WorldWideScience

Sample records for nuclear erythroid 2-related

  1. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  3. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  4. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  5. Nuclear factor erythroid 2-related factor 2 deletion impairs glucose tolerance and exacerbates hyperglycemia in type 1 diabetic mice.

    Science.gov (United States)

    Aleksunes, Lauren M; Reisman, Scott A; Yeager, Ronnie L; Goedken, Michael J; Klaassen, Curtis D

    2010-04-01

    The transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2) induces a battery of cytoprotective genes after oxidative stress. Nrf2 aids in liver regeneration by altering insulin signaling; however, whether Nrf2 participates in hepatic glucose homeostasis is unknown. Compared with wild-type mice, mice lacking Nrf2 (Nrf2-null) have lower basal serum insulin and prolonged hyperglycemia in response to an intraperitoneal glucose challenge. In the present study, blood glucose, serum insulin, urine flow rate, and hepatic expression of glucose-related genes were quantified in male diabetic wild-type and Nrf2-null mice. Type 1 diabetes was induced with a single intraperitoneal dose (200 mg/kg) of streptozotocin (STZ). Histopathology and serum insulin levels confirmed depleted pancreatic beta-cells in STZ-treated mice of both genotypes. Five days after STZ, Nrf2-null mice had higher blood glucose levels than wild-type mice. Nine days after STZ, polyuria occurred in both genotypes with more urine output from Nrf2-null mice (11-fold) than wild-type mice (7-fold). Moreover, STZ-treated Nrf2-null mice had higher levels of serum beta-hydroxybutyrate, triglycerides, and fatty acids 10 days after STZ compared with wild-type mice. STZ reduced hepatic glycogen in both genotypes, with less observed in Nrf2-null mice. Increased urine output and blood glucose in STZ-treated Nrf2-null mice corresponded with enhanced gluconeogenesis (glucose-6-phosphatase and phosphoenolpyruvate carboxykinase)- and reduced glycolysis (pyruvate kinase)-related mRNA expression in their livers. Furthermore, the Nrf2 activator oltipraz lowered blood glucose in wild-type but not Nrf2-null mice administered STZ. Collectively, these data indicate that the absence of Nrf2 worsens hyperglycemia in type I diabetic mice and Nrf2 may represent a therapeutic target for reducing circulating glucose levels.

  6. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  8. The nuclear factor-erythroid 2-related factor/heme oxygenase-1 axis is critical for the inflammatory features of type 2 diabetes-associated osteoarthritis.

    Science.gov (United States)

    Vaamonde-Garcia, Carlos; Courties, Alice; Pigenet, Audrey; Laiguillon, Marie-Charlotte; Sautet, Alain; Houard, Xavier; Kerdine-Römer, Saadia; Meijide, Rosa; Berenbaum, Francis; Sellam, Jérémie

    2017-09-01

    Epidemiological findings support the hypothesis that type 2 diabetes mellitus (T2DM) is a risk factor for osteoarthritis (OA). Moreover, OA cartilage from patients with T2DM exhibits a greater response to inflammatory stress, but the molecular mechanism is unclear. To investigate whether the antioxidant defense system participates in this response, we examined here the expression of nuclear factor-erythroid 2-related factor (Nrf-2), a master antioxidant transcription factor, and of heme oxygenase-1 (HO-1), one of its main target genes, in OA cartilage from T2DM and non-T2DM patients as well as in murine chondrocytes exposed to high glucose (HG). Ex vivo experiments indicated that Nrf-2 and HO-1 expression is reduced in T2DM versus non-T2DM OA cartilage (0.57-fold Nrf-2 and 0.34-fold HO-1), and prostaglandin E 2 (PGE 2 ) release was increased in samples with low HO-1 expression. HG-exposed, IL-1β-stimulated chondrocytes had lower Nrf-2 levels in vitro , particularly in the nuclear fraction, than chondrocytes exposed to normal glucose (NG). Accordingly, HO-1 levels were also decreased (0.49-fold) in these cells. The HO-1 inducer cobalt protoporphyrin IX more efficiently attenuated PGE 2 and IL-6 release in HG+IL-1β-treated cells than in NG+IL-1β-treated cells. Greater reductions in HO-1 expression and increase in PGE 2 /IL-6 production were observed in HG+IL-1β-stimulated chondrocytes from Nrf-2 -/- mice than in chondrocytes from wild-type mice. We conclude that the Nrf-2/HO-1 axis is a critical pathway in the hyperglucidic-mediated dysregulation of chondrocytes. Impairments in this antioxidant system may explain the greater inflammatory responsiveness of OA cartilage from T2DM patients and may inform treatments of such patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  10. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  11. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  12. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  13. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  14. Qing brick tea (QBT) aqueous extract protects monosodium glutamate-induced obese mice against metabolic syndrome and involves up-regulation Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) antioxidant pathway.

    Science.gov (United States)

    Gao, Wenqi; Xiao, Changyi; Hu, Jun; Chen, Biaoxin; Wang, Chunyan; Cui, Bangping; Deng, Pengyi; Yang, Jian; Deng, Zhifang

    2018-04-18

    Qing brick tea (QBT), traditional and popular beverage for Chinese people, is an important post-fermentation dark tea. Our present study was performed to investigate the ameliorative effects of QBT aqueous extract on metabolic syndrome (Mets) in monosodium glutamate-induced obese mice and the potential mechanisms. Monosodium glutamate-induced obese mice were used to evaluate the anti-Mets effects of QBT. Content levels of malonaldehyde (MDA), reactive oxygen species (ROS) and protein carbonylation, antioxidant enzyme activities of superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT), glutathione reductase (GR) in the skeletal muscle were assessed by commercial kits, respectively. Western blot and Q-PCR were used to detect the expressions of Transcription Factor Nuclear Factor-Erythroid 2-Related Factor 2 (Nrf2) signaling pathway and downstream antioxidant factors. In addition, activity of AKT signaling and expression of glucose transporter type 4 (GLUT4) in the skeletal muscle were investigated by western blot. QBT treatment limited gain of body weight, waistline and LEE index, improved insulin resistance and glucose intolerance, reduced lipid level in MSG mice. Content levels of MDA, ROS and protein carbonylation in skeletal muscle of QBT group were significantly improved compared to those of MSG mice. The antioxidant enzyme activities of SOD, GPx, CAT, and GR were increased in skeletal muscle of MSG mice intervened with QBT. After 20-week QBT treatment, Nrf2 signaling pathway and downstream antioxidant factors were both increased in the skeletal muscle. In addition, QBT treatment improved insulin signaling by preferentially augmenting AKT signaling, as well as increased the protein expression of GLUT4 in the skeletal muscle. Our results showed that QBT intake was effective in protecting monosodium glutamate-induced obese mice against metabolic syndrome and involved in the Nrf2 signaling pathway in the skeletal muscle. Copyright © 2018

  15. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  16. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  17. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  18. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  19. Antioxidant mechanism of black garlic extract involving nuclear factor erythroid 2-like factor 2 pathway.

    Science.gov (United States)

    Ha, Ae Wha; Kim, Woo Kyoung

    2017-06-01

    Although studies have revealed that black garlic is a potent antioxidant, its antioxidant mechanism remains unclear. The objective of this study was to determine black garlic's antioxidant activities and possible antioxidant mechanisms related to nuclear factor erythroid 2-like factor 2 (Nrf2)-Keap1 complex. After four weeks of feeding rats with a normal fat diet (NF), a high-fat diet (HF), a high-fat diet with 0.5% black garlic extract (HF+BGE 0.5), a high-fat diet with 1.0% black garlic extract (HF+BGE 1.0), or a high-fat diet with 1.5% black garlic extract (HF+BGE 1.5), plasma concentrations of glucose, insulin,homeostatic model assessment of insulin resistance (HOMA-IR) were determined. As oxidative stress indices, plasma concentrations of thiobarbituric acid reactive substances (TBARS) and 8-isoprostaglandin F2α (8-iso-PGF) were determined. To measure antioxidant capacities, plasma total antioxidant capacity (TAC) and activities of antioxidant enzymes in plasma and liver were determined. The mRNA expression levels of antioxidant related proteins such as Nrf2, NAD(P)H: quinone-oxidoreductase-1 (NQO1), heme oxygenase-1 (HO-1), glutathione reductase (GR), and glutathione S-transferase alpha 2 (GSTA2) were examined. Plasma glucose level, plasma insulin level, and HOMA-IR in black garlic supplemented groups were significantly ( P concentration and TAC in the HF+BGE 1.5 group were significantly decreased compared to those of the HF group. The activities of catalase and glutathione peroxidase were significantly ( P antioxidant systems in rats fed with black garlic extract were related to mRNA expression levels of Nrf2 related genes.

  20. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  2. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  3. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  4. Lack of association between nuclear factor erythroid-derived 2-like 2 promoter gene polymorphisms and oxidative stress biomarkers in amyotrophic lateral sclerosis patients.

    Science.gov (United States)

    LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele

    2014-01-01

    Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.

  5. Lack of Association between Nuclear Factor Erythroid-Derived 2-Like 2 Promoter Gene Polymorphisms and Oxidative Stress Biomarkers in Amyotrophic Lateral Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Annalisa LoGerfo

    2014-01-01

    Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.

  6. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  7. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  8. Protection by dimethyl fumarate against diabetic cardiomyopathy in type 1 diabetic mice likely via activation of nuclear factor erythroid-2 related factor 2.

    Science.gov (United States)

    Hu, Xinyue; Rajesh, Mohanraj; Zhang, Jian; Zhou, Shanshan; Wang, Shudong; Sun, Jian; Tan, Yi; Zheng, Yang; Cai, Lu

    2018-05-01

    Oxidative stress and inflammation play key roles in the development of diabetic cardiomyopathy (DCM). Dimethyl fumarate (DMF), an FDA approved medicine for relapsing multiple sclerosis, has manifested its antioxidant and anti-inflammatory function mostly in the central nervous system. In this study, we investigated whether DMF could attenuate the development of DCM. Type 1 diabetes mouse model was established using multiple low-dose streptozotocin, and the diabetic mice were treated with DMF (10 mg/kg body weight) for 3 months. Cardiac functions were determined using echocardiography. Oxidative stress, pro-inflammatory cytokines and pro-fibrotic markers were determined with commercially available kits, real-time quantitative PCR or western blot techniques. DCM was characterized by diminished cardiac function, accompanied by oxidative stress and enhanced expression of pro-inflammatory cytokines. Diabetic cardiac tissue exhibited marked fibrosis, revealed by extracellular matrix deposition as determined by Sirius red staining of the myocardial tissues. Furthermore, Nrf2 and its downstream effectors were repressed in diabetic myocardium. On the contrary, diabetic animals treated with DMF exhibited blunted oxidative stress, inflammation, fibrosis and this correlated with Nrf2 activation. Our findings suggest that DMF could potentially thwart diabetes-induced myocardial tissue injury, likely via activation of Nrf2 function, providing firm impetus for future repurposing of DMF in the management of DCM. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    Science.gov (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

    Science.gov (United States)

    Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

    2017-06-01

    Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Dual-energy precursor and nuclear erythroid-related factor 2 activator treatment additively improve redox glutathione levels and neuron survival in aging and Alzheimer mouse neurons upstream of reactive oxygen species.

    Science.gov (United States)

    Ghosh, Debolina; LeVault, Kelsey R; Brewer, Gregory J

    2014-01-01

    To determine whether glutathione (GSH) loss or increased reactive oxygen species (ROS) are more important to neuron loss, aging, and Alzheimer's disease (AD), we stressed or boosted GSH levels in neurons isolated from aging 3xTg-AD neurons compared with those from age-matched nontransgenic (non-Tg) neurons. Here, using titrating with buthionine sulfoximine, an inhibitor of γ-glutamyl cysteine synthetase (GCL), we observed that GSH depletion increased neuronal death of 3xTg-AD cultured neurons at increasing rates across the age span, whereas non-Tg neurons were resistant to GSH depletion until old age. Remarkably, the rate of neuron loss with ROS did not increase in old age and was the same for both genotypes, which indicates that cognitive deficits in the AD model were not caused by ROS. Therefore, we targeted for neuroprotection activation of the redox sensitive transcription factor, nuclear erythroid-related factor 2 (Nrf2) by 18 alpha glycyrrhetinic acid to stimulate GSH synthesis through GCL. This balanced stimulation of a number of redox enzymes restored the lower levels of Nrf2 and GCL seen in 3xTg-AD neurons compared with those of non-Tg neurons and promoted translocation of Nrf2 to the nucleus. By combining the Nrf2 activator together with the NADH precursor, nicotinamide, we increased neuron survival against amyloid beta stress in an additive manner. These stress tests and neuroprotective treatments suggest that the redox environment is more important for neuron survival than ROS. The dual neuroprotective treatment with nicotinamide and an Nrf2 inducer indicates that these age-related and AD-related changes are reversible. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. The transcription factor, Nuclear factor, erythroid 2 (Nfe2), is a regulator of the oxidative stress response during Danio rerio development

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others

    2016-11-15

    Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were

  13. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  14. l-2-Oxothiazolidine-4-Carboxylic Acid or α-Lipoic Acid Attenuates Airway Remodeling: Involvement of Nuclear Factor-κB (NF-κB, Nuclear Factor Erythroid 2p45-Related Factor-2 (Nrf2, and Hypoxia-Inducible Factor (HIF

    Directory of Open Access Journals (Sweden)

    Heung Bum Lee

    2012-06-01

    Full Text Available Reactive oxygen species (ROS play a crucial role in the pathogenesis of acute and chronic respiratory diseases. Antioxidants have been found to ameliorate airway inflammation and hyperresponsiveness in animal models employing short-term exposure to allergen. However, little data are available on the effect of antioxidants on airway remodeling and signaling pathways in chronic asthma. In the present study, we used a long-term exposure murine model of allergic airway disease to evaluate the effects of an antioxidant, l-2-oxothiazolidine-4-carboxylic acid (OTC or α-lipoic acid (LA on airway remodeling, focusing on the ROS-related hypoxia-inducible signaling. Long-term challenge of ovalbumin (OVA increased ROS production, airway inflammation, and airway hyperresponsiveness, and developed features of airway remodeling such as excessive mucus secretion, subepithelial fibrosis, and thickening of the peribronchial smooth muscle layer. Administration of OTC or LA reduced these features of asthma, including airway remodeling, which was accompanied by suppression of transforming growth factor-β1, vascular endothelial growth factor, and T-helper 2 cytokines. In addition, OVA-induced activation of nuclear factor-κB (NF-κB, nuclear factor erythroid 2p45-related factor-2 (Nrf2, hypoxia-inducible factor (HIF-1α, and HIF-2α was reduced by OTC or LA. Our results also showed that OTC or LA down-regulated phosphoinositide 3-kinase activity and decreased phosphorylation of p38 mitogen-activated protein kinase but not extracellular signal-regulated kinase 1/2 or c-Jun N-terminal kinase. These findings demonstrate that OTC and LA can inhibit activation of NF-κB, Nrf2, and HIF, leading to attenuate allergen-induced airway remodeling.

  15. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  16. Effects of Nuclear Factor-E2-related factor 2/Heme Oxygenase 1 on splanchnic hemodynamics in experimental cirrhosis with portal hypertension.

    Science.gov (United States)

    Qin, Jun; He, Yue; Duan, Ming; Luo, Meng

    2017-05-01

    We explored the effects of Nuclear Factor-E2-related factor 2 (Nrf2) and Heme Oxygenase 1 (HO-1) on splanchnic hemodynamics in portal hypertensive rats. Experimental cirrhosis with portal hypertension was induced by intraperitoneal injection of carbon tetrachloride. The expression of proteins was examined by immunoblotting. Hemodynamic studies were performed by radioactive microspheres. The vascular perfusion system was used to measure the contractile response of mesentery arterioles in rats. Nrf2 expression in the nucleus and HO-1 expression in cytoplasm was significantly enhanced in portal hypertensive rats. Portal pressure, as well as regional blood flow, increased significantly in portal hypertension and can be blocked by tin protoporphyrin IX. The expression of endogenous nitric oxide synthase and vascular endothelial growth factors increased significantly compared to normal rats, while HO-1 inhibition decreased the expression of these proteins significantly. The contractile response of mesenteric arteries decreased in portal hypertension, but can be partially recovered through tin protoporphyrin IX treatment. The expression of Nrf2/HO-1 increased in mesenteric arteries of portal hypertensive rats, which was related to oxidative stress. HO-1was involved in increased portal pressure and anomaly splanchnic hemodynamics in portal hypertensive rats. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xu, Yuanyuan; Zheng, Hongzhi; Fu, Jingqi; Hou, Yongyong; Wang, Huihui; Zhang, Qiang; Yamamoto, Masayuki; Pi, Jingbo

    2016-01-01

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.

  18. The role of nuclear factor E2-Related factor 2 and uncoupling protein 2 in glutathione metabolism: Evidence from an in vivo gene knockout study

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yanyan [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Xu, Yuanyuan, E-mail: yyxu@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zheng, Hongzhi [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Fu, Jingqi; Hou, Yongyong; Wang, Huihui [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zhang, Qiang [Rollins School of Public Health, Emory University, Atlanta, GA (United States); Yamamoto, Masayuki [Graduate School of Medicine, Tohoku University, Sendai (Japan); Pi, Jingbo, E-mail: jbpi@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States)

    2016-09-09

    Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.

  19. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  20. Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

    Science.gov (United States)

    Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

    2014-01-01

    Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

  1. Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β-Cell Damage

    Directory of Open Access Journals (Sweden)

    Jingqi Fu

    2015-01-01

    Full Text Available Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2 is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2 and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF, and tert-butylhydroquinone (tBHQ, protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS are involved in regulating glucose-stimulated insulin secretion (GSIS and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes.

  2. Nuclear factor E2-related factor 2’s activation in transgenic mice fed with dosage of saturated or unsaturated fatty acids using in vivo bioluminescent imaging

    Directory of Open Access Journals (Sweden)

    Elena Mariani

    2017-05-01

    Full Text Available To counteract oxidative stress cells developed several mechanisms, including the transcription factor Nuclear Factor E2-related factor 2 (Nrf2. The aim of the study was to evaluate the activation of Nrf2 in transgenic mice fed saturated or polyunsaturated fatty acids and the anti-inflammatory effect of estrogens on organism. Forty-eight ARE CRE OMO reporter mice were divided into 3 groups, consisting of 16 animals, based on presence/absence of estrogens (ovariectomized or sham female, OVX - SH; male, MA. Each group was further split in 4 subgroups of 4 animals each and fed different diets (7.5% lard, 7.5% tuna oil, 20.0 % lard and 20.0% tuna oil. Two times a week animals were anaesthetized and injected i.p. with 100µL luciferin 15 min before the imaging session. Using the Living Image Software, photon emission was mapped for selected body areas. On day 70, animals were sacrificed after a challenge with Sodium Arsenite. Specific organs were dissected and immediately subjected to ex vivo imaging session. MIXED and GLM procedures of SAS software were used for statistical analysis. Dietary treatments did not affect body weight and feed intake as well as Nrf2 expression in both pre- and post-challenge phases, with the exception of the abdominal region (P=0.031 pre-challenge; in this area, during the pre-challenge phase, OVX showed lower Nrf2 activation (P<0.001. Ex vivo results outlined a significant effect of the challenge on all the considered organs (P<0.001, while OVX subjects had higher Nrf2 expression on urinary bladder and kidney (P<0.05 and high fat diet increased Nrf2 in urinary bladder (P<0.05. The present trial shows how saturated or polyunsaturated fatty acids supplementation in the diet do not exert significant effects on oxidative stress in mice, but confirms the protective role of estrogens under physiological condition.

  3. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    International Nuclear Information System (INIS)

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-01-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs 3+ ) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs 3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs 3+ and monomethylarsonous acid (MMA 3+ )-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs 3+ -induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs 3+ . The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs 3+ in β-cells. ► Deficiency of Nrf2 in β-cells sensitized to iAs 3+ and MMA 3

  4. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Bei [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang 110001 (China); Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

    2012-11-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  5. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  6. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  7. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  8. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  9. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  10. LAMA2-related myopathy

    DEFF Research Database (Denmark)

    Løkken, Nicoline; Born, Alfred Peter; Duno, Morten

    2015-01-01

    INTRODUCTION: Muscular dystrophy caused by LAMA2-gene mutations is an autosomal recessive disease typically presenting as a severe, early-onset congenital muscular dystrophy (CMD). However, milder cases with a limb-girdle type muscular dystrophy (LGMD) have been described. METHODS: In this study......, we assessed the frequency and phenotypic spectrum of LAMA2-related muscular dystrophy in CMD (n = 18) and LGMD2 (n = 128) cohorts identified in the last 15 years in eastern Denmark. The medical history, brain-MRI, muscle pathology, muscle laminin-α2 expression, and genetic analyses were assessed....... RESULTS: Molecular genetics revealed 2 pathogenic LAMA2 mutations in 5 of 18 CMD and 3 of 128 LGMD patients, corresponding to a LAMA2-mutation frequency of 28% in the CMD and 2.3% in the LGMD cohorts, respectively. CONCLUSIONS: This study demonstrates a wide clinical spectrum of LAMA2-related muscular...

  11. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  12. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  13. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  14. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  15. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  16. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  17. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  18. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  19. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  20. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line.

    Science.gov (United States)

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20μM BDE-47 for 24h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20μM BDE-47 for 24h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  2. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  3. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  5. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  6. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    International Nuclear Information System (INIS)

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-01-01

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  7. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hae-Ryung, E-mail: heaven@umich.edu; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  8. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  9. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  10. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  11. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  12. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  13. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  14. Melatonin Attenuates Memory Impairment Induced by Klotho Gene Deficiency Via Interactive Signaling Between MT2 Receptor, ERK, and Nrf2-Related Antioxidant Potential

    Science.gov (United States)

    Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

    2015-01-01

    Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID

  15. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  16. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  17. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  18. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  19. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  20. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  1. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  2. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  3. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  4. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  5. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  6. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    International Nuclear Information System (INIS)

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-01-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and

  7. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  8. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  9. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  10. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  11. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  12. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  13. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  14. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  15. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  16. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  17. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  18. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  19. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  1. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  2. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  3. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  4. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  5. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  8. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  9. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  10. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  11. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  12. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  13. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  15. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  16. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  17. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  18. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  19. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  20. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  1. 27 CFR 5.2 - Related regulations.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Related regulations. 5.2 Section 5.2 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS LABELING AND ADVERTISING OF DISTILLED SPIRITS Scope § 5.2 Related regulations...

  2. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  3. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  4. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  5. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  6. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  7. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  8. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  9. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  10. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  11. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Nuclear

    International Nuclear Information System (INIS)

    2014-01-01

    This document proposes a presentation and discussion of the main notions, issues, principles, or characteristics related to nuclear energy: radioactivity (presence in the environment, explanation, measurement, periods and activities, low doses, applications), fuel cycle (front end, mining and ore concentration, refining and conversion, fuel fabrication, in the reactor, back end with reprocessing and recycling, transport), the future of the thorium-based fuel cycle (motivations, benefits and drawbacks), nuclear reactors (principles of fission reactors, reactor types, PWR reactors, BWR, heavy-water reactor, high temperature reactor of HTR, future reactors), nuclear wastes (classification, packaging and storage, legal aspects, vitrification, choice of a deep storage option, quantities and costs, foreign practices), radioactive releases of nuclear installations (main released radio-elements, radioactive releases by nuclear reactors and by La Hague plant, gaseous and liquid effluents, impact of releases, regulation), the OSPAR Convention, management and safety of nuclear activities (from control to quality insurance, to quality management and to sustainable development), national safety bodies (mission, means, organisation and activities of ASN, IRSN, HCTISN), international bodies, nuclear and medicine (applications of radioactivity, medical imagery, radiotherapy, doses in nuclear medicine, implementation, the accident in Epinal), nuclear and R and D (past R and D programmes and expenses, main actors in France and present funding, main R and D axis, international cooperation)

  13. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  14. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  16. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  17. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  18. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  19. Nuclear

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    The first text deals with a new circular concerning the collect of the medicine radioactive wastes, containing radium. This campaign wants to incite people to let go their radioactive wastes (needles, tubes) in order to suppress any danger. The second text presents a decree of the 31 december 1999, relative to the limitations of noise and external risks resulting from the nuclear facilities exploitation: noise, atmospheric pollution, water pollution, wastes management and fire prevention. (A.L.B.)

  20. The anti-oxidative transcription factor Nuclear factor E2 related factor-2 (Nrf2) counteracts TGF-β1 mediated growth inhibition of pancreatic ductal epithelial cells -Nrf2 as determinant of pro-tumorigenic functions of TGF-β1

    International Nuclear Information System (INIS)

    Genrich, Geeske; Kruppa, Marcus; Lenk, Lennart; Helm, Ole; Broich, Anna; Freitag-Wolf, Sandra; Röcken, Christoph; Sipos, Bence; Schäfer, Heiner; Sebens, Susanne

    2016-01-01

    Nuclear factor E2 related factor-2 (Nrf2) is an oxidative stress inducible transcription factor being essential in regulating cell homeostasis. Thus, acute induction of Nrf2 in epithelial cells exposed to inflammation confers protection from oxidative cell damage and mutagenesis supporting an anti-tumorigenic role for Nrf2. However, pancreatic ductal adenocarcinoma (PDAC) is characterized by persistent Nrf2 activity conferring therapy resistance which points to a pro-tumorigenic role of Nrf2. A similar dichotomous role in tumorigenesis is described for the Transforming Growth Factor-beta 1 (TGF-β1). The present study therefore aimed at elucidating whether the switch of Nrf2 function towards a tumor promoting one relates to the modulation of TGF-β1 induced cell responses and whether this might occur early in PDAC development. In situ analysis comprised immunohistochemical stainings of activated (phosphorylated) Nrf2 and Ki67 in pancreatic tissues containing normal ducts and pancreatic intraepithelial neoplasia (PanINs). In vitro, Nrf2 levels in benign (H6c7-pBp), premalignant (H6c7-kras) and malignant (Colo357) pancreatic ductal epithelial cells were modulated by Nrf2 specific siRNA or Nrf2 overexpression. Then, the effect of Nrf2 alone and in combination with TGF-β1 on cell growth and survival was investigated by cell counting, Ki67 staining and apoptosis assays. The underlying cell signaling was investigated by western blotting. Statistical analysis was performed by Shapiro-Wilk test for normal distribution. Parametric data were analyzed by one-way ANOVA, while non-parametric data were analyzed by Kruskal-Wallis one-way ANOVA on ranks. Significantly elevated expression of activated Nrf2 and Ki67 could be detected in PanINs but not in normal pancreatic ductal epithelium. While the effect of Nrf2 on basal cell growth of H6c7-pBp, H6c7-kras and Colo357 cells was minor, it clearly attenuated the growth inhibiting effects of TGF-β1 in all cell lines. This enhanced

  1. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  2. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  3. Nuclear medicine

    International Nuclear Information System (INIS)

    Price, D.C.

    1989-01-01

    The spleen is a sinusoidal vascular filter that is an integral part of the reticuloendothelial system and is the largest single lymphoid organ in the body. Thus it has important scavenging and immunologic functions in humans. It is also a site for normal hematopoiesis in humans during the third to sixth months of gestation. Solenic hematopoiesis does occur normally in adult animals of other species (for instance, mouse, rat, rabbit), but it is seen postnatally in humans only when they have certain hematologic disorders such as myelofibrosis with myeloid metaplasia and severe hemolytic anemias. In its role as a reticuloendothelial organ the adult human spleen serves as a vascular scavenger. Arterial blood filters through a network of arterioles, cords, and sinuses in a closed system that requires the blood cells to be pliable and brings them into intimate contact with macrophages suspended on the reticulin stroma of the cords. Erythrocyte culling and pitting functions as described by Crosby result in a transient retention of immature circulating erythroid cells until residual intracellular nuclear fragments have been extruded. The increased risk for overwhelming infection in children and adults whose spleen have been removed for reasons other than acute trauma would appear to be caused by the loss of both its phagocytic and its immunologic (antibody-producing) contributions to the monitoring of the circulating blood. This paper reports that the ability of the spleen to phagocytose intravascular foreign particles and to recognize and destroy damaged erythrocytes is the basis for the current use of radiopharmaceuticals in spleen scintigraphy

  4. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  5. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  6. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  7. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  8. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  9. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  10. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  11. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  12. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  13. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  14. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  15. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  16. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  17. Bardoxolone methyl in type 2 diabetes and stage 4 chronic kidney disease

    DEFF Research Database (Denmark)

    de Zeeuw, Dick; Akizawa, Tadao; Audhya, Paul

    2013-01-01

    Although inhibitors of the renin-angiotensin-aldosterone system can slow the progression of diabetic kidney disease, the residual risk is high. Whether nuclear 1 factor (erythroid-derived 2)-related factor 2 activators further reduce this risk is unknown....

  18. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  19. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  20. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  1. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  2. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  3. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  4. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  5. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  6. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  7. MeCP2-Related Diseases and Animal Models

    Directory of Open Access Journals (Sweden)

    Chinelo D. Ezeonwuka

    2014-01-01

    Full Text Available The role of epigenetics in human disease has become an area of increased research interest. Collaborative efforts from scientists and clinicians have led to a better understanding of the molecular mechanisms by which epigenetic regulation is involved in the pathogenesis of many human diseases. Several neurological and non-neurological disorders are associated with mutations in genes that encode for epigenetic factors. One of the most studied proteins that impacts human disease and is associated with deregulation of epigenetic processes is Methyl CpG binding protein 2 (MeCP2. MeCP2 is an epigenetic regulator that modulates gene expression by translating epigenetic DNA methylation marks into appropriate cellular responses. In order to highlight the importance of epigenetics to development and disease, we will discuss how MeCP2 emerges as a key epigenetic player in human neurodevelopmental, neurological, and non-neurological disorders. We will review our current knowledge on MeCP2-related diseases, including Rett Syndrome, Angelman Syndrome, Fetal Alcohol Spectrum Disorder, Hirschsprung disease, and Cancer. Additionally, we will briefly discuss about the existing MeCP2 animal models that have been generated for a better understanding of how MeCP2 impacts certain human diseases.

  8. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  9. Bacteroides species produce Vibrio harveyi autoinducer 2-related molecules.

    Science.gov (United States)

    Antunes, Luis Caetano Martha; Ferreira, Lívia Queiroz; Ferreira, Eliane Oliveira; Miranda, Karla Rodrigues; Avelar, Kátia Eliane Santos; Domingues, Regina Maria Cavalcanti Pilotto; Ferreira, Maria Candida de Souza

    2005-10-01

    Quorum sensing is a density-dependent gene regulation mechanism that has been described in many bacterial species in the last decades. Bacteria that use quorum sensing as part of their gene regulation circuits produce molecules called autoinducers that accumulate in the environment and activate target genes in a quorum-dependent way. Some specific clues led us to hypothesize that Bacteroides species can produce autoinducers and possess a quorum sensing system. First, Bacteroides are anaerobic bacteria that are frequently involved in polymicrobial infections. These infections often involve Pseudomonas aeruginosa and Staphylococcus aureus, two of the best understood examples of bacteria that employ quorum sensing systems as part of their pathogenesis. Also, studies have detected the presence of a quorum sensing gene involved in the production of autoinducers in Porphyromonas gingivalis, a species closely related to the Bacteroides genus. These and other evidences prompted us to investigate if Bacteroides strains could produce autoinducer molecules that could be detected by a Vibrio harveyi reporter system. In this paper, we show that supernatants of B. fragilis, B. vulgatus and B. distasonis strains are able to stimulate the V. harveyi quorum sensing system 2. Also, we were able to demonstrate that the stimulation detected is due to the production of autoinducer molecules and not the growth of reporter strains after addition of supernatant. Moreover, the phenomenon observed does not seem to represent the degradation of repressors possibly present in the culture medium used. We could also amplify bands from some of the strains tested using primers designed to the luxS gene of Escherichia coli. Altogether, our results show that B. fragilis, B. vulgatus and B. distasonis (but possibly some other species) can produce V. harveyi autoinducer 2-related molecules. However, the role of such molecules in the biology of these organisms remains unknown.

  10. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability

    OpenAIRE

    Lambert, Muriel W

    2016-01-01

    Non-erythroid alpha spectrin (?IISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. ?IISp?s interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear ?IISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in ma...

  11. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  13. Nuclear law - Nuclear safety

    International Nuclear Information System (INIS)

    Pontier, Jean-Marie; Roux, Emmanuel; Leger, Marc; Deguergue, Maryse; Vallar, Christian; Pissaloux, Jean-Luc; Bernie-Boissard, Catherine; Thireau, Veronique; Takahashi, Nobuyuki; Spencer, Mary; Zhang, Li; Park, Kyun Sung; Artus, J.C.

    2012-01-01

    This book contains the contributions presented during a one-day seminar. The authors propose a framework for a legal approach to nuclear safety, a discussion of the 2009/71/EURATOM directive which establishes a European framework for nuclear safety in nuclear installations, a comment on nuclear safety and environmental governance, a discussion of the relationship between citizenship and nuclear, some thoughts about the Nuclear Safety Authority, an overview of the situation regarding the safety in nuclear waste burying, a comment on the Nome law with respect to electricity price and nuclear safety, a comment on the legal consequences of the Fukushima accident on nuclear safety in the Japanese law, a presentation of the USA nuclear regulation, an overview of nuclear safety in China, and a discussion of nuclear safety in the medical sector

  14. Nuclear substructure reorganization during late stageerythropoiesis is selective and does not involve caspase cleavage ofmajor nuclear substructural proteins

    Energy Technology Data Exchange (ETDEWEB)

    Krauss, Sharon Wald; Lo, Annie J.; Short, Sarah A.; Koury, MarkJ.; Mohandas, Narla; Chasis, Joel Anne

    2005-04-06

    Enucleation, a rare feature of mammalian differentiation, occurs in three cell types: erythroblasts, lens epithelium and keratinocytes. Previous investigations suggest that caspase activation functions in lens epithelial and keratinocyte enucleation, as well as in early erythropoiesis encompassing BFU-E differentiation to proerythroblast. To determine whether caspase activation contributes to later erythropoiesis and whether nuclear substructures other than chromatin reorganize, we analyzed distributions of nuclear subcompartment proteins and assayed for caspase-induced cleavage of subcompartmental target proteins in mouse erythroblasts. We found that patterns of lamin B in the filamentous network interacting with both the nuclear envelope and DNA, nuclear matrix protein NuMA, and splicing factors Sm and SC35 persisted during nuclear condensation, consistent with effective transcription of genes expressed late in differentiation. Thus nuclear reorganization prior to enucleation is selective, allowing maintenance of critical transcriptional processes independent of extensive chromosomal reorganization. Consistent with these data, we found no evidence for caspase-induced cleavage of major nuclear subcompartment proteins during late erythropoiesis, in contrast to what has been observed in early erythropoiesis and in lens epithelial and keratinocyte differentiation. These findings imply that nuclear condensation and extrusion during terminal erythroid differentiation involve novel mechanisms that do not entail major activation of apoptotic machinery.

  15. Berberine activates Nrf2 nuclear translocation and inhibits apoptosis induced by high glucose in renal tubular epithelial cells through a phosphatidylinositol 3-kinase/Akt-dependent mechanism.

    Science.gov (United States)

    Zhang, Xiuli; Liang, Dan; Lian, Xu; Jiang, Yan; He, Hui; Liang, Wei; Zhao, Yue; Chi, Zhi-Hong

    2016-06-01

    Apoptosis of tubular epithelial cells is a major feature of diabetic kidney disease, and hyperglycemia triggers the generation of free radicals and oxidant stress in tubular cells. Berberine (BBR) is identified as a potential anti-diabetic herbal medicine due to its beneficial effects on insulin sensitivity, glucose metabolism and glycolysis. In this study, the underlying mechanisms involved in the protective effects of BBR on high glucose-induced apoptosis were explored using cultured renal tubular epithelial cells (NRK-52E cells) and human kidney proximal tubular cell line (HK-2 cells). We identified the pivotal role of phosphatidylinositol 3-kinase (PI3K)/Akt in BBR cellular defense mechanisms and revealed the novel effect of BBR on nuclear factor (erythroid-derived 2)-related factor-2 (Nrf2) and heme oxygenase (HO)-1 in NRK-52E and HK-2 cells. BBR attenuated reactive oxygen species production, antioxidant defense (GSH and SOD) and oxidant-sensitive proteins (Nrf2 and HO-1), which also were blocked by LY294002 (an inhibitor of PI3K) in HG-treated NRK-52E and HK-2 cells. Furthermore, BBR improved mitochondrial function by increasing mitochondrial membrane potential. BBR-induced anti-apoptotic function was demonstrated by decreasing apoptotic proteins (cytochrome c, Bax, caspase3 and caspase9). All these findings suggest that BBR exerts the anti-apoptosis effects through activation of PI3K/Akt signal pathways and leads to activation of Nrf2 and induction of Nrf2 target genes, and consequently protecting the renal tubular epithelial cells from HG-induced apoptosis.

  16. Nuclear Medicine

    Science.gov (United States)

    ... Parents/Teachers Resource Links for Students Glossary Nuclear Medicine What is nuclear medicine? What are radioactive tracers? ... funded researchers advancing nuclear medicine? What is nuclear medicine? Nuclear medicine is a medical specialty that uses ...

  17. Nuclear safety. Seguranca nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Aveline, A [Rio Grande do Sul Univ., Porto Alegre, RS (Brazil). Inst. de Fisica

    1981-01-01

    What is nuclear safety Is there any technical way to reduce risks Is it possible to put them at reasonable levels Are there competitiveness and economic reliability to employ the nuclear energy by means of safety technics Looking for answers to these questions the author describes the sources of potential risks to nuclear reactors and tries to apply the answers to the Brazilian Nuclear Programme. (author).

  18. Invisible nuclear; converting nuclear

    International Nuclear Information System (INIS)

    Park, Jongmoon

    1993-03-01

    This book consists of 14 chapters which are CNN era and big science, from East and West to North and South, illusory nuclear strategy, UN and nuclear arms reduction, management of armaments, advent of petroleum period, the track of nuclear power generation, view of energy, internationalization of environment, the war over water in the Middle East, influence of radiation and an isotope technology transfer and transfer armament into civilian industry, the end of nuclear period and the nuclear Nonproliferation, national scientific and technological power and political organ and executive organ.

  19. Induction of Mkp-1 and Nuclear Translocation of Nrf2 by Limonoids from Khaya grandifoliola C.DC Protect L-02 Hepatocytes against Acetaminophen-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Arnaud F. Kouam

    2017-09-01

    Full Text Available Drug-induced liver injury (DILI is a major clinical problem where natural compounds hold promise for its abrogation. Khaya grandifoliola (Meliaceae is used in Cameroonian traditional medicine for the treatment of liver related diseases and has been studied for its hepatoprotective properties. Till date, reports showing the hepatoprotective molecular mechanism of the plant are lacking. The aim of this study was therefore to identify compounds from the plant bearing hepatoprotective activity and the related molecular mechanism by assessing their effects against acetaminophen (APAP-induced hepatotoxicity in normal human liver L-02 cells line. The cells were exposed to APAP (10 mM or co-treated with phytochemical compounds (40 μM over a period of 36 h and, biochemical and molecular parameters assessed. Three known limonoids namely 17-epi-methyl-6-hydroxylangolensate, 7-deacetoxy-7-oxogedunin and deacetoxy-7R-hydroxygedunin were identified. The results of cells viability and membrane integrity, reactive oxygen species generation and lipid membrane peroxidation assays, cellular glutathione content determination as well as expression of cytochrome P450 2E1 demonstrated the protective action of the limonoids. Immunoblotting analysis revealed that limonoids inhibited APAP-induced c-Jun N-terminal Kinase phosphorylation (p-JNK, mitochondrial translocation of p-JNK and Bcl2-associated X Protein, and the release of Apoptosis-inducing Factor into the cytosol. Interestingly, limonoids increased the expression of Mitogen-activated Protein Kinase Phosphatase (Mkp-1, an endogenous inhibitor of JNK phosphorylation and, induced the nuclear translocation of Nuclear Factor Erythroid 2-related Factor-2 (Nrf2 and decreased the expression of Kelch-like ECH-associated Protein-1. The limonoids also reversed the APAP-induced decreased mRNA levels of Catalase, Superoxide Dismutase-1, Glutathione-S-Transferase and Methionine Adenosyltransferase-1A. The obtained results

  20. [Nuclear theory

    International Nuclear Information System (INIS)

    Haxton, W.

    1990-01-01

    This report discusses research in nuclear physics. Topics covered in this paper are: symmetry principles; nuclear astrophysics; nuclear structure; quark-gluon plasma; quantum chromodynamics; symmetry breaking; nuclear deformation; and cold fusion

  1. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  2. Nuclear topics

    International Nuclear Information System (INIS)

    Lukner, C.

    1982-07-01

    The pamphlet touches on all aspects of nuclear energy, from the world energy demands and consumption, the energy program of the Federal Government, nuclear power plants in the world, nuclear fusion, nuclear liability up to the nuclear fuel cycle and the shutdown of nuclear power plants. (HSCH) [de

  3. Nuclear power and nuclear weapons

    International Nuclear Information System (INIS)

    Vaughen, V.C.A.

    1983-01-01

    The proliferation of nuclear weapons and the expanded use of nuclear energy for the production of electricity and other peaceful uses are compared. The difference in technologies associated with nuclear weapons and nuclear power plants are described

  4. Tight regulation of a timed nuclear import wave of EKLF by PKCθ and FOE during Pro-E to Baso-E transition.

    Science.gov (United States)

    Shyu, Yu-Chiau; Lee, Tung-Liang; Chen, Xin; Hsu, Pang-Hung; Wen, Shau-Ching; Liaw, Yi-Wei; Lu, Chi-Huan; Hsu, Po-Yen; Lu, Mu-Jie; Hwang, JauLang; Tsai, Ming-Daw; Hwang, Ming-Jing; Chen, Jim-Ray; Shen, Che-Kun James

    2014-02-24

    Erythropoiesis is a highly regulated process during which BFU-E are differentiated into RBCs through CFU-E, Pro-E, PolyCh-E, OrthoCh-E, and reticulocyte stages. Uniquely, most erythroid-specific genes are activated during the Pro-E to Baso-E transition. We show that a wave of nuclear import of the erythroid-specific transcription factor EKLF occurs during the Pro-E to Baso-E transition. We further demonstrate that this wave results from a series of finely tuned events, including timed activation of PKCθ, phosphorylation of EKLF at S68 by P-PKCθ(S676), and sumoylation of EKLF at K74. The latter EKLF modifications modulate its interactions with a cytoplasmic ankyrin-repeat-protein FOE and importinβ1, respectively. The role of FOE in the control of EKLF nuclear import is further supported by analysis of the subcellular distribution patterns of EKLF in FOE-knockout mice. This study reveals the regulatory mechanisms of the nuclear import of EKLF, which may also be utilized in the nuclear import of other factors. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Nuclear rights - nuclear wrongs

    Energy Technology Data Exchange (ETDEWEB)

    Paul, E.F.; Miller, F.D.; Paul, J.; Ahrens, J.

    1986-01-01

    This book contains 11 selections. The titles are: Three Ways to Kill Innocent Bystanders: Some Conundrums Concerning the Morality of War; The International Defense of Liberty; Two Concepts of Deterrence; Nuclear Deterrence and Arms Control; Ethical Issues for the 1980s; The Moral Status of Nuclear Deterrent Threats; Optimal Deterrence; Morality and Paradoxical Deterrence; Immoral Risks: A Deontological Critique of Nuclear Deterrence; No War Without Dictatorship, No Peace Without Democracy: Foreign Policy as Domestic Politics; Marxism-Leninism and its Strategic Implications for the United States; Tocqueveille War.

  6. Nuclear moments

    CERN Document Server

    Kopferman, H; Massey, H S W

    1958-01-01

    Nuclear Moments focuses on the processes, methodologies, reactions, and transformations of molecules and atoms, including magnetic resonance and nuclear moments. The book first offers information on nuclear moments in free atoms and molecules, including theoretical foundations of hyperfine structure, isotope shift, spectra of diatomic molecules, and vector model of molecules. The manuscript then takes a look at nuclear moments in liquids and crystals. Discussions focus on nuclear paramagnetic and magnetic resonance and nuclear quadrupole resonance. The text discusses nuclear moments and nucl

  7. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  8. Clinical Correlations With Lewy Body Pathology in LRRK2-Related Parkinson Disease

    Science.gov (United States)

    Kalia, Lorraine V.; Lang, Anthony E.; Hazrati, Lili-Naz; Fujioka, Shinsuke; Wszolek, Zbigniew K.; Dickson, Dennis W.; Ross, Owen A.; Van Deerlin, Vivianna M.; Trojanowski, John Q.; Hurtig, Howard I.; Alcalay, Roy N.; Marder, Karen S.; Clark, Lorraine N.; Gaig, Carles; Tolosa, Eduardo; Ruiz-Martínez, Javier; Marti-Masso, Jose F.; Ferrer, Isidre; de Munain, Adolfo López; Goldman, Samuel M.; Schüle, Birgitt; Langston, J. William; Aasly, Jan O.; Giordana, Maria T.; Bonifati, Vincenzo; Puschmann, Andreas; Canesi, Margherita; Pezzoli, Gianni; De Paula, Andre Maues; Hasegawa, Kazuko; Duyckaerts, Charles; Brice, Alexis; Stoessl, A. Jon; Marras, Connie

    2015-01-01

    IMPORTANCE Mutations in leucine-rich repeat kinase 2 (LRRK2) are the most common cause of genetic Parkinson disease (PD) known to date. The clinical features of manifesting LRRK2 mutation carriers are generally indistinguishable from those of patients with sporadic PD. However, some PD cases associated with LRRK2 mutations lack Lewy bodies (LBs), a neuropathological hallmark of PD. We investigated whether the presence or absence of LBs correlates with different clinical features in LRRK2-related PD. OBSERVATIONS We describe genetic, clinical, and neuropathological findings of 37 cases of LRRK2-related PD including 33 published and 4 unpublished cases through October 2013. Among the different mutations, the LRRK2 p.G2019S mutation was most frequently associated with LB pathology. Nonmotor features of cognitive impairment/dementia, anxiety, and orthostatic hypotension were correlated with the presence of LBs. In contrast, a primarily motor phenotype was associated with a lack of LBs. CONCLUSIONS AND RELEVANCE To our knowledge, this is the first report of clinicopathological correlations in a series of LRRK2-related PD cases. Findings from this selected group of patients with PD demonstrated that parkinsonian motor features can occur in the absence of LBs. However, LB pathology in LRRK2-related PD may be a marker for a broader parkinsonian symptom complex including cognitive impairment. PMID:25401511

  9. Nuclear power

    International Nuclear Information System (INIS)

    Abd Khalik Wood

    2005-01-01

    This chapter discussed the following topics related to the nuclear power: nuclear reactions, nuclear reactors and its components - reactor fuel, fuel assembly, moderator, control system, coolants. The topics titled nuclear fuel cycle following subtopics are covered: , mining and milling, tailings, enrichment, fuel fabrication, reactor operations, radioactive waste and fuel reprocessing. Special topic on types of nuclear reactor highlighted the reactors for research, training, production, material testing and quite detail on reactors for electricity generation. Other related topics are also discussed: sustainability of nuclear power, renewable nuclear fuel, human capital, environmental friendly, emission free, impacts on global warming and air pollution, conservation and preservation, and future prospect of nuclear power

  10. Isolating a cytoprotective compound from Ganoderma tsugae: effects on induction of Nrf-2-related genes in endothelial cells.

    Science.gov (United States)

    Wei, Yu-Shan; Wung, Being-Sun; Lin, Yuan-Chun; Hsieh, Chia-Wen

    2009-08-01

    Ganoderma tsugae is a medicinal fungus with several biological activities. It has long been used as a folk remedy for the promotion of health and longevity in China and other oriental countries. Here, a bioactive fraction of G. tsugae was progressively purified to be enriched in the activity of cytoprotective enzymes. The highest bioactivity was detected in the 20% EtOH-precipitated fraction, which was prepared from submerged fermentation filtrate of G. tsugae. Following further purification by gel filtration chromatography and acetone extraction, the most bioactive fraction, F5-2, was identified as a peptidoglycan-like compound. Extracts of G. tsugae (F5-2) induced heme oxygenase-1 (HO-1) and thioredoxin reductase-1 (TrxR1) expression in endothelial cells by increasing NF-E2-related factor-2 (Nrf2) nuclear translocation. Pretreatment with F5-2 increased intracellular glutathione (GSH) and protected against H(2)O(2), suggesting that induction of these antioxidant enzymes is important in protection against oxidative stress. Hence the bioactive peptidoglycan-like compound from G. tsugae might protect endothelial cells.

  11. Nuclear science

    International Nuclear Information System (INIS)

    1989-01-01

    This fact sheet answers specific questions about the Department of Energy's possible acquisition and conversion of a partially completed commercial nuclear power plant to a nuclear materials production facility. The nuclear power plant is the Washington Nuclear Plant number sign 1 owned by the Washington Public Power Supply System and is located on DOE's Hanford Reservation near Richland, Washington

  12. Nuclear science

    International Nuclear Information System (INIS)

    1989-04-01

    This report answers questions about the Department of Energy's possible acquisition and conversion of a partially completed commercial nuclear power plant to a nuclear materials production facility. The nuclear power plant is the Washington Nuclear Plant No.1 owned by the Washington Public Power Supply System and is located on DOE's Hanford Reservation near Richland, Washington

  13. Nuclear medicine

    International Nuclear Information System (INIS)

    Lentle, B.C.

    1986-01-01

    Several growth areas for nuclear medicine were defined. Among them were: cardiac nuclear medicine, neuro-psychiatric nuclear medicine, and cancer diagnosis through direct tumor imaging. A powerful new tool, Positron Emission Tomography (PET) was lauded as the impetus for new developments in nuclear medicine. The political environment (funding, degree of autonomy) was discussed, as were the economic and scientific environments

  14. Nuclear option

    Energy Technology Data Exchange (ETDEWEB)

    Kemm, K R

    1978-05-01

    The global outlook is that nuclear reactors are here to stay and South Africa has already entered the nuclear power stakes. This article discusses the rocketing oil prices, and the alternatives that can be used in power generation, the good safety record of the nuclear industry and the effect that South Africa's first nuclear power station should have on the environment.

  15. Nuclear resisters

    International Nuclear Information System (INIS)

    1981-01-01

    The booklet contains six papers by different authors, under the headings: dangers along the nuclear fuel cycle; the nuclear profiteers; the nuclear state is a police state; a non-disposable future (renewable energy sources, energy conservation); nuclear weapons - out of control; man made madness. (U.K.)

  16. Nuclear links

    International Nuclear Information System (INIS)

    1981-01-01

    The subject is dealt with in sections: introduction; energy and the third world; world energy consumption 1978; oil -the energy dilemma; nuclear chains - introduction; uranium; Namibia; enrichment and reprocessing; countries with enrichment and reprocessing facilities; waste; conclusion; why take the nuclear option; third world countries with nuclear reactors; the arms connection; government spending and human resources 1977 (by countries); nuclear power - the final solution; the fascists; world bank; campaigns; community action in Plogoff; Australian labour movement; NUM against nuclear power; Scottish campaign; students against nuclear energy; anti-nuclear campaign; partizans; 3W1 disarmament and development; campaign ATOM; CANUC; 3W1; SANE. (U.K.)

  17. Expansion of phenotype and genotypic data in CRB2-related syndrome.

    Science.gov (United States)

    Lamont, Ryan E; Tan, Wen-Hann; Innes, A Micheil; Parboosingh, Jillian S; Schneidman-Duhovny, Dina; Rajkovic, Aleksandar; Pappas, John; Altschwager, Pablo; DeWard, Stephanie; Fulton, Anne; Gray, Kathryn J; Krall, Max; Mehta, Lakshmi; Rodan, Lance H; Saller, Devereux N; Steele, Deanna; Stein, Deborah; Yatsenko, Svetlana A; Bernier, François P; Slavotinek, Anne M

    2016-10-01

    Sequence variants in CRB2 cause a syndrome with greatly elevated maternal serum alpha-fetoprotein and amniotic fluid alpha-fetoprotein levels, cerebral ventriculomegaly and renal findings similar to Finnish congenital nephrosis. All reported patients have been homozygotes or compound heterozygotes for sequence variants in the Crumbs, Drosophila, Homolog of, 2 (CRB2) genes. Variants affecting CRB2 function have also been identified in four families with steroid resistant nephrotic syndrome, but without any other known systemic findings. We ascertained five, previously unreported individuals with biallelic variants in CRB2 that were predicted to affect function. We compiled the clinical features of reported cases and reviewed available literature for cases with features suggestive of CRB2-related syndrome in order to better understand the phenotypic and genotypic manifestations. Phenotypic analyses showed that ventriculomegaly was a common clinical manifestation (9/11 confirmed cases), in contrast to the original reports, in which patients were ascertained due to renal disease. Two children had minor eye findings and one was diagnosed with a B-cell lymphoma. Further genetic analysis identified one family with two affected siblings who were both heterozygous for a variant in NPHS2 predicted to affect function and separate families with sequence variants in NPHS4 and BBS7 in addition to the CRB2 variants. Our report expands the clinical phenotype of CRB2-related syndrome and establishes ventriculomegaly and hydrocephalus as frequent manifestations. We found additional sequence variants in genes involved in kidney development and ciliopathies in patients with CRB2-related syndrome, suggesting that these variants may modify the phenotype.

  18. Nuclear Power

    International Nuclear Information System (INIS)

    Douglas-Hamilton, J.; Home Robertson, J.; Beith, A.J.

    1987-01-01

    In this debate the Government's policy on nuclear power is discussed. Government policy is that nuclear power is the safest and cleanest way of generating electricity and is cheap. Other political parties who do not endorse a nuclear energy policy are considered not to be acting in the people's best interests. The debate ranged over the risks from nuclear power, the UK safety record, safety regulations, and the environmental effects of nuclear power. The Torness nuclear power plant was mentioned specifically. The energy policy of the opposition parties is strongly criticised. The debate lasted just over an hour and is reported verbatim. (UK)

  19. Co-occurring Down syndrome and SUCLA2-related mitochondrial depletion syndrome.

    Science.gov (United States)

    Couser, Natario L; Marchuk, Daniel S; Smith, Laurie D; Arreola, Alexandra; Kaiser-Rogers, Kathleen A; Muenzer, Joseph; Pandya, Arti; Gucsavas-Calikoglu, Muge; Powell, Cynthia M

    2017-10-01

    Mitochondrial DNA depletion syndrome 5 (MIM 612073) is a rare autosomal recessive disorder caused by homozygous or compound heterozygous pathogenic variants in the beta subunit of the succinate-CoA ligase gene located within the 13q14 band. We describe two siblings of Hispanic descent with SUCLA2-related mitochondrial depletion syndrome (encephalomyopathic form with methylmalonic aciduria); the older sibling is additionally affected with trisomy 21. SUCLA2 sequencing identified homozygous p.Arg284Cys pathogenic variants in both patients. This mutation has previously been identified in four individuals of Italian and Caucasian descent. The older sibling with concomitant disease has a more severe phenotype than what is typically described in patients with either SUCLA2-related mitochondrial depletion syndrome or Down syndrome alone. The younger sibling, who has a normal female chromosome complement, is significantly less affected compared to her brother. While the clinical and molecular findings have been reported in about 50 patients affected with a deficiency of succinate-CoA ligase caused by pathogenic variants in SUCLA2, this report describes the first known individual affected with both a mitochondrial depletion syndrome and trisomy 21. © 2017 Wiley Periodicals, Inc.

  20. JPRS Report, Nuclear Developments

    National Research Council Canada - National Science Library

    1991-01-01

    Partial Contents: Medium Range Missiles, Rocket Engine, Nuclear Submarine, Nuclear Reactor, Nuclear Inspection, Nuclear Weapons, Transfer Technology, Scud, Safety, Nuclear Power, Chernobyl Trial, ,CHemical Weapons...

  1. Nuclear forensics

    International Nuclear Information System (INIS)

    Venugopal, V.

    2010-01-01

    Nuclear forensics is the analysis of nuclear materials recovered from either the capture of unused materials, or from the radioactive debris following a nuclear explosion and can contribute significantly to the identification of the sources of the materials and the industrial processes used to obtain them. In the case of an explosion, nuclear forensics can also reconstruct key features of the nuclear device. Nuclear forensic analysis works best in conjunction with other law enforcement, radiological protection dosimetry, traditional forensics, and intelligence work to provide the basis for attributing the materials and/or nuclear device to its originators. Nuclear forensics is a piece of the overall attribution process, not a stand-alone activity

  2. Nuclear power

    International Nuclear Information System (INIS)

    1987-01-01

    ''Nuclear Power'' describes how a reactor works and examines the different designs including Magnox, AGR, RBMK and PWR. It charts the growth of nuclear generation in the world and its contributions to world energy resources. (author)

  3. Nuclear Scans

    Science.gov (United States)

    Nuclear scans use radioactive substances to see structures and functions inside your body. They use a special ... images. Most scans take 20 to 45 minutes. Nuclear scans can help doctors diagnose many conditions, including ...

  4. Nuclear energy

    International Nuclear Information System (INIS)

    Kuhn, W.

    1986-01-01

    This loose-leaf collection is made up of five didactically prepared units covering the following subjects: basic knowledge on nuclear energy, nuclear energy in relation to energy economy, site issues, environmental compatibility of nuclear energy, and nuclear energy in the focus of political and social action. To this was added a comprehensive collection of material: specific scientific background material, a multitude of tables, diagrams, charts etc. for copying, as well as 44 transparent charts, mostly in four colours. (orig./HP) [de

  5. Nuclear structure

    International Nuclear Information System (INIS)

    Eastham, D.A.; Joy, T.

    1986-01-01

    The paper on 'nuclear structure' is the Appendix to the Daresbury (United Kingdom) Annual Report 1985/86, and contains the research work carried out at the Nuclear Structure Facility, Daresbury, within that period. During the year a total of 74 experiments were scheduled covering the main areas of activity including: nuclear collective motion, nuclei far from stability, and nuclear collisions. The Appendix contains brief reports on these experiments and associated theory. (U.K.)

  6. Microsecond molecular dynamics simulations of intrinsically disordered proteins involved in the oxidative stress response

    NARCIS (Netherlands)

    Cino, E.A.; Wong-ekkabut, J.; Karttunen, M.E.J.; Choy, W.-Y.

    2011-01-01

    Intrinsically disordered proteins (IDPs) are abundant in cells and have central roles in protein-protein interaction networks. Interactions between the IDP Prothymosin alpha (ProTa) and the Neh2 domain of Nuclear factor erythroid 2-related factor 2 (Nrf2), with a common binding partner, Kelch-like

  7. Baseline characteristics in the Bardoxolone methyl EvAluation in patients with Chronic kidney disease and type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Lambers Heerspink, Hiddo J; Chertow, Glenn M; Akizawa, Tadao

    2013-01-01

    Type 2 diabetes mellitus (T2DM) is the most important contributing cause of end-stage renal disease (ESRD) worldwide. Bardoxolone methyl, a nuclear factor-erythroid-2-related factor 2 activator, augments estimated glomerular filtration. The Bardoxolone methyl EvAluation in patients with Chronic...

  8. In vitro studies of the sensitivity of canine bone-marrow erythroid burst-forming units (BFU-E) and fibroblast colony-forming units (CFU-F) to X-irradiation

    International Nuclear Information System (INIS)

    Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm

    1989-01-01

    The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)

  9. Nuclear terrorism

    International Nuclear Information System (INIS)

    2002-01-01

    Recent reports of alleged terrorist plans to build a 'dirty bomb' have heightened longstanding concerns about nuclear terrorism. This briefing outlines possible forms of attack, such as: detonation of a nuclear weapon; attacks involving radioactive materials; attacks on nuclear facilities. Legislation addressing these risks and the UK's strategy for coping with them are also considered

  10. Nuclear power

    International Nuclear Information System (INIS)

    d'Easum, Lille.

    1976-03-01

    An environmentalist's criticism of nuclear energy is given, on a layman's level. Such subjects as conflict of interest in controlling bodies, low-level radiation, reactor safety, liability insurance, thermal pollution, economics, heavy water production, export of nuclear technology, and the history of the anti-nuclear movement are discussed in a sensationalistic tone. (E.C.B.)

  11. Nuclear alerts

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    Anti-nuclear demonstrations against the deployment of new US missiles were held in Nato Europe. As no agreement has yet been reached at the US-Soviet Intermediate Nuclear Forces talks in Geneva, the deployment of nuclear missiles in Europe has started

  12. Nuclear questions

    International Nuclear Information System (INIS)

    Berg, Eugene

    2012-01-01

    Civilian and military nuclear questions fill a multitude of publications these days, especially after the Japanese tsunami and the Fukushima disaster. The author analyses some of them and highlights the links between civil and military nuclear industries, the realities of the nuclear cycle and related industrial questions before concluding on the controversial issue of weapons and their proliferation potential

  13. Nuclear decommissioning

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    The paper on nuclear decommissioning was presented by Dr H. Lawton to a meeting of the British Nuclear Energy Society and Institution of Nuclear Engineers, 1986. The decommissioning work currently being undertaken on the Windscale advanced gas cooled reactor (WAGR) is briefly described, along with projects in other countries, development work associated with the WAGR operation and costs. (U.K.)

  14. Nuclear electronics

    International Nuclear Information System (INIS)

    Friese, T.

    1981-09-01

    A short survey is given on nuclear radiation detectors and nuclear electronics. It is written for newcomers and those, who are not very familiar with this technique. Some additional information is given on typical failures in nuclear measurement systems. (orig.) [de

  15. [SUCLA2-related encephalomyopathic mitochondrial DNA depletion syndrome: a case report and review of literature].

    Science.gov (United States)

    Liu, Zhimei; Fang, Fang; Ding, Changhong; Wu, Husheng; Lyu, Junlan; Wu, Yun

    2014-11-01

    To analyze the clinical characteristics of SUCLA2-related encephalomyopathic mitochondrial DNA depletion syndrome (MDS) in one patient, and review the latest clinical research reports. Clinical, laboratory and genetic data of one case of SUCLA2-related encephalomyopathic MDS diagnosed by department of Neurology, Beijing Children's Hospital in November, 2013 were reported, and through taking "SUCLA2" as key words to search at CNKI, Wanfang, PubMed and the Human Gene Mutation Database (HGMD) professional to date, the clinical characteristics of 24 reported cases of SUCLA2-related encephalomyopathic MDS in international literature in combination with our case were analyzed. (1) The patient was 5 years and 9 months old, born as a term small for gestational age infant whose birth weight was 2 400 g, and presented since birth with severe muscular hypotonia, feeding difficulties, failure to thrive, psychomotor retardation and hearing impairment. Until now, he still showed severe developmental retardation, together with muscular atrophy, thoracocyllosis and scoliosis, and facial features. The patient is the first born from consanguineous healthy parents, whose relationship is cousins. Laboratory tests showed urinary excretion of mild methylmalonic acid (MMA), elevated plasma lactate concentration, and increased C3-carnitine and C4-dicarboxylic-carnitine in plasma carnitine ester profiling. MRI showed brain atrophy-like and bilateral T2 hyperintensities in bilateral caudate nuclei and putamen. By Next-Generation Sequencing (NGS), we identified a novel homozygous missense mutation (c.970G > A) in the SUCLA2 in a highly conserved amino acid residue. (2) The total number was only 25 with a male to female ratio of 14: 11, and age of onset of 23 was 0-4 months. The most common clinical features in patients with SUCLA2 mutation were permanent hypotonia, muscle atrophy, psychomotor retardation and scoliosis or kyphosis. Frequent signs included hearing impairment, hyperkinesia

  16. Nuclear energy

    International Nuclear Information System (INIS)

    2007-01-01

    This digest document was written by members of the union of associations of ex-members and retired people of the Areva group (UARGA). It gives a comprehensive overview of the nuclear industry world, starting from radioactivity and its applications, and going on with the fuel cycle (front-end, back-end, fuel reprocessing, transports), the nuclear reactors (PWR, BWR, Candu, HTR, generation 4 systems), the effluents from nuclear facilities, the nuclear wastes (processing, disposal), and the management and safety of nuclear activities. (J.S.)

  17. Nuclear orientation and nuclear structure

    International Nuclear Information System (INIS)

    Krane, K.S.

    1988-01-01

    The present generation of on-line nuclear orientation facilities promises to revolutionize the gathering of nuclear structure information, especially for the hitherto poorly known and understood nuclei far from stability. Following a brief review of the technological developments that have facilitated these experiments, the nuclear spectroscopic information that can be obtained is summarized. Applications to understanding nuclear structure are reviewed, and challenges for future studies are discussed. (orig.)

  18. Nuclear power

    International Nuclear Information System (INIS)

    Anon.

    1980-01-01

    The committee concludes that the nature of the proliferation problem is such that even stopping nuclear power completely could not stop proliferation completely. Countries can acquire nuclear weapons by means independent of commercial nuclear power. It is reasonable to suppose if a country is strongly motivated to acquire nuclear weapons, it will have them by 2010, or soon thereafter, no matter how nuclear power is managed in the meantime. Unilateral and international diplomatic measures to reduce the motivations that lead to proliferation should be high on the foreign policy agenda of the United States. A mimimum antiproliferation prescription for the management of nuclear power is to try to raise the political barriers against proliferation through misuse of nuclear power by strengthening the Non-Proliferation Treaty, and to seek to raise the technological barriers by placing fuel-cycle operations involving weapons-usable material under international control. Any such measures should be considered tactics to slow the spread of nuclear weapons and thus earn time for the exercise of statesmanship. The committee concludes the following about technical factors that should be considered in formulating nuclear policy: (1) rate of growth of electricity use is a primary factor; (2) growth of conventional nuclear power will be limited by producibility of domestic uranium sources; (3) greater contribution of nuclear power beyond 400 GWe past the year 2000 can only be supported by advanced reactor systems; and (4) several different breeder reactors could serve in principle as candidates for an indefinitely sustainable source of energy

  19. Nuclear physics

    International Nuclear Information System (INIS)

    Kamal, Anwar

    2014-01-01

    Explains the concepts in detail and in depth. Provides step-by-step derivations. Contains numerous tables and diagrams. Supports learning and teaching with numerous worked examples, questions and problems with answers. Sketches also the historical development of the subject. This textbook explains the experimental basics, effects and theory of nuclear physics. It supports learning and teaching with numerous worked examples, questions and problems with answers. Numerous tables and diagrams help to better understand the explanations. A better feeling to the subject of the book is given with sketches about the historical development of nuclear physics. The main topics of this book include the phenomena associated with passage of charged particles and radiation through matter which are related to nuclear resonance fluorescence and the Moessbauer effect., Gamov's theory of alpha decay, Fermi theory of beta decay, electron capture and gamma decay. The discussion of general properties of nuclei covers nuclear sizes and nuclear force, nuclear spin, magnetic dipole moment and electric quadrupole moment. Nuclear instability against various modes of decay and Yukawa theory are explained. Nuclear models such as Fermi Gas Model, Shell Model, Liquid Drop Model, Collective Model and Optical Model are outlined to explain various experimental facts related to nuclear structure. Heavy ion reactions, including nuclear fusion, are explained. Nuclear fission and fusion power production is treated elaborately.

  20. Nuclear chemistry

    International Nuclear Information System (INIS)

    Vertes, A.; Kiss, I.

    1987-01-01

    This book is an introduction to the application of nuclear science in modern chemistry. The first group of chapters discuss the basic phenomena and concepts of nuclear physics with emphasis on their relation to chemical problems, including the main properties and the composition of atomic nuclei, nuclear reactions, radioactive decay and interactions of radiation with matter. These chapters provide the basis for understanding the following chapters which encompass the wide scope of nuclear chemistry. The methods of the investigation of chemical structure based on the interaction of nuclear radiation with matter including positronium chemistry and other exotic atoms is elaborated in particular detail. Separate chapters are devoted to the use of radioactive tracers, the chemical consequences of nuclear processes (i.e. hot atom chemistry), radiation chemistry, isotope effects and their applications, and the operation of nuclear reactors

  1. Nuclear chemistry

    International Nuclear Information System (INIS)

    Vertes, A.; Kiss, I.

    1987-01-01

    This book is an introduction to the application of nuclear science in modern chemistry. The first group of chapters discuss the basic phenomena and concepts of nuclear physics with emphasis on their relation to chemical problems, including the main properties and the composition of atomic nuclei, nuclear reactions, radioactive decay and interactions of radiation with matter. These chapters provide the basis for understanding the following chapters which encompass the wide scope of nuclear chemistry. The methods of the investigation of chemical structure based on the interaction of nuclear radiation with matter including positronium chemistry and other exotic atoms is elaborated in particular detail. Separate chapters are devoted to the use of radioactive tracers, the chemical consequences of nuclear processes (i.e. hot atom chemistry), radiation chemistry, isotope effects and their applications, and the operation of nuclear reactors. (Auth.)

  2. Nuclear forensics

    International Nuclear Information System (INIS)

    Karadeniz, O.; Guenalp, G.

    2010-01-01

    This review discusses the methodology of nuclear forensics and illicit trafficking of nuclear materials. Nuclear forensics is relatively new scientific branch whose aim it is to read out material inherent from nuclear material. Nuclear forensics investigations have to be considered as part of a comprehensive set of measures for detection,interception, categorization and characterization of illicitly trafficking nuclear material. Prevention, detection and response are the main elements in combating illicit trafficking. Forensics is a key element in the response process. Forensic science is defined as the application of a broad spectrum of sciences to answer questions of interest to the legal system. Besides, in this study we will explain age determination of nuclear materials.

  3. Nuclear fuels

    International Nuclear Information System (INIS)

    Gangwani, Saloni; Chakrabortty, Sumita

    2011-01-01

    Nuclear fuel is a material that can be consumed to derive nuclear energy, by analogy to chemical fuel that is burned for energy. Nuclear fuels are the most dense sources of energy available. Nuclear fuel in a nuclear fuel cycle can refer to the fuel itself, or to physical objects (for example bundles composed of fuel rods) composed of the fuel material, mixed with structural, neutron moderating, or neutron reflecting materials. Long-lived radioactive waste from the back end of the fuel cycle is especially relevant when designing a complete waste management plan for SNF. When looking at long-term radioactive decay, the actinides in the SNF have a significant influence due to their characteristically long half-lives. Depending on what a nuclear reactor is fueled with, the actinide composition in the SNF will be different. The following paper will also include the uses. advancements, advantages, disadvantages, various processes and behavior of nuclear fuels

  4. Nuclear networking.

    Science.gov (United States)

    Xie, Wei; Burke, Brian

    2017-07-04

    Nuclear lamins are intermediate filament proteins that represent important structural components of metazoan nuclear envelopes (NEs). By combining proteomics and superresolution microscopy, we recently reported that both A- and B-type nuclear lamins form spatially distinct filament networks at the nuclear periphery of mouse fibroblasts. In particular, A-type lamins exhibit differential association with nuclear pore complexes (NPCs). Our studies reveal that the nuclear lamina network in mammalian somatic cells is less ordered and more complex than that of amphibian oocytes, the only other system in which the lamina has been visualized at high resolution. In addition, the NPC component Tpr likely links NPCs to the A-type lamin network, an association that appears to be regulated by C-terminal modification of various A-type lamin isoforms. Many questions remain, however, concerning the structure and assembly of lamin filaments, as well as with their mode of association with other nuclear components such as peripheral chromatin.

  5. The Antioxidant Additive Approach for Alzheimer's Disease Therapy: New Ferulic (Lipoic) Acid Plus Melatonin Modified Tacrines as Cholinesterases Inhibitors, Direct Antioxidants, and Nuclear Factor (Erythroid-Derived 2)-Like 2 Activators.

    Science.gov (United States)

    Benchekroun, Mohamed; Romero, Alejandro; Egea, Javier; León, Rafael; Michalska, Patrycja; Buendía, Izaskun; Jimeno, María Luisa; Jun, Daniel; Janockova, Jana; Sepsova, Vendula; Soukup, Ondrej; Bautista-Aguilera, Oscar M; Refouvelet, Bernard; Ouari, Olivier; Marco-Contelles, José; Ismaili, Lhassane

    2016-11-10

    Novel multifunctional tacrines for Alzheimer's disease were obtained by Ugi-reaction between ferulic (or lipoic acid), a melatonin-like isocyanide, formaldehyde, and tacrine derivatives, according to the antioxidant additive approach in order to modulate the oxidative stress as therapeutic strategy. Compound 5c has been identified as a promising permeable agent showing excellent antioxidant properties, strong cholinesterase inhibitory activity, less hepatotoxicity than tacrine, and the best neuroprotective capacity, being able to significantly activate the Nrf2 transcriptional pathway.

  6. Omeprazole induces NAD(P)H quinone oxidoreductase 1 via aryl hydrocarbon receptor-independent mechanisms: Role of the transcription factor nuclear factor erythroid 2–related factor 2

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Shaojie; Patel, Ananddeep; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2015-11-13

    Activation of the aryl hydrocarbon receptor (AhR) transcriptionally induces phase I (cytochrome P450 (CYP) 1A1) and phase II (NAD(P)H quinone oxidoreductase 1 (NQO1) detoxifying enzymes. The effects of the classical and nonclassical AhR ligands on phase I and II enzymes are well studied in human hepatocytes. Additionally, we observed that the proton pump inhibitor, omeprazole (OM), transcriptionally induces CYP1A1 in the human adenocarcinoma cell line, H441 cells via AhR. Whether OM activates AhR and induces the phase II enzyme, NAD(P)H quinone oxidoreductase 1 (NQO1), in fetal primary human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce NQO1 in HPMEC via the AhR. The concentrations of OM used in our experiments did not result in cytotoxicity. OM activated AhR as evident by increased CYP1A1 mRNA expression. However, contrary to our hypothesis, OM increased NQO1 mRNA and protein via an AhR-independent mechanism as AhR knockdown failed to abrogate OM-mediated increase in NQO1 expression. Interestingly, OM activated Nrf2 as evident by increased phosphoNrf2 (S40) expression in OM-treated compared to vehicle-treated cells. Furthermore, Nrf2 knockdown abrogated OM-mediated increase in NQO1 expression. In conclusion, we provide evidence that OM induces NQO1 via AhR-independent, but Nrf2-dependent mechanisms. - Highlights: • We investigated whether omeprazole induces NQO1 in human fetal lung cells. • Omeprazole induces the phase II enzyme, NQO1, in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of NQO1. • Omeprazole increases phosphoNrf2 (S40) protein expression in human fetal lung cells. • Nrf2 knockdown abrogates the induction of NQO1 by omeprazole in human lung cells.

  7. Nuclear blackmail and nuclear balance

    International Nuclear Information System (INIS)

    Betts, R.K.

    1987-01-01

    This book raises pointed questions about nuclear saber rattling. More than a dozen cases since the bombing of Hiroshima and Magasaki in which some sort of nuclear threat was used as a sparring technique in tense confrontations are cited. Each incident is described and analyzed. Two theories offered to explain America's use of nuclear threats, the balance of interest theory and the balance of power theory, are contrasted throughout the book. This book helps to fill the gap in the understanding of nuclear weapons and their uses, while pointing out that nuclear bravado could lead to an unintended unleashing of these weapons

  8. Nuclear energy and nuclear weapons

    International Nuclear Information System (INIS)

    Robertson, J.A.L.

    1983-06-01

    We all want to prevent the use of nuclear weapons. The issue before us is how best to achieve this objective; more specifically, whether the peaceful applications of nuclear energy help or hinder, and to what extent. Many of us in the nuclear industry are working on these applications from a conviction that without peaceful nuclear energy the risk of nuclear war would be appreciably greater. Others, however, hold the opposite view. In discussing the subject, a necessary step in allaying fears is understanding some facts, and indeed facing up to some unpalatable facts. When the facts are assessed, and a balance struck, the conclusion is that peaceful nuclear energy is much more part of the solution to preventing nuclear war than it is part of the problem

  9. Nuclear materials

    International Nuclear Information System (INIS)

    1996-01-01

    In 1998, Nuclear Regulatory Authority of the Slovak Republic (NRA SR) performed 38 inspections, 25 of them were performed in co-operation with IAEA inspectors. There is no fresh nuclear fuel at Bohunice A-1 NPP at present. Fresh fuel of Bohunice V-1 and V-2 NPPs is inspected in the fresh fuel storage.There are 327 fresh fuel assemblies in Mochovce NPP fresh fuel storage. In addition to that, are also 71 small users of nuclear materials in Slovakia. In most cases they use: covers made of depleted uranium for non-destructive works, detection of level in production plants, covers for therapeutical sources at medical facilities. In. 1995, NRA SR issued 4 new licences for nuclear material withdrawal. In the next part manipulation with nuclear materials, spent fuel stores and illegal trafficking in nuclear materials are reported

  10. Nuclear Law

    International Nuclear Information System (INIS)

    Wiesbauer, Bruno

    1978-01-01

    This book is the first attempt of a comprehensive compilation of national Austrian Nuclear Law (Nuclear Liability Act; Radiation protection Act, Radiation Protection Ordinance, Security Control Act, Act on the uses of Nuclear Energy - Zwentendorf Nuclear Power Plant) and the most important international agreements to which Austria is a party. Furthermore, the book contains the most important Nuclear Liability Conventions to which Austria is not yet a party, but which are applicable in neighbouring; the Paris Convention served as a model for the national Nuclear Liability Act and may be used for its interpretation. The author has translated a number of international instruments into German, such as the Expose des Motifs of the Paris Convention. (NEA) [fr

  11. Nuclear nonproliferation

    International Nuclear Information System (INIS)

    Neubert, M.

    1992-01-01

    The following motion was put before the United Kingdom House of Commons on 3rd February 1992 and agreed; that this House, recognising the potential dangers of the rapidly changing world order, welcomes the recent proposals for substantial reductions in nuclear weaponry, the growing support for the non-proliferation treaty and progress in the implementation of the United Nations Security Council Resolutions concerning the dismantling of Iraqi nuclear, chemical and biological capabilities; urges the Government to play their full part in helping the relevant authorities in the Commonwealth of Independent States to dismantle their nuclear devices, to safeguard their nuclear components and to discourage the proliferation of nuclear expertise; and believes it is of the first importance that Britain retains an effective and credible minimum nuclear deterrent as security in a world where there remain many sources of instability. The record of arguments for and against the motion in the debate is presented. (author)

  12. Nuclear energy

    International Nuclear Information System (INIS)

    Panait, A.

    1994-01-01

    This is a general report presenting the section VII entitled Nuclear Power of the National Conference on Energy (CNE '94) held in Neptun, Romania, on 13-16 June 1994. The problems addressed were those relating to electric power produced by nuclear power plant, to heat secondary generation, to quality assurance, to safety, etc. A special attention was paid to the commissioning of the first Romanian nuclear power unit, the Cernavoda-1 reactor of CANDU type. The communications were grouped in four subsections. These were: 1. Quality assurance, nuclear safety, and environmental protection; 2. Nuclear power plant, commissioning, and operation; 3. Nuclear power plant inspection, maintenance, and repairs, heavy water technology; 4. Public opinion education. There were 22 reports, altogether

  13. Nuclear power

    International Nuclear Information System (INIS)

    King, P.

    1990-01-01

    Written from the basis of neutrality, neither for nor against nuclear power this book considers whether there are special features of nuclear power which mean that its development should be either promoted or restrained by the State. The author makes it dear that there are no easy answers to the questions raised by the intervention of nuclear power but calls for openness in the nuclear decision making process. First, the need for energy is considered; most people agree that energy is the power to progress. Then the historicalzed background to the current position of nuclear power is given. Further chapters consider the fuel cycle, environmental impacts including carbon dioxide emission and the greenhouse effect, the costs, safety and risks and waste disposal. No conclusion either for or against nuclear power is made. The various shades of opinion are outlined and the arguments presented so that readers can come to their own conclusions. (UK)

  14. Nuclear power

    International Nuclear Information System (INIS)

    Porter, Arthur.

    1980-01-01

    This chapter of the final report of the Royal Commission on Electric Power Planning in Ontario updates its interim report on nuclear power in Ontario (1978) in the light of the Three Mile Island accident and presents the commission's general conclusions and recommendations relating to nuclear power. The risks of nuclear power, reactor safety with special reference to Three Mile Island and incidents at the Bruce generating station, the environmental effects of uranium mining and milling, waste management, nuclear power economics, uranium supplies, socio-political issues, and the regulation of nuclear power are discussed. Specific recommendations are made concerning the organization and public control of Ontario Hydro, but the commission concluded that nuclear power is acceptable in Ontario as long as satisfactory progress is made in the disposal of uranium mill tailings and spent fuel wastes. (LL)

  15. Nuclear astrophysics

    International Nuclear Information System (INIS)

    Haxton, W.C.

    1992-01-01

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized

  16. Nuclear physics

    International Nuclear Information System (INIS)

    Patel, S.B.

    1991-01-01

    This book is a simple and direct introduction to the tools of modern nuclear physics, both experimental and mathematical. Emphasizes physical intuition and illuminating analogies, rather than formal mathematics. Topics covered include particle accelerators, radioactive series, types of nuclear reactions, detection of the neutrino, nuclear isomerism, binding energy of nuclei, fission chain reactions, and predictions of the shell model. Each chapter contains problems and illustrative examples. Pre-requisites are calculus and elementary vector analysis

  17. Nuclear energy

    International Nuclear Information System (INIS)

    Hesketh, Ross.

    1985-01-01

    The subject is treated under the headings: nuclear energy -what is it; fusion (principles; practice); fission (principles); reactor types and systems (fast (neutron) reactors as breeders; fast reactors; thermal reactors; graphite-moderated thermal reactors; the CANDU reactor; light water reactors - the BWR and the PWR); the nuclear fuel cycle (waste storage; fuel element manufacture; enrichment processes; uranium mining); safety and risk assessment; the nuclear power industry and the economy (regulating authorities; economics; advantages and disadvantages). (U.K.)

  18. Nuclear Asia

    National Research Council Canada - National Science Library

    Ferguson, Joseph; Tarleton, Gael

    2004-01-01

    .... This event was an opportunity for policy makers, security analysts, nuclear scientists and engineers, regional experts, and military planners to share perspectives and identify those issues requiring...

  19. Nuclear cardiology

    International Nuclear Information System (INIS)

    Fish, M.B.

    2002-01-01

    Recent advances in nuclear medicine instrumentation and software, including myocardial perfusion imaging, offer increased accuracy in the detection, diagnosis and prognosis of coronary artery disease. (orig.)

  20. Nuclear medicine

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The area of nuclear medicine, the development of artificially produced radioactive isotopes for medical applications, is relatively recent. Among the subjects covered in a lengthy discussion are the following: history of development; impact of nuclear medicine; understanding the most effective use of radioisotopes; most significant uses of nuclear medicine radioimmunoassays; description of equipment designed for use in the field of nuclear medicine (counters, scanning system, display systems, gamma camera); description of radioisotopes used and their purposes; quality control. Numerous historical photographs are included. 52 refs

  1. Nuclear Law

    International Nuclear Information System (INIS)

    Pascal, Maurice.

    1979-01-01

    This book on nuclear law is the first of a series of analytical studies to be published by the French Energy Commission (CEA) concerning all the various nuclear activities. It describes national and international legislation applicable in France covering the following main sectors: the licensing procedure for nuclear installations, the law of the sea and nuclear law, the legal system governing radioisotopes, the transport of radioactive materials, third party liability and insurance and radiation protection. In each chapter, the overall analysis is supplemented by the relevant regulatory texts and by organisation charts in annex. (NEA) [fr

  2. Nuclear Safety

    Energy Technology Data Exchange (ETDEWEB)

    Silver, E G [ed.

    1989-01-01

    This document is a review journal that covers significant developments in the field of nuclear safety. Its scope includes the analysis and control of hazards associated with nuclear energy, operations involving fissionable materials, and the products of nuclear fission and their effects on the environment. Primary emphasis is on safety in reactor design, construction, and operation; however, the safety aspects of the entire fuel cycle, including fuel fabrication, spent-fuel processing, nuclear waste disposal, handling of radioisotopes, and environmental effects of these operations, are also treated.

  3. Nuclear power

    International Nuclear Information System (INIS)

    Bupp, I.C.

    1991-01-01

    Is a nuclear power renaissance likely to occur in the United States? This paper investigates the many driving forces that will determine the answer to that question. This analysis reveals some frequently overlooked truths about the current state of nuclear technology: An examination of the issues also produces some noteworthy insights concerning government regulations and related technologies. Public opinion will play a major role in the unfolding story of the nuclear power renaissance. Some observers are betting that psychological, sociological, and political considerations will hod sway over public attitudes. Others wager that economic and technical concerns will prevail. The implications for the nuclear power renaissance are striking

  4. Nuclear stress test

    Science.gov (United States)

    ... Persantine stress test; Thallium stress test; Stress test - nuclear; Adenosine stress test; Regadenoson stress test; CAD - nuclear stress; Coronary artery disease - nuclear stress; Angina - nuclear ...

  5. Nuclear physics for nuclear fusion

    International Nuclear Information System (INIS)

    Li Xingzhong; Liu Bin; Wei Qingming; Ren Xianzhe

    2004-01-01

    The D-T fusion cross-section is calculated using quantum mechanics with the model of square nuclear potential well and Coulomb potential barrier. The agreement between ENDF data and the theoretically calculated results is well in the range of 0.2-280 keV. It shows that the application of Breit-Wigner formula is not suitable for the case of the light nuclei fusion reaction. When this model is applied to the nuclear reaction between the charged particles confined in a lattice, it explains the 'abnormal phenomena'. It implies a prospect of nuclear fusion energy without strong nuclear radiations

  6. Nuclear installations

    International Nuclear Information System (INIS)

    2001-01-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 2 of the document contains some details about the existing Brazilian nuclear installations. Also, safety improvements at Angra 1 and aspects of Angra 2 and 3 are reported

  7. Nuclear safety

    International Nuclear Information System (INIS)

    1991-02-01

    This book reviews the accomplishments, operations, and problems faced by the defense Nuclear Facilities Safety Board. Specifically, it discusses the recommendations that the Safety Board made to improve safety and health conditions at the Department of Energy's defense nuclear facilities, problems the Safety Board has encountered in hiring technical staff, and management problems that could affect the Safety Board's independence and credibility

  8. Nuclear violence

    International Nuclear Information System (INIS)

    Mullen, R.K.

    1987-01-01

    A great deal of attention has been paid in the past decade or so to the characteristics of terrorists and their apparent goals and objectives, capabilities, and evolving strategy and tactics with respect to nuclear terrorism. In contrast, little has been said about the procedural aspects of nuclear terrorism, and even less about the way in which such endeavors can fail. This latter omission is important because it bears directly on the ability to evaluate credibly the potential for nuclear terrorism. Here, the author addresses the requirements inherent in acquiring a nuclear explosive capability by three routes: separation of plutonium from irradiated light or heavy water reactor (LWR or HWR) fuel, processing, or use of separated fissile material, and theft of a nuclear weapon. In addition, he deals with other potential acts of nuclear terrorism: sabotage of power reactors, uranium enrichment facilities and spent nuclear fuel in transport, and dispersal of radioactive materials, in particular, plutonium. He specifically does not look at the design or production of a nuclear weapon. Finally, the discussion here assumes that the terrorist is subnational; that is, a nation is not involved. Also, the discussion of subnational participation does not address the possibility of collusion with insiders

  9. Nuclear installations

    International Nuclear Information System (INIS)

    1998-01-01

    This document presents the fulfilling of the Brazilian obligations under the Convention on Nuclear Safety. The Chapter 2 of the document contains some details about the existing Brazilian nuclear installations. Also, safety improvements at Angra 1 and aspects of Angra 2 and 3 are reported

  10. Nuclear power

    International Nuclear Information System (INIS)

    Abd Khalik Wood

    2003-01-01

    This chapter discuss on nuclear power and its advantages. The concept of nucleus fission, fusion, electric generation are discussed in this chapter. Nuclear power has big potential to become alternative energy to substitute current conventional energy from coal, oil and gas

  11. Nuclear energy

    International Nuclear Information System (INIS)

    1978-01-01

    This brochure is intended as a contribution to a better and more general understanding of one of the most urgent problems of present society. Emphasis is laid on three issues that are always raised in the nuclear debate: 1) Fuel cycle, 2) environmental effects of nuclear power plants, 3) waste disposal problems. (GL) [de

  12. Nuclear pollution

    International Nuclear Information System (INIS)

    Ramade, Francois

    1979-01-01

    In this chapter devoted to nuclear pollution the following topics were studied: fundamentals of radiobiology (ecological importance of the various radioisotopes, biological effects of ionizing radiations); ecological effects of radioactive fallout (contamination of atmosphere, terrestrial ecosystems, oceans). The electronuclear industry and its environmental impact. PWR type reactors, fuel reprocessing plants, contamination of trophic chains by radionuclides released in the environment from nuclear installations [fr

  13. Nuclear lifetimes

    International Nuclear Information System (INIS)

    Caraca, J.M.G.

    1976-01-01

    The importance of the results obtained in experiments of measurement of lifetimes for a detailed knowledge of nuclear structure is referred. Direct methods of measurement of nuclear lifetimes are described, namely, electronic methods, recoil-distance method, doppler shift atenuation method and blocking-method. A brief reference is made to indirect methods for measurement of life-times

  14. Nuclear facts

    International Nuclear Information System (INIS)

    1982-01-01

    The subject is discussed as follows: the case for using nuclear energy (Britain's energy needs; energy policy); safety; transport of spent fuel; radiation (natural radioactivity); environment (land use of nuclear power plants; storage and disposal of radioactive wastes). (U.K.)

  15. Nuclear measurements

    International Nuclear Information System (INIS)

    Schenkel, R.

    2005-01-01

    Nuclear measurements play a fundamental role in the development of nuclear technology and the assurance of its peaceful use. They are also required in many non-power nuclear applications such as in nuclear medicine, agriculture, environmental protection, etc. This presentation will show examples of most recent advances in measurement methodology or technology in the areas described below. The Generation IV International Forum has selected six innovative reactor systems as candidates for a next generation of sustainable, economic and safe nuclear energy systems. The choice of the best options relies heavily on the availability of accurate nuclear data that can only be obtained, in an international effort, using highly specialised facilities. Significant efforts are being directed towards the partitioning and transmutation of highly active nuclear waste. Different concepts involving fast reactors or accelerator-driven systems are being studied in view of their transmutation capabilities. State of the art equipment has been developed to assess basic properties of nuclear fuel at very high burn-up; some fine examples of this work will be shown. Physical and chemical methods play a crucial role in the detection and identification of radioisotopes used in various stages of the nuclear fuel cycle. Radiation measurement techniques are used, for example, to monitor the quantities of uranium, plutonium and other actinide elements in fuel enrichment and reprocessing facilities. Another field of application of physical and chemical methods is the characterisation of nuclear material seized from illicit trafficking. Seized material has to be analysed in order to obtain clues on its origin and intended use and to prevent diversion of nuclear material from the same source in the future. A recent highlight in basic physics relates to nuclear fission and transmutation with high intensity lasers. Ultra-fast high intensity lasers can produce high energy (tens of MeV) photons through

  16. Nuclear rockets

    International Nuclear Information System (INIS)

    Sarram, M.

    1972-01-01

    Nuclear energy has found many applications in space projects. This article deals with these applications. The first application is the use of nuclear energy for the production of electricity in space and the second main application is the use of nuclear energy for propulsion purposes in space flight. The main objective is to develop a 75000 pound thrust flight engine call NERVA by heating liquid hydrogen, in a nuclear reactor, from 420F to 4000 0 F. The paper describes in detail the salient features of the NERVA rocket as well as its comparison with the conventional chemical rockets. It is shown that a nuclear rocket using liquid hydrogen as medium is at least 85% more efficient as compared with the chemical rockets such as those used for the APOLLO moon flight

  17. Nuclear rockets

    Energy Technology Data Exchange (ETDEWEB)

    Sarram, M [Teheran Univ. (Iran). Inst. of Nuclear Science and Technology

    1972-02-01

    Nuclear energy has found many applications in space projects. This article deals with these applications. The first application is the use of nuclear energy for the production of electricity in space and the second main application is the use of nuclear energy for propulsion purposes in space flight. The main objective is to develop a 75000 pound thrust flight engine called NERVA by heating liquid hydrogen in a nuclear reactor. The paper describes in detail the salient features of the NERVA rocket as well as its comparison with the conventional chemical rockets. It is shown that a nuclear rocket using liquid hydrogen as medium is at least 85% more efficient as compared with the chemical rockets such as those used for the APOLLO moon flight.

  18. Nuclear haematology

    International Nuclear Information System (INIS)

    Masjhur, J.S.

    1992-01-01

    Nuclear techniques have been applied to study diagnose and treat various haematological disorders for more than five decades. Two scientists are regarded as pioneers in this field, i.e. John Lawrence who in 1938 used 32 P to treat chronic myeloid leukaemia and George Hevessy who used 32 P labelled erythrocytes to measure blood volume in 1939. At present, many nuclear medicine procedures are available for diagnosis and therapy of a variety of haematological disorders. Although nuclear techniques are somewhat complex, they give direct and quantitative assessment of the kinetics of blood elements as compared to other non-isotopic haematological tests. Basically, equipment required for nuclear haematology is very simple such as well scintillation counters to measure radioactivity in blood samples. More sophisticated equipment like rectilinear scanner or gamma camera is required when imaging is necessary. An overview of the basic principles and clinical applications of nuclear haematology is given

  19. Nuclear forensics

    International Nuclear Information System (INIS)

    Venugopal, V.

    2010-01-01

    Increasing threat by terrorists for a possible nuclear attack is particularly alarming in recent years. The likelihood of such an event is highly uncertain but cannot be ruled out. The consequence of such an event would be highly disastrous and the implications could be far-reaching both socially and politically. It is feared that significant amount of nuclear weapons materials may be kept under poor security. Therefore, there is a greater demand with utmost priority to curb nuclear terrorism by adapting proper security measures. One of the most important measures is to stop illicit trafficking of nuclear materials which are the source of building nuclear explosive devices. According to the IAEA illicit trafficking database (ITDB) report, a total number of 252 incidents were reported in 2006, of which 150 occurred in 2006 and the remaining 102 had taken place prior to that year, mainly in 2005

  20. Nuclear Safety

    International Nuclear Information System (INIS)

    1978-09-01

    In this short paper it has only been possible to deal in a rather general way with the standards of safety used in the UK nuclear industry. The record of the industry extending over at least twenty years is impressive and, indeed, unique. No other industry has been so painstaking in protection of its workers and in its avoidance of damage to the environment. Headings are: introduction; how a nuclear power station works; radiation and its effects (including reference to ICRP, the UK National Radiological Protection Board, and safety standards); typical radiation doses (natural radiation, therapy, nuclear power programme and other sources); safety of nuclear reactors - design; key questions (matters of concern which arise in the public mind); safety of operators; safety of people in the vicinity of a nuclear power station; safety of the general public; safety bodies. (U.K.)

  1. Nuclear proliferation

    International Nuclear Information System (INIS)

    Stencel, S.

    1978-01-01

    The terms and reactions to President Carter's nuclear policy, culminating in the 1978 Nuclear Non-Proliferation Act, are reviewed and analyzed. The new law increases restrictions on nuclear exports, encourages continued use of light water reactors in preference to plutonium-fueled reactors, and emphasizes technical solutions to proliferation problems. Critics of the law point out that it will hurt U.S. trade unfairly, that other countries do not have as many fuel options as the U.S. has, and that nuclear sales have as many political and economic as technical solutions. Compromise areas include new international safety guidelines, the possibility of an international nuclear fuel bank, and a willingness to consider each case on its merits. 21 references

  2. Nuclear privatization

    International Nuclear Information System (INIS)

    Jeffs, E.

    1995-01-01

    The United Kingdom government announced in May 1995 plans to privatize the country's two nuclear generating companies, Nuclear Electric and Scottish Nuclear. Under the plan, the two companies will become operating divisions of a unified holding company, to be called British Electric, with headquarters in Scotland. Britain's nuclear plants were left out of the initial privatization in 1989 because the government believed the financial community would be unwilling to accept the open-ended liability of decommissioning the original nine stations based on the Magnox gas-cooled reactor. Six years later, the government has found a way around this by retaining these power stations in state ownership, leaving the new nuclear company with the eight Advanced Gas-cooled Reactor (AGR) stations and the recently completed Sizewell B PWR stations. The operating Magnox stations are to be transferred to BNFL, which operates two Magnox stations of their own at Calder Hall and Chapelcross

  3. Nuclear haematology

    Energy Technology Data Exchange (ETDEWEB)

    Masjhur, J S

    1993-12-31

    Nuclear techniques have been applied to study diagnose and treat various haematological disorders for more than five decades. Two scientists are regarded as pioneers in this field, i.e. John Lawrence who in 1938 used {sup 32}P to treat chronic myeloid leukaemia and George Hevessy who used {sup 32}P labelled erythrocytes to measure blood volume in 1939. At present, many nuclear medicine procedures are available for diagnosis and therapy of a variety of haematological disorders. Although nuclear techniques are somewhat complex, they give direct and quantitative assessment of the kinetics of blood elements as compared to other non-isotopic haematological tests. Basically, equipment required for nuclear haematology is very simple such as well scintillation counters to measure radioactivity in blood samples. More sophisticated equipment like rectilinear scanner or gamma camera is required when imaging is necessary. An overview of the basic principles and clinical applications of nuclear haematology is given

  4. Nuclear questions

    Energy Technology Data Exchange (ETDEWEB)

    Durrani, M. [Physics World (United Kingdom)

    2006-01-01

    The future of nuclear power has returned to centre stage. Freezing weather on both sides of the Atlantic and last month's climate-change talks in Montreal have helped to put energy and the future of nuclear power right back on the political agenda. The issue is particularly pressing for those countries where existing nuclear stations are reaching the end of their lives. In the UK, prime minister Tony Blair has commissioned a review of energy, with a view to deciding later this year whether to build new nuclear power plants. The review comes just four years after the Labour government published a White Paper on energy that said the country should keep the nuclear option open but did not follow this up with any concrete action. In Germany, new chancellor and former physicist Angela Merkel is a fan of nuclear energy and had said she would extend the lifetime of its nuclear plants beyond 2020, when they are due to close. However, that commitment has had to be abandoned, at least for the time being, following negotiations with her left-wing coalition partners. The arguments in favour of nuclear power will be familiar to all physicists - it emits almost no carbon dioxide and can play a vital role in maintaining a diverse energy supply. To over-rely on imported supplies of oil and gas can leave a nation hostage to fortune. The arguments against are equally easy to list - the public is scared of nuclear power, it generates dangerous waste with potentially huge clean-up costs, and it is not necessarily cheap. Nuclear plants could also be a target for terrorist attacks. Given political will, many of these problems can be resolved, or at least tackled. China certainly sees the benefits of nuclear power, as does Finland, which is building a new 1600 MW station - the world's most powerful - that is set to open in 2009. Physicists, of course, are essential to such developments. They play a vital role in ensuring the safety of such plants and developing new types of

  5. Nuclear energy

    International Nuclear Information System (INIS)

    Rippon, S.

    1984-01-01

    Do we need nuclear energy. Is it safe. What are the risks. Will it lead to proliferation. The questions are endless, the answers often confused. In the vigorous debates that surround the siting and operation of nuclear power plants, it is all too easy to lose sight of the central issues amid the mass of arguments and counter-arguments put forward. And there remains the doubt, who do we believe. This book presents the facts, simply, straightforwardly, and comprehensibly. It describes the different types of nuclear reactor, how they work, how energy is produced and transformed into usable power, how nuclear waste is handled, what safeguards are built in to prevent accident, contamination and misuse. More important, it does this in the context of the real world, examining the benefits as well as the dangers of a nuclear power programme, quantifying the risks, and providing an authoritative account of the nuclear industry worldwide. Technically complex and politically controversial, the contribution of nuclear energy to our future energy requirements is a crucial topic of our time. (author)

  6. Nuclear Hostages

    International Nuclear Information System (INIS)

    Cooper, C.L.

    1978-01-01

    The global spread of nuclear reactors for the production of energy seems inevitable. Nuclear power plants will be supplied--if not by the United States, then by one of several other exporters. But other aspects of this development are less certain. One is the relationship between proliferation of nuclear energy plants and that of nuclear weapons. Another is the actual constraint that such vulnerable potential targets as nuclear power plants would have on would-be aggressors. In the last analysis, this would depend on the rationality of a nation's leadership. What can be said for the concept of nuclear power plants as potential hostages is that by installing a reactor on its territory, a country increases its vulnerability to grave, possibly unacceptable damage in the event of war. As a result, that nation's leaders might be inclined to raise the threshold of their sensitivity to provocation by neighbors and to restrain their own inclinations toward aggression. Admittedly this is a frail substitute for robust international agreements, but in the present order of things it is not a trivial consideration. Many incidents once regarded by the great powers as easi belli have more recently been either resolved by diplomacy or ignored altogether. The idea must not be pressed too far. The export of a nuclear power plant to a Third World country cannot be advocated simply as a means to constrain its own military adventurism. Aside from the promise of a vast increase in energy supply for developing nations, nuclear powered generating stations could actually improve relations among countries. The risk of widespread radioactive contamination by nuclear power plants hit by even conventional bombs could introduce a positive new element into the military calculations of powers outside the NATO-Warsaw Pact arena. As they balance military and diplomatic solutions to local conflicts, moderation rather than bellicosity might become the better part of valor

  7. Nuclear medicine

    International Nuclear Information System (INIS)

    Kand, Purushottam

    2012-01-01

    Nuclear medicine is a specialized area of radiology that uses very small amounts of radioactive materials to examine organ function and structure. Nuclear medicine is older than CT, ultrasound and MRI. It was first used in patients over 60-70 years ago. Today it is an established medical specialty and offers procedures that are essential in many medical specialities like nephrology, pediatrics, cardiology, psychiatry, endocrinology and oncology. Nuclear medicine refers to medicine (a pharmaceutical) that is attached to a small quantity of radioactive material (a radioisotope). This combination is called a radiopharmaceutical. There are many radiopharmaceuticals like DTPA, DMSA, HIDA, MIBI and MDP available to study different parts of the body like kidneys, heart and bones etc. Nuclear medicine uses radiation coming from inside a patient's body where as conventional radiology exposes patients to radiation from outside the body. Thus nuclear imaging study is a physiological imaging, whereas diagnostic radiology is anatomical imaging. It combines many different disciplines like chemistry, physics mathematics, computer technology, and medicine. It helps in diagnosis and to treat abnormalities very early in the progression of a disease. The information provides a quick and accurate diagnosis of wide range of conditions and diseases in a person of any age. These tests are painless and most scans expose patients to only minimal and safe amounts of radiation. The amount of radiation received from a nuclear medicine procedure is comparable to, or often many times less than, that of a diagnostic X-ray. Nuclear medicine provides an effective means of examining whether some tissues/organs are functioning properly. Therapy using nuclear medicine in an effective, safe and relatively inexpensive way of controlling and in some cases eliminating, conditions such as overactive thyroid, thyroid cancer and arthritis. Nuclear medicine imaging is unique because it provides doctors with

  8. Nuclear inheritance

    International Nuclear Information System (INIS)

    Delpech, Therese

    1997-01-01

    Since the end of the East-West confronting, the nuclear weapon issue has been focused in an international debate with obvious repercussions in Europe, because it is the European continent which indicated first the significance of nuclear deterrence. This debate refers first upon the past, as the German unification allowed capturing numerous documents of Warsaw treaty which revealed the intentions and the plans of Soviet Union during the cold war, and secondly concerns the future, since the role of nuclear weapons must be re-thought in a new context. This is the subject of this book, which refers also to the problem of the nuclear proliferation in the world and evolution of different countries in a political and regional context. The extension of the non-proliferation treaty for an undefined duration, in May 1995, is a incontestable victory because this treaty rules the renouncement to nuclear weapons of 185 countries. However, it does not solve most sensible problems like the Iraq case, for which a specific inspection regime has been instituted, or the case of Iran, which is suspected to acquire the bomb, although no clear evidence has been provided up to now. This is also the case of Israel, India and Pakistan which allege plainly their willingness of keeping open, from security reasons, their nuclear option. The content is displayed in five chapters: 1. Introduction; 2. The role of the nuclear weapons after the cold war; 3. The nuclear proliferation at crossroads; 4. Undefined extension of the NPT, a striking but fragile victory; 5. Conclusions. An appendix containing the text of the Nuclear Weapon Non-Proliferation Treaty and a chronology are added

  9. Nuclear energy

    International Nuclear Information System (INIS)

    Hladky, S.

    1985-01-01

    This booklet appeared in a series on technical history. It tries to communicate some of the scientific, technical and social stresses, which have been connected with the application of nuclear energy since its discovery. The individual sections are concerned with the following subjects: the search for the 'smallest particles'; the atomic nucleus; nuclear fission; the 'Manhattan Project'; the time after this - from the euphoria of the 1950's via disillusionment and change of opinion to the state of nuclear energy at the start of the 1980's. The booklet contains many details and is generously illustrated. (HSCH) [de

  10. Nuclear transport

    International Nuclear Information System (INIS)

    Anon.

    2003-01-01

    During january and february 2003, a unique event concerning nuclear transport was reported and rated 1 on the INES scale. This event concerns the absence of a maintenance operation on a shipping cask. This shipping cask was used for several years for nuclear transport inside La-hague site before being re-assigned to transport on public thoroughfare. The re-assignment of the cask should have been preceded and conditioned by a maintenance operation whose purpose is to check the efficiency of its radiation shield. During this period 2 on-site inspections concerning the transport of nuclear materials were performed. (A.C.)

  11. Nuclear energy

    International Nuclear Information System (INIS)

    Luxo, Armand.

    1977-01-01

    The reasons and conditions of utilizing nuclear power in developing countries are examined jointly with the present status and future uses already evaluated by some organizations. Some consequences are deduced in the human, financial scientific and technological fields, with provisional suggestions for preparing the nuclear industry development in these countries. As a conclusion trends are given to show how the industrialized countries having gained a long scientific and technological experience in nuclear energy can afford their assistance in this field, to developing countries [fr

  12. Nuclear questions

    International Nuclear Information System (INIS)

    Hohlfeld, W.

    1977-01-01

    This brochure 'nuclear problems' deals with the attitude of the protestant church in the region around the northern Elbe towards further quantitative economic growth, esp. nuclear energy, with the following essays: preaching the Gospel in an environment in danger: the Christian occident and the problems of the third world, facing the problems of exhausted supplies, the role of the prophet, problem of environment - a problem of theology, the political dimension, against ATW, signal Brokdorf, strange effects (defense of the church from unqualified teachings by non-professionals), Christian liberty, church and nuclear energy, violence and robes. (HP) [de

  13. Rotterdam Nuclear

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    In 1965 Rotterdam Nuclear received an order for the design, supply of materials, manufacture, testing, inspection and preparation for shipment of one 450MW Boiling Water Reactor pressure vessel. This was one of the first orders for a reactor pressure vessel, ever obtained by a European Manufacturer. The Company has since supplied 19 reactor pressure vessels for nuclear power stations, having a total weight of about 10,000,000kg. The nuclear power stations in which these are installed represent an electrical output of about 15,000MW and they are located in seven different countries (USA, Spain, Switzerland, Argentina, Sweden, Germany and the Netherlands). (Auth.)

  14. Nuclear law

    International Nuclear Information System (INIS)

    Bringuier, P.

    2009-01-01

    The object of this report is to present the evolution of the nuclear law during the period from 2006 to 2008, period that was characterized in France by a real rewriting from the implementation of a control authority. The prescriptive backing of nuclear activities has been deeply changed by numerous texts. In this first part are presented: (1) the institutional aspects, (2) openness and public information, (7) radioactive wastes and (9) liability and insurance. In a next publication will be treated: (3) safety and radiation protection; (4) nuclear matter, inspection, physical protection; (5) transports; (6) trade, non-proliferation; (8) radiological accidents. (N.C.)

  15. Nuclear fuel

    International Nuclear Information System (INIS)

    D Hondt, P.

    1998-01-01

    The research and development programme on nuclear fuel at the Belgian Nuclear Research Centre SCK/CEN is described. The objective of this programme is to enhance the quantitative prediction of the operational limits of nuclear fuel and to assess the behaviour of fuel under incidental and accidental conditions. Progress is described in different domains including the modelling of fission gas release in LWR fuel, thermal conductivity, basic physical phenomena, post-irradiation examination for fuel performance assessment, and conceptual studies of incidental and accidental fuel experiments

  16. Nuclear energy

    International Nuclear Information System (INIS)

    Wethe, Per Ivar

    2009-01-01

    Today we know two forms of nuclear energy: fission and fusion. Fission is the decomposition of heavy nuclei, while fusion is the melting together of light nuclei. Both processes create a large surplus of energy. Technologically, we can currently only use fission to produce energy in today's nuclear power plants, but there is intense research worldwide in order to realize a controlled fusion process. In a practical context, today's nuclear energy is a sustained source of energy since the resource base is virtually unlimited. When fusion technology is realized, the resource supply will be a marginal problem. (AG)

  17. Nuclear electronics

    International Nuclear Information System (INIS)

    Lucero B, E.

    1989-01-01

    The rapid technical development of Colombia over the past years, resulted among others, a considerable increase in the number of measuring instrumentation and testing laboratories, scientific research and metrology centers, in industry, agriculture, public health, education on the nuclear field, etc. IAN is a well organized institution with qualified management, trained staff and reasonably equipped laboratories to carry out tasks as: Metrology, standardization, quality control and maintenance and repair of nuclear instruments. The government of Colombia has adopted a policy to establish and operate through the country maintenance and repair facilities for nuclear instrumentation. This policy is reflected in the organization of electronic laboratories in Bogota-IAN

  18. Nuclear wastes

    International Nuclear Information System (INIS)

    2002-01-01

    This scientific document presents an introduction to the nuclear wastes problems, the separation process and the transmutation, the political and technical aspects of the storage, the radioprotection standards and the biological effects. (A.L.B.)

  19. Nuclear Disarmament.

    Science.gov (United States)

    Johnson, Christopher

    1982-01-01

    Material about nuclear disarmament and the arms race should be included in secondary school curricula. Teachers can present this technical, controversial, and frightening material in a balanced and comprehensible way. Resources for instructional materials are listed. (PP)

  20. Nuclear analysis

    International Nuclear Information System (INIS)

    1988-01-01

    Basic studies in nuclear analytical techniques include the examination of underlying assumptions and the development and extention of techniques involving the use of ion beams for elemental and mass analysis. 1 ref., 1 tab

  1. Nuclear reaction

    CERN Multimedia

    Penwarden, C

    2001-01-01

    At the European Research Organization for Nuclear Research, Nobel laureates delve into the mysteries of particle physics. But when they invited artists from across the continent to visit their site in Geneva, they wanted a new kind of experiment.

  2. [Nuclear theory

    International Nuclear Information System (INIS)

    1989-06-01

    This report discusses concepts in nuclear theory such as: neutrino nucleosynthesis; double beta decay; neutrino oscillations; chiral symmetry breaking; T invariance; quark propagator; cold fusion; and other related topics

  3. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 1 to 56. (A.L.B.)

  4. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    2000-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  5. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1998-01-01

    This paper is made of two tables. The first table describes the different particles (bosons and fermions) while the second one gives the nuclear constants of isotopes from the different elements with Z = 1 to 25. (J.S.)

  6. Nuclear constants

    International Nuclear Information System (INIS)

    Foos, J.

    1999-01-01

    This paper is written in two tables. The first one describes the different particles (bosons and fermions). The second one gives the isotopes nuclear constants of the different elements, for Z = 56 to 68. (A.L.B.)

  7. Nuclear transmutations

    International Nuclear Information System (INIS)

    Mikulaj, V.

    1992-01-01

    Two types of nuclear transmutations are outlined, namely the radioactive transmutations and nuclear reactions. The basic characteristics are given of radioactive transmutations (gamma transmutations and isomeric transitions, beta, alpha transmutations, spontaneous fission and spontaneous emission of nucleons), their kinetics and the influence of the physical and chemical state of the radionuclide on the transmutation rate. The basic characteristics are described of nuclear reactions (reactions of neutrons including fission, reactions induced by charged particles and photons), their kinetics, effective cross sections and their mechanism. Chemical reactions caused by nuclear transmutations are discussed (recoil energy, properties of hot atoms, Szilard-Chalmers effect). A brief information is given on the behavior of radionuclides in trace concentrations. (Z.S.) 2 tabs., 19 figs., 12 refs

  8. Nuclear waste

    International Nuclear Information System (INIS)

    1992-05-01

    The Nuclear Waste Policy Act of 1982, as amended in 1987, directed the Secretary of Energy to, among other things, investigate Yucca Mountain, Nevada, as a potential site for permanently disposing of highly radioactive wastes in an underground repository. In April 1991, the authors testified on Yucca Mountain project expenditures before your Subcommittee. Because of the significance of the authors findings regrading DOE's program management and expenditures, you asked the authors to continue reviewing program expenditures in depth. As agreed with your office, the authors reviewed the expenditures of project funds made available to the Department of Energy's (DOE) Lawrence Livermore National Laboratory, which is the lead project contractor for developing a nuclear waste package that wold be used for disposing of nuclear waste at Yucca Mountain. This report discusses the laboratory's use of nuclear waste funds to support independent research projects and to manage Yucca Mountain project activities. It also discusses the laboratory's project contracting practices

  9. Nuclear shields

    International Nuclear Information System (INIS)

    Linares, R.C.; Nienart, L.F.; Toelcke, G.A.

    1976-01-01

    A process is described for preparing melt-processable nuclear shielding compositions from chloro-fluoro substituted ethylene polymers, particularly PCTFE and E-CTFE, containing 1 to 75 percent by weight of a gadolinium compound. 13 claims, no drawings

  10. Nuclear option

    International Nuclear Information System (INIS)

    Olson, P.S.

    1983-01-01

    The energy demand complexion of this country is always changing and promises to change in the future. The nuclear industry is responding to changing energy demands through standards writing activities. Since the oil embargo of 1973, there has been a change in the mix of fuels contributing to energy growth in this country; virtually all of the energy growth has come from coal and nuclear power. The predicted expansion of coal use by 1985, over 1977 level, is 37%, while the use of oil is expected to decline by 17%. Use of nuclear power is expected to increase 62% from the 1977 level. The feasibility of using nuclear energy to meet the needs of the USA for electric power is discussed

  11. Nuclear safety

    International Nuclear Information System (INIS)

    Tarride, Bruno

    2015-10-01

    The author proposes an overview of methods and concepts used in the nuclear industry, at the design level as well as at the exploitation level, to ensure an acceptable safety level, notably in the case of nuclear reactors. He first addresses the general objectives of nuclear safety and the notion of acceptable risk: definition and organisation of nuclear safety (relationships between safety authorities and operators), notion of acceptable risk, deterministic safety approach and main safety principles (safety functions and confinement barriers, concept of defence in depth). Then, the author addresses the safety approach at the design level: studies of operational situations, studies of internal and external aggressions, safety report, design principles for important-for-safety systems (failure criterion, redundancy, failure prevention, safety classification). The next part addresses safety during exploitation and general exploitation rules: definition of the operation domain and of its limits, periodic controls and tests, management in case of incidents, accidents or aggressions

  12. Nuclear fission

    International Nuclear Information System (INIS)

    Kodama, T.

    1981-01-01

    The nuclear fission process is pedagogically reviewed from a macroscopic-microscopic point of view. The Droplet model is considered. The fission dynamics is discussed utilizing path integrals and semiclassical methods. (L.C.) [pt

  13. Nuclear physics

    International Nuclear Information System (INIS)

    Connell, K.A.; Warner, D.D.

    1990-01-01

    The first volume of the Annual Report for 1989/90 gives an overview of the Nuclear Structure Facility at Daresbury, its development and a selection of highlights of the year's programme. This volume is complementary, presenting brief specialist reports, submitted by the users, describing the progress and results of each individual proposal. The contents reflect the extremely successful year due in good measure to the performance of the tandem accelerator which provided a record number of hours with ''beam on target''. Reports are grouped in four sections: research into nuclear structure with contributions ordered in increasing Z numbers of the nuclei studied; investigations of nuclear reaction mechanisms; nuclear theory; accelerator operations and development plus experimental instrumentation and techniques. The appendix forms a concise summary of the work at the facility for the year. (author)

  14. Nuclear waste

    International Nuclear Information System (INIS)

    Pligt, J. van der

    1989-01-01

    This chapter present a brief overview of the current situation of siting radioactive wastes. This is followed by an overview of various psychological approaches attempting to analyse public reactions to nuclear facilities. It will be argued that public reactions to nuclear waste factilities must be seen in the context of more general attitudes toward nuclear energy. The latter are not only based upon perceptions of the health and environmental risks but are built on values, and sets of attributes which need not be similar to the representations o the experts and policy-makers. The issue of siting nuclear waste facilities is also embedded in a wider moral and political domain. This is illustrated by the importance of equity issues in siting radioactive wastes. In the last section, the implications of the present line of argument for risk communication and public participation in decisions about siting radioactive wastes will be briefly discussed. (author). 49 refs

  15. Children's (Pediatric) Nuclear Medicine

    Medline Plus

    Full Text Available ... Physician Resources Professions Site Index A-Z Children's (Pediatric) Nuclear Medicine Children’s (pediatric) nuclear medicine imaging uses ... limitations of Children's Nuclear Medicine? What is Children's (Pediatric) Nuclear Medicine? Nuclear medicine is a branch of ...

  16. Children's (Pediatric) Nuclear Medicine

    Medline Plus

    Full Text Available ... Professions Site Index A-Z Children's (Pediatric) Nuclear Medicine Children’s (pediatric) nuclear medicine imaging uses small amounts ... Children's Nuclear Medicine? What is Children's (Pediatric) Nuclear Medicine? Nuclear medicine is a branch of medical imaging ...

  17. General Nuclear Medicine

    Science.gov (United States)

    ... Resources Professions Site Index A-Z General Nuclear Medicine Nuclear medicine imaging uses small amounts of radioactive ... of General Nuclear Medicine? What is General Nuclear Medicine? Nuclear medicine is a branch of medical imaging ...

  18. Children's (Pediatric) Nuclear Medicine

    Science.gov (United States)

    ... Professions Site Index A-Z Children's (Pediatric) Nuclear Medicine Children’s (pediatric) nuclear medicine imaging uses small amounts ... Children's Nuclear Medicine? What is Children's (Pediatric) Nuclear Medicine? Nuclear medicine is a branch of medical imaging ...

  19. Children's (Pediatric) Nuclear Medicine

    Medline Plus

    Full Text Available ... News Physician Resources Professions Site Index A-Z Children's (Pediatric) Nuclear Medicine Children’s (pediatric) nuclear medicine imaging ... the limitations of Children's Nuclear Medicine? What is Children's (Pediatric) Nuclear Medicine? Nuclear medicine is a branch ...

  20. Children's (Pediatric) Nuclear Medicine

    Medline Plus

    Full Text Available ... Resources Professions Site Index A-Z Children's (Pediatric) Nuclear Medicine Children’s (pediatric) nuclear medicine imaging uses small ... of Children's Nuclear Medicine? What is Children's (Pediatric) Nuclear Medicine? Nuclear medicine is a branch of medical ...

  1. Nuclear instrumentation

    International Nuclear Information System (INIS)

    Weill, Jacky; Fabre, Rene.

    1981-01-01

    This article sums up the Research and Development effort at present being carried out in the five following fields of applications: Health physics and Radioprospection, Control of nuclear reactors, Plant control (preparation and reprocessing of the fuel, testing of nuclear substances, etc.), Research laboratory instrumentation, Detectors. It also sets the place of French industrial activities by means of an estimate of the French market, production and flow of trading with other countries [fr

  2. Nuclear hadrodynamics

    International Nuclear Information System (INIS)

    Geesaman, D.F.

    1984-01-01

    The role of hadron dynamics in the nucleus is illustrated to show the importance of nuclear medium effects in hadron interactions. The low lying hadron spectrum is considered to provide the natural collective variables for nuclear systems. Recent studies of nucleon-nucleon and delta-nucleon interactions are reviewed, with emphasis on the type of experimental phenomena which signal the importance of the many-body dynamics. 28 references

  3. Seguro Nuclear

    International Nuclear Information System (INIS)

    Oliveira, S.C.C. de.

    1978-04-01

    A description of the constitutive elements of insurance and its features in the field of law, and special legislation about the matter are given. The relationship between the liability of the nuclear power plant operator and the international conventions about civil liability on nuclear damage is discussed. Some considerations on damage reparing in the United States, Germany, France and Spain are presented. (A.L.S.L.) [pt

  4. Nuclear medicine

    International Nuclear Information System (INIS)

    Sibille, L.; Nalda, E.; Collombier, L.; Kotzki, P.O.; Boudousq, V.

    2011-01-01

    Nuclear medicine is a medical specialty using the properties of radioactivity. Radioactive markers associated with vectors are used as a tracer or radiopharmaceutical for diagnostic purposes and/or therapy. Since its birth more than half a century ago, it has become essential in the care of many patients, particularly in oncology. After some definitions, this paper presents the main nuclear techniques - imaging for diagnostic, radiopharmaceuticals as therapeutic agents, intra-operative detection, technique of radioimmunoassay - and the future of this field. (authors)

  5. Nuclear waste

    International Nuclear Information System (INIS)

    1988-01-01

    The Department of Energy has proposed a draft plan for investigating the Yucca Mountain, Nevada, site to determine if it suitable for a waste repository. This fact sheet provides information on the status of DOE's and the Nuclear Regulatory Commission's efforts to streamline what NRC expects will be the largest and most complex nuclear-licensing proceeding in history, including the development of an electronic information management system called the Licensing Support System

  6. Nuclear safety

    International Nuclear Information System (INIS)

    Arnott, D.

    1981-01-01

    Dr Arnott, scientific consultant to PANDORA, emphasises our lack of knowledge of the behaviour of highly active radioactive wastes, particularly effluents, and their characteristics. He proposes that they should be stored, preferably in a solidified state, until our knowledge allows their safe disposal. Political aspects and government policies are discussed and human fallibility is stressed. The nuclear establishment and nuclear power programme are severely criticised. (U.K.)

  7. Nuclear astrophysics

    International Nuclear Information System (INIS)

    Lehoucq, Roland; Klotz, Gregory

    2015-11-01

    Astronomy deals with the position and observation of the objects in our Universe, from planets to galaxies. It is the oldest of the sciences. Astrophysics is the study of the physical properties of these objects. It dates from the start of the 20. century. Nuclear astrophysics is the marriage of nuclear physics, a laboratory science concerned with the infinitely small, and astrophysics, the science of what is far away and infinitely large. Its aim is to explain the origin, evolution and abundance of the elements in the Universe. It was born in 1938 with the work of Hans Bethe, an American physicist who won the Nobel Prize for physics in 1967, on the nuclear reactions that can occur at the center of stars. It explains where the incredible energy of the stars and the Sun comes from and enables us to understand how they are born, live and die. The matter all around us and from which we are made, is made up of ninety-two chemical elements that can be found in every corner of the Universe. Nuclear astrophysics explains the origin of these chemical elements by nucleosynthesis, which is the synthesis of atomic nuclei in different astrophysical environments such as stars. Nuclear astrophysics provides answers to fundamental questions: - Our Sun and the stars in general shine because nuclear reactions are taking place within them. - The stars follow a sequence of nuclear reaction cycles. Nucleosynthesis in the stars enables us to explain the origin and abundance of elements essential to life, such as carbon, oxygen, nitrogen and iron. - Star explosions, in the form of supernovae, disperse the nuclei formed by nucleosynthesis into space and explain the formation of the heaviest chemical elements such as gold, platinum and lead. Nuclear astrophysics is still a growing area of science. (authors)

  8. Nuclear physics

    International Nuclear Information System (INIS)

    Spicer, B.M.

    1981-01-01

    Major centres of experimental nuclear physics are at Melbourne University, A.N.U., the A.A.E.C., James Cook University and the University of Western Australia. Groups working in theoretical nuclear physics exist at Melbourne, A.N.U., the A.A.E.C., Flinders and Adelaide Universities and the University of Western Australia. The activities of these groups are summarised

  9. Nuclear energy

    International Nuclear Information System (INIS)

    1996-01-01

    Several issues concerning nuclear energy in France during 1996 are presented: permission of a demand for installing underground laboratories in three sites (Marcoule, Bure and Chapelle-Baton); a report assessing the capacity of Superphenix plant to operate as a research tool; the project of merging between Framatome and Gec-Alsthom companies; the revision of a general report on nuclear energy in France; the issue of military plutonium management

  10. Nuclear Data

    Energy Technology Data Exchange (ETDEWEB)

    White, Morgan C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-01-23

    PowerPoint presentation targeted for educational use. Nuclear data comes from a variety of sources and in many flavors. Understanding where the data you use comes from and what flavor it is can be essential to understand and interpret your results. This talk will discuss the nuclear data pipeline with particular emphasis on providing links to additional resources that can be used to explore the issues you will encounter.

  11. Nuclear medicine

    International Nuclear Information System (INIS)

    Blanquet, Paul; Blanc, Daniel.

    1976-01-01

    The applications of radioisotopes in medical diagnostics are briefly reviewed. Each organ system is considered and the Nuclear medicine procedures pertinent to that system are discussed. This includes, the principle of the test, the detector and the radiopharmaceutical used, the procedure followed and the clinical results obtained. The various types of radiation detectors presently employed in Nuclear Medicine are surveyed, including scanners, gamma cameras, positron cameras and procedures for obtaining tomographic presentation of radionuclide distributions [fr

  12. Nuclear medicine

    International Nuclear Information System (INIS)

    Chamberlain, M.J.

    1986-01-01

    Despite an aggressive, competitive diagnostic radiology department, the University Hospital, London, Ontario has seen a decline of 11% total (in vivo and in the laboratory) in the nuclear medicine workload between 1982 and 1985. The decline of in vivo work alone was 24%. This trend has already been noted in the U.S.. Nuclear medicine is no longer 'a large volume prosperous specialty of wide diagnostic application'

  13. Nuclear cardiac

    International Nuclear Information System (INIS)

    Slutsky, R.; Ashburn, W.L.

    1982-01-01

    The relationship between nuclear medicine and cardiology has continued to produce a surfeit of interesting, illuminating, and important reports involving the analysis of cardiac function, perfusion, and metabolism. To simplify the presentation, this review is broken down into three major subheadings: analysis of myocardial perfusion; imaging of the recent myocardial infarction; and the evaluation of myocardial function. There appears to be an increasingly important relationship between cardiology, particularly cardiac physiology, and nuclear imaging techniques

  14. Nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, S M [Bhabha Atomic Research Centre, Bombay (India). Radiation Medicine Centre

    1967-01-01

    The article deals with the growth of nuclear medicine in India. Radiopharmaceuticals both in elemental form and radiolabelled compounds became commercially available in India in 1961. Objectives and educational efforts of the Radiation Medicine Centre setup in Bombay are mentioned. In vivo tests of nuclear medicine such as imaging procedures, dynamic studies, dilution studies, thyroid function studies, renal function studies, linear function studies, blood flow, and absorption studies are reported. Techniques of radioimmunoassay are also mentioned.

  15. Nuclear technology

    International Nuclear Information System (INIS)

    1983-03-01

    This report examines nuclear technology in Canada, with emphasis on Quebec, as a means of revitilizing industry. The historical, present day, and future states of Atomic Energy of Canada Limited are examined. Future research programs are discussed in greatest detail. These range from disposal of porcine wastes to new applications for electricity to nuclear medical techniques (to cite only a few examples). The executive summary is written in English. (23 fig., 16 tab.)

  16. Nuclear risk

    International Nuclear Information System (INIS)

    Mulkers, G.

    1988-01-01

    This file includes data on risks insured by the nuclear insurance pool in Belgium and on the Chernobyl accident covering injury, economic damage and compensation for the latter. Also included are the texts of the IAEA Conventions on Early Notification and on Assistance in Case of a Nuclear Accident as well as that of a Convention on long-distance transfrontier atmospheric pollution signed in Geneva [fr

  17. Nuclear accidents

    International Nuclear Information System (INIS)

    1987-01-01

    On 27 May 1986 the Norwegian government appointed an inter-ministerial committee of senior officials to prepare a report on experiences in connection with the Chernobyl accident. The present second part of the committee's report describes proposals for measures to prevent and deal with similar accidents in the future. The committee's evaluations and proposals are grouped into four main sections: Safety and risk at nuclear power plants; the Norwegian contingency organization for dealing with nuclear accidents; compensation issues; and international cooperation

  18. Nuclear education

    International Nuclear Information System (INIS)

    Kemeny, L.G.

    1987-01-01

    All scientists and technologists are agreed that the coal based fuel cycle is somewhere between 50 to 300 times more dangerous than the uranium fuel cycle. Under these circumstances it is not difficult to show that on a more quantitative basis, the nuclear industry, in all countries, has an unblemished safety record when compared with other energy sources. Various hazards and benefits of nuclear power are analyzed in this paper comparing with other energy sources. (Liu)

  19. Nuclear astrophysics

    International Nuclear Information System (INIS)

    Arnould, M.; Takahashi, K.

    1999-01-01

    Nuclear astrophysics is that branch of astrophysics which helps understanding of the Universe, or at least some of its many faces, through the knowledge of the microcosm of the atomic nucleus. It attempts to find as many nuclear physics imprints as possible in the macrocosm, and to decipher what those messages are telling us about the varied constituent objects in the Universe at present and in the past. In the last decades much advance has been made in nuclear astrophysics thanks to the sometimes spectacular progress made in the modelling of the structure and evolution of the stars, in the quality and diversity of the astronomical observations, as well as in the experimental and theoretical understanding of the atomic nucleus and of its spontaneous or induced transformations. Developments in other subfields of physics and chemistry have also contributed to that advance. Notwithstanding the accomplishment, many long-standing problems remain to be solved, and the theoretical understanding of a large variety of observational facts needs to be put on safer grounds. In addition, new questions are continuously emerging, and new facts endangering old ideas. This review shows that astrophysics has been, and still is, highly demanding to nuclear physics in both its experimental and theoretical components. On top of the fact that large varieties of nuclei have to be dealt with, these nuclei are immersed in highly unusual environments which may have a significant impact on their static properties, the diversity of their transmutation modes, and on the probabilities of these modes. In order to have a chance of solving some of the problems nuclear astrophysics is facing, the astrophysicists and nuclear physicists are obviously bound to put their competence in common, and have sometimes to benefit from the help of other fields of physics, like particle physics, plasma physics or solid-state physics. Given the highly varied and complex aspects, we pick here some specific nuclear

  20. Nuclear safety

    International Nuclear Information System (INIS)

    2014-01-01

    The Program on Nuclear Safety comprehends Radioprotection, Radioactive Waste Management and Nuclear Material Control. These activities are developed at the Nuclear Safety Directory. The Radioactive Waste Management Department (GRR) was formally created in 1983, to promote research and development, teaching and service activities in the field of radioactive waste. Its mission is to develop and employ technologies to manage safely the radioactive wastes generated at IPEN and at its customer’s facilities all over the country, in order to protect the health and the environment of today's and future generations. The Radioprotection Service (GRP) aims primarily to establish requirements for the protection of people, as workers, contractors, students, members of the general public and the environment from harmful effects of ionizing radiation. Furthermore, it also aims to establish the primary criteria for the safety of radiation sources at IPEN and planning and preparing for response to nuclear and radiological emergencies. The procedures about the management and the control of exposures to ionizing radiation are in compliance with national standards and international recommendations. Research related to the main activities is also performed. The Nuclear Material Control has been performed by the Safeguard Service team, which manages the accountability and the control of nuclear material at IPEN facilities and provides information related to these activities to ABACC and IAEA. (author)

  1. Nuclear fuel

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, H [Power Reactor and Nuclear Fuel Development Corp., Tokyo (Japan)

    1976-10-01

    It is expected that nuclear power generation will reach 49 million kW in 1985 and 129 million kW in 1995, and the nuclear fuel having to be supplied and processed will increase in proportion to these values. The technical problems concerning nuclear fuel are presented on the basis of the balance between the benefit for human beings and the burden on the human beings. Recently, especially the downstream of nuclear fuel attracts public attention. Enriched uranium as the raw material for light water reactor fuel is almost monopolized by the U.S., and the technical information has not been published for fear of the diversion to nuclear weapons. In this paper, the present situations of uranium enrichment, fuel fabrication, transportation, reprocessing and waste disposal and the future problems are described according to the path of nuclear fuel cycle. The demand and supply of enriched uranium in Japan will be balanced up to about 1988, but afterwards, the supply must rely upon the early establishment of the domestic technology by centrifugal separation method. No problem remains in the fabrication of light water reactor fuel, but for the fabrication of mixed oxide fuel, the mechanization of the production facility and labor saving are necessary. The solution of the capital risk for the construction of the second reprocessing plant is the main problem. Japan must develop waste disposal techniques with all-out efforts.

  2. Nuclear safety

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2014-07-01

    The Program on Nuclear Safety comprehends Radioprotection, Radioactive Waste Management and Nuclear Material Control. These activities are developed at the Nuclear Safety Directory. The Radioactive Waste Management Department (GRR) was formally created in 1983, to promote research and development, teaching and service activities in the field of radioactive waste. Its mission is to develop and employ technologies to manage safely the radioactive wastes generated at IPEN and at its customer’s facilities all over the country, in order to protect the health and the environment of today's and future generations. The Radioprotection Service (GRP) aims primarily to establish requirements for the protection of people, as workers, contractors, students, members of the general public and the environment from harmful effects of ionizing radiation. Furthermore, it also aims to establish the primary criteria for the safety of radiation sources at IPEN and planning and preparing for response to nuclear and radiological emergencies. The procedures about the management and the control of exposures to ionizing radiation are in compliance with national standards and international recommendations. Research related to the main activities is also performed. The Nuclear Material Control has been performed by the Safeguard Service team, which manages the accountability and the control of nuclear material at IPEN facilities and provides information related to these activities to ABACC and IAEA. (author)

  3. Nuclear energy

    International Nuclear Information System (INIS)

    Seidel, J.

    1990-01-01

    This set of questions is based on an inquiry from the years 1987 to 1989. About 250 people af all age groups - primarily, however, young people between 16 and 25 years of age - were asked to state the questions they considered particularly important on the subject of nuclear energy. The survey was carried out without handicaps according to the brain-storming principle. Although the results cannot claim to be representative, they certainly reflect the areas of interest of many citizens and also their expectations, hopes and fears in connection with nuclear energy. The greater part of the questions were aimed at three topic areas: The security of nuclear power-stations, the effects of radioactivity on people and the problem of waste disposal. The book centres around these sets of questions. The introduction gives a general survey of the significance of nuclear energy as a whole. After this follow questions to do with the function of nuclear power stations, for the problems of security and waste disposal - which are dealt with in the following chapters - are easier to explain and to understand if a few physical and technical basics are understood. In the final section of the book there are questions on the so-called rejection debate and on the possibility of replacing nuclear energy with other energy forms. (orig./HP) [de

  4. Nuclear technologies

    International Nuclear Information System (INIS)

    Toyama, Makoto; Hamasaki, Manabu; Kobayashi, Masahiko; Hoshide, Akihiko; Katayama, Kimio; Nozawa, H.; Karigome, Satoshi

    2010-01-01

    In recent days, energy security is becoming a major global concern and it has been recognized that a major reduction in greenhouse-gas emissions is required to combat climate change. Considerable expansion and new introduction of nuclear power generation are currently being planned and considered for the further in various parts of the world. Nuclear technologies of the latest 10 years in Japan were reviewed with their characteristics, advancement and future perspective. Steady efforts have been made to construct new nuclear power stations with computer-aided engineering system and modular and prefabricated structures, extend the interval of periodic inspections under the new inspection system that should improve both safety and reliability, implement advanced measures against aging and develop the next-generation light water reactors including a medium small reactor. Export of nuclear power plants has been promoted with international business alliance or cooperation. Activities to close nuclear fuel cycle to ensure sustainable nuclear energy utilization have been promoted. Decommissioning technologies for Tokai power station have been developed and accumulated know-how will be utilized in light water reactors. (T. Tanaka)

  5. Nuclear watershed

    International Nuclear Information System (INIS)

    Makovich, L.; Parish, T.

    1984-01-01

    In 1979 the accident at Three Mile Island brought nuclear power to the forefront of national attention. Over the last five years there have been no new orders for nuclear plants, construction costs and lead times have increased drastically, and numerous plants have been cancelled. In the coming years many new plants will come on line, and the first round of nuclear plant retirements will begin. Thus, the new set of issues faced by utilities are whether to complete plants currently under construction, how to recover the cost of abandoned plants, how to handle the potential rate shock of bringing costly plants into rate base, and how to accomplish decommissioning and retirement of nuclear plants. This paper presents and analyzes these issues. First, the history of the nuclear electric generation industry is reviewed. Next a case study illustrating the cost momentum built into nuclear power plant construction is presented. The issues involved in plant cancellation are discussed. Finally, a case study involving rate phase-in strategies is analyzed. 1 reference, 7 figures

  6. Nuclear waste

    International Nuclear Information System (INIS)

    Anon.

    1983-01-01

    The Koeberg nuclear power station, planned to come on stream in 1984, is expected to save South Africa some six million t/annum of coal, and to contribute some 10 per cent of the country's electricity requirements. The use of nuclear energy will provide for growing national energy needs, and reduce high coal transport costs for power generation at the coast. In the long term, however, it gives rise to the controversial question of nuclear waste storage. The Atomic Energy Corporation of South Africa Ltd (AEC) recently announced the purchase of a site in Namaqualand (NW Cape) for the storage of low-level radioactive waste. The Nuclear Development Corporation of South Africa (Pty) Ltd, (NUCOR) will develop and operate the site. The South African Mining and Engineering Journal interviewed Dr P.D. Toens, manager of the Geology Department and Mr P.E. Moore, project engineer, on the subject of nuclear waste, the reasons behind Nucor's choice of site and the storage method

  7. Nuclear risk

    International Nuclear Information System (INIS)

    Levenson, M.

    1989-01-01

    The title of our session, Nuclear Risk Versus Other Power Options, is provocative. It is also a title with different meanings to different people. To the utility chief executive officer, nuclear power is a high-risk financial undertaking because of political and economic barriers to cost recovery. To the utility dispatcher, it is a high-risk future power source since plant completion and start-up dates can be delayed for very long times due to uncertain legal and political issues. To the environmentalist, concerned about global effects such as greenhouse and acid rain, nuclear power is a relatively low risk energy source. To the financial people, nuclear power is a cash cow turned sour because of uncertainties as to what new plants will cost and whether they will even be allowed to operate. The statistics on risk are known and the results of probability risk assessment calculations of risks are known. The challenge is not to make nuclear power safer, it is already one of the safest, if not the safest, source of power currently available. The challenge is to find a way to communicate this to the public

  8. Nuclear recession

    International Nuclear Information System (INIS)

    Speth, G.

    1978-01-01

    The private sector's growing doubts about nuclear power plants, as reflected in the decline in new orders and the number of rescinded orders, will result in an estimated total of under 300 nuclear power plants by the year 2000 rather than the 1200 to 1500 that were projected several years ago. The decline is a result of construction and equipment costs and a lower operating efficiency than anticipated. The growth of electricity demand also declined after 1974 and, although it is increasing again, there are concerns about future growth rates. Besides its noncompetitive position relative to coal, nuclear plant construction suffers from restrictive policies based on the uncertainties of safety, security, waste disposal, and proliferation. Unless these problems can be resolved, many consider nuclear power to be an impractical option as an energy source. The Council on Environmental Quality supports policies that will permit further nuclear or coal development only after a clear demonstration of technical and institutional capacity to handle these problems. A commitment to solar technology is urged

  9. Nuclear fusion

    International Nuclear Information System (INIS)

    Al-zaelic, M.M.

    2013-01-01

    Nuclear fusion can be relied on to solve the global energy crisis if the process of limiting the heat produced by the fusion reaction (Plasma) is successful. Currently scientists are progressively working on this aspect whereas there are two methods to limit the heat produced by fusion reaction, the two methods are auto-restriction using laser beam and magnetic restriction through the use of magnetic fields and research is carried out to improve these two methods. It is expected that at the end of this century the nuclear fusion energy will play a vital role in overcoming the global energy crisis and for these reasons, acquiring energy through the use of nuclear fusion reactors is one of the most urge nt demands of all mankind at this time. The conclusion given is that the source of fuel for energy production is readily available and inexpensive ( hydrogen atoms) and whole process is free of risks and hazards, especially to general health and the environment . Nuclear fusion importance lies in the fact that energy produced by the process is estimated to be about four to five times the energy produced by nuclear fission. (author)

  10. Nuclear scales

    International Nuclear Information System (INIS)

    Friar, J.L.

    1998-01-01

    Nuclear scales are discussed from the nuclear physics viewpoint. The conventional nuclear potential is characterized as a black box that interpolates nucleon-nucleon (NN) data, while being constrained by the best possible theoretical input. The latter consists of the longer-range parts of the NN force (e.g., OPEP, TPEP, the π-γ force), which can be calculated using chiral perturbation theory and gauged using modern phase-shift analyses. The shorter-range parts of the force are effectively parameterized by moments of the interaction that are independent of the details of the force model, in analogy to chiral perturbation theory. Results of GFMC calculations in light nuclei are interpreted in terms of fundamental scales, which are in good agreement with expectations from chiral effective field theories. Problems with spin-orbit-type observables are noted

  11. Nuclear forces

    International Nuclear Information System (INIS)

    Holinde, K.

    1990-01-01

    In this paper the present status of the meson theory of nuclear forces is reviewed. After some introductory remarks about the relevance of the meson exchange concept in the era of QCD and the empirical features of the NN interaction, the exciting history of nuclear forces is briefly outlined. In the main part, the author gives the basic physical ideas and sketch the derivation of the one-boson-exchange model of the nuclear force, in the Feynman approach. Secondly we describe, in a qualitative way, various necessary extensions, leading to the Bonn model of the N interaction. Finally, points to some interesting pen questions connected with the extended quark structure of the hadrons, which are topics of current research activity

  12. Nuclear astrophysics

    International Nuclear Information System (INIS)

    Penionzhkevich, Yu. E.

    2010-01-01

    The International Year of Astronomy 2009 (IYA2009) was declared by the 62nd General Assembly of the United Nations and was also endorsed by UNESCO. Investigations in the realms of particle and nuclear physicsmake a large contribution in the development of our ideas of the properties of the Universe. The present article discusses some problems of the evolution of the Universe, nucleosyntheses, and cosmochronology from the point of view of nuclear and particle physics. Processes occurring in the Universe are compared with the mechanisms of the production and decay of nuclei, as well as with the mechanisms of their interaction at high energies. Examples that demonstrate the potential of nuclearphysics methods for studying cosmic objects and the properties of the Universe are given. The results that come from investigations into nuclear reactions induced by beams of radioactive nuclei and which make it possible to take a fresh look at the nucleosynthesis scenario in the range at light nuclei are presented.

  13. Nuclear scales

    Energy Technology Data Exchange (ETDEWEB)

    Friar, J.L.

    1998-12-01

    Nuclear scales are discussed from the nuclear physics viewpoint. The conventional nuclear potential is characterized as a black box that interpolates nucleon-nucleon (NN) data, while being constrained by the best possible theoretical input. The latter consists of the longer-range parts of the NN force (e.g., OPEP, TPEP, the {pi}-{gamma} force), which can be calculated using chiral perturbation theory and gauged using modern phase-shift analyses. The shorter-range parts of the force are effectively parameterized by moments of the interaction that are independent of the details of the force model, in analogy to chiral perturbation theory. Results of GFMC calculations in light nuclei are interpreted in terms of fundamental scales, which are in good agreement with expectations from chiral effective field theories. Problems with spin-orbit-type observables are noted.

  14. Nuclear waste

    International Nuclear Information System (INIS)

    Anon.

    1996-01-01

    The NEA Nuclear Waste Bulletin has been prepared by the Radiation Protection and Waste Management Division of the OECD Nuclear Energy Agency to provide a means of communication amongst the various technical and policy groups within the waste management community. In particular, it is intended to provide timely and concise information on radioactive waste management activities, policies and programmes in Member countries and at the NEA. It is also intended that the Bulletin assists in the communication of recent developments in a variety of areas contributing to the development of acceptable technology for the management and disposal of nuclear waste (e.g., performance assessment, in-situ investigations, repository engineering, scientific data bases, regulatory developments, etc)

  15. Nuclear policy

    International Nuclear Information System (INIS)

    Ford, G.R.

    1976-01-01

    Then-President Gerald Ford outlines the potential benefits of nuclear power as opposed to the danger of proliferation. He points out that not all nations have the same interest or views toward nuclear energy; but also he says that if a choice must be made, nonproliferation objectives must take precedence over economic and energy benefits. It is pointed out that the management of nuclear energy can be only partial and temporary by technical measures, and that full management can result only if nations realistically face the task prepared to forego preconceived short-term advantages in favor of long-term gains. Coordination of the policies of all nations toward the common goal of nonproliferation is predicted to lead to success

  16. Nuclear proliferation and terrorism

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    This section of the book, Part III, has two chapters (9 and 10). Chapter 9, Nuclear Power and Proliferation of Nuclear Weapons, is disucssed under these subjects: nuclear nonproliferation: origins and status; requirements for nuclear weapons manufacture; current nuclear programs and proliferation capabilities; encouraging decisions to forego weapons; arms control; safeguards; attitudes and expectations. Chapter 10, Nuclear Terrorism, discusses these areas: theft of nuclear materials; attacks on nuclear reactors; responding to nuclear terrorism; security and civil liberties

  17. A high-resolution peak fractionation approach for streamlined screening of nuclear-factor-E2-related factor-2 activators in Salvia miltiorrhiza.

    Science.gov (United States)

    Zhang, Hui; Luo, Li-Ping; Song, Hui-Peng; Hao, Hai-Ping; Zhou, Ping; Qi, Lian-Wen; Li, Ping; Chen, Jun

    2014-01-24

    Generation of a high-purity fraction library for efficiently screening active compounds from natural products is challenging because of their chemical diversity and complex matrices. In this work, a strategy combining high-resolution peak fractionation (HRPF) with a cell-based assay was proposed for target screening of bioactive constituents from natural products. In this approach, peak fractionation was conducted under chromatographic conditions optimized for high-resolution separation of the natural product extract. The HRPF approach was automatically performed according to the predefinition of certain peaks based on their retention times from a reference chromatographic profile. The corresponding HRPF database was collected with a parallel mass spectrometer to ensure purity and characterize the structures of compounds in the various fractions. Using this approach, a set of 75 peak fractions on the microgram scale was generated from 4mg of the extract of Salvia miltiorrhiza. After screening by an ARE-luciferase reporter gene assay, 20 diterpene quinones were selected and identified, and 16 of these compounds were reported to possess novel Nrf2 activation activity. Compared with conventional fixed-time interval fractionation, the HRPF approach could significantly improve the efficiency of bioactive compound discovery and facilitate the uncovering of minor active components. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Nuclear politics

    International Nuclear Information System (INIS)

    Hall, Tony.

    1986-01-01

    Written by an arts graduate journalist this is intended for a non-technical general readership. It chronicles the history of the nuclear power industry in Britain from its beginnings, which were inextricably tied to the development of the atomic bomb, to the Sellafield investigation and Sizewell public inquiry. In particular the government decisions which have influenced the present structure and state of the industry are criticised. With important decisions about to be made the author questions the accountability of the nuclear industry and the government's ability to understand the complex technical aspects of the industry. (U.K.)

  19. Nuclear dilemma

    Energy Technology Data Exchange (ETDEWEB)

    Penn, J.

    Declaring nuclear preparedness 'immoral' helps to recreate the pacifism of 50 years ago. War itself is a dilemma, not the weapons with which it is waged. We must ask of the anti-war proposals: whom do they benefit. On the whole people concerned are ordinary citizens who are fearful of nuclear incineration. But marching with them is a spectrum of forces with other motivations and purposes. In a real life situation of international tension or crises, numbers of weapons in combination with their particular charateristics could mean the difference between peace and outbreak of war.

  20. Nuclear energy

    International Nuclear Information System (INIS)

    Lotter, A.C.

    1979-01-01

    The recent, terrifying threat of a major calamity at Pennsylvania's Three Mile Island power plant near Harrisburg reverberated across practically the whole of the civilised world. An almost incredible sequence of human and mechanical failures at this installation had stopped just short of disaster and had brought the unthinkable perilously close to happening. The accident had sprayed radioactive waste into the air and had led to the large scale evacuation of people from the endangered area, disrupted hundreds of thousands of lives and caused a crippling setback to the nuclear industry. In this article the author discusses the impact the Harrisburg incident has had on the nuclear industry

  1. Nuclear cardiology

    International Nuclear Information System (INIS)

    Bashore, T.M.; Shaffer, P.B.

    1985-01-01

    The birth of nuclear cardiology has generally been attributed to a 1927 experiment during which a radium salt was injected in one arm vein and the circulation time calculated by recording the arrival of the radioactivity in the opposite arm. This simple experiment lead to the radiocardiogram in the late 1940s that was used to measure left ventricular function and, later, cardiac output. This chapter provides a brief overview of nuclear cardiology. Methodology is presented when it is important for the understanding of test results. The use of these studies in the diagnosis and evaluation of patients with suspected cardiovascular disease is emphasized

  2. Nuclear fuel

    International Nuclear Information System (INIS)

    Azevedo, J.B.L. de.

    1980-01-01

    All stages of nuclear fuel cycle are analysed with respect to the present situation and future perspectives of supply and demand of services; the prices and the unitary cost estimation of these stages for the international fuel market are also mentioned. From the world resources and projections of uranium consumption, medium-and long term analyses are made of fuel availability for several strategies of use of different reactor types. Finally, the cost of nuclear fuel in the generation of electric energy is calculated to be used in the energetic planning of the electric sector. (M.A.) [pt

  3. Nuclear reactions

    International Nuclear Information System (INIS)

    Lane, A.M.

    1980-01-01

    In reviewing work at Harwell over the past 25 years on nuclear reactions it is stated that a balance has to be struck in both experiment and theory between work on cross-sections of direct practical relevance to reactors and on those relevant to an overall understanding of reaction processes. The compound nucleus and direct process reactions are described. Having listed the contributions from AERE, Harwell to developments in nuclear reaction research in the period, work on the optical model, neutron capture theory, reactions at doorway states with fine structure, and sum-rules for spectroscopic factors are considered in more detail. (UK)

  4. The nuclear

    International Nuclear Information System (INIS)

    2011-01-01

    This report proposes an overview of knowledge and technical aspects regarding nuclear energy. It presents the phenomenon of radioactivity and its measurement and thresholds, describes the fuel cycle, presents the different principles and types of nuclear reactors, and more precisely the pressurized water reactors and their various models (900, 1300, 1400 and 1600 MW). It presents other reactors: boiling water reactors, heavy water reactors, high temperature reactors, fourth generation reactors. It addresses the issues of wastes and releases, presents the OSPAR convention, the issues of management and safety. It presents the national safety bodies (ASN, IRSN, HCTISM) and international bodies

  5. Nuclear medicine

    International Nuclear Information System (INIS)

    Reichelt, H.G.

    1980-01-01

    Nuclear medicine as a complex diagnostical method is used mainly to detect functional organic disorders, to locate disorders and for radioimmunologic assays (RIA) in vitro. In surgery, its indication range comprises the thyroid (in vivo and in vitro), liver and bile ducts, skeletal and joint diseases, disorders of the cerebro-spinal liquor system and the urologic disorders. In the early detection of tumors, the search for metastases and tumor after-care, scintiscanning and the tumor marcher method (CEA) can be of great practical advantage, but the value of myocardial sciritiscanning in cardiac respectively coronary disorders is restricted. The paper is also concerned with the radiation doses in nuclear medicine. (orig.) [de

  6. Nuclear energy and nuclear technology

    International Nuclear Information System (INIS)

    Luescher, E.

    1982-01-01

    This book originated in the training courses for teachers of grammar- and secondary schools in Dillingen (Bavaria). The aim of these courses is to become informed about the latest state in one field of physics. The lectures are well-known experts in the respective fields. In the latest study (1980) of the National Academy of Sciences the experts came to the conclusion that without further development nuclear power plants the utilization of too much coal would become necessary and involve irreversible environmental damage (see chapter 6). There are two important obstacles impeding the further extension of nuclear energy. The first problem to be solved is the processing and storage of radioactive waste. This is a more technical task and can be treated in a satisfactory way. The second obstacle is less easy to take as the population has to be convinced that a nuclear power plant can be operated with almost unbelievable safety (see chapter 5) and be shut down safely in the case of incidents. The most promising possibility of controlled nuclear fusion as energy source is still many decades- if feasible at all- away from being performed (see chapter. 7). In the Soviet Union 25% of the electric energy production shall be proceed from nuclear power plants by the year 1990. (orig./GL) [de

  7. Nuclear winter or nuclear fall?

    Science.gov (United States)

    Berger, André

    Climate is universal. If a major modern nuclear war (i.e., with a large number of small-yield weapons) were to happen, it is not even necessary to have a specific part of the world directly involved for there to be cause to worry about the consequences for its inhabitants and their future. Indeed, smoke from fires ignited by the nuclear explosions would be transported by winds all over the world, causing dark and cold. According to the first study, by Turco et al. [1983], air surface temperature over continental areas of the northern mid-latitudes (assumed to be the nuclear war theatre) would fall to winter levels even in summer (hence the term “nuclear winter”) and induce drastic climatic conditions for several months at least. The devastating effects of a nuclear war would thus last much longer than was assumed initially. Discussing to what extent these estimations of long-term impacts on climate are reliable is the purpose of this article.

  8. Nuclear crime

    International Nuclear Information System (INIS)

    Braun, P.; Ferchland, B.

    1993-01-01

    The article discusses the legal provisions (Criminal Code (StGB), weapons Control Act) applicable in Germany to combat illegal trading of nuclear fuels and other readioactive materials. The authors conclude that part of the provisions are not in live with the rights and duties of the police, and they evolve near-practice proposals for remedy and legal improvement. (hP) [de

  9. Nuclear reactor

    International Nuclear Information System (INIS)

    Mysels, K.J.; Shenoy, A.S.

    1976-01-01

    A nuclear reactor is described in which the core consists of a number of fuel regions through each of which regulated coolant flows. The coolant from neighbouring fuel regions is combined in a manner which results in an averaging of the coolant temperature at the outlet of the core. By this method the presence of hot streaks in the reactor is reduced. (UK)

  10. Nuclear energy

    International Nuclear Information System (INIS)

    Reuss, Paul

    2012-01-01

    With simple and accessible explanations, this book presents the physical principles, the history and industrial developments of nuclear energy. More than 25 years after the Chernobyl accidents and few months only after the Fukushima one, it discusses the pros and cons of this energy source with its assets and its risks. (J.S.)

  11. Nuclear imaging

    International Nuclear Information System (INIS)

    Miller, J.H.; Reid, B.S.

    1985-01-01

    Nuclear imaging, utilizing relatively low photon energy emitting isotopes, allows an assessment of anatomic configuration and organ function. This method of imaging is predicted on the utilization of physiologically active radioisotope-labeled compounds or biologically active radioisotopes. Localization of such isotopes in normal or abnormal concentrations may be due to varying physiological or pathological mechanisms

  12. Nuclear Energy

    International Nuclear Information System (INIS)

    1982-11-01

    A brief indication is given of the United Kingdom nuclear power programme including descriptions of the fission process, the Magnox, AGR and PWR type reactors, the recycling process, waste management and decommissioning, safety precautions, the prototype fast reactor at Dounreay, and the JET fusion experiment. (U.K.)

  13. Nuclear physics

    International Nuclear Information System (INIS)

    Guzman B, O.; Vallejo M, J.I.; Cardenas C, H.F.

    1989-01-01

    A historical review of the evolution of the Nuclear Physics Section at the IAN is presented along the 30 years of existence of the Institute. Objectives, structure, programs and goal are historically examined. Present status of the section and its projection on national development is also analyzed

  14. Nuclear films

    International Nuclear Information System (INIS)

    Malone, Peter.

    1985-01-01

    This booklet is a resource for the study of feature films that highlight the theme of nuclear war. It provides basic credits and brief indication of the theme, treatment, quality and particular notable aspects; and a series of questions raised by the film. Seventy feature films and thirty documentaries are examined

  15. Nuclear reactions

    International Nuclear Information System (INIS)

    Corner, J.; Richardson, K.; Fenton, N.

    1990-01-01

    Nuclear reactions' marks a new development in the study of television as an agency of public policy debate. During the Eighties, nuclear energy became a major international issue. The disasters at Three-mile Island and Chernobyl created a global anxiety about its risks and a new sensitivity to it among politicians and journalists. This book is a case-study into documentary depictions of nuclear energy in television and video programmes and into the interpretations and responses of viewers drawn from many different occupational groupings. How are the complex and specialist arguments about benefit, risk and proof conveyed through the different conventions of commentary, interview and film sequence? What symbolic associations does the visual language of television bring to portrayals of the issue? And how do viewers make sense of various and conflicting accounts, connecting what they see and hear on the screen with their pre-existing knowledge, experience and 'civic' expectations. The authors examine some of the contrasting forms and themes which have been used by programme makers to explain and persuade, and then give a sustained analysis of the nature and sources of viewers' own accounts. 'Nuclear Reactions' inquires into the public meanings surrounding energy and the environment, spelling out in its conclusion some of the implications for future media treatments of this issue. It is also a key contribution to the international literature on 'television knowledge' and the processes of active viewing. (author)

  16. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  17. Nuclear physics

    International Nuclear Information System (INIS)

    1990-01-01

    This work describes the actual situation of nuclear physics in Brazil as well as its perspectives of developments and real needs in the next decade. It discusses the main projects and the financing of brazilian research groups and Universities. (A.C.A.S.)

  18. Nuclear waste

    International Nuclear Information System (INIS)

    1990-06-01

    DOE estimates that disposing of radioactive waste from civilian nuclear power plants and its defense-related nuclear facilities could eventually end up costing $32 billion. To pay for this, DOE collects fees from utilities on electricity generated by nuclear power plants and makes payments from its defense appropriation. This report states that unless careful attention is given to its financial condition, the nuclear waste program is susceptible to future shortfalls. Without a fee increase, the civilian-waste part of the program may already be underfunded by at least $2.4 billion (in discounted 1988 dollars). Also, DOE has not paid its share of cost-about $480 million-nor has it disclosed this liability in its financial records. Indexing the civilian fee to the inflation rate would address one major cost uncertainty. However, while DOE intends to do this at an appropriate time, it does not use a realistic rate of inflation as its most probable scenario in assessing whether that time has arrived

  19. Nuclear safety culture and nuclear safety supervision

    International Nuclear Information System (INIS)

    Chai Jianshe

    2013-01-01

    In this paper, the author reviews systematically and summarizes up the development process and stage characteristics of nuclear safety culture, analysis the connotation and characteristics of nuclear safety culture, sums up the achievements of our country's nuclear safety supervision, dissects the challenges and problems of nuclear safety supervision. This thesis focused on the relationship between nuclear safety culture and nuclear safety supervision, they are essential differences, but there is a close relationship. Nuclear safety supervision needs to introduce some concepts of nuclear safety culture, lays emphasis on humanistic care and improves its level and efficiency. Nuclear safety supervision authorities must strengthen nuclear safety culture training, conduct the development of nuclear safety culture, make sure that nuclear safety culture can play significant roles. (author)

  20. The Arabidopsis Nuclear Pore and Nuclear Envelope

    OpenAIRE

    Meier, Iris; Brkljacic, Jelena

    2010-01-01

    The nuclear envelope is a double membrane structure that separates the eukaryotic cytoplasm from the nucleoplasm. The nuclear pores embedded in the nuclear envelope are the sole gateways for macromolecular trafficking in and out of the nucleus. The nuclear pore complexes assembled at the nuclear pores are large protein conglomerates composed of multiple units of about 30 different nucleoporins. Proteins and RNAs traffic through the nuclear pore complexes, enabled by the interacting activities...

  1. The nuclear controversy

    International Nuclear Information System (INIS)

    Walske, C.; Dobkin, R.A.

    1984-01-01

    The article deals with the nuclear controversy, especially in the United States. To a certain extent the nuclear debate has become heavily politicised. Public opinion and anti-nuclear groups are mentioned as well as nuclear disarmament

  2. Institute for Nuclear Research and Nuclear Energy and Nuclear Science

    International Nuclear Information System (INIS)

    Stamenov, J.

    2004-01-01

    The Institute for Nuclear Research and Nuclear Energy (INRNE) of the Bulgarian Academy of Sciences is the leading Bulgarian Institute for scientific investigations and applications of nuclear science. The main Institute's activities in the field of elementary particles and nuclear physics, high energy physics and nuclear energy, radiochemistry, radioecology, radioactive wastes treatment, monitoring of the environment, nuclear instruments development ect. are briefly described. Several examples for: environmental radiation monitoring; monitoring of the radioactivity and heavy metals in aerosols, 99m Tc clinical use, Boron Neutron Capture Therapy application of IRT-2000 Research Reactor, neutron fluence for reactor vessel embrittlement, NPP safety analysis, nuclear fuel modelling are also presented

  3. EL2-related defects in neutron irradiated GaAs1/sub -x/P/sub x/ alloys

    International Nuclear Information System (INIS)

    Munoz, E.; Garcia, F.; Jimenez, B.; Calleja, E.; Gomez, A.; Alcober, V.

    1985-01-01

    The generation of EL2-related defects in GaAsP alloys by fast neutron irradiation has been studied through deep level transient spectroscopy and photocapacitance techniques. After irradiation p-n junctions were not annealed at high temperatures. In the composition range x>0.4, fast neutrons generate a broad center at E/sub c/-0.7 eV that it is suggested to belong to the EL2 family. The presence of photocapacitance quenching effects has been taken as a preliminary fingerprint to make the above assignment. From computer analysis of the nonexponential transient capacitance waveforms, evidence that neutron irradiation creates a family of midgap levels, EL2-related, is found

  4. Nuclear power without nuclear weapons

    International Nuclear Information System (INIS)

    Kaiser, K.; Klein, F.J.

    1982-01-01

    In this study leading experts summarize the work of a working group meeting during several years, and they represent the state of the art of the international discussion about the non-proliferation of nuclear weapons. The technical basis of proliferation, the relations between energy policy and nuclear energy, as well as the development of the non-proliferation system up to the present are thoroughly studied. Special attention is paid to the further development of the instruments of the non-proliferation policy, and approaches and ways to improving the control of the fuel cycle, e.g. by means of multinational methods or by improving the control requirements are analyzed. Also the field of positive inducements and negative sanctions to prevent the proliferation as well as the question of ensured supply are elucidated in detail. A further section then analyzes the functions of the international organizations active in this field and the nuclear policy of the most important western industrial nations, the RGW-states and the threshold countries of the Third World. This volume pays special attention to the nuclear policy of the Federal Republic of Germany and to the possibilities and necessities of a further development of the non-proliferation policy. (orig.) [de

  5. Nuclear power of Korea

    International Nuclear Information System (INIS)

    Chun Bee-Ho

    2011-01-01

    National nuclear is presented. Nuclear energy safety after Fukushima, international cooperation in nuclear energy is discussed. Nuclear projects with the United Arab Emirates have been developed to build 4 nuclear power plants in the UAE - APR 1400. At the Korea-Bulgaria Industrial Committee Meeting in Sofia (March 2011) Korean side proposed Nuclear Safety Training Program in Korea for Bulgarian government officials and experts transfer of know-how and profound expertise on world-class nuclear technology and nuclear safety

  6. Nuclear power plants

    International Nuclear Information System (INIS)

    1985-01-01

    Data concerning the existing nuclear power plants in the world are presented. The data was retrieved from the SIEN (Nuclear and Energetic Information System) data bank. The information are organized in table forms as follows: nuclear plants, its status and type; installed nuclear power plants by country; nuclear power plants under construction by country; planned nuclear power plants by country; cancelled nuclear power plants by country; shut-down nuclear power plants by country. (E.G.) [pt

  7. Nuclear energy and the nuclear industry

    International Nuclear Information System (INIS)

    1979-01-01

    These notes have been prepared by the Department of Energy to provide information and to answer questions often raised about nuclear energy and the nuclear industry and in the hope that they will contribute to the public debate about the future of nuclear energy in the UK. The subject is dealt with under the headings; contribution of nuclear power, energy forecasts, nuclear fuels and reactor types, cost, thermal reactor strategy, planning margin, safety, nuclear licensing, unlike an atomic bomb, radiation, waste disposal, transport of nuclear materials, emergency arrangements at nuclear sites, siting of nuclear stations, security of nuclear installations, world nuclear programmes, international regulation and non-proliferation, IAEA safeguards arrangements in the UK, INFCE, and uranium supplies. (U.K.)

  8. Nuclear astrophysics: An application of nuclear physics

    International Nuclear Information System (INIS)

    Fueloep, Z.

    2005-01-01

    Nuclear astrophysics, a fruitful combination of nuclear physics and astrophysics can be viewed as a special application of nuclear physics where the study of nuclei and their reactions are motivated by astrophysical problems. Nuclear astrophysics is also a good example for the state of the art interdisciplinary research. The origin of elements studied by geologists is explored by astrophysicists using nuclear reaction rates provided by the nuclear physics community. Due to the high interest in the field two recent Nuclear Physics Divisional Conferences of the European Physical Society were devoted to nuclear astrophysics and a new conference series entitled 'Nuclear Physics in Astrophysics' has been established. Selected problems of nuclear astrophysics will be presented emphasizing the interplay between nuclear physics and astrophysics. As an example the role of 14 N(p,r) 15 O reaction rate in the determination of the age of globular clusters will be discussed in details

  9. I wonder nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Cheol

    2009-04-15

    This book consists seven chapters, which are powerful nuclear energy, principle of nuclear fission, nuclear energy in our daily life, is nuclear energy safe?, what is radiation?, radiation spread in pur daily life and radiation like a spy. It adds nuclear energy story through quiz. This book with pictures is for kids to explain nuclear energy easily.

  10. Nuclear insurance

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The yearbook contains among others the figures of the nuclear insurance line. According to these these the DKVG (German nuclear power plant insurance association) has 102 member insurance companies all registered in the Federal Republic of Germany. By using reinsurance capacities of the other pools at present property insurance amounts to 1.5 billion DM and liability insurance to 200 million DM. In 1991 the damage charges on account of DKV amounted to 3.1 (1990 : 4.3) million DM. From these 0.6 million DM are apportioned to payments and 2.5 million DM to reserves. One large damage would cost a maximum gross sum of 2.2 billion DM property and liability insurance; on account of DKVG 750 million DM. (orig./HSCH) [de

  11. Nuclear power

    Energy Technology Data Exchange (ETDEWEB)

    Hodgson, P.

    1985-01-01

    The question 'Do we really need nuclear power' is tackled within the context of Christian beliefs. First, an estimate is made of the energy requirements in the future and whether it can be got in conventional ways. The dangers of all the ways of supplying energy (eg coal mining, oil and gas production) are considered scientifically. Also the cost of each source and its environmental effects are debated. The consequences of developing a new energy source, as well as the consequences of not developing it, are considered. Decisions must also take into account a belief about the ultimate purpose of life, the relation of men to each other and to nature. Each issue is raised and questions for discussion are posed. On the whole the book comes down in favour of nuclear power.

  12. Nuclear reactor

    International Nuclear Information System (INIS)

    Sasaki, Tomozo.

    1987-01-01

    Purpose: To improve the nuclear reactor availability by enabling to continuously exchange fuels in the natural-slightly enriched uranium region during operation. Constitution: A control rod is withdrawn to the midway of a highly enriched uranium region by means of control rod drives and the highly enriched uranium region is burnt to maintain the nuclear reactor always at a critical state. At the same time, fresh uranium-slightly enriched uranium is continuously supplied gravitationally from a fresh fuel reservoir through fuel reservoir to each of fuel pipes in the natural-slightly enriched uranium region. Then, spent fuels reduced with the reactivity by the burn up are successively taken out from the bottom of each of the fuel pipes through an exit duct and a solenoid valve to the inside of a spent fuel reservoir and the burn up in the natural-slightly enriched uranium region is conducted continuously. (Kawakami, Y.)

  13. Nuclear reactors

    International Nuclear Information System (INIS)

    Barre, Bertrand

    2015-10-01

    After some remarks on the nuclear fuel, on the chain reaction control, on fuel loading and unloading, this article proposes descriptions of the design, principles and operations of different types of nuclear reactors as well as comments on their presence and use in different countries: pressurized water reactors (design of the primary and secondary circuits, volume and chemistry control, backup injection circuits), boiling water reactors, heavy water reactors, graphite and boiling water reactors, graphite-gas reactors, fast breeder reactors, and fourth generation reactors (definition, fast breeding). For these last ones, six concepts are presented: sodium-cooled fast reactor, lead-cooled fast reactor, gas-cooled fast reactor, high temperature gas-cooled reactor, supercritical water-cooled reactor, and molten salt reactor

  14. Nuclear waste

    International Nuclear Information System (INIS)

    1991-01-01

    The Privacy Act of 1974 restricts both the type of information on private individuals that federal agencies may maintain in their records and the conditions under which such information may be disclosed. The Nuclear Regulatory Commission, which must approve DOE plans to build a nuclear waste repository at the Yucca Mountain site in Nevada, requires a quality assurance program to guarantee that studies of the site are done by qualified employees. Under such a program, the training and qualifications of DOE and contractor employees would be verified. This report reviews DOE's efforts to identify and resolve the implications of the Privacy Act for DOE's quality assurance program and how the delay in resolving Privacy Act issues may have affected preliminary work on the Yucca Mountain project

  15. Nuclear physics

    International Nuclear Information System (INIS)

    Warner, D.D.; Aitken, T.W.; Rowley, N.

    1989-01-01

    The many diverse programmes of fundamental research and technical development at the Daresbury Nuclear Structure Facility (NSF) have continued at their usual hectic pace throughout the period 1988/89. An overview of the overall programme and of the Facility has been presented in the first volume of this report, along with an expanded discussion of some of the highlights of the year's work. This second volume presents the more technical and detailed reports on the progress and results of individuals proposals and hence will be of most interest to the more expert reader. The reports are grouped in terms of experimental studies aimed at probing the structure of individual nuclei or series of nuclei, studies devoted to probing the primary nuclear reaction mechanism itself, theoretical work and research devoted to the development of the accelerator, and experimental equipment/techniques. Overall, they provide a concise summary of the year's work at the NSF. (author)

  16. Nuclear safeguards

    International Nuclear Information System (INIS)

    Estrampres, J.

    2010-01-01

    Close cooperation with the Ministry of Industry with representation from the UNESA Safeguards Group, has meant that, after almost two years of intense meetings and negotiations, Spain has a specific plant to plant agreement for the application of Safeguards under this new method. This is an agreement which aims to be a benchmark for all other EU countries, as the IAEA tends to apply a generic agreement that, in many cases, majority interferes in the nuclear power plants own processes. (Author).

  17. Nuclear structure

    International Nuclear Information System (INIS)

    Joy, T.; Price, H.G.

    1984-01-01

    The appendix to the Daresbury Annual report contains detailed summaries of experiments carried out, or in progress, for the period 1983/84, using the Nuclear Structure Facility tandem accelerator. The experimental work is carried out by University groups from the UK and abroad, and Daresbury Staff. Developments in instrumentation, and a report on the first year of scheduled operation of the Facility, are also given. (U.K.)

  18. Nuclear terrorism

    International Nuclear Information System (INIS)

    Watson, C.

    2005-01-01

    This article is aimed at those professional scientists and engineers who believe that issues of international peace and security are too important to be left to the politicians. Nuclear Terrorism is a hostile act (or a threat of such an act) involving nuclear materials (fissile or radioactive) performed by a terrorist, a term which covers a wide range of individuals. What they all have in common is that, for some reason they have become motivated to hurt or destroy sections of society which they have come to regard as the enemy; their motivation varies enormously. They also vary enormously in the extent and nature of their technical/scientific education. There are 'PhD terrorists' and 'Peasant terrorists', and they differ greatly in the threat that they represent, and the steps which can appropriately be taken to counter it. The most serious threat comes from the potential ability of terrorists to steal or manufacture nuclear weapons of mass destruction (e.g. capable of causing thousands of deaths). Unless the underlying causes of terrorism can be quickly removed, we have a duty to mankind to make terrorist access to such weapons, and to the nuclear materials which are their essential ingredients, as difficult as possible. Improvements in the arrangements for denying unauthorised access to radioactive material should be made such that the protective measures made are proportionate to the number of Curies at risk and the likelihood of a terrorist initiative. The preventative measures, sadly, need to take account of the possibility that the terrorist will use lethal force to access the material. (author)

  19. Nuclear medicine

    International Nuclear Information System (INIS)

    Casier, Ph.; Lepage, B.

    1998-01-01

    Except for dedicated devices for mobile nuclear cardiology for instance, the market is set on variable angulation dual heads cameras. These cameras are suited for all general applications and their cost effectiveness is optimized. Now, all major companies have such a camera in their of products. But, the big question in nuclear medicine is about the future of coincidence imaging for the monitoring of treatments in oncology. Many companies are focused on WIP assessments to find out the right crustal thickness to perform both high energy FDG procedures and low energy Tc procedures, with the same SPECT camera. The classic thickness is 3/8''. Assessments are made with 1/2'', 5/8'' or 3/4'' crystals. If FDG procedures proved to be of great interest in oncology, it may lead to the design of a dedicated SPECT camera with a 1'' crustal. Due to the short half of FDG, it may be the dawning of slip ring technology. (e.g. Varicam from Elscint). The three small heads camera market seems to be depressed. Will the new three large heads camera unveiled by Picker, reverse that trend? The last important topic in nuclear medicine is the emergence of new flat digital detectors to get rid of the old bulky ones. Digirad is the first company to manufacture a commercial product based on that technology. Bichron, Siemens and General Electric are working on that development, too. But that technology is very expensive and the market for digital detection in nuclear medicine is not as large as the market in digital detection in radiology. (author)

  20. Nuclear transport

    International Nuclear Information System (INIS)

    Anon.

    2002-01-01

    During September and October 2001, 1 event has been reported and classified at the first level of the INES scale. This incident concerns the violation of the European regulation that imposes to any driver of radioactive matter of being the holder of a certificate asserting that he attended a special training. During this period, 13 in-site inspections have been made in places related to nuclear transport. (A.C.)

  1. Nuclear stethoscope

    Energy Technology Data Exchange (ETDEWEB)

    Shen, W.F.; Singer, I.; Hackworthy, R.A.; Morris, J.; Kelly, D.T. (Royal Prince Alfred Hospital, Camperdown (Australia))

    1983-05-14

    A portable, computerized nuclear probe designed to measure left ventricular function is described. The ejection fraction was reproducible and correlated well with that obtained by means of a gamma camera. The limitations of the machine are that it measures the global, rather than the segmental, function of the left ventricle and, when discrete large areas of regional dysfunction occur, the global ejection fraction may be overestimated. An advantage is that continuous beat-to-beat measurements are easily performed and displayed.

  2. Nuclear shelters

    International Nuclear Information System (INIS)

    Prendergast, L.; Prendergast, P.; Prendergast, E.J.; Prendergast, L.J.

    1982-01-01

    An underground nuclear shelter, fabricated from a series of transverse metal hoop frames connected by longitudinal metal members and plates, is described. The shelter chamber has two hatches in the roof each with a shaft fitted with a shield cover. One shaft houses an air inlet and filter, the other is used for access. Two or more shelter units can be linked. (U.K.)

  3. Nuclear decommissioning

    Energy Technology Data Exchange (ETDEWEB)

    Lawton, H.

    1987-02-01

    Sufficient work has now been done, on a world-wide basis, to justify confidence that full decommissioning of nuclear installations, both plant and reactors, can be carried out safely and efficiently. Projects in several countries should confirm this in the next few years. In the UK, good progress has been made with the WAGR and supporting development work is finding solutions to resolve uncertainties. Estimates from several sources suggest that decommissioning costs can be kept to an acceptable level.

  4. Nuclear decommissioning

    International Nuclear Information System (INIS)

    Lawton, H.

    1987-01-01

    Sufficient work has now been done, on a world-wide basis, to justify confidence that full decommissioning of nuclear installations, both plant and reactors, can be carried out safely and efficiently. Projects in several countries should confirm this in the next few years. In the UK, good progress has been made with the WAGR and supporting development work is finding solutions to resolve uncertainties. Estimates from several sources suggest that decommissioning costs can be kept to an acceptable level. (author)

  5. Nuclear reactors

    International Nuclear Information System (INIS)

    Humphreys, P.; Davidson, D.F.; Thatcher, G.

    1980-01-01

    The cooling system of a liquid metal cooled fast breeder nuclear reactor of the pool kind is described. It has an intermediate heat exchange module comprising a tube-in-shell heat exchanger and an electromagnetic flow coupler in the base region of the module. Primary coolant is flowed through the heat exchanger being driven by electromagnetic interaction with secondary liquid metal coolant flow effected by a mechanical pump. (author)

  6. Nuclear reactor

    International Nuclear Information System (INIS)

    Batheja, P.; Huber, R.; Rau, P.

    1985-01-01

    Particularly for nuclear reactors of small output, the reactor pressure vessel contains at least two heat exchangers, which have coolant flowing through them in a circuit through the reactor core. The circuit of at least one heat exchanger is controlled by a slide valve, so that even for low drive forces, particularly in natural circulation, the required even loading of the heat exchanger is possible. (orig./HP) [de

  7. Nuclear therapy

    International Nuclear Information System (INIS)

    Roux, Henry

    1977-01-01

    Having first recalled the biological action of ionizing radiations, the main problems relating to the therapeutical use of radioelements were analyzed. Stressing the good results recorded with this method for the treatment of some diseases, the present limits were also defined, stating however that the progress made in biochemistry in the direction of metabolism, combined with the progress made in nuclear medicine, still allows some hope [fr

  8. Nuclear Britain

    Energy Technology Data Exchange (ETDEWEB)

    Bunyard, P

    1981-01-01

    The subject is dealt with in chapters, entitled: (preface) the new resistance; (1) the weapons connection; (2) the AGR - a bungled programme; (3) reactor choice - a fearful dilemma; (4) the deadly atom (uranium - mining, processing, enrichment of U-235, political and international aspects); (5) the fast reactor - how safe; (6) radiation risk and cancer; (7) atomic waste - the industry's Achilles Heel; (8) accidents - the ever-present threat; (9) the growing opposition; (10) the nuclear state.

  9. Nuclear decisions

    International Nuclear Information System (INIS)

    Dunster, H.J.; Farmer, F.R.; Gaines, M.J.

    1979-01-01

    In the Correspondence section of this issue of Nature three letters are published each of which has a bearing on the article by P. Taylor in the issue of 22 February. In that article Taylor calls for changes in the way decisions are taken on nuclear energy matters. The three articles are by H.J. Dunster of the UKAEA Health and Safety Executive, F.R. Farmer, Safety Adviser to the UKAEA, and M.J. Gaines, National Radiological Protection Board. (UK)

  10. Nuclear energy

    International Nuclear Information System (INIS)

    1978-01-01

    2 1/2 years ago a consultation group was formed to help the Section for Social Questions of the Council of Churches in the Netherlands, to answer questions in the area of nuclear energy. During this time the character of the questions has changed considerably. In the beginning people spoke of fear and anxiety over the plans for the application of this new technical development but later this fear and anxiety turned to protest and opposition. This brochure has been produced to enlighten people and try and answer their alarm, by exploring the many facets of the problems. Some of these problems are already being deeply discussed by the public, others play no role in the forming of public opinion. The points of view of the churches over nuclear energy are not expressed, the brochure endeavours to express that nuclear energy problems are a concern for the churches. Technical and economic information and the most important social questions are discussed. (C.F.)

  11. Nuclear medicine

    International Nuclear Information System (INIS)

    James, A.E. Jr.; Squire, L.F.

    1977-01-01

    The book presents a number of fundamental imaging principles in nuclear medicine. The fact that low radiation doses are sufficient for the study of normal and changed physiological functions of the body is an important advancement brought about by nuclear medicine. The possibility of quantitative investigations of organs and organ regions and of an assessment of their function as compared to normal values is a fascinating new diagnostic dimension. The possibility of comparing the findings with other pathological findings and of course control in the same patient lead to a dynamic continuity with many research possibilities not even recognized until now. The limits of nuclear scanning methods are presented by the imprecise structural information of the images. When scintiscans are compared with X-ray images or contrast angiography, the great difference in the imaging of anatomical details is clearly seen. But although the present pictures are not optimal, they are a great improvement on the pictures that were considered clinically valuable a few years ago. (orig./AJ) [de

  12. Nuclear physics

    International Nuclear Information System (INIS)

    Dacre, J.

    1990-01-01

    This book fills a gap in current literature by covering the increasing nuclear physics content of various A-level syllabuses. In section 1 we outline the background and early development of the subject, in section 2 we deal with nuclear properties and theories at a level suitable for the pre-university student. The majority of topics have been treated with the limited use of mathematics, this necessitating some simplification which we hope to have accomplished without undue error. A few topics have been developed mathematically, to some extent, e.g. series decay. While it is the purpose of a book at this level to introduce the reader to the facts and theories of nuclear physics, we have to recognise that any teacher of science, at any level, must attempt to instill in the young scientist a sense of responsibility and an understanding of the problems attendant on the technological applications are important. These problems have been touched on in the text but we hope the student will be persuaded to read further; for this purpose we have added a short list of suggested additional reading. A selection of A-level past paper questions has been included. (author)

  13. Nuclear facilities

    International Nuclear Information System (INIS)

    Anon.

    2002-01-01

    During September and October 2001, 15 events were recorded on the first grade and 1 on the second grade of the INES scale. The second grade event is in fact a re-classification of an incident that occurred on the second april 2001 at Dampierre power plant. This event happened during core refueling, a shift in the operation sequence led to the wrong positioning of 113 assemblies. A preliminary study of this event shows that this wrong positioning could have led, in other circumstances, to the ignition of nuclear reactions. Even in that case, the analysis made by EDF shows that the consequences on the staff would have been limited. Nevertheless a further study has shown that the existing measuring instruments could not have detected the power increase announcing the beginning of the chain reaction. The investigation has shown that there were deficiencies in the control of the successive operations involved in refueling. EDF has proposed a series of corrective measures to be implemented in all nuclear power plants. The other 15 events are described in the article. During this period 121 inspections have been made in nuclear facilities. (A.C.)

  14. Nuclear fuels

    International Nuclear Information System (INIS)

    2008-01-01

    The nuclear fuel is one of the key component of a nuclear reactor. Inside it, the fission reactions of heavy atoms, uranium and plutonium, take place. It is located in the core of the reactor, but also in the core of the whole nuclear system. Its design and properties influence the behaviour, the efficiency and the safety of the reactor. Even if it represents a weak share of the generated electricity cost, its proper use represents an important economic stake. Important improvements remain to be made to increase its residence time inside the reactor, to supply more energy, and to improve its robustness. Beyond the economical and safety considerations, strategical questions have to find an answer, like the use of plutonium, the management of resources and the management of nuclear wastes and real technological challenges have to be taken up. This monograph summarizes the existing knowledge about the nuclear fuel, its behaviour inside the reactor, its limits of use, and its R and D tracks. It illustrates also the researches in progress and presents some key results obtained recently. Content: 1 - Introduction; 2 - The fuel of water-cooled reactors: aspect, fabrication, behaviour of UO 2 and MOX fuels inside the reactor, behaviour in loss of tightness situation, microscopic morphology of fuel ceramics and evolution under irradiation - migration and localisation of fission products in UOX and MOX matrices, modeling of fuels behaviour - modeling of defects and fission products in the UO 2 ceramics by ab initio calculations, cladding and assembly materials, pellet-cladding interaction, advanced UO 2 and MOX ceramics, mechanical behaviour of the fuel assembly, fuel during a loss of coolant accident, fuel during a reactivity accident, fuel during a serious accident, fuel management inside reactor cores, fuel cycle materials balance, long-term behaviour of the spent fuel, fuel of boiling water reactors; 3 - the fuel of liquid metal fast reactors: fast neutrons radiation

  15. The nuclear arsenals and nuclear disarmament.

    Science.gov (United States)

    Barnaby, F

    1998-01-01

    Current world stockpiles of nuclear weapons and the status of treaties for nuclear disarmament and the ultimate elimination of nuclear weapons are summarised. The need for including stockpiles of civil plutonium in a programme for ending production and disposing of fissile materials is emphasized, and the ultimate difficulty of disposing of the last few nuclear weapons discussed.

  16. Nuclear power and the nuclear fuel cycle

    International Nuclear Information System (INIS)

    Hardy, C.J.; Silver, J.M.

    1985-09-01

    The report provides data and assessments of the status and prospects of nuclear power and the nuclear fuel cycle. The report discusses the economic competitiveness of nuclear electricity generation, the extent of world uranium resources, production and requirements, uranium conversion and enrichment, fuel fabrication, spent fuel treatment and radioactive waste management. A review is given of the status of nuclear fusion research

  17. Nuclear power economic database

    International Nuclear Information System (INIS)

    Ding Xiaoming; Li Lin; Zhao Shiping

    1996-01-01

    Nuclear power economic database (NPEDB), based on ORACLE V6.0, consists of three parts, i.e., economic data base of nuclear power station, economic data base of nuclear fuel cycle and economic database of nuclear power planning and nuclear environment. Economic database of nuclear power station includes data of general economics, technique, capital cost and benefit, etc. Economic database of nuclear fuel cycle includes data of technique and nuclear fuel price. Economic database of nuclear power planning and nuclear environment includes data of energy history, forecast, energy balance, electric power and energy facilities

  18. Nuclear danger and nuclear history

    International Nuclear Information System (INIS)

    Howard, M.

    1988-01-01

    This article makes a review of the books Danger and Survival: Choices about the Bomb in the First Fifty Years written by McGeorge Bundy, and War and Peace in the Nuclear Age written by John Newhouse. A history of political decisions on weapon development is given, along with a what if analysis of other options. The lesson of these two books is that it has proved considerably easier to live with nuclear weapons and the Soviet Union than anyone expected forty years ago. It is all the easier if arms control issues, based on worst case analyses, are kept in their place, which is firmly in the background of the overall conduct of foreign policy

  19. Nuclear Law: A Key Against Nuclear Terrorism

    International Nuclear Information System (INIS)

    Cardozo, P.

    2004-01-01

    The role of the legal instruments in the war against nuclear terrorism. Control of radioactive sources. Elements of Nuclear Law: Definition: it is the body of special legislation that regulates the pacific uses of nuclear energy and the conduct of the persons engaged in activities related to fissionable materials and ionizing radiation . Objective: to provide a legal framework in order to protect individuals , property and the environment against the harmful effects of the use of nuclear energy and ionising radiation. Principles of nuclear energy legislation: safety principle, exclusively operator responsibility, authorization, independence of the regulatory body, inspections and enforcement, nuclear damage compensation, international cooperation. National regulatory infrastructure. Establishment of special law in Emergency Preparedness for nuclear or radiological disaster. IAEA Conventions. Transportation of nuclear material. IAEA regulations on radioactive material. Compensation for nuclear damage. Nuclear safety, security and terrorism. International and domestic instruments. Anti terrorism acts. International agreements on Safety Cooperation. (Author)

  20. Nuclear tele medicine; Telemedicina nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Vargas, L.; Hernandez, F.; Fernandez, R. [Departamento de Medicina Nuclear, Imagenologia Diagnostica, Xalapa, Veracruz (Mexico)

    2005-07-01

    The great majority of the digital images of nuclear medicine are susceptible of being sent through internet. This has allowed that the work in diagnosis cabinets by image it can benefit of this modern technology. We have presented in previous congresses works related with tele medicine, however, due to the speed in the evolution of the computer programs and the internet, becomes necessary to make a current position in this modality of work. (Author)

  1. Applications of nuclear physics

    Science.gov (United States)

    Hayes, A. C.

    2017-02-01

    Today the applications of nuclear physics span a very broad range of topics and fields. This review discusses a number of aspects of these applications, including selected topics and concepts in nuclear reactor physics, nuclear fusion, nuclear non-proliferation, nuclear-geophysics, and nuclear medicine. The review begins with a historic summary of the early years in applied nuclear physics, with an emphasis on the huge developments that took place around the time of World War II, and that underlie the physics involved in designs of nuclear explosions, controlled nuclear energy, and nuclear fusion. The review then moves to focus on modern applications of these concepts, including the basic concepts and diagnostics developed for the forensics of nuclear explosions, the nuclear diagnostics at the National Ignition Facility, nuclear reactor safeguards, and the detection of nuclear material production and trafficking. The review also summarizes recent developments in nuclear geophysics and nuclear medicine. The nuclear geophysics areas discussed include geo-chronology, nuclear logging for industry, the Oklo reactor, and geo-neutrinos. The section on nuclear medicine summarizes the critical advances in nuclear imaging, including PET and SPECT imaging, targeted radionuclide therapy, and the nuclear physics of medical isotope production. Each subfield discussed requires a review article unto itself, which is not the intention of the current review; rather, the current review is intended for readers who wish to get a broad understanding of applied nuclear physics.

  2. Applications of nuclear physics

    International Nuclear Information System (INIS)

    Hayes-Sterbenz, Anna Catherine

    2017-01-01

    Today the applications of nuclear physics span a very broad range of topics and fields. This review discusses a number of aspects of these applications, including selected topics and concepts in nuclear reactor physics, nuclear fusion, nuclear non-proliferation, nuclear-geophysics, and nuclear medicine. The review begins with a historic summary of the early years in applied nuclear physics, with an emphasis on the huge developments that took place around the time of World War II, and that underlie the physics involved in designs of nuclear explosions, controlled nuclear energy, and nuclear fusion. The review then moves to focus on modern applications of these concepts, including the basic concepts and diagnostics developed for the forensics of nuclear explosions, the nuclear diagnostics at the National Ignition Facility, nuclear reactor safeguards, and the detection of nuclear material production and trafficking. The review also summarizes recent developments in nuclear geophysics and nuclear medicine. The nuclear geophysics areas discussed include geo-chronology, nuclear logging for industry, the Oklo reactor, and geo-neutrinos. The section on nuclear medicine summarizes the critical advances in nuclear imaging, including PET and SPECT imaging, targeted radionuclide therapy, and the nuclear physics of medical isotope production. Lastly, each subfield discussed requires a review article unto itself, which is not the intention of the current review; rather, the current review is intended for readers who wish to get a broad understanding of applied nuclear physics.

  3. Repair of rabbit radial bone defects using true bone ceramics combined with BMP-2-related peptide and type I collagen

    International Nuclear Information System (INIS)

    Li Jingfeng; Lin Zhenyu; Zheng Qixin; Guo Xiaodong; Lan Shenghui; Liu Sunan; Yang Shuhua

    2010-01-01

    An ideal bone graft material is the one characterized with good biocompatibility, biodegradation, osteoconductivity and osteoinductivity. In this study, a novel synthetic BMP-2-related peptide (designated P24) corresponding to residues of the knuckle epitope of BMP-2 was introduced into a biomimetic scaffold based on sintered bovine bone or true bone ceramics (TBC) and type I collagen (TBC/collagen I) using a simulated body fluid (SBF). Hydroxylapatite crystal mineralization with a Ca/P molar ratio of 1.63 was observed on the surface of P24/TBC/collagen I composite by scanning electron microscopy (SEM), energy dispersive X-ray spectroscopy (EDX) and X-ray diffraction (XRD) techniques. Cell adhesion rate evaluation of bone marrow stromal cells (BMSCs) seeded on materials in vitro showed that the percentage of cells attached to P24/TBC/collagen I composite was significantly higher than that of the TBC/collagen I composite. A 10 mm unilateral segmental bone defect was created in the radius of New Zealand white rabbits and randomly implanted with three groups of biomaterials (Group A: P24/TBC/collagen I composite; Group B: TBC/collagen I composite and Group C: TBC alone). Based on radiographic evaluation and histological examination, the implants of P24/TBC/collagen I composite significantly stimulated bone growth, thereby confirming the enhanced rate of bone healing compared with that of TBC/collagen I composite and TBC alone. It was concluded that BMP-2-related peptide P24 could induce nucleation of calcium phosphate crystals on the surface of TBC/collagen I composite. The TBC/collagen I composite loaded with the synthetic BMP-2-related peptide is a promising scaffold biomaterial for bone tissue engineering.

  4. Glossary of nuclear energy

    International Nuclear Information System (INIS)

    Seo, Du Hwan

    1987-01-01

    This book gives descriptions of explanations of terminologies concerning to nuclear energy such as analysis of financial safety of nuclear energy, radwaste disposal, fast breeder reactor, nuclear reactor and device, nuclear fuel and technique for concentration, using of nuclear energy radiation and measurement, plan for development of nuclear energy and international institution. This book includes 160 terms on nuclear energy and arranges in Korean alphabetical order.

  5. Nuclear energy - some aspects

    International Nuclear Information System (INIS)

    Bandeira, Fausto de Paula Menezes

    2005-05-01

    This work presents a brief history of research and development concerning to nuclear technology worldwide and in Brazil, also information about radiations and radioactive elements as well; the nuclear technology applications; nuclear reactor types and functioning of thermonuclear power plants; the number of existing nuclear power plants; the nuclear hazards occurred; the national fiscalization of nuclear sector; the Brazilian legislation in effect and the propositions under proceduring at House of Representatives related to the nuclear energy

  6. Nuclear Installations Act 1965

    International Nuclear Information System (INIS)

    1965-01-01

    This Act governs all activities related to nuclear installations in the United Kingdom. It provides for the licensing procedure for nuclear installations, the duties of licensees, the competent authorities and carriers of nuclear material in respect of nuclear occurrences, as well as for the system of third party liability and compensation for nuclear damage. The Act repeals the Nuclear Installations (Licensing and Insurance) Act 1959 and the Nuclear Installations (Amendment Act) 1965 except for its Section 17(2). (NEA) [fr

  7. Applications of Nuclear Physics

    OpenAIRE

    Hayes, Anna C.

    2017-01-01

    Today the applications of nuclear physics span a very broad range of topics and fields. This review discusses a number of aspects of these applications, including selected topics and concepts in nuclear reactor physics, nuclear fusion, nuclear non-proliferation, nuclear-geophysics, and nuclear medicine. The review begins with a historic summary of the early years in applied nuclear physics, with an emphasis on the huge developments that took place around the time of World War II, and that und...

  8. Nuclear emergencies

    International Nuclear Information System (INIS)

    1991-01-01

    This leaflet, which is in the form of a fold-up chart, has panels of text which summarize the emergencies that could arise and the countermeasures and emergency plans that have been prepared should nuclear accident occur or affect the United Kingdom. The levels of radiation doses at which various measures would be introduced are outlined. The detection and monitoring programmes that would operate is illustrated. The role of NRPB and the responsible government departments are set out together with an explanation of how the National Arrangements for Incidents involving Radioactivity would be coordinated. (UK)

  9. Nuclear reactor

    International Nuclear Information System (INIS)

    Scholz, M.

    1976-01-01

    An improvement of the accessibility of that part of a nuclear reactor serving for biological shield is proposed. It is intended to provide within the biological shield, distributed around the circumference of the reactor pressure vessel, several shielding chambers filled with shielding material, which are isolated gastight from the outside by means of glass panes with a given bursting strength. It is advantageous that, on the one hand, inspection and maintenance will be possible without great effort and, on the other, a large relief cross section will be at desposal if required. (UWI) [de

  10. Nuclear recycling

    International Nuclear Information System (INIS)

    Spinrad, B.I.

    1985-01-01

    This paper discusses two aspects of the economics of recycling nuclear fuel: the actual costs and savings of the recycling operation in terms of money spent, made, and saved; and the impact of the recycling on the future cost of uranium. The authors review the relevant physical and chemical processes involved in the recycling process. Recovery of uranium and plutonium is discussed. Fuel recycling in LWRs is examined and a table presents the costs of reprocessing and not reprocessing. The subject of plutonium in fast reactors is addressed. Safeguards and weapons proliferation are discussed

  11. Nuclear power

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The Single Channel Trip System for the Dungeness B AGRs in the United Kingdom has enabled Nuclear Electric to enhance the performance of each of the twin reactors progressively towards the design figure of 660MW. The unique self-testing dynamic nature of the microprocessor-based ISAT system was one of the key factors in satisfying the UK Regulator that the system met the demanding requirements of the Dungeness B application, and current operational and maintenance experience is very encouraging. Systems based on the ISAT principle have application in reactor protection systems throughout the world. (Author)

  12. Nuclear stethoscope

    Energy Technology Data Exchange (ETDEWEB)

    Inagaki, Yoshiaki; Saito, Toshihiro; Shimizu, Masahiko (Chiba Univ. (Japan). School of Medicine)

    1983-06-01

    The nuclear stethoscope consisting of radiocardiography and data processing by a microcomputer was introduced with respect to its outline, reliability and clinical application. Ejection fractions (EF) obtained by this device showed a satisfactory correlation with values obtained by the cardiac pool multigate (MUGA) method using a scinticamera and minicomputer, with a slight tendency to overestimation. They showed a good correlation with left ventriculography, accompanied by a slight tendency to underestimation. The reproducibility of this device was also satisfactory. Clinically, EF values during exercise in ischemic heart disease were well correlated with those obtained by the MUGA method. This device permitted real time evaluation of left ventricular function and was highly reliable.

  13. Nuclear stethoscope

    International Nuclear Information System (INIS)

    Inagaki, Yoshiaki; Saito, Toshihiro; Shimizu, Masahiko

    1983-01-01

    The nuclear stethoscope consisting of radiocardiography and data processing by a microcomputer was introduced with respect to its outline, reliability and clinical application. Ejection fractions (EF) obtained by this device showed a satisfactory correlation with values obtained by the cardiac pool multigate (MUGA) method using a scinticamera and minicomputer, with a slight tendency to overestimation. They showed a good correlation with left ventriculography, accompanied by a slight tendency to underestimation. The reproducibility of this device was also satisfactory. Clinically, EF values during exercise in ischemic heart disease were well correlated with those obtained by the MUGA method. This device permitted real time evaluation of left ventricular function and was highly reliable. (Chiba, N.)

  14. Nuclear reactor

    International Nuclear Information System (INIS)

    Rau, P.

    1980-01-01

    The reactor core of nuclear reactors usually is composed of individual elongated fuel elements that may be vertically arranged and through which coolant flows in axial direction, preferably from bottom to top. With their lower end the fuel elements gear in an opening of a lower support grid forming part of the core structure. According to the invention a locking is provided there, part of which is a control element that is movable along the fuel element axis. The corresponding locking element is engaged behind a lateral projection in the opening of the support grid. The invention is particularly suitable for breeder or converter reactors. (orig.) [de

  15. Nuclear sound

    International Nuclear Information System (INIS)

    Wambach, J.

    1991-01-01

    Nuclei, like more familiar mechanical systems, undergo simple vibrational motion. Among these vibrations, sound modes are of particular interest since they reveal important information on the effective interactions among the constituents and, through extrapolation, on the bulk behaviour of nuclear and neutron matter. Sound wave propagation in nuclei shows strong quantum effects familiar from other quantum systems. Microscopic theory suggests that the restoring forces are caused by the complex structure of the many-Fermion wavefunction and, in some cases, have no classical analogue. The damping of the vibrational amplitude is strongly influenced by phase coherence among the particles participating in the motion. (author)

  16. Nuclear decommissioning

    International Nuclear Information System (INIS)

    Lawton, H.

    1987-01-01

    Sufficient work has now been done, on a world-wide basis, to justify confidence that full decommissioning of nuclear installations, both plant and reactors, can be carried out safely and efficiently. Projects in several countries should confirm this in the next few years. In the United Kingdom, good progress has been made with the Windscale Advanced Gas-cooled Reactor and supporting development work is finding solutions to resolve uncertainties. Estimates from several sources suggest that decommissioning costs can be kept to an acceptable level. (author)

  17. Nuclear dualism.

    Science.gov (United States)

    Karrer, Kathleen M

    2012-01-01

    Nuclear dualism is a characteristic feature of the ciliated protozoa. Tetrahymena have two different nuclei in each cell. The larger, polyploid, somatic macronucleus (MAC) is the site of transcriptional activity in the vegetatively growing cell. The smaller, diploid micronucleus (MIC) is transcriptionally inactive in vegetative cells, but is transcriptionally active in mating cells and responsible for the genetic continuity during sexual reproduction. Although the MICs and MACs develop from mitotic products of a common progenitor and reside in a common cytoplasm, they are different from one another in almost every respect. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Nuclear waste

    International Nuclear Information System (INIS)

    England-Joseph, J.

    1991-03-01

    This paper discusses the Department of Energy's (DOE) procedures for annually assessing the adequacy of the fee that utilities pay for disposal of spent (used) nuclear fuel. In a June 1990 report, it was recommended, among other things, that the Congress authorize DOE to automatically adjust the fee each year on the basis of an inflation index. At that time, DOE also favored fee indexing; however, it subsequently reversed its position. Because of this change, it is now believe that Congress should require DOE to index the fee to the rate of inflation

  19. Nuclear reactor

    International Nuclear Information System (INIS)

    Anthony, A.J.; Gruber, E.A.

    1979-01-01

    A nuclear reactor with control rods in channels between fuel assemblies wherein the fuel assemblies incorporate guide rods which protrude outwardly into the control rod channels to prevent the control rods from engaging the fuel elements. The guide rods also extend back into the fuel assembly such that they are relatively rigid members. The guide rods are tied to the fuel assembly end or support plates and serve as structural members which are supported independently of the fuel element. Fuel element spacing and support means may be attached to the guide rods. 9 claims

  20. Anti-oxidative stress regulator NF-E2-related factor 2 mediates the adaptive induction of antioxidant and detoxifying enzymes by lipid peroxidation metabolite 4-hydroxynonenal

    Directory of Open Access Journals (Sweden)

    Huang Ying

    2012-11-01

    Full Text Available Abstract Background NF-E2-related factor 2 (NRF2 regulates a battery of antioxidative and phase II drug metabolizing/detoxifying genes through binding to the antioxidant response elements (ARE. NRF2-ARE signaling plays a central role in protecting cells from a wide spectrum of reactive toxic species including reactive oxygen/nitrogen species (RONS. 4-hydroxylnonenal (4-HNE is a major end product from lipid peroxidation of omega-6 polyunsaturated fatty acids (PUFA induced by oxidative stress, and it is highly reactive to nucleophilic sites in DNA and proteins, causing cytotoxicity and genotoxicity. In this study, we examined the role of NRF2 in regulating the 4-HNE induced gene expression of antioxidant and detoxifying enzymes. Results When HeLa cells were treated with 4-HNE, NRF2 rapidly transloated into the nucleus, as determined by the distribution of NRF2 tagged with the enhanced green fluorescent protein (EGFP and increased NRF2 protein in the nuclear fraction. Transcriptional activity of ARE-luciferase was significantly induced by 0.01-10 μM of 4-HNE in a dose-dependent manner, and the induction could be blocked by pretreatment with glutathione (GSH. 4-HNE induced transcriptional expression of glutathione S-transferase (GST A4, aldoketone reductase (AKR 1C1 and heme oxygenase-1 (HO-1, and the induction was attenuated by knocking down NRF2 using small interfering RNA. Conclusions NRF2 is critical in mediating 4-HNE induced expression of antioxidant and detoxifying genes. This may account for one of the major cellular defense mechanisms against reactive metabolites of lipids peroxidation induced by oxidative stress and protect cells from cytotoxicity.

  1. Nuclear cardiology

    International Nuclear Information System (INIS)

    Vos, P.H.

    1982-01-01

    This thesis deals with two topics in nuclear cardiology. In the first, left ventricular wall motion assessment using Fourier transform of local left ventricular time-activity curves in gated blood pool studies is evaluated. In the second, the interpretation of myocardial perfusion scintigrams is assessed which are obtained with thallium-201 or with another radiopharmaceutical with different physical, but identical biological properties. In all these investigations data acquisition and analysis by computer played an essential role. In chapter 1 the desirable properties of a nuclear medicine computer system are given and the computer system used for this work is described. Wall motion analysis of the left ventricle using Fourier transform of local time-activity curves in the left ventricular region in gated blood pool studies is described in chapter 2. In chapter 3 detection of non-perfused lesions in myocardial perfusion scintigraphy with thallium-201 is described. Detection of partly perfused lesions and the influence of scatter and photon energy on myocardial perfusion scintigraphy is described in chapter 4. (Auth.)

  2. Nuclear reactors

    International Nuclear Information System (INIS)

    Pearson, K.G.

    1977-01-01

    Reference is made to auxiliary means of cooling the nuclear fuel clusters used in light or heavy water cooled nuclear reactors. One method is to provide one or more spray cooling tubes. From holes in the side walls of those tubes coolant water may be sprayed laterally into the cluster against the rods. The flow of main coolant may thus be supplemented or even replaced by the auxiliary coolant. A difficulty, however, is that only those fuel rods close to a spray cooling tube can readily be reached by the auxiliary coolant. In the arrangement described, where the fuel rods are spaced apart by transverse grids, at least one of the interspaces between the grids is provided with an axially extending auxiliary coolant conduit having lateral holes through which an auxiliary coolant is sprayed into the cluster. A deflector is provided that extends from a transverse grid into a position in front of the holes and deflects auxiliary coolant on to parts of the fuel rods otherwise inaccessible to the auxiliary coolant. The construction of the deflector is described. (U.K.)

  3. Nuclear reactors

    International Nuclear Information System (INIS)

    Matheson, J.E.

    1983-01-01

    A nuclear reactor has an upper and a lower grid plate. Protrusions project from the upper grid plate. Fuel assemblies having end fittings fit between the grid plates. An arrangement is provided for accepting axial forces generated during the operation of the nuclear reactor by the flow of the cooling medium and thermal expansion and irradiation-induced growth of the fuel assembly, which comprises rods. Each fuel assembly rests on the lower grid plate and its upper end is elastically supported against the upper grid plate by the above-mentioned arrangement. The arrangement comprises four (for example) torsion springs each having a torsion tube and a torsion bar nested within the torsion tube and connected at one end thereto. The other end of the torsion bar is connected to an associated one of four lever arms. The torsion tube is rigidly connected to the other end fitting and the springs are disposed such that the lever arms are biassed against the protrusions. (author)

  4. Efficacy of nuclear forensics

    International Nuclear Information System (INIS)

    Kazi, Reshmi

    2011-01-01

    In a strange turn of history, the threat of global nuclear war has gone down, but the risk of a nuclear attack has gone up. The danger of nuclear terrorism and ways to thwart it, tackle it and manage it in the event of an attack is increasingly gaining the attention of nuclear analysts all over the world. There is rising awareness among nuclear experts to develop mechanisms to prevent, deter and deal with the threat of nuclear terrorism. Nuclear specialists are seeking to develop and improve the science of nuclear forensics so as to provide faster analysis during a crisis. Nuclear forensics can play an important role in detecting illicit nuclear materials to counter trafficking in nuclear and radiological materials. An effective nuclear forensic and attribution strategy can enable policy makers, decision makers and technical managers to respond to situations involving interception of special nuclear materials

  5. On China's Nuclear Doctrine

    Directory of Open Access Journals (Sweden)

    Xia Liping

    2015-12-01

    Full Text Available Nuclear weapons have played an important role in China's national strategy. China’s nuclear doctrine has a very strong continuity. Nevertheless, China has made readjustments in its nuclear doctrine according to the changes of its internal and external situation and its general strategic threat perception. China’s nuclear doctrine has experienced a process of evolution from anti-nuclear blackmail to minimum deterrence. There are five major parts in China's nuclear doctrine: policy of declaration, nuclear development, nuclear deployment, nuclear employment, and nuclear disarmament. Because China is faced with a different situation from other nuclear powers and has its own strategic culture, China has a nuclear doctrine with its own characteristics. China’s nuclear doctrine has been affiliated with and has served the national development strategy, national security strategy, national defense policy and military strategy of China.

  6. Reconversion of nuclear weapons

    CERN Document Server

    Kapitza, Sergei P

    1992-01-01

    The nuclear predicament or nuclear option. Synopsis of three lectures : 1- The physical basis of nuclear technology. Physics of fission. Chain reaction in reactors and weapons. Fission fragments. Separration of isotopes. Radiochemistry.2- Nuclear reactors with slow and fast neutrons. Power, size, fuel and waste. Plutonium production. Dose rate, shielding and health hazard. The lessons of Chernobyl3- Nuclear weapons. Types, energy, blast and fallout. Fusion and hydrogen bombs. What to do with nuclear weapons when you cannot use them? Testing. Nonmilittary use. Can we get rid of the nuclear weapon? Nuclear proliferation. Is there a nuclear future?

  7. Nuclear power in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Hagen, Ronald E.

    1998-08-01

    Contains Executive Summary and Chapters on: Nuclear Energy in the Asian context; Types of nuclear power reactors used in Asia; A survey of nuclear power by country; The economics of nuclear power; Fuels, fuel cycles and reprocessing; Environmental issues and waste disposal; The weapons issues and nuclear power; Conclusions. (Author)

  8. Fundamentals of nuclear physics

    International Nuclear Information System (INIS)

    Jelley, N.A.

    1990-01-01

    The book is aimed at undergraduates in their final year, to give the student a thorough understanding of the principal features of nuclei, nuclear decays and nuclear reactions. Several models are described and used to explain nuclear properties with many illustrative examples. Sections follow on α-, β- and γ-decay, fission, thermonuclear fusion, reactions, nuclear forces and nuclear collective motion. (author)

  9. Nuclear energy basic knowledge

    International Nuclear Information System (INIS)

    Volkmer, Martin

    2013-11-01

    The following topics are dealt with: Atoms, nuclear decays and radioactivity, energy, nuclear fission and the chain reaction, controlled nuclear fission, nuclear power plants, safety installations in nuclear power plants, fuel supply and disposal, radiation measurement and radiation exposition of man. (HSI)

  10. The nuclear dilemma

    International Nuclear Information System (INIS)

    Mason, Colin.

    1983-01-01

    This paper discusses nuclear war, disarmament and national defence policies. The author argues that in spite of the obvious advantages of nuclear power in many parts of the world, the world cannot afford the risk of continuing with it because of the demonstrated close and deadly association of nuclear power and nuclear reactors with nuclear weapons

  11. Nuclear energy data

    International Nuclear Information System (INIS)

    1990-01-01

    Nuclear Energy Data is the OECD Nuclear Energy Agency's annual compilation of basic statistics on electricity generation and nuclear power in OECD countries. The reader will find quick and easy reference to the present status of and projected trends in total electricity generating capacity, nuclear generating capacity, and actual electricity production as well as on supply and demand for nuclear fuel cycle services [fr

  12. Nuclear safety and nuclear insurance

    International Nuclear Information System (INIS)

    Abramovitz, A.

    1983-01-01

    To an extent, public opinion is against Koeberg, inspite of the fact that Escom, Koeberg's prospective licensee, are liable for damages caused in the event of an accident, that they carry public liability insurance bought in the market place to the maximum of ten million rand, and if that is not enough the government will take over responsibility for the rest. A question is put that if this kind of protection carries on, won't there always be a minority of the public who will find nuclear power socially, psychologically and politically unacceptable

  13. Nuclear war nuclear proliferation and their consequences

    International Nuclear Information System (INIS)

    Aga Khan, Sadruddin

    1986-01-01

    The paper concerns the proceedings of a conference hosted by the Groupe de Bellerive to explore and discuss the implications for humanity of nuclear war, nuclear proliferation and their consequences, Geneva 1985. The conference was divided into five sessions, headed by the subject titles: the nuclear non-proliferation treaty (NPT) and its future, the spread of nuclear weapons among nations, global effects of a nuclear war, the nuclear arms race and arms control, the NPT and its future. Twenty eight papers were presented in the five sessions. (UK)

  14. Nuclear dewatering

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    The Sizewell 'B' Nuclear Power Station, the first in a new family of PWR (Pressurised Water Reactor) stations in the UK, is currently under construction on the Suffolk coast. One of the first civil engineering tasks associated with the power station construction was the necessity to lower the water table by 17-18 m over an area of approximately 8 hectares to allow the excavation for the foundations to be carried out in the dry. The way chosen to do this was to construct a diaphragm wall around the site area. This had the least effect on surrounding sites -the Sizewell-A station and various nature reserves and wetlands. The reasons for the choice of method are discussed. Following the construction of the wall the water was pumped out from within the diaphragm wall in January 1988. (author)

  15. Nuclear prophecy

    International Nuclear Information System (INIS)

    Michaelis, A.R.

    1981-01-01

    It is shown that there are at least four instances known of reasonably accurate forecasts of the benefits and dangers of nuclear energy. H.G. Wells' atomic bomb of 1914, A.W. Stewart's chain reaction of 1923, Olaf Stapeldon's mushroom cloud of 1930 and Hans Dominik's tactical atomic weapon of 1927 are briefly reviewed as well as a forecast of the Three Mile island accident. These examples show that although the trained imagination of writers can approach the truth none can claim accuracy in predicting the facts. Where they do approach the truth is in the prediction of the consequences of the discoveries, social as well as military, of unlimited energy and of unlimited disasters. (U.K.)

  16. Nuclear waste

    International Nuclear Information System (INIS)

    1989-10-01

    The Department of Energy is awarding grants to the state of Nevada for the state's participation in DOE's program to investigate Yucca Mountain as a possible site for the disposal of civilian nuclear waste. This report has found that DOE's financial assistance budget request of $15 million for Nevada's fiscal year 1990 was not based on the amount the state requested but rather was derived by increasing Nevada's grant funds from the previous year in proportion to the increase that DOE requested for its own activities at the Nevada site. DOE's evaluations of Nevada's requests are performed too late to be used in DOE's budget formulation process because Nevada has been applying for financial assistance at about the same time that DOE submits its budget request to Congress

  17. Nuclear reactors

    International Nuclear Information System (INIS)

    Prescott, R.F.

    1976-01-01

    A nuclear reactor containment vessel faced internally with a metal liner is provided with thermal insulation for the liner, comprising one or more layers of compressible material such as ceramic fiber, such as would be conventional in an advanced gas-cooled reactor and also a superposed layer of ceramic bricks or tiles in combination with retention means therefor, the retention means (comprising studs projecting from the liner, and bolts or nuts in threaded engagement with the studs) being themselves insulated from the vessel interior so that the coolant temperatures achieved in a High-Temperature Reactor or a Fast Reactor can be tolerated with the vessel. The layer(s) of compressible material is held under a degree of compression either by the ceramic bricks or tiles themselves or by cover plates held on the studs, in which case the bricks or tiles are preferably bedded on a yielding layer (for example of carbon fibers) rather than directly on the cover plates

  18. Nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Prescott, R F; George, B V; Baglin, C J

    1978-05-10

    Reference is made to thermal insulation on the inner surfaces of containment vessels of fluid cooled nuclear reactors and particularly in situations where the thermal insulation must also serve a structural function and transmit substantial load forces to the surface which it covers. An arrangement is described that meets this requirement and also provides for core support means that favourably influences the flow of hot coolant from the lower end of the core into a plenum space in the hearth of the reactor. The arrangement comprises a course of thermally insulating bricks arranged as a mosaic covering a wall of the reactor and a course of thermally insulating tiles arranged as a mosaic covering the course of bricks. Full constructional details are given.

  19. Nuclear energy

    International Nuclear Information System (INIS)

    Anon.

    1994-01-01

    The Administrative Court of Braunschweig judges the Ordinance on Advance Funding of Repositories (EndlagervorausleistungsVO) to be void. The Hannover Regional Court passes a basic judgment concerning the Gorleben salt mine (repository) and an action for damages. The Federal Administrative Court dismisses actions against part-permits for the Hanau fuel element fabrication plant. The Koblenz Higher Administrative Court dismisses actions against a part-permit for the Muelheim-Kaerlich reactor. 31st Amendment of the German Criminal Code passed, involving amendments in environmental criminal code, defined in the 2nd amendment to the Act on Unlowful Practices Causing Damage to the Environment (UKG); here: Amendments to the law relating to the criminal code and penal provisions governing unlawful conduct in the operation of nuclear installations. (orig.) [de

  20. Nuclear waste

    International Nuclear Information System (INIS)

    1989-01-01

    This paper reviews the Department of Energy's management of underground single-shell waste storage tanks at its Hanford, Washington, site. The tanks contain highly radioactive and nonradioactive hazardous liquid and solid wastes from nuclear materials production. Hundreds of thousands of gallons of these wastes have leaked, contaminating the soil, and a small amount of leaked waste has reached the groundwater. DOE does not collect sufficient data to adequately trace the migration of the leaks through the soil, and studies predicting the eventual environmental impact of tank leaks do not provide convincing support for DOE's conclusion that the impact will be low or nonexistent. DOE can do more to minimize the environmental risks associated with leaks. To reduce the environmental impact of past leaks, DOE may be able to install better ground covering over the tanks to reduce the volume of precipitation that drains through the soil and carries contaminants toward groundwater

  1. Nuclear facilities

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    Here is given the decree (2000-1065) of the 25. of October 2000 reporting the publication of the convention between the Government of the French Republic and the CERN concerning the safety of the LHC (Large Hadron Collider) and the SPS (Proton Supersynchrotron) facilities, signed in Geneva on July 11, 2000. By this convention, the CERN undertakes to ensure the safety of the LHC and SPS facilities and those of the operations of the LEP decommissioning. The French legislation and regulations on basic nuclear facilities (concerning more particularly the protection against ionizing radiations, the protection of the environment and the safety of facilities) and those which could be decided later on apply to the LHC, SPS and auxiliary facilities. (O.M.)

  2. Nuclear reactors

    International Nuclear Information System (INIS)

    Prescott, R.F.; George, B.V.; Baglin, C.J.

    1978-01-01

    Reference is made to thermal insulation on the inner surfaces of containment vessels of fluid cooled nuclear reactors and particularly in situations where the thermal insulation must also serve a structural function and transmit substantial load forces to the surface which it covers. An arrangement is described that meets this requirement and also provides for core support means that favourably influences the flow of hot coolant from the lower end of the core into a plenum space in the hearth of the reactor. The arrangement comprises a course of thermally insulating bricks arranged as a mosaic covering a wall of the reactor and a course of thermally insulating tiles arranged as a mosaic covering the course of bricks. Full constructional details are given. (UK)

  3. Nuclear reactor

    International Nuclear Information System (INIS)

    Gibbons, J.F.; McLaughlin, D.J.

    1978-01-01

    In the pressure vessel of the water-cooled nuclear reactor there is provided an internal flange on which the one- or two-part core barrel is hanging by means of an external flange. A cylinder is extending from the reactor vessel closure downwards to a seat on the core cupport structure and serves as compression element for the transmission of the clamping load from the closure head to the core barrel (upper guide structure). With the core barrel, subject to tensile stress, between the vessel internal flange and its seat on one hand and the compression of the cylinder resp. hold-down element between the closure head and the seat on the other a very strong, elastic sprung structure is obtained. (DG) [de

  4. Nuclear reactor

    International Nuclear Information System (INIS)

    Miyashita, Akio.

    1981-01-01

    Purpose: To facilitate and accelerate a leakage test of valves of a main steam pipe by adding a leakage test partition valve thereto. Constitution: A leakage testing partition valve is provided between a pressure vessel for a nuclear reactor and the most upstream side valve of a plurality of valves to be tested for leakage, a testing branch pipe is communicated with the downstream side of the partition valve, and the testing water for preventing leakage is introduced thereto through the branch pipe. Since main steam pipe can be simply isolated by closing the partition valve in the leakage test, the leakage test can be conducted without raising or lowering the water level in the pressure vessel, and since interference with other work in the reactor can be eliminated, the leakage test can be readily conducted parallel with other work in the reactor in a short time. Clean water can be used without using reactor water as the test water. (Yoshihara, H.)

  5. Nuclear reactor

    International Nuclear Information System (INIS)

    Aleite, W.; Bock, H.W.; Struensee, S.

    1976-01-01

    The invention concerns the use of burnable poisons in a nuclear reactor, especially in PWRs, in order to improve the controllability of the reactor. An unsymmetrical arrangement in the lattice is provided, if necessary also by insertion of special rods for these additions. It is proposed to arrange the burnable poisons in fuel elements taken over from a previous burn-up cycle and to distribute them, going out from the side facing the control rods, over not more than 20% of the lenth of the fuel elements. It seems sufficient, for the burnable poisons to bind an initial reactivity of only 0.1% and to become ineffective after normal operation of 3 to 4 months. (ORU) [de

  6. Nuclear reactor

    International Nuclear Information System (INIS)

    Schweiger, F.; Glahe, E.

    1976-01-01

    In a nuclear reactor of the kind which is charged with spherical reaction elements and in which control rods are arranged to be thrust directly into the charge, each control rod has at least one screw thread on its external surface so that as the rod is thrust into the charge it is caused to rotate and thus make penetration easier. The length of each control rod may have two distinct portions, a latter portion which carries a screw thread and a lead-in portion which is shorter than the latter portion and which may carry a thread of greater pitch than that on the latter portion or may have a number of axially extending ribs instead of a thread

  7. Nuclear cardiology

    Energy Technology Data Exchange (ETDEWEB)

    Cuaron, A

    1993-12-31

    Today, nuclear medicine techniques are routinely used in cardiological practice. They include procedures for the atraumatic investigation of different physiological processes in the various structures included in the central circulation: pericardium, myocardium, myocardial adrenergic innervation, cardiac chambers and valves, coronary microcirculation, and great vessels. Beside these in-Vivo procedures, they also comprise of in-Vitro methods for the detection and measurement in blood of various biological molecules of significance in the management of cardiac diseases. A common feature in this collection of in-Vivo and in-Vitro techniques is their ability to provide helpful clinical information for the diagnosis, prognosis and management of cardiac diseases. Their simplicity and safety for the patient allow their repeated use in the follow up of the progress of disease and in the assessment of the efficacy of the therapeutic measures 15 figs, 14 tabs

  8. NUCLEAR REACTOR

    Science.gov (United States)

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  9. Nuclear cardiology

    International Nuclear Information System (INIS)

    Cuaron, A.

    1992-01-01

    Today, nuclear medicine techniques are routinely used in cardiological practice. They include procedures for the atraumatic investigation of different physiological processes in the various structures included in the central circulation: pericardium, myocardium, myocardial adrenergic innervation, cardiac chambers and valves, coronary microcirculation, and great vessels. Beside these in-Vivo procedures, they also comprise of in-Vitro methods for the detection and measurement in blood of various biological molecules of significance in the management of cardiac diseases. A common feature in this collection of in-Vivo and in-Vitro techniques is their ability to provide helpful clinical information for the diagnosis, prognosis and management of cardiac diseases. Their simplicity and safety for the patient allow their repeated use in the follow up of the progress of disease and in the assessment of the efficacy of the therapeutic measures

  10. Nuclear waste

    International Nuclear Information System (INIS)

    1988-01-01

    As required by the Nuclear Waste Policy Act of 1982, the Department of Energy is to annually determine whether the waste disposal fee will produce sufficient revenues to offset the total estimated costs of the waste disposal program. In its June 1987 assessment, DOE recommended that the fee remain unchanged even though its analysis showed that at an inflation rate of 4 percent the current fee would result in end-of-program deficits ranging from $21 billion to $76 billion in 2085. The 1988 assessment calls for reduced total costs because of program changes. Thus, DOE may be able to begin using a realistic inflation rate in determining fee adequacy in 1988 without proposing a major fee increase

  11. Nuclear reactor

    International Nuclear Information System (INIS)

    Tilliette, Z.

    1975-01-01

    A description is given of a nuclear reactor and especially a high-temperature reactor in which provision is made within a pressure vessel for a main cavity containing the reactor core and a series of vertical cylindrical pods arranged in spaced relation around the main cavity and each adapted to communicate with the cavity through two collector ducts or headers for the primary fluid which flows downwards through the reactor core. Each pod contains two superposed steam-generator and circulator sets disposed in substantially symmetrical relation on each side of the hot primary-fluid header which conveys the primary fluid from the reactor cavity to the pod, the circulators of both sets being mounted respectively at the bottom and top ends of the pod

  12. Nuclear waste

    International Nuclear Information System (INIS)

    1990-01-01

    Each year, nuclear power plants, businesses, hospitals, and universities generate more than 1 million cubic feet of hardware, rags, paper, liquid waste, and protective clothing that have been contaminated with radioactivity. While most of this waste has been disposed of in facilities in Nevada, South Carolina, and Washington state, recent legislation made the states responsible - either individually, or through groups of states called compacts - for developing new disposal facilities. This paper discusses the states' progress and problems in meeting facility development milestones in the law, federal and state efforts to resolve issues related to mixed waste (low-level waste that also contains hazardous chemicals) and waste with very low levels of radioactivity, and the Department of Energy's progress in discharging the federal government's responsibility under the law to manage the most hazardous low-level waste

  13. Nuclear insurance

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The German Nuclear Power Plant Insurance (DKVG) Association was able to increase its net capacity in property insurance to 637 million marks in 1993 (1992: 589 million). The reinsurance capacity of the other pools included, the total amount covered now amounts to 2 billion marks in property incurance and 200 million marks in liability incurance. As in the year before the pool can reckon with a stable gross premium yield around 175 million marks. The revival of the US dollar has played a decisive role in this development. In 1993 in the domestic market, the DKVG offered policies for 22 types of property risk and 43 types to third-party risk, operating with a gross target premium of 65 million marks and 16 million marks, respectively. The DKVG also participated in 540 foreign insurance contracts. (orig./HSCH) [de

  14. Nuclear fuels

    International Nuclear Information System (INIS)

    Beauvy, M.; Berthoud, G.; Defranceschi, M.; Ducros, G.; Guerin, Y.; Limoge, Y.; Madic, Ch.; Santarini, G.; Seiler, J.M.; Sollogoub, P.; Vernaz, E.; Guillet, J.L.; Ballagny, A.; Bechade, J.L.; Bonin, B.; Brachet, J.Ch.; Delpech, M.; Dubois, S.; Ferry, C.; Freyss, M.; Gilbon, D.; Grouiller, J.P.; Iracane, D.; Lansiart, S.; Lemoine, P.; Lenain, R.; Marsault, Ph.; Michel, B.; Noirot, J.; Parrat, D.; Pelletier, M.; Perrais, Ch.; Phelip, M.; Pillon, S.; Poinssot, Ch.; Vallory, J.; Valot, C.; Pradel, Ph.; Bonin, B.; Bouquin, B.; Dozol, M.; Lecomte, M.; Vallee, A.; Bazile, F.; Parisot, J.F.; Finot, P.; Roberts, J.F.

    2009-01-01

    Fuel is one of the essential components in a reactor. It is within that fuel that nuclear reactions take place, i.e. fission of heavy atoms, uranium and plutonium. Fuel is at the core of the reactor, but equally at the core of the nuclear system as a whole. Fuel design and properties influence reactor behavior, performance, and safety. Even though it only accounts for a small part of the cost per kilowatt-hour of power provided by current nuclear power plants, good utilization of fuel is a major economic issue. Major advances have yet to be achieved, to ensure longer in-reactor dwell-time, thus enabling fuel to yield more energy; and improve ruggedness. Aside from economics, and safety, such strategic issues as use of plutonium, conservation of resources, and nuclear waste management have to be addressed, and true technological challenges arise. This Monograph surveys current knowledge regarding in-reactor behavior, operating limits, and avenues for R and D. It also provides illustrations of ongoing research work, setting out a few noteworthy results recently achieved. Content: 1 - Introduction; 2 - Water reactor fuel: What are the features of water reactor fuel? 9 (What is the purpose of a nuclear fuel?, Ceramic fuel, Fuel rods, PWR fuel assemblies, BWR fuel assemblies); Fabrication of water reactor fuels (Fabrication of UO 2 pellets, Fabrication of MOX (mixed uranium-plutonium oxide) pellets, Fabrication of claddings); In-reactor behavior of UO 2 and MOX fuels (Irradiation conditions during nominal operation, Heat generation, and removal, The processes involved at the start of irradiation, Fission gas behavior, Microstructural changes); Water reactor fuel behavior in loss of tightness conditions (Cladding, the first containment barrier, Causes of failure, Consequences of a failure); Microscopic morphology of fuel ceramic and its evolution under irradiation; Migration and localization of fission products in UOX and MOX matrices (The ceramic under irradiation

  15. Nuclear fuels

    Energy Technology Data Exchange (ETDEWEB)

    Beauvy, M.; Berthoud, G.; Defranceschi, M.; Ducros, G.; Guerin, Y.; Limoge, Y.; Madic, Ch.; Santarini, G.; Seiler, J.M.; Sollogoub, P.; Vernaz, E.; Guillet, J.L.; Ballagny, A.; Bechade, J.L.; Bonin, B.; Brachet, J.Ch.; Delpech, M.; Dubois, S.; Ferry, C.; Freyss, M.; Gilbon, D.; Grouiller, J.P.; Iracane, D.; Lansiart, S.; Lemoine, P.; Lenain, R.; Marsault, Ph.; Michel, B.; Noirot, J.; Parrat, D.; Pelletier, M.; Perrais, Ch.; Phelip, M.; Pillon, S.; Poinssot, Ch.; Vallory, J.; Valot, C.; Pradel, Ph.; Bonin, B.; Bouquin, B.; Dozol, M.; Lecomte, M.; Vallee, A.; Bazile, F.; Parisot, J.F.; Finot, P.; Roberts, J.F

    2009-07-01

    Fuel is one of the essential components in a reactor. It is within that fuel that nuclear reactions take place, i.e. fission of heavy atoms, uranium and plutonium. Fuel is at the core of the reactor, but equally at the core of the nuclear system as a whole. Fuel design and properties influence reactor behavior, performance, and safety. Even though it only accounts for a small part of the cost per kilowatt-hour of power provided by current nuclear power plants, good utilization of fuel is a major economic issue. Major advances have yet to be achieved, to ensure longer in-reactor dwell-time, thus enabling fuel to yield more energy; and improve ruggedness. Aside from economics, and safety, such strategic issues as use of plutonium, conservation of resources, and nuclear waste management have to be addressed, and true technological challenges arise. This Monograph surveys current knowledge regarding in-reactor behavior, operating limits, and avenues for R and D. It also provides illustrations of ongoing research work, setting out a few noteworthy results recently achieved. Content: 1 - Introduction; 2 - Water reactor fuel: What are the features of water reactor fuel? 9 (What is the purpose of a nuclear fuel?, Ceramic fuel, Fuel rods, PWR fuel assemblies, BWR fuel assemblies); Fabrication of water reactor fuels (Fabrication of UO{sub 2} pellets, Fabrication of MOX (mixed uranium-plutonium oxide) pellets, Fabrication of claddings); In-reactor behavior of UO{sub 2} and MOX fuels (Irradiation conditions during nominal operation, Heat generation, and removal, The processes involved at the start of irradiation, Fission gas behavior, Microstructural changes); Water reactor fuel behavior in loss of tightness conditions (Cladding, the first containment barrier, Causes of failure, Consequences of a failure); Microscopic morphology of fuel ceramic and its evolution under irradiation; Migration and localization of fission products in UOX and MOX matrices (The ceramic under

  16. A casein-kinase-2-related protein kinase is tightly associated with the large T antigen of simian virus 40

    DEFF Research Database (Denmark)

    Götz, C; Koenig, M G; Issinger, O G

    1995-01-01

    by the addition of protein kinase CK2 suggest that at least one of the T-antigen-associated protein kinases is CK2 or a protein-kinase-CK2-related enzyme. The association of recombinant CK2 with T antigen was strongly confirmed by in vitro binding studies. Experiments with temperature-sensitive SV40-transformed......The simian virus 40 (SV40) large T antigen is a multifunctional protein involved in SV40 cell transformation and lytic virus infection. Some of its activities are regulated by interaction with cellular proteins and/or by phosphorylation of T antigen by various protein kinases. In this study, we...... show that immuno-purified T antigen from SV40-transformed cells and from baculovirus-infected insect cells is tightly associated with a protein kinase that phosphorylates T antigen in vitro. In the presence of heparin or a peptide resembling a protein kinase CK2 recognition site, the phosphorylation...

  17. Mean nuclear volume

    DEFF Research Database (Denmark)

    Mogensen, O.; Sørensen, Flemming Brandt; Bichel, P.

    1999-01-01

    We evaluated the following nine parameters with respect to their prognostic value in females with endometrial cancer: four stereologic parameters [mean nuclear volume (MNV), nuclear volume fraction, nuclear index and mitotic index], the immunohistochemical expression of cancer antigen (CA125...

  18. Nuclear analytical chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Brune, D.; Forkman, B.; Persson, B.

    1984-01-01

    This book covers the general theories and techniques of nuclear chemical analysis, directed at applications in analytical chemistry, nuclear medicine, radiophysics, agriculture, environmental sciences, geological exploration, industrial process control, etc. The main principles of nuclear physics and nuclear detection on which the analysis is based are briefly outlined. An attempt is made to emphasise the fundamentals of activation analysis, detection and activation methods, as well as their applications. The book provides guidance in analytical chemistry, agriculture, environmental and biomedical sciences, etc. The contents include: the nuclear periodic system; nuclear decay; nuclear reactions; nuclear radiation sources; interaction of radiation with matter; principles of radiation detectors; nuclear electronics; statistical methods and spectral analysis; methods of radiation detection; neutron activation analysis; charged particle activation analysis; photon activation analysis; sample preparation and chemical separation; nuclear chemical analysis in biological and medical research; the use of nuclear chemical analysis in the field of criminology; nuclear chemical analysis in environmental sciences, geology and mineral exploration; and radiation protection.

  19. Children's (Pediatric) Nuclear Medicine

    Medline Plus

    Full Text Available ... interventions. Children's (pediatric) nuclear medicine refers to imaging examinations done in babies, young children and teenagers. Nuclear ... nuclear medicine procedure work? With ordinary x-ray examinations, an image is made by passing x-rays ...

  20. NATO's Nuclear Glue

    National Research Council Canada - National Science Library

    Horton, Scott T

    2007-01-01

    .... nuclear weapons prepositioned in Europe? This paper reviews the past and current role of US nuclear forces in NATO, considers future nuclear policy options, and discusses potential consequences of those decisions...

  1. Nuclear Heart Scan

    Science.gov (United States)

    ... Home / Nuclear Heart Scan Nuclear Heart Scan Also known as Nuclear Stress Test , ... Learn More Connect With Us Contact Us Directly Policies Privacy Policy Freedom of Information Act (FOIA) Accessibility ...

  2. Nuclear analytical chemistry

    International Nuclear Information System (INIS)

    Brune, D.; Forkman, B.; Persson, B.

    1984-01-01

    This book covers the general theories and techniques of nuclear chemical analysis, directed at applications in analytical chemistry, nuclear medicine, radiophysics, agriculture, environmental sciences, geological exploration, industrial process control, etc. The main principles of nuclear physics and nuclear detection on which the analysis is based are briefly outlined. An attempt is made to emphasise the fundamentals of activation analysis, detection and activation methods, as well as their applications. The book provides guidance in analytical chemistry, agriculture, environmental and biomedical sciences, etc. The contents include: the nuclear periodic system; nuclear decay; nuclear reactions; nuclear radiation sources; interaction of radiation with matter; principles of radiation detectors; nuclear electronics; statistical methods and spectral analysis; methods of radiation detection; neutron activation analysis; charged particle activation analysis; photon activation analysis; sample preparation and chemical separation; nuclear chemical analysis in biological and medical research; the use of nuclear chemical analysis in the field of criminology; nuclear chemical analysis in environmental sciences, geology and mineral exploration; and radiation protection

  3. Nuclear energy in Japan

    International Nuclear Information System (INIS)

    Guillemard, B.

    1978-01-01

    After having described the nuclear partners in Japan, the author analyzes the main aspects of Japan's nuclear energy: nuclear power plants construction program; developping of light water reactors; fuel cycle politics [fr

  4. Themes in nuclear law

    International Nuclear Information System (INIS)

    2003-01-01

    The nuclear law was analyzed during a workshop. The main aspects were: the law of population to access to information on nuclear energy and the relationship between the Regulator Organism and the nuclear power plants managers

  5. Essay about nuclear right

    International Nuclear Information System (INIS)

    Puig, D.

    1994-01-01

    The present essay treat about all Uruguaian Nuclear Energy legislation. Nuclear energy history, international treaties, agreements, national programs, nuclear government politics, radiation protection regulations, wastes, radioactive materials transport, environment and safeguards has been given in this compilation

  6. Nuclear experts and nuclear weapons proliferation

    International Nuclear Information System (INIS)

    Mueller, H.

    1979-01-01

    In Germany the issue of nuclear weapons proliferation has attracted scant attention. Most potential nuclear weapon states are important trade partners of the FRG and, since further proliferation of nuclear weapons could worsen conflicts involving these, it should be in the FRG's interest to limit proliferation. The security of the FRG is also dependent on the common interest of the great powers to avoid nuclear war. The contradictory positions of Usa and the USSR on nuclear weapons policy regarding themselves and non-nuclear weapon states encourages less developed countries to see nuclear weaponry as useful. The NPT and IAEA safeguards have only limited inhibiting effect. The nuclear export policy of the FRG has been dominated by short term economic advantage, neglecting the negative long term effects of decreased political stability. The FRG should formulate a policy based on self-restraint, positive stimuli and extension of controls, using its economic strength to deter proliferation. (JIW)

  7. Nuclear reaction data and nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Paver, N [University of Trieste (Italy); Herman, M [International Atomic Energy Agency, Vienna (Austria); Gandini, A [ENEA, Rome (Italy)

    2001-12-15

    These two volumes contain the lecture notes of the workshop 'Nuclear Reaction Data and Nuclear Reactors: Physics, Design and Safety', which was held at the Abdus Salam ICTP in the Spring of 2000. The workshop consisted of five weeks of lecture courses followed by practical computer exercises on nuclear data treatment and design of nuclear power systems. The spectrum of topics is wide enough to timely cover the state-of-the-art and the perspectives of this broad field. The first two weeks were devoted to nuclear reaction models and nuclear data evaluation. Nuclear data processing for applications to reactor calculations was the subject of the third week. On the last two weeks reactor physics and on-going projects in nuclear power generation, waste disposal and safety were presented.

  8. Nuclear Fuel Cycle & Vulnerabilities

    Energy Technology Data Exchange (ETDEWEB)

    Boyer, Brian D. [Los Alamos National Laboratory

    2012-06-18

    The objective of safeguards is the timely detection of diversion of significant quantities of nuclear material from peaceful nuclear activities to the manufacture of nuclear weapons or of other nuclear explosive devices or for purposes unknown, and deterrence of such diversion by the risk of early detection. The safeguards system should be designed to provide credible assurances that there has been no diversion of declared nuclear material and no undeclared nuclear material and activities.

  9. Nuclear energy data 2010

    CERN Document Server

    2010-01-01

    This 2010 edition of Nuclear Energy Data , the OECD Nuclear Energy Agency's annual compilation of official statistics and country reports on nuclear energy, provides key information on plans for new nuclear plant construction, nuclear fuel cycle developments as well as current and projected nuclear generating capacity to 2035 in OECD member countries. This comprehensive overview provides authoritative information for policy makers, experts and other interested stakeholders.

  10. The Iranian nuclear diplomacy

    International Nuclear Information System (INIS)

    Tabatabaei, Seyed Mohammad

    2008-01-01

    While assuming that civil nuclear means progress, and that military nuclear means danger, the author explains why Iran had decided to perform nuclear research and to implement electro-nuclear science, why Iran emphasises its willingness to develop uranium enrichment, what is the Iranian policy in terms of civil nuclear industry, why Iran does not want any shift of its nuclear programme towards military purposes

  11. Nuclear power and nuclear safety 2006

    International Nuclear Information System (INIS)

    Lauritzen, B.; Oelgaard, P.L.; Kampmann, D.; Majborn, B.; Nonboel, E.; Nystrup, P.E.

    2007-04-01

    The report is the fourth report in a series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe National Laboratory and the Danish Emergency Management Agency. The report for 2006 covers the following topics: status of nuclear power production, regional trends, reactor development and development of emergency management systems, safety related events of nuclear power, and international relations and conflicts. (LN)

  12. Nuclear Deterrence in a New Nuclear Era

    International Nuclear Information System (INIS)

    Miraillet, Michel

    2010-01-01

    Within an unstable international environment and an unpredictable future, nuclear weapons will continue to play a major role in defense policies. Indeed, since disarmament currently seems an unlikely objective, nuclear weapons remain as a security guarantee. Within this context, talk of the global abolition of nuclear weapons remains essentially rhetorical and the supposed link between disarmament and non-proliferation is a tenuous one. The foremost purpose of both disarmament and nuclear deterrence must be security

  13. Nuclear power and nuclear safety 2004

    International Nuclear Information System (INIS)

    2005-03-01

    The report is the second report in a new series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe National Laboratory and the Danish Emergency Management Agency. The report for 2004 covers the following topics: status of nuclear power production, regional trends, reactor development and development of emergency management systems, safety related events of nuclear power and international relations and conflicts. (ln)

  14. Nuclear power and nuclear safety 2005

    International Nuclear Information System (INIS)

    Lauritzen, B.; Oelgaard, P.L.; Kampman, D.; Majborn, B.; Nonboel, E.; Nystrup, P.E.

    2006-03-01

    The report is the third report in a series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe National Laboratory and the Danish Emergency Management Agency. The report for 2005 covers the following topics: status of nuclear power production, regional trends, reactor development and development of emergency management systems, safety related events of nuclear power and international relations and conflicts. (ln)

  15. Nuclear power and nuclear safety 2008

    International Nuclear Information System (INIS)

    Lauritzen, B.; Oelgaard, P.L.; Kampmann, D.

    2009-06-01

    The report is the fifth report in a series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe DTU and the Danish Emergency Management Agency. The report for 2008 covers the following topics: status of nuclear power production, regional trends, reactor development, safety related events of nuclear power, and international relations and conflicts. (LN)

  16. Nuclear standardization development study

    International Nuclear Information System (INIS)

    Pan Jianjun

    2010-01-01

    Nuclear industry is the important part of national security and national economic development is key area of national new energy supported by government. nuclear standardization is the important force for nuclear industry development, is the fundamental guarantee of nuclear safe production, is the valuable means of China's nuclear industry technology to the world market. Now nuclear standardization faces to the new development opportunity, nuclear standardization should implement strategy in standard system building, foreign standard research, company standard building, and talented people building to meet the requirement of nuclear industry development. (author)

  17. Nuclear safety and regulation

    International Nuclear Information System (INIS)

    Kim, Hho Jung

    2000-03-01

    This book contains 12 chapters, which are atom and radiation, nuclear reactor and kinds of nuclear power plant, safeguard actuation system and stability evaluation for rock foundation of nuclear power plant, nuclear safety and principle, safety analysis and classification of incident, probabilistic safety assessment and major incident, nuclear safety regulation, system of nuclear safety regulation, main function and subject of safety regulation in nuclear facilities, regulation of fuel cycle and a nuclear dump site, protection of radiation and, safety supervision and, safety supervision and measurement of environmental radioactivity.

  18. Nuclear weapons modernizations

    Energy Technology Data Exchange (ETDEWEB)

    Kristensen, Hans M. [Federation of American Scientists, Washington, DC (United States)

    2014-05-09

    This article reviews the nuclear weapons modernization programs underway in the world's nine nuclear weapons states. It concludes that despite significant reductions in overall weapons inventories since the end of the Cold War, the pace of reductions is slowing - four of the nuclear weapons states are even increasing their arsenals, and all the nuclear weapons states are busy modernizing their remaining arsenals in what appears to be a dynamic and counterproductive nuclear competition. The author questions whether perpetual modernization combined with no specific plan for the elimination of nuclear weapons is consistent with the nuclear Non-Proliferation Treaty and concludes that new limits on nuclear modernizations are needed.

  19. [Cyclotron based nuclear science

    International Nuclear Information System (INIS)

    1989-06-01

    This report contains papers on the following topics: Heavy ion reactors, nuclear structure and fundamental interactions; atomic and materials studies; nuclear theory; and superconducting cyclotron and instrumentation

  20. Nuclear energy data 2011

    CERN Document Server

    2011-01-01

     . Nuclear Energy Data, the OECD Nuclear Energy Agency's annual compilation of statistics and country reports on nuclear energy, contains official information provided by OECD member country governments on plans for new nuclear plant construction, nuclear fuel cycle developments as well as current and projected nuclear generating capacity to 2035. For the first time, it includes data for Chile, Estonia, Israel and Slovenia, which recently became OECD members. Key elements of this edition show a 2% increase in nuclear and total electricity production and a 0.5% increase in nuclear generating ca

  1. Sunken nuclear submarines

    International Nuclear Information System (INIS)

    Eriksen, V.O.

    1990-01-01

    The increasing number of accidents with nuclear submarines is a worriment to the general public. Five nuclear submarines are resting on the bottom of the North Atlantic. Design information on nuclear propulsion plants for submarines is classified. The author describes a potential generic nuclear submarine propulsion plant. Design information from the civilian nuclear industry, nuclear power plants, research reactors, nuclear cargo vessels and nuclear propelled icebreakers are used for illustration of relevant problems. A survey is given of nuclear submarines. Factors influencing the accident risks and safety characteristics of nuclear submarines are considered, and potential accident scenarios are described. The fission product content of the nuclear plant can be estimated, '' source terms'' can be guessed and potential release rates can be judged. The mechanisms of dispersion in the oceans is reviewed and compared with the dumping of radioactive waste in the Atlantic and other known releases. 46 refs., 49 figs., 14 tabs

  2. Nuclear energy. Economical aspects

    International Nuclear Information System (INIS)

    Legee, F.

    2010-01-01

    This document present 43 slides of a power point presentation containing detailed data on economical and cost data for nuclear energy and nuclear power plants: evolution from 1971 to 2007 of world total primary energy supply, development of nuclear energy in the world, nuclear power plants in the world in 2009, service life of nuclear power plants and its extension; nuclear energy market and perspectives at 2030, the EPR concept (generation III) and its perspectives at 2030 in the world; cost assessment (power generation cost, nuclear power generation cost, costs due to nuclear safety, comparison of investment costs for gas, coal and nuclear power generation, costs for building a nuclear reactor and general cost; cost for the entire fuel cycle, the case of the closed cycle with recycling (MOX); costs for radioactive waste storage; financial costs and other costs such as environmental impacts, strategic stocks, comparative evaluation of the competitiveness of nuclear versus coal and gas

  3. Nuclear knowledge management

    International Nuclear Information System (INIS)

    2007-01-01

    The management of nuclear knowledge has emerged as a growing challenge in recent years. The need to preserve and transfer nuclear knowledge is compounded by recent trends such as ageing of the nuclear workforce, declining student numbers in nuclear-related fields, and the threat of losing accumulated nuclear knowledge. Addressing these challenges, the IAEA promotes a 'knowledge management culture' through: - Providing guidance for policy formulation and implementation of nuclear knowledge management; - Strengthening the contribution of nuclear knowledge in solving development problems, based on needs and priorities of Member States; - Pooling, analysing and sharing nuclear information to facilitate knowledge creation and its utilization; - Implementing effective knowledge management systems; - Preserving and maintaining nuclear knowledge; - Securing sustainable human resources for the nuclear sector; and - Enhancing nuclear education and training

  4. Development of nuclear energy and nuclear policy in China

    International Nuclear Information System (INIS)

    You Deliang

    1993-11-01

    Status of nuclear power development in China, nuclear policy and nuclear power programme are described. Issues regarding nuclear fuel cycle system, radioactive waste management and international cooperation in the field of peaceful use of nuclear energy are discussed

  5. Nuclear regulation

    International Nuclear Information System (INIS)

    1990-04-01

    Because of an accidental release in 1986 of low-level waste stored at the Wright-Patterson Air Force Base, Ohio, several individuals inhaled small amounts of a radioactive substance. GAO examined the Nuclear Regulatory Commission's oversight of the Department of Defense's use, handling, and disposal of radioactive material and found that no comprehensive DOD waste disposal program exists and none of the three services knows the full extent of its low-level radioactive waste disposal problems. Throughout the 1980s, the Army and the Air Force had, on occasion, been banned from disposal sites for failing to comply with federal and state requirements. By December 1992, two of the three sites now used by DOD to disposed of waste will close, and only a limited number of new sites may be available for several years. In the interim, DID will pay substantial surcharges to dispose of waste. After January 1993, DOD will have to comply with disposal requirements for as many as 16 sites or store waste on-site pending the availability of new sites. This report discusses how GAO believes DOD needs to take full advantage of the time between now and January 1993 to establish a low-level radioactive waste disposal program. DOD also needs to work with other federal agencies, compacts, and states to determine the feasibility of dedicating a portion of one or more disposal sites for the government's use

  6. Nuclear fusion

    International Nuclear Information System (INIS)

    Huber, H.

    1978-01-01

    A comprehensive survey is presented of the present state of knowledge in nuclear fusion research. In the first part, potential thermonuclear reactions, basic energy balances of the plasma (Lawson criterion), and the main criteria to be observed in the selection of appropriate thermonuclear reactions are dealt with. This is followed by a discussion of the problems encountered in plasma physics (plasma confinement and heating, transport processes, plasma impurities, plasma instabilities and plasma diagnostics) and by a consideration of the materials problems involved, such as material of the first wall, fuel inlet and outlet, magnetic field generation, as well as repair work and in-service inspections. Two main methods have been developed to tackle these problems: reactor concepts using the magnetic pinch (stellarator, Tokamak, High-Beta reactors, mirror machines) on the one hand, and the other concept using the inertial confinement (laser fusion reactor). These two approaches and their specific problems as well as past, present and future fusion experiments are treated in detail. The last part of the work is devoted to safety and environmental aspects of the potential thermonuclear aspects of the potential thermonuclear reactor, discussing such problems as fusion-specific hazards, normal operation and potential hazards, reactor incidents, environmental pollution by thermal effluents, radiological pollution, radioactive wastes and their disposal, and siting problems. (orig./GG) [de

  7. Nuclear security

    International Nuclear Information System (INIS)

    1991-12-01

    This paper reports that despite their crucial importance to national security, safeguards at the Department of Energy's (DOE) weapons facilities may be falling short. DOE security inspections have identified many weaknesses, including poor performance by members of DOE's security force, poor accountability for quantities of nuclear materials, and the inability of personnel to locate documents containing classified information. About 13 percent of the 2,100 identified weakness resulted in DOE inspectors giving out unsatisfactory security ratings; another 38 percent led to marginal ratings. In addition, DOE's centralized safeguards and security information tracking system lacks current data on whether DOE field offices have corrected the identified weaknesses. Without reliable information, DOE has no way of knowing whether timely action was taken to correct problems, nor can it determine whether weaknesses are systematic. DOE has tried to minimize the impact of these security weaknesses at its facilities by establishing multiple layers of protection measures and instituting interim and compensatory measures for identified weaknesses. DOE is planning enhancements to the centralized tracking system that should improve its reliability and increase its effectiveness

  8. Nuclear reactors

    International Nuclear Information System (INIS)

    Prescott, R.F.; George, B.V.; Baglin, C.J.

    1979-01-01

    In a nuclear reactor (e.g. one having coolant down-flow through a core to a hearth below) thermal insulation (e.g. of a floor of the hearth) comprises a layer of bricks and a layer of tiles thereon, with smaller clearances between the tiles than between the bricks but with the bricks being of reduced cross-section immediately adjacent the tiles so as to be surrounded by interconnected passages, of relatively large dimensions, constituting a continuous chamber extending behind the layer of tiles. By this arrangement, lateral coolant flow in the inter-brick clearances is much reduced. The reactor core is preferably formed of hexagonal columns, supported on diamond-shaped plates each supported on a pillar resting on one of the hearth-floor tiles. Each plate has an internal duct, four upper channels connecting the duct with coolant ducts in four core columns supported by the plate, and lower channels connecting the duct to a downwardly-open recess common to three plates, grouped to form a hexagon, at their mutually-adjacent corners. This provides mixing, and temperature-averaging, of coolant from twelve columns

  9. Nuclear standards

    International Nuclear Information System (INIS)

    Fichtner, N.; Becker, K.; Bashir, M.

    1981-01-01

    This compilation of all nuclear standards available to the authors by mid 1980 represents the third, carefully revised edition of a catalogue which was first published in 1975 as EUR 5362. In this third edition several changes have been made. The title has been condensed. The information has again been carefully up-dated, covering all changes regarding status, withdrawal of old standards, new projects, amendments, revisions, splitting of standards into several parts, combination of several standards into one, etc., as available to the authors by mid 1980. The speed with which information travels varies and requires in many cases rather tedious and cumbersome inquiries. Also, the classification scheme has been revised with the goal of better adjustment to changing situations and priorities. Whenever it turned out to be difficult to attribute a standard to a single subject category, multiple listings in all relevant categories have been made. As in previous editions, within the subcategories the standards are arranged by organization (in Categorie 2.1 by country) alphabetically and in ascending numerical order. It covers all relevant areas of power reactors, the fuel cycle, radiation protection, etc., from the basic laws and governmental regulations, regulatory guides, etc., all the way to voluntary industrial standards and codes of pratice. (orig./HP)

  10. Nuclear stethoscope

    International Nuclear Information System (INIS)

    1976-01-01

    A built-up image illustrating heart activity within the cardiac cycle is produced by simultaneously displaying a plurality of memory channels which accumulate respectively the amount of radioactivity detected within a cardiac chamber during successive intervals throughout the cardiac cycle. The parallel lines of a raster scan display correspond respectively to the memory channels. The count stored in a particular memory channel causes the video signal for the corresponding line to be maintained at a binary level for a corresponding time interval thus generating a bar graph in which the length of each bar indicates the amount of radioactivity sensed during the corresponding interval of the cardiac cycle. As each memory channel accumulates radioactivity data with each successive cardiac cycle, each bar displayed in the bar graph lengthens to indicate the cumulative activity until an interpretable curve is obtained. The invention relates generally to the field of nuclear medicine and, more specifically, to diagnostic techniques of analyzing blood flow through the heart by detecting radioactivity from radioisotopes injected into the bloodstream

  11. Nuclear reactors

    International Nuclear Information System (INIS)

    Yoshioka, Michiko.

    1985-01-01

    Purpose: To obtain an optimum structural arrangement of IRM having a satisfactory responsibility to the inoperable state of a nuclear reactor and capable of detecting the reactor power in an averaged manner. Constitution: As the structural arrangement of IRM, from 6 to 16 even number of IRM are bisected into equial number so as to belong two trip systems respectively, in which all of the detectors are arranged at an equal pitch along a circumference of a circle with a radius rl having the center at the position of the central control rod in one trip system, while one detector is disposed near the central control rod and other detectors are arranged substantially at an equal pitch along the circumference of a circle with a radius r2 having the center at the position for the central control rod in another trip system. Furthermore, the radius r1 and r2 are set such that r1 = 0.3 R, r2 = 0.5 R in the case where there are 6 IRM and r1 = 0.4 R and R2 = 0.8 R where there are eight IRM where R represents the radius of the reactor core. (Kawakami, Y.)

  12. Nuclear chemistry

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    Topics covered include: mass asymmetry and total kinetic energy release in the spontaneous fission of 262 105; calculation of spontaneous fission properties of very heavy nuclei - 98 less than or equal to Z less than or equal to 106 and 150 less than or equal to N less than or equal to 164; energy losses for 84 Kr ions in nickel, aluminium and titanium; differences in compound nuclei formed with 40 Ar and 84 Kr projectiles; measurement of the energy division vs. mass in highly damped reactions; ambiguities in the inference of precompound emission from excitation function analysis; selective laser one-atom detection of neutral prompt fission fragments; laser induced nuclear polarization - application to the study of spontaneous fission isomers; quadrupole and hexadecapole deformations in the actinide nuclei; high-spin states in 164 Yb; contrasting behavior of h/sub 9/2/ and i/sub 13/2/ bands in 185 Au; multiple band crossings in 164 Er; recoil-distance measurement of lifetimes of rotational states in 164 Dy, lifetimes of ground-band states in 192 Pt and 194 Pt and application of the rotation-alignment model; coulomb excitation of vibrational nuclei with heavy ions; surface structure of deformed nuclei; valency contribution to neutron capture in 32 S; neutron capture cross section of manganese; search for superheavy elements in natural samples by neutron multiplicity counting; and gamma-ray studies on the geochemistry of achondritic meteorites

  13. Nuclear decisions

    International Nuclear Information System (INIS)

    Fischhoff, B.

    1991-01-01

    This attempts to identify the role of judgmental processes in various nuclear arms/war decisions. That task analysis is done with some confidence. The next two steps, diagnosing potential weaknesses in those judgments and suggesting ameliorative procedures, are done with increasing timidity. The empirical research base is not (ever) as large as one would like. It is particularly weak with regard to studies of experts forced to go beyond hard data and rely on intuitive judgments within their field of expertise. further evidence is needed to substantiate the claim that experts think like everyone else unless they have had the opportunity to master a particular kind of judgment as a learned skill. Although there is both theoretical and empirical reason to believe that various forms of decision aiding are possible, the high stakes involved mandate caution before proposing any intervention. Ineffective steps may make matters worse if they raise confidence without improving performance, or if they disrupt the cognitive ecology within which decision makers are accustomed to functioning, so that they lose touch with their own imperfect intuitions without acquiring viable alternatives

  14. Nuclear waste

    International Nuclear Information System (INIS)

    1990-07-01

    The state of Nevada opposed DOE's development of a nuclear waste repository at Yucca Mountain. As a result, disputes have arisen over how Nevada has spent financial assistance provided by DOE to pay the state's repository program costs. This report reviews Nevada's use of about $32 million in grant funds provided by DOE through June 1989 and found that Nevada improperly spent about $1 million. Nevada used as much as $683,000 for lobbying and litigation expenses that were unauthorized or were expressly prohibited by law, court decision, or grant terms; exceeded a legislative spending limit on socioeconomic studies by about $96,000; and used, contrary to grant terms, about $275,000 from one grant period to pay expenses incurred in the prior year. Also, Nevada did not always exercise adequate internal controls over grant funds, such as timely liquidation of funds advanced to contractors. A permissive approach to grant administration by DOE contributed to Nevada's inappropriate use of grant funds

  15. Nuclear energy and nuclear technology in Switzerland

    International Nuclear Information System (INIS)

    Graf, P.

    1975-01-01

    The energy crisis, high fuel costs and slow progress in the development of alternative energy sources, e.g. solar energy have given further impetus to nuclear power generation. The Swiss nuclear energy programme is discussed and details are given of nuclear station in operation, under construction, in the project stage and of Swiss participation in foreign nuclear stations. Reference is made to the difficulties, delays and resulting cost increases caused by local and regional opposition to nuclear power stations. The significant contributions made by Swiss industry and Swiss consulting engineers are discussed. (P.G.R.)

  16. Nuclear disarmament and peaceful nuclear technology

    International Nuclear Information System (INIS)

    Taylor, T.B.

    1989-01-01

    According to the author, it remains to be seen whether nuclear disarmament can reduce the risks of nuclear war sufficiently for the residual risks to be acceptable to a majority of the world's population, while at the same time vigorous growth in the world's dependence on nuclear energy for peaceful purposes continues. This paper discusses how use of nuclear materials from dismantled weapons as fuel for peaceful purposes may help progress to be made towards that goal, by stimulating considerable improvements in the effectiveness of arrangements for preventing diversion of the materials from peaceful to military purposes, while at the same time eliminating large numbers of nuclear weapons

  17. Nuclear power and the nuclear fuel cycle

    International Nuclear Information System (INIS)

    Scurr, I.F.; Silver, J.M.

    1990-01-01

    Australian Nuclear Science and Technology Organization maintains an ongoing assessment of the world's nuclear technology developments, as a core activity of its Strategic Plan. This publication reviews the current status of the nuclear power and the nuclear fuel cycle in Australia and around the world. Main issues discussed include: performances and economics of various types of nuclear reactors, uranium resources and requirements, fuel fabrication and technology, radioactive waste management. A brief account of the large international effort to demonstrate the feasibility of fusion power is also given. 11 tabs., ills

  18. Nuclear power and the nuclear fuel cycle

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1976-07-01

    The IAEA is organizing a major conference on nuclear power and the nuclear fuel cycle, which is to be held from 2 to 13 May 1977 in Salzburg, Austria. The programme for the conference was published in the preceding issue of the IAEA Bulletin (Vol.18, No. 3/4). Topics to be covered at the conference include: world energy supply and demand, supply of nuclear fuel and fuel cycle services, radioactivity management (including transport), nuclear safety, public acceptance of nuclear power, safeguarding of nuclear materials, and nuclear power prospects in developing countries. The articles in the section that follows are intended to serve as an introduction to the topics to be discussed at the Salzburg Conference. They deal with the demand for uranium and nuclear fuel cycle services, uranium supplies, a computer simulation of regional fuel cycle centres, nuclear safety codes, management of radioactive wastes, and a pioneering research project on factors that determine public attitudes toward nuclear power. It is planned to present additional background articles, including a review of the world nuclear fuel reprocessing situation and developments in the uranium enrichment industry, in future issues of the Bulletin. (author)

  19. Natural antioxidants exhibit chemopreventive characteristics through the regulation of CNC b-Zip transcription factors in estrogen-induced breast carcinogenesis.

    Science.gov (United States)

    Chatterjee, Anwesha; Ronghe, Amruta; Singh, Bhupendra; Bhat, Nimee K; Chen, Jie; Bhat, Hari K

    2014-12-01

    The objective of the present study was to characterize the role of resveratrol (Res) and vitamin C (VC) in prevention of estrogen-induced breast cancer through regulation of cap "n"collar (CNC) b-zip transcription factors. Human breast epithelial cell line MCF-10A was treated with 17β-estradiol (E2) and VC or Res with or without E2. mRNA and protein expression levels of CNC b-zip transcription factors nuclear factor erythroid 2-related factor 1 (Nrf1), nuclear factor erythroid 2 related factor 2 (Nrf2), nuclear factor erythroid 2 related factor 3 (Nrf3), and Nrf2-regulated antioxidant enzymes superoxide dismutase 3 (SOD3) and quinone oxidoreductase 1 (NQO1) were quantified. The treatment with E2 suppressed, whereas VC and Res prevented E2-mediated decrease in the expression levels of SOD3, NQO1, Nrf2 mRNA, and protein in MCF-10A cells. The treatment with E2, Res, or VC significantly increased mRNA and protein expression levels of Nrf1. 17β-Estradiol treatment significantly increased but VC or Res decreased Nrf3 mRNA and protein expression levels. Our studies demonstrate that estrogen-induced breast cancer might be prevented through upregulation of antioxidant enzymes via Nrf-dependent pathways. © 2014 Wiley Periodicals, Inc.

  20. Gene disruptions indicate an essential function for the LmmCRK1 cdc2-related kinase of Leishmania mexicana.

    Science.gov (United States)

    Mottram, J C; McCready, B P; Brown, K G; Grant, K M

    1996-11-01

    The generation of homozygous null mutants for the crk1 Cdc2-Related Kinase of Leishmania mexicana was attempted using targeted gene disruption. Promastigote mutants heterozygous for crk1 were readily isolated with a hyg-targeting fragment, but attempts to create null mutants by second-round transfections with a bie-targeting fragment yielded two classes of mutant, neither of which was null. First, the transfected fragment formed an episome; second, the cloned transfectants were found to contain wild-type crk1 alleles as well as hyg and ble integrations. DNA-content analysis revealed that these mutants were triploid or tetraploid. Plasticity in chromosome number following targeting has been proposed as a means by which Leishmania avoids deletion of essential genes. These data support this theory and implicate crk1 as an essential gene, validating CRK1 as a potential drug target. L mexicana transfected with a Trypanosoma brucel homologue, tbcrk1, was shown to be viable in an immcrk1 null background, thus showing complementation of function between these trypanosomatid genes. The expression of crk1 was further manipulated by engineering a six-histidine tag at the C-terminus of the kinase, allowing purification of the active complex by affinity selection on Nl(2+)-nitriloacetic acid (NTA) agarose.