent AF-2 activating domain. Included in the group of the putative AF-2 TIFs identified so far is TIF1alpha, a member of a new...... family of proteins which contains an N-terminal RBCC (RING finger-B boxes-coiled coil) motif and a C-terminal bromodomain preceded by a PHD finger. In addition to these conserved domains present in a number of transcriptional regulatory proteins, TIF1alpha was found to contain several protein......-protein interaction sites. Of these, one specifically interacts with NRs bound to their agonistic ligand and not with NR mutants that are defective in the AF-2 activity. Immediately adjacent to this 'NR box', TIF1alpha contains an interaction site for members of the chromatin organization modifier (chromo) family, HP...
Directory of Open Access Journals (Sweden)
Amitis Karrys
2018-02-01
Full Text Available Treatment with 1,25-dihydroxyvitamin D3 (1,25D improves psoriasis symptoms, possibly by inducing the expression of late cornified envelope (LCE3 genes involved in skin repair. In psoriasis patients, the majority of whom harbor genomic deletion of LCE3B and LCE3C (LCE3C_LCE3B-del, we propose that certain dietary analogues of 1,25D activate the expression of residual LCE3A/LCE3D/LCE3E genes to compensate for the loss of LCE3B/LCE3C in the deletant genotype. Herein, human keratinocytes (HEKn homozygous for LCE3C_LCE3B-del were treated with docosahexaenoic acid (DHA and curcumin, two low-affinity, nutrient ligands for the vitamin D receptor (VDR. DHA and curcumin induce the expression of LCE3A/LCE3D/LCE3E mRNAs at concentrations corresponding to their affinity for VDR. Moreover, immunohistochemical quantitation revealed that the treatment of keratinocytes with DHA or curcumin stimulates LCE3 protein expression, while simultaneously opposing the tumor necrosis factor-alpha (TNFα-signaled phosphorylation of mitogen activated protein (MAP kinases, p38 and Jun amino-terminal kinase (JNK, thereby overcoming inflammation biomarkers elicited by TNFα challenge. Finally, DHA and curcumin modulate two transcription factors relevant to psoriatic inflammation, the activator protein-1 factor Jun B and the nuclear receptor NR4A2/NURR1, that is implicated as a mediator of VDR ligand-triggered gene control. These findings provide insights into the mechanism(s whereby dietary VDR ligands alter inflammatory and barrier functions relevant to skin repair, and may provide a molecular basis for improved treatments for mild/moderate psoriasis.
International Nuclear Information System (INIS)
Joksimovich, V.; Orvis, D.D.
1997-01-01
There are four nuclear safety imperatives or ''4Ms'': machine (hardware, design, QA/QC), milieux (operating conditions, environment, natural phenomena), man (human reliability) and management (organizational and management influences). Nuclear safety evaluations as well as evolution of its most powerful tool, Probabilistic Safety Assessment (PSA), followed chronologically the 4M constituents. The nuclear industry worldwide, and the nuclear safety regulators in particular, have been preoccupied with the first M almost to the point of obsession with belated and only intuitive interest in the third and fourth M (human dimension). Human factors or economics in the nuclear industry was an afterthought. Human reliability was essentially born in the aftermath of the Three Mile Island (TMI) accident. Impact of organizational factors on nuclear safety is only in the early stages of R and D. This paper describes some of the concepts being pursued by APG to link organizational factors and safety culture to Human Reliability Analysis (HRA) and to integrate such into probabilistic safety assessment (PSA), e.g. [APG, 1993]. (author). 11 refs, 4 figs, 1 tab
Chen, Peng
2014-12-03
Background Protein-ligand binding is important for some proteins to perform their functions. Protein-ligand binding sites are the residues of proteins that physically bind to ligands. Despite of the recent advances in computational prediction for protein-ligand binding sites, the state-of-the-art methods search for similar, known structures of the query and predict the binding sites based on the solved structures. However, such structural information is not commonly available. Results In this paper, we propose a sequence-based approach to identify protein-ligand binding residues. We propose a combination technique to reduce the effects of different sliding residue windows in the process of encoding input feature vectors. Moreover, due to the highly imbalanced samples between the ligand-binding sites and non ligand-binding sites, we construct several balanced data sets, for each of which a random forest (RF)-based classifier is trained. The ensemble of these RF classifiers forms a sequence-based protein-ligand binding site predictor. Conclusions Experimental results on CASP9 and CASP8 data sets demonstrate that our method compares favorably with the state-of-the-art protein-ligand binding site prediction methods.
Craniometaphyseal dysplasia with obvious biochemical abnormality and rickets-like features.
Wu, Bo; Jiang, Yan; Wang, Ou; Li, Mei; Xing, Xiao-Ping; Xia, Wei-Bo
2016-05-01
Craniometaphyseal dysplasia (CMD) is a rare genetic disorder that is characterized by progressive sclerosis of the craniofacial bones and metaphyseal widening of long bones, and biochemical indexes were mostly normal. To further the understanding of the disease from a biochemical perspective, we reported a CMD case with obviously abnormal biochemical indexes. A 1-year-old boy was referred to our clinic. Biochemical test showed obviously increased alkaline phosphatase (ALP) and parathyroid hormone (PTH), mild hypocalcemia and hypophosphatemia. Moreover, significant elevated receptor activator of nuclear factor kappa-B ligand (RANKL) level, but normal β-C-terminal telopeptide of type I collagen (β-CTX) concentration were revealed. He was initially suspected of rickets, because the radiological examination also showed broadened epiphysis in his long bones. Supplementation with calcium and calcitriol alleviated biochemical abnormality. However, the patient gradually developed osteosclerosis which was inconformity with rickets. Considering that he was also presented with facial paralysis and nasal obstruction symptom, the diagnosis of craniometaphyseal dysplasia was suspected, and then was confirmed by the mutation analysis of ANKH of the proband and his family, which showed a de novo heterozygous mutation (C1124-1126delCCT) on exon 9. Our study revealed that obvious biochemical abnormality and rickets-like features might present as uncommon characteristics in CMD patients, and the calcium and calcitriol supplementation could alleviate biochemical abnormalities. Furthermore, although early osteoclast differentiation factor was excited in CMD patient, activity of osteoclast was still inert. Copyright © 2016. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Kyung Eun Choi
2014-07-01
Full Text Available Our previous findings have demonstrated that bee venom (BV has anti-cancer activity in several cancer cells. However, the effects of BV on lung cancer cell growth have not been reported. Cell viability was determined with trypan blue uptake, soft agar formation as well as DAPI and TUNEL assay. Cell death related protein expression was determined with Western blotting. An EMSA was used for nuclear factor kappaB (NF-κB activity assay. BV (1–5 μg/mL inhibited growth of lung cancer cells by induction of apoptosis in a dose dependent manner in lung cancer cell lines A549 and NCI-H460. Consistent with apoptotic cell death, expression of DR3 and DR6 was significantly increased. However, deletion of DRs by small interfering RNA significantly reversed BV induced cell growth inhibitory effects. Expression of pro-apoptotic proteins (caspase-3 and Bax was concomitantly increased, but the NF-κB activity and expression of Bcl-2 were inhibited. A combination treatment of tumor necrosis factor (TNF-like weak inducer of apoptosis, TNF-related apoptosis-inducing ligand, docetaxel and cisplatin, with BV synergistically inhibited both A549 and NCI-H460 lung cancer cell growth with further down regulation of NF-κB activity. These results show that BV induces apoptotic cell death in lung cancer cells through the enhancement of DR3 expression and inhibition of NF-κB pathway.
Radiation-induced Epstein-Barr virus reactivation in gastric cancer cells with latent EBV infection.
Nandakumar, Athira; Uwatoko, Futoshi; Yamamoto, Megumi; Tomita, Kazuo; Majima, Hideyuki J; Akiba, Suminori; Koriyama, Chihaya
2017-07-01
Epstein-Barr virus, a ubiquitous human herpes virus with oncogenic activity, can be found in 6%-16% of gastric carcinomas worldwide. In Epstein-Barr virus-associated gastric carcinoma, only a few latent genes of the virus are expressed. Ionizing irradiation was shown to induce lytic Epstein-Barr virus infection in lymphoblastoid cell lines with latent Epstein-Barr virus infection. In this study, we examined the effect of ionizing radiation on the Epstein-Barr virus reactivation in a gastric epithelial cancer cell line (SNU-719, an Epstein-Barr virus-associated gastric carcinoma cell line). Irradiation with X-ray (dose = 5 and 10 Gy; dose rate = 0.5398 Gy/min) killed approximately 25% and 50% of cultured SNU-719 cells, respectively, in 48 h. Ionizing radiation increased the messenger RNA expression of immediate early Epstein-Barr virus lytic genes (BZLF1 and BRLF1), determined by real-time reverse transcription polymerase chain reaction, in a dose-dependent manner at 48 h and, to a slightly lesser extent, at 72 h after irradiation. Similar findings were observed for other Epstein-Barr virus lytic genes (BMRF1, BLLF1, and BcLF1). After radiation, the expression of transforming growth factor beta 1 messenger RNA increased and reached a peak in 12-24 h, and the high-level expression of the Epstein-Barr virus immediate early genes can convert latent Epstein-Barr virus infection into the lytic form and result in the release of infectious Epstein-Barr virus. To conclude, Ionizing radiation activates lytic Epstein-Barr virus gene expression in the SNU-719 cell line mainly through nuclear factor kappaB activation. We made a brief review of literature to explore underlying mechanism involved in transforming growth factor beta-induced Epstein-Barr virus reactivation. A possible involvement of nuclear factor kappaB was hypothesized.
A regulatory perspective on human factors in nuclear power
International Nuclear Information System (INIS)
Whitfield, D.
1987-01-01
This paper sets out the approaches being taken by the United Kingdom Nuclear Installations Inspectorate (NII) to monitoring the application of human factors principles and practice in the UK industry. The role of NII is outlined, the development of human factors concerns is reviewed, the assessment of the Sizewell 'B' safety case is presented as a particular example, and pertinent future developments in the human factors discipline are proposed. (author)
Factors which could limit the nuclear fuel cycle development
International Nuclear Information System (INIS)
Pecqueur, M.; Barre, B.
1977-01-01
The nuclear fuel cycle is a most important industry for the energy future of the world. It has also a leading part as regards the physical continuity of energy supply of the countries engaged in the nuclear field. The development of this industry is subject to the economic or political constraints involved by the availability of raw materials, technologies or production means. The various limiting factors which could affect the different stages of the fuel cycle are linked with the technical, economic and financial aspects, with the impact on the environment, nuclear safety, risks of non-pacific uses and proliferation of arms. Interesting to note is also the correlation between the fuel cycle development and the problems of energy independence and security of nuclear programs. As a conclusion, the nuclear fuel cycle industry is confronted to difficulties due to its extremely rapid growth (doubling time 5 years) which only few heavy industries have encountered for long periods. It is more over submitted to the political and safety constraints always linked with nuclear matters. The task is therefore a difficult one. But the objective is worth-while since it is a condition to the development of nuclear industry [fr
Schmidt, A; Vogel, R; Holloway, M K; Rutledge, S J; Friedman, O; Yang, Z; Rodan, G A; Friedman, E
1999-09-10
LXR and PPAR receptors belong to the nuclear receptor superfamily of transcriptional activating factors. Using ligand-dependent transcription assays, we found that 5-tetradecyloxy-2-furancarboxylic acid (TOFA) transactivates chimeric receptors composed of the glucocorticoid receptor DNA binding domain and the ligand binding regions of PPARalpha, PPARbeta (NUC-1) and LXRbeta (NER) receptors. In the same assays, ligands for PPARs (oleic acid, WY-14643 and L-631,033) and LXRs (hydroxycholesterols) maintain their respective receptor selectivity. TOFA and hydroxycholesterols also stimulate transcription from a minimal fibrinogen promoter that is under the control of AP-1 or NF-kappaB transcription factor binding sites. In addition to their effects on transcription, these LXRbeta activators induce neuronal differentiation in rat pheochromocytoma cells. TOFA and the natural LXR agonist, 22 (R)-hydroxycholesterol, stimulate neurite outgrowth in 55 and 28% of cells, respectively. No neurite outgrowth was induced by the related 22(S)-hydroxycholesterol, which does not activate the LXR family. These results suggest that the hydroxycholesterol signaling pathway has a complex effect on transcription that mediates the activity of TOFA and hydroxycholesterol on neuronal differentiation in pheochromocytoma cells.
Differential effects of EGFR ligands on endocytic sorting of the receptor
DEFF Research Database (Denmark)
Roepstorff, Kirstine; Grandal, Michael Vibo; Henriksen, Lasse
2009-01-01
signalling and is a more potent mitogen than EGF. In addition to EGF and TGF-alpha, five EGFR ligands have been identified. Although many of these ligands are upregulated in cancers, very little is known about their effect on EGFR trafficking. We have compared the effect of six different ligands on endocytic...... trafficking of EGFR. We find that, whereas they all stimulate receptor internalization, they have very diverse effects on endocytic sorting. Heparin-binding EGF-like growth factor and Betacellulin target all EGFRs for lysosomal degradation. In contrast, TGF-alpha and epiregulin lead to complete receptor...
International Nuclear Information System (INIS)
Nakamura, S.; Imura, H.; Suzuki, N.
1984-01-01
Synergistic effect of neutral bidentate ligands, L, such as 1,10-phenanthroline(phen), 2,9-dimethyl-1,10-phenanthroline(dmp) and 2,2'-bipyridine(bpy) and of neutral unidentate ligands TBP and TOPO have been studied in the extraction of Mn(II) labelled with 54 Mn using 2-thenoyl-trifluoroacetone(HTTA) in various organic solvents. The following factors play important role in the synergistic extraction involving bidentate ligands: a two-phase partition of bidentate ligands, and their protonation and complex formation with Mn(II) in the aqueous phase. The mixed ligand complex, Mn(TTA) 2 L is formed in all bidentate ligand systems. The adduct formation constant (βsub(s,1)) decreases in the following order: phen (lg βsub(s,1)=12.64)>dmp(11.32)>.bpy(8.54) in the cyclohexane system. This order is ascribed to the bacisity and the steric effect of the bidentate ligands. Organic solvents influence both the adduct formation and the partition of the ligands, and βsub(s,1) decreases in the order cyclohexane > carbon tetrachloride > cholrobenzene approx.= benzene > chloroform. (author)
Crystallization of protein–ligand complexes
International Nuclear Information System (INIS)
Hassell, Anne M.; An, Gang; Bledsoe, Randy K.; Bynum, Jane M.; Carter, H. Luke III; Deng, Su-Jun J.; Gampe, Robert T.; Grisard, Tamara E.; Madauss, Kevin P.; Nolte, Robert T.; Rocque, Warren J.; Wang, Liping; Weaver, Kurt L.; Williams, Shawn P.; Wisely, G. Bruce; Xu, Robert; Shewchuk, Lisa M.
2007-01-01
Methods presented for growing protein–ligand complexes fall into the categories of co-expression of the protein with the ligands of interest, use of the ligands during protein purification, cocrystallization and soaking the ligands into existing crystals. Obtaining diffraction-quality crystals has long been a bottleneck in solving the three-dimensional structures of proteins. Often proteins may be stabilized when they are complexed with a substrate, nucleic acid, cofactor or small molecule. These ligands, on the other hand, have the potential to induce significant conformational changes to the protein and ab initio screening may be required to find a new crystal form. This paper presents an overview of strategies in the following areas for obtaining crystals of protein–ligand complexes: (i) co-expression of the protein with the ligands of interest, (ii) use of the ligands during protein purification, (iii) cocrystallization and (iv) soaks
on skin keratinocytes by nuclear factor-kappa B
African Journals Online (AJOL)
DR. NJ TONUKARI
2012-06-21
Jun 21, 2012 ... Effects of advanced glycation end-products (AGEs) on ... AGE levels, nuclear factor-kappa B (NF-κB) localization and cell viability were measured in vivo. ..... and related alteration in NF-κB activity, we treated normal cells by ...
Effect of Ligand Exchange on the Photoluminescence Properties of Cu-Doped Zn-In-Se Quantum Dots
Dong, Xiaofei; Xu, Jianping; Yang, Hui; Zhang, Xiaosong; Mo, Zhaojun; Shi, Shaobo; Li, Lan; Yin, Shougen
2018-04-01
The surface-bound ligands of a semiconductor nanocrystal can affect its electron transition behavior. We investigate the photoluminescence (PL) properties of Cu-doped Zn-In-Se quantum dots (QDs) through the exchange of oleylamine with 6-mercaptohexanol (MCH). Fourier transform infrared and 1H nuclear magnetic resonance spectroscopies, and mass spectrometry reveal that the short-chain MCH molecules are bound to the QD surface. The emission peaks remain unchanged after ligand exchange, and the PL quantum yield is reduced from 49% to 38%. The effects of particle size and defect type on the change in PL behavior upon ligand substitution are excluded through high-resolution transmission electron microscopy, UV-Vis absorption, and PL spectroscopies. The origin of the decreased PL intensity is associated with increased ligand density and the stronger ligand electron-donating abilities of MCH-capped QDs that induce an increase in the nonradiative transition probability. A lower PL quenching transition temperature is observed for MCH-capped QDs and is associated with increasing electron-acoustic phonon coupling due to the lower melting temperature of MCH.
Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls.
Baud, Véronique; Karin, Michael
2009-01-01
Nuclear factor kappaB (NF-kappaB) transcription factors have a key role in many physiological processes such as innate and adaptive immune responses, cell proliferation, cell death, and inflammation. It has become clear that aberrant regulation of NF-kappaB and the signalling pathways that control its activity are involved in cancer development and progression, as well as in resistance to chemotherapy and radiotherapy. This article discusses recent evidence from cancer genetics and cancer genome studies that support the involvement of NF-kappaB in human cancer, particularly in multiple myeloma. The therapeutic potential and benefit of targeting NF-kappaB in cancer, and the possible complications and pitfalls of such an approach, are explored.
Takano, H; Takahashi, T; Nakata, A; Nogami, S; Yusa, K; Kuwajima, S; Yamazaki, M; Fukuda, M
2016-05-01
The aim of this study was to investigate the bone resorption effect of the mediators delivered in joint cavity of patients with mandibular condyle fractures by detecting osteoclast markers using cellular biochemistry methods, and by analysing bone resorption activities via inducing osteoclast differentiation of the infiltrated cells from arthrocentesis. Sixteen joints in 10 patients with mandibular condyle fractures were evaluated. The control group consisted of synovial fluid (SF) samples from seven joints of four volunteers who had no clinical signs or symptoms involving the temporomandibular joint (TMJ) or disc displacement. We collected SF cells from all patients during therapeutic arthrocentesis. The infiltrating cells from TMJ SF were cultured, differentiated into tartrate-resistant acid phosphatase (TRAP)-positive osteoclast-like cells and examined bone resorption activities. We also investigated factors related to osteoclast induction of SF, using ELISA procedures. Osteoclast-like cells were induced from the SF cells obtained from all patients with condylar fractures. These multinucleated giant cells were positive for TRAP and actin, and had the ability to absorb dentin slices. The levels of macrophage colony-stimulating factor (M-CSF), prostaglandin E2 (PGE2), soluble form of receptor activator of nuclear factor kappa-B ligand (sRANKL) and osteoprotegerin (OPG), in SF samples from the patients, were significantly higher than in the controls. These findings indicate that bone resorption activities in SF from patients with mandibular condyle fractures were upregulated and may participate in the pathogenesis and wound healing. © 2016 The Authors. Journal of Oral Rehabilitation Published by John Wiley & Sons Ltd.
Neuroinflammation Induces Neurodegeneration.
Kempuraj, D; Thangavel, R; Natteru, P A; Selvakumar, G P; Saeed, D; Zahoor, H; Zaheer, S; Iyer, S S; Zaheer, A
2016-01-01
Neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), and Multiple Sclerosis (MS) are characterized by neuronal degeneration and neuronal death in specific regions of the central nervous system (CNS). In AD, neurons of the hippocampus and entorhinal cortex are the first to degenerate, whereas in PD, dopaminergic neurons in the substantia nigra degenerate. MS patients show destruction of the myelin sheath. Once the CNS neurons are damaged, they are unable to regenerate unlike any other tissue in the body. Neurodegeneration is mediated by inflammatory and neurotoxic mediators such as interleukin-1beta (IL-1β), IL-6, IL-8, IL-33, tumor necrosis factor-alpha (TNF-α), chemokine (C-C motif) ligand 2 (CCL2), CCL5, matrix metalloproteinase (MMPs), granulocyte macrophage colony-stimulating factor (GM-CSF), glia maturation factor (GMF), substance P, reactive oxygen species (ROS), reactive nitrogen species (RNS), mast cells-mediated histamine and proteases, protease activated receptor-2 (PAR-2), CD40, CD40L, CD88, intracellular Ca + elevation, and activation of mitogen-activated protein kinases (MAPKs) and nuclear factor kappa-B (NF-kB). Activated microglia, astrocytes, neurons, T-cells and mast cells release these inflammatory mediators and mediate neuroinflammation and neurodegeneration in a vicious manner. Further, immune and inflammatory cells and inflammatory mediators from the periphery cross the defective blood-brain-barrier (BBB) and augment neuroinflammation. Though inflammation is crucial in the onset and the progression of neurodegenerative diseases, anti-inflammatory drugs do not provide significant therapeutic effects in these patients till date, as the disease pathogenesis is not yet clearly understood. In this review, we discuss the possible factors involved in neuroinflammation-mediated neurodegeneration.
New Ru(II) Complexes for Dual Photoreactivity: Ligand Exchange and 1O2 Generation
Knoll, Jessica D.; Albani, Bryan A.; Turro, Claudia
2015-01-01
Uncovering the factors that govern the electronic structure of Ru(II)–polypyridyl complexes is critical in designing new compounds for desired photochemical reactions, and strategies to tune excited states for ligand dissociation and 1O2 production are discussed herein. The generally accepted mechanism for photoinduced ligand dissociation proposes that population of the dissociative triplet ligand field (3LF) state proceeds through thermal population from the vibrationally cooled triplet meta...
Deletion of hepatocyte nuclear factor-1-beta in an infant with prune belly syndrome.
Haeri, Sina; Devers, Patricia L; Kaiser-Rogers, Kathleen A; Moylan, Vincent J; Torchia, Beth S; Horton, Amanda L; Wolfe, Honor M; Aylsworth, Arthur S
2010-08-01
Prune belly syndrome is a rare congenital disorder characterized by deficiency of abdominal wall muscles, cryptorchidism, and urinary tract anomalies. We have had the opportunity to study a baby with prune belly syndrome associated with an apparently de novo 1.3-megabase interstitial 17q12 microdeletion that includes the hepatocyte nuclear factor-1-beta gene at 17q12. One previous patient, an adult, has been reported with prune belly syndrome and a hepatocyte nuclear factor-1-beta microdeletion. Hepatocyte nuclear factor-1-beta is a widely expressed transcription factor that regulates tissue-specific gene expression and is expressed in numerous tissues including mesonephric duct derivatives, the renal tubule of the metanephros, and the developing prostate of the mouse. Mutations in hepatocyte nuclear factor-1-beta cause the "renal cysts and diabetes syndrome," isolated renal cystic dysplasia, and a variety of other malformations. Based on its expression pattern and the observation of two affected cases, we propose that haploinsufficiency of hepatocyte nuclear factor-1-beta may be causally related to the production of the prune belly syndrome phenotype through a mechanism of prostatic and ureteral hypoplasia that results in severe obstructive uropathy with urinary tract and abdominal distension. Copyright Thieme Medical Publishers.
Rapid, radiochemical-ligand binding assay for methotrexate
International Nuclear Information System (INIS)
Caston, J.D.
1976-01-01
A radiochemical ligand binding assay for methotrexate is provided. A binder factor comprising a partially purified dihydrofolic acid reductase preparation is employed. The binder factor is conveniently prepared by homogenizing a factor containing animal organ such as liver, and extracting with isotonic saline and ammonium sulfate. A binder cofactor, NADPH 2 , is also employed in the binding reaction. The procedure contemplates both direct and sequential assay techniques, and it is not interfered with by vast excesses of many natural folate derivatives. 12 claims, 6 drawing figures
Marsh, Lorraine
2015-01-01
Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.
Heterobifunctional crosslinkers for tethering single ligand molecules to scanning probes
International Nuclear Information System (INIS)
Riener, Christian K.; Kienberger, Ferry; Hahn, Christoph D.; Buchinger, Gerhard M.; Egwim, Innocent O.C.; Haselgruebler, Thomas; Ebner, Andreas; Romanin, Christoph; Klampfl, Christian; Lackner, Bernd; Prinz, Heino; Blaas, Dieter; Hinterdorfer, Peter; Gruber, Hermann J.
2003-01-01
Single molecule recognition force microscopy (SMRFM) is a versatile atomic force microscopy (AFM) method to probe specific interactions of cognitive molecules on the single molecule level. It allows insights to be gained into interaction potentials and kinetic barriers and is capable of mapping interaction sites with nm positional accuracy. These applications require a ligand to be attached to the AFM tip, preferably by a distensible poly(ethylene glycol) (PEG) chain between the measuring tip and the ligand molecule. The PEG chain greatly facilitates specific binding of the ligand to immobile receptor sites on the sample surface. The present study contributes to tip-PEG-ligand tethering in three ways: (i) a convenient synthetic route was found to prepare NH 2 -PEG-COOH which is the key intermediate for long heterobifunctional crosslinkers; (ii) a variety of heterobifunctional PEG derivatives for tip-PEG-ligand linking were prepared from NH 2 -PEG-COOH; (iii) in particular, a new PEG crosslinker with one thiol-reactive end and one terminal nitrilotriacetic acid (NTA) group was synthesized and successfully used to tether His 6 -tagged protein molecules to AFM tips via noncovalent NTA-Ni 2+ -His 6 bridges. The new crosslinker was applied to link a recombinant His 6 -tagged fragment of the very-low density lipoprotein receptor to the AFM tip whereupon specific docking to the capsid of human rhinovirus particles was observed by force microscopy. In a parallel study, the specific interaction of the small GTPase Ran with the nuclear import receptor importin β1 was studied in detail by SMRFM, using the new crosslinker to link His 6 -tagged Ran to the measuring tip [Nat. Struct. Biol. (2003), 10, 553-557
Baek, Jong Min; Kim, Ju-Young; Yoon, Kwon-Ha; Oh, Jaemin; Lee, Myeung Su
2016-01-01
Ebselen is a non-toxic seleno-organic drug with anti-inflammatory and antioxidant properties that is currently being examined in clinical trials to prevent and treat various diseases, including atherosclerosis, stroke, and cancer. However, no reports are available for verifying the pharmacological effects of ebselen on major metabolic bone diseases such as osteoporosis. In this study, we observed that ebselen suppressed the formation of tartrate-resistant acid phosphatase (TRAP)-positive mult...
Economic benefits of power factor correction at a nuclear facility
International Nuclear Information System (INIS)
Boger, R.M.; Dalos, W.; Juguilon, M.E.
1986-01-01
The economic benefits of correcting poor power factor at an operating nuclear facility are shown. A project approach for achieving rapid return of investment without disrupting plant availability is described. Examples of technical problems associated with using capacitors for power factor correction are presented
International Nuclear Information System (INIS)
Jeong, Kwan Seong; Lee, Dong Gyu; Jung, Chong Hun; Lee, Kune Woo
2006-01-01
The estimated decommissioning cost of nuclear research reactor is calculated by applying a unit cost factor-based engineering cost calculation method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning cost of nuclear research reactor is composed of labor cost, equipment and materials cost. Labor cost of decommissioning costs in decommissioning works are calculated on the basis of working time consumed in decommissioning objects. In this paper, the unit cost factors and work difficulty factors which are needed to calculate the labor cost in estimating decommissioning cost of nuclear research reactor are derived and figured out.
Czech Academy of Sciences Publication Activity Database
Tejel, C.; del Río, M. P.; Ciriano, M. A.; Reijerse, E. J.; Hartl, F.; Záliš, Stanislav; Hetterscheid, D. G. H.; Tsichlis i Spithas, N.; de Bruin, B.
2009-01-01
Roč. 15, č. 44 (2009), s. 11878-11889 ISSN 0947-6539 R&D Projects: GA MŠk OC 139; GA AV ČR KAN100400702 Institutional research plan: CEZ:AV0Z40400503 Keywords : bis(picolyl)amine * iridium * ligand radical * oxygenation Subject RIV: CG - Electrochemistry Impact factor: 5.382, year: 2009
Chen, Peng; Huang, Jianhua Z; Gao, Xin
2014-01-01
Protein-ligand binding is important for some proteins to perform their functions. Protein-ligand binding sites are the residues of proteins that physically bind to ligands. Despite of the recent advances in computational prediction
Nuclear receptor 4A (NR4A) family - orphans no more.
Safe, Stephen; Jin, Un-Ho; Morpurgo, Benjamin; Abudayyeh, Ala; Singh, Mandip; Tjalkens, Ronald B
2016-03-01
The orphan nuclear receptors NR4A1, NR4A2 and NR4A3 are immediate early genes induced by multiple stressors, and the NR4A receptors play an important role in maintaining cellular homeostasis and disease. There is increasing evidence for the role of these receptors in metabolic, cardiovascular and neurological functions and also in inflammation and inflammatory diseases and in immune functions and cancer. Despite the similarities of NR4A1, NR4A2 and NR4A3 and their interactions with common cis-genomic elements, they exhibit unique activities and cell-/tissue-specific functions. Although endogenous ligands for NR4A receptors have not been identified, there is increasing evidence that structurally-diverse synthetic molecules can directly interact with the ligand binding domain of NR4A1 and act as agonists or antagonists, and ligands for NR4A2 and NR4A3 have also been identified. Since NR4A receptors are key factors in multiple diseases, there are opportunities for the future development of NR4A ligands for clinical applications in treating multiple health problems including metabolic, neurologic and cardiovascular diseases, other inflammatory conditions, and cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Helder Veras Ribeiro Filho
2018-02-01
Full Text Available Peroxisome proliferator-activated receptor gamma (PPARγ is a member of a nuclear receptor superfamily and acts as a ligand-dependent transcription factor, playing key roles in maintenance of adipose tissue and in regulation of glucose and lipid homeostasis. This receptor is the target of thiazolidinediones, a class of antidiabetic drugs, which improve insulin sensitization and regulate glycemia in type 2 diabetes. Despite the beneficial effects of drugs, such as rosiglitazone and pioglitazone, their use is associated with several side effects, including weight gain, heart failure, and liver disease, since these drugs induce full activation of the receptor. By contrast, a promising activation-independent mechanism that involves the inhibition of cyclin-dependent kinase 5 (CDK5-mediated PPARγ phosphorylation has been related to the insulin-sensitizing effects induced by these drugs. Thus, we aimed to identify novel PPARγ ligands that do not possess agonist properties by conducting a mini-trial with 80 compounds using the sequential steps of thermal shift assay, 8-anilino-1-naphthalenesulfonic acid fluorescence quenching, and a cell-based transactivation assay. We identified two non-agonist PPARγ ligands, AM-879 and P11, and one partial-agonist, R32. Using fluorescence anisotropy, we show that AM-879 does not dissociate the NCOR corepressor in vitro, and it has only a small effect on TRAP coactivator recruitment. In cells, AM-879 could not induce adipocyte differentiation or positively regulate the expression of genes associated with adipogenesis. In addition, AM-879 inhibited CDK5-mediated phosphorylation of PPARγ in vitro. Taken together, these findings supported an interaction between AM-879 and PPARγ; this interaction was identified by the analysis of the crystal structure of the PPARγ:AM-879 complex and evidenced by AM-879’s mechanism of action as a putative PPARγ non-agonist with antidiabetic properties. Moreover, we present an
Human factors in the Canadian nuclear industry: future needs
International Nuclear Information System (INIS)
Harrison, F.
2008-01-01
Currently the industry is facing refurbishment and new builds. At present most licensees in Canada do not have sufficient numbers of Human Factors staff. As a result, the activities of the CNSC are too often focused on providing guidance regarding the application of Human Factors, in addition to reviewing work submitted by the licensee. Greater efficiencies for both the licensee and the CNSC could be realized if licensee staff had greater Human Factors expertise. Strategies for developing Human Factors expertise should be explored through cooperative partnerships with universities, which could be encouraged to include Human Factors courses specific to nuclear. (author)
International Nuclear Information System (INIS)
Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.
1988-01-01
Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)
de Matos, Felipe Rodrigues; de Moraes, Maiara; das Neves Silva, Emília Beatriz; Galvão, Hébel Cavalcanti; de Almeida Freitas, Roseana
2013-11-01
The aim of the present study was to compare the immunohistochemical detection of receptor activator nuclear κB ligand (RANKL) and osteoprotegerin (OPG) in radicular cysts (RCs), dentigerous cysts (DCs), solid ameloblastomas (SAs), and keratocystic odontogenic tumors (KOTs). A total of 20 RCs, 20 DCs, 20 KOTs, 14 dental follicles (DFs), and 18 SAs were evaluated by immunohistochemistry using anti-RANKL and anti-OPG antibodies. The analysis was quantitative, and the number of positive cells was counted in 10 microscopic high-power fields (400×). The DFs, KOTs, and SAs showed higher expression of RANKL than did the RCs and DCs in the epithelium (P < .05). The epithelial expression of OPG was higher in the DFs, KOTs, RCs, and DCs than in the SAs (P < .05). The ratio of OPG less than RANKL was more frequent in SAs and OPG greater than RANKL in DCs (P < .05). Our results have shown differences in RANKL and OPG detection in the odontogenic cysts and tumors studied. The higher RANKL and lower OPG detection in SA could play a role in bone resorption, compatible with the tumor's biologic behavior. Copyright © 2013 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.
Factors affecting the next generation of nuclear power
International Nuclear Information System (INIS)
Remick, F.J.
1990-01-01
For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it
Factors affecting the next generation of nuclear power
Energy Technology Data Exchange (ETDEWEB)
Remick, F J [Nuclear Regulatory Commission, Washington, DC (United States)
1990-07-01
For both financial, environmental and health reasons, and because of external and internal factors affecting this nation's energy supply, nuclear power will likely play a part in supplying this nation's energy in the coming decades. I believe this to be true for some other parts of the world as well. Even some severe critics of the nuclear power industry and the NRC might agree with me on this point. Increasing concern with the environmental consequences of the burning of fossil fuels has led some former opponents of the use of nuclear power to balance anew the risks and benefits of nuclear power and to modify to some degree their former opposition. A related concern with the adequacy of the energy supply is leading others to modify their positions. According to analyses done by the U.S. Department of Energy, after 1994 the United States will no longer be able to assure all its citizens a reliable supply of electricity. Already, many areas of the country are in need of additional electric capacity. In both Sweden and Switzerland, similar concerns have led to the adoption by many of more compromising positions. Some critics of nuclear power may in the end still reject it as an alternative, but, with the increased pressures on the environment and on our energy supply, nuclear power is an alternative which cannot be rejected without the most serious consideration. This should be, I believe, a point of consensus among us. In sum, there is a future for nuclear power in the sense that there is a use for it.
Overall analysis of the cost key factors for the nuclear energy
International Nuclear Information System (INIS)
Caero, M.
1996-01-01
In 1995, 25,8 % of the world electricity consumption was of nuclear origin, while in the EU this figure is increased up to 50,6 %. In order to maintain and even to increase its share in the electricity generation, Nuclear Energy needs to achieve a good economic performance as a base load source when compared with its competitors, basically coal and gas fired plants. Fossil-fired generation costs have declined over the past ten years, mainly due to lower fossil fuel prices. This factor together with the recently observed tendency of higher discount rates to be applied are challenging the attractiveness of the nuclear energy. Nuclear energy is a capital intensive option. Taken into account extensive standardization programs has been established aiming at cost reductions as well as to increase efficiency of nuclear energy utilization, among their main purposes. Externalities play an important role, as they are already internalized in nuclear generation costs. This is not true for many existing coal-fired plants. Even a great uncertainly exists on greenhouse gas effects. Also decisions on greenhouse gas control and their impact on carbonaceous fuel generation costs cannot be clearly predicted, even in the immediate future. Macroeconomic factors like employment, competitiveness, energy conservation, energy availability, energy demand control, etc are positively influenced by the use of nuclear energy. A sustainable economic development cannot be achieved only relying on fossil fuel generation. As a wrap up sustainable development demands nuclear energy in order to cover the future objectives of energy availability, environmental control and energy cost control. (author)
International Nuclear Information System (INIS)
Alliot, C.
2003-01-01
This work comes within studies of nuclear waste disposal. The sorption of radionuclide onto mineral is very important to understand their migration. So this work deals with the influence of ligands like oxalic, acetic and carbonic acids on lanthanides and actinides sorption onto alumina. Two complementary approaches were carried out: thermodynamic (determination of chemical reactions and associated constants). So we obtain a thermodynamic database for the ternary systems metal/ligand/alumina which we use to define the experimental conditions to observe by spectroscopy sorbed species. Then the identification of surface complexes was carried out using two spectroscopies, XPS and TRLIFS. (author)
Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions
Nefiodov, A. V.; Plunien, G.; Soff, G.
2002-01-01
The influence of nuclear polarization on the bound-electron $g$ factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron $g$ factor in highly charged ions.
Nuclear-polarization correction to the bound-electron g factor in heavy hydrogenlike ions.
Nefiodov, A V; Plunien, G; Soff, G
2002-08-19
The influence of nuclear polarization on the bound-electron g factor in heavy hydrogenlike ions is investigated. Numerical calculations are performed for the K- and L-shell electrons taking into account the dominant virtual nuclear excitations. This determines the ultimate limit for tests of QED utilizing measurements of the bound-electron g factor in highly charged ions.
Regulation of the NLRP3 inflammasome in Porphyromonas gingivalis-accelerated periodontal disease.
Yamaguchi, Yohei; Kurita-Ochiai, Tomoko; Kobayashi, Ryoki; Suzuki, Toshihiko; Ando, Tomohiro
2017-01-01
Porphyromonas gingivalis is involved in the pathogenesis of chronic inflammatory periodontal disease. Recent studies have suggested that the NLRP3 inflammasome plays an important role in the development of chronic inflammation. We investigated a possible association between the inflammasome in gingival inflammation and bone loss induced by P. gingivalis infection using NLRP3-deficient mice. Wild-type and NLRP3-deficient mice were injected orally with P. gingivalis. We assessed alveolar bone loss, expression of pro-interleukin (IL)-1β, pro-IL-18, receptor activator of nuclear factor kappa-B ligand (RANKL), and osteoprotegerin (OPG) in gingival tissue, as well as IL-1β, IL-18, and IL-6 production and caspase-1 activity in peritoneal macrophages. Porphyromonas gingivalis challenge significantly increased alveolar bone loss; gingival gene expression of pro-IL-1β, pro-IL-18, and RANKL; production of IL-1β, IL-18, and IL-6; and caspase-1 activity in peritoneal macrophages of wild-type mice, but did not affect NLRP3-deficient mice. Meanwhile, OPG mRNA expression in gingival tissue and peritoneal IL-6 production were significantly higher in NLRP3-knockout mice. Porphyromonas gingivalis activated innate immune cells via the NLRP3 inflammasome. These results suggest that the NLRP3 inflammasome, followed by a response from the IL-1 family, is critical in periodontal disease induced by wild-type P. gingivalis challenge via sustained inflammation.
Curcumol suppresses RANKL-induced osteoclast formation by attenuating the JNK signaling pathway
International Nuclear Information System (INIS)
Yu, Mingxiang; Chen, Xianying; Lv, Chaoyang; Yi, Xilu; Zhang, Yao; Xue, Mengjuan; He, Shunmei; Zhu, Guoying; Wang, Hongfu
2014-01-01
Highlights: • Curcumol suppresses osteoclasts differentiation in vitro. • Curcumol impairs JNK/AP-1 signaling pathway. • Curcumol may be used for treating osteoclast related diseases. - Abstract: Osteoclasts, derived from hemopoietic progenitors of the monocyte/macrophage lineage, have a unique role in bone resorption, and are considered a potential therapeutic target in the treatment of such pathologic bone diseases as osteoporosis, rheumatoid arthritis, and periodontitis. In the present study, we demonstrate that curcumol, one of the major components of the essential oil of Rhizoma Curcumae, exhibits an inhibitory effect on receptor activator of nuclear factor kappaB ligand (RANKL)-induced osteoclast differentiation with both bone marrow-derived macrophages and RAW264.7 cells in a dose-dependent manner. In addition, RANKL-induced mRNA expression of osteoclast-specific genes, such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K, is prominently reduced in the presence of curcumol. Furthermore, the molecular mechanism of action was investigated, and curcumol inhibited osteoclastogenesis by specifically impairing RANKL-induced c-Jun N-terminal kinase (JNK)/activator protein-1 (AP-1) signaling, which was further identified in rescue studies by means of anisomycin, a JNK signaling-specific activator. Taken together, these findings suggest that curcumol suppresses RANKL-induced osteoclast differentiation through the JNK/AP-1 signaling pathway, and may be useful as a therapeutic treatment for bone resorption-associated diseases
Directory of Open Access Journals (Sweden)
Andressa Vilas Boas Nogueira
2014-01-01
Full Text Available The present study aimed to evaluate in vitro whether biomechanical loading modulates proinflammatory and bone remodeling mediators production by periodontal ligament (PDL cells in the presence of bacterial challenge. Cells were seeded on BioFlex culture plates and exposed to Fusobacterium nucleatum ATCC 25586 and/or cyclic tensile strain (CTS of low (CTSL and high (CTSH magnitudes for 1 and 3 days. Synthesis of cyclooxygenase-2 (COX2 and prostaglandin E2 (PGE2 was evaluated by ELISA. Gene expression and protein secretion of osteoprotegerin (OPG and receptor activator of nuclear factor kappa-B ligand (RANKL were evaluated by quantitative RT-PCR and ELISA, respectively. F. nucleatum increased the production of COX2 and PGE2, which was further increased by CTS. F. nucleatum-induced increase of PGE2 synthesis was significantly (P<0.05 increased when CTSH was applied at 1 and 3 days. In addition, CTSH inhibited the F. nucleatum-induced upregulation of OPG at 1 and 3 days, thereby increasing the RANKL/OPG ratio. OPG and RANKL mRNA results correlated with the protein results. In summary, our findings provide original evidence that CTS can enhance bacterial-induced syntheses of molecules associated with inflammation and bone resorption by PDL cells. Therefore, biomechanical, such as orthodontic or occlusal, loading may enhance the bacterial-induced inflammation and destruction in periodontitis.
A Review on the Relationship between Aspirin and Bone Health
Directory of Open Access Journals (Sweden)
Kok-Yong Chin
2017-01-01
Full Text Available Aspirin is a cyclooxygenase inhibitor commonly used in primary prevention of cardiovascular diseases and cancers. Its users are elderly population susceptible to osteoporosis. It also inhibits the synthesis of prostaglandin E2 essential in bone remodeling. This prompts the question whether it can influence bone health among users. This review aimed to summarize the current literature on the use of aspirin on bone health. A literature search on experimental and clinical evidence on the effects of aspirin on bone health was performed using major scientific databases. In vitro studies showed that aspirin could enhance the survival of bone marrow mesenchymal stem cells, the progenitors of osteoblasts, and stimulate the differentiation of preosteoblasts. Aspirin also inhibited the nuclear factor kappa-B (NFκB pathway and decreased the expression of receptor activator of NFκB ligand, thus suppressing the formation of osteoclast. Aspirin could prevent bone loss in animal models of osteoporosis. Despite a positive effect on bone mineral density, the limited human epidemiological studies revealed that aspirin could not reduce fracture risk. A study even suggested that the use of aspirin increased fracture risk. As a conclusion, aspirin may increase bone mineral density but its effect on fracture prevention is inconclusive. More data are needed to determine the effects of aspirin and bone health in human.
Curcumol suppresses RANKL-induced osteoclast formation by attenuating the JNK signaling pathway
Energy Technology Data Exchange (ETDEWEB)
Yu, Mingxiang, E-mail: yu.mingxiang@zs-hospital.sh.cn [Department of Endocrinology and Metabolism, Zhongshan Hospital, Fudan University, Shanghai (China); Chen, Xianying [Department of Endocrinology and Metabolism, Hainan Provincial Nong Ken Hospital, Hainan (China); Lv, Chaoyang [Department of Endocrinology and Metabolism, Zhongshan Hospital, Fudan University, Shanghai (China); Yi, Xilu [Department of Endocrinology and Metabolism, Shanghai Songjiang District Central Hospital, Shanghai (China); Zhang, Yao; Xue, Mengjuan; He, Shunmei [Department of Endocrinology and Metabolism, Zhongshan Hospital, Fudan University, Shanghai (China); Zhu, Guoying [Institute of Radiation Medicine, Fudan University, Shanghai (China); Wang, Hongfu, E-mail: hfwang@shmu.edu.cn [Institute of Radiation Medicine, Fudan University, Shanghai (China)
2014-05-02
Highlights: • Curcumol suppresses osteoclasts differentiation in vitro. • Curcumol impairs JNK/AP-1 signaling pathway. • Curcumol may be used for treating osteoclast related diseases. - Abstract: Osteoclasts, derived from hemopoietic progenitors of the monocyte/macrophage lineage, have a unique role in bone resorption, and are considered a potential therapeutic target in the treatment of such pathologic bone diseases as osteoporosis, rheumatoid arthritis, and periodontitis. In the present study, we demonstrate that curcumol, one of the major components of the essential oil of Rhizoma Curcumae, exhibits an inhibitory effect on receptor activator of nuclear factor kappaB ligand (RANKL)-induced osteoclast differentiation with both bone marrow-derived macrophages and RAW264.7 cells in a dose-dependent manner. In addition, RANKL-induced mRNA expression of osteoclast-specific genes, such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K, is prominently reduced in the presence of curcumol. Furthermore, the molecular mechanism of action was investigated, and curcumol inhibited osteoclastogenesis by specifically impairing RANKL-induced c-Jun N-terminal kinase (JNK)/activator protein-1 (AP-1) signaling, which was further identified in rescue studies by means of anisomycin, a JNK signaling-specific activator. Taken together, these findings suggest that curcumol suppresses RANKL-induced osteoclast differentiation through the JNK/AP-1 signaling pathway, and may be useful as a therapeutic treatment for bone resorption-associated diseases.
In vitro evaluation of osteoprotegerin in chitosan for potential bone defect applications
Directory of Open Access Journals (Sweden)
Soher Nagi Jayash
2016-08-01
Full Text Available Background The receptor activator of nuclear factor kappa-B (RANK/RANK ligand/osteoprotegerin (OPG system plays a critical role in bone remodelling by regulating osteoclast formation and activity. OPG has been used systemically in the treatment of bone diseases. In searching for more effective and safer treatment for bone diseases, we investigated newly formulated OPG-chitosan complexes, which is prepared as a local application for its osteogenic potential to remediate bone defects. Methods We examined high, medium and low molecular weights of chitosan combined with OPG. The cytotoxicity of OPG in chitosan and its proliferation in vitro was evaluated using normal, human periodontal ligament (NHPL fibroblasts in 2D and 3D cell culture. The cytotoxicity of these combinations was compared by measuring cell survival with a tetrazolium salt reduction (MTT assay and AlamarBlue assay. The cellular morphological changes were observed under an inverted microscope. A propidium iodide and acridine orange double-staining assay was used to evaluate the morphology and quantify the viable and nonviable cells. The expression level of osteopontin and osteocalcin protein in treated normal human osteoblast cells was evaluated by using Western blot. Results The results demonstrated that OPG in combination with chitosan was non-toxic, and OPG combined with low molecular weight chitosan has the most significant effect on NHPL fibroblasts and stimulates proliferation of cells over the period of treatment.
A new class of PN3-pincer ligands for metal–ligand cooperative catalysis
Li, Huaifeng
2014-12-01
Work on a new class of PN3-pincer ligands for metal-ligand cooperative catalysis is reviewed. While the field of the pyridine-based PN3-transition metal pincer complexes is still relatively young, many important applications of these complexes have already emerged. In several cases, the PN3-pincer complexes for metal-ligand cooperative catalysis result in significantly improved or unprecedented activities. The synthesis and coordination chemistry of PN3-pincer ligands are briefly summarized first to cover the synthetic routes for their preparation, followed by a focus review on their applications in catalysis. A specific emphasis is placed on the later section about the role of PN3-pincer ligands\\' dearomatization-rearomatization steps during the catalytic cycles. The mechanistic insights from density functional theory (DFT) calculations are also discussed.
A new class of PN3-pincer ligands for metal–ligand cooperative catalysis
Li, Huaifeng; Zheng, Bin; Huang, Kuo-Wei
2014-01-01
Work on a new class of PN3-pincer ligands for metal-ligand cooperative catalysis is reviewed. While the field of the pyridine-based PN3-transition metal pincer complexes is still relatively young, many important applications of these complexes have already emerged. In several cases, the PN3-pincer complexes for metal-ligand cooperative catalysis result in significantly improved or unprecedented activities. The synthesis and coordination chemistry of PN3-pincer ligands are briefly summarized first to cover the synthetic routes for their preparation, followed by a focus review on their applications in catalysis. A specific emphasis is placed on the later section about the role of PN3-pincer ligands' dearomatization-rearomatization steps during the catalytic cycles. The mechanistic insights from density functional theory (DFT) calculations are also discussed.
Main factors affecting the fixing work about nuclear engineering and its discussion
International Nuclear Information System (INIS)
Zhang Zhihua; Liu Yaoguan; Qian Dazhi; Liu Hangang; Xu Xianqi; Deng Yue
2010-01-01
Main factors to the impact of the fixing work about nuclear engineering such as project design, construction, plan program, document, preparation, order, locale management, surveillance, quality assurance system and so on were presented. These factors were analyzed and discussed in this paper. Some measures and suggestions were put forward to accelerate construction fixing plan and insure good quality. We wish provide some references and help for someone engaged with construction of nuclear engineering. (authors)
Lim, Sung-Chul; Jeon, Ho Jong; Kee, Keun Hong; Lee, Mi Ja; Hong, Ran; Han, Song Iy
2017-01-01
Andrographolide, a natural compound isolated from Andrographis paniculata, has been reported to possess antitumor activity. In the present study, the effect of andrographolide in human gastric cancer (GC) cells was investigated. Andrographolide induced cell death with apoptotic and non-apoptotic features. At a low concentration, andrographolide potentiated apoptosis and reduction of clonogenicity triggered by recombinant human tumor necrosis factor-related apoptosis-inducing ligand (rhTRAIL)....
Ammonia formation by metal-ligand cooperative hydrogenolysis of a nitrido ligand
Askevold, Bjorn; Nieto, Jorge Torres; Tussupbayev, Samat; Diefenbach, Martin; Herdtweck, Eberhardt; Holthausen, Max C.; Schneider, Sven
2011-07-01
Bioinspired hydrogenation of N2 to ammonia at ambient conditions by stepwise nitrogen protonation/reduction with metal complexes in solution has experienced remarkable progress. In contrast, the highly desirable direct hydrogenation with H2 remains difficult. In analogy to the heterogeneously catalysed Haber-Bosch process, such a reaction is conceivable via metal-centred N2 splitting and unprecedented hydrogenolysis of the nitrido ligands to ammonia. We report the synthesis of a ruthenium(IV) nitrido complex. The high nucleophilicity of the nitrido ligand is demonstrated by unusual N-C coupling with π-acidic CO. Furthermore, the terminal nitrido ligand undergoes facile hydrogenolysis with H2 at ambient conditions to produce ammonia in high yield. Kinetic and quantum chemical examinations of this reaction suggest cooperative behaviour of a phosphorus-nitrogen-phosphorus pincer ligand in rate-determining heterolytic hydrogen splitting.
Overview of factors affecting the leachability of nuclear waste forms
International Nuclear Information System (INIS)
Stone, J.A.
1980-01-01
An overview of various factors that affect the leachability of nuclear waste forms is presented. The factors affect primarily the leaching system (temperature, for example), the leachant (pH, for example), or the solid being leached (surface condition, for example). A qualitative understanding exists of the major factors affecting leaching, but further studies are needed to establish leaching mechanisms and develop predictive models. 67 refs
The human orphan nuclear receptor tailless (TLX, NR2E1 is druggable.
Directory of Open Access Journals (Sweden)
Cindy Benod
Full Text Available Nuclear receptors (NRs are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1, a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD. Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP. Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3 that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open.
The human orphan nuclear receptor tailless (TLX, NR2E1) is druggable.
Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S; Hwang, Peter K; Leonard, Paul G; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J; Gustafsson, Jan-Åke; Webb, Paul
2014-01-01
Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open.
Reduction of dinitrogen ligands
International Nuclear Information System (INIS)
Richards, R.L.
1983-01-01
Processes of dinitrogen ligand reduction in complexes of transition metals are considered. The basic character of the dinitrogen ligand is underlined. Data on X-ray photoelectronic spectroscopy and intensities of bands ν (N 2 ) in IR-spectra of nitrogen complexes are given. The mechanism of protonation of an edge dinitrogen ligand is discussed. Model systems and mechanism of nitrogenogenase are compared
International Nuclear Information System (INIS)
Bisson, J.
2011-01-01
The aim of this project is to design and study new extractants for spent nuclear fuel reprocessing. To decrease the long-term radiotoxicity of the waste, the GANEX process is an option to homogeneously recycle actinides. All actinides (U, Np, Pu, Am, Cm) would be extracted together from a highly acidic media and separated from fission products (especially from lanthanides). In this context, fourteen new bi-topic ligands constituted of a nitrogen poly-aromatic unit from the dipyridyl-phenanthroline and dipyridyl-1,3,5-triazine families and functionalized by amid groups were synthesized. Extraction studies performed with some of these ligands confirmed their interest to selectively separate actinides at different oxidation states from an aqueous solution 3M HNO 3 . To determine the influence of ligands structure on cation complexation, a study in a homogenous media (MeOH/H 2 O) has been carried out. Electro-spray ionization mass spectrometry have been used to characterize the complexes stoichiometries formed with several cations (Eu 3+ , Nd 3+ , Am 3+ , Pu 4+ and NpO 2 + ). Stability constants, evaluated by UV-Visible spectrophotometry, confirm the selectivity of these ligands toward actinides. Lanthanides and actinides complexes have also been characterized in the solid state by infra-red spectroscopy and X-Ray diffraction. Associated to nuclear magnetic resonance experiments and DFT calculations (Density Functional Theory), a better knowledge of their coordination mode was achieved. (author) [fr
The human factor in the organisation and regulation of nuclear safety
International Nuclear Information System (INIS)
Bordes, F.; Savagner, J.-M.; Snanoudj, G.
1981-10-01
The TMI accident has brought to light the importance of the human factor in the safe operation of complex installations such as nuclear power plants. On this basis, the paper outlines the institutional framework for nuclear safety in France and reports on EDF practices in human resources management as well as in the improvement of working premises (control rooms) to optimize human behaviour in accident conditions. Finally, the interaction of labour laws on nuclear law in connection with safety is described. (NEA) [fr
Detection of site-specific binding and co-binding of ligands to macromolecules using 19F NMR
International Nuclear Information System (INIS)
Jenkins, B.G.
1991-01-01
Study of ligand-macromolecular interactions by 19 F nuclear magnetic resonance (NMR) spectroscopy affords many opportunities for obtaining molecular biochemical and pharmaceutical information. This is due to the absence of a background fluorine signal, as well as the relatively high sensitivity of 19 F NMR. Use of fluorine-labeled ligands enables one to probe not only binding and co-binding phenomena to macromolecules, but also can provide data on binding constants, stoichiometries, kinetics, and conformational properties of these complexes. Under conditions of slow exchange and macromolecule-induced chemical shifts, multiple 19 F NMR resonances can be observed for free and bound ligands. These shifted resonances are a direct correlate of the concentration of ligand bound in a specific state rather than the global concentrations of bound or free ligand which are usually determined using other techniques such as absorption spectroscopy or equilibrium dialysis. Examples of these interactions are demonstrated both from the literature and from interactions of 5-fluorotryptophan, 5-fluorosalicylic acid, flurbiprofen, and sulindac sulfide with human serum albumin. Other applications of 19 F NMR to study of these interactions in vivo, as well for receptor binding and metabolic tracing of fluorinated drugs and proteins are discussed
Directory of Open Access Journals (Sweden)
Adrian E. Roitberg
2008-06-01
Full Text Available Estrogen receptors (ER are known as nuclear receptors. They exist in the cytoplasm of human cells and serves as a DNA binding transcription factor that regulates gene expression. However the estrogen receptor also has additional functions independent of DNA binding. The human estrogen receptor comes in two forms, alpha and beta. This work focuses on the alpha form of the estrogen receptor. The ERα is found in breast cancer cells, ovarian stroma cells, endometrium, and the hypothalamus. It has been suggested that exposure to DDE, a metabolite of DDT, and other pesticides causes conformational changes in the estrogen receptor. Before examining these factors, this work examines the protein unfolding from the antagonist form found in the 3ERT PDB crystal structure. The 3ERT PDB crystal structure has the estrogen receptor bound to the cancer drug 4-hydroxytamoxifen. The 4-hydroxytamoxifen ligand was extracted before the simulation, resulting in new conformational freedom due to absence of van der Waals contacts between the ligand and the receptor. The conformational changes that result expose the binding clef of the co peptide beside Helix 12 of the receptor forming an apo conformation. Two key conformations in the loops at either end of the H12 are produced resulting in the antagonist to apo conformation transformation. The results were produced over a 42ns Molecular Dynamics simulation using the AMBER FF99SB force field.
Lanthanide - actinide separation: a challenge in the back end of nuclear fuel cycle
International Nuclear Information System (INIS)
Mohapatra, P.K.
2015-01-01
Due to their similar size and chemical state, separation of trivalent lanthanide and actinide ions has always been a challenging topic of research. Of late, the growing concern for the radioactive waste management in the back end of the nuclear fuel cycle has led to the possibility of transmuting the long-lived transuranides in high flux reactors. This necessitates the development of processes for the separation of lanthanides and actinides in acidic/low pH media. In view of the high absorption cross section of few lanthanides, their presence in relatively large proportion (10-100 times) impedes the transmutation process. Processes such as the TRAMEX and TALSPEAK have been used for the separation of lanthanides from trivalent actinides. Of late soft donor ligands containing S and N donor atoms have been used for the selective extraction of trivalent actinide ions. The commercially available S-donor compound, CYANEX 301 (bis(2,4,4-trimethylpentyl) dithiophosphinic acid) has been used to yield separation factor (S.F.) values in the excess of 6000. Synergistic extraction with N-donor ligands such as 2,2'-bipyridyl and 1,10-phenanthroline have yielded S.F. values close to 40,000. N-donor ligands such as BTP (bis-triazinylpyridine), BTBP (bis-triazinylbipyridyl) and BTPhen (bis-triazinyl-phenanthroline) have been particularly effective from relatively acidic feed conditions. The present lecture will give a brief outline of the separation processes and experimental results of studies carried out using various S and N donor ligands. Use of room temperature ionic liquids for more favorable separations will be highlighted. Liquid membrane separation results for application to back end nuclear fuel cycle will also be discussed. (author)
International Nuclear Information System (INIS)
Katzenellenbogen, John A.
2007-01-01
Summary of Progress The specific aims of this project can be summarized as follows: Aim 1: Prepare and evaluate radiolabeled ligands for the peroxisome proliferator-activated receptor γ (PPARγ), a new nuclear hormone receptor target for tumor imaging and hormone therapy. Aim 2: Prepare steroids labeled with a cyclopentadienyl tricarbonyl technetium or rhenium unit. Aim 3: Prepare and evaluate other organometallic systems of novel design as ligand mimics and halogenated ligands for nuclear hormone receptor-based tumor imaging. As is described in detail in the report, we made excellent progress on all three of these aims; the highlights of our progress are the following: (1) we have prepared the first fluorine-18 labeled analogs of ligands for the PPARγ receptor and used these in tissue distribution studies in rats; (2) we have developed three new methods for the synthesis of cyclopentadienyltricarbonyl rhenium and technetium (CpRe(CO)3 and CpTc(CO)3) systems and we have adapted these to the synthesis of steroids labeled with these metals, as well as ligands for other receptor systems; (3) we have prepared a number of fluorine-18 labeled steroidal and non-steroidal androgens and measured their tissue distribution in rats; (4) we have prepared iodine and bromine-labeled progestins with high progesterone receptor binding affinity; and (5) we have prepared inorganic metal tricarbonyl complexes and steroid receptor ligands in which the metal tricarbonyl unit is an integral part off the ligand core
A Study on the Allowable Safety Factor of Cut-Slopes for Nuclear Facilities
Energy Technology Data Exchange (ETDEWEB)
Kim, Myung Soo; Yee, Eric [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of)
2015-10-15
In this study, the issues of allowable safety factor design criteria for cut-slopes in nuclear facilities is derived through case analysis, a proposed construction work slope design criteria that provides relatively detailed conditions can be applied in case of the dry season and some unclear parts of slope design criteria be modified in case of the rainy season. This safety factor can be further subdivided into two; normal and earthquake factors, a factor of 1.5 is applied for normal conditions and a factor of 1.2 is applied for seismic conditions. This safety factor takes into consideration the effect of ground water and rainfall conditions. However, no criteria for the case of cut-slope in nuclear facilities and its response to seismic conditions is clearly defined, this can cause uncertainty in design. Therefore, this paper investigates the allowable safety factor for cut-slopes in nuclear facilities, reviews conditions of both local and international cut-slope models and finally suggests an alternative method of analysis. It is expected that the new design criteria adequately ensures the stability of the cut-slope to reflect clear conditions for both the supervising and design engineers.
International Nuclear Information System (INIS)
Sato, Renato Cesar; Zouain, Desiree Moraes
2012-01-01
To identify and evaluate latent variables (variables that are not directly observed) for adopting and using nuclear technologies in diagnosis and treatment of chronic diseases. The measurement and management of these latent factors are important for health care due to complexities of the sector. Methods: An exploratory factor analysis study was conducted among 52 physicians practicing in the areas of Cardiology, Neurology and Oncology in the State of Sao Paulo who agreed to participate in the study between 2009 and 2010. Data were collected using an attitude measurement questionnaire, and analyzed according to the principal component method with Varimax rotation. Results: The component matrix after factor rotation showed three elucidative groups arranged according to demand for nuclear technology: clinical factors, structural factors, and technological factors. Clinical factors included questionnaire answers referring to medical history, previous interventions, complexity and chronicity of the disease. Structural factors included patient age, physician's practice area, and payment ability. Technological factors included prospective growth in the use of nuclear technology and availability of services. Conclusions: The clinical factors group dimension identified in the study included patient history, prior interventions, and complexity and chronicity of the disease. This dimension is the main motivating for adopting nuclear technology in diagnosis and treatment of chronic diseases. (author)
Kinetic study on ligand exchange reaction between EC and 99mTc-GH
International Nuclear Information System (INIS)
Wu Chunying; Luo Shineng; Fang Ping; Huang Heyun; Xie Minhao; Meng Hong
1995-01-01
The ligand exchange reaction between EC and 99m Tc-GH and its influence factors such as concentrations of EC and pH were described. The concentration of EC has no influence on the exchange reaction rate constant, while pH is the most important influence factor. The rate constants of ligand exchange reaction at different pH values were determined. The results showed that in order to make the labelling yield of 99m Tc-EC higher than 90%, pH of the reaction must be higher than 8
International Nuclear Information System (INIS)
Maeda, Yonezo; Noda, Yosuke; Oshio, Hiroki; Takashima, Yoshimasa; Matsumoto, Naohide
1994-01-01
Magnetic properties, Moessbauer spectra and crystal structures of spin-crossover iron(III) complexes with a quinquedentate ligand [FeLX]BPh 4 are reported. X and L denote a unidentate ligand and a quinquedentate ligand, respectively. [Fe(mbpN)(im)]BPh 4 shows spin-crossover behavior in an appropriate organic solvent, and [Fe(mbpN)(lut)]BPh 4 , [Fe(bpN)(py)]BPh 4 and [Fe(salten)X]BPh 4 (X = 4me-py or 2me-im) show spin-crossover behavior in a solid and in an organic solvent. It was found that the ligand field strength of salten was stronger than that of mbpN. The rates of spin-state interexchange in the complexes are as fast as the inverse of the lifetime (1 x 10 -7 s) of the Moessbauer nuclear level. The Moessbauer spectroscopic behavior of [Fe(mbpN)(lut)]BPh 4 and [Fe(bpN)(py)]BPh 4 is different to that of [Fe(salten)X]BPh 4 (X = 4me-py or 2me-im). The difference was ascribed to the different geometrical positions of the corresponding anions. (orig.)
Human factor engineering applied to nuclear power plant design
International Nuclear Information System (INIS)
Manrique, A.; Valdivia, J.C.
2007-01-01
Advantages of implementing adequate Human Factor Engineering techniques in the design of nuclear reactors have become not only a fact recognized by the majority of engineers and operators but also an explicit requirement regulated and mandatory for the new designs of the so called advanced reactors. The first step for this is preparing a plan to incorporate all the Human Factor Engineering principles and developing an integral design of the Instrumentation and Control and Man-machine interface systems. Such a plan should state: -) Activities to be performed, and -) Creation of a Human Factor Engineering team adequately qualified. The Human Factor Engineering team is an integral part of the design team and is strongly linked to the engineering organizations but simultaneously has independence to act and is free to evaluate designs and propose changes in order to enhance human behavior. TECNATOM S.A. (a Spanish company) has been a part of the Design and Human Factor Engineering Team and has collaborated in the design of an advanced Nuclear Power Plant, developing methodologies and further implementing those methodologies in the design of the plant systems through the development of the plant systems operational analysis and of the man-machine interface design. The methodologies developed are made up of the following plans: -) Human Factor Engineering implementation in the Man-Machine Interface design; -) Plant System Functional Requirement Analysis; -) Allocation of Functions to man/machine; -) Task Analysis; -) Human-System Interface design; -) Control Room Verification and -) Validation
Ligand identification using electron-density map correlations
International Nuclear Information System (INIS)
Terwilliger, Thomas C.; Adams, Paul D.; Moriarty, Nigel W.; Cohn, Judith D.
2007-01-01
An automated ligand-fitting procedure is applied to (F o − F c )exp(iϕ c ) difference density for 200 commonly found ligands from macromolecular structures in the Protein Data Bank to identify ligands from density maps. A procedure for the identification of ligands bound in crystal structures of macromolecules is described. Two characteristics of the density corresponding to a ligand are used in the identification procedure. One is the correlation of the ligand density with each of a set of test ligands after optimization of the fit of that ligand to the density. The other is the correlation of a fingerprint of the density with the fingerprint of model density for each possible ligand. The fingerprints consist of an ordered list of correlations of each the test ligands with the density. The two characteristics are scored using a Z-score approach in which the correlations are normalized to the mean and standard deviation of correlations found for a variety of mismatched ligand-density pairs, so that the Z scores are related to the probability of observing a particular value of the correlation by chance. The procedure was tested with a set of 200 of the most commonly found ligands in the Protein Data Bank, collectively representing 57% of all ligands in the Protein Data Bank. Using a combination of these two characteristics of ligand density, ranked lists of ligand identifications were made for representative (F o − F c )exp(iϕ c ) difference density from entries in the Protein Data Bank. In 48% of the 200 cases, the correct ligand was at the top of the ranked list of ligands. This approach may be useful in identification of unknown ligands in new macromolecular structures as well as in the identification of which ligands in a mixture have bound to a macromolecule
Indian Academy of Sciences (India)
Unknown
Low-temperature stoichiometric Schiff base reaction in air in 3 : 1 mole ratio between benz- aldehyde and triethylenetetramine (trien) in methanol yields a novel tetraaza µ-bis(bidentate) acyclic ligand L. It was .... electrochemical work was performed as reported in ..... change in ligand shape through change in oxidation.
Human factor in the problem of Russian nuclear industry safety
International Nuclear Information System (INIS)
Abramova, V.
2002-01-01
The approach to human factor definition, considered in the paper, consists of recognition of as many as possible factors for developing a complete list of factors, which have influence on mistakes or successful work of NPP personnel. Safety culture is considered as the main factor. The enhancement in nuclear power industry includes an optimization of organizational structures and development of personnel safety attitudes. The organizational factors, as possible root causes for human errors, need to be identified, assessed and improved. The organizational activities taken in Russia are presented
Organisational factors. Their definition and influence on nuclear safety. Final report
International Nuclear Information System (INIS)
Baumont, G.; Wahlstroem, B.; Sola, R.; Williams, J.; Frischknecht, A.; Wilpert, B.; Rollenhagen, C.
2000-12-01
The importance of organisational factors in the operational safety and efficiency of nuclear power plants (NPP) has been recognised by many organisations around the world. Despite this recognition, however, there are as yet very few methods by which organisational factors can be systematically assessed and improved. The majority of research efforts applied so far have tended to be modest and scattered. The ORFA project was created as a remedy to these problems. The objective of the project is to create a better understanding of how organisation and management factors influence nuclear safety. A key scientific objective of the project is to identify components of a theoretical framework, which would help in understanding the relationships between organisational factors and nuclear safety. Three work packages were planned. First, a review of literature listed out the identified factors and methods for assessing them. Then, a draft version of the present report was prepared to clarify the environment context and the main issues of the topics. This draft was discussed at the ORFA seminar in Madrid 21-22 October 1999. During the seminar views and comments were collected on preliminary results of the project. Finally, this information has been integrated in the present and other reports and will be used to give further guidance to the European Commission in the development of forthcoming research programmes in the field. The project has addressed nuclear safety taking a broad perspective, which reflected and took into account the views of senior NPP management and regulators. The questions discussed during the project have been: how can organisational factors be included in safety assessments, how can good and bad operational practices be identified, which methods can be used for detecting weak signals of deteriorating performance, how should incidents be analysed with respect to organisational factors to give the largest learning benefit, how can data on organisational
International Nuclear Information System (INIS)
Yang Hualong; Liu Yanzi; Jia Ming; Huang Weijun
2014-01-01
In order to prevent or reduce human error and ensure the safe operation of nuclear power plants, control device should be verified from the perspective of human factors engineering (HFE). The domestic and international human factors engineering guidelines about nuclear power plant controller were considered, the verification criterion and method of human factors engineering for nuclear power plant controller were discussed and the application examples were provided for reference in this paper. The results show that the appropriate verification criterion and method should be selected to ensure the objectivity and accuracy of the conclusion. (authors)
Directory of Open Access Journals (Sweden)
Léa Décarie-Spain
2018-04-01
Full Text Available Objective: The incidence of depression is significantly compounded by obesity. Obesity arising from excessive intake of high-fat food provokes anxiodepressive behavior and elicits molecular adaptations in the nucleus accumbens (NAc, a region well-implicated in the hedonic deficits associated with depression and in the control of food-motivated behavior. To determine the etiology of diet-induced depression, we studied the impact of different dietary lipids on anxiodepressive behavior and metabolic and immune outcomes and the contribution of NAc immune activity. Methods: Adult C57Bl/6 mice were subjected to isocaloric high-fat/high-sucrose diets (HFD, enriched in either saturated or monounsaturated fat, or a control low-fat diet (LFD. Metabolic responses, anxiodepressive behavior, and plasma and NAc inflammatory markers were assessed after 12 weeks. In separate experiments, an adenoviral construct inhibiting IKKβ, an upstream component of the nuclear factor kappa-b (NFkB pathway, was a priori injected into the NAc. Results: Both HFDs resulted in obesity and hyperleptinemia; however, the saturated HFD uniquely triggered anxiety-like behavior, behavioral despair, hyperinsulinemia, glucose intolerance, peripheral inflammation, and multiple pro-inflammatory signs in the NAc, including reactive gliosis, increased expression of cytokines, antigen-presenting markers and NFкB transcriptional activity. Selective NAc IKKβ inhibition reversed the upregulated expression of inflammatory markers, prevented anxiodepressive behavior and blunted compulsive sucrose-seeking in mice fed the saturated HFD. Conclusions: Metabolic inflammation and NFкB-mediated neuroinflammatory responses in the NAc contribute to the expression of anxiodepressive behavior and heightened food cravings caused by a diet high in saturated fat and sugar. Keywords: Diet-induced obesity, Dietary fatty acids, Nuclear factor kappa-b, Neuroinflammation, Depression, Anxiety, Food reward
Sharma, Sonia; Grandvaux, Nathalie; Mamane, Yael; Genin, Pierre; Azimi, Nazli; Waldmann, Thomas; Hiscott, John
2002-09-15
IFN regulatory factor (IRF)-4 is a lymphoid/myeloid-restricted member of the IRF transcription factor family that plays an essential role in the homeostasis and function of mature lymphocytes. IRF-4 expression is tightly regulated in resting primary T cells and is transiently induced at the mRNA and protein levels after activation by Ag-mimetic stimuli such as TCR cross-linking or treatment with phorbol ester and calcium ionophore (PMA/ionomycin). However, IRF-4 is constitutively upregulated in human T cell leukemia virus type I (HTLV-I) infected T cells as a direct gene target for the HTLV-I Tax oncoprotein. In this study we demonstrate that chronic IRF-4 expression in HTLV-I-infected T lymphocytes is associated with a leukemic phenotype, and we examine the mechanisms by which continuous production of IRF-4 is achieved in HTLV-I-transformed T cells. IRF-4 expression in HTLV-1-infected cells is driven through activation of the NF-kappaB and NF-AT pathways, resulting in the binding of p50, p65, and c-Rel to the kappaB1 element and p50, c-Rel, and NF-ATp to the CD28RE element within the -617 to -209 region of the IRF-4 promoter. Furthermore, mutation of either the kappaB1 or CD28RE sites blocks Tax-mediated transactivation of the human IRF-4 promoter in T cells. These experiments constitute the first detailed analysis of human IRF-4 transcriptional regulation within the context of HTLV-I infection and transformation of CD4(+) T lymphocytes.
Di Fabio, Francesco; Shrier, Ian; Bégin, Louis R; Gordon, Philip H
2008-12-01
Several retrospective studies, including our previous investigation, have shown a prognostic value of nuclear shape factor in colorectal carcinomas. This prospective study was designed to assess the reliability of nuclear shape factor determined by nuclear morphometry and to confirm its prognostic value. Ninety-eight patients who underwent colorectal carcinoma resection were prospectively enrolled. Measurement of nuclear shape factor was performed by using a computer-based image analysis system. Nuclear shape factor was defined as the degree of circularity of the nucleus (1.0 for a perfect circle and values by American Joint Committee on Cancer stage were: 0.73 (0.07) in Stage I, 0.74 (0.06) in Stage II, and 0.75 (0.05) in Stage III carcinomas (P = 0.78, ANOVA). The intraobserver agreement was poor for observer A (r = 0.28) and practically nonexistent for observer B (r = -0.004, Pearson correlation). The intraclass coefficient for interobserver agreement was practically nonexistent. No significant association between nuclear shape factor and ten-year survival was found. Our prospective results, as opposed to our previous retrospective results, suggest that the reliability for nuclear shape factor morphometric analysis is very poor. We failed to confirm a prognostic value for nuclear shape factor in colorectal carcinoma.
Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.
Directory of Open Access Journals (Sweden)
Georgi K Marinov
Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.
Contrasting roles for TLR ligands in HIV-1 pathogenesis.
Directory of Open Access Journals (Sweden)
Beda Brichacek
2010-09-01
Full Text Available The first line of a host's response to various pathogens is triggered by their engagement of cellular pattern recognition receptors (PRRs. Binding of microbial ligands to these receptors leads to the induction of a variety of cellular factors that alter intracellular and extracellular environment and interfere directly or indirectly with the life cycle of the triggering pathogen. Such changes may also affect any coinfecting microbe. Using ligands to Toll-like receptors (TLRs 5 and 9, we examined their effect on human immunodeficiency virus (HIV-1 replication in lymphoid tissue ex vivo. We found marked differences in the outcomes of such treatment. While flagellin (TLR5 agonist treatment enhanced replication of CC chemokine receptor 5 (CCR 5-tropic and CXC chemokine receptor 4 (CXCR4-tropic HIV-1, treatment with oligodeoxynucleotide (ODN M362 (TLR9 agonist suppressed both viral variants. The differential effects of these TLR ligands on HIV-1 replication correlated with changes in production of CC chemokines CCL3, CCL4, CCL5, and of CXC chemokines CXCL10, and CXCL12 in the ligand-treated HIV-1-infected tissues. The nature and/or magnitude of these changes were dependent on the ligand as well as on the HIV-1 viral strain. Moreover, the tested ligands differed in their ability to induce cellular activation as evaluated by the expression of the cluster of differentiation markers (CD 25, CD38, CD39, CD69, CD154, and human leukocyte antigen D related (HLA-DR as well as of a cell proliferation marker, Ki67, and of CCR5. No significant effect of the ligand treatment was observed on apoptosis and cell death/loss in the treated lymphoid tissue ex vivo. Our results suggest that binding of microbial ligands to TLRs is one of the mechanisms that mediate interactions between coinfected microbes and HIV-1 in human tissues. Thus, the engagement of appropriate TLRs by microbial molecules or their mimetic might become a new strategy for HIV therapy or prevention.
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
Development of novel non agoinst PPAR-gamma ligands for lung cancer treatment
2017-08-01
AWARD NUMBER: W81XWH-15-1-0165 TITLE: Development of novel non-agoinst PPAR-gamma ligands for lung cancer treatment . PRINCIPAL INVESTIGATOR...factor PPARγ, the thiazolidinediones (TZDs), synergized with carboplatin treatment of lung cancer in vitro and in vivo. Unfortunately, the use of TZDs...novel therapeutics with potential in lung cancer , we have explored the role of these non- agonist PPARγ ligands in cancer treatment . We have
Directory of Open Access Journals (Sweden)
Macejova Dana
2016-07-01
Full Text Available Retinoic acid (RA, an active form of vitamin A, regulates the embryonic development, male and female reproduction and induces important effects on the cell development, proliferation, and differentiation. These effects are mediated by the retinoid (RAR and rexinoid nuclear receptors (RXR, which are considered to be a ligand-activated, DNA-binding, trans-acting, and transcription-modulating proteins, involved in a general molecular mechanism responsible for the transcriptional responses in target genes. Organotin compounds are typical environmental contaminants and suspected endocrine disrupting substances. They may affect processes of reproductive system in mammals, predominantly via nuclear receptor signaling pathways. Triorganotins, such as tributyltin chloride (TBTCl and triphenyltin chloride (TPTCl, are capable to bind to RXR molecules, and thus represent potent agonists of RXR subtypes of nuclear receptors not sharing any structural characteristics with endogenous ligands of nuclear receptors. Th is article summarizes selected effects of biologically active retinoids and rexinoids on both male and female reproduction and also deals with the effects of organotin compounds evoking endocrine disrupting actions in reproduction.
International Nuclear Information System (INIS)
Mehmood, Rashid; Yasuhara, Noriko; Oe, Souichi; Nagai, Masahiro; Yoneda, Yoshihiro
2009-01-01
The transition from undifferentiated pluripotent cells to terminally differentiated neurons is coordinated by a repertoire of transcription factors. NeuroD1 is a type II basic helix loop helix (bHLH) transcription factor that plays critical roles in neuronal differentiation and maintenance in the central nervous system. Its dimerization with E47, a type I bHLH transcription factor, leads to the transcriptional regulation of target genes. Mounting evidence suggests that regulating the localization of transcription factors contributes to the regulation of their activity during development as defects in their localization underlie a variety of developmental disorders. In this study, we attempted to understand the nuclear import mannerisms of NeuroD1 and E47. We found that the nuclear import of NeuroD1 and E47 is energy-dependent and involves the Ran-mediated pathway. Herein, we demonstrate that NeuroD1 and E47 can dimerize inside the cytoplasm before their nuclear import. Moreover, this dimerization promotes nuclear import as the nuclear accumulation of NeuroD1 was enhanced in the presence of E47 in an in vitro nuclear import assay, and NLS-deficient NeuroD1 was successfully imported into the nucleus upon E47 overexpression. NeuroD1 also had a similar effect on the nuclear accumulation of NLS-deficient E47. These findings suggest a novel role for dimerization that may promote, at least partially, the nuclear import of transcription factors allowing them to function efficiently in the nucleus.
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Regression analysis of nuclear plant capacity factors
International Nuclear Information System (INIS)
Stocks, K.J.; Faulkner, J.I.
1980-07-01
Operating data on all commercial nuclear power plants of the PWR, HWR, BWR and GCR types in the Western World are analysed statistically to determine whether the explanatory variables size, year of operation, vintage and reactor supplier are significant in accounting for the variation in capacity factor. The results are compared with a number of previous studies which analysed only United States reactors. The possibility of specification errors affecting the results is also examined. Although, in general, the variables considered are statistically significant, they explain only a small portion of the variation in the capacity factor. The equations thus obtained should certainly not be used to predict the lifetime performance of future large reactors
International Nuclear Information System (INIS)
Cura, Vincent; Gangloff, Monique; Eiler, Sylvia; Moras, Dino; Ruff, Marc
2007-01-01
A new crystallization strategy: the presence of cleaved thioredoxin fusion is critical for crystallization of the estrogen nuclear receptor ligand binding domain in complex with synthetic ligands. This novel technique should be regarded as an interesting alternative for crystallization of difficult proteins. The ligand-binding domain (LBD) of human oestrogen receptor α was produced in Escherichia coli as a cleavable thioredoxin (Trx) fusion in order to improve solubility. Crystallization trials with either cleaved and purified LBD or with the purified fusion protein both failed to produce crystals. In another attempt, Trx was not removed from the LBD after endoproteolytic cleavage and its presence promoted nucleation and subsequent crystal growth, which allowed the structure determination of two different LBD–ligand–coactivator peptide complexes at 2.3 Å resolution. This technique is likely to be applicable to other low-solubility proteins
International Nuclear Information System (INIS)
Kimura, Hiroshi; Suzuki, Atsuyuki; Furuta, Kazuo
2003-01-01
The purpose of this research is to clarify how psychological factors' impact on public acceptance of nuclear energy varies with where they live and their degree of knowledge. For this purpose, we carried out questionnaire survey about nuclear energy at three urban areas and two nuclear power plant siting areas. After collecting data, we applied factor analysis to the data, and found four factors which construct cognitive structure of nuclear energy. Using multiple regression analysis, we evaluated the impact of the four factors on two issues: the decision for or against nuclear policy and the reaction to nuclear power plant siting, and compared changes of the impact by where respondents live and their degree of knowledge. Consequently, we found that the impact of all four factors on the two issues varies with where respondents live. We also found that the impact of respondents' degree of knowledge to four factors varies with where they live. (author)
International Nuclear Information System (INIS)
Seminara, J.L.; Seidenstein, S.; Eckert, S.K.; Smith, D.L.
1979-11-01
Human factors engineering is an interdisciplinary specialty concerned with influencing the design of equipment systems, facilities, and operational environments to promote safe, efficient, and reliable operator performance. Human factors approaches were applied in the design of representative nuclear power plant control panels. First, methods for upgrading existing operational control panels were examined. Then, based on detailed human factors analyses of operator information and control requirements, designs of reactor, feedwater, and turbine-generator control panels were developed to improve the operator-control board interface, thereby reducing the potential for operator errors. In addition to examining present-generation concepts, human factors aspects of advanced systems and of hybrid combinations of advanced and conventional designs were investigated. Special attention was given to warning system designs. Also, a survey was conducted among control board designers to (1) develop an overview of design practices in the industry, and (2) establish appropriate measures leading to a more systematic concern for human factors in control board design
Alger, Heather M.; Raben, Nina; Pistilli, Emidio; Francia, Dwight; Rawat, Rashmi; Getnet, Derese; Ghimbovschi, Svetlana; Chen, Yi-Wen; Lundberg, Ingrid E.; Nagaraju, Kanneboyina
2011-01-01
Objective Multinucleated cells are relatively resistant to classical apoptosis, and the factors initiating cell-death and damage in myositis are not well defined. We hypothesized that non-immune autophagic cell death may play a role in muscle fiber damage. Recent literature indicates that tumor necrosis factor-alpha-related apoptosis inducing ligand (TRAIL) may induce both NFκB (nuclear factor kappa-light chain enhancer of activated B cells) activation and autophagic cell death in other systems. Here, we have investigated its role in cell death and pathogenesis in vitro and in vivo using myositis (human and mouse) muscle tissues. Methods Gene expression profiling indicated that expression of TRAIL and several autophagy markers was specifically upregulated in myositis muscle tissue; these results were confirmed by immunohistochemistry and immunoblotting. We also analyzed TRAIL-induced cell death (apoptosis and autophagy) and NFκB activation in vitro in cultured cells. Results TRAIL was expressed predominantly in muscle fibers of myositis, but not in biopsies from normal or other dystrophic-diseased muscle. Autophagy markers were upregulated in human and mouse models of myositis. TRAIL expression was restricted to regenerating/atrophic areas of muscle fascicles, blood vessels, and infiltrating lymphocytes. TRAIL induced NFκB activation and IκB degradation in cultured cells that are resistant to TRAIL-induced apoptosis but undergo autophagic cell death. Conclusion Our data demonstrate that TRAIL is expressed in myositis muscle and may mediate both activation of NFκB and autophagic cell death in myositis. Thus, this non-immune pathway may be an attractive target for therapeutic intervention in myositis. PMID:21769834
Organizational factors and nuclear power plant safety
International Nuclear Information System (INIS)
Haber, S.B.
1995-01-01
There are many organizations in our society that depend on human performance to avoid incidents involving significant adverse consequences. As our culture and technology have become more sophisticated, the management of risk on a broad basis has become more and more critical. The safe operation of military facilities, chemical plants, airlines, and mass transit, to name a few, are substantially dependent on the performance of the organizations that operate those facilities. The nuclear power industry has, within the past 15 years, increased the attention given to the influence of human performance in the safe operation of nuclear power plants (NPP). While NPPs have been designed through engineering disciplines to intercept and mitigate events that could cause adverse consequences, it has been clear from various safety-related incidents that human performance also plays a dominant role in preventing accidents. Initial efforts following the 1979 Three Mile Island incident focused primarily on ergonomic factors (e.g., the best design of control rooms for maximum performance). Greater attention was subsequently directed towards cognitive processes involved in the use of NPP decision support systems and decision making in general, personnel functions such as selection systems, and the influence of work scheduling and planning on employees' performance. Although each of these approaches has contributed to increasing the safety of NPPS, during the last few years, there has been a growing awareness that particular attention must be paid to how organizational processes affect NPP personnel performance, and thus, plant safety. The direct importance of organizational factors on safety performance in the NPP has been well-documented in the reports on the Three Mile Island and Chernobyl accidents as well as numerous other events, especially as evaluated by the U.S. Nuclear Regulatory Commission (NRC)
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Biosensors engineered from conditionally stable ligand-binding domains
Church, George M.; Feng, Justin; Mandell, Daniel J.; Baker, David; Fields, Stanley; Jester, Benjamin Ward; Tinberg, Christine Elaine
2017-09-19
Disclosed is a biosensor engineered to conditionally respond to the presence of specific small molecules, the biosensors including conditionally stable ligand-binding domains (LBDs) which respond to the presence of specific small molecules, wherein readout of binding is provided by reporter genes or transcription factors (TFs) fused to the LBDs.
Study of greenhouse gases emission factor for nuclear power chain of China
International Nuclear Information System (INIS)
Ma Zhonghai; Pan Ziqiang; Xie Jianlun; Xiu Binglin
2001-01-01
The Greenhouse Gases Emission Factor (GGEF) for nuclear power chain of China is calculated based on Life Cycle Analysis method and the definition of full energy chain. There is no greenhouse gases released directly from nuclear power plant. The greenhouse gases emission from nuclear power plant is mainly from coal-fired electricity supply to nuclear power plant for its normal operation and the production of construction materials those are used in the nuclear power plant. The total GGEF of nuclear power chain in China is 13.71 g-co 2 /kWh. It is necessary to regulate un-rational power source mix and to use the energy sources in rational way for reducing the greenhouse gas effect. Nuclear power for electricity generation is one of effective ways to reduce greenhouse gases emission and retard the greenhouse effect
Reversible Redox-Induced Modulation of Sterics in an α-Diimine Ligand Coordinated to Gallium
Energy Technology Data Exchange (ETDEWEB)
Zarkesh, Ryan A. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Foster, Michael E. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Ichimura, Andrew S. [San Francisco State Univ., CA (United States); Anstey, Mitchell R. [Davidson College, Davidson, NC (United States)
2017-07-01
The ability to tune the steric envelope through redox events post-synthetically or in tandem with other chemical processes is a powerful tool that could assist in enabling new catalytic methodologies and understanding potential pitfalls in ligand design. The α-diimine ligand, dmp-BIAN, exhibits the peculiar and previously unreported feature of varying steric profiles depending on oxidation state when paired with a main group element. A study of the factors that give rise to this behaviour as well as its impact on the incorporation of other ligands is performed.
Eiber, Matthias; Herrmann, Ken; Calais, Jeremie; Hadaschik, Boris; Giesel, Frederik L; Hartenbach, Markus; Hope, Thomas; Reiter, Robert; Maurer, Tobias; Weber, Wolfgang A; Fendler, Wolfgang P
2018-03-01
Prostate-specific membrane antigen (PSMA)-ligand PET imaging provides unprecedented accuracy for whole-body staging of prostate cancer. As PSMA-ligand PET/CT is increasingly adopted in clinical trials and routine practice worldwide, a unified language for image reporting is urgently needed. We propose a molecular imaging TNM system (miTNM, version 1.0) as a standardized reporting framework for PSMA-ligand PET/CT or PET/MRI. miTNM is designed to organize findings in comprehensible categories to promote the exchange of information among physicians and institutions. Additionally, flowcharts integrating findings of PSMA-ligand PET and morphologic imaging have been designed to guide image interpretation. Specific applications, such as assessment of prognosis or impact on management, should be evaluated in future trials. miTNM is a living framework that evolves with clinical experience and scientific data. © 2018 by the Society of Nuclear Medicine and Molecular Imaging.
Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM
International Nuclear Information System (INIS)
Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim
2014-01-01
Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations
Steroid receptors and their ligands: Effects on male gamete functions
International Nuclear Information System (INIS)
Aquila, Saveria; De Amicis, Francesca
2014-01-01
In recent years a new picture of human sperm biology is emerging. It is now widely recognized that sperm contain nuclear encoded mRNA, mitochondrial encoded RNA and different transcription factors including steroid receptors, while in the past sperm were considered incapable of transcription and translation. One of the main targets of steroid hormones and their receptors is reproductive function. Expression studies on Progesterone Receptor, estrogen receptor, androgen receptor and their specific ligands, demonstrate the presence of these systems in mature spermatozoa as surface but also as nuclear conventional receptors, suggesting that both systemic and local steroid hormones, through sperm receptors, may influence male reproduction. However, the relationship between the signaling events modulated by steroid hormones and sperm fertilization potential as well as the possible involvement of the specific receptors are still controversial issues. The main line of this review highlights the current research in human sperm biology examining new molecular systems of response to the hormones as well as specific regulatory pathways controlling sperm cell fate and biological functions. Most significant studies regarding the identification of steroid receptors are reported and the mechanistic insights relative to signaling pathways, together with the change in sperm metabolism energy influenced by steroid hormones are discussed.The reviewed evidences suggest important effects of Progesterone, Estrogen and Testosterone and their receptors on spermatozoa and implicate the involvement of both systemic and local steroid action in the regulation of male fertility potential. - Highlights: • One of the main targets of steroid hormones and their receptors is reproductive function. • Pg/PR co-work to stimulate enzymatic activities to sustain a capacitation process. • E2/ERs regulate sperm motility, capacitation and acrosome reaction and act as survival factors. • Androgens
Steroid receptors and their ligands: Effects on male gamete functions
Energy Technology Data Exchange (ETDEWEB)
Aquila, Saveria; De Amicis, Francesca, E-mail: francesca.deamicis@unical.it
2014-11-01
In recent years a new picture of human sperm biology is emerging. It is now widely recognized that sperm contain nuclear encoded mRNA, mitochondrial encoded RNA and different transcription factors including steroid receptors, while in the past sperm were considered incapable of transcription and translation. One of the main targets of steroid hormones and their receptors is reproductive function. Expression studies on Progesterone Receptor, estrogen receptor, androgen receptor and their specific ligands, demonstrate the presence of these systems in mature spermatozoa as surface but also as nuclear conventional receptors, suggesting that both systemic and local steroid hormones, through sperm receptors, may influence male reproduction. However, the relationship between the signaling events modulated by steroid hormones and sperm fertilization potential as well as the possible involvement of the specific receptors are still controversial issues. The main line of this review highlights the current research in human sperm biology examining new molecular systems of response to the hormones as well as specific regulatory pathways controlling sperm cell fate and biological functions. Most significant studies regarding the identification of steroid receptors are reported and the mechanistic insights relative to signaling pathways, together with the change in sperm metabolism energy influenced by steroid hormones are discussed.The reviewed evidences suggest important effects of Progesterone, Estrogen and Testosterone and their receptors on spermatozoa and implicate the involvement of both systemic and local steroid action in the regulation of male fertility potential. - Highlights: • One of the main targets of steroid hormones and their receptors is reproductive function. • Pg/PR co-work to stimulate enzymatic activities to sustain a capacitation process. • E2/ERs regulate sperm motility, capacitation and acrosome reaction and act as survival factors. • Androgens
Bitopic Ligands and Metastable Binding Sites
DEFF Research Database (Denmark)
Fronik, Philipp; Gaiser, Birgit I; Sejer Pedersen, Daniel
2017-01-01
of orthosteric binding sites. Bitopic ligands have been employed to address the selectivity problem by combining (linking) an orthosteric ligand with an allosteric modulator, theoretically leading to high-affinity subtype selective ligands. However, it remains a challenge to identify suitable allosteric binding...... that have been reported to date, this type of bitopic ligands would be composed of two identical pharmacophores. Herein, we outline the concept of bitopic ligands, review metastable binding sites, and discuss their potential as a new source of allosteric binding sites....
Kaur, Gurpreet; Delluc-Clavieres, Aurelie; Poon, Ivan K H; Forwood, Jade K; Glover, Dominic J; Jans, David A
2010-08-15
The HMG (high-mobility group)-box-containing chromatin-remodelling factor SRY (sex-determining region on the Y chromosome) plays a key role in sex determination. Its role in the nucleus is critically dependent on two NLSs (nuclear localization signals) that flank its HMG domain: the C-terminally located 'beta-NLS' that mediates nuclear transport through Impbeta1 (importin beta1) and the N-terminally located 'CaM-NLS' which is known to recognize the calcium-binding protein CaM (calmodulin). In the present study, we examined a number of missense mutations in the SRY CaM-NLS from human XY sex-reversed females for the first time, showing that they result in significantly reduced nuclear localization of GFP (green fluorescent protein)-SRY fusion proteins in transfected cells compared with wild-type. The CaM antagonist CDZ (calmidazolium chloride) was found to significantly reduce wild-type SRY nuclear accumulation, indicating dependence of SRY nuclear import on CaM. Intriguingly, the CaM-NLS mutants were all resistant to CDZ's effects, implying a loss of interaction with CaM, which was confirmed by direct binding experiments. CaM-binding/resultant nuclear accumulation was the only property of SRY found to be impaired by two of the CaM-NLS mutations, implying that inhibition of CaM-dependent nuclear import is the basis of sex reversal in these cases. Importantly, the CaM-NLS is conserved in other HMG-box-domain-containing proteins such as SOX-2, -9, -10 and HMGN1, all of which were found for the first time to rely on CaM for optimal nuclear localization. CaM-dependent nuclear translocation is thus a common mechanism for this family of important transcription factors.
Nishigaki, Masaru; Yamamoto, Toshiro; Ichioka, Hiroaki; Honjo, Ken-Ichi; Yamamoto, Kenta; Oseko, Fumishige; Kita, Masakazu; Mazda, Osam; Kanamura, Narisato
2013-07-01
β-cryptoxanthin (β-cry) is a type of carotenoid found in certain fruits and vegetables. Although it has been shown that β-cry inhibits alveolar bone resorption, the molecular mechanisms for this have not yet been clarified. In the present study, we investigated the effects of β-cry on bone resorption related-cytokine production in human periodontal ligament (hPDL) cells. hPDL cells were stimulated with β-cry (1×10(-7)mol/l), mechanical stress (1 or 6MPa), and P. gingivalis. The production of interleukin (IL)-1β, IL-6, IL-8, tumour necrosis factor (TNF)-α, osteoprotegerin (OPG), and receptor activator of nuclear factor kappa-B ligand (RANKL) were analyzed by RT-PCR and ELISA. The production of IL-1β, IL-6, IL-8, and TNF-α was not induced in hPDL cells after stimulation with β-cry, although these cytokines were produced after stimulation with P. gingivalis. On the other hand, IL-6 and IL-8 were produced after exposure to 6MPa of mechanical stress. The production of IL-6 and IL-8 was significantly decreased by the addition of β-cry. Furthermore, β-cry up-regulated the production of OPG, but not RANKL. β-cry inhibited the production of IL-6 and IL-8 induced by mechanical stress and periodontopathogenic bacteria in hPDL cells. Moreover, β-cry up-regulated OPG production. These results suggest that β-cry may prevent bone resorption in periodontitis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Safety and tolerability of denosumab for the treatment of postmenopausal osteoporosis
Directory of Open Access Journals (Sweden)
Lewiecki EM
2011-12-01
Full Text Available E Michael LewieckiNew Mexico Clinical Research & Osteoporosis Center, Albuquerque, New Mexico, USAAbstract: Denosumab is a fully human monoclonal antibody to receptor activator of nuclear factor kappa-B ligand (RANKL, a cytokine member of the tumor necrosis factor family that is the principal regulator of osteoclastic bone resorption. Postmenopausal osteoporosis (PMO is a systemic skeletal disease associated with high levels of RANKL, resulting in a high rate of bone remodeling and an imbalance of bone resorption over bone formation. By inhibiting RANKL in women with PMO, denosumab reduces the rate of bone remodeling, thereby increasing bone mineral density, improving bone strength, and reducing the risk of fractures. In clinical trials of women with osteoporosis and low bone mineral density, denosumab has been well tolerated, with overall rates of adverse events and serious adverse events in women treated with denosumab similar to those receiving placebo. In the largest clinical trial of denosumab for the treatment of women with PMO, there was a significantly greater incidence of cellulitis reported as a serious adverse event, with no difference in the overall incidence of cellulitis, and a significantly lower incidence of the serious adverse event of concussions with denosumab compared with placebo. The evidence supports a favorable balance of benefits versus risks of denosumab for the treatment of PMO. Assessments of the long-term safety of denosumab are ongoing. Denosumab 60 mg subcutaneously every 6 months is an approved treatment for women with PMO who are at high risk for fracture.Keywords: denosumab, osteoporosis, safety, risk, benefit, FDA
Bitra, Anusha; Rani, B Jhansi; Agarkar, Sanket S; Parihar, Anuj S; Vynath, Gopinath P; Grover, Shekhar
2017-10-01
Orthodontic treatment is one of the commonly used dental treatments. Orthodontic forces act on the bone by modulating the biomolecules, chiefly the osteoprotegerin (OPG), osteopontin (OPN), receptor activator of nuclear factor kappa-B (RANK), and RANK ligand (RANKL) (OPG ligand). Hormonal changes are known to cause marked alteration in the levels of these biomolecules. Hence, we planned this study to evaluate the response of bone biomarkers in the gingival crevicular fluid (GCF) in postmenopausal women undergoing fixed orthodontic therapy. This study included assessment of 50 subjects who underwent orthodontic treatment from June 2012 to July 2016. All the patients were divided into two study groups with 25 patients in each group: premenopausal group and postmenopausal group. Similar orthodontic wires were used for controlling the forces applied in subjects of both the study groups and their GCF levels of RANKL, and OPN was assessed at baseline and 24 hours after the activation of orthodontic forces. All the results were compiled, assessed, and analyzed by Statistical Package for the Social Sciences software version 16.0. Chi-square test, Student's t-test, and Mann-Whitney U test were used for the assessment of the level of significance. The mean values of RANKL and OPN in the premenopausal and postmenopausal groups were found to be 241.52 and 317.15 pg/μL respectively. The mean values of RANKL at baseline in the premenopausal and postmenopausal groups were found to be 7.15 and 3.84 pg/μL respectively. Nonsignificant results were obtained while comparing mean OPN and RANKL level alteration in between the two study groups. The mean alterations in the GCF levels of bone biomarkers are similar for both premenopausal and postmeno-pausal women. For women with either premenopausal or postmenopausal status, orthodontic treatment appears to be equally safer.
Action mechanisms of Liver X Receptors
Energy Technology Data Exchange (ETDEWEB)
Gabbi, Chiara; Warner, Margaret [Center for Nuclear Receptors and Cell Signaling, University of Houston, 3056 Cullen Blv, 77204 Houston, Texas (United States); Gustafsson, Jan-Åke, E-mail: jgustafs@central.uh.edu [Center for Nuclear Receptors and Cell Signaling, University of Houston, 3056 Cullen Blv, 77204 Houston, Texas (United States); Department of Biosciences and Nutrition, Karolinska Institutet, Novum S-141 86 (Sweden)
2014-04-11
Highlights: • LXRα and LXRβ are ligand-activated nuclear receptors. • They share oxysterol ligands and the same heterodimerization partner, RXR. • LXRs regulate lipid and glucose metabolism, CNS and immune functions, and water transport. - Abstract: The two Liver X Receptors, LXRα and LXRβ, are nuclear receptors belonging to the superfamily of ligand-activated transcription factors. They share more than 78% homology in amino acid sequence, a common profile of oxysterol ligands and the same heterodimerization partner, Retinoid X Receptor. LXRs play crucial roles in several metabolic pathways: lipid metabolism, in particular in preventing cellular cholesterol accumulation; glucose homeostasis; inflammation; central nervous system functions and water transport. As with all nuclear receptors, the transcriptional activity of LXR is the result of an orchestration of numerous cellular factors including ligand bioavailability, presence of corepressors and coactivators and cellular context i.e., what other pathways are activated in the cell at the time the receptor recognizes its ligand. In this mini-review we summarize the factors regulating the transcriptional activity and the mechanisms of action of these two receptors.
Action mechanisms of Liver X Receptors
International Nuclear Information System (INIS)
Gabbi, Chiara; Warner, Margaret; Gustafsson, Jan-Åke
2014-01-01
Highlights: • LXRα and LXRβ are ligand-activated nuclear receptors. • They share oxysterol ligands and the same heterodimerization partner, RXR. • LXRs regulate lipid and glucose metabolism, CNS and immune functions, and water transport. - Abstract: The two Liver X Receptors, LXRα and LXRβ, are nuclear receptors belonging to the superfamily of ligand-activated transcription factors. They share more than 78% homology in amino acid sequence, a common profile of oxysterol ligands and the same heterodimerization partner, Retinoid X Receptor. LXRs play crucial roles in several metabolic pathways: lipid metabolism, in particular in preventing cellular cholesterol accumulation; glucose homeostasis; inflammation; central nervous system functions and water transport. As with all nuclear receptors, the transcriptional activity of LXR is the result of an orchestration of numerous cellular factors including ligand bioavailability, presence of corepressors and coactivators and cellular context i.e., what other pathways are activated in the cell at the time the receptor recognizes its ligand. In this mini-review we summarize the factors regulating the transcriptional activity and the mechanisms of action of these two receptors
DEFF Research Database (Denmark)
Lassen, Peter Rygaard
2006-01-01
The infrared and vibrational circular dichroism (VCD) spectra of six chiral oxorhenium(V) complexes, bearing a hydrotris(1-pyrazolyl)borate (Tp) ligand, have been investigated. These complexes are promising candidates for observation of parity violation (symmetry breaking due to the weak nuclear...
Lazennec, Gwendal; Canaple, Laurence; Saugy, Damien; Wahli, Walter
2000-01-01
The nuclear peroxisome proliferator-activated receptors (PPARs) α, β and γ activate the transcription of multiple genes involved in lipid metabolism. Several natural and synthetic ligands have been identified for each PPAR isotype but little is known about the phosphorylation state of these receptors. We show here that activators of protein kinase A (PKA) can enhance mouse PPAR activity in the absence and the presence of exogenous ligands in transient transfection experiments. The activation function 1 (AF-1) of PPARs was dispensable for transcriptional enhancement, whereas the activation function 2 (AF-2) was required for this effect. We also show that several domains of PPAR can be phosphorylated by PKA in vitro. Moreover, gel experiments suggest that PKA stabilizes binding of the liganded PPAR to DNA. PKA inhibitors decreased not only the kinase dependent induction of PPARs but also their ligand-dependent induction, suggesting that the ligands may also mobilize the PKA pathway to lead to maximal transcriptional induction by PPARs. Moreover, comparing PPARα KO with PPARα wild-type mice, we show that the expression of the ACO gene can be regulated by PKA-activated PPARα in liver. These data demonstrate that the PKA pathway is an important modulator of PPAR activity and we propose a model associating this pathway in the control of fatty acid β-oxidation under conditions of fasting, stress and exercise. PMID:11117527
Directory of Open Access Journals (Sweden)
Susanne Vogeler
Full Text Available Disruption of nuclear receptors, a transcription factor superfamily regulating gene expression in animals, is one proposed mechanism through which pollution causes effects in aquatic invertebrates. Environmental pollutants have the ability to interfere with the receptor's functions through direct binding and inducing incorrect signals. Limited knowledge of invertebrate endocrinology and molecular regulatory mechanisms, however, impede the understanding of endocrine disruptive effects in many aquatic invertebrate species. Here, we isolated three nuclear receptors of the Pacific oyster, Crassostrea gigas: two isoforms of the retinoid X receptor, CgRXR-1 and CgRXR-2, a retinoic acid receptor ortholog CgRAR, and a peroxisome proliferator-activated receptor ortholog CgPPAR. Computer modelling of the receptors based on 3D crystal structures of human proteins was used to predict each receptor's ability to bind to different ligands in silico. CgRXR showed high potential to bind and be activated by 9-cis retinoic acid and the organotin tributyltin (TBT. Computer modelling of CgRAR revealed six residues in the ligand binding domain, which prevent the successful interaction with natural and synthetic retinoid ligands. This supports an existing theory of loss of retinoid binding in molluscan RARs. Modelling of CgPPAR was less reliable due to high discrepancies in sequence to its human ortholog. Yet, there are suggestions of binding to TBT, but not to rosiglitazone. The effect of potential receptor ligands on early oyster development was assessed after 24h of chemical exposure. TBT oxide (0.2μg/l, all-trans retinoic acid (ATRA (0.06 mg/L and perfluorooctanoic acid (20 mg/L showed high effects on development (>74% abnormal developed D-shelled larvae, while rosiglitazone (40 mg/L showed no effect. The results are discussed in relation to a putative direct (TBT disruption effect on nuclear receptors. The inability of direct binding of ATRA to CgRAR suggests
Identification of ligand-selective peptidic ActRIIB-antagonists using phage display technology
Directory of Open Access Journals (Sweden)
Kotaro Sakamoto
2017-09-01
Full Text Available ActRIIB (activin receptor type-2B is an activin receptor subtype constitutively expressed in the whole body, playing a role in cellular proliferation, differentiation, and metabolism. For its various physiological activities, ActRIIB interacts with activin and multiple other ligands including myostatin (MSTN, growth differentiation factor 11 (GDF11, and bone morphogenetic protein 9 (BMP9. Notably, the protein-protein interaction (PPI between ActRIIB and MSTN negatively controls muscular development. Therefore, this PPI has been targeted for effective treatment of muscle degenerative diseases such as muscular dystrophy and sarcopenia. Here, we report the identification of ligand-selective peptidic ActRIIB-antagonists by phage display technology. Our peptides bound to the extracellular domain of ActRIIB, inhibited PPIs between ActRIIB expressed on the cell surface and its ligands, and subsequently suppressed activation of Smad that serves as the downstream signal of the ActRIIB pathway. Interestingly, these peptidic antagonists displayed different ligand selectivities; the AR2mini peptide inhibited multiple ligands (activin A, MSTN, GDF11, and BMP9, AR9 inhibited MSTN and GDF11, while AR8 selectively inhibited MSTN. This is the first report of artificial peptidic ActRIIB-antagonists possessing ligand-selectivity.
Duarte, Gabriel M; Braun, Jason D; Giesbrecht, Patrick K; Herbert, David E
2017-12-21
Diiminepyridines are a well-known class of "non-innocent" ligands that confer additional redox activity to coordination complexes beyond metal-centred oxidation/reduction. Here, we demonstrate that metal coordination complexes (MCCs) of diiminepyridine (DIP) ligands with iron are suitable anolytes for redox-flow battery applications, with enhanced capacitance and stability compared with bipyridine analogs, and access to storage of up to 1.6 electron equivalents. Substitution of the ligand is shown to be a key factor in the cycling stability and performance of MCCs based on DIP ligands, opening the door to further optimization.
Schmidt, Azriel; Vogel, Robert; Rutledge, Su Jane; Opas, Evan E; Rodan, Gideon A; Friedman, Eitan
2005-03-01
Nuclear receptors are transcription factors that usually interact, in a ligand-dependent manner, with specific DNA sequences located within promoters of target genes. The nuclear receptors can also be controlled in a ligand-independent manner via the action of membrane receptors and cellular signaling pathways. 5-Tetradecyloxy-2-furancarboxylic acid (TOFA) was shown to stimulate transcription from the MMTV promoter via chimeric receptors that consist of the DNA binding domain of GR and the ligand binding regions of the PPARbeta or LXRbeta nuclear receptors (GR/PPARbeta and GR/LXRbeta). TOFA and hydroxycholesterols also modulate transcription from NF-kappaB- and AP-1-controlled reporter genes and induce neurite differentiation in PC12 cells. In CV-1 cells that express D(1) dopamine receptors, D(1) dopamine receptor stimulation was found to inhibit TOFA-stimulated transcription from the MMTV promoter that is under the control of chimeric GR/PPARbeta and GR/LXRbeta receptors. Treatment with the D(1) dopamine receptor antagonist, SCH23390, prevented dopamine-mediated suppression of transcription, and by itself increased transcription controlled by GR/LXRbeta. Furthermore, combined treatment of CV-1 cells with TOFA and SCH23390 increased transcription controlled by the GR/LXRbeta chimeric receptor synergistically. The significance of this in vitro synergy was demonstrated in vivo, by the observation that SCH23390 (but not haloperidol)-mediated catalepsy in rats was potentiated by TOFA, thus showing that an agent that mimics the in vitro activities of compounds that activate members of the LXR and PPAR receptor families can influence D1 dopamine receptor elicited responses.
Nuclear Factor-kappaB in Autoimmunity: Man and Mouse.
Miraghazadeh, Bahar; Cook, Matthew C
2018-01-01
NF-κB (nuclear factor-kappa B) is a transcription complex crucial for host defense mediated by innate and adaptive immunity, where canonical NF-κB signaling, mediated by nuclear translocation of RelA, c-Rel, and p50, is important for immune cell activation, differentiation, and survival. Non-canonical signaling mediated by nuclear translocation of p52 and RelB contributes to lymphocyte maturation and survival and is also crucial for lymphoid organogenesis. We outline NF-κB signaling and regulation, then summarize important molecular contributions of NF-κB to mechanisms of self-tolerance. We relate these mechanisms to autoimmune phenotypes described in what is now a substantial catalog of immune defects conferred by mutations in NF-κB pathways in mouse models. Finally, we describe Mendelian autoimmune syndromes arising from human NF-κB mutations, and speculate on implications for understanding sporadic autoimmune disease.
Non-conventional Frizzled ligands and Wnt receptors.
Hendrickx, Marijke; Leyns, Luc
2008-05-01
The Wnt family of secreted signaling factors plays numerous roles in embryonic development and in stem cell biology. In the adult, Wnt signaling is involved in tissue homeostasis and mutations that lead to the overexpression of Wnt can be linked to cancer. Wnt signaling is transduced intracellularly by the Frizzled (Fzd) family of receptors. In the canonical pathway, accumulation of beta-catenin and the subsequent formation of a complex with T cell factors (TCF) or lymphoid enhancing factors (Lef) lead to target gene activation. The identification of Ryk as an alternative Wnt receptor and the discovery of the novel Fzd ligands Norrie disease protein (NDP) and R-Spondin, changed the traditional view of Wnts binding to Fzd receptors. Mouse R-Spondin cooperates with Wnt signaling and Low density lipoprotein (LDL) receptor related protein (LRP) to activate beta-catenin dependent gene expression and is involved in processes such as limb and placental development in the mouse. NDP is the product of the Norrie disease gene and controls vascular development in the retina, inner ear and in the female reproductive system during pregnancy. In this review a functional overview of the interactions of the different Wnt and non-Wnt ligands with the Fzd receptors is given as well as a survey of Wnts binding to Ryk and we discuss the biological significance of these interactions.
Czech Academy of Sciences Publication Activity Database
Urdzíková, Lucia; Mašínová, Katarína; Vaněček, Václav; Růžička, Jiří; Šedý, Jiří; Syková, Eva; Jendelová, Pavla
2011-01-01
Roč. 13, č. 9 (2011), s. 1090-1104 ISSN 1465-3249 R&D Projects: GA AV ČR IAA500390902; GA MŠk(CZ) LC554 Grant - others:GA MŠk(CZ) 1M0538 Program:1M Institutional research plan: CEZ:AV0Z50390703 Keywords : axonal sprouting * bone marrow mobilization * Flt3 ligand Subject RIV: FH - Neurology Impact factor: 3.627, year: 2011
Fuentes, Rolly G; Toume, Kazufumi; Arai, Midori A; Sadhu, Samir K; Ahmed, Firoj; Ishibashi, Masami
2015-04-24
Scopadulciol (1), a scopadulan-type diterpenoid, was isolated from Scoparia dulcis along with three other compounds (2-4) by an activity-guided approach using the TCF reporter (TOP) luciferase-based assay system. A fluorometric microculture cytotoxicity assay (FMCA) revealed that compound 1 was cytotoxic to AGS human gastric adenocarcinoma cells. The treatment of AGS cells with 1 decreased β-catenin levels and also inhibited its nuclear localization. The pretreatment of AGS cells with a proteasome inhibitor, either MG132 or epoxomicin, protected against the degradation of β-catenin induced by 1. The 1-induced degradation of β-catenin was also abrogated in the presence of pifithrin-α, an inhibitor of p53 transcriptional activity. Compound 1 inhibited TOP activity in AGS cells and downregulated the protein levels of cyclin D1, c-myc, and survivin. Compound 1 also sensitized AGS cells to tumor necrosis factor-related apoptosis ligand (TRAIL)-induced apoptosis by increasing the levels of the death receptors, DR4 and DR5, and decreasing the level of the antiapoptotic protein Bcl-2. Collectively, our results demonstrated that 1 induced the p53- and proteasome-dependent degradation of β-catenin, which resulted in the inhibition of TCF/β-catenin transcription in AGS cells. Furthermore, 1 enhanced apoptosis in TRAIL-resistant AGS when combined with TRAIL.
International Nuclear Information System (INIS)
Grosso, Marcos; Kalstein, Adrian; Parisi, Gustavo; Fernandez-Alberti, Sebastian; Roitberg, Adrian E.
2015-01-01
The native state of a protein consists of an equilibrium of conformational states on an energy landscape rather than existing as a single static state. The co-existence of conformers with different ligand-affinities in a dynamical equilibrium is the basis for the conformational selection model for ligand binding. In this context, the development of theoretical methods that allow us to analyze not only the structural changes but also changes in the fluctuation patterns between conformers will contribute to elucidate the differential properties acquired upon ligand binding. Molecular dynamics simulations can provide the required information to explore these features. Its use in combination with subsequent essential dynamics analysis allows separating large concerted conformational rearrangements from irrelevant fluctuations. We present a novel procedure to define the size and composition of essential dynamics subspaces associated with ligand-bound and ligand-free conformations. These definitions allow us to compare essential dynamics subspaces between different conformers. Our procedure attempts to emphasize the main similarities and differences between the different essential dynamics in an unbiased way. Essential dynamics subspaces associated to conformational transitions can also be analyzed. As a test case, we study the glutaminase interacting protein (GIP), composed of a single PDZ domain. Both GIP ligand-free state and glutaminase L peptide-bound states are analyzed. Our findings concerning the relative changes in the flexibility pattern upon binding are in good agreement with experimental Nuclear Magnetic Resonance data
Energy Technology Data Exchange (ETDEWEB)
Grosso, Marcos; Kalstein, Adrian; Parisi, Gustavo; Fernandez-Alberti, Sebastian, E-mail: sfalberti@gmail.com [Universidad Nacional de Quilmes, Roque Saenz Peña 352, B1876BXD Bernal (Argentina); Roitberg, Adrian E. [Departments of Physics and Chemistry, University of Florida, Gainesville, Florida 32611 (United States)
2015-06-28
The native state of a protein consists of an equilibrium of conformational states on an energy landscape rather than existing as a single static state. The co-existence of conformers with different ligand-affinities in a dynamical equilibrium is the basis for the conformational selection model for ligand binding. In this context, the development of theoretical methods that allow us to analyze not only the structural changes but also changes in the fluctuation patterns between conformers will contribute to elucidate the differential properties acquired upon ligand binding. Molecular dynamics simulations can provide the required information to explore these features. Its use in combination with subsequent essential dynamics analysis allows separating large concerted conformational rearrangements from irrelevant fluctuations. We present a novel procedure to define the size and composition of essential dynamics subspaces associated with ligand-bound and ligand-free conformations. These definitions allow us to compare essential dynamics subspaces between different conformers. Our procedure attempts to emphasize the main similarities and differences between the different essential dynamics in an unbiased way. Essential dynamics subspaces associated to conformational transitions can also be analyzed. As a test case, we study the glutaminase interacting protein (GIP), composed of a single PDZ domain. Both GIP ligand-free state and glutaminase L peptide-bound states are analyzed. Our findings concerning the relative changes in the flexibility pattern upon binding are in good agreement with experimental Nuclear Magnetic Resonance data.
Nuclear Receptor Cofactors in PPARγ-Mediated Adipogenesis and Adipocyte Energy Metabolism
Directory of Open Access Journals (Sweden)
Emily Powell
2007-01-01
Full Text Available Transcriptional cofactors are integral to the proper function and regulation of nuclear receptors. Members of the peroxisome proliferator-activated receptor (PPAR family of nuclear receptors are involved in the regulation of lipid and carbohydrate metabolism. They modulate gene transcription in response to a wide variety of ligands, a process that is mediated by transcriptional coactivators and corepressors. The mechanisms by which these cofactors mediate transcriptional regulation of nuclear receptor function are still being elucidated. The rapidly increasing array of cofactors has brought into focus the need for a clear understanding of how these cofactors interact in ligand- and cell-specific manners. This review highlights the differential effects of the assorted cofactors regulating the transcriptional action of PPARγ and summarizes the recent advances in understanding the physiological functions of corepressors and coactivators.
What factors facilitate regulatory competence in supervising the safety of nuclear technology?
International Nuclear Information System (INIS)
Mishar, Marina
2012-01-01
The proposed utilization of nuclear energy for electricity generation as the alternative energy source requires Atomic Energy Licensing Board (AELB), the Malaysian nuclear regulatory body taking key role in supervising the safety of the program. This study looked into factors influencing the competency of current AELB human resource as technical competency has been identified as one of the main contributors to the success of a civil nuclear power program. The four quadrant competency model developed by International Atomic Energy Agency was utilized as the required competency. A comprehensive study on 81 personnel from five states in different geographic regions of the country were carried out to investigate the impact of six factors related to competency (educational level, years of working experience, trainings attended, participation in technical committees, numbers of technical papers written and number of technical presentation presented) on four dependent measures in the areas of regulatory competency (legal basis, technical disciplines, regulatory practices and personal and interpersonal effectiveness). Multiple regression (method enter) identified factors that had significant contribution to level of competency while stepwise regression resulted in identifying predictors to enhance competencies. Results were mixed but each of the independent factors is a predictor to different competencies. This study had identified the best predictors that could significantly contribute to the enhancement of regulatory. (author)
DEFF Research Database (Denmark)
Baffert, Carole; Collomb, Marie-Nöelle; Deronzier, Alain
2003-01-01
were characterised by UV-visible spectroscopy, ESI mass spectrometry and cyclic voltammetry. In addition, III-IV and II-III species were electrochemically generated. Thus the new mononegative pentadentate ligand systems display significant flexibility in the range of Mn oxidation states and species...
Organizational factors and reoccurrence protection on the JCO nuclear critical accident
International Nuclear Information System (INIS)
Takano, Kenichi
2000-01-01
A nuclear critical accident formed at a nuclear fuel conversion factory in Tokai-mura on September, 1999 became gradually clear not to be a simple human error formed at a level of workmen but to be an organizational error or accident relating to various organizational factors. As a nuclear power facility adopts a depth protection system fundamentally, a large accident with serious danger would not form only by a single trouble and a human error and unless some factors overlaps. By reviewing recent serious accidents and troubles, all of them seem to have a keyword of 'organizational factor'. In the JCO accident, there are some organizational factors such as a climate deviating from a manual, insufficient and loose check against change of procedure, reduction of operators from a reason of profit priority, attitude on priority of working efficiency, and so forth, which are partially common to the Chernobyl accident. Recently, accidents and troubles impossible to make them a cause of simple human error by a person but to have to say an organizational error, have increased. This trend seems to depend upon not only complication and scale-up of technology system but also graduate change of social and management systems operating them. Therefore, it seems to be necessary to introduce a concept of depth protection (multiple protection) in order to keep its reliability and safety when complicating and scaling-up of system. (G.K.)
International Nuclear Information System (INIS)
Dadachova, E.; Chappell, L.L.; Brechbiel, M.W.
1999-01-01
A simple spectrophotometric assay for determination of bifunctional polyazacarboxylate-macrocyclic ligands of different sizes that are conjugated to proteins has been developed for: 12-membered macrocycle DOTA (2-[4-nitrobenzyl]-1, 4, 7, 10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid) and analogs, the 15-membered PEPA macrocycle (2-[4-nitrobenzyl]-1,4,7,10,13-pentaazacyclopentadecane-N,N',N'',N''',N'''' -pentaacetic acid), and the large 18-membered macrocycle HEHA (1,4,7,10,13,16-hexaazacyclooctadecane-N,N',N'',N''',N''''-hexaacetic acid). The method is based on titration of the blue-colored 1:1 Pb(II)-Arsenazo III (AAIII) complex with the polyazacarboxylate macrocyclic ligand in the concentration range of 0-2.5 μM, wherein color change occurring upon transchelation of the Pb(II) from the AAIII to the polyazamacrocyclic ligand is monitored at 656 nm. The assay is performed at ambient temperature within 20 min without any interfering interaction between the protein and Pb(II)-AA(III) complex. Thus, this method also provides a ligand-to-protein ratio (L/P ratio) that reflects the effective number of ligands per protein molecule available to radiolabeling. The method is not suitable for 14-membered TETA macrocycle (2-[4-nitrobenzyl]-1, 4, 8, 11-tetraazacyclotetradecane N,N',N'',N'''-tetraacetic acid) because of low stability constant of Pb(II)-TETA complex. The method is rapid, simple and may be customized for other polyazacarboxylate macrocyclic ligands
Diverse coactivator recruitment through differential PPARγ nuclear receptor agonism
Directory of Open Access Journals (Sweden)
Fernando Lizcano
2013-01-01
Full Text Available The PPARγ nuclear receptor regulates the expression of genes involved in lipid and carbohydrate metabolism, and it has protective effects in some patients with type 2 diabetes. Nevertheless, the therapeutic value of the PPARγ nuclear receptor protein is limited due to the secondary effects of some PPARγ ligands. Because the downstream effects of PPARγ are determined by the binding of specific cofactors that are mediated by ligand-induced conformational changes, we evaluated the differential effects of various ligands on the binding of certain cofactors associated with PPARγ. The ligands used were rosiglitazone for treating type 2 diabetes and telmisartan for treating arterial hypertension. Functional, phenotypic, and molecular studies were conducted on pre-adipocyte 3T3-L1 and functional studies in U2OS cells. The moderating influence of various cofactor families was evaluated using transient transfection assays. Our findings confirm that telmisartan has a partial modulating effect on PPARγ activity compared to rosiglitazone. The cofactors SRC1 and GRIP1 mediate the activity of telmisartan and rosiglitazone and partially determine the difference in their effects. Studying the modulating activity of these cofactors can provide interesting insights for developing new therapeutic approaches for certain metabolic diseases.
Rosetta Ligand docking with flexible XML protocols.
Lemmon, Gordon; Meiler, Jens
2012-01-01
RosettaLigand is premiere software for predicting how a protein and a small molecule interact. Benchmark studies demonstrate that 70% of the top scoring RosettaLigand predicted interfaces are within 2Å RMSD from the crystal structure [1]. The latest release of Rosetta ligand software includes many new features, such as (1) docking of multiple ligands simultaneously, (2) representing ligands as fragments for greater flexibility, (3) redesign of the interface during docking, and (4) an XML script based interface that gives the user full control of the ligand docking protocol.
Establishing a value chain for human factors in nuclear power plantcontrol room modernization
Energy Technology Data Exchange (ETDEWEB)
Joe, Jeffrey Clark [Idaho National Laboratory; Thomas, Kenneth David [Idaho National Laboratory; Boring, Ronald Laurids [Idaho National Laboratory
2015-07-01
Commercial nuclear power plants in the United States (U.S.) have operated reliably and efficiently for decades. With the life extensions of plants now being planned for operation beyond their original operating licenses, there are opportunities to achieve even greater efficiencies, while maintaining high operational reliabilities, with strategic, risk- and economically-informed, upgrades to plant systems and infrastructure. The U.S. Department of Energy’s Light Water Reactor Sustainability (LWRS) program supports the commercial nuclear industry’s modernization efforts through research and development (R&D) activities across many areas to help establish the technical and economic bases for modernization activities. The Advanced Instrumentation, Information, and Control Systems Technologies pathway is one R&D focus area for the LWRS program, and has researchers at Idaho National Laboratory working with select utility partners to use human factors and instrumentation and controls R&D to help modernize the plant’s main control room. However, some in the nuclear industry have not been as enthusiastic about using human factors R&D to inform life extension decision making. Part of the reason for this may stem from uncertainty decision-makers have regarding how human factors fits into the value chain for nuclear power plant control room modernization. This paper reviews past work that has attempted to demonstrate the value of human factors, and then describes the value chain concept, how it applies to control room modernization, and then makes a case for how and why human factors is an essential link in the modernization value chain.
Ligand-receptor Interactions by NMR Spectroscopy
Directory of Open Access Journals (Sweden)
Novak. P.
2008-04-01
Full Text Available Today NMR spectroscopy is a method of choice for elucidation of interactions between biomolecules and the potential ligands. Knowledge on these interactions is an essential prerequisite for the rational drug design. The most important contribution of NMR to drug design a few years ago was the 3D structure determination of proteins. Besides delivering the 3D structures of the free proteins as a raw material for the modeling studies on ligand binding, NMR can directly yield valuable experimental data on the biologically important protein-ligand complexes. In addition to X-ray diffraction, NMR spectroscopy can provide information on the internal protein dynamics ordynamics of intermolecular interactions. Changes in NMR parameters allow us to detect ("SAR by NMR" and quantitatively determine binding affinities (titration, diffusion NMR experiments, etc. of potential ligands. Also, it is possible to determine the binding site and conformations of ligands, receptors and receptor-ligand complexes with the help of NMR methods such as tr-NOESY. Epitopes or functional groups responsible for binding of ligands to the receptor can be identified by employing STD or WaterLOGSY experiments. In this review are described some of the most frequent NMR methods for the characterization of the interactions between biomolecules and ligands, together with their advantages and disadvantages.
Intra-group separation of rare earths using new organic phosphorus ligands
International Nuclear Information System (INIS)
Hadic, Sanela
2017-01-01
Rare earth elements (REE) have unique magnetic, photophysical, and chemical properties and they are therefore used in numerous high-technology applications. However, to this day, the isolation of pure rare earths from primary and secondary raw materials is very challenging. In this work, the hydrometallurgical separation of neighboring rare earths (e.g., praseodymium/ neodymium) was optimized with novel selective extraction agents. The separation of rare earths (yttrium and all lanthanides except promethium) was investigated with fourteen new organophosphorus compounds. Oxygen-bearing phosphinic acids yielded good separation results for heavy rare earths (dysprosium to lutetium). For light rare earths (lanthanum to neodymium), particularly high separation factors were realized with synergistic systems containing an aromatic dithiophosphinic acid and a co-extractant, such as tris (2-ethylhexyl) phosphate (TEHP). Optimization studies of the latter extraction system revealed an extremely high separation factor (SF) of 4.21 between praseodymium and neodymium. Another focus of this work was to understand the extraction mechanism. With the aid of nuclear magnetic resonance spectroscopy ("1H-NMR) and time-resolved laser fluorescence spectroscopy (TRLFS), the complex stoichiometry of promising extraction systems was examined. Studies revealed a dependency between the selectivity for rare earths and the coordination number of the formed complexes. In addition, temperature-dependent extraction experiments were performed and thermodynamic data (ΔG, ΔH, and ΔS) determined. These data provided additional information about the origin of selectivity for neighboring rare earths. With regard to the industrial capability of the investigated extraction systems, the chemical durability of ligands was studied under process-relevant conditions. Qualitative and quantitative analytical methods (e.g., GC-MS) were used in long-term experiments to determine the ligand degradation. After
International Nuclear Information System (INIS)
Choi, Y.H.; Chung, Y.K.; Park, Y.W.; Lee, J.B.
1997-01-01
The purpose of this study is to develop new Z-factors to evaluate the behavior of a circumferential surface crack in nuclear pipe. Z-factor is a load multiplier used in the Z-factor method, which is one of the ASME Code Sec. XI's recommendations for the estimation of a surface crack in nuclear pipe. It has been reported that the load carrying capacities predicted from the current ASME Code Z-factors, are not well in agreement with the experimental results for nuclear pipes with a surface crack. In this study, new Z-factors for ferritic base metal, ferritic submerged arc welding (SAW) weld metal, austenitic base metal, and austenitic SAW weld metal are obtained by use of the surface crack for thin pipe (SC.TNP) method based on GE/EPRI method. The desirability of both the SC.TNP method and the new Z-factors is examined using the results from 48 pipe fracture experiments for nuclear pipes with a circumferential surface crack. The results show that the SC.TNP method is good for describing the circumferential surface crack behavior and the new Z-factors are well in agreement with the measured Z-factors for both ferritic and austenitic pipes. (orig.)
Directory of Open Access Journals (Sweden)
Rolf Diezko
Full Text Available Peroxisome proliferator-activated receptor gamma (PPARγ is a ligand-activated nuclear receptor regulating adipogenesis, glucose homeostasis and inflammatory responses. The activity of PPARγ is controlled by post-translational modifications including SUMOylation and phosphorylation that affects its biological and molecular functions. Several important aspects of PPARγ SUMOylation including SUMO isoform-specificity and the impact of ligand binding on SUMOylation remain unresolved or contradictory. Here, we present a comprehensive study of PPARγ1 SUMOylation. We show that PPARγ1 can be modified by SUMO1 and SUMO2. Mutational analyses revealed that SUMOylation occurs exclusively within the N-terminal activation function 1 (AF1 domain predominantly at lysines 33 and 77. Ligand binding to the C-terminal ligand-binding domain (LBD of PPARγ1 reduces SUMOylation of lysine 33 but not of lysine 77. SUMOylation of lysine 33 and lysine 77 represses basal and ligand-induced activation by PPARγ1. We further show that lysine 365 within the LBD is not a target for SUMOylation as suggested in a previous report, but it is essential for full LBD activity. Our results suggest that PPARγ ligands negatively affect SUMOylation by interdomain communication between the C-terminal LBD and the N-terminal AF1 domain. The ability of the LBD to regulate the AF1 domain may have important implications for the evaluation and mechanism of action of therapeutic ligands that bind PPARγ.
A Guided Inquiry Activity for Teaching Ligand Field Theory
Johnson, Brian J.; Graham, Kate J.
2015-01-01
This paper will describe a guided inquiry activity for teaching ligand field theory. Previous research suggests the guided inquiry approach is highly effective for student learning. This activity familiarizes students with the key concepts of molecular orbital theory applied to coordination complexes. Students will learn to identify factors that…
Nuclear translocation of the cytoplasmic domain of HB-EGF induces gastric cancer invasion
International Nuclear Information System (INIS)
Shimura, Takaya; Higashiyama, Shigeki; Joh, Takashi; Yoshida, Michihiro; Fukuda, Shinji; Ebi, Masahide; Hirata, Yoshikazu; Mizoshita, Tsutomu; Tanida, Satoshi; Kataoka, Hiromi; Kamiya, Takeshi
2012-01-01
Membrane-anchored heparin-binding epidermal growth factor-like growth factor (proHB-EGF) yields soluble HB-EGF, which is an epidermal growth factor receptor (EGFR) ligand, and a carboxy-terminal fragment of HB-EGF (HB-EGF-CTF) after ectodomain shedding. We previously reported that HB-EGF-CTF and unshed proHB-EGF which has the cytoplasmic domain of proHB-EGF (HB-EGF-C), translocate from the plasma membrane to the nucleus and regulate cell cycle after shedding stimuli. However, the significance of nuclear exported HB-EGF-C in human gastric cancer is unclear. We investigated the relationship between intracellular localization of HB-EGF-C and clinical outcome in 96 gastric cancer patients treated with gastrectomy. Moreover, we established stable gastric cancer cell lines overexpressing wild-type HB-EGF (wt-HB-EGF) and mutated HB-EGF (HB-EGF-mC), which prevented HB-EGF-C nuclear translocation after shedding. Cell motility between these 2 gastric cancer cell lines was investigated using a transwell invasion assay and a wound healing assay. Of the 96 gastric cancer cases, HB-EGF-C immunoreactivity was detected in both the nucleus and cytoplasm in 19 cases (19.8 %) and in the cytoplasm only in 25 cases (26.0 %). The nuclear immunoreactivity of HB-EGF-C was significantly increased in stage pT3/4 tumors compared with pT1/2 tumors (T1/2 vs. T3/4: 11.1 % vs. 36.4 %, P < 0.01). The growth of wt-HB-EGF- and HB-EGF-mC-expressing cells significantly increased compared with control cells, but the growth of HB-EGF-mC-expressing cells was significantly decreased compared with wt-HB-EGF-expressing cells. Gastric cancer cell invasion obviously increased in wt-HB-EGF-expressing cells, but invasion in HB-EGF-mC-expressing cells showed a slight increase compared with control cells. Moreover, wt-HB-EGF overexpression increased the effectiveness of wound healing, but had no significant effect in HB-EGF-mC-expressing cells. Both the function of HB-EGF as an EGFR ligand and a novel signal for
Nuclear translocation of the cytoplasmic domain of HB-EGF induces gastric cancer invasion
2012-01-01
Background Membrane-anchored heparin-binding epidermal growth factor-like growth factor (proHB-EGF) yields soluble HB-EGF, which is an epidermal growth factor receptor (EGFR) ligand, and a carboxy-terminal fragment of HB-EGF (HB-EGF-CTF) after ectodomain shedding. We previously reported that HB-EGF-CTF and unshed proHB-EGF which has the cytoplasmic domain of proHB-EGF (HB-EGF-C), translocate from the plasma membrane to the nucleus and regulate cell cycle after shedding stimuli. However, the significance of nuclear exported HB-EGF-C in human gastric cancer is unclear. Methods We investigated the relationship between intracellular localization of HB-EGF-C and clinical outcome in 96 gastric cancer patients treated with gastrectomy. Moreover, we established stable gastric cancer cell lines overexpressing wild-type HB-EGF (wt-HB-EGF) and mutated HB-EGF (HB-EGF-mC), which prevented HB-EGF-C nuclear translocation after shedding. Cell motility between these 2 gastric cancer cell lines was investigated using a transwell invasion assay and a wound healing assay. Results Of the 96 gastric cancer cases, HB-EGF-C immunoreactivity was detected in both the nucleus and cytoplasm in 19 cases (19.8 %) and in the cytoplasm only in 25 cases (26.0 %). The nuclear immunoreactivity of HB-EGF-C was significantly increased in stage pT3/4 tumors compared with pT1/2 tumors (T1/2 vs. T3/4: 11.1 % vs. 36.4 %, P HB-EGF- and HB-EGF-mC-expressing cells significantly increased compared with control cells, but the growth of HB-EGF-mC-expressing cells was significantly decreased compared with wt-HB-EGF-expressing cells. Gastric cancer cell invasion obviously increased in wt-HB-EGF-expressing cells, but invasion in HB-EGF-mC-expressing cells showed a slight increase compared with control cells. Moreover, wt-HB-EGF overexpression increased the effectiveness of wound healing, but had no significant effect in HB-EGF-mC-expressing cells. Conclusions Both the function of HB-EGF as an EGFR ligand
A python-based docking program utilizing a receptor bound ligand shape: PythDock.
Chung, Jae Yoon; Cho, Seung Joo; Hah, Jung-Mi
2011-09-01
PythDock is a heuristic docking program that uses Python programming language with a simple scoring function and a population based search engine. The scoring function considers electrostatic and dispersion/repulsion terms. The search engine utilizes a particle swarm optimization algorithm. A grid potential map is generated using the shape information of a bound ligand within the active site. Therefore, the searching area is more relevant to the ligand binding. To evaluate the docking performance of PythDock, two well-known docking programs (AutoDock and DOCK) were also used with the same data. The accuracy of docked results were measured by the difference of the ligand structure between x-ray structure, and docked pose, i.e., average root mean squared deviation values of the bound ligand were compared for fourteen protein-ligand complexes. Since the number of ligands' rotational flexibility is an important factor affecting the accuracy of a docking, the data set was chosen to have various degrees of flexibility. Although PythDock has a scoring function simpler than those of other programs (AutoDock and DOCK), our results showed that PythDock predicted more accurate poses than both AutoDock4.2 and DOCK6.2. This indicates that PythDock could be a useful tool to study ligand-receptor interactions and could also be beneficial in structure based drug design.
The human factor in operating nuclear power plants during crisis situations
International Nuclear Information System (INIS)
Schnauder, H.; Smidt, D.
1981-10-01
Human factors in nuclear power plant operation are a main part of safety analyses. A considerable reduction in the influence of human factors has been obtained through ergonomic control room design, automation, clearly formulated operating manuals, and appropriate personnel education and training. These precautions are directed primarily at skill- and rule-based behaviour and are intended for normal operation and design accidents. In addition, one can construct an area of uncommon and very rare events where a partial failure of the safety systems is assumed. This is an area of knowledge-based behaviour. This report describes and assesses the present situation in German nuclear power plants. Recommendations for further research activity are made and, as a main result, for improvements in knowledge-based behaviour. (orig.) [de
b-jet tagged nuclear modification factors in heavy ion collisions with CMS
Jung, Kurt
2014-01-01
The energy loss of jets in heavy-ion collisions is expected to depend on the flavor of the fragmenting parton. Thus, measurements of jet quenching as a function of flavor place powerful constraints on the thermodynamical and transport properties of the hot and dense medium. Measurements of the nuclear modification factors of the heavy-flavor-tagged jets in both PbPb and pPb collisions can quantify such energy loss effects. Specifically, pPb measurements provide crucial insights into the behavior of the cold nuclear matter effect, which is required to fully understand the hot and dense medium effects on jets in PbPb collisions. In this talk, we present the b-jet spectra and the first measurement of the nuclear modification factors as a function of transverse momentum and pseudorapidity, using the high statistics pp, pPb and PbPb data taken in 2011 and 2013.
Energy Technology Data Exchange (ETDEWEB)
Mugridge, Jeffrey; Fiedler, Dorothea; Raymond, Kenneth
2010-02-04
A ferrocene-based biscatecholamide ligand was prepared and investigated for the formation of metal-ligand supramolecular assemblies with different metals. Reaction with Ge(IV) resulted in the formation of a variety of Ge{sub n}L{sub m} coordination complexes, including [Ge{sub 2}L{sub 3}]{sup 4-} and [Ge{sub 2}L{sub 2}({mu}-OMe){sub 2}]{sup 2-}. The ligand's ability to swivel about the ferrocenyl linker and adopt different conformations accounts for formation of many different Ge{sub n}L{sub m} species. This study demonstrates why conformational ligand rigidity is essential in the rational design and directed self-assembly of supramolecular complexes.
Engineering factors influencing Corbicula fouling in nuclear-service water systems
International Nuclear Information System (INIS)
Henager, C.H.; Johnson, K.I.; Page, T.L.
1983-06-01
Corbicula fouling is a continuing problem in nuclear-service water systems. More knowledge of biological and engineering factors is needed to develop effective detection and control methods. A data base on Corbicula fouling was compiled from nuclear and non-nuclear power stations and industries using raw water. This data base was used in an analysis to identify systems and components which are conducive to fouling by Corbicula. Bounds on several engineering parameters such as velocity and temperature which support Corbicula growth are given. Service water systems found in BWR and PWR reactors are listed and those that show fouling are identified. Possible safety implications of Corbicula fouling are discussed for specific service water systems. Several effective control methods in current use include backflushing with heated water, centrifugal strainers, and continuous chlorination during spawning seasons
Czech Academy of Sciences Publication Activity Database
Löw, I.; Bubrin, M.; Paretzki, A.; Fiedler, Jan; Záliš, Stanislav; Kaim, W.
2017-01-01
Roč. 455, č. 2 (2017), s. 540-548 ISSN 0020-1693 R&D Projects: GA MŠk LD14129 Grant - others:COST(XE) CM1202 Institutional support: RVO:61388955 Keywords : BIAN diimine ligand * Carbonylmetal complexes * Electron transfer Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 2.002, year: 2016
Economic Conditions and Factors Affecting New Nuclear Power Deployment
Energy Technology Data Exchange (ETDEWEB)
Harrison, Thomas J [ORNL
2014-10-01
This report documents work performed in support of the US Department of Energy Office of Nuclear Energy’s Advanced Small Modular Reactor (AdvSMR) program. The report presents information and results from economic analyses to describe current electricity market conditions and those key factors that may impact the deployment of AdvSMRs or any other new nuclear power plants. Thus, this report serves as a reference document for DOE as it moves forward with its plans to develop advanced reactors, including AdvSMRs. For the purpose of this analysis, information on electricity markets and nuclear power plant operating costs will be combined to examine the current state of the nuclear industry and the process required to successfully move forward with new nuclear power in general and AdvSMRs in particular. The current electricity market is generally unfavorable to new nuclear construction, especially in deregulated markets with heavy competition from natural gas and subsidized renewables. The successful and profitable operation of a nuclear power plant (or any power plant) requires the rate at which the electricity is sold to be sufficiently greater than the cost to operate. The wholesale rates in most US markets have settled into values that provide profits for most operating nuclear power plants but are too low to support the added cost of capital recovery for new nuclear construction. There is a strong geographic dependence on the wholesale rate, with some markets currently able to support new nuclear construction. However, there is also a strong geographic dependence on pronuclear public opinion; the areas where power prices are high tend to have unfavorable views on the construction of new nuclear power plants. The use of government-backed incentives, such as subsidies, can help provide a margin to help justify construction projects that otherwise may not seem viable. Similarly, low interest rates for the project will also add a positive margin to the economic
Macrocyclic G-quadruplex ligands
DEFF Research Database (Denmark)
Nielsen, M C; Ulven, Trond
2010-01-01
are macrocyclic structures which have been modeled after the natural product telomestatin or from porphyrin-based ligands discovered in the late 1990s. These two structural classes of G-quadruplex ligands are reviewed here with special attention to selectivity and structure-activity relationships, and with focus...
Anokhina, Ekaterina V.
Low-dimensional and open-framework materials containing transition metals have a wide range of applications in redox catalysis, solid-state batteries, and electronic and magnetic devices. This dissertation reports on research carried out with the goal to develop a strategy for the preparation of low-dimensional and open-framework materials using octahedral metal clusters as building blocks. Our approach takes its roots from crystal engineering principles where the desired framework topologies are achieved through building block design. The key idea of this work is to induce directional bonding preferences in the cluster units using a combination of ligands with a large difference in charge density. This investigation led to the preparation and characterization of a new family of niobium oxychloride cluster compounds with original structure types exhibiting 1ow-dimensional or open-framework character. Most of these materials have framework topologies unprecedented in compounds containing octahedral clusters. Comparative analysis of their structural features indicates that the novel cluster connectivity patterns in these systems are the result of complex interplay between the effects of anisotropic ligand arrangement in the cluster unit and optimization of ligand-counterion electrostatic interactions. The important role played by these factors sets niobium oxychloride systems apart from cluster compounds with one ligand type or statistical ligand distribution where the main structure-determining factor is the total number of ligands. These results provide a blueprint for expanding the ligand combination strategy to other transition metal cluster systems and for the future rational design of cluster-based materials.
Major factors influencing craft productivity in nuclear power plant construction
International Nuclear Information System (INIS)
Borcherding, J.D.; Sebastian, S.J.
1980-01-01
This paper reports on a research study whose objective was to determine the most influential factors adversely affecting craft productivity in nuclear power plant construction from the perspective of the tradesmen employed at the sites. Data were collected through the use of a questionnaire survey and group interview sessions, predominantly with workmen, at six nuclear power plant construction projects. Craftsmen were chosen as the major data base because of their awareness of how their time would actually be spent on the project. Topics considered include the factors influencing craft productivity, material availability, redoing work, crew interfacing, overcrowded work areas, instruction time, inspection delays, craft turnover, craft absenteeism, foreman changes, foreman incompetence, engineering design lead time, comprehensive scheduling of the design function, the responsibility of the utility, value engineering, plant standardization, the effective utilization of the planning and scheduling system, and the labor-management committee
International Nuclear Information System (INIS)
Hua, Xiu-Ni; Qin, Lan; Yan, Xiao-Zhi; Yu, Lei; Xie, Yi-Xin; Han, Lei
2015-01-01
Hydrothermal reactions of N-auxiliary flexible exo-bidentate ligand 1,3-bis(4-pyridyl)propane (bpp) and carboxylates ligands naphthalene-2,6-dicarboxylic acid (2,6-H_2ndc) or 4,4′-(hydroxymethylene)dibenzoic acid (H_2hmdb), in the presence of cadmium(II) salts have given rise to two novel metal-organic frameworks based on flexible ligands (FL-MOFs), namely, [Cd_2(2,6-ndc)_2(bpp)(DMF)]·2DMF (1) and [Cd_3(hmdb)_3(bpp)]·2DMF·2EtOH (2) (DMF=N,N-Dimethylformamide). Single-crystal X-ray diffraction analyses revealed that compound 1 exhibits a three-dimensional self-penetrating 6-connected framework based on dinuclear cluster second building unit. Compound 2 displays an infinite three-dimensional ‘Lucky Clover’ shape (2,10)-connected network based on the trinuclear cluster and V-shaped organic linkers. The flexible bpp ligand displays different conformations in 1 and 2, which are successfully controlled by size-matching mixed ligands during the self-assembly process. - Graphical abstract: Compound 1 exhibits a 3D self-penetrating 6-connected framework based on dinuclear cluster, and 2 displays an infinite 3D ‘Lucky Clover’ shape (2,10)-connected network based on the trinuclear cluster. The flexible 1,3-bis(4-pyridyl)propane ligand displays different conformations in 1 and 2, which successfully controlled by size-matching mixed ligands during the self-assembly process.
Energy Technology Data Exchange (ETDEWEB)
Hua, Xiu-Ni; Qin, Lan; Yan, Xiao-Zhi; Yu, Lei; Xie, Yi-Xin; Han, Lei, E-mail: hanlei@nbu.edu.cn
2015-12-15
Hydrothermal reactions of N-auxiliary flexible exo-bidentate ligand 1,3-bis(4-pyridyl)propane (bpp) and carboxylates ligands naphthalene-2,6-dicarboxylic acid (2,6-H{sub 2}ndc) or 4,4′-(hydroxymethylene)dibenzoic acid (H{sub 2}hmdb), in the presence of cadmium(II) salts have given rise to two novel metal-organic frameworks based on flexible ligands (FL-MOFs), namely, [Cd{sub 2}(2,6-ndc){sub 2}(bpp)(DMF)]·2DMF (1) and [Cd{sub 3}(hmdb){sub 3}(bpp)]·2DMF·2EtOH (2) (DMF=N,N-Dimethylformamide). Single-crystal X-ray diffraction analyses revealed that compound 1 exhibits a three-dimensional self-penetrating 6-connected framework based on dinuclear cluster second building unit. Compound 2 displays an infinite three-dimensional ‘Lucky Clover’ shape (2,10)-connected network based on the trinuclear cluster and V-shaped organic linkers. The flexible bpp ligand displays different conformations in 1 and 2, which are successfully controlled by size-matching mixed ligands during the self-assembly process. - Graphical abstract: Compound 1 exhibits a 3D self-penetrating 6-connected framework based on dinuclear cluster, and 2 displays an infinite 3D ‘Lucky Clover’ shape (2,10)-connected network based on the trinuclear cluster. The flexible 1,3-bis(4-pyridyl)propane ligand displays different conformations in 1 and 2, which successfully controlled by size-matching mixed ligands during the self-assembly process.
Mix-and-match: ligand-receptor pairs in stomatal development and beyond.
Torii, Keiko U
2012-12-01
Stomata are small valves on the plant epidermis balancing gas exchange and water loss. Stomata are formed according to positional cues. In Arabidopsis, two EPIDERMAL PATTERNING FACTOR (EPF) peptides, EPF1 and EPF2, are secreted from stomatal precursors enforcing proper stomatal patterning. Here, I review recent studies revealing the ligand-receptor pairs and revising the previously predicted relations between receptors specifying stomatal patterning: ERECTA-family and TOO MANY MOUTHS (TMM). Furthermore, EPF-LIKE9 (EPFL9/Stomagen) promotes stomatal differentiation from internal tissues. Two EPFL peptides specify inflorescence architecture, a process beyond stomatal development, as ligands for ERECTA. Thus, broadly expressed receptor kinases may regulate multiple developmental processes through perceiving different peptide ligands, each with a specialized expression pattern. TMM in the epidermis may fine-tune multiple EPF/EPFL signals to prevent signal interference. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Rudolf, Henning
2013-10-24
Due to our current way of life and the environmental influences we are exposed in the industrial nations, cancer diseases turn out to be a more and more serious threat to our civilization. The ongoing research during the last decades leads to a better insight in cancer diseases and enables an earlier recognition of developing carcinoma. The detection of pathological tissue changes at an early stage increases the patients' chances of cure. Magnetic resonance tomography (MRT) and computed tomography (CT) as well as radiopharmaceutically assisted imaging techniques, like positron emission tomography (PET) and scintigraphy are an indispensable clinical tool in the oncological early diagnosis. By the development of multimodality imaging agents that combine the benefits of several imaging techniques, the early recognition of tumors can be more efficient and in consequence a matching therapy can be applied. This thesis deals with the synthesis of novel bispidine based ligands and their transition metal complexes as potential mono- and bimodal imaging agents for a {sup 64}Cu-assisted radiopharmaceutical application in positron emission tomography (PET) and optical imaging (OI). The synthesized ligands L and L{sup OH} are offering the opportunity to build up a ruthenium(II) polypyridine complex by one of the ligand's donor sets, to act as a fluorescence dye for optical imaging (OI), and to coordinate {sup 64}Cu{sup II} by the ligand's vacant cavity for positron emission tomography (PET). The Ru{sup II} complex exhibits two different fluorescence activities with two different lifetimes and only one of the two fluorescences is quenched by subsequent complexation of Cu{sup II}. The calculated Cu{sup II} stability constant of L and L{sup OH} is similar to that of the isomeric ligand N{sub 2}py{sub 2} which has been already evaluated as a {sup 64}Cu-radiotracer. Further transition metal complexes of Fe{sup II}, Fe{sup III} and Mn{sup II} are dealing with
Bolkun, Lukasz; Lemancewicz, Dorota; Piszcz, Jaroslaw; Moniuszko, Marcin; Bolkun-Skornicka, Urszula; Szkiladz, Malgorzata; Jablonska, Ewa; Kloczko, Janusz; Dzieciol, Janusz
2015-12-01
Tumour necrosis factor-alfa (TNF-α) is an inflammatory cytokine with a wide spectrum of biological activity, including angiogenesis. Tumour necrosis factor-related apoptosis inducing ligand (TRAIL), which belongs to the TNF family of proteins, plays a role in the regulation of vascular responses, but its effect on the formation of new blood vessels (angiogenesis) is unclear. We analysed TRAIL concentrations in parallel with pro-angiogenic cytokines in serum and their expression in trephine biopsy (TB) in 56 patients with newly diagnosed IgG MM and 24 healthy volunteers. The study showed statistically higher concentrations of TRAIL and TNF-α, as well as of VEGF and its receptor, in MM patients compared to healthy volunteers and patients in advanced stages of the disease. Furthermore, we observed a significant decrease in all studied pro-angiogenic cytokines and significant increase of TRAIL concentration after anti-angiogenic therapy, with meaningful differences between responders (at least partial remission) and patients with progression during the induction treatment. It was also established that TRAIL correlated statistically and negatively with pro-angiogenic cytokines such as VEGF with its receptor and expression of VEGF and syndecan-1 in TB. In summary, our data indicate that in MM patients, both clinical course and treatment responsiveness are associated with dynamic yet corresponding changes of levels of TRAIL parallel pro-angiogenic mediators such as VEGF with its receptor and expression of VEGF and syndecan-1 in TB. Copyright © 2014 John Wiley & Sons, Ltd.
Wang, Yanzhao; Wang, Zhixun; Li, Yuxue; Wu, Gongde; Cao, Zheng; Zhang, Liming
2014-01-01
Most homogenous gold catalyses demand ≥0.5 mol % catalyst loading. Due to the high cost of gold, these reactions are unlikely to be applicable in medium or large scale applications. Here we disclose a novel ligand design based on the privileged biphenyl-2-phosphine framework that offers a potentially general approach to dramatically lowering catalyst loading. In this design, an amide group at the 3’ position of the ligand framework directs and promotes nucleophilic attack at the ligand gold complex-activated alkyne, which is unprecedented in homogeneous gold catalysis considering the spatial challenge of using ligand to reach antiapproaching nucleophile in a linear P-Au-alkyne centroid structure. With such a ligand, the gold(I) complex becomes highly efficient in catalyzing acid addition to alkynes, with a turnover number up to 99,000. Density functional theory calculations support the role of the amide moiety in directing the attack of carboxylic acid via hydrogen bonding. PMID:24704803
Safety review for human factors engineering and control rooms of nuclear power plants
International Nuclear Information System (INIS)
Yang Mengzhuo
1998-01-01
Safety review for human factors engineering and control rooms of nuclear power plants (NPP) is in a forward position of science and technology, which began at American TMI severe accident and had been implemented in China. The importance and the significance of the safety review are expounded, the requirements of its scope and profundity are explained in detail. In addition, the situation of the technical document system for nuclear safety regulation on human factors engineering and control rooms of NPP in China is introduced briefly, on which the safety review is based
International Nuclear Information System (INIS)
Cao, Ke-Li; Zhang, Yi-Ping; Cai, Yi-Ni; Xu, Xiao-Wei; Feng, Yun-Long
2014-01-01
To investigate the influence of hydrogen bonds and secondary ligands on the structures and properties of the resulting frameworks, five new Co(II) compounds have been synthesized by the reactions of Co(II) salts and 3,5-bis(pyridin-4-ylmethoxy)benzoic acid (HL) with four rationally selected dicarboxylic acid ligands. Without secondary ligand, we got one compound [CoL 2 (H 2 O) 2 ] n ·2nH 2 O (1), which possesses a 1D chain structure. In the presence of ancillary ligands, namely, 1,3-adamantanedicarboxylic acid (H 2 adbc), terephthalic acid (H 2 tpa), thiophene-2,5-dicarboxylic acid (H 2 tdc) and 1,4-benzenedithioacetic acid (H 2 bdtc), four 3D structures [Co 2 L 2 (adbc)] n ·nH 2 O (2), [Co 2 L 2 (tpa)] n (3), [Co 2 L 2 (tdc)] n (4), [Co 2 L 2 (bdtc)(H 2 O)] n (5) were obtained, respectively. It can be observed from the architectures of 1–5 that hydrogen bonds and secondary ligands both have great effects on the spatial connective fashions, resulting in the formation of various dimensional compounds. The XRPD, TGA data of title polymers and the magnetic properties for 2 and 5 have also been investigated. - Graphical abstract: The structural differences show that the ancillary ligands have great effects on the spatial connective fashions, resulting in the formation of various dimensional compounds. - Highlights: • Five new Co(II) coordination polymers have been synthesized by solvothermal reactions based on 3,5-bis(pyridin-4-ylmethoxy)benzoic acid (HL). • The long-flexible ligand (HL) is a good candidate to produce interpenetrating architectures. • The secondary dicarboxylic acid ligands play important roles in the spatial connective fashions and the formation of various dimensional compounds. • The magnetism studies show that both 2 and 5 exhibit antiferromagnetic interactions
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Castillo Gomez, Juan Daniel
2015-04-27
Bioconjugation reactions with Rhenium and Technetium are of high importance for the development of novel radiopharmaceuticals for nuclear medicine. In this thesis the possibilities for bioconjugation using linkable Thiocarmbamoylbenzamidines as ligands for the complexation of Rhenium and Technetium were examined.
International Nuclear Information System (INIS)
Du Preez, J.G.H.; Gerber, T.I.A.; Gibson, M.L.; Geyser, R.
1990-01-01
The authors have used the potentially bis(terdentate) nitrogen aromatic heterocyclic ligand 2,3,5,6-tetrakis(2-pyridyl)pyrazine (tppz) to prepare mono- and bimetallic technetium(V) complexes bound to tppz. The stimulus for the development of the coordination chemistry of the man-made element technetium is provided by the use of complexes of this element as anatomical imaging agents in nuclear medicine. Although the chemistry of technetium(V) with nitrogen donor ligands is well understood, no complexes have been prepared using potentially terdentate neutral nitrogen donor ligands of this metal in the +5 oxidation state
Lee, Yong-Woo; Kim, Chulsung
2012-01-01
Bench-scale soil washing studies were performed to evaluate the potential application of non-toxic, biodegradable extracted soybean-complexing ligands for the remediation of lead-contaminated soils. Results showed that, with extracted soybean-complexing ligands, lead solubility extensively increased when pH of the solution was higher than 6, and approximately 10% (500 mg/kg) of lead was removed from a rifle range soil. Two potential primary factors controlling the effectiveness of lead extraction from lead-contaminated soils with natural ligands are adsorption of extracted aqueous lead ions onto the ground soybean and the pH of the extraction solution. More complexing ligands were extracted from the ground soybean as the reaction pH increased. As a result, significantly higher lead extraction efficiency was observed under basic environments. In addition, less adsorption onto soybean was observed when the pH of the solution was higher than 7. Among two available Lewis base functional groups in the extracted soybean-complexing ligands such as carboxylate and the alpha-amino functional groups, the non-protonated alpha-amino functional groups may play an important role for the dissolution of lead from lead-contaminated soil through the formation of soluble lead--ligand complexes.
Human factors design review guidelines for advanced nuclear control room technologies
International Nuclear Information System (INIS)
O'Hara, J.; Brown, W.; Granda, T.; Baker, C.
1991-01-01
Advanced control rooms (ACRs) for future nuclear power plants are being designed utilizing computer-based technologies. The US Nuclear Regulatory Commission reviews the human engineering aspects of such control rooms to ensure that they are designed to good human factors engineering principles and that operator performance and reliability are appropriately supported in order to protect public health and safety. This paper describes the rationale, general approach, and initial development of an NRC Advanced Control Room Design Review Guideline. 20 refs., 1 fig
Bone-remodeling transcript levels are independent of perching in end-of-lay white leghorn chickens.
Dale, Maurice D; Mortimer, Erin M; Kolli, Santharam; Achramowicz, Erik; Borchert, Glenn; Juliano, Steven A; Halkyard, Scott; Sietz, Nick; Gatto, Craig; Hester, Patricia Y; Rubin, David A
2015-01-23
Osteoporosis is a bone disease that commonly results in a 30% incidence of fracture in hens used to produce eggs for human consumption. One of the causes of osteoporosis is the lack of mechanical strain placed on weight-bearing bones. In conventionally-caged hens, there is inadequate space for chickens to exercise and induce mechanical strain on their bones. One approach is to encourage mechanical stress on bones by the addition of perches to conventional cages. Our study focuses on the molecular mechanism of bone remodeling in end-of-lay hens (71 weeks) with access to perches. We examined bone-specific transcripts that are actively involved during development and remodeling. Using real-time quantitative PCR, we examined seven transcripts (COL2A1 (collagen, type II, alpha 1), RANKL (receptor activator of nuclear factor kappa-B ligand), OPG (osteoprotegerin), PTHLH (PTH-like hormone), PTH1R (PTH/PTHLH type-1 receptor), PTH3R (PTH/PTHLH type-3 receptor), and SOX9 (Sry-related high mobility group box)) in phalange, tibia and femur. Our results indicate that the only significant effect was a difference among bones for COL2A1 (femur > phalange). Therefore, we conclude that access to a perch did not alter transcript expression. Furthermore, because hens have been used as a model for human bone metabolism and osteoporosis, the results indicate that bone remodeling due to mechanical loading in chickens may be a product of different pathways than those involved in the mammalian model.
Samara, Stavroula; Dailiana, Zoe; Chassanidis, Christos; Koromila, Theodora; Papatheodorou, Loukia; Malizos, Konstantinos N; Kollia, Panagoula
2014-02-01
Femoral head avascular necrosis (AVN) is a recalcitrant disease of the hip that leads to joint destruction. Osteoprotegerin (OPG), Receptor Activator of Nuclear Factor kappa-B (RANK) and RANK ligand (RANKL) regulate the balance between osteoclasts-osteoblasts. The expression of these genes affects the maturation and function of osteoblasts-osteoclasts and bone remodeling. In this study, we investigated the molecular pathways leading to AVN by studying the expression profile of OPG, RANK and RANKL genes. Quantitative Real Time-PCR was performed for evaluation of OPG, RANK and RANKL expression. Analysis was based on parallel evaluation of mRNA and protein levels in normal/necrotic sites of 42 osteonecrotic femoral heads (FHs). OPG and RANKL protein levels were estimated by western blotting. The OPG mRNA levels were higher (insignificantly) in the necrotic than the normal site (p > 0.05). Although the expression of RANK and RANKL was significantly lower than OPG in both sites, RANK and RANKL mRNA levels were higher in the necrotic part than the normal (p < 0.05). Protein levels of OPG and RANKL showed no remarkable divergence. Our results indicate that differential expression mechanisms for OPG, RANK and RANKL that could play an important role in the progress of bone remodeling in the necrotic area, disturbing bone homeostasis. This finding may have an effect on the resulting bone destruction and the subsequent collapse of the hip joint. Copyright © 2013. Published by Elsevier Inc.
International Nuclear Information System (INIS)
Hojo, Yasuji; Sugiura, Yukio; Tanaka, Hisashi
1975-01-01
Removal of 203 Hg-labeled organomercurials, bound to sulfhydryl groups of hemoglobin, by various chelating agents was investigated by the use of equilibrium dialysis. Organomercurials employed were chlormerodrin, methylmercury, ethylmercury and phenylmercury compounds. Higher and more specific effects of the sulfur-ligands, such as penicillamine and glutathione, on removal of organomercurial were found as compared with those of the nitrogen-ligands such as EDTA, glycine and polymethylenediamines. Linear correlation was observed between the degree of organomercury elimination from hemoglobin and the stability constant (log K 1 ) of 1:1 organomercury complex in both the sulfur- and nitrogen-ligand systems and at the same value of log K 1 , the elimination-effect of sulfur-ligands was extremely greater than that of the nitrogen-ligands. The relationship between the average percentage of removal and the Taft's polar substituent constant of organic moiety of the metal was also linear among the organomercury compounds other than chlormerodrin. The average removal percentage by sulfur-ligands increased in the order, ethylmercury>methylmercury>phenylmercury, while that of the nitrogen-ligands was not different among the organomercurials investigated. In addition, direct ligand-exchange reaction between hemoglobin-SH and the ligand coordinating-atom (S or N) against organomercurials rather than Ssub(N2) reaction via the ternary complex, hemoglobin-S-RHg-ligand, is postulated. (auth.)
Factors influencing the decommissioning of large-scale nuclear plants
International Nuclear Information System (INIS)
Large, J.H.
1988-01-01
The decision-making process involving the decommissioning of the UK graphite moderated, gas-cooled nuclear power stations is complex. There are timing, engineering, waste disposal, cost and lost generation capacity factors to consider and the overall decision of when and how to proceed with decommissioning may include political and public tolerance dimensions. For the final stage of decommissioning the nuclear industry could either completely dismantle the reactor island leaving a green-field site or, alternatively, the reactor island could be maintained indefinitely with additional super- and substructure containment. At this time the first of these options, or deferred decommissioning, prevails and with this the nuclear industry has expressed considerable confidence that the technology required will become available with passing time, that acceptable radioactive waste disposal methods and facilities will be available and that the eventual costs of decommissioning will not escalate without restraint. If the deferred decommissioning strategy is wrong and it is not possible to completely dismantle the reactor islands a century into the future, then it may be too late to effect sufficient longer term containment to maintain the reactor hulks in a reliable condition. With respect to the final decommissioning of large-scale nuclear plant, it is concluded that the nuclear industry does not know quite how to do it, when it will be attempted and when it will be completed, and they do not know how much it will eventually cost. (author)
A HUMAN FACTORS META MODEL FOR U.S. NUCLEAR POWER PLANT CONTROL ROOM MODERNIZATION
Energy Technology Data Exchange (ETDEWEB)
Joe, Jeffrey C.
2017-03-01
Over the last several years, the United States (U.S.) Department of Energy (DOE) has sponsored human factors research and development (R&D) and human factors engineering (HFE) activities through its Light Water Reactor Sustainability (LWRS) program to modernize the main control rooms (MCR) of commercial nuclear power plants (NPP). Idaho National Laboratory (INL), in partnership with numerous commercial nuclear utilities, has conducted some of this R&D to enable the life extension of NPPs (i.e., provide the technical basis for the long-term reliability, productivity, safety, and security of U.S. NPPs). From these activities performed to date, a human factors meta model for U.S. NPP control room modernization can now be formulated. This paper discusses this emergent HFE meta model for NPP control room modernization, with the goal of providing an integrated high level roadmap and guidance on how to perform human factors R&D and HFE for those in the U.S. nuclear industry that are engaging in the process of upgrading their MCRs.
Biomolecular ligands screening using radiation damping difference WaterLOGSY spectroscopy
International Nuclear Information System (INIS)
Sun Peng; Jiang Xianwang; Jiang Bin; Zhang Xu; Liu Maili
2013-01-01
Water-ligand observed via gradient spectroscopy (WaterLOGSY) is a widely used nuclear magnetic resonance method for ligand screening. The crucial procedure for the effectiveness of WaterLOGSY is selective excitation of the water resonance. The selective excitation is conventionally achieved by using long selective pulse, which causes partial saturation of the water magnetization leading to reduction of sensitivity, in addition to time consuming and error prone. Therefore, many improvements have been made to enhance the sensitivity and robustness of the method. Here we propose an alternative selective excitation scheme for WaterLOGSY by utilizing radiation damping effect. The pulse scheme starts simply with a hard inversion pulse, instead of selective pulse or pulse train, followed by a pulse field gradient to control the radiation damping effect. The rest parts of the pulse scheme are similar to conventional WaterLOGSY. When the gradient pulse is applied immediately after the inversion pulse, the radiation damping effect is suppressed, and all of the magnetization is inversed. When the gradient pulse and the inversion pulse are about 10–20 ms apart, the radiation damping effect remains active and drives the water magnetization toward +z-axis, resulting in selective non-inversion of the water magnetization. By taking the differences of the spectra obtained under these two conditions, one should get the result of WaterLOGSY. The method is demonstrated to be simple, robust and sensitive for ligand screening
Soldevila-Sanmartín, Joan; Calvet, Teresa; Font-Bardia, Merce; Domingo, Concepción; Ayllón, José A; Pons, Josefina
2018-05-08
The reaction of copper(ii) acetate monohydrate with p-hydroxycinnamic acid (HpOHcinn) and different pyridine derivatives (4-tert-butylpyridine, 4-tBupy; 4-acetylpyridine, 4-Acpy; 3-phenylpyridine, 3-Phpy; 4-phenylpyridine, 4-Phpy) was essayed in methanol solvent at room temperature. The crystal structures of the resulting compounds were elucidated. Their analysis shows that the choice of pyridine ligands determines different coordination modes of the pOHcinn ligand and the Cu(ii) coordination, nuclearity and geometry. The pOHcinn acts as a monodentate carboxylate ligand in combination with 4-tBupy or 4-Phpy, yielding monomers and dimers, associated by hydrogen bonds into supramolecular networks in which the phenol group plays a key role. Conversely, in combination with 4-Acpy or 3-Phpy, the phenol group coordinates directly to the Cu(ii), acting as a ditopic ligand and yielding 2D coordination polymers. The compound containing 3-Phpy shows interesting MeOH-H2O reversible exchange behavior. Not only has the pyridine auxiliary ligand had a tremendous effect on the coordination mode of pOHcinn, but also its reactivity is influenced. Particularly, in the case of the compound containing 4-Phpy, it undergoes a photoinduced process, in which the phenol group deprotonates and coordinates to Cu(ii) as a phenoxy ligand. This yields a coordination polymer in which two different dimers alternate, bridged by the resulting pOcinn ligand. The magneto-structural correlation of this compound is also discussed.
Ligand cluster-based protein network and ePlatton, a multi-target ligand finder.
Du, Yu; Shi, Tieliu
2016-01-01
Small molecules are information carriers that make cells aware of external changes and couple internal metabolic and signalling pathway systems with each other. In some specific physiological status, natural or artificial molecules are used to interact with selective biological targets to activate or inhibit their functions to achieve expected biological and physiological output. Millions of years of evolution have optimized biological processes and pathways and now the endocrine and immune system cannot work properly without some key small molecules. In the past thousands of years, the human race has managed to find many medicines against diseases by trail-and-error experience. In the recent decades, with the deepening understanding of life and the progress of molecular biology, researchers spare no effort to design molecules targeting one or two key enzymes and receptors related to corresponding diseases. But recent studies in pharmacogenomics have shown that polypharmacology may be necessary for the effects of drugs, which challenge the paradigm, 'one drug, one target, one disease'. Nowadays, cheminformatics and structural biology can help us reasonably take advantage of the polypharmacology to design next-generation promiscuous drugs and drug combination therapies. 234,591 protein-ligand interactions were extracted from ChEMBL. By the 2D structure similarity, 13,769 ligand emerged from 156,151 distinct ligands which were recognized by 1477 proteins. Ligand cluster- and sequence-based protein networks (LCBN, SBN) were constructed, compared and analysed. For assisting compound designing, exploring polypharmacology and finding possible drug combination, we integrated the pathway, disease, drug adverse reaction and the relationship of targets and ligand clusters into the web platform, ePlatton, which is available at http://www.megabionet.org/eplatton. Although there were some disagreements between the LCBN and SBN, communities in both networks were largely the same
Energy Technology Data Exchange (ETDEWEB)
Varga, J.M.; Fritsch, P.
1995-01-30
The invention relates to radio-derivatized polymers and a method of producing them by contacting non-polymerizable conjugands with radiolysable polymers in the presence of irradiation. The resulting radio-derivatized polymers can be further linked with ligand of organic or inorganic nature to immobilize such ligands. 2 figs., 5 tabs.
Molecular methods in nuclear medicine therapy
International Nuclear Information System (INIS)
Lee, Kyung Han
2001-01-01
Nuclear medicine has traditionally contributed to molecular oncology by allowing noninvasive monitoring of tumor metabolism, growth and genetic changes, thereby providing a basis for appropriate biology-based treatment planning. However, NM techniques are now being applied as an active therapeutic tool in novel molecular approaches for cancer treatment. Such areas include research on cancer therapy with radiolabeled ligands or oligonucleotides, and utilization of synergism between NM radiotherapy and gene transfer techniques. Here we will focus on novel aspects of nuclear medicine therapy
Plant twitter: ligands under 140 amino acids enforcing stomatal patterning.
Rychel, Amanda L; Peterson, Kylee M; Torii, Keiko U
2010-05-01
Stomata are an essential land plant innovation whose patterning and density are under genetic and environmental control. Recently, several putative ligands have been discovered that influence stomatal density, and they all belong to the epidermal patterning factor-like family of secreted cysteine-rich peptides. Two of these putative ligands, EPF1 and EPF2, are expressed exclusively in the stomatal lineage cells and negatively regulate stomatal density. A third, EPFL6 or CHALLAH, is also a negative regulator of density, but is expressed subepidermally in the hypocotyl. A fourth, EPFL9 or STOMAGEN, is expressed in the mesophyll tissues and is a positive regulator of density. Genetic evidence suggests that these ligands may compete for the same receptor complex. Proper stomatal patterning is likely to be an intricate process involving ligand competition, regional specificity, and communication between tissue layers. EPFL-family genes exist in the moss Physcomitrella patens, the lycophyte Selaginella moellendorffii, and rice, Oryza sativa, and their sequence analysis yields several genes some of which are related to EPF1, EPF2, EPFL6, and EPFL9. Presence of these EPFL family members in the basal land plants suggests an exciting hypothesis that the genetic components for stomatal patterning originated early in land plant evolution.
Beyond the Matrix: The Many Non-ECM Ligands for Integrins
Directory of Open Access Journals (Sweden)
Bryce LaFoya
2018-02-01
Full Text Available The traditional view of integrins portrays these highly conserved cell surface receptors as mediators of cellular attachment to the extracellular matrix (ECM, and to a lesser degree, as coordinators of leukocyte adhesion to the endothelium. These canonical activities are indispensable; however, there is also a wide variety of integrin functions mediated by non-ECM ligands that transcend the traditional roles of integrins. Some of these unorthodox roles involve cell-cell interactions and are engaged to support immune functions such as leukocyte transmigration, recognition of opsonization factors, and stimulation of neutrophil extracellular traps. Other cell-cell interactions mediated by integrins include hematopoietic stem cell and tumor cell homing to target tissues. Integrins also serve as cell-surface receptors for various growth factors, hormones, and small molecules. Interestingly, integrins have also been exploited by a wide variety of organisms including viruses and bacteria to support infectious activities such as cellular adhesion and/or cellular internalization. Additionally, the disruption of integrin function through the use of soluble integrin ligands is a common strategy adopted by several parasites in order to inhibit blood clotting during hematophagy, or by venomous snakes to kill prey. In this review, we strive to go beyond the matrix and summarize non-ECM ligands that interact with integrins in order to highlight these non-traditional functions of integrins.
Die Rolle von RANK-Ligand und Osteoprotegerin bei Osteoporose
Directory of Open Access Journals (Sweden)
Hofbauer LC
2004-01-01
Full Text Available Receptor activator of nuclear factor (NF- κB ligand (RANKL, sein zellulärer Rezeptor RANK und der Decoy-Rezeptor Osteoprotegerin (OPG stellen ein essentielles Zytokinsystem für die Zellbiologie von Osteoklasten dar. Verschiedene Untersuchungen belegen die Bedeutung von Störungen des OPG/RANKL/RANK-Systems bei der Pathogenese metabolischer Knochenerkrankungen. In dieser Arbeit werden die wichtigsten Störungen des OPG/RANKL/RANK-Systems bei verschiedenen Osteoporoseformen dargestellt. Östrogenrezeptor- (ER- Agonisten wie 17 β-Östradiol, Raloxifen und Genistein stimulieren die osteoblastäre Produktion von OPG durch Aktivierung von ER- α in vitro, während Lymphozyten von Patientinnen mit Östrogenmangel RANKL überexprimieren. Die parenterale Gabe von OPG vermag den mit Östrogenmangel assoziierten Knochenverlust im Tiermodell und in einer kleineren klinischen Studie zu verhindern. Glukokortikoide und Immunsuppressiva steigern gleichzeitig die RANKL-Expression und hemmen die OPG-Produktion in osteoblastären Zellen in vitro. Glukokortikoide sind auch in vivo imstande, die OPG-Serumspiegel deutlich zu reduzieren. Dagegen hemmen biomechanische Reize in vitro die RANKL-Produktion und steigern die OPG-Produktion. Ein Fehlen dieser biomechanischen Reize bei längerer Immobilisierung kann daher den RANKL/OPG-Quotienten steigern, während die tierexperimentelle Immobilisierungs-Osteoporose durch die parenterale Gabe von OPG gemildert werden kann.
Ning, R B; Zhu, J; Chai, D J; Xu, C S; Xie, H; Lin, X Y; Zeng, J Z; Lin, J X
2013-12-13
An inflammatory response induced by high glucose is a cause of endothelial dysfunction in diabetes and is an important contributing link to atherosclerosis. Diabetes is an independent risk factor of atherosclerosis and activation of retinoid X receptor (RXR) has been shown to exert anti-atherogenic effects. In the present study, we examined the effects of the RXR ligands 9-cis-retinoic acid (9-cis-RA) and SR11237 on high glucose-induced inflammation in human umbilical endothelial vein endothelial cells (HUVECs) and explored the potential mechanism. Our results showed that the inflammation induced by high-glucose in HUVECs was mainly mediated by the activation of nuclear factor-B (NF- κB). High glucose-induced expression of intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) were in comparison, significantly decreased by treatment with RXR. The effect of RXR agonists was mainly due to the inhibition of NF-κB activation. Using pharmacological inhibitors and siRNA, we confirmed that nicotinamide adenine dinucleotide phosphate (NADPH) oxidase was an upstream activator of NF-κB. Furthermore, RXR agonists significantly inhibited high glucose-induced activation of NADPH oxidase and significantly decreased the production of reactive oxygen species (ROS). To explore whether the rapid inhibitory effects of RXR agonists were in fact mediated by RXR, we examined the effect of RXR downregulation by RXR siRNA. Our results showed that RXR siRNA largely abrogated the effects of RXR agonists, suggesting the requirement of RXR expression. Therefore, we have shown that RXR is involved in the regulation of NADPH oxidase- NF-κB signal pathway, as the RXR ligands antagonized the inflammatory response in HUVECs induced by high glucose.
International Nuclear Information System (INIS)
2002-05-01
The Technical Committee Meeting (TCM) was held in Vienna on 8-10 November 1999; it was organized by the International Atomic Energy Agency and attended by 26 participants from 16 Member States. The purpose of the meeting was to exchange information among experts on the back end fuel cycle strategies adopted by Member States; to identify key factors determining the long-term back end fuel cycle strategies; and to assess the applicability of these factors to future nuclear systems. Issues associated with the back end fuel cycle supporting a country's nuclear power programme are technical, economic, institutional and political. This TCM provided an opportunity to address these issues and their impacts to the back end fuel cycles, as well as to identify and assess factors affecting the back end fuel cycle strategies. The discussion was organized ib the following topical sessions: the nuclear fuel cycle; spent fuel management; waste management and repository; plutonium management. This document contains a summary of the meeting and 22 individual papers presented by participants. Each of the papers was indexed separately
Energy Technology Data Exchange (ETDEWEB)
NONE
2002-05-01
The Technical Committee Meeting (TCM) was held in Vienna on 8-10 November 1999; it was organized by the International Atomic Energy Agency and attended by 26 participants from 16 Member States. The purpose of the meeting was to exchange information among experts on the back end fuel cycle strategies adopted by Member States; to identify key factors determining the long-term back end fuel cycle strategies; and to assess the applicability of these factors to future nuclear systems. Issues associated with the back end fuel cycle supporting a country's nuclear power programme are technical, economic, institutional and political. This TCM provided an opportunity to address these issues and their impacts to the back end fuel cycles, as well as to identify and assess factors affecting the back end fuel cycle strategies. The discussion was organized ib the following topical sessions: the nuclear fuel cycle; spent fuel management; waste management and repository; plutonium management. This document contains a summary of the meeting and 22 individual papers presented by participants. Each of the papers was indexed separately.
Human-factor operating concept for Borssele Nuclear Power Station
International Nuclear Information System (INIS)
Wieman, J.L.
1995-01-01
The safety level in the operation of a reactor is determined basically by human beings. The Borssele Nuclear Power Station has carried out measures for improving the man-machine interface through training and operating instructions for the shift personnel. The retrofitting of control technology relevant to safety engineering should avoid operating instructions which can cause potential failures. A safety study has shown that the remaining risk following all retrofitting measures remains dependent to the extent of 80% on human factors and that human factors as a whole have a positive effect on reactor safety. (orig.) [de
Reactivity of halide and pseudohalide ligands
International Nuclear Information System (INIS)
Kukushkin, Yu.N.
1987-01-01
Reactivity of halide and pseudohalide (cyanide, azide, thiocyanate, cyanate) ligands tending to form bridge bonds in transition metal (Re, Mo, W) complexes is considered. Complexes where transition metal salts are ligands of other, complex-forming ion, are described. Transformation of innerspheric pseudohalide ligands is an important way of directed synthesis of these metal coordination compounds
Group 4 Metal Complexes of Chelating Cyclopentadienyl-ketimide Ligands
Czech Academy of Sciences Publication Activity Database
Večeřa, M.; Varga, Vojtěch; Císařová, I.; Pinkas, Jiří; Kucharczyk, P.; Sedlařík, V.; Lamač, Martin
2016-01-01
Roč. 35, č. 5 (2016), s. 785-798 ISSN 0276-7333 R&D Projects: GA ČR(CZ) GA14-08531S; GA MŠk(CZ) LO1504 Institutional support: RVO:61388955 Keywords : group 4 metal complexes * cyclopentadienyl-ketimide ligands * metallocenes Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.862, year: 2016
Jafarzadeh, Abdollah; Nemati, Maryam; Rezayati, Mohammad Taghi; Nabizadeh, Mansooreh; Ebrahimi, Medhi
2013-07-01
H. pylori infection has been associated with some autoimmune disorders. The aim of this study was to evaluate the serum concentrations of rheumatoid factor and anti-nuclear antibodies in H. pylori-infected peptic ulcer patients, H. pylori-infected asymptomatic carriers and a healthy control group. A Total of 100 H. pylori-infected peptic ulcer patients, 65 asymptomatic carriers and 30 healthy H. pylori-negative subjects (as a control group) were enrolled into study. Serum samples of participants tested for the levels of rheumatoid factor and anti-nuclear antibodies by use of ELISA. The mean serum levels of rheumatoid factor and anti-nuclear antibodies in peptic ulcer group was significantly higher in comparison to the control group (ppeptic ulcer patients and asymptomatic carriers groups regarding the mean serum levels of rheumatoid factor and anti-nuclear antibodies. The mean serum levels of rheumatoid factor in men with peptic ulcer was significantly higher compared to the group of healthy men (ppeptic ulcer patients or asymptomatic carriers groups, the mean serum levels of rheumatoid factor was higher than that in healthy women, but the differences were not statistically significant. Also, no significant differences were observed between men and women with peptic ulcer, asymptomatic carriers control groups based on the serum levels of anti-nuclear antibodies. The results showed higher serum levels of rheumatoid factor and anti-nuclear antibodies in H. pylori-infected patients with peptic ulcer disease which represent the H. pylori-related immune disturbance in these patients. Additional follow-up studies are necessary to clarify the clinical significance of these autoantibodies in patients with H. pylori infection.
A Fluid Membrane-Based Soluble Ligand Display System for Live CellAssays
Energy Technology Data Exchange (ETDEWEB)
Nam, Jwa-Min; Nair, Pradeep N.; Neve, Richard M.; Gray, Joe W.; Groves, Jay T.
2005-10-14
Cell communication modulates numerous biological processes including proliferation, apoptosis, motility, invasion and differentiation. Correspondingly, there has been significant interest in the development of surface display strategies for the presentation of signaling molecules to living cells. This effort has primarily focused on naturally surface-bound ligands, such as extracellular matrix components and cell membranes. Soluble ligands (e.g. growth factors and cytokines) play an important role in intercellular communications, and their display in a surface-bound format would be of great utility in the design of array-based live cell assays. Recently, several cell microarray systems that display cDNA, RNAi, or small molecules in a surface array format were proven to be useful in accelerating high-throughput functional genetic studies and screening therapeutic agents. These surface display methods provide a flexible platform for the systematic, combinatorial investigation of genes and small molecules affecting cellular processes and phenotypes of interest. In an analogous sense, it would be an important advance if one could display soluble signaling ligands in a surface assay format that allows for systematic, patterned presentation of soluble ligands to live cells. Such a technique would make it possible to examine cellular phenotypes of interest in a parallel format with soluble signaling ligands as one of the display parameters. Herein we report a ligand-modified fluid supported lipid bilayer (SLB) assay system that can be used to functionally display soluble ligands to cells in situ (Figure 1A). By displaying soluble ligands on a SLB surface, both solution behavior (the ability to become locally enriched by reaction-diffusion processes) and solid behavior (the ability to control the spatial location of the ligands in an open system) could be combined. The method reported herein benefits from the naturally fluid state of the supported membrane, which allows
Gaieb, Zied; Liu, Shuai; Gathiaka, Symon; Chiu, Michael; Yang, Huanwang; Shao, Chenghua; Feher, Victoria A.; Walters, W. Patrick; Kuhn, Bernd; Rudolph, Markus G.; Burley, Stephen K.; Gilson, Michael K.; Amaro, Rommie E.
2018-01-01
The Drug Design Data Resource (D3R) ran Grand Challenge 2 (GC2) from September 2016 through February 2017. This challenge was based on a dataset of structures and affinities for the nuclear receptor farnesoid X receptor (FXR), contributed by F. Hoffmann-La Roche. The dataset contained 102 IC50 values, spanning six orders of magnitude, and 36 high-resolution co-crystal structures with representatives of four major ligand classes. Strong global participation was evident, with 49 participants submitting 262 prediction submission packages in total. Procedurally, GC2 mimicked Grand Challenge 2015 (GC2015), with a Stage 1 subchallenge testing ligand pose prediction methods and ranking and scoring methods, and a Stage 2 subchallenge testing only ligand ranking and scoring methods after the release of all blinded co-crystal structures. Two smaller curated sets of 18 and 15 ligands were developed to test alchemical free energy methods. This overview summarizes all aspects of GC2, including the dataset details, challenge procedures, and participant results. We also consider implications for progress in the field, while highlighting methodological areas that merit continued development. Similar to GC2015, the outcome of GC2 underscores the pressing need for methods development in pose prediction, particularly for ligand scaffolds not currently represented in the Protein Data Bank (http://www.pdb.org), and in affinity ranking and scoring of bound ligands.
International Nuclear Information System (INIS)
2001-01-01
In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-07-01
In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures.
Eijsink, Linda E; Perdriau, Sébastien C P; de Vries, Johannes G; Otten, Edwin
2016-01-01
The pincer complex (PNN)RuH(CO), with a de-aromatized pyridine in the ligand backbone, is shown to react with nitriles in a metal-ligand cooperative manner. This leads to the formation of a series of complexes with new Ru-N(nitrile) and C(ligand)-C(nitrile) bonds. The initial nitrile cycloaddition
Studies on human factors in nuclear power plants
International Nuclear Information System (INIS)
Tsukuda, H.; Miyaoka, S.
1988-01-01
In order to raise the reliability and safety of nuclear power plants to the highest possible level, improvements to the mechanical system alone are not sufficient. Human factors must be systematically analysed and the causes and mechanisms of human error clarified to allow the development of countermeasures that will reduce error as much as possible. The paper introduces research in two areas, fundamental clarification of human behavioural, physiological and psychological characteristics to aid in the development of preventive measures for reducing error, and studies involving analysis of actual cases of accidents and failures related to man along with development of countermeasures to prevent the recurrence of such cases. The paper especially considers the latter area. The Human Performance Evaluation System (HPES) developed by the Institute of Nuclear Power Operations (INPO) in the USA was applied on a trial basis to 31 recent accidents and failures at Japanese nuclear power plants. The effectiveness of and possible improvement to HPES were considered. Also, cases that were not directly linked to accidents or failures were analysed using a method developed independently in Japan using data collected from a survey of approximately 3,000 power plant personnel. Fundamental research on human behaviour, physiology and psychology are also introduced. (author). 4 figs
International Nuclear Information System (INIS)
Su, Hsiang-Han; Lin, Hsin-Ting; Suen, Jau-Ling; Sheu, Chau Chyun; Yokoyama, Kazunari K.; Huang, Shau-Ku; Cheng, Chih Mei
2016-01-01
Pulmonary fibroblast migration and differentiation are critical events in fibrogenesis; meanwhile, fibrosis characterizes the pathology of many respiratory diseases. The role of aryl hydrocarbon receptor (AhR), a unique cellular chemical sensor, has been suggested in tissue fibrosis, but the mechanisms through which the AhR-ligand axis influences the fibrotic process remain undefined. In this study, the potential impact of the AhR-ligand axis on pulmonary fibroblast migration and differentiation was analyzed using human primary lung fibroblasts HFL-1 and CCL-202 cells. Boyden chamber-based cell migration assay showed that activated AhR in HFL-1cells significantly enhanced cell migration in response to 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD), and a known AhR antagonist, CH223191, inhibited its migratory activity. Furthermore, the calcium mobilization and subsequent upregulated expression of arachidonic acid metabolizing enzymes, including cyclooxygenase2 (COX-2) and 5-lipoxygenase (5-LOX), were observed in TCDD-treated HFL-1 cells, concomitant with elevated levels of prostaglandin E2 (PGE2) and leukotriene B4 (LTB4) secretion. Also, significantly increased expression of α-smooth muscle actin α-SMA), a fibroblast differentiation marker, was also noted in TCDD-treated HFL-1 cells (p < 0.05), resulting in a dynamic change in cytoskeleton protein levels and an increase in the nuclear translocation of the myocardin-related transcription factor. Moreover, the enhanced levels of α-SMA expression and fibroblast migration induced by TCDD, PGE2 and LTB4 were abrogated by selective inhibitors for COX-2 and 5-LOX. Knockdown of AhR by siRNA Completely diminished intracellular calcium uptake and reduced α-SMA protein verified by promoter-reporter assays and chromatin immunoprecipitation. Taken together, our results suggested the importance of the AhR-ligand axis in fibroblast migration and differentiation through its capacity in enhancing arachidonic acid metabolism.
Courtaut, Flavie; Derangère, Valentin; Chevriaux, Angélique; Ladoire, Sylvain; Cotte, Alexia K; Arnould, Laurent; Boidot, Romain; Rialland, Mickaël; Ghiringhelli, François; Rébé, Cédric
2015-09-29
Increasing evidence indicates that Liver X Receptors (LXRs) have some anticancer properties. We recently demonstrated that LXR ligands induce colon cancer cell pyroptosis through an LXRβ-dependent pathway. In the present study, we showed that human colon cancer cell lines presented differential cytoplasmic localizations of LXRβ. This localization correlated with caspase-1 activation and cell death induction under treatment with LXR ligand. The association of LXRβ with the truncated form of RXRα (t-RXRα) was responsible for the sequestration of LXRβ in the cytoplasm in colon cancer cells. Moreover t-RXRα was not expressed in normal colon epithelial cells. These cells presented a predominantly nuclear localization of LXRβ and were resistant to LXR ligand cytotoxicity. Our results showed that predominant cytoplasmic localization of LXRβ, which occurs in colon cancer cells but not in normal colon epithelial cells, allowed LXR ligand-induced pyroptosis. This study strengthens the hypothesis that LXRβ could be a promising target in cancer therapy.
Farnesoid X receptor, the bile acid sensing nuclear receptor, in liver regeneration
Directory of Open Access Journals (Sweden)
Guodong Li
2015-03-01
Full Text Available The liver is unique in regenerative potential, which could recover the lost mass and function after injury from ischemia and resection. The underlying molecular mechanisms of liver regeneration have been extensively studied in the past using the partial hepatectomy (PH model in rodents, where 2/3 PH is carried out by removing two lobes. The whole process of liver regeneration is complicated, orchestrated event involving a network of connected interactions, which still remain fully elusive. Bile acids (BAs are ligands of farnesoid X receptor (FXR, a nuclear receptor of ligand-activated transcription factor. FXR has been shown to be highly involved in liver regeneration. BAs and FXR not only interact with each other but also regulate various downstream targets independently during liver regeneration. Moreover, recent findings suggest that tissue-specific FXR also contributes to liver regeneration significantly. These novel findings suggest that FXR has much broader role than regulating BA, cholesterol, lipid and glucose metabolism. Therefore, these researches highlight FXR as an important pharmaceutical target for potential use of FXR ligands to regulate liver regeneration in clinic. This review focuses on the roles of BAs and FXR in liver regeneration and the current underlying molecular mechanisms which contribute to liver regeneration.
Towards ligand docking including explicit interface water molecules.
Directory of Open Access Journals (Sweden)
Gordon Lemmon
Full Text Available Small molecule docking predicts the interaction of a small molecule ligand with a protein at atomic-detail accuracy including position and conformation the ligand but also conformational changes of the protein upon ligand binding. While successful in the majority of cases, docking algorithms including RosettaLigand fail in some cases to predict the correct protein/ligand complex structure. In this study we show that simultaneous docking of explicit interface water molecules greatly improves Rosetta's ability to distinguish correct from incorrect ligand poses. This result holds true for both protein-centric water docking wherein waters are located relative to the protein binding site and ligand-centric water docking wherein waters move with the ligand during docking. Protein-centric docking is used to model 99 HIV-1 protease/protease inhibitor structures. We find protease inhibitor placement improving at a ratio of 9:1 when one critical interface water molecule is included in the docking simulation. Ligand-centric docking is applied to 341 structures from the CSAR benchmark of diverse protein/ligand complexes [1]. Across this diverse dataset we see up to 56% recovery of failed docking studies, when waters are included in the docking simulation.
Public opinion factors regarding nuclear power
Energy Technology Data Exchange (ETDEWEB)
Benson, B.
1991-12-31
This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry`s practices are aligned with public opinion, a more favorable regulatory climate is possible.
Public opinion factors regarding nuclear power
Energy Technology Data Exchange (ETDEWEB)
Benson, B.
1991-01-01
This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible.
Public opinion factors regarding nuclear power
International Nuclear Information System (INIS)
Benson, B.
1991-01-01
This paper is an effort to identify, as comprehensively as possible, public concerns about nuclear power, and to assess, where possible, the relative importance of these concerns as they relate to government regulation of and policy towards nuclear power. It is based on some two dozen in-depth interviews with key communicators representing the nuclear power industry, the environmental community, and government, as well as on the parallel efforts in our research project: (1) review of federal court case law, (2) a selective examination of the Nuclear Regulatory Commission (NRC) administrative process, and (3) the preceding George Mason University research project in this series. The paper synthesizes our findings about public attitudes towards nuclear power as expressed through federal court case law, NRC administrative law, public opinion surveys, and direct personal interviews. In so doing, we describe the public opinion environment in which the nuclear regulatory process must operate. Our premise is that public opinion ultimately underlies the approaches government agencies take towards regulating nuclear power, and that, to the degree that the nuclear power industry's practices are aligned with public opinion, a more favorable regulatory climate is possible
Allosteric Regulation in the Ligand Binding Domain of Retinoic Acid Receptorγ.
Directory of Open Access Journals (Sweden)
Yassmine Chebaro
Full Text Available Retinoic acid (RA plays key roles in cell differentiation and growth arrest through nuclear retinoic acid receptors (RARs, which are ligand-dependent transcription factors. While the main trigger of RAR activation is the binding of RA, phosphorylation of the receptors has also emerged as an important regulatory signal. Phosphorylation of the RARγ N-terminal domain (NTD is known to play a functional role in neuronal differentiation. In this work, we investigated the phosphorylation of RARγ ligand binding domain (LBD, and present evidence that the phosphorylation status of the LBD affects the phosphorylation of the NTD region. We solved the X-ray structure of a phospho-mimetic mutant of the LBD (RARγ S371E, which we used in molecular dynamics simulations to characterize the consequences of the S371E mutation on the RARγ structural dynamics. Combined with simulations of the wild-type LBD, we show that the conformational equilibria of LBD salt bridges (notably R387-D340 are affected by the S371E mutation, which likely affects the recruitment of the kinase complex that phosphorylates the NTD. The molecular dynamics simulations also showed that a conservative mutation in this salt bridge (R387K affects the dynamics of the LBD without inducing large conformational changes. Finally, cellular assays showed that the phosphorylation of the NTD of RARγ is differentially regulated by retinoic acid in RARγWT and in the S371N, S371E and R387K mutants. This multidisciplinary work highlights an allosteric coupling between phosphorylations of the LBD and the NTD of RARγ and supports the importance of structural dynamics involving electrostatic interactions in the regulation of RARs activity.
Phan, N T; Cabot, P J; Wallwork, B D; Cervin, A U; Panizza, B J
2015-07-01
Chronic rhinosinusitis is characterised by persistent inflammation of the sinonasal mucosa. Multiple pathophysiological mechanisms are likely to exist. Previous research has focused predominantly on T-helper type cytokines to highlight the inflammatory mechanisms. However, proteins such as nuclear factor kappa B and transforming growth factor beta are increasingly recognised to have important roles in sinonasal inflammation and tissue remodelling. This review article explores the roles of T-helper type cytokines, nuclear factor kappa B and transforming growth factor beta in the pathophysiological mechanisms of chronic rhinosinusitis. An understanding of these mechanisms will allow for better identification and classification of chronic rhinosinusitis endotypes, and, ultimately, improved therapeutic strategies.
Mazzola, Carmen; Medalie, Julie; Scherma, Maria; Panlilio, Leigh V.; Solinas, Marcello; Tanda, Gianluigi; Drago, Filippo; Cadet, Jean Lud; Goldberg, Steven R.; Yasar, Sevil
2009-01-01
Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of anandamide (a cannabinoid CB[subscript 1]-receptor ligand) and oleoylethanolamide and palmitoylethanolamide (OEA and PEA, ligands for alpha-type peroxisome proliferator-activated nuclear receptors, PPAR-alpha) when and where they are naturally released in the brain.…
Human factors in maintenance: Development and research in Swedish nuclear power plants
International Nuclear Information System (INIS)
Salo, I.; Svensson, Ola
2001-11-01
The present report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects
Human factors in maintenance: development and research in Swedish nuclear power plants
International Nuclear Information System (INIS)
Salo, I.; Svenson, O.
2001-11-01
The report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects. (au)
Human factors in maintenance: Development and research in Swedish nuclear power plants
Energy Technology Data Exchange (ETDEWEB)
Salo, I. [Lund Univ. (Sweden). Dept. of Psychology; Svensson, Ola [Stockholm Univ. (Sweden). Dept. of Psychology
2001-11-01
The present report investigated previously completed, ongoing, and planned research and development projects focusing human factors and maintenance work carried out at Swedish nuclear power plants and SKI. In addition, needs for future research and development works were also investigated. Participants from all nuclear power plants and SKI were included in the study. Participants responded to a set of questions in an interview. The interviews also generated a list of future research and development projects.
Transferring aviation human factors technology to the nuclear power industry
International Nuclear Information System (INIS)
Montemerlo, M.D.
1981-01-01
The purpose of this paper is to demonstrate the availability of aviation safety technology and research on problems which are sufficiently similar to those faced by the nuclear power industry that an agressive effort to adapt and transfer that technology and research is warranted. Because of time and space constraints, the scope of this paper is reduced from a discussion of all of aviation safety technology to the human factors of air carrier safety. This area was selected not only because of similarities in the human factors challenges shared by both industries (e.g. selection, training, evaluation, certification, etc.) but because experience in aviation has clearly demonstrated that human error contributes to a substantially greater proportion of accidents and incidents than does equipment failure. The Congress of the United States has placed a great deal of emphasis on investigating and solving human factors problems in aviation. A number of recent examples of this interest and of the resulting actions are described. The opinions of prominent aviation organizations as to the human factors problems most in need of research are presented, along with indications of where technology transfer to the nuclear power industry may be viable. The areas covered include: fatigue, crew size, information transfer, resource management, safety data-bases, the role of automation, voice and data recording systems, crew distractions, the management of safety regulatory agencies, equipment recertification, team training, crew work-load, behavioural factors, human factors of equipment design, medical problems, toxicological factors, the use of simulators for training and certification, determining the causes of human errors, the politics of systems improvement, and importance of both safety and public perception of safety if the industry is to be viable. (author)
UNC Nuclear Industries' human-factored approach to the operating or maintenance procedure
International Nuclear Information System (INIS)
Nelson, A.A.; Clark, J.E.
1982-01-01
The development of Human Factors Engineering (HFE) and UNC Nuclear Industries' (UNC) commitment to minimizing the potential for human error in the performance of operating or maintenance procedures have lead to a procedure upgrade program. Human-factored procedures were developed using information from many sources including, but not limited to, operators, a human factors specialist, engineers and supervisors. This has resulted in the Job Performance Aid (JPA). This paper presents UNC's approach to providing human-factored operating and maintenance procedures
Factors determining the UK's back-end nuclear fuel cycle strategy and future nuclear systems
International Nuclear Information System (INIS)
Dunn, M.J.; Ainsworth, Z.E.
2002-01-01
Nuclear generating capacity in the UK is static with no units currently under construction. The AGRs and the UK's only PWR, Sizewell B, are operated by British Energy Generation Ltd (BEGL) and British Energy Generation (UK) Ltd (BEG(UK)L), who are subsidiaries of British Energy plc (BE) which was privatised in July 1996. Ownership of the Magnox stations, which were excluded from this privatisation, has now been transferred to BNFL.Government policy on spent fuel management in the UK is that it is for the owners of the spent fuel to decide on the appropriate spent fuel management options, based on their own commercial judgement, subject to meeting the necessary regulatory requirements. The main factors which have predominantly determined UK utility decisions on spent fuel management, to date, have been based on the technical considerations of the spent fuel characteristics, economic attractiveness of the options and at reactor site spent fuel storage capacities. To date, reprocessing has been the dominant form of spent fuel treatment in the UK. Spent fuel storage facilities consist of a mixture of at-reactor stores and large, centralised ponds associated with the reprocessing activities which take place at the Sellafield site. BEGL and BEG(UK)L have contracts for the lifetime arisings of AGR fuel which allow for all AGR spent fuel to be sent to Sellafield for reprocessing or long-term storage. The prompt reprocessing of all Magnox fuel will continue, and spent PWR fuel will continue to be stored at the reactor site in the short to medium term. It is likely that a combination of factors, which are discussed later in this paper, will continue to affect back-end nuclear fuel cycle strategy and future nuclear systems. (author)
Crystallization of bi-functional ligand protein complexes.
Antoni, Claudia; Vera, Laura; Devel, Laurent; Catalani, Maria Pia; Czarny, Bertrand; Cassar-Lajeunesse, Evelyn; Nuti, Elisa; Rossello, Armando; Dive, Vincent; Stura, Enrico Adriano
2013-06-01
Homodimerization is important in signal transduction and can play a crucial role in many other biological systems. To obtaining structural information for the design of molecules able to control the signalization pathways, the proteins involved will have to be crystallized in complex with ligands that induce dimerization. Bi-functional drugs have been generated by linking two ligands together chemically and the relative crystallizability of complexes with mono-functional and bi-functional ligands has been evaluated. There are problems associated with crystallization with such ligands, but overall, the advantages appear to be greater than the drawbacks. The study involves two matrix metalloproteinases, MMP-12 and MMP-9. Using flexible and rigid linkers we show that it is possible to control the crystal packing and that by changing the ligand-enzyme stoichiometric ratio, one can toggle between having one bi-functional ligand binding to two enzymes and having the same ligand bound to each enzyme. The nature of linker and its point of attachment on the ligand can be varied to aid crystallization, and such variations can also provide valuable structural information about the interactions made by the linker with the protein. We report here the crystallization and structure determination of seven ligand-dimerized complexes. These results suggest that the use of bi-functional drugs can be extended beyond the realm of protein dimerization to include all drug design projects. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
J.S. Oh
2002-01-01
Full Text Available Activation of the insulin-like growth factor-1 receptor (IGF-11R by IGF-1 is associated with the risk and progression of many types of cancer, although despite this it remains unclear how activated IGF-1 R contributes to cancer progression. In this study, gene expression changes elicited by IGF-1 were profiled in breast epithelial cells. We noted that many genes are functionally linked to cancer progression and angiogenesis. To validate some of the changes observed, the RNA and/or protein was confirmed for c-fos, cytochrome P4501Al, cytochrome P450 1131, interleukin-1 beta, fas ligand, vascular endothelial growth factor, and urokinase plasminogen activator. Nuclear proteins were also temporally monitored to address how gene expression changes were regulated. We found that IGF-1 stimulated the nuclear translocation of phosphorylated AKT, hypoxic-inducible factor-1 alpha, and phosphorylated cAMP-responsive element-binding protein, which correlated with temporal changes in gene expression. Next, the promoter regions of IGF-1-regulated genes were searched in silico. The promoters of genes that clustered together had similar regulatory regions. In summary, IGF-1 inscribes a gene expression profile relevant to cancer progression, and this study provides insight into the mechanism(s whereby some of these changes occur.
Autocrine signal transmission with extracellular ligand degradation
Muratov, C B; Posta, F; Shvartsman, S Y
2009-03-01
Traveling waves of cell signaling in epithelial layers orchestrate a number of important processes in developing and adult tissues. These waves can be mediated by positive feedback autocrine loops, a mode of cell signaling where binding of a diffusible extracellular ligand to a cell surface receptor can lead to further ligand release. We formulate and analyze a biophysical model that accounts for ligand-induced ligand release, extracellular ligand diffusion and ligand-receptor interaction. We focus on the case when the main mode for ligand degradation is extracellular and analyze the problem with the sharp threshold positive feedback nonlinearity. We derive expressions that link the speed of propagation and other characteristics of traveling waves to the parameters of the biophysical processes, such as diffusion rates, receptor expression level, etc. Analyzing the derived expressions we found that traveling waves in such systems can exhibit a number of unusual properties, e.g. non-monotonic dependence of the speed of propagation on ligand diffusivity. Our results for the fully developed traveling fronts can be used to analyze wave initiation from localized perturbations, a scenario that frequently arises in the in vitro models of epithelial wound healing, and guide future modeling studies of cell communication in epithelial layers.
Battelle's human factors program for the US Nuclear Regulatory Commission
International Nuclear Information System (INIS)
Shikiar, R.
1983-10-01
Battelle has been involved in a programmatic effort of technical assistance to the Division of Human Factors Safety of the NRC. This program involves the efforts of over 75 professionals engaged in over 20 projects. These projects span the areas of human factors engineering, procedures, examinations, training, staffing and qualifications, and utility management and organization. All of these bear, one way or another, on the role of operators in nuclear power plants. This programmatic effort can be viewed as part of an integrative approach to system safety
Cell-specific targeting by heterobivalent ligands.
Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J
2011-07-20
Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.
International Nuclear Information System (INIS)
Takahashi, Akinori; Obata, Yuuki; Fukumoto, Yasunori; Nakayama, Yuji; Kasahara, Kousuke; Kuga, Takahisa; Higashiyama, Yukihiro; Saito, Takashi; Yokoyama, Kazunari K.; Yamaguchi, Naoto
2009-01-01
Src-family kinases (SFKs), which participate in various signaling events, are found at not only the plasma membrane but also several subcellular compartments, including the nucleus. Nuclear structural changes are frequently observed during transcription, cell differentiation, senescence, tumorigenesis, and cell cycle. However, little is known about signal transduction in the alteration of chromatin texture. Here, we develop a pixel imaging method for quantitatively evaluating chromatin structural changes. Growth factor stimulation increases euchromatic hypocondensation and concomitant heterochromatic hypercondensation in G 1 phase, and the levels reach a plateau by 30 min, sustain for at least 5 h and return to the basal levels after 24 h. Serum-activated SFKs in the nucleus were more frequently detected in the euchromatin areas than the heterochromatin areas. Nuclear expression of kinase-active SFKs, but not unrelated Syk kinase, drastically increases both euchromatinization and heterochromatinization in a manner dependent on the levels of nuclear tyrosine phosphorylation. However, growth factor stimulation does not induce chromatin structural changes in SYF cells lacking SFKs, and reintroduction of one SFK member into SYF cells can, albeit insufficiently, induce chromatin structural changes. These results suggest that nuclear tyrosine phosphorylation by SFKs plays an important role in chromatin structural changes upon growth factor stimulation.
Retinal Ligand Mobility Explains Internal Hydration and Reconciles Active Rhodopsin Structures
Leioatts, Nicholas; Mertz, Blake; Martínez-Mayorga, Karina; Romo, Tod D.; Pitman, Michael C.; Feller, Scott E.; Grossfield, Alan; Brown, Michael F.
2014-01-01
Rhodopsin, the mammalian dim-light receptor, is one of the best-characterized G-protein-coupled receptors, a pharmaceutically important class of membrane proteins that has garnered a great deal of attention because of the recent availability of structural information. Yet the mechanism of rhodopsin activation is not fully understood. Here, we use microsecond-scale all-atom molecular dynamics simulations, validated by solid-state 2H nuclear magnetic resonance spectroscopy, to understand the transition between the dark and metarhodopsin I (Meta I) states. Our analysis of these simulations reveals striking differences in ligand flexibility between the two states. Retinal is much more dynamic in Meta I, adopting an elongated conformation similar to that seen in the recent activelike crystal structures. Surprisingly, this elongation corresponds to both a dramatic influx of bulk water into the hydrophobic core of the protein and a concerted transition in the highly conserved Trp2656.48 residue. In addition, enhanced ligand flexibility upon light activation provides an explanation for the different retinal orientations observed in X-ray crystal structures of active rhodopsin. PMID:24328554
Espa, Davide; Pilia, Luca; Marchiò, Luciano; Artizzu, Flavia; Serpe, Angela; Mercuri, Maria Laura; Simão, Dulce; Almeida, Manuel; Pizzotti, Maddalena; Tessore, Francesca; Deplano, Paola
2012-03-28
The mixed-ligand dithiolene complex [Pt(Bz(2)pipdt)(dcbdt)] (1) bearing the two ligands Bz(2)pipdt = 1,4-dibenzyl-piperazine-3,2-dithione and dcbdt = dicyanobenzodithiolato, has been synthesized, characterized and studied to evaluate its second-order optical nonlinearity. The dithione/dithiolato character of the two ligands gives rise to an asymmetric distribution of the charge in the molecule. This is reflected by structural data showing that in the C(2)S(2)PtS(2)C(2) dithiolene core the four sulfur atoms define a square-planar coordination environment of the metal where the Pt-S bond distances involving the two ligands are similar, while the C-S bond distances in the C(2)S(2) units exhibit a significant difference in Bz(2)pipdt (dithione) and dcbdt (dithiolato). 1 shows a moderately strong absorption peak in the visible region, which can be related to a HOMO-LUMO transition, where the dcbdt ligand (dithiolato) contributes mostly to the HOMO, and the Bz(2)pipdt one (dithione) mostly to the LUMO. Thus this transition has ligand-to-ligand charge transfer (CT) character with some contribution of the metal and undergoes negative solvatochromism and molecular quadratic optical nonlinearity (μβ(0) = -1296 × 10(-48) esu), which was determined by the EFISH (electric-field-induced second-harmonic generation) technique and compared with the values of similar complexes on varying the dithiolato ligand (mnt = maleonitriledithiolato, dmit = 2-thioxo-1,3-dithiole-4,5-dithiolato). Theoretical calculations help to elucidate the role of the dithiolato ligands in affecting the molecular quadratic optical nonlinearity of these complexes.
International Nuclear Information System (INIS)
Gao Feng; Liu Yanzi; Sun Yongbin
2014-01-01
The design of nuclear power plant control room system is a process of improvement with the implementation of human factor engineering theory and guidance. The method of implementation human factor engineering principles into the nuclear power plant control room system design and improvement was discussed in this paper. It is recommended that comprehensive address should be done from control room system function, human machine interface, digital procedure, control room layout and environment design based on the human factor engineering theory and experience. The main issues which should be paid more attention during the control room system design and improvement also were addressed in this paper, and then advices and notices for the design and improvement of the nuclear power plant control room system were afforded. (authors)
Changing the insulin receptor to possess insulin-like growth factor I ligand specificity
International Nuclear Information System (INIS)
Andersen, A.S.; Kjeldsen, T.; Wiberg, F.C.; Christensen, P.M.; Rasmussen, J.S.; Norris, K.; Moeller, K.B.; Moeller, N.P.H.
1990-01-01
To examine the role of the N-terminal part of the insulin-like growth factor I (IGF-I) receptor and insulin receptor in determining ligand specificity, the authors prepared an expression vector encoding a hybrid receptor where exon 1 (encoding the signal peptide and seven amino acids of the α-subunit), exon 2, and exon 3 of the insulin receptor were replaced with the corresponding IGF-I receptor cDNA (938 nucleotides). To allow direct quantitative comparison of the binding capabilities of this hybrid receptor with those of the human IGF-I receptor and the insulin receptor, all three receptors were expressed in baby hamster kidney (BHK) cells as soluble molecules and partially purified before characterization. The hybrid IGF-I/insulin receptor bound IGF-I with an affinity comparable to that of the wild-type IGF-I receptor. In contrast, the hybrid receptor no longer displayed high-affinity binding of insulin. These results directly demonstrate that it is possible to change the specificity of the insulin receptor to that of the IGF-I receptor and, furthermore, that the binding specificity for IGF-I is encoded within the nucleotide sequence from 135 to 938 of the IGF-I receptor cDNA. Since the hybrid receptor only bound insulin with low affinity, the insulin binding region is likely to be located within exons 2 and 3 of the insulin receptor
Fermi liquid, clustering, and structure factor in dilute warm nuclear matter
Röpke, G.; Voskresensky, D. N.; Kryukov, I. A.; Blaschke, D.
2018-02-01
Properties of nuclear systems at subsaturation densities can be obtained from different approaches. We demonstrate the use of the density autocorrelation function which is related to the isothermal compressibility and, after integration, to the equation of state. This way we connect the Landau Fermi liquid theory well elaborated in nuclear physics with the approaches to dilute nuclear matter describing cluster formation. A quantum statistical approach is presented, based on the cluster decomposition of the polarization function. The fundamental quantity to be calculated is the dynamic structure factor. Comparing with the Landau Fermi liquid theory which is reproduced in lowest approximation, the account of bound state formation and continuum correlations gives the correct low-density result as described by the second virial coefficient and by the mass action law (nuclear statistical equilibrium). Going to higher densities, the inclusion of medium effects is more involved compared with other quantum statistical approaches, but the relation to the Landau Fermi liquid theory gives a promising approach to describe not only thermodynamic but also collective excitations and non-equilibrium properties of nuclear systems in a wide region of the phase diagram.
International Nuclear Information System (INIS)
Simard, R.L.
1977-01-01
The Council on Economic Priorities (CEP) has assembled capacity factor data on most U.S. nuclear and coal-fired units in operation, performed a regression analysis upon capacity factor as a function of intrinsic unit variables such as size and age, and attempted a comparison of the economics of typical nuclear and coal-fired units using the resultant fitted-capacity factors. The report points out inadequacies in the CEP data base, the lack of predictive value in the results of the regression analysis, and inconsistencies in the economic evaluation of nuclear and coal-fired units
Role of ligands in permanganate oxidation of organics.
Jiang, Jin; Pang, Su-Yan; Ma, Jun
2010-06-01
We previously demonstrated that several ligands such as phosphate, pyrophosphate, EDTA, and humic acid could significantly enhance permanganate oxidation of triclosan (one phenolic biocide), which was explained by the contribution of ligand-stabilized reactive manganese intermediates in situ formed upon permanganate reduction. To further understand the underlying mechanism, we comparatively investigated the influence of ligands on permanganate oxidation of bisphenol A (BPA, one phenolic endocrine-disrupting chemical), carbamazepine (CBZ, a pharmaceutical containing the olefinic group), and methyl p-tolyl sulfoxide (TMSO, a typical oxygen-atom acceptor). Selected ligands exerted oxidation enhancement for BPA but had negligible influence for CBZ and TMSO. This was mainly attributed to the effects of identified Mn(III) complexes, which would otherwise disproportionate spontaneously in the absence of ligands. The one-electron oxidant Mn(III) species exhibited no reactivity toward CBZ and TMSO for which the two-electron oxygen donation may be the primary oxidation mechanism but readily oxidized BPA. The latter case was a function of pH, the complexing ligand, and the molar [Mn(III)]:[ligand] ratio, generally consistent with the patterns of ligand-affected permanganate oxidation. Moreover, the combination of the one-electron reduction of Mn(III) (Mn(III) + e(-) -->Mn(II)) and the Mn(VII)/Mn(II) reaction in excess ligands (Mn(VII) + 4Mn(II) ----> (ligands) 5Mn(III)) suggested a catalytic role of the Mn(III)/Mn(II) pair in permanganate oxidation of some phenolics in the presence of ligands.
Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue
Directory of Open Access Journals (Sweden)
R. Linden
1999-07-01
Full Text Available Programmed cell death in the form of apoptosis involves a network of metabolic events and may be triggered by a variety of stimuli in distinct cells. The nervous system contains several neuron and glial cell types, and developmental events are strongly dependent on selective cell interactions. Retinal explants have been used as a model to investigate apoptosis in nervous tissue. This preparation maintains the structural complexity and cell interactions similar to the retina in situ, and contains cells in all stages of development. We review the finding of nuclear exclusion of several transcription factors during apoptosis in retinal cells. The data reviewed in this paper suggest a link between apoptosis and a failure in the nucleo-cytoplasmic partition of transcription factors. It is argued that the nuclear exclusion of transcription factors may be an integral component of apoptosis both in the nervous system and in other types of cells and tissues.
Human factors review of nuclear power plant control room design. Final report
International Nuclear Information System (INIS)
Seminara, J.L.; Gonzalez, W.R.; Parsons, S.O.
1976-11-01
The human factors aspects of five representative nuclear power plant control rooms were evaluated using such methods as a checklist guided observation system, structured interviews with operators and trainers, direct observations of operator behavior, task analyses and procedure evaluation, and historical error analyses. The human factors aspects of design practices are illustrated, and many improvements in current practices are suggested. The study recommends that a detailed set of applicable human factors standards be developed to stimulate a uniform and systematic concern for human factors in design considerations
International Nuclear Information System (INIS)
Kwan-Seong Jeong; Dong-Gyu Lee; Chong-Hun Jung; Kune-Woo Lee
2007-01-01
Available in abstract form only. Full text of publication follows: The uncertainties of decommissioning costs increase high due to several conditions. Decommissioning cost estimation depends on the complexity of nuclear installations, its site-specific physical and radiological inventories. Therefore, the decommissioning costs of nuclear research facilities must be estimated in accordance with the detailed sub-tasks and resources by the tasks of decommissioning activities. By selecting the classified activities and resources, costs are calculated by the items and then the total costs of all decommissioning activities are reshuffled to match with its usage and objectives. And the decommissioning cost of nuclear research facilities is calculated by applying a unit cost factor method on which classification of decommissioning works fitted with the features and specifications of decommissioning objects and establishment of composition factors are based. Decommissioning costs of nuclear research facilities are composed of labor cost, equipment and materials cost. Of these three categorical costs, the calculation of labor costs are very important because decommissioning activities mainly depend on labor force. Labor costs in decommissioning activities are calculated on the basis of working time consumed in decommissioning objects and works. The working times are figured out of unit cost factors and work difficulty factors. Finally, labor costs are figured out by using these factors as parameters of calculation. The accuracy of decommissioning cost estimation results is much higher compared to the real decommissioning works. (authors)
Directory of Open Access Journals (Sweden)
Nikolai V. Kuznetsov
2017-10-01
Full Text Available Abstract Background The Wiskott–Aldrich syndrome protein (WASp family of actin-nucleating factors are present in the cytoplasm and in the nucleus. The role of nuclear WASp for T cell development remains incompletely defined. Methods We performed WASp chromatin immunoprecipitation and deep sequencing (ChIP-seq in thymocytes and spleen CD4+ T cells. Results WASp was enriched at genic and intergenic regions and associated with the transcription start sites of protein-coding genes. Thymocytes and spleen CD4+ T cells showed 15 common WASp-interacting genes, including the gene encoding T cell factor (TCF12. WASp KO thymocytes had reduced nuclear TCF12 whereas thymocytes expressing constitutively active WASpL272P and WASpI296T had increased nuclear TCF12, suggesting that regulated WASp activity controlled nuclear TCF12. We identify a putative DNA element enriched in WASp ChIP-seq samples identical to a TCF1-binding site and we show that WASp directly interacted with TCF1 in the nucleus. Conclusions These data place nuclear WASp in proximity with TCF1 and TCF12, essential factors for T cell development.
International Nuclear Information System (INIS)
Ribokaite, Kristina
2013-01-01
Monoamides and organophosphate are of great interest for the nuclear fuel cycle. Such ligands can selectively extract actinides in liquid-liquid extraction processes. The structure of the extractant (its functional group and its alkyl substituents) has a predominant role in the selective separation of actinides. This thesis concerns the theoretical and experimental studies of model systems in the aim of better understanding of the effect on molecular structures of the complexes. Structures of actinides complexes formed with model ligands in simple media (water or methanol in the presence of nitrate ions) have been characterized. At first, the complexation of uranyl by monoamide and phosphine oxide was studied in water and methanol. Molecular Dynamics simulations and DFT calculations were used to quantify the stability of uranyl complexes with those ligands, and to determine their structural properties. The theoretical results were then compared with experimental results obtained by UV-visible, infrared, Raman and EXAFS on the same chemical systems. The results were used to highlight the greater stability of uranyl complexes with phosphine oxide and monoamides. Further spectroscopic measurements combined with molecular modeling were used to gain a better understanding of the coordination mode of nitrate ion around the uranyl in both water and methanol. Finally, DFT calculations were used to study the influence of the structure of the monoamide or organophosphorus ligand and their interaction with the actinides (IV, VI) including steric effects in the first coordination sphere. (author) [fr
De Zoysa, Mahanama; Nikapitiya, Chamilani; Oh, Chulhong; Whang, Ilson; Lee, Jae-Seong; Jung, Sung-Ju; Choi, Cheol Young; Lee, Jehee
2010-01-01
The lipopolysaccharide-induced TNF-alpha factor (LITAF) and Rel family nuclear factor kappaB (Rel/NF-kB) are two important transcription factors which play major roles in the regulating inflammatory cytokine, apoptosis and immune related genes. Here, we report the discovery of disk abalone LITAF (AbLITAF) and Rel/NF-kB (AbRel/NF-kB) homologues and their immune responses. Full-length cDNA of AbLITAF consists of 441 bp open reading frame (ORF) that translates into putative peptide of 147 aa. Analysis of AbLITAF sequence showed it has characteristic LITAF (Zn(+2)) binding domain with two CXXC motifs. Phylogenetic analysis results further revealed that AbLITAF is a member of LITAF family. AbRel/NF-kB is 584 aa protein that contains several characteristic motifs including Rel homology domain (RHD), Rel protein signature, DNA binding motif, nuclear localization signal (NLS) and transcription factor immunoglobulin - like fold (TIG) similar to their invertebrate and vertebrate counterparts. Tissue specific analysis results showed that both AbLITAF and AbRel/NF-kB mRNA was expressed ubiquitously in all selected tissues in constitutive manner. However, constitutive expression of AbLITAF was higher than AbRel/NF-kB in all tissues except mantle. Upon immune challenge by bacteria (Vibrio alginolyticus, Vibrio parahemolyticus and Lysteria monocytogenes) and viral hemoragic septicemia virus (VHSV), AbLITAF showed the significant up-regulation in gills while AbRel/NF-kB transcription was not change significantly. Based on transcriptional response against immune challenge, we could suggest that regulation of TNF-alpha expression may have occurred mainly by LITAF activation rather than NF-kB in disk abalone. The cumulative data from other molluscs and our data with reference to TNF-alpha, LITAF and Rel/NF-kB from disk abalone provide strong evidence that LITAF and NF-kB are independent pathways likely to occur throughout the Phylum mollusca. 2010 Elsevier Ltd. All rights reserved.
Nuclear medicine - factors influencing the choice and use of radionuclides in diagnosis and therapy
International Nuclear Information System (INIS)
Anon.
1983-01-01
This report addresses the many factors which influence the choice of the proper radiopharmaceutical drug product for the diagnosis or treatment of a specific disease or condition in a human subject. The Report examines the historical factors that influence the choice of radionuclides, the factors that influence the localization of radionuclides in tissues, the factors that influence the choice of instruments, and include an evaluation of the nuclear medicine procedures that could be selected and their clinical usefulness. In examining these factors the desirable characteristics of the radiopharmaceutical drug products of the measurement systems are identified. The methods of dose determination and the assumptions used in determination of dose are developed. There is also a section on radiation effects. A chapter on guidelines for procedures in nuclear medicine and some general and specific recommendations for protection of patients conclude the body of the text
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-07-01
In co-operation with the OECD Nuclear Energy Agency (NEA), the Halden Reactor Project organised a Summer School on ''Safe Operation of Nuclear Power Plants: Impacts of Human and Organisational Factors and Emerging Technologies'' in the period August 27-August 31, 2001. The Summer School was intended for scientists, engineers and technicians working for nuclear installations, engineering companies, industry and members of universities and research institutes, who wanted to broaden their nuclear background by getting acquainted with Man-Technology-Organisation-related subjects and issues. The Summer School should also serve to transfer knowledge to the ''young generation'' in the nuclear field. The following presentations were given: (1) Overview of the Nuclear Community and Current issues, (2) The Elements of Safety Culture; Evaluation of Events, (3) Quality Management (QM), (4) Probabilistic Risk Assessment (PSA), (5) Human Behaviour from the Viewpoint of Industrial Psychology, (6) Technical tour of the Halden Project Experimental Facilities, (7) Human Factors in Control Room Design, (8) Computerised Operator Support Systems (COSSs) and (9) Artificial Intelligence; a new Approach. Most of the contributions are overhead figures from spoken lectures.
The role of nuclear hormone receptors in cutaneous wound repair.
Rieger, Sandra; Zhao, Hengguang; Martin, Paige; Abe, Koichiro; Lisse, Thomas S
2015-01-01
The cutaneous wound repair process involves balancing a dynamic series of events ranging from inflammation, oxidative stress, cell migration, proliferation, survival and differentiation. A complex series of secreted trophic factors, cytokines, surface and intracellular proteins are expressed in a temporospatial manner to restore skin integrity after wounding. Impaired initiation, maintenance or termination of the tissue repair processes can lead to perturbed healing, necrosis, fibrosis or even cancer. Nuclear hormone receptors (NHRs) in the cutaneous environment regulate tissue repair processes such as fibroplasia and angiogenesis. Defects in functional NHRs and their ligands are associated with the clinical phenotypes of chronic non-healing wounds and skin endocrine disorders. The functional relationship between NHRs and skin niche cells such as epidermal keratinocytes and dermal fibroblasts is pivotal for successful wound closure and permanent repair. The aim of this review is to delineate the cutaneous effects and cross-talk of various nuclear receptors upon injury towards functional tissue restoration. Copyright © 2014 John Wiley & Sons, Ltd.
Nuclear Power and Resource Efficiency—A Proposal for a Revised Primary Energy Factor
Directory of Open Access Journals (Sweden)
Ola Eriksson
2017-06-01
Full Text Available Measuring resource efficiency can be achieved using different methods, of which primary energy demand is commonly used. The primary energy factor (PEF is a figure describing how much energy from primary resources is being used per unit of energy delivered. The PEF for nuclear power is typically 3, which refers to thermal energy released from fission in relation to electricity generated. Fuel losses are not accounted for. However; nuclear waste represents an energy loss, as current plans for nuclear waste management mostly include final disposal. Based on a literature review and mathematical calculations of the power-to-fuel ratio for nuclear power, PEF values for the open nuclear fuel cycle (NFC option of nuclear power and different power mixes are calculated. These calculations indicate that a more correct PEF for nuclear power would be 60 (range 32–88; for electricity in Sweden (41% nuclear power PEF would change from 1.8 to 25.5, and the average PEF for electricity in the European Union (EU would change from 2.5 to 18. The results illustrate the poor resource efficiency of nuclear power, which paves the way for the fourth generation of nuclear power and illustrates the policy implication of using PEFs which are inconsistent with current waste management plans.
Inhibitors of nuclear factor kappa B cause apoptosis in cultured macrophages
Directory of Open Access Journals (Sweden)
E. E. Mannick
1997-01-01
Full Text Available The precise role of the transcription factor nuclear factor kappa B (NF- κB in the regulation of cell survival and cell death is still unresolved and may depend on cell type and position in the cell cycle. The aim of this study was to determine if three pharmacologic inhibitors of NF-κB, pyrrolidine dithiocarbamate, N-tosyl-L-lysl chloromethyl ketone and calpain I inhibitor, induce apoptosis in a murine macrophage cell line (RAW 264.7 at doses similar to those required for NF-κB inhibition. We found that each of the three inhibitors resulted in a dose- and time-dependent increase in morphologic indices of apoptosis in unstimulated, LPS-stimulated and TNF-stimulated cells. Lethal doses were consistent with those required for NF- κB inhibition. We conclude that nuclear NF-κB activation may represent an important survival mechanism in macrophages.
International Nuclear Information System (INIS)
Xu, Ningna; Yu, Shen; Moniot, Sébastien; Weyand, Michael; Blankenfeldt, Wulf
2012-01-01
The ligand-binding domain of the transcription factor PqsR from P. aeruginosa has been crystallized and initial phases have been obtained using SAD data from seleno-l-methionine-labelled crystals. The opportunistic bacterial pathogen Pseudomonas aeruginosa employs three transcriptional regulators, LasR, RhlR and PqsR, to control the transcription of a large subset of its genes in a cell-density-dependent process known as quorum sensing. Here, the recombinant production, crystallization and structure solution of the ligand-binding domain of PqsR (MvfR), the LysR-type transcription factor that responds to the Pseudomonas quinolone signal (PQS), a quinolone-based quorum-sensing signal that is unique to P. aeruginosa and possibly a small number of other bacteria, is reported. PqsR regulates the expression of many virulence genes and may therefore be an interesting drug target. The ligand-binding domain (residues 91–319) was produced as a fusion with SUMO, and hexagonal-shaped crystals of purified PqsR-91–319 were obtained using the vapour-diffusion method. Crystallization in the presence of a PQS precursor allowed data collection to 3.25 Å resolution on a synchrotron beamline, and initial phases have been obtained using single-wavelength anomalous diffraction data from seleno-l-methionine-labelled crystals, revealing the space group to be P6 5 22, with unit-cell parameters a = b = 116–120, c = 115–117 Å
Radiation induced ligand loss from cobalt complexes
International Nuclear Information System (INIS)
Funston, A. M.; McFadyen, W.D.; Tregloan, P.A.
2000-01-01
Full text: Due to the rapid nature of ligand dissociation from cobalt(II) complexes the study of the rate of ligand dissociation necessitates the use of a technique such as pulse radiolysis. This allows the rapid reduction of the corresponding cobalt(III) complex by a reducing radical, such as the aquated electron, to form the cobalt(II) complex. However, to date, no systematic study of either the mechanism of reduction or the influence of the electronic structure on the rate of ligand dissociation has been carried out. In order to understand these processes more fully the mechanism of reduction of a range of related cobalt(III) complexes by the aquated electron and the subsequent rate of ligand dissociation from the resulting cobalt(II) complexes is being investigated. It has been found that a number of processes are observed following the initial rapid reaction of the cobalt(III) complex with the aquated electron. Ultimately ligand loss is observed. Depending upon the complex, the initial processes observed may include the formation of coordinated radicals and electron transfer within the complex. For complexes containing aromatic ligands such as 2,2'-bipyridine, 1,10-phenanthroline and dipyrido[3,2-a:2',3'-c]phenazine the formation of a coordinated radical is observed as the initial reduction step. The kinetics of ligand dissociation of these complexes has been determined. The loss of monodentate ligands is fast and has been indistinguishable from the reduction processes when aromatic ligands are also present in the complex. However, for diamine chelates and diimine chelates spectra of the transient species can be resolved
Nuclear Import and Export of the Thyroid Hormone Receptor.
Zhang, Jibo; Roggero, Vincent R; Allison, Lizabeth A
2018-01-01
The thyroid hormone receptors, TRα1 and TRβ1, are members of the nuclear receptor superfamily that forms one of the most abundant classes of transcription factors in multicellular organisms. Although primarily localized to the nucleus, TRα1 and TRβ1 shuttle rapidly between the nucleus and cytoplasm. The fine balance between nuclear import and export of TRs has emerged as a critical control point for modulating thyroid hormone-responsive gene expression. Mutagenesis studies have defined two nuclear localization signal (NLS) motifs that direct nuclear import of TRα1: NLS-1 in the hinge domain and NLS-2 in the N-terminal A/B domain. Three nuclear export signal (NES) motifs reside in the ligand-binding domain. A combined approach of shRNA-mediated knockdown and coimmunoprecipitation assays revealed that nuclear entry of TRα1 is facilitated by importin 7, likely through interactions with NLS-2, and importin β1 and the adapter importin α1 interacting with both NLS-1 and NLS-2. Interestingly, TRβ1 lacks NLS-2 and nuclear import depends solely on the importin α1/β1 heterodimer. Heterokaryon and fluorescence recovery after photobleaching shuttling assays identified multiple exportins that play a role in nuclear export of TRα1, including CRM1 (exportin 1), and exportins 4, 5, and 7. Even single amino acid changes in TRs dramatically alter their intracellular distribution patterns. We conclude that mutations within NLS and NES motifs affect nuclear shuttling activity, and propose that TR mislocalization contributes to the development of some types of cancer and Resistance to Thyroid Hormone syndrome. © 2018 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Prat-Lepesant, M
2005-06-15
The hematopoietic compartment is one of the most severely damaged after chemotherapy, radiotherapy or accidental irradiations. Whatever its origin, the resulting damage to the bone marrow remains difficult to evaluate. Thus, it would be of great interest to get a biological indicator of residual hematopoiesis in order to adapt the treatment to each clinical situation. Recent results indicated that the plasma Flt3 ligand concentration was increased in patients suffering from either acquired or induced aplasia, suggesting that Flt3 ligand might be useful as a biological indicator of bone marrow status. We thus followed in a mouse model as well as in several clinical situations the variations in plasma Flt3 ligand concentration, after either homogeneous or heterogeneous irradiations. These variations were correlated to the number of hematopoietic progenitors and to other parameters such as duration and depth of pancytopenia. The results indicated that the concentration of Flt3 ligand in the blood reflects the bone marrow status, and that the follow-up of plasma Flt3 ligand concentration could give predictive information about the bone marrow function and the duration and severity of pancytopenia and thrombocytopenia. Nevertheless, the clinical use of Flt3 ligand as a biological indicator of bone marrow damage require the knowledge of the mechanisms regulating the variations in plasma Flt3 ligand concentration. We thus developed a study in the mouse model. The results indicated that the variations in plasma Flt3 ligand variations were not solely due to a balance between its production by lymphoid cells and its consumption by hematopoietic cells. Moreover, we showed that T lymphocytes are not the main regulator of plasma Flt3 ligand concentration as previously suggested, and that other cell types, possibly including bone marrow stromal cells, might be strongly implicated. These results also suggest that the Flt3 ligand is a main systemic regulator of hematopoiesis
Synthesis and characterization of mixed ligand chiral nanoclusters
Guven, Zekiye P.; Ustbas, Burcin; Harkness, Kellen M.; Coskun, Hikmet; Joshi, Chakra Prasad; Besong, Tabot M.D.; Stellacci, Francesco; Bakr, Osman; Akbulut, Ozge
2016-01-01
Chiral mixed ligand silver nanoclusters were synthesized in the presence of a chiral and an achiral ligand. While the chiral ligand led mostly to the formation of nanoparticles, the presence of the achiral ligand drastically increased the yield of nanoclusters with enhanced chiral properties. © 2016 The Royal Society of Chemistry.
Synthesis and characterization of mixed ligand chiral nanoclusters
Guven, Zekiye P.
2016-06-22
Chiral mixed ligand silver nanoclusters were synthesized in the presence of a chiral and an achiral ligand. While the chiral ligand led mostly to the formation of nanoparticles, the presence of the achiral ligand drastically increased the yield of nanoclusters with enhanced chiral properties. © 2016 The Royal Society of Chemistry.
International Nuclear Information System (INIS)
Madden, V.J.
1990-01-01
The staff and simulators of utility's nuclear training function are being utilized in support of a wide range of human factor related activities. In addition to work on man machines interface review, operating procedures, operator support system and VDU format design and validation for the Magnox and AGR series of nuclear power plants, support is also being provided to the PWR Project Team through staff who have undergone extensive and comprehensive overseas PWR training programs. This paper discusses how recent initiatives in connection with a survey on operator stress and the possible use of psychometric testing in support of the selection of reactor desk engineers are also being supported
Identifying Marine Copper-Binding Ligands in Seawater
Whitby, H.; Hollibaugh, J. T.; Maldonado, M. T.; Ouchi, S.; van den Berg, S. M.
2016-02-01
Complexation reactions are important because they affect the bioavailability of trace metals such as copper and iron. For example, organic complexation can determine whether copper is a limiting or a toxic micronutrient at natural levels. Copper competes with iron for complexing ligands, and when iron is limiting, copper can also substitute for iron in some metabolic pathways. The speciation of copper can be measured using complexing capacity titrations, which provide the concentration of individual ligand classes (L1, L2 etc.) and the complex stabilities (log K). Using methods recently developed in our laboratory, we show that the ligands within these classes can be measured independently of titrations, thus confirming the titration method and simultaneously identifying the ligands within each class. Thiols were identified as the L1 ligand class and humic compounds as the weaker L2 class in samples from coastal Georgia, USA, collected monthly from April to December. Log K values of the ligand complexes were consistent with values expected for thiols and humic substances. Recent results from culture studies and from samples collected along Line P, a coastal - oceanic transect in the HNLC region of the NE subarctic Pacific, will be presented in comparison to the estuarine results. This comparison will help to broaden our perspective on copper complexation and the ligands responsible, furthering our understanding of ligand sources and life cycles.
A nuclear-receptor-dependent phosphatidylcholine pathway with antidiabetic effects.
Lee, Jae Man; Lee, Yoon Kwang; Mamrosh, Jennifer L; Busby, Scott A; Griffin, Patrick R; Pathak, Manish C; Ortlund, Eric A; Moore, David D
2011-05-25
Nuclear hormone receptors regulate diverse metabolic pathways and the orphan nuclear receptor LRH-1 (also known as NR5A2) regulates bile acid biosynthesis. Structural studies have identified phospholipids as potential LRH-1 ligands, but their functional relevance is unclear. Here we show that an unusual phosphatidylcholine species with two saturated 12 carbon fatty acid acyl side chains (dilauroyl phosphatidylcholine (DLPC)) is an LRH-1 agonist ligand in vitro. DLPC treatment induces bile acid biosynthetic enzymes in mouse liver, increases bile acid levels, and lowers hepatic triglycerides and serum glucose. DLPC treatment also decreases hepatic steatosis and improves glucose homeostasis in two mouse models of insulin resistance. Both the antidiabetic and lipotropic effects are lost in liver-specific Lrh-1 knockouts. These findings identify an LRH-1 dependent phosphatidylcholine signalling pathway that regulates bile acid metabolism and glucose homeostasis.
Mitić, M.; Simić, I.; Djordjević, J.; Radojčić, M. B.; Adžić, M.
2011-12-01
Dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis has been implicated in the pathophysiology of depression and stress disorders. Glucocorticoids, key regulators of the stress response, exert diverse effects on cellular processes in the hippocampus. Beside non-genomic pathways, glucocorticoid effects are mediated through activation of the glucocorticoid receptor (GR), a ligand activated transcriptional factor that belongs to the nuclear hormone receptor superfamily. We analysed the GR protein levels both in the cytoplasmic and nuclear compartments of the hippocampus of Wistar rats exposed to chronic psychosocial isolation stress upon chronic fluoxetine (FLU) treatment. Under chronic stress, corticosterone levels (CORT) were decreased compared to the control, and treatment with FLU did not change its level in the stressed rats. At the molecular level, FLU normalized the level of nuclear GR protein in the hippocampus of the stressed rats. Discrepancy between normalization of nuclear GR in the hippocampus and lack of normalization of HPA axis activity judged by CORT, suggests that other brain structures such as the amygdale and prefrontal cortex that also regulate HPA axis activity, seem not to be normalized by the FLU treatment used in our study.
Human factors considerations for expert systems in the nuclear industry
International Nuclear Information System (INIS)
Nelson, W.R.
1988-01-01
This paper discusses the general human factors issues relative to the development and implementation of expert systems for the nuclear industry. It summarizes the relevant research that addresses these issues, and identifies those areas that need the most effort for success. Since much of the prominent work for the application of expert systems has focused on computerized aids for decision making in emergencies, this paper draws from this area for its examples. This area tends to highlight the issues because of the safety-critical nature of the application. The same issues, however, are relevant to other applications of expert systems in the nuclear industry as well, even though the consequences of failure may not be as dramatic