WorldWideScience

Sample records for nrf2-mediated adaptive response

  1. Nrf2 mediates redox adaptations to exercise

    Directory of Open Access Journals (Sweden)

    Aaron J. Done

    2016-12-01

    Full Text Available The primary aim of this review is to summarize the current literature on the effects of acute exercise and regular exercise on nuclear factor erythroid 2-related factor 2 (Nrf2 activity and downstream targets of Nrf2 signaling. Nrf2 (encoded in humans by the NFE2L2 gene is the master regulator of antioxidant defenses, a transcription factor that regulates expression of more than 200 cytoprotective genes. Increasing evidence indicates that Nrf2 signaling plays a key role in how oxidative stress mediates the beneficial effects of exercise. Episodic increases in oxidative stress induced through bouts of acute exercise stimulate Nrf2 activation and when applied repeatedly, as with regular exercise, leads to upregulation of endogenous antioxidant defenses and overall greater ability to counteract the damaging effects of oxidative stress. The evidence of Nrf2 activation in response to exercise across variety of tissues may be an important mechanism of how exercise exerts its well-known systemic effects that are not limited to skeletal muscle and myocardium. Additionally there are emerging data that results from animal studies translate to humans.

  2. Dose-dependent transitions in Nrf2-mediated adaptive response and related stress responses to hypochlorous acid in mouse macrophages

    International Nuclear Information System (INIS)

    Woods, Courtney G.; Fu Jingqi; Xue Peng; Hou Yongyong; Pluta, Linda J.; Yang Longlong; Zhang Qiang; Thomas, Russell S.; Andersen, Melvin E.; Pi Jingbo

    2009-01-01

    Hypochlorous acid (HOCl) is potentially an important source of cellular oxidative stress. Human HOCl exposure can occur from chlorine gas inhalation or from endogenous sources of HOCl, such as respiratory burst by phagocytes. Transcription factor Nrf2 is a key regulator of cellular redox status and serves as a primary source of defense against oxidative stress. We recently demonstrated that HOCl activates Nrf2-mediated antioxidant response in cultured mouse macrophages in a biphasic manner. In an effort to determine whether Nrf2 pathways overlap with other stress pathways, gene expression profiling was performed in RAW 264.7 macrophages exposed to HOCl using whole genome mouse microarrays. Benchmark dose (BMD) analysis on gene expression data revealed that Nrf2-mediated antioxidant response and protein ubiquitination were the most sensitive biological pathways that were activated in response to low concentrations of HOCl (< 0.35 mM). Genes involved in chromatin architecture maintenance and DNA-dependent transcription were also sensitive to very low doses. Moderate concentrations of HOCl (0.35 to 1.4 mM) caused maximal activation of the Nrf2 pathway and innate immune response genes, such as IL-1β, IL-6, IL-10 and chemokines. At even higher concentrations of HOCl (2.8 to 3.5 mM) there was a loss of Nrf2-target gene expression with increased expression of numerous heat shock and histone cluster genes, AP-1-family genes, cFos and Fra1 and DNA damage-inducible Gadd45 genes. These findings confirm an Nrf2-centric mechanism of action of HOCl in mouse macrophages and provide evidence of interactions between Nrf2, inflammatory, and other stress pathways.

  3. Activation of Nrf2-mediated oxidative stress response in macrophages by hypochlorous acid

    International Nuclear Information System (INIS)

    Pi Jingbo; Zhang Qiang; Woods, Courtney G.; Wong, Victoria; Collins, Sheila; Andersen, Melvin E.

    2008-01-01

    Hypochlorous acid (HOCl), a potent oxidant generated when chlorine gas reacts with water, is important in the pathogenesis of many disorders. Transcription factor Nrf2-mediated antioxidant response represents a critical cellular defense mechanism that serves to maintain intracellular redox homeostasis and limit oxidative damage. In the present study, the effect of HOCl on Nrf2 activation was investigated in macrophages, one of the target cells of chlorine gas exposure. Exposure of RAW 264.7 macrophages to HOCl resulted in increased protein levels of Nrf2 in nuclear extractions, as well as a time- and dose-dependent increase in the expression of Nrf2 target genes, including heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 (NQO-1), glutamate cysteine ligase catalytic subunit (GCLC), and glutathione synthetase (GS). Additionally, intracellular glutathione (GSH), which is the prime scavenger for HOCl in cells, decreased within the first hour of HOCl exposure. The decline was followed by a GSH rebound that surpassed the initial basal levels by up to 4-fold. This reversal in GSH levels closely correlated with the gene expression profile of GCLC and GS. To study the mechanisms of Nrf2 activation in response to HOCl exposure, we examined the effects of several antioxidants on Nrf2-mediated response. Pretreatment with cell-permeable catalase, N-acetyl-L-cysteine or GSH-monoethyl ester markedly reduced expression of NQO-1 and GCLC under HOCl challenge conditions, suggesting intracellular ROS-scavenging capacity affects HOCl-induced Nrf2 activation. Importantly, pre-activation of Nrf2 with low concentrations of pro-oxidants protected the cells against HOCl-induced cell damage. Taken together, we provide direct evidence that HOCl activates Nrf2-mediated antioxidant response, which protects cells from oxidative damage

  4. Nrf2 mediates redox adaptation in NOX4-overexpressed non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qipeng; Yao, Bei; Li, Ning; Ma, Lei; Deng, Yanchao; Yang, Yang; Zeng, Cheng; Yang, Zhicheng [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Liu, Bing, E-mail: liubing520@gdpu.edu.cn [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Guangdong Key Laboratory of Pharmaceutical Bioactive Substances, Guangdong Pharmaceutical University, Guangzhou 510006 (China)

    2017-03-15

    The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells. However, the comprehensive mechanisms for NOX4-mediated oxidative resistance of cancer cells remain still undentified. The present study found that NOX4-derived H{sub 2}O{sub 2} enhanced the nuclear factor erythroid 2-related factor 2 (Nrf2) stability via disruption of redox-dependent proteasomal degradation and stimulated its activity through activation of PI3K signaling. Specifically, the results showed that ectopic NOX4 expression did not induce apoptosis of A549 cells; however, inhibition of Nrf2 resulted in obvious apoptotic death of NOX4-overexpressed A549 cells, accompanied by a significant increase in H{sub 2}O{sub 2} level and decrease in GSH content. Besides, inhibition of Nrf2 could suppress cell growth and efficiently reverse the enhancement effect of NOX4 on cell growth. The in vivo data confirmed that inhibition of Nrf2 could interfere apoptosis resistance in NOX4-overexpressed A549 tumors and led to cell growth inhibition. In conclusion, these results reveal that Nrf2 is critically involved in redox adaptation regulation in NOX4-overexpressed NSCLC cells. Therefore, NOX4 and Nrf2 may be promising combination targets against malignant progression of NSCLC. - Highlights: • NOX4-derived H{sub 2}O{sub 2} upregulates Nrf2 expression and activity in NSCLC. • Nrf2 confers apoptosis resistance in NOX4-overexpressed NSCLC cells. • Inhibition of Nrf2 reverses the enhancement effect of NOX4 on cell growth.

  5. Enhanced B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation contributes to ABCC1-mediated chemoresistance and glutathione-mediated survival in acquired topoisomerase II poison-resistant cancer cells.

    Science.gov (United States)

    Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan

    2017-12-01

    Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell

    2013-01-01

    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  7. Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytotoxic effects of electrophiles, peroxides and redox-cycling agents

    International Nuclear Information System (INIS)

    Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2009-01-01

    Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2 -/- MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 μmol/l sulforaphane was very substantially lower in Nrf2 -/- MEFs than in wild-type cells, and the rebound leading to a ∼ 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2 +/+ MEFs were treated with sulforaphane was not observed in Nrf2 -/- fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 μmol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, α,β-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2 +/+ MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2 -/- MEFs were typically ∼ 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 μmol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2 +/+ MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.

  8. Nrf2, the Master Regulator of Anti-Oxidative Responses

    Directory of Open Access Journals (Sweden)

    Sandra Vomund

    2017-12-01

    Full Text Available Tight regulation of inflammation is very important to guarantee a balanced immune response without developing chronic inflammation. One of the major mediators of the resolution of inflammation is the transcription factor: the nuclear factor erythroid 2-like 2 (Nrf2. Stabilized following oxidative stress, Nrf2 induces the expression of antioxidants as well as cytoprotective genes, which provoke an anti-inflammatory expression profile, and is crucial for the initiation of healing. In view of this fundamental modulatory role, it is clear that both hyper- or hypoactivation of Nrf2 contribute to the onset of chronic diseases. Understanding the tight regulation of Nrf2 expression/activation and its interaction with signaling pathways, known to affect inflammatory processes, will facilitate development of therapeutic approaches to prevent Nrf2 dysregulation and ameliorate chronic inflammatory diseases. We discuss in this review the principle mechanisms of Nrf2 regulation with a focus on inflammation and autophagy, extending the role of dysregulated Nrf2 to chronic diseases and tumor development.

  9. Partial contribution of the Keap1–Nrf2 system to cadmium-mediated metallothionein expression in vascular endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Shinkai, Yasuhiro [Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575 (Japan); Kimura, Tomoki [Faculty of Science and Engineering, Setsunan University, 17-8 Ikedanaka-machi, Neyagawa, Osaka 572-8508 (Japan); Itagaki, Ayaka [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Yamamoto, Chika [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi, Chiba 274-8510 (Japan); Taguchi, Keiko; Yamamoto, Masayuki [Department of Medical Biochemistry, Tohoku University Graduate School of Medicine, 2-1 Seiryo-cho, Aoba-ku, Sendai 980-8575 (Japan); Kumagai, Yoshito, E-mail: yk-em-tu@md.tsukuba.ac.jp [Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575 (Japan); Kaji, Toshiyuki, E-mail: t-kaji@rs.tus.ac.jp [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Faculty of Pharmaceutical Sciences, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510 (Japan)

    2016-03-15

    Cadmium is an environmental electrophile that modifies protein reactive thiols such as Kelch-like ECH-associated protein 1 (Keap1), a negative regulator of nuclear factor-erythroid 2-related factor 2 (Nrf2). In the present study, we investigated a role of the Keap1–Nrf2 system in cellular response to cadmium in vascular endothelial cells. Exposure of bovine aortic endothelial cells to cadmium resulted in modification of Keap1 and Nrf2 activation, thereby up-regulating not only its typical downstream proteins but also metallothionein-1/2. Experiments with siRNA-mediated knockdown of Nrf2 or Keap1 supported participation of the Keap1–Nrf2 system in the modulation of metallothionein-1/2 expression. Furthermore, chromatin immunoprecipitation assay showed that Nrf2 was recruited to the antioxidant response element of the promoter region of the bovine metallothionein-2 gene in the presence of cadmium. These results suggest that the transcription factor Nrf2 plays, at least in part, a role in the changes in metallothionein expression mediated by exposure to cadmium. - Highlights: • Role of the Keap1–Nrf2 system in cellular response to cadmium was examined. • We used bovine aortic endothelial cells as a model of the vascular endothelium. • Exposure of cells to cadmium resulted in modification of Keap1 and Nrf2 activation. • Keap1–Nrf2 system participated in the modulation of metallothionein-1/2 expression. • Nrf2 was recruited to the antioxidant response element of MT2 promoter region.

  10. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    International Nuclear Information System (INIS)

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing

    2014-01-01

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  11. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Bin [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S. [Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Ward, Keith W.; Meyer, Colin J. [Department of Pharmacology, Reata Pharmaceuticals, Inc., Irving, TX 75063 (United States); Wang, Xing Li [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Tang, Dongqi, E-mail: Dongqi.Tang@uscmed.sc.edu [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Cui, Taixing, E-mail: taixing.cui@uscmed.sc.edu [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States)

    2014-02-21

    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  12. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response.

    Science.gov (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun

    2017-01-01

    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  13. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2017-01-01

    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  14. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Nrf2: bane or blessing in cancer?

    Science.gov (United States)

    Xiang, MingJun; Namani, Akhileshwar; Wu, ShiJun; Wang, XiaoLi

    2014-08-01

    The Kelch-like ECH-associated protein 1 (Keap1)-nuclear factor-E2-related factor 2 (Nrf2)-antioxidant response element pathway serves a major function in endogenous cytoprotection in normal cells. Nrf2 is a transcription factor that mainly regulates the expression of a wide array of genes that produce the antioxidants and other proteins responsible for the detoxification of xenobiotics and reactive oxygen species. Nrf2 mediates the chemoprevention of cancer in normal cells. Growing body of evidence suggests that Nrf2 is not only involved in the chemoprevention of normal cells but also promotes the growth of cancer cells. However, the mechanism underlying the function of Nrf2 in oncogenesis and tumor protection in cancer cells remains unclear and thus requires further study. This review aims to rationalize the existing functions of Nrf2 in chemoprevention and tumorigenesis, as well as the somatic mutations of Nrf2 and Keap1 in cancer and Nrf2 cross talk with miRNAs. This review also discusses the future challenges in Nrf2 research.

  16. Photoprotection by dietary phenolics against melanogenesis induced by UVA through Nrf2-dependent antioxidant responses

    Science.gov (United States)

    Chaiprasongsuk, Anyamanee; Onkoksoong, Tasanee; Pluemsamran, Thanyawan; Limsaengurai, Saowalak; Panich, Uraiwan

    2015-01-01

    Dietary phenolics may play a protective role in UV-mediated skin pigmentation through their antioxidant and UV-absorbing actions. In this study, we investigated whether genetic silencing of Nrf2, regulating the transcription of antioxidant genes, affected melanogenesis in primary human epidermal melanocytes (HEMn) and B16F10 melanoma cells subjected to UVA (8 J/cm2) exposure. Then, we explored the antimelanogenic actions of phenolics; caffeic acid (CA) and ferulic acid (FA) providing partial UVA protection; quercetin (QU) and rutin (RU) providing strong UVA protection and; avobenzone (AV), an efficient UVA filter, in association with modulation of Nrf2-mediated antioxidant defenses in response to UVA insults in B16F10 cells. Upon oxidative insults, Nrf2 silencing promoted melanogenesis in both HEMn and B16F10 cells irradiated with UVA. Stimulation of melanogenesis by UVA correlated with increased ROS and oxidative DNA damage (8-OHdG), GSH depletion as well as a transient downregulation of Nrf2 nuclear translocation and of Nrf2-ARE signaling in B16F10 cells. All test compounds exerted antimelanogenic effects with respect to their abilities to reverse UVA-mediated oxidative damage as well as downregulation of Nrf2 activity and its target antioxidants (GCLC, GST and NQO1) in B16F10 cells. In conclusion, defective Nrf2 may promote melanogenesis under UVA irradiation through oxidative stress mechanisms. Compounds with antioxidant and/or UVA absorption properties could protect against UVA-induced melanogenesis through indirect regulatory effect on Nrf2-ARE pathway. PMID:26765101

  17. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  18. Nrf2 protects against airway disorders

    International Nuclear Information System (INIS)

    Cho, Hye-Youn; Kleeberger, Steven R.

    2010-01-01

    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  19. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  20. Expression of Nrf2 in neurodegenerative diseases.

    Science.gov (United States)

    Ramsey, Chenere P; Glass, Charles A; Montgomery, Marshall B; Lindl, Kathryn A; Ritson, Gillian P; Chia, Luis A; Hamilton, Ronald L; Chu, Charleen T; Jordan-Sciutto, Kelly L

    2007-01-01

    In response to oxidative stress, the nuclear factor E2-related factor 2 (Nrf2) transcription factor translocates from the cytoplasm into the nucleus and transactivates expression of genes with antioxidant activity. Despite this cellular mechanism, oxidative damage is abundant in Alzheimer and Parkinson disease (AD and PD). To investigate mechanisms by which Nrf2 activity may be aberrant or insufficient in neurodegenerative conditions, we assessed Nrf2 localization in affected brain regions of AD, Lewy body variant of AD (LBVAD), and PD. By immunohistochemistry, Nrf2 is expressed in both the nucleus and the cytoplasm of neurons in normal hippocampi with predominant expression in the nucleus. In AD and LBVAD, Nrf2 was predominantly cytoplasmic in hippocampal neurons and was not a major component of beta amyloid plaques or neurofibrillary tangles. By immunoblotting, we observed a significant decrease in nuclear Nrf2 levels in AD cases. In contrast, Nrf2 was strongly nuclear in PD nigral neurons but cytoplasmic in substantia nigra of normal, AD, and LBVAD cases. These findings suggest that Nrf2-mediated transcription is not induced in neurons in AD despite the presence of oxidative stress. In PD, nuclear localization of Nrf2 is strongly induced, but this response may be insufficient to protect neurons from degeneration.

  1. Cancer Chemoprevention by Traditional Chinese Herbal Medicine and Dietary Phytochemicals: Targeting Nrf2-Mediated Oxidative Stress/Anti-Inflammatory Responses, Epigenetics, and Cancer Stem Cells

    Directory of Open Access Journals (Sweden)

    Jong Hun Lee

    2013-01-01

    Full Text Available Excessive oxidative stress induced by reactive oxygen species (ROS, reactive nitrogen species (RNS, and reactive metabolites of carcinogens alters cellular homeostasis, leading to genetic/epigenetic changes, genomic instability, neoplastic transformation, and cancer initiation/progression. As a protective mechanism against oxidative stress, antioxidant/detoxifying enzymes reduce these reactive species and protect normal cells from endo-/exogenous oxidative damage. The transcription factor nuclear factor-erythroid 2 p45 (NF-E2-related factor 2 (Nrf2, a master regulator of the antioxidative stress response, plays a critical role in the expression of many cytoprotective enzymes, including NAD(PH:quinine oxidoreductase (NQO1, heme oxygenase-1 (HO-1, UDP-glucuronosyltransferase (UGT, and glutathione S-transferase (GST. Recent studies demonstrated that many dietary phytochemicals derived from various vegetables, fruits, spices, and herbal medicines induce Nrf2-mediated antioxidant/detoxifying enzymes, restore aberrant epigenetic alterations, and eliminate cancer stem cells (CSCs. The Nrf2-mediated antioxidant response prevents many age-related diseases, including cancer. Owing to their fundamental contribution to carcinogenesis, epigenetic modifications and CSCs are novel targets of dietary phytochemicals and traditional Chinese herbal medicine (TCHM. In this review, we summarize cancer chemoprevention by dietary phytochemicals, including TCHM, which have great potential as a safer and more effective strategy for preventing cancer.

  2. Disruption of Nrf2, a key inducer of antioxidant defenses, attenuates ApoE-mediated atherosclerosis in mice.

    Directory of Open Access Journals (Sweden)

    Thomas E Sussan

    Full Text Available BACKGROUND: Oxidative stress and inflammation are two critical factors that drive the formation of plaques in atherosclerosis. Nrf2 is a redox-sensitive transcription factor that upregulates a battery of antioxidative genes and cytoprotective enzymes that constitute the cellular response to oxidative stress. Our previous studies have shown that disruption of Nrf2 in mice (Nrf2(-/- causes increased susceptibility to pulmonary emphysema, asthma and sepsis due to increased oxidative stress and inflammation. Here we have tested the hypothesis that disruption of Nrf2 in mice causes increased atherosclerosis. PRINCIPAL FINDINGS: To investigate the role of Nrf2 in the development of atherosclerosis, we crossed Nrf2(-/- mice with apoliporotein E-deficient (ApoE(-/- mice. ApoE(-/- and ApoE(-/-Nrf2(-/- mice were fed an atherogenic diet for 20 weeks, and plaque area was assessed in the aortas. Surprisingly, ApoE(-/-Nrf2(-/- mice exhibited significantly smaller plaque area than ApoE(-/- controls (11.5% vs 29.5%. This decrease in plaque area observed in ApoE(-/-Nrf2(-/- mice was associated with a significant decrease in uptake of modified low density lipoproteins (AcLDL by isolated macrophages from ApoE(-/-Nrf2(-/- mice. Furthermore, atherosclerotic plaques and isolated macrophages from ApoE(-/-Nrf2(-/- mice exhibited decreased expression of the scavenger receptor CD36. CONCLUSIONS: Nrf2 is pro-atherogenic in mice, despite its antioxidative function. The net pro-atherogenic effect of Nrf2 may be mediated via positive regulation of CD36. Our data demonstrates that the potential effects of Nrf2-targeted therapies on cardiovascular disease need to be investigated.

  3. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    International Nuclear Information System (INIS)

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung

    2012-01-01

    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  4. An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.

    Science.gov (United States)

    Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing

    2010-07-20

    Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral

  5. Carbon monoxide mediates heme oxygenase 1 induction via Nrf2 activation in hepatoma cells

    International Nuclear Information System (INIS)

    Lee, Bok-Soo; Heo, JungHee; Kim, Yong-Man; Shim, Sang Moo; Pae, Hyun-Ock; Kim, Young-Myeong; Chung, Hun-Taeg

    2006-01-01

    Carbon monoxide (CO) and nitric oxide (NO) are two gas molecules which have cytoprotective functions against oxidative stress and inflammatory responses in many cell types. Currently, it is known that NO produced by nitric oxide synthase (NOS) induces heme oxygenase 1 (HO1) expression and CO produced by the HO1 inhibits inducible NOS expression. Here, we first show CO-mediated HO1 induction and its possible mechanism in human hepatocytes. Exposure of HepG2 cells or primary hepatocytes to CO resulted in dramatic induction of HO1 in dose- and time-dependent manner. The CO-mediated HO1 induction was abolished by MAP kinase inhibitors (MAPKs) but not affected by inhibitors of PI3 kinase or NF-κB. In addition, CO induced the nuclear translocation and accumulation of Nrf2, which suppressed by MAPKs inhibitors. Taken together, we suggest that CO induces Nrf2 activation via MAPKs signaling pathways, thereby resulting in HO1 expression in HepG2 cells

  6. NRF2 Mutation Confers Malignant Potential and Resistance to Chemoradiation Therapy in Advanced Esophageal Squamous Cancer

    Directory of Open Access Journals (Sweden)

    Tatsuhiro Shibata

    2011-09-01

    Full Text Available Esophageal squamous cancer (ESC is one of the most aggressive tumors of the gastrointestinal tract. A combination of chemotherapy and radiation therapy (CRT has improved the clinical outcome, but the molecular background determining the effectiveness of therapy remains unknown. NRF2 is a master transcriptional regulator of stress adaptation, and gain of-function mutation of NRF2 in cancer confers resistance to stressors including anticancer therapy. Direct resequencing analysis revealed that Nrf2 gain-of-function mutation occurred recurrently (18/82, 22% in advanced ESC tumors and ESC cell lines (3/10. The presence of Nrf2 mutation was associated with tumor recurrence and poor prognosis. Short hairpin RNA-mediated down-regulation of NRF2 in ESC cells that harbor only mutated Nrf2 allele revealed that themutant NRF2 conferred increased cell proliferation, attachment-independent survival, and resistance to 5-fluorouracil and γ-irradiation. Based on the Nrf2 mutation status, gene expression signatures associated with NRF2 mutation were extracted from ESC cell lines, and their potential utility for monitoring and prognosis was examined in a cohort of 33 pre-CRT cases of ESC. The molecular signatures of NRF2 mutation were significantly predictive and prognostic for CRT response. In conclusion, recurrent NRF2 mutation confers malignant potential and resistance to therapy in advanced ESC, resulting in a poorer outcome. Molecular signatures of NRF2 mutation can be applied as predictive markers of response to CRT, and efficient inhibition of aberrant NRF2 activation could be a promising approach in combination with CRT.

  7. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Da-min [Department of Anesthesiology, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Lu, Pei-Hua, E-mail: lphty1_1@163.com [Department of Medical Oncology, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China); Zhang, Ke; Wang, Xiang [Department of Anesthesiology, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Sun, Min [Department of General Surgery, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Chen, Guo-Qian [Department of Clinical Laboratory, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China); Wang, Qiong, E-mail: WangQiongprof1@126.com [Department of Clinical Laboratory, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China)

    2015-02-13

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R.

  8. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    International Nuclear Information System (INIS)

    Gu, Da-min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong

    2015-01-01

    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R

  9. A systems biology perspective on Nrf2-mediated antioxidant response

    International Nuclear Information System (INIS)

    Zhang Qiang; Pi Jingbo; Woods, Courtney G.; Andersen, Melvin E.

    2010-01-01

    Cells in vivo are constantly exposed to reactive oxygen species (ROS) generated endogenously and exogenously. To defend against the deleterious consequences of ROS, cells contain multiple antioxidant enzymes expressed in various cellular compartments to scavenge these toxic species. Under oxidative stresses, these antioxidant enzymes are upregulated to restore redox homeostasis. Such an adaptive response results from the activation of a redox-sensitive gene regulatory network mediated by nuclear factor E2-related factor 2. To more completely understand how the redox control system is designed by nature to meet homeostatic goals, we have examined the network from a systems perspective using engineering approaches. As with man-made control devices, the redox control system can be decomposed into distinct functional modules, including transducer, controller, actuator, and plant. Cells achieve specific performance objectives by utilizing nested feedback loops, feedforward control, and ultrasensitive signaling motifs, etc. Given that endogenously generated ROS are also used as signaling molecules, our analysis suggests a novel mode of action to explain oxidative stress-induced pathological conditions and diseases. Specifically, by adaptively upregulating antioxidant enzymes, oxidative stress may inadvertently attenuate ROS signals that mediate physiological processes, resulting in aberrations of cellular functions and adverse consequences. Lastly, by simultaneously considering the two competing cellular tasks-adaptive antioxidant defense and ROS signaling-we re-examine the premise that dietary antioxidant supplements is generally beneficial to human health. Our analysis highlights some possible adverse effects of these widely consumed antioxidants.

  10. ROS signaling, oxidative stress and Nrf2 in pancreatic beta-cell function

    International Nuclear Information System (INIS)

    Pi Jingbo; Zhang Qiang; Fu Jingqi; Woods, Courtney G.; Hou Yongyong; Corkey, Barbara E.; Collins, Sheila; Andersen, Melvin E.

    2010-01-01

    This review focuses on the emerging evidence that reactive oxygen species (ROS) derived from glucose metabolism, such as H 2 O 2 , act as metabolic signaling molecules for glucose-stimulated insulin secretion (GSIS) in pancreatic beta-cells. Particular emphasis is placed on the potential inhibitory role of endogenous antioxidants, which rise in response to oxidative stress, in glucose-triggered ROS and GSIS. We propose that cellular adaptive response to oxidative stress challenge, such as nuclear factor E2-related factor 2 (Nrf2)-mediated antioxidant induction, plays paradoxical roles in pancreatic beta-cell function. On the one hand, induction of antioxidant enzymes protects beta-cells from oxidative damage and possible cell death, thus minimizing oxidative damage-related impairment of insulin secretion. On the other hand, the induction of antioxidant enzymes by Nrf2 activation blunts glucose-triggered ROS signaling, thus resulting in reduced GSIS. These two premises are potentially relevant to impairment of beta-cells occurring in the late and early stage of Type 2 diabetes, respectively. In addition, we summarized our recent findings that persistent oxidative stress due to absence of uncoupling protein 2 activates cellular adaptive response which is associated with impaired pancreatic beta-cell function.

  11. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1.

    Science.gov (United States)

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D

    2009-07-29

    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  12. Effects of Nrf2 deficiency on arsenic metabolism in mice.

    Science.gov (United States)

    Wang, Huihui; Zhu, Jiayu; Li, Lu; Li, Yongfang; Lv, Hang; Xu, Yuanyuan; Sun, Guifan; Pi, Jingbo

    2017-12-15

    Inorganic arsenic (iAs) is a known toxicant and carcinogen. Worldwide arsenic exposure has become a threat to human health. The severity of arsenic toxicity is strongly correlated with the speed of arsenic metabolism (methylation) and clearance. Furthermore, oxidative stress is recognized as a major mechanism for arsenic-induced toxicity. Nuclear factor-E2-related factor 2 (Nrf2), a key regulator in cellular adaptive antioxidant response, is clearly involved in alleviation of arsenic-induced oxidative damage. Multiple studies demonstrate that Nrf2 deficiency mice are more vulnerable to arsenic-induced intoxication. However, what effect Nrf2 deficiency might have on arsenic metabolism in mice is still unknown. In the present study, we measured the key enzymes involved in arsenic metabolism in Nrf2-WT and Nrf2-KO mice. Our results showed that basal transcript levels of glutathione S-transferase omega 2 (Gsto2) were significantly higher and GST mu 1 (Gstm1) lower in Nrf2-KO mice compared to Nrf2-WT control. Arsenic speciation and methylation rate in liver and urine was then studied in mice treated with 5mg/kg sodium arsenite for 12h. Although there were some alterations in arsenic metabolism enzymes between Nrf2-WT and Nrf2-KO mice, the Nrf2 deficiency had no significant effect on arsenic methylation. These results suggest that the Nrf2-KO mice are more sensitive to arsenic than Nrf2-WT mainly because of differences in adaptive antioxidant detoxification capacity rather than arsenic methylation capacity. Copyright © 2017. Published by Elsevier Inc.

  13. Agmatine Reduces Lipopolysaccharide-Mediated Oxidant Response via Activating PI3K/Akt Pathway and Up-Regulating Nrf2 and HO-1 Expression in Macrophages.

    Directory of Open Access Journals (Sweden)

    Jianshen Chai

    Full Text Available Macrophages are key responders of inflammation and are closely related with oxidative stress. Activated macrophages can enhance oxygen depletion, which causes an overproduction of reactive oxygen species (ROS and leads to further excessive inflammatory response and tissue damage. Agmatine, an endogenous metabolite of L-arginine, has recently been shown to have neuroprotective effects based on its antioxidant properties. However, the antioxidant effects of agmatine in peripheral tissues and cells, especially macrophages, remain unclear. In this study we explored the role of agmatine in mediating antioxidant effects in RAW 264.7 cells and studied its antioxidant mechanism. Our data demonstrate that agmatine is an activator of Nrf2 signaling that markedly enhances Nrf2 nuclear translocation, increases nuclear Nrf2 protein level, up-regulates the expression of the Nrf2 downstream effector HO-1, and attenuates ROS generation induced by Lipopolysaccharide (LPS. We further demonstrated that the agmatine-induced activation of Nrf2 is likely through the PI3K/Akt pathway. LY294002, a specific PI3K/Akt inhibitor, abolished agmatine-induced HO-1 up-regulation and ROS suppression significantly. Inhibiting HO-1 pathway significantly attenuated the antioxidant effect of agmatine which the products of HO-1 enzymatic activity contributed to. Furthermore, the common membrane receptors of agmatine were evaluated, revealing that α2-adrenoceptor, I1-imidazoline receptor or I2-imidazoline receptor are not required by the antioxidant properties of agmatine. Taken together, our findings revealed that agmatine has antioxidant activity against LPS-induced ROS accumulation in RAW 264.7 cells involving HO-1 expression induced by Nrf2 via PI3K/Akt pathway activation.

  14. Three transcription regulators of the Nss family mediate the adaptive response induced by nitrate, nitric oxide or nitrous oxide in Wolinella succinogenes.

    Science.gov (United States)

    Kern, Melanie; Simon, Jörg

    2016-09-01

    Sensing potential nitrogen-containing respiratory substrates such as nitrate, nitrite, hydroxylamine, nitric oxide (NO) or nitrous oxide (N2 O) in the environment and subsequent upregulation of corresponding catabolic enzymes is essential for many microbial cells. The molecular mechanisms of such adaptive responses are, however, highly diverse in different species. Here, induction of periplasmic nitrate reductase (Nap), cytochrome c nitrite reductase (Nrf) and cytochrome c N2 O reductase (cNos) was investigated in cells of the Epsilonproteobacterium Wolinella succinogenes grown either by fumarate, nitrate or N2 O respiration. Furthermore, fumarate respiration in the presence of various nitrogen compounds or NO-releasing chemicals was examined. Upregulation of each of the Nap, Nrf and cNos enzyme systems was found in response to the presence of nitrate, NO-releasers or N2 O, and the cells were shown to employ three transcription regulators of the Crp-Fnr superfamily (homologues of Campylobacter jejuni NssR), designated NssA, NssB and NssC, to mediate the upregulation of Nap, Nrf and cNos. Analysis of single nss mutants revealed that NssA controls production of the Nap and Nrf systems in fumarate-grown cells, while NssB was required to induce the Nap, Nrf and cNos systems specifically in response to NO-generators. NssC was indispensable for cNos production under any tested condition. The data indicate dedicated signal transduction routes responsive to nitrate, NO and N2 O and imply the presence of an N2 O-sensing mechanism. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. Targeted deletion of Nrf2 reduces urethane-induced lung tumor development in mice.

    Directory of Open Access Journals (Sweden)

    Alison K Bauer

    Full Text Available Nrf2 is a key transcription factor that regulates cellular redox and defense responses. However, permanent Nrf2 activation in human lung carcinomas promotes pulmonary malignancy and chemoresistance. We tested the hypothesis that Nrf2 has cell survival properties and lack of Nrf2 suppresses chemically-induced pulmonary neoplasia by treating Nrf2(+/+ and Nrf2(-/- mice with urethane. Airway inflammation and injury were assessed by bronchoalveolar lavage analyses and histopathology, and lung tumors were analyzed by gross and histologic analysis. We used transcriptomics to assess Nrf2-dependent changes in pulmonary gene transcripts at multiple stages of neoplasia. Lung hyperpermeability, cell death and apoptosis, and inflammatory cell infiltration were significantly higher in Nrf2(-/- mice compared to Nrf2(+/+ mice 9 and 11 wk after urethane. Significantly fewer lung adenomas were found in Nrf2(-/- mice than in Nrf2(+/+ mice at 12 and 22 wk. Nrf2 modulated expression of genes involved cell-cell signaling, glutathione metabolism and oxidative stress response, and immune responses during early stage neoplasia. In lung tumors, Nrf2-altered genes had roles in transcriptional regulation of cell cycle and proliferation, carcinogenesis, organismal injury and abnormalities, xenobiotic metabolism, and cell-cell signaling genes. Collectively, Nrf2 deficiency decreased susceptibility to urethane-induced lung tumorigenesis in mice. Cell survival properties of Nrf2 were supported, at least in part, by reduced early death of initiated cells and heightened advantage for tumor cell expansion in Nrf2(+/+ mice relative to Nrf2(-/- mice. Our results were consistent with the concept that Nrf2 over-activation is an adaptive response of cancer conferring resistance to anti-cancer drugs and promoting malignancy.

  16. Targeting NRF2 signaling for cancer chemoprevention

    International Nuclear Information System (INIS)

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2010-01-01

    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  17. Activation of Nrf2 Reduces UVA-Mediated MMP-1 Upregulation via MAPK/AP-1 Signaling Cascades: The Photoprotective Effects of Sulforaphane and Hispidulin

    Science.gov (United States)

    Chaiprasongsuk, Anyamanee; Lohakul, Jinaphat; Soontrapa, Kitipong; Sampattavanich, Somponnat; Akarasereenont, Pravit

    2017-01-01

    UVA irradiation plays a role in premature aging of the skin through triggering oxidative stress-associated stimulation of matrix metalloproteinase-1 (MMP-1) responsible for collagen degradation, a hallmark of photoaged skin. Compounds that can activate nuclear factor E2-related factor 2 (Nrf2), a transcription factor regulating antioxidant gene expression, should therefore serve as effective antiphotoaging agents. We investigated whether genetic silencing of Nrf2 could relieve UVA-mediated MMP-1 upregulation via activation of mitogen-activated protein kinase (MAPK)/activator protein 1 (AP-1) signaling using human keratinocyte cell line (HaCaT). Antiphotoaging effects of hispidulin (HPD) and sulforaphane (SFN) were assessed on their abilities to activate Nrf2 in controlling MMP-1 and collagen expressions in association with phosphorylation of MAPKs (extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38), c-Jun, and c-Fos, using the skin of BALB/c mice subjected to repetitive UVA irradiation. Our findings suggested that depletion of Nrf2 promoted both mRNA expression and activity of MMP-1 in the UVA-irradiated HaCaT cells. Treatment of Nrf2 knocked-down HaCaT cells with MAPK inhibitors significantly suppressed UVA-induced MMP-1 and AP-1 activities. Moreover, pretreatment of the mouse skin with HPD and SFN, which could activate Nrf2, provided protective effects against UVA-mediated MMP-1 induction and collagen depletion in correlation with the decreased levels of phosphorylated MAPKs, c-Jun, and c-Fos in the mouse skin. In conclusion, Nrf2 could influence UVA-mediated MMP-1 upregulation through the MAPK/AP-1 signaling cascades. HPD and SFN may therefore represent promising antiphotoaging candidates. PMID:28011874

  18. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-09

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  19. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-01-01

    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  20. Ectodermal-neural cortex 1 down-regulates Nrf2 at the translational level.

    Directory of Open Access Journals (Sweden)

    Xiao-Jun Wang

    Full Text Available The transcription factor Nrf2 is the master regulator of a cellular defense mechanism against environmental insults. The Nrf2-mediated antioxidant response is accomplished by the transcription of a battery of genes that encode phase II detoxifying enzymes, xenobiotic transporters, and antioxidants. Coordinated expression of these genes is critical in protecting cells from toxic and carcinogenic insults and in maintaining cellular redox homeostasis. Activation of the Nrf2 pathway is primarily controlled by Kelch-like ECH-associated protein 1 (Keap1, which is a molecular switch that turns on or off the Nrf2 signaling pathway according to intracellular redox conditions. Here we report our finding of a novel Nrf2 suppressor ectodermal-neural cortex 1 (ENC1, which is a BTB-Kelch protein and belongs to the same family as Keap1. Transient expression of ENC1 reduced steady-state levels of Nrf2 and its downstream gene expression. Although ENC1 interacted with Keap1 indirectly, the ENC1-mediated down-regulation of Nrf2 was independent of Keap1. The negative effect of ENC1 on Nrf2 was not due to a change in the stability of Nrf2 because neither proteasomal nor lysosomal inhibitors had any effects. Overexpression of ENC1 did not result in a change in the level of Nrf2 mRNA, rather, it caused a decrease in the rate of Nrf2 protein synthesis. These results demonstrate that ENC1 functions as a negative regulator of Nrf2 through suppressing Nrf2 protein translation, which adds another level of complexity in controlling the Nrf2 signaling pathway.

  1. Direct Keap1-Nrf2 disruption as a potential therapeutic target for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Fiona Kerr

    2017-03-01

    Full Text Available Nrf2, a transcriptional activator of cell protection genes, is an attractive therapeutic target for the prevention of neurodegenerative diseases, including Alzheimer's disease (AD. Current Nrf2 activators, however, may exert toxicity and pathway over-activation can induce detrimental effects. An understanding of the mechanisms mediating Nrf2 inhibition in neurodegenerative conditions may therefore direct the design of drugs targeted for the prevention of these diseases with minimal side-effects. Our study provides the first in vivo evidence that specific inhibition of Keap1, a negative regulator of Nrf2, can prevent neuronal toxicity in response to the AD-initiating Aβ42 peptide, in correlation with Nrf2 activation. Comparatively, lithium, an inhibitor of the Nrf2 suppressor GSK-3, prevented Aβ42 toxicity by mechanisms independent of Nrf2. A new direct inhibitor of the Keap1-Nrf2 binding domain also prevented synaptotoxicity mediated by naturally-derived Aβ oligomers in mouse cortical neurons. Overall, our findings highlight Keap1 specifically as an efficient target for the re-activation of Nrf2 in AD, and support the further investigation of direct Keap1 inhibitors for the prevention of neurodegeneration in vivo.

  2. Prolonged fasting activates Nrf2 in post-weaned elephant seals.

    Science.gov (United States)

    Vázquez-Medina, José Pablo; Soñanez-Organis, José G; Rodriguez, Ruben; Viscarra, Jose A; Nishiyama, Akira; Crocker, Daniel E; Ortiz, Rudy M

    2013-08-01

    Elephant seals naturally experience prolonged periods of absolute food and water deprivation (fasting). In humans, rats and mice, prolonged food deprivation activates the renin-angiotensin system (RAS) and increases oxidative damage. In elephant seals, prolonged fasting activates RAS without increasing oxidative damage likely due to an increase in antioxidant defenses. The mechanism leading to the upregulation of antioxidant defenses during prolonged fasting remains elusive. Therefore, we investigated whether prolonged fasting activates the redox-sensitive transcription factor Nrf2, which controls the expression of antioxidant genes, and if such activation is potentially mediated by systemic increases in RAS. Blood and skeletal muscle samples were collected from seals fasting for 1, 3, 5 and 7 weeks. Nrf2 activity and nuclear content increased by 76% and 167% at week 7. Plasma angiotensin II (Ang II) and transforming growth factor β (TGF-β) were 5000% and 250% higher at week 7 than at week 1. Phosphorylation of Smad2, an effector of Ang II and TGF signaling, increased by 120% at week 7 and by 84% in response to intravenously infused Ang II. NADPH oxidase 4 (Nox4) mRNA expression, which is controlled by smad proteins, increased 430% at week 7, while Nox4 protein expression, which can activate Nrf2, was 170% higher at week 7 than at week 1. These results demonstrate that prolonged fasting activates Nrf2 in elephant seals and that RAS stimulation can potentially result in increased Nox4 through Smad phosphorylation. The results also suggest that Nox4 is essential to sustain the hormetic adaptive response to oxidative stress in fasting seals.

  3. NRF1 Is an ER Membrane Sensor that Is Central to Cholesterol Homeostasis.

    Science.gov (United States)

    Widenmaier, Scott B; Snyder, Nicole A; Nguyen, Truc B; Arduini, Alessandro; Lee, Grace Y; Arruda, Ana Paula; Saksi, Jani; Bartelt, Alexander; Hotamisligil, Gökhan S

    2017-11-16

    Cholesterol is a critical nutrient requiring tight constraint in the endoplasmic reticulum (ER) due to its uniquely challenging biophysical properties. While the mechanisms by which the ER defends against cholesterol insufficiency are well described, it remains unclear how the ER senses and effectively defends against cholesterol excess. Here, we identify the ER-bound transcription factor nuclear factor erythroid 2 related factor-1, Nrf1/Nfe2L1, as a critical mediator of this process. We show that Nrf1 directly binds to and specifically senses cholesterol in the ER through a defined domain and that cholesterol regulates Nrf1 turnover, processing, localization, and activity. In Nrf1 deficiency, in vivo cholesterol challenges induce massive hepatic cholesterol accumulation and damage, which is rescued by replacing Nrf1 exogenously. This Nrf1-mediated mechanism involves the suppression of CD36-driven inflammatory signaling and derepression of liver X receptor activity. These findings reveal Nrf1 as a guardian of cholesterol homeostasis and a core component of adaptive responses to excess cellular cholesterol. Copyright © 2017. Published by Elsevier Inc.

  4. Nrf2 Activation Protects against Solar-Simulated Ultraviolet Radiation in Mice and Humans.

    Science.gov (United States)

    Knatko, Elena V; Ibbotson, Sally H; Zhang, Ying; Higgins, Maureen; Fahey, Jed W; Talalay, Paul; Dawe, Robert S; Ferguson, James; Huang, Jeffrey T-J; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L; Honda, Tadashi; Proby, Charlotte M; Dinkova-Kostova, Albena T

    2015-06-01

    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative, and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity, and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated are lower than those that arise in their wild-type counterparts. Pharmacologic Nrf2 activation by topical biweekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacologic Nrf2 activation lowers the expression of the pro-inflammatory factors IL6 and IL1β, and COX2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate endpoint for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation. ©2015 American Association for Cancer Research.

  5. The Keap1-Nrf2 system in cancers: Stress response and anabolic metabolism

    Directory of Open Access Journals (Sweden)

    Yoichiro eMitsuishi

    2012-12-01

    Full Text Available The Keap1-Nrf2 pathway plays a central role in the protection of cells against oxidative and xenobiotic stresses. Nrf2 is a potent transcription activator that recognizes a unique DNA sequence known as the antioxidant response element (ARE. Under normal conditions, Nrf2 binds to Keap1 in the cytoplasm, resulting in proteasomal degradation. Following exposure to electrophiles or reactive oxygen species, Nrf2 becomes stabilized, translocates into the nucleus and activates the transcription of various cytoprotective genes. Increasing attention has been paid to the role of Nrf2 in cancer cells because the constitutive stabilization of Nrf2 has been observed in many human cancers with poor prognosis. Recent studies have shown that the antioxidant and detoxification activities of Nrf2 confer chemo- and radio-resistance to cancer cells. In this review, we provide an overview of the Keap1-Nrf2 system and discuss its role under physiological and pathological conditions, including cancers. We also introduce the results of our recent study describing Nrf2 function in the metabolism of cancer cells. Nrf2 likely confers a growth advantage to cancer cells through enhancing cytoprotection and anabolism. Finally, we discuss the possible impact of Nrf2 inhibitors on cancer therapy.

  6. Novel function of transcription factor Nrf2 as an inhibitor of RON tyrosine kinase receptor-mediated cancer cell invasion.

    Science.gov (United States)

    Thangasamy, Amalraj; Rogge, Jessica; Krishnegowda, Naveen K; Freeman, James W; Ammanamanchi, Sudhakar

    2011-09-16

    Recepteur d' origine nantais (RON), a tyrosine kinase receptor, is aberrantly expressed in human tumors and promotes cancer cell invasion. RON receptor activation is also associated with resistance to tamoxifen treatment in breast cancer cells. Nrf2 is a positive regulator of cytoprotective genes. Using chromatin immunoprecipitation (ChIP) and site-directed mutagenesis studies of the RON promoter, we identified Nrf2 as a negative regulator of RON gene expression. High Nrf2 and low RON expression was observed in normal mammary tissue whereas high RON and low or undetectable expression of Nrf2 was observed in breast tumors. The Nrf2 inducer sulforaphane (SFN) as well as ectopic Nrf2 expression or knock-down of the Nrf2 negative regulator keap1, which stabilizes Nrf2, inhibited RON expression and invasion of carcinoma cells. Consequently, our studies identified a novel functional role for Nrf2 as a "repressor" and RON kinase as a molecular target of SFN, which mediates the anti-tumor effects of SFN. These results are not limited to breast cancer cells since the Nrf2 inducer SFN stabilized Nrf2 and inhibited RON expression in carcinoma cells from various tumor types.

  7. The anti-oxidative transcription factor Nuclear factor E2 related factor-2 (Nrf2) counteracts TGF-β1 mediated growth inhibition of pancreatic ductal epithelial cells -Nrf2 as determinant of pro-tumorigenic functions of TGF-β1

    International Nuclear Information System (INIS)

    Genrich, Geeske; Kruppa, Marcus; Lenk, Lennart; Helm, Ole; Broich, Anna; Freitag-Wolf, Sandra; Röcken, Christoph; Sipos, Bence; Schäfer, Heiner; Sebens, Susanne

    2016-01-01

    Nuclear factor E2 related factor-2 (Nrf2) is an oxidative stress inducible transcription factor being essential in regulating cell homeostasis. Thus, acute induction of Nrf2 in epithelial cells exposed to inflammation confers protection from oxidative cell damage and mutagenesis supporting an anti-tumorigenic role for Nrf2. However, pancreatic ductal adenocarcinoma (PDAC) is characterized by persistent Nrf2 activity conferring therapy resistance which points to a pro-tumorigenic role of Nrf2. A similar dichotomous role in tumorigenesis is described for the Transforming Growth Factor-beta 1 (TGF-β1). The present study therefore aimed at elucidating whether the switch of Nrf2 function towards a tumor promoting one relates to the modulation of TGF-β1 induced cell responses and whether this might occur early in PDAC development. In situ analysis comprised immunohistochemical stainings of activated (phosphorylated) Nrf2 and Ki67 in pancreatic tissues containing normal ducts and pancreatic intraepithelial neoplasia (PanINs). In vitro, Nrf2 levels in benign (H6c7-pBp), premalignant (H6c7-kras) and malignant (Colo357) pancreatic ductal epithelial cells were modulated by Nrf2 specific siRNA or Nrf2 overexpression. Then, the effect of Nrf2 alone and in combination with TGF-β1 on cell growth and survival was investigated by cell counting, Ki67 staining and apoptosis assays. The underlying cell signaling was investigated by western blotting. Statistical analysis was performed by Shapiro-Wilk test for normal distribution. Parametric data were analyzed by one-way ANOVA, while non-parametric data were analyzed by Kruskal-Wallis one-way ANOVA on ranks. Significantly elevated expression of activated Nrf2 and Ki67 could be detected in PanINs but not in normal pancreatic ductal epithelium. While the effect of Nrf2 on basal cell growth of H6c7-pBp, H6c7-kras and Colo357 cells was minor, it clearly attenuated the growth inhibiting effects of TGF-β1 in all cell lines. This enhanced

  8. ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells.

    Science.gov (United States)

    Bao, Lingjie; Wu, Jianfa; Dodson, Matthew; Rojo de la Vega, Elisa Montserrat; Ning, Yan; Zhang, Zhenbo; Yao, Ming; Zhang, Donna D; Xu, Congjian; Yi, Xiaofang

    2017-06-01

    Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer cells, respectively. These two pairs of stable cell lines were then subjected to microarray analysis, where we identified 18 putative NRF2 target genes. Among these genes, ABCF2, a cytosolic member of the ABC superfamily of transporters, has previously been reported to contribute to chemoresistance in clear cell ovarian cancer. A detailed analysis on ABCF2 revealed a functional antioxidant response element (ARE) in its promoter region, establishing ABCF2 as an NRF2 target gene. Next, we investigated the contribution of ABCF2 in NRF2-mediated cisplatin resistance using our stable ovarian cancer cell lines. The NRF2-overexpressing cell line, containing high levels of ABCF2, was more resistant to cisplatin-induced apoptosis compared to its control cell line; whereas the NRF2 knockdown cell line with low levels of ABCF2, was more sensitive to cisplatin treatment than its control cell line. Furthermore, transient overexpression of ABCF2 in the parental cells decreased apoptosis and increased cell viability following cisplatin treatment. Conversely, knockdown of ABCF2 using specific siRNA notably increased apoptosis and decreased cell viability in cisplatin-resistant cells treated with cisplatin. This data indicate that the novel NRF2 target gene, ABCF2, plays a critical role in cisplatin resistance in ovarian cancer, and that targeting ABCF2 may be a new strategy to improve chemotherapeutic efficiency. © 2017 Wiley Periodicals, Inc.

  9. UVA Irradiation Enhances Brusatol-Mediated Inhibition of Melanoma Growth by Downregulation of the Nrf2-Mediated Antioxidant Response

    Science.gov (United States)

    Wang, Mei; Shi, Guangwei; Bian, Chunxiang; Nisar, Muhammad Farrukh; Guo, Yingying; Wu, Yan; Li, Wei; Huang, Xiao; Jiang, Xuemei; Bartsch, Jörg W.

    2018-01-01

    Brusatol (BR) is a potent inhibitor of Nrf2, a transcription factor that is highly expressed in cancer tissues and confers chemoresistance. UVA-generated reactive oxygen species (ROS) can damage both normal and cancer cells and may be of potential use in phototherapy. In order to provide an alternative method to treat the aggressive melanoma, we sought to investigate whether low-dose UVA with BR is more effective in eliminating melanoma cells than the respective single treatments. We found that BR combined with UVA led to inhibition of A375 melanoma cell proliferation by cell cycle arrest in the G1 phase and triggers cell apoptosis. Furthermore, inhibition of Nrf2 expression attenuated colony formation and tumor development from A375 cells in heterotopic mouse models. In addition, cotreatment of UVA and BR partially suppressed Nrf2 and its downstream target genes such as HO-1 along with the PI3K/AKT pathway. We propose that cotreatment increased ROS-induced cell cycle arrest and cellular apoptosis and inhibits melanoma growth by regulating the AKT-Nrf2 pathway in A375 cells which offers a possible therapeutic intervention strategy for the treatment of human melanoma. PMID:29670684

  10. The role of Nrf1 and Nrf2 in the regulation of glutathione and redox dynamics in the developing zebrafish embryo

    Directory of Open Access Journals (Sweden)

    Karilyn E. Sant

    2017-10-01

    Full Text Available Redox signaling is important for embryogenesis, guiding pathways that govern processes crucial for embryo patterning, including cell polarization, proliferation, and apoptosis. Exposure to pro-oxidants during this period can be deleterious, resulting in altered physiology, teratogenesis, later-life diseases, or lethality. We previously reported that the glutathione antioxidant defense system becomes increasingly robust, including a doubling of total glutathione and dynamic shifts in the glutathione redox potential at specific stages during embryonic development in the zebrafish, Danio rerio. However, the mechanisms underlying these changes are unclear, as is the effectiveness of the glutathione system in ameliorating oxidative insults to the embryo at different stages. Here, we examine how the glutathione system responds to the model pro-oxidants tert-butylhydroperoxide and tert-butylhydroquinone at different developmental stages, and the role of Nuclear factor erythroid 2-related factor (Nrf proteins in regulating developmental glutathione redox status. Embryos became increasingly sensitive to pro-oxidants after 72 h post-fertilization (hpf, after which the duration of the recovery period for the glutathione redox potential was increased. To determine whether the doubling of glutathione or the dynamic changes in glutathione redox potential are mediated by zebrafish paralogs of Nrf transcription factors, morpholino oligonucleotides were used to knock down translation of Nrf1 and Nrf2 (nrf1a, nrf1b, nrf2a, nrf2b. Knockdown of Nrf1a or Nrf1b perturbed glutathione redox state until 72 hpf. Knockdown of Nrf2 paralogs also perturbed glutathione redox state but did not significantly affect the response of glutathione to pro-oxidants. Nrf1b morphants had decreased gene expression of glutathione synthesis enzymes, while hsp70 increased in Nrf2b morphants. This work demonstrates that despite having a more robust glutathione system, embryos become more

  11. NRF2 Protection against Liver Injury Produced by Various Hepatotoxicants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2013-01-01

    Full Text Available To investigate the role of Nrf2 as a master defense against the hepatotoxicity produced by various chemicals, Nrf2-null, wild-type, Keap1-knock down (Keap1-Kd and Keap1-hepatocyte knockout (Keap1-HKO mice were used as a “graded Nrf2 activation” model. Mice were treated with 14 hepatotoxicants at appropriate doses, and blood and liver samples were collected thereafter (6 h to 7 days depending on the hepatotoxicant. Graded activation of Nrf2 offered a Nrf2-dependent protection against the hepatotoxicity produced by carbon tetrachloride, acetaminophen, microcystin, phalloidin, furosemide, cadmium, and lithocholic acid, as evidenced by serum alanine aminotransferase (ALT activities and by histopathology. Nrf2 activation also offered moderate protection against liver injury produced by ethanol, arsenic, bromobenzene, and allyl alcohol but had no effects on the hepatotoxicity produced by D-galactosamine/endotoxin and the Fas ligand antibody Jo-2. Graded Nrf2 activation reduced the expression of inflammatory genes (MIP-2, mKC, IL-1β, IL-6, and TNFα, oxidative stress genes (Ho-1, Egr1, ER stress genes (Gadd45 and Gadd153, and genes encoding cell death (Noxa, Bax, Bad, and caspase3. Thus, this study demonstrates that Nrf2 prevents the liver from many, but not all, hepatotoxicants. The Nrf2-mediated protection is accompanied by induction of antioxidant genes, suppression of inflammatory responses, and attenuation of oxidative stress.

  12. Role of Nrf2 antioxidant defense in mitigating cadmium-induced oxidative stress in the olfactory system of zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lu; Gallagher, Evan P., E-mail: evang3@uw.edu

    2013-01-15

    Exposure to trace metals can disrupt olfactory function in fish leading to a loss of behaviors critical to survival. Cadmium (Cd) is an olfactory toxicant that elicits cellular oxidative stress as a mechanism of toxicity while also inducing protective cellular antioxidant genes via activation of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway. However, the molecular mechanisms of Cd-induced olfactory injury have not been characterized. In the present study, we investigated the role of the Nrf2-mediated antioxidant defense pathway in protecting against Cd-induced olfactory injury in zebrafish. A dose-dependent induction of Nrf2-regulated antioxidant genes associated with cellular responses to oxidative stress was observed in the olfactory system of adult zebrafish following 24 h Cd exposure. Zebrafish larvae exposed to Cd for 3 h showed increased glutathione S-transferase pi (gst pi), glutamate–cysteine ligase catalytic subunit (gclc), heme oxygenase 1 (hmox1) and peroxiredoxin 1 (prdx1) mRNA levels indicative of Nrf2 activation, and which were blocked by morpholino-mediated Nrf2 knockdown. The inhibition of antioxidant gene induction in Cd-exposed Nrf2 morphants was associated with disruption of olfactory driven behaviors, increased cell death and loss of olfactory sensory neurons (OSNs). Nrf2 morphants also exhibited a downregulation of OSN-specific genes after Cd exposure. Pre-incubation of embryos with sulforaphane (SFN) partially protected against Cd-induced olfactory tissue damage. Collectively, our results indicate that oxidative stress is an important mechanism of Cd-mediated injury in the zebrafish olfactory system. Moreover, the Nrf2 pathway plays a protective role against cellular oxidative damage and is important in maintaining zebrafish olfactory function. -- Highlights: ► Oxidative stress is an important mechanism of Cd-mediated olfactory injury. ► Cd induces antioxidant gene expression in the zebrafish olfactory system. ► The

  13. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    International Nuclear Information System (INIS)

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang

    2013-01-01

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury

  14. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Xu [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Ren, Dongmei [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China); Wei, Xinbing; Shi, Huanying; Zhang, Xiumei [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Perez, Ruth G. [Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905 (United States); Lou, Haiyan, E-mail: louhaiyan@sdu.edu.cn [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Lou, Hongxiang [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China)

    2013-12-15

    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  15. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    International Nuclear Information System (INIS)

    Rigalli, Juan Pablo; Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa; Bataille, Amy Michele; Ghanem, Carolina Inés; Ruiz, María Laura; Manautou, José Enrique; Catania, Viviana Alicia

    2016-01-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  16. The trypanocidal benznidazole promotes adaptive response to oxidative injury: Involvement of the nuclear factor-erythroid 2-related factor-2 (Nrf2) and multidrug resistance associated protein 2 (MRP2)

    Energy Technology Data Exchange (ETDEWEB)

    Rigalli, Juan Pablo [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Department of Clinical Pharmacology and Pharmacoepidemiology, University of Heidelberg, Heidelberg (Germany); Perdomo, Virginia Gabriela; Ciriaci, Nadia; Francés, Daniel Eleazar Antonio; Ronco, María Teresa [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Bataille, Amy Michele [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Ghanem, Carolina Inés [Institute of Pharmacological Investigations (ININFA-CONICET), University of Buenos Aires, Buenos Aires (Argentina); Ruiz, María Laura [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Manautou, José Enrique [University of Connecticut, School of Pharmacy, Department of Pharmaceutical Sciences, Storrs, CT (United States); Catania, Viviana Alicia, E-mail: vcatania@fbioyf.unr.edu.ar [Institute of Experimental Physiology (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2016-08-01

    Oxidative stress is a frequent cause underlying drug-induced hepatotoxicity. Benznidazole (BZL) is the only trypanocidal agent available for treatment of Chagas disease in endemic areas. Its use is associated with side effects, including increases in biomarkers of hepatotoxicity. However, BZL potential to cause oxidative stress has been poorly investigated. Here, we evaluated the effect of a pharmacologically relevant BZL concentration (200 μM) at different time points on redox status and the counteracting mechanisms in the human hepatic cell line HepG2. BZL increased reactive oxygen species (ROS) after 1 and 3 h of exposure, returning to normality at 24 h. Additionally, BZL increased glutathione peroxidase activity at 12 h and the oxidized glutathione/total glutathione (GSSG/GSSG + GSH) ratio that reached a peak at 24 h. Thus, an enhanced detoxification of peroxide and GSSG formation could account for ROS normalization. GSSG/GSSG + GSH returned to control values at 48 h. Expression of the multidrug resistance-associated protein 2 (MRP2) and GSSG efflux via MRP2 were induced by BZL at 24 and 48 h, explaining normalization of GSSG/GSSG + GSH. BZL activated the nuclear erythroid 2-related factor 2 (Nrf2), already shown to modulate MRP2 expression in response to oxidative stress. Nrf2 participation was confirmed using Nrf2-knockout mice in which MRP2 mRNA expression was not affected by BZL. In summary, we demonstrated a ROS increase by BZL in HepG2 cells and a glutathione peroxidase- and MRP2 driven counteracting mechanism, being Nrf2 a key modulator of this response. Our results could explain hepatic alterations associated with BZL therapy. - Highlights: • BZL triggers a redox imbalance in the human hepatic cell line HepG2. • Concomitantly BZL triggers compensatory mechanisms to alleviate the redox injury. • Response mechanisms comprise an enhanced glutathione peroxidase and MRP2 activity. • Transcription factor Nrf2 plays a key role orchestrating

  17. Pyrrolidine dithiocarbamate activates the Nrf2 pathway in astrocytes.

    Science.gov (United States)

    Liddell, Jeffrey R; Lehtonen, Sarka; Duncan, Clare; Keksa-Goldsteine, Velta; Levonen, Anna-Liisa; Goldsteins, Gundars; Malm, Tarja; White, Anthony R; Koistinaho, Jari; Kanninen, Katja M

    2016-02-26

    Endogenous defense against oxidative stress is controlled by nuclear factor erythroid 2-related factor 2 (Nrf2). The normal compensatory mechanisms to combat oxidative stress appear to be insufficient to protect against the prolonged exposure to reactive oxygen species during disease. Counterbalancing the effects of oxidative stress by up-regulation of Nrf2 signaling has been shown to be effective in various disease models where oxidative stress is implicated, including Alzheimer's disease. Stimulation of Nrf2 signaling by small-molecule activators is an appealing strategy to up-regulate the endogenous defense mechanisms of cells. Here, we investigate Nrf2 induction by the metal chelator and known nuclear factor-κB inhibitor pyrrolidine dithiocarbamate (PDTC) in cultured astrocytes and neurons, and mouse brain. Nrf2 induction is further examined in cultures co-treated with PDTC and kinase inhibitors or amyloid-beta, and in Nrf2-deficient cultures. We show that PDTC is a potent inducer of Nrf2 signaling specifically in astrocytes and demonstrate the critical role of Nrf2 in PDTC-mediated protection against oxidative stress. This induction appears to be regulated by both Keap1 and glycogen synthase kinase 3β. Furthermore, the presence of amyloid-beta magnifies PDTC-mediated induction of endogenous protective mechanisms, therefore suggesting that PDTC may be an effective Nrf2 inducer in the context of Alzheimer's disease. Finally, we show that PDTC increases brain copper content and glial expression of heme oxygenase-1, and decreases lipid peroxidation in vivo, promoting a more antioxidative environment. PDTC activates Nrf2 and its antioxidative targets in astrocytes but not neurons. These effects may contribute to the neuroprotection observed for PDTC in models of Alzheimer's disease.

  18. Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene

    Science.gov (United States)

    2012-01-01

    Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

  19. Aldose Reductase Inhibitor Protects against Hyperglycemic Stress by Activating Nrf2-Dependent Antioxidant Proteins.

    Science.gov (United States)

    Shukla, Kirtikar; Pal, Pabitra Bikash; Sonowal, Himangshu; Srivastava, Satish K; Ramana, Kota V

    2017-01-01

    We have shown earlier that pretreatment of cultured cells with aldose reductase (AR) inhibitors prevents hyperglycemia-induced mitogenic and proinflammatory responses. However, the effects of AR inhibitors on Nrf2-mediated anti-inflammatory responses have not been elucidated yet. We have investigated how AR inhibitor fidarestat protects high glucose- (HG-) induced cell viability changes by increasing the expression of Nrf2 and its dependent phase II antioxidant enzymes. Fidarestat pretreatment prevents HG (25 mM)-induced Thp1 monocyte viability. Further, treatment of Thp1 monocytes with fidarestat caused a time-dependent increase in the expression as well as the DNA-binding activity of Nrf2. In addition, fidarestat augmented the HG-induced Nrf2 expression and activity and also upregulated the expression of Nrf2-dependent proteins such as hemeoxygenase-1 (HO1) and NQO1 in Thp1 cells. Similarly, treatment with AR inhibitor also induced the expression of Nrf2 and HO1 in STZ-induced diabetic mice heart and kidney tissues. Further, AR inhibition increased the HG-induced expression of antioxidant enzymes such as SOD and catalase and activation of AMPK- α 1 in Thp1 cells. Our results thus suggest that pretreatment with AR inhibitor prepares the monocytes against hyperglycemic stress by overexpressing the Nrf2-dependent antioxidative proteins.

  20. Soybean-Derived Phytoalexins Improve Cognitive Function through Activation of Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo

    2018-01-01

    Full Text Available As soy-derived glyceollins are known to induce antioxidant enzymes in various types of cells and tissues, we hypothesized that the compounds could protect neurons from damage due to reactive oxygen species (ROS. In order to examine the neuroprotective effect of glyceollins, primary cortical neurons collected from mice and mouse hippocampal HT22 cells were challenged with glutamate. Glyceollins attenuated glutamate-induced cytotoxicity in primary cortical neuron isolated from mice carrying wild-type nuclear factor (erythroid-derived 2-like 2 (Nrf2, but the compounds were ineffective in those isolated from Nrf2 knockout mice, suggesting the involvement of the Nrf2 signaling pathway in glyceollin-mediated neuroprotection. Furthermore, the inhibition of heme oxygenase-1 (HO-1, a major downstream enzyme of Nrf2, abolished the suppressive effect of glyceollins against glutamate-induced ROS production and cytotoxicity, confirming that activation of HO-1 by glyceollins is responsible for the neuroprotection. To examine whether glyceollins also improve cognitive ability, mice pretreated with glyceollins were challenged with scopolamine and subjected to behavioral tests. Glyceollins attenuated scopolamine-induced cognitive impairment of mice, but failed to enhance memory in Nrf2 knockout mice, suggesting that the memory-enhancing effect is also mediated by the Nrf2 signaling pathway. Overall, glyceollins showed neuroprotection against glutamate-induced damage, and attenuated scopolamine-induced memory deficits in an Nrf2-dependent manner.

  1. Nrf2 protects human bladder urothelial cells from arsenite and monomethylarsonous acid toxicity

    International Nuclear Information System (INIS)

    Wang Xiaojun; Sun Zheng; Chen Weimin; Eblin, Kylee E.; Gandolfi, Jay A.; Zhang, Donna D.

    2007-01-01

    Arsenic is widely spread in our living environment and imposes a big challenge on human health worldwide. Arsenic damages biological systems through multiple mechanisms including the generation of reactive oxygen species. The transcription factor Nrf2 regulates the cellular antioxidant response that protects cells from various insults. In this study, the protective role of Nrf2 in arsenic toxicity was investigated in a human bladder urothelial cell line, UROtsa. Using a UROtsa cell line stably infected with Nrf2-siRNA, we clearly demonstrate that compromised Nrf2 expression sensitized the cells to As(III)- and MMA(III)-induced toxicity. On the other hand, the activation of the Nrf2 pathway by tert-butylhydroquinone (tBHQ) and sulforaphane (SF), the known Nrf2-inducers, rendered UROtsa cells more resistant to As(III) and MMA(III). Furthermore, the wild-type mouse embryo fibroblast (WT-MEF) cells were protected from As(III)- and MMA(III)-induced toxicity following Nrf2 activation by tBHQ or SF, whereas neither tBHQ nor SF conferred protection in the Nrf2 -/- MEF cells, demonstrating that tBHQ- or SF-mediated protection against As(III)- and MMA(III)-induced toxicity depends on Nrf2 activation. These results, obtained by both loss of function and gain of function analyses, clearly demonstrate the protective role of Nrf2 in arsenic-induced toxicity. The current work lays the groundwork for using Nrf2 activators for therapeutic and dietary interventions against adverse effects of arsenic

  2. Aldose Reductase Inhibitor Protects against Hyperglycemic Stress by Activating Nrf2-Dependent Antioxidant Proteins

    Directory of Open Access Journals (Sweden)

    Kirtikar Shukla

    2017-01-01

    Full Text Available We have shown earlier that pretreatment of cultured cells with aldose reductase (AR inhibitors prevents hyperglycemia-induced mitogenic and proinflammatory responses. However, the effects of AR inhibitors on Nrf2-mediated anti-inflammatory responses have not been elucidated yet. We have investigated how AR inhibitor fidarestat protects high glucose- (HG- induced cell viability changes by increasing the expression of Nrf2 and its dependent phase II antioxidant enzymes. Fidarestat pretreatment prevents HG (25 mM-induced Thp1 monocyte viability. Further, treatment of Thp1 monocytes with fidarestat caused a time-dependent increase in the expression as well as the DNA-binding activity of Nrf2. In addition, fidarestat augmented the HG-induced Nrf2 expression and activity and also upregulated the expression of Nrf2-dependent proteins such as hemeoxygenase-1 (HO1 and NQO1 in Thp1 cells. Similarly, treatment with AR inhibitor also induced the expression of Nrf2 and HO1 in STZ-induced diabetic mice heart and kidney tissues. Further, AR inhibition increased the HG-induced expression of antioxidant enzymes such as SOD and catalase and activation of AMPK-α1 in Thp1 cells. Our results thus suggest that pretreatment with AR inhibitor prepares the monocytes against hyperglycemic stress by overexpressing the Nrf2-dependent antioxidative proteins.

  3. Andrographolide protects liver cells from H2O2 induced cell death by upregulation of Nrf-2/HO-1 mediated via adenosine A2a receptor signalling.

    Science.gov (United States)

    Mittal, Smriti P K; Khole, Swati; Jagadish, Nidhi; Ghosh, Debjani; Gadgil, Vijay; Sinkar, Vilas; Ghaskadbi, Saroj S

    2016-11-01

    Andrographolide, principle constituent of Andrographis paniculata Nees is used in traditional medicine in Southeast Asia and is known to exhibit various biological activities. Its antioxidant activity is due to its ability to activate one of the antioxidant enzymes, heme oxygenase-1 (HO-1) which is regulated transcriptionally through Nrf-2. However, molecular mechanism underlying activation of Nrf-2/HO-1 has not yet been clearly understood. Protective effect of andrographolide against H2O2 induced cell death, reactive oxygen species and lipid peroxidation was observed in HepG2 cells. Ability of andrographolide to modulate G-protein coupled receptor (GPCR) mediated signalling was determined using in silico docking and gene expression was analyzed by qRT-PCR, confocal microscopy and western blot analysis. We clearly show that andrographolide via adenosine A2A receptor signalling leads to activation of p38 MAP kinase, resulting in upregulation of Nrf-2, its translocation to nucleus and activation of HO-1. Additionally, it activates adenylate cyclase resulting in cAMP formation which in turn activates protein kinase A leading to inhibition of GSK-3β by phosphorylation. Inactivated GSK-3β leads to retention of Nrf-2 in the nucleus leading to sustained expression of HO-1 by binding to its antioxidant response element (ARE). Thus, andrographolide probably by binding to adenosine A2a receptor activates Nrf-2 transcription and also inhibits its exclusion from the nucleus by inactivating GSK-3β, together resulting in activation of HO-1. We speculate that andrographolide can be used as a therapeutic drug to combat oxidative stress implicated in pathogenesis of various diseases such as diabetes, osteoporosis, neurodegenerative diseases etc. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Melatonin Attenuates Memory Impairment Induced by Klotho Gene Deficiency Via Interactive Signaling Between MT2 Receptor, ERK, and Nrf2-Related Antioxidant Potential

    Science.gov (United States)

    Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun

    2015-01-01

    Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID

  5. Nrf2 protects against 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced oxidative injury and steatohepatitis

    International Nuclear Information System (INIS)

    Lu Hong; Cui Wei; Klaassen, Curtis D.

    2011-01-01

    Previous studies demonstrate that Nrf2, a master regulator of antioxidative responses, is essential in mediating induction of many antioxidative enzymes by acute activation of the AhR. However, the role of Nrf2 in protecting against oxidative stress and DNA damage induced by sustained activation of the AhR remains unknown and was investigated herein. Tissue and blood samples were collected from wild-type (WT) and Nrf2-null mice 21 days after administration of a low-toxic dose (10 μg/kg ip) of TCDD. Only Nrf2-null mice lost body weight after TCDD treatment; however, blood levels of ALT were not markedly changed in either genotype, indicating a lack of extensive necrosis. Compared to livers of TCDD-treated WT mice, livers of TCDD-treated Nrf2-null mice had: 1) degenerated hepatocytes, lobular inflammation, marked fat accumulation, and higher mRNA expression of inflammatory and fibrotic genes; 2) depletion of glutathione, elevation in lipid peroxidation and marker of DNA damage; 3) attenuated induction of phase-II enzymes Nqo1, Gsta1/2, and Ugt2b35 mRNAs, but higher induction of cytoprotective Ho-1, Prdx1, Trxr1, Gclc, and Epxh1 mRNAs; 4) higher mRNA expression of Fgf21 and triglyceride-synthesis genes, but down-regulation of bile-acid-synthesis genes and cholesterol-efflux transporters; and 5) trend of induction/activation of c-jun and NF-kB. Additionally, TCDD-treated Nrf2-null mice had impaired adipogenesis in white adipose tissue. In conclusion, Nrf2 protects livers of mice against oxidative stress, DNA damage, and steatohepatitis induced by TCDD-mediated sustained activation of the AhR. The aggravated hepatosteatosis in TCDD-treated Nrf2-null mice is due to increased lipogenesis in liver and impaired lipogenesis in white adipose tissue. - Highlights: → TCDD causes hepatosteatosis and induction of Nrf2-target genes in wild-type mice. → TCDD causes weight loss, oxidative injury, and steatohepatitis in Nrf2-null mice. → Livers of TCDD-treated Nrf2-null mice

  6. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kaijun [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Jiang, Yiqian [The First People Hospital of Xiaoshan, Hangzhou (China); Wang, Wei; Ma, Jian [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Chen, Min, E-mail: eyedrchenminzj@163.com [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China)

    2015-12-25

    Here we explored the anti-oxidative and cytoprotective potentials of escin, a natural triterpene-saponin, against hydrogen peroxide (H{sub 2}O{sub 2}) in retinal pigment epithelium (RPE) cells. We showed that escin remarkably attenuated H{sub 2}O{sub 2}-induced death and apoptosis of established (ARPE-19) and primary murine RPE cells. Meanwhile, ROS production and lipid peroxidation by H{sub 2}O{sub 2} were remarkably inhibited by escin. Escin treatment in RPE cells resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by transcription of anti-oxidant-responsive element (ARE)-regulated genes, including HO-1, NQO-1 and SRXN-1. Knockdown of Nrf2 through targeted shRNAs/siRNAs alleviated escin-mediated ARE gene transcription, and almost abolished escin-mediated anti-oxidant activity and RPE cytoprotection against H{sub 2}O{sub 2}. Reversely, escin was more potent against H{sub 2}O{sub 2} damages in Nrf2-over-expressed ARPE-19 cells. Further studies showed that escin-induced Nrf2 activation in RPE cells required AKT signaling. AKT inhibitors (LY294002 and perifosine) blocked escin-induced AKT activation, and dramatically inhibited Nrf2 phosphorylation, its cytosol accumulation and nuclear translocation in RPE cells. Escin-induced RPE cytoprotection against H{sub 2}O{sub 2} was also alleviated by the AKT inhibitors. Together, these results demonstrate that escin protects RPE cells from oxidative stress possibly through activating AKT-Nrf2 signaling.

  7. Alkylating Agent-Induced NRF2 Blocks Endoplasmic Reticulum Stress-Mediated Apoptosis via Control of Glutathione Pools and Protein Thiol Homeostasis.

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V Pragathi; Loranc, Eva; Tonapi, Sonal S; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C F; Chen, Yidong; Bishop, Alexander J R

    2016-12-01

    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis, and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival, an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine or glutathione-ethyl-ester, decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 target overexpression and poor survival. In KEAP1-mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. Mol Cancer Ther; 15(12); 3000-14. ©2016 AACR. ©2016 American Association for Cancer Research.

  8. Alkylating agent induced NRF2 blocks endoplasmic reticulum stress-mediated apoptosis via control of glutathione pools and protein thiol homeostasis

    Science.gov (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V. Pragathi; Loranc, Eva; Tonapi, Sonal S.; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C. F.; Chen, Yidong; Bishop, Alexander J. R.

    2016-01-01

    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival; an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine (BSO) caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine (NAC) or glutathione-ethyl-ester (GSH-E), decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 targets overexpression and poor survival. In KEAP1 mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. PMID:27638861

  9. Antioxidant-mediated up-regulation of OGG1 via NRF2 induction is associated with inhibition of oxidative DNA damage in estrogen-induced breast cancer

    International Nuclear Information System (INIS)

    Singh, Bhupendra; Chatterjee, Anwesha; Ronghe, Amruta M; Bhat, Nimee K; Bhat, Hari K

    2013-01-01

    Estrogen metabolism-mediated oxidative stress is suggested to play an important role in estrogen-induced breast carcinogenesis. We have earlier demonstrated that antioxidants, vitamin C (Vit C) and butylated hydroxyanisole (BHA) inhibit 17β-estradiol (E2)-mediated oxidative stress and oxidative DNA damage, and breast carcinogenesis in female August Copenhagen Irish (ACI) rats. The objective of the present study was to characterize the mechanism by which above antioxidants prevent DNA damage during breast carcinogenesis. Female ACI rats were treated with E2; Vit C; Vit C + E2; BHA; and BHA + E2 for up to 240 days. mRNA and protein levels of a DNA repair enzyme 8-Oxoguanine DNA glycosylase (OGG1) and a transcription factor NRF2 were quantified in the mammary and mammary tumor tissues of rats after treatment with E2 and compared with that of rats treated with antioxidants either alone or in combination with E2. The expression of OGG1 was suppressed in mammary tissues and in mammary tumors of rats treated with E2. Expression of NRF2 was also significantly suppressed in E2-treated mammary tissues and in mammary tumors. Vitamin C or BHA treatment prevented E2-mediated decrease in OGG1 and NRF2 levels in the mammary tissues. Chromatin immunoprecipitation analysis confirmed that antioxidant-mediated induction of OGG1 was through increased direct binding of NRF2 to the promoter region of OGG1. Studies using silencer RNA confirmed the role of OGG1 in inhibition of oxidative DNA damage. Our studies suggest that antioxidants Vit C and BHA provide protection against oxidative DNA damage and E2-induced mammary carcinogenesis, at least in part, through NRF2-mediated induction of OGG1

  10. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han

    2015-01-01

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death

  11. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-09-25

    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.

  12. The rise of antioxidant signaling-The evolution and hormetic actions of Nrf2

    International Nuclear Information System (INIS)

    Maher, Jonathan; Yamamoto, Masayuki

    2010-01-01

    Organisms have evolved sophisticated and redundant mechanisms to manage oxidative and electrophilic challenges that arise from internal metabolism or xenobiotic challenge for survival. NF-E2-related factor 2 (Nrf2) is a transcription factor that has evolved over millennia from primitive origins, with homologues traceable back to invertebrate Caenorhabditis and Drosophila species. The ancestry of Nrf2 clearly has deep-seated roots in hematopoiesis, yet has diversified into a transcription factor that can mediate a multitude of antioxidant signaling and detoxification genes. In higher organisms, a more sophisticated means of tightly regulating Nrf2 activity was introduced via the cysteine-rich kelch-like ECH-associated protein 1 (Keap1), thus suggesting a need to modulate Nrf2 activity. This is evidenced in Keap1 -/- mice, which succumb to juvenile mortality due to hyperkeratosis of the gastrointestinal tract. Although Nrf2 activation protects against acute toxicity and prevents or attenuates several disease states, constitutive activation in some tumors leads to poor clinical outcomes, suggesting Nrf2 has evolved in response to a multitude of selective pressures. The purpose of this review is to examine the origins of Nrf2, while highlighting the versatility and protective abilities elicited upon activation. Various model systems in which Nrf2 is normally beneficial but in which exaggerated pharmacology exacerbates a physiological or pathological condition will be addressed. Although Darwinian principles have selected Nrf2 activity for maximal beneficial effect based on environmental and oxidative challenge, both sub- or super-physiological effects have been noted to be detrimental. The functions of Nrf2 thus suggest a hormetic factor that has evolved empirically over time.

  13. Nrf2 and regulation of the antioxidant system in the Antarctic silverfish, Pleuragramma antarctica: Adaptation to environmental changes of pro-oxidant pressure.

    Science.gov (United States)

    Giuliani, Maria Elisa; Benedetti, Maura; Nigro, Marco; Regoli, Francesco

    2017-08-01

    Despite the key importance of Nrf2-Keap1 in regulating antioxidant system in vertebrates, this system is still poorly investigated in marine species. The present study focused on the Antarctic silverfish Pleuragramma antarctica which, during the final phases of embryo development in platelet ice, is challenged by a sudden enhancement of environmental oxidative conditions associated to ice melting. Partial coding sequences were identified for Nrf2, its repressor Keap1 and for typical Nrf2-target antioxidant genes, like catalase, glutathione peroxidase isoform 1 and Cu/Zn-dependent superoxide dismutase. Compared to temperate homologues, the protein sequences showed an elevated conservation of amino acids essential for catalytic functions, while a few specific substitutions in non-essential regions may represent a molecular adaptation to improve flexibility and accessibility to active site at cold temperatures. The role of the Nrf2-Keap1 pathway in modulating the activation of antioxidant defences was demonstrated at both transcriptional and functional levels with a clear temporal increase of antioxidant protection in embryos before the hatching. Such findings confirm the importance of Nrf2 and highlight regulation of antioxidants as an adaptive strategy in P. antarctica to protect the early life stages toward the environmental changes of pro-oxidant pressure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Andrographolide induces Nrf2 and heme oxygenase 1 in astrocytes by activating p38 MAPK and ERK.

    Science.gov (United States)

    Wong, Siew Ying; Tan, Michelle G K; Wong, Peter T H; Herr, Deron R; Lai, Mitchell K P

    2016-09-23

    Andrographolide is the major labdane diterpenoid originally isolated from Andrographis paniculata and has been shown to have anti-inflammatory and antioxidative effects. However, there is a dearth of studies on the potential therapeutic utility of andrographolide in neuroinflammatory conditions. Here, we aimed to investigate the mechanisms underlying andrographolide's effect on the expression of anti-inflammatory and antioxidant heme oxygenase-1 (HO-1) in primary astrocytes. Measurements of the effects of andrograholide on antioxidant HO-1 and its transcription factor, Nrf2, include gene expression, protein turnover, and activation of putative signaling regulators. Andrographolide potently activated Nrf2 and also upregulated HO-1 expression in primary astrocytes. Andrographolide's effects on Nrf2 seemed to be biphasic, with acute (within 1 h) reductions in Nrf2 ubiquitination efficiency and turnover rate, followed by upregulation of Nrf2 mRNA between 8 and 24 h. The acute regulation of Nrf2 by andrographolide seemed to be independent of Keap1 and partly mediated by p38 MAPK and ERK signaling. These data provide further insights into the mechanisms underlying andrographolide's effects on astrocyte-mediated antioxidant, and anti-inflammatory responses and support the further assessment of andrographolide as a potential therapeutic for neurological conditions in which oxidative stress and neuroinflammation are implicated.

  15. Sinomenine attenuates renal fibrosis through Nrf2-mediated inhibition of oxidative stress and TGFβ signaling

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Tian [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Yin, Shasha; Yang, Jun; Zhang, Qin; Liu, Yangyang [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China); Huang, Fengjie, E-mail: hfj@cpu.edu.cn [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Cao, Wangsen, E-mail: wangsencao@nju.edu.cn [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China)

    2016-08-01

    Renal fibrosis is the common feature of chronic kidney disease and mainly mediated by TGFβ-associated pro-fibrogenic signaling, which causes excessive extracellular matrix accumulation and successive loss of kidney functions. Sinomenine (SIN), an alkaloid derived from medicinal herb extensively used in treatment of rheumatoid arthritis and various inflammatory disorders, displays renal protective properties in experimental animals; however its pharmacological potency against renal fibrosis is not explored. In this study we report that SIN possesses strong anti-renal fibrosis functions in kidney cell and in mouse fibrotic kidney. SIN beneficially modulated the pro-fibrogenic protein expression in TGFβ-treated kidney cells and attenuated the renal fibrotic pathogenesis incurred by unilateral ureteral obstruction (UUO), which correlated with its activation of Nrf2 signaling - the key defender against oxidative stress with anti-fibrotic potentials. Further investigation on its regulation of Nrf2 downstream events revealed that SIN significantly balanced oxidative stress via improving the expression and activity of anti-oxidant and detoxifying enzymes, and interrupted the pro-fibrogenic signaling of TGFβ/Smad and Wnt/β-catenin. Even more impressively SIN achieved its anti-fibrotic activities in an Nrf2-dependent manner, suggesting that SIN regulation of Nrf2-associated anti-fibrotic activities constitutes a critical component of SIN's renoprotective functions. Collectively our studies have demonstrated a novel anti-fibrotic property of SIN and its upstream events and provided a molecular basis for SIN's potential applications in treatment of renal fibrosis-associated kidney disorders. - Highlights: • Sinomenine has strong potency of inhibiting renal fibrosis in UUO mouse kidney. • Sinomenine attenuates the expression of profibrogenic proteins. • Sinomenine balances renal fibrosis-associated oxidative stress. • Sinomenine mitigates profibrogenic

  16. Shanxi Aged Vinegar Protects against Alcohol-Induced Liver Injury via Activating Nrf2-Mediated Antioxidant and Inhibiting TLR4-Induced Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ting Xia

    2018-06-01

    Full Text Available Shanxi aged vinegar (SAV is a typical fermented and antioxidant food, which has various health-promoting effects. This work aimed to explore the effects of SAV on alcohol-induced liver injury. A mice model of alcoholic liver injury was established to illuminate its potential mechanisms. All mice pretreated with SAV and then received an ethanol solution (50% w/v, 4.8 g/kg b.w.. The results showed that SAV ameliorated alcohol-induced histological changes and elevation of liver enzymes. SAV attenuated alcohol-induced oxidative stress by declining levels of hepatic oxidants, and restoring depletion of antioxidant enzyme activities in mice livers. Moreover, SAV alleviated alcohol-induced oxidative damage by activating nuclear factor erythroid-2-related factor 2 (Nrf2-mediated signal pathway. In addition, SAV prevented alcohol-induced inflammation by suppressing lipopolysaccharide (LPS level and activities of pro-inflammatory enzymes, and regulating inflammatory cytokines. SAV inhibited alcohol-induced inflammation through down-regulating the expression of Toll-like receptor 4 (TLR4-mediated inflammatory response. The findings provide crucial evidence for elucidating the hepatoprotective mechanisms of SAV and encourage the future application of SAV as a functional food for liver protection.

  17. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Juanjuan, E-mail: jwu32@emory.edu [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Williams, Devin [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Walter, Grant A. [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Thompson, Winston E. [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Sidell, Neil [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States)

    2014-11-01

    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  18. Metformin inhibits heme oxygenase-1 expression in cancer cells through inactivation of Raf-ERK-Nrf2 signaling and AMPK-independent pathways

    International Nuclear Information System (INIS)

    Do, Minh Truong; Kim, Hyung Gyun; Khanal, Tilak; Choi, Jae Ho; Kim, Dong Hee; Jeong, Tae Cheon; Jeong, Hye Gwang

    2013-01-01

    Resistance to therapy is the major obstacle to more effective cancer treatment. Heme oxygenase-1 (HO-1) is often highly up-regulated in tumor tissues, and its expression is further increased in response to therapies. It has been suggested that inhibition of HO-1 expression is a potential therapeutic approach to sensitize tumors to chemotherapy and radiotherapy. In this study, we tested the hypothesis that the anti-tumor effects of metformin are mediated by suppression of HO-1 expression in cancer cells. Our results indicate that metformin strongly suppresses HO-1 mRNA and protein expression in human hepatic carcinoma HepG2, cervical cancer HeLa, and non-small-cell lung cancer A549 cells. Metformin also markedly reduced Nrf2 mRNA and protein levels in whole cell lysates and suppressed tert-butylhydroquinone (tBHQ)-induced Nrf2 protein stability and antioxidant response element (ARE)-luciferase activity in HepG2 cells. We also found that metformin regulation of Nrf2 expression is mediated by a Keap1-independent mechanism and that metformin significantly attenuated Raf-ERK signaling to suppress Nrf2 expression in cancer cells. Inhibition of Raf-ERK signaling by PD98059 decreased Nrf2 mRNA expression in HepG2 cells, confirming that the inhibition of Nrf2 expression is mediated by an attenuation of Raf-ERK signaling in cancer cells. The inactivation of AMPK by siRNA, DN-AMPK or the pharmacological AMPK inhibitor compound C, revealed that metformin reduced HO-1 expression in an AMPK-independent manner. These results highlight the Raf-ERK-Nrf2 axis as a new molecular target in anticancer therapy in response to metformin treatment. - Highlights: • Metformin inhibits HO-1 expression in cancer cells. • Metformin attenuates Raf-ERK-Nrf2 signaling. • Suppression of HO-1 by metformin is independent of AMPK. • HO-1 inhibition contributes to anti-proliferative effects of metformin

  19. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jae Yun [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Seung Sik [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Da Eon [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Bang, Joon Seok [Graduate School of Clinical Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Jung, Young Suk [College of Pharmacy, Pusan National University, Busan (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)

    2015-08-15

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  20. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    International Nuclear Information System (INIS)

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan

    2015-01-01

    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  1. DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model

    Directory of Open Access Journals (Sweden)

    Huimin eCao

    2016-01-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.

  2. Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis

    Science.gov (United States)

    Malhotra, Deepti; Portales-Casamar, Elodie; Singh, Anju; Srivastava, Siddhartha; Arenillas, David; Happel, Christine; Shyr, Casper; Wakabayashi, Nobunao; Kensler, Thomas W.; Wasserman, Wyeth W.; Biswal, Shyam

    2010-01-01

    The Nrf2 (nuclear factor E2 p45-related factor 2) transcription factor responds to diverse oxidative and electrophilic environmental stresses by circumventing repression by Keap1, translocating to the nucleus, and activating cytoprotective genes. Nrf2 responses provide protection against chemical carcinogenesis, chronic inflammation, neurodegeneration, emphysema, asthma and sepsis in murine models. Nrf2 regulates the expression of a plethora of genes that detoxify oxidants and electrophiles and repair or remove damaged macromolecules, such as through proteasomal processing. However, many direct targets of Nrf2 remain undefined. Here, mouse embryonic fibroblasts (MEF) with either constitutive nuclear accumulation (Keap1−/−) or depletion (Nrf2−/−) of Nrf2 were utilized to perform chromatin-immunoprecipitation with parallel sequencing (ChIP-Seq) and global transcription profiling. This unique Nrf2 ChIP-Seq dataset is highly enriched for Nrf2-binding motifs. Integrating ChIP-Seq and microarray analyses, we identified 645 basal and 654 inducible direct targets of Nrf2, with 244 genes at the intersection. Modulated pathways in stress response and cell proliferation distinguish the inducible and basal programs. Results were confirmed in an in vivo stress model of cigarette smoke-exposed mice. This study reveals global circuitry of the Nrf2 stress response emphasizing Nrf2 as a central node in cell survival response. PMID:20460467

  3. Different roles of ROS and Nrf2 in Cr(VI)-induced inflammatory responses in normal and Cr(VI)-transformed cells

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Ram Vinod; Pratheeshkumar, Poyil; Son, Yong-Ok; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Divya, Sasidharan Padmaja; Zhang, Zhuo [Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Shi, Xianglin, E-mail: xshi5@email.uky.edu [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)

    2016-09-15

    Hexavalent chromium (Cr(VI)) is classified as a human carcinogen. Cr(VI) has been associated with adenocarcinomas and squamous cell carcinoma of the lung. The present study shows that acute Cr(VI) treatment in human bronchial epithelial cells (BEAS-2B) increased inflammatory responses (TNF-α, COX-2, and NF-кB/p65) and expression of Nrf2. Cr(VI)-induced generation of reactive oxygen species (ROS) are responsible for increased inflammation. Despite the fact that Nrf2 is a master regulator of response to oxidative stress, silencing of Nrf2 in the acute Cr(VI) treatment had no effect on Cr(VI)-induced inflammation. In contrast, in Cr(VI)-transformed (CrT) cells, Nrf2 is constitutively activated. Knock-down of this protein resulted in decreased inflammation, while silencing of SOD2 and CAT had no effect in the expression of these inflammatory proteins. Results obtained from the knock-down of Nrf2 in CrT cells are very different from the results obtained in the acute Cr(VI) treatment. In BEAS-2B cells, knock-down of Nrf2 had no effect in the inflammation levels, while in CrT cells a decrease in the expression of inflammation markers was observed. These results indicate that before transformation, ROS plays a critical role while Nrf2 not in Cr(VI)-induced inflammation, whereas after transformation (CrT cells), Nrf2 is constitutively activated and this protein maintains inflammation while ROS not. Constitutively high levels of Nrf2 in CrT binds to the promoter regions of COX-2 and TNF-α, leading to increased inflammation. Collectively, our results demonstrate that before cell transformation ROS are important in Cr(VI)-induced inflammation and after transformation a constitutively high level of Nrf2 is important. - Highlights: • Cr(VI)-induced ROS increased inflammation, while Nrf2 had no effect. • In the CrT cells knock-down of Nrf2 resulted in decreased inflammation. • Mechanistic differences in regulating Cr(VI)-induced inflammation.

  4. Activation of glutathione peroxidase via Nrf1 mediates genistein's protection against oxidative endothelial cell injury

    International Nuclear Information System (INIS)

    Hernandez-Montes, Eva; Pollard, Susan E.; Vauzour, David; Jofre-Montseny, Laia; Rota, Cristina; Rimbach, Gerald; Weinberg, Peter D.; Spencer, Jeremy P.E.

    2006-01-01

    Cellular actions of isoflavones may mediate the beneficial health effects associated with high soy consumption. We have investigated protection by genistein and daidzein against oxidative stress-induced endothelial injury. Genistein but not daidzein protected endothelial cells from damage induced by oxidative stress. This protection was accompanied by decreases in intracellular glutathione levels that could be explained by the generation of glutathionyl conjugates of the oxidised genistein metabolite, 5,7,3',4'-tetrahydroxyisoflavone. Both isoflavones evoked increased protein expression of γ-glutamylcysteine synthetase-heavy subunit (γ-GCS-HS) and increased cytosolic accumulation and nuclear translocation of Nrf2. However, only genistein led to increases in the cytosolic accumulation and nuclear translocation of Nrf1 and the increased expression of and activity of glutathione peroxidase. These results suggest that genistein-induced protective effects depend primarily on the activation of glutathione peroxidase mediated by Nrf1 activation, and not on Nrf2 activation or increases in glutathione synthesis

  5. Early induction of NRF2 antioxidant pathway by RHBDF2 mediates rapid cutaneous wound healing.

    Science.gov (United States)

    Hosur, Vishnu; Burzenski, Lisa M; Stearns, Timothy M; Farley, Michelle L; Sundberg, John P; Wiles, Michael V; Shultz, Leonard D

    2017-04-01

    Rhomboid family protein RHBDF2, an upstream regulator of the epidermal growth factor (EGF) receptor signaling, has been implicated in cutaneous wound healing. However, the underlying molecular mechanisms are still emerging. In humans, a gain-of-function mutation in the RHBDF2 gene accelerates cutaneous wound healing in an EGFR-dependent manner. Likewise, a gain-of-function mutation in the mouse Rhbdf2 gene (Rhbdf2 cub/cub ) shows a regenerative phenotype (rapid ear-hole closure) resulting from constitutive activation of the EGFR pathway. Because the RHBDF2-regulated EGFR pathway is relevant to cutaneous wound healing in humans, we used Rhbdf2 cub/cub mice to investigate the biological networks and pathways leading to accelerated ear-hole closure, with the goal of identifying therapeutic targets potentially effective in promoting wound healing in humans. Comparative transcriptome analysis of ear pinna tissue from Rhbdf2 cub/cub and Rhbdf2 +/+ mice at 0h, 15min, 2h, and 24h post-wounding revealed an early induction of the nuclear factor E2-related factor 2 (NRF2)-mediated anti-oxidative pathway (0h and 15min), followed by the integrin-receptor aggregation pathway (2h) as early-stage events immediately and shortly after wounding in Rhbdf2 cub/cub mice. Additionally, we observed genes enriched for the Fc fragment of the IgG receptor IIIa (FCGR3A)-mediated phagocytosis pathway 24h post-wounding. Although cutaneous wound repair in healthy individuals is generally non-problematic, it can be severely impaired due to aging, diabetes, and chronic inflammation. This study suggests that activation of the NRF2-antioxidant pathway by rhomboid protein RHBDF2 might be beneficial in treating chronic non-healing wounds. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Xu [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Wang, Dapeng [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Department of Toxicology, School of Public Health, Guizhou Medical University, Guiyang, Guizhou (China); Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Yamanaka, Kenzo [Laboratory of Environmental Toxicology and Carcinogenesis, School of Pharmacy, Nihon University, Chiba (Japan); An, Yan, E-mail: dranyan@126.com [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China)

    2015-12-01

    Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

  7. Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Yang, Xu; Wang, Dapeng; Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian; Yamanaka, Kenzo; An, Yan

    2015-01-01

    Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

  8. Induction of cancer chemopreventive enzymes by coffee is mediated by transcription factor Nrf2. Evidence that the coffee-specific diterpenes cafestol and kahweol confer protection against acrolein

    International Nuclear Information System (INIS)

    Higgins, Larry G.; Cavin, Christophe; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.

    2008-01-01

    Mice fed diets containing 3% or 6% coffee for 5 days had increased levels of mRNA for NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase class Alpha 1 (GSTA1) of between 4- and 20-fold in the liver and small intestine. Mice fed 6% coffee also had increased amounts of mRNA for UDP-glucuronosyl transferase 1A6 (UGT1A6) and the glutamate cysteine ligase catalytic (GCLC) subunit of between 3- and 10-fold in the small intestine. Up-regulation of these mRNAs was significantly greater in mice possessing Nrf2 (NF-E2 p45 subunit-related factor 2) than those lacking the transcription factor. Basal levels of mRNAs for NQO1, GSTA1, UGT1A6 and GCLC were lower in tissues from nrf2 -/- mice than from nrf2 +/+ mice, but modest induction occurred in the mutant animals. Treatment of mouse embryonic fibroblasts (MEFs) from nrf2 +/+ mice with either coffee or the coffee-specific diterpenes cafestol and kahweol (C + K) increased NQO1 mRNA up to 9-fold. MEFs from nrf2 -/- mice expressed less NQO1 mRNA than did wild-type MEFs, but NQO1 was induced modestly by coffee or C + K in the mutant fibroblasts. Transfection of MEFs with nqo1-luciferase reporter constructs showed that induction by C + K was mediated primarily by Nrf2 and required the presence of an antioxidant response element in the 5'-upstream region of the gene. Luciferase reporter activity did not increase following treatment of MEFs with 100 μmol/l furan, suggesting that this ring structure within C + K is insufficient for gene induction. Priming of nrf2 +/+ MEFs, but not nrf2 -/- MEFs, with C + K conferred 2-fold resistance towards acrolein

  9. Proteomics analysis of dendritic cell activation by contact allergens reveals possible biomarkers regulated by Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Mussotter, Franz, E-mail: franz.mussotter@bfr.bund.de [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Tomm, Janina Melanie [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); El Ali, Zeina; Pallardy, Marc; Kerdine-Römer, Saadia [INSERM UMR 996, Univ Paris-Sud, Université Paris-Saclay, Chátenay-Malabry (France); Götz, Mario [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Bergen, Martin von [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); University of Leipzig, Institute of Biochemistry, Leipzig (Germany); Aalborg University, Department of Chemistry and Bioscience, Aalborg (Denmark); Haase, Andrea; Luch, Andreas [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany)

    2016-12-15

    Allergic contact dermatitis is a widespread disease with high clinical relevance affecting approximately 20% of the general population. Typically, contact allergens are low molecular weight electrophilic compounds which can activate the Keap1/Nrf2 pathway. We performed a proteomics study to reveal possible biomarkers for dendritic cell (DC) activation by contact allergens and to further elucidate the role of Keap1/Nrf2 signaling in this process. We used bone marrow derived dendritic cells (BMDCs) of wild-type (nrf2{sup +/+}) and Nrf2 knockout (nrf2{sup −/−}) mice and studied their response against the model contact sensitizers 2,4-dinitrochlorobenzene (DNCB), cinnamaldehyde (CA) and nickel(II) sulfate by 2-dimensional polyacrylamide gel electrophoresis (2D-PAGE) in combination with electrospray ionization tandem mass spectrometry (ESI-MS/MS). Sodium dodecyl sulfate (SDS, 100 μM) served as irritant control. While treatment with nickel(II) sulfate and SDS had only little effects, CA and DNCB led to significant changes in protein expression. We found 18 and 30 protein spots up-regulated in wild-type cells treated with 50 and 100 μM CA, respectively. For 5 and 10 μM DNCB, 32 and 37 spots were up-regulated, respectively. Almost all of these proteins were not differentially expressed in nrf2{sup −/−} BMDCs, indicating an Nrf2-dependent regulation. Among them proteins were detected which are involved in oxidative stress and heat shock responses, as well as in signal transduction or basic cellular pathways. The applied approach allowed us to differentiate between Nrf2-dependent and Nrf2-independent cellular biomarkers differentially regulated upon allergen-induced DC activation. The data presented might contribute to the further development of suitable in vitro testing methods for chemical-mediated sensitization. - Highlights: • Contact allergens induce proteins involved in DC maturation Nrf2-dependently. • Induction of these proteins points to a functional

  10. Selenium antagonizes cadmium-induced apoptosis in chicken spleen but not involving Nrf2-regulated antioxidant response.

    Science.gov (United States)

    Chen, Menghao; Li, Xiaojing; Fan, Ruifeng; Cao, Changyu; Yao, Haidong; Xu, Shiwen

    2017-11-01

    The nuclear transcription factor NF-E2-related factor 2 (Nrf2) binds to antioxidant response elements (AREs) and is involved in the regulation of genes participated in defending cells against oxidative damage, which have been confirmed in animal models. Selenium (Se), known as an important element in the regulation of antioxidant activity, can antagonize Cadmium (Cd) toxicity in birds. However, the role of Nrf2 in selenium-cadmium interaction has not been reported in birds. To further explore the mechanism of selenium attenuating spleen toxicity induced by cadmium in chickens, cadmium chloride (CdCl 2 , 150mg/kg) and sodium selenite (Na 2 SeO 3 , 2mg/kg) were co-administrated or individually administered in the diet of chickens for 90 days. The results showed that Cd exposure increased the level of hydrogen peroxide (H 2 O 2 ) and malondialdehyde (MDA) and decreased the antioxidant enzyme activities, including superoxide dismutase (SOD), glutathione peroxidase (Gpx), total antioxidative capacity (T-AOC), catalase (CAT). Cd exposure increased obviously nuclear accumulation of Nrf2, and the expression of Nrf2 downstream heme oxygenase-1 (HO-1) and NAD(P)H: quinine oxidoreductase 1 (NQO1), reduced the expression of Kelch-like ECH-associated protein (keap1), Gpx-1 and thioredoxin reductase-1 (TrxR1). In addition, Cd induced the increase of bak, caspase9, p53, Cyt c mRNA levels, increased bax/bcl-2 ratio, increased caspase3 mRNA and protein levels. Selenium treatment reduced the accumulation of Cd in the spleen, attenuates Cd-induced Nrf2 nuclear accumulation, enhanced antioxidant enzyme activities, ameliorated Cd-induced oxidative stress and apoptosis in the spleen. In summary, our results demonstrate that Se ameliorated spleen toxicity induced by cadmium by modulating the antioxidant system, independently of Nrf2-regulated antioxidant response pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Regulation of hemeoxygenase-1 gene expression by Nrf2 and c-Jun in tertiary butylhydroquinone-stimulated rat primary astrocytes

    International Nuclear Information System (INIS)

    Park, Jin-Sun; Kim, Hee-Sun

    2014-01-01

    Highlights: • tBHQ increased HO-1 mRNA and protein levels in rat primary astrocytes. • tBHQ enhanced HO-1 gene transcription in an ARE-dependent manner. • tBHQ increased the nuclear translocation and DNA binding of Nrf2 and c-Jun to ARE. • Nrf2 and c-Jun are involved in the differential modulation of HO-1 expression. • Nrf2 and c-Jun regulate HO-1 expression via their coordinated interaction. - Abstract: Hemeoxygenase-1 (HO-1) is a phase II antioxidant enzyme that is primarily involved in detoxification and cytoprotection in a variety of tissues. However, the mechanism underlying HO-1 gene expression remains unclear. In the present study, we investigated the regulation of HO-1 expression in primary cultured astrocytes by using the natural antioxidant compound tertiary butylhydroquinone (tBHQ). We found that tBHQ increased HO-1 mRNA and protein levels. Promoter analysis revealed that tBHQ enhanced HO-1 gene transcription in an antioxidant response element (ARE)-dependent manner. In addition, tBHQ increased the nuclear translocation and DNA binding of Nrf2 and c-Jun to ARE. Small interfering RNA (siRNA) experiments demonstrated that Nrf2 and c-Jun are involved in the differential modulation of HO-1 expression. Thus, Nrf2 knockdown reduced the basal level of HO-1 expression but did not affect the fold induction by tBHQ. On the other hand, knockdown of c-Jun diminished tBHQ-mediated induction of HO-1 without affecting basal expression. The data suggest that Nrf2 generally modulates the basal expression of HO-1, while c-Jun mediates HO-1 induction in response to tBHQ. The results of co-immunoprecipitation assays demonstrated a physical interaction between Nrf2 and c-Jun in tBHQ-treated astrocytes. The results suggest that Nrf2 and c-Jun regulate HO-1 expression via their coordinated interaction in tBHQ-treated rat primary astrocytes

  12. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2

    Science.gov (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun

    2017-01-01

    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway. PMID:28260081

  13. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  14. Rosmarinic acid counteracts activation of hepatic stellate cells via inhibiting the ROS-dependent MMP-2 activity: Involvement of Nrf2 antioxidant system

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Changfang; Zou, Yu; Liu, Yuzhang; Niu, Yingcai, E-mail: nyc1968@126.com

    2017-03-01

    Recently, oxidative stress is involved in hepatofibrogenesis. Matrix metalloproteinase-2 (MMP-2) is required for activation of hepatic stellate cells (HSCs) in response to reactive oxygen species (ROS). This study was designed to explore the hypothesis that the inhibitory effect of rosmarinic acid (RA) on HSCs activation might mainly result from its antioxidant capability by increasing the synthesis of glutathione (GSH) involved in nuclear factor kappa B (NF-κB)-dependent inhibition of MMP-2 activity. Here, we demonstrate that RA reverses activated HSCs to quiescent cells. Concomitantly, RA inhibits MMP-2 activity. RNA interference-imposed knockdown of NF-κB abolished down-regulation of MMP-2 by RA. RA-mediated inactivation of NF-κB could be blocked by the diphenyleneiodonium chloride (DPI; a ROS inhibitor). Conversely, transfection of dominant-negative (DN) mutant of extracellular signal-regulated kinases 2 (ERK2), c-Jun N-terminal kinase 1 (JNK1), or p38α kinase had no such effect. Simultaneously, RA suppresses ROS generation and lipid peroxidation (LPO) whereas increases cellular GSH in HSC-T6 cells. Furthermore, RA significantly increased antioxidant response element (ARE)-mediated luciferase activity, nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and catalytic subunits from glutamate cysteine ligase (GCLc) expression, but not modulatory subunits from GCL (GCLm). RA-mediated up-regulation of GClc is inhibited by the shRNA-induced Nrf2 knockdown. The knocking down of Nrf2 or buthionine sulfoximine (a GCL inhibitor) abolished RA-mediated inhibition of ROS. Collectively, these results provide novel insights into the mechanisms of RA as an antifibrogenic candidate in the prevention and treatment of liver fibrosis. - Highlights: • RA reverses activated HSCs to quiescent cells. • RA suppresses MMP-2 activity through a NF-κB-dependent pathway. • Inhibition of oxidative stress by RA is dependent on nuclear translocation of Nrf2

  15. Rosmarinic acid counteracts activation of hepatic stellate cells via inhibiting the ROS-dependent MMP-2 activity: Involvement of Nrf2 antioxidant system

    International Nuclear Information System (INIS)

    Lu, Changfang; Zou, Yu; Liu, Yuzhang; Niu, Yingcai

    2017-01-01

    Recently, oxidative stress is involved in hepatofibrogenesis. Matrix metalloproteinase-2 (MMP-2) is required for activation of hepatic stellate cells (HSCs) in response to reactive oxygen species (ROS). This study was designed to explore the hypothesis that the inhibitory effect of rosmarinic acid (RA) on HSCs activation might mainly result from its antioxidant capability by increasing the synthesis of glutathione (GSH) involved in nuclear factor kappa B (NF-κB)-dependent inhibition of MMP-2 activity. Here, we demonstrate that RA reverses activated HSCs to quiescent cells. Concomitantly, RA inhibits MMP-2 activity. RNA interference-imposed knockdown of NF-κB abolished down-regulation of MMP-2 by RA. RA-mediated inactivation of NF-κB could be blocked by the diphenyleneiodonium chloride (DPI; a ROS inhibitor). Conversely, transfection of dominant-negative (DN) mutant of extracellular signal-regulated kinases 2 (ERK2), c-Jun N-terminal kinase 1 (JNK1), or p38α kinase had no such effect. Simultaneously, RA suppresses ROS generation and lipid peroxidation (LPO) whereas increases cellular GSH in HSC-T6 cells. Furthermore, RA significantly increased antioxidant response element (ARE)-mediated luciferase activity, nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and catalytic subunits from glutamate cysteine ligase (GCLc) expression, but not modulatory subunits from GCL (GCLm). RA-mediated up-regulation of GClc is inhibited by the shRNA-induced Nrf2 knockdown. The knocking down of Nrf2 or buthionine sulfoximine (a GCL inhibitor) abolished RA-mediated inhibition of ROS. Collectively, these results provide novel insights into the mechanisms of RA as an antifibrogenic candidate in the prevention and treatment of liver fibrosis. - Highlights: • RA reverses activated HSCs to quiescent cells. • RA suppresses MMP-2 activity through a NF-κB-dependent pathway. • Inhibition of oxidative stress by RA is dependent on nuclear translocation of Nrf2

  16. MDM2 controls NRF2 antioxidant activity in prevention of diabetic kidney disease.

    Science.gov (United States)

    Guo, Weiying; Tian, Dan; Jia, Ye; Huang, Wenlin; Jiang, Mengnan; Wang, Junnan; Sun, Weixia; Wu, Hao

    2018-04-26

    Oxidative stress and P53 contribute to the pathogenesis of diabetic kidney disease (DKD). Nuclear factor erythroid 2-related factor 2 (NRF2) is a master regulator of cellular antioxidant defense system, is negatively regulated by P53 and prevents DKD. Recent findings revealed an important role of mouse double minute 2 (MDM2) in protection against DKD. However, the mechanism remained unclear. We hypothesized that MDM2 enhances NRF2 antioxidant signaling in DKD given that MDM2 is a key negative regulator of P53. The MDM2 inhibitor nutlin3a elevated renal P53, inhibited NRF2 signaling and induced oxidative stress, inflammation, fibrosis, DKD-like renal pathology and albuminuria in the wild-type (WT) non-diabetic mice. These effects exhibited more prominently in nutlin3a-treated WT diabetic mice. Interestingly, nutlin3a failed to induce greater renal injuries in the Nrf2 knockout (KO) mice under both the diabetic and non-diabetic conditions, indicating that NRF2 predominantly mediates MDM2's action. On the contrary, P53 inhibition by pifithrin-α activated renal NRF2 signaling and the expression of Mdm2, and attenuated DKD in the WT diabetic mice, but not in the Nrf2 KO diabetic mice. In high glucose-treated mouse mesangial cells, P53 gene silencing completely abolished nutlin3a's inhibitory effect on NRF2 signaling. The present study demonstrates for the first time that MDM2 controls renal NRF2 antioxidant activity in DKD via inhibition of P53, providing MDM2 activation and P53 inhibition as novel strategies in the management of DKD. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Upregulation of transcription factor NRF2-mediated oxidative stress response pathway in rat brain under short-term chronic hypobaric hypoxia.

    Science.gov (United States)

    Sethy, Niroj Kumar; Singh, Manjulata; Kumar, Rajesh; Ilavazhagan, Govindasamy; Bhargava, Kalpana

    2011-03-01

    Exposure to high altitude (and thus hypobaric hypoxia) induces electrophysiological, metabolic, and morphological modifications in the brain leading to several neurological clinical syndromes. Despite the known fact that hypoxia episodes in brain are a common factor for many neuropathologies, limited information is available on the underlying cellular and molecular mechanisms. In this study, we investigated the temporal effect of short-term (0-12 h) chronic hypobaric hypoxia on global gene expression of rat brain followed by detailed canonical pathway analysis and regulatory network identification. Our analysis revealed significant alteration of 33, 17, 53, 81, and 296 genes (p stress response pathway and genes were detected at all time points suggesting activation of NRF2-ARE antioxidant defense system. The results were further validated by assessing the expression levels of selected genes in temporal as well as brain regions with quantitative RT-PCR and western blot. In conclusion, our whole brain approach with temporal monitoring of gene expression patterns during hypobaric hypoxia has resulted in (1) deciphering sequence of pathways and signaling networks activated during onset of hypoxia, and (2) elucidation of NRF2-orchestrated antioxidant response as a major intrinsic defense mechanism. The results of this study will aid in better understanding and management of hypoxia-induced brain pathologies.

  18. Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension.

    Science.gov (United States)

    Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei

    2016-11-21

    Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.

  19. Effects of monascin on anti-inflammation mediated by Nrf2 activation in advanced glycation end product-treated THP-1 monocytes and methylglyoxal-treated wistar rats.

    Science.gov (United States)

    Lee, Bao-Hong; Hsu, Wei-Hsuan; Huang, Tao; Chang, Yu-Ying; Hsu, Ya-Wen; Pan, Tzu-Ming

    2013-02-13

    Hyperglycemia is associated with advanced glycation end products (AGEs). This study was designed to evaluate the inhibitory effects of monascin on receptor for advanced glycation end product (RAGE) signal and THP-1 monocyte inflammation after treatment with S100b, a specific ligand of RAGE. Monascin inhibited cytokine production by S100b-treated THP-1 monocytes via up-regulation of nuclear factor-erythroid 2-related factor-2 (Nrf2) and alleviated p47phox translocation to the membrane. Methylglyoxal (MG, 600 mg/kg bw) was used to induce diabetes in Wistar rats. Inhibitions of RAGE and p47phox by monascin were confirmed by peripheral blood mononuclear cells (PBMCs) of MG-induced rats. Silymarin (SM) was used as a positive control group. It was found that monascin promoted heme oxygenase-1 (HO-1) expression mediated by Nrf2. Suppressions of AGEs, tumor necrosis factor-α (TNF-α), and interleukin-1β (IL-β) in serum of MG-induced rats were attenuated in the monascin administration group treated with retinoic acid (RA). RA treatment resulted in Nrf2 inactivation by increasing RA receptor-α (RARα) activity, suggesting that RA acts as an inhibitor of Nrf2. The results showed that monascin exerted anti-inflammatory and antioxidative effects mediated by Nrf2 to prevent the development of diseases such as type 2 diabetes caused by inflammation.

  20. 4-methoxychalcone enhances cisplatin-induced oxidative stress and cytotoxicity by inhibiting the Nrf2/ARE-mediated defense mechanism in A549 lung cancer cells.

    Science.gov (United States)

    Lim, Juhee; Lee, Sung Ho; Cho, Sera; Lee, Ik-Soo; Kang, Bok Yun; Choi, Hyun Jin

    2013-10-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcriptional regulator for the protection of cells against oxidative and xenobiotic stresses. Recent studies have demonstrated that high constitutive expression of Nrf2 is observed in many types of cancer cells showing resistance to anti-cancer drugs, suggesting that the suppression of overexpressed Nrf2 could be an attractive therapeutic strategy to overcome cancer drug resistance. In the present study, we aimed to find small molecule compounds that enhance the sensitivity of tumor cells to cisplatin induced cytotoxicity by suppressing Nrf2-mediated defense mechanism. A549 lung cancer cells were shown to be more resistant to the anti-cancer drug cisplatin than HEK293 cells, with higher Nrf2 signaling activity; constitutively high amounts of Nrf2-downstream target proteins were observed in A549 cells. Among the three chalcone derivatives 4-methoxy-chalcone (4-MC), hesperidin methylchalcone, and neohesperidin dihydrochalcone, 4-MC was found to suppress transcriptional activity of Nrf2 in A549 cells but to activate it in HEK293 cells. 4-MC was also shown to down-regulate expression of Nrf2 and the downstream phase II detoxifying enzyme NQO1 in A549 cells. The PI3K/Akt pathway was found to be involved in the 4-MC-induced inhibition of Nrf2/ARE activity in A549 cells. This inhibition of Nrf2 signaling results in the accelerated generation of reactive oxygen species and exacerbation of cytotoxicity in cisplatin-treated A549 cells. Taken together, these results suggest that the small molecule compound 4-MC could be used to enhance the sensitivity of tumor cells to the therapeutic effect of cisplatin through the regulation of Nrf2/ARE signaling.

  1. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    International Nuclear Information System (INIS)

    Klaassen, Curtis D.; Reisman, Scott A.

    2010-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  2. Cardiac and renal upregulation of Nox2 and NF-κB and repression of Nox4 and Nrf2 in season- and diabetes-mediated models of vascular oxidative stress in guinea-pig and rat.

    Science.gov (United States)

    Gajos-Draus, Anna; Duda, Monika; Beręsewicz, Andrzej

    2017-11-01

    The superoxide-forming NADPH oxidase homologues, Nox1, Nox2, and Nox5, seem to mediate the pro-atherosclerotic vascular phenotype. The hydrogen peroxide-forming Nox4 afforded vascular protection, likely via NF-E2-related factor-2 (Nrf2) activation and/or Nox2 downregulation in transgenic mice. We hypothesized that oxidative stress in the intact vasculature involves, aside from the upregulation of the superoxide-forming Noxs, the downregulation of the Nox4/Nrf2 pathway. Guinea-pigs and rats were studied either in winter or in summer, and the streptozotocin diabetic rats in winter. Plasma nitrite, and superoxide production by isolated hearts were measured, while frozen tissues served in biochemical analyses. Summer in both species and diabetes in rats downregulated myocardial Nox4 while reciprocally upregulating Nox2 and Nox5 in guinea-pigs, and Nox2 in rats. Simultaneously, myocardial Nrf2 activity and the expression of the Nrf2-directed heme oxygenase-1 and endothelial NO synthase were reduced while activity of the nuclear factor κ B (NF- κ B) and the expression of NF- κ B-directed inducible NO synthase and the vascular cell adhesion molecule-1 were increased. Cardiac superoxide production was increased while plasma nitrite was decreased reciprocally. Analogous disregulation of Noxs, Nrf2, and NF- κ B, occurred in diabetic rat kidneys. Given the diversity of the experimental settings and the uniform pattern of the responses, we speculate that: (1) chronic vascular oxidative stress is a nonspecific (model-, species-, organ-independent) response involving the induction of Nox2 (and Nox5 in guinea-pigs) and the NF- κ B pathway, and the repression of Nox4 and the Nrf2 pathway; and (2) the systems Nox2-NF- κ B and Nox4-Nrf2 regulate each other negatively. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  3. Age-related retinopathy in NRF2-deficient mice.

    Directory of Open Access Journals (Sweden)

    Zhenyang Zhao

    2011-04-01

    Full Text Available Cumulative oxidative damage is implicated in the pathogenesis of age-related macular degeneration (AMD. Nuclear factor erythroid 2-related factor 2 (NRF2 is a transcription factor that plays key roles in retinal antioxidant and detoxification responses. The purposes of this study were to determine whether NRF2-deficient mice would develop AMD-like retinal pathology with aging and to explore the underlying mechanisms.Eyes of both wild type and Nrf2(-/- mice were examined in vivo by fundus photography and electroretinography (ERG. Structural changes of the outer retina in aged animals were examined by light and electron microscopy, and immunofluorescence labeling. Our results showed that Nrf2(-/- mice developed age-dependent degenerative pathology in the retinal pigment epithelium (RPE. Drusen-like deposits, accumulation of lipofuscin, spontaneous choroidal neovascularization (CNV and sub-RPE deposition of inflammatory proteins were present in Nrf2(-/- mice after 12 months. Accumulation of autophagy-related vacuoles and multivesicular bodies was identified by electron microscopy both within the RPE and in Bruch's membrane of aged Nrf2(-/- mice.Our data suggest that disruption of Nfe2l2 gene increased the vulnerability of outer retina to age-related degeneration. NRF2-deficient mice developed ocular pathology similar to cardinal features of human AMD and deregulated autophagy is likely a mechanistic link between oxidative injury and inflammation. The Nrf2(-/- mice can provide a novel model for mechanistic and translational research on AMD.

  4. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.

    2012-01-01

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H 2 DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  5. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  6. Lycopene inhibits NF-κB activation and adhesion molecule expression through Nrf2-mediated heme oxygenase-1 in endothelial cells.

    Science.gov (United States)

    Yang, Po-Min; Chen, Huang-Zhi; Huang, Yu-Ting; Hsieh, Chia-Wen; Wung, Being-Sun

    2017-06-01

    The endothelial expression of cell adhesion molecules plays a leading role in atherosclerosis. Lycopene, a carotenoid with 11 conjugated double bonds, has been shown to have anti-inflammatory properties. In the present study, we demonstrate a putative mechanism for the anti-inflammatory effects of lycopene. We demonstrate that lycopene inhibits the adhesion of tumor necrosis factor α (TNFα)-stimulated monocytes to endothelial cells and suppresses the expression of intercellular cell adhesion molecule-1 (ICAM-1) at the transcriptional level. Moreover, lycopene was found to exert its inhibitory effects by blocking the degradation of the inhibitory protein, IκBα, following 6 h of pre-treatment. In TNFα-stimulated endothelial cells, nuclear factor-κB (NF-κB) nuclear translocation and transcriptional activity were abolished by up to 12 h of lycopene pre-treatment. We also found that lycopene increased the intracellular glutathione (GSH) level and glutamate-cysteine ligase expression. Subsequently, lycopene induced nuclear factor-erythroid 2 related factor 2 (Nrf2) activation, leading to the increased expression of downstream of heme oxygenase-1 (HO-1). The use of siRNA targeting HO-1 blocked the inhibitory effects of lycopene on IκB degradation and ICAM-1 expression. The inhibitory effects of lycopene thus appear to be mediated through its induction of Nrf2-mediated HO-1 expression. Therefore, the findings of the present study indicate that lycopene suppresses the activation of TNFα-induced signaling pathways through the upregulation of Nrf2-mediated HO-1 expression.

  7. Cytoprotective Role of Nrf2 in Electrical Pulse Stimulated C2C12 Myotube.

    Directory of Open Access Journals (Sweden)

    Masaki Horie

    Full Text Available Regular physical exercise is central to a healthy lifestyle. However, exercise-related muscle contraction can induce reactive oxygen species and reactive nitrogen species (ROS/RNS production in skeletal muscle. The nuclear factor-E2-related factor-2 (Nrf2 transcription factor is a cellular sensor for oxidative stress. Regulation of nuclear Nrf2 signaling regulates antioxidant responses and protects organ structure and function. However, the role of Nrf2 in exercise- or contraction-induced ROS/RNS production in skeletal muscle is not clear. In this study, using differentiated C2C12 cells and electrical pulse stimulation (EPS of muscle contraction, we explored whether Nrf2 plays a role in the skeletal muscle response to muscle contraction-induced ROS/RNS. We found that EPS (40 V, 1 Hz, 2 ms stimulated ROS/RNS accumulation and Nrf2 activation. We also showed that expression of NQO1, HO-1 and GCLM increased after EPS-induced muscle contraction and was remarkably suppressed in cells with Nrf2 knockdown. We also found that the antioxidant N-acetylcysteine (NAC significantly attenuated Nrf2 activation after EPS, whereas the nitric oxide synthetase inhibitor Nω-nitro-L-arginine methyl ester (L-NAME did not. Furthermore, Nrf2 knockdown after EPS markedly decreased ROS/RNS redox potential and cell viability and increased expression of the apoptosis marker Annexin V in C2C12 myotubes. These results indicate that Nrf2 activation and expression of Nrf2 regulated-genes protected muscle against the increased ROS caused by EPS-induced muscle contraction. Thus, our findings suggest that Nrf2 may be a key factor for preservation of muscle function during muscle contraction.

  8. Novel cytoprotective mechanism of anti-parkinsonian drug deprenyl: PI3K and Nrf2-derived induction of antioxidative proteins

    International Nuclear Information System (INIS)

    Nakaso, Kazuhiro; Nakamura, Chiharu; Sato, Hiromi; Imamura, Keiko; Takeshima, Takao; Nakashima, Kenji

    2006-01-01

    Neuroprotection has received considerable attention as a strategy for the treatment of Parkinson's disease (PD). Deprenyl (Selegiline) is a promising candidate for neuroprotection; however, its cytoprotective mechanism has not been fully clarified. Here, we report a novel cytoprotective mechanism of deprenyl involving PI3K and Nrf2-mediated induction of oxidative stress-related proteins. Deprenyl increased the expression of HO-1, PrxI, TrxI, TrxRxI, γGCS, and p62/A170 in SH-SY5Y cells. Deprenyl also induced the nuclear accumulation of Nrf2 and increased the binding activity of Nrf2 to the enhancer region of human genomic HO-1. The Nrf2-mediated induction of antioxidative molecules was controlled by PI3K. Indeed, furthermore, neurotrophin receptor TrkB was identified as an upstream signal for PI3K-Nrf2 activation by deprenyl. These results suggest that the cytoprotective effect of deprenyl is, in part, dependent on Nrf2-mediated induction of antioxidative proteins, suggesting that activation of the PI3K-Nrf2 system may be a useful therapeutic strategy for PD

  9. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    International Nuclear Information System (INIS)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong

    2015-01-01

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  10. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China); Yang, Chung S. [Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, Piscataway, NJ 08854 (United States); Zhang, Jinsong, E-mail: zjs@ahau.edu.cn [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China)

    2015-02-15

    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  11. Anti-oxidative stress regulator NF-E2-related factor 2 mediates the adaptive induction of antioxidant and detoxifying enzymes by lipid peroxidation metabolite 4-hydroxynonenal

    Directory of Open Access Journals (Sweden)

    Huang Ying

    2012-11-01

    Full Text Available Abstract Background NF-E2-related factor 2 (NRF2 regulates a battery of antioxidative and phase II drug metabolizing/detoxifying genes through binding to the antioxidant response elements (ARE. NRF2-ARE signaling plays a central role in protecting cells from a wide spectrum of reactive toxic species including reactive oxygen/nitrogen species (RONS. 4-hydroxylnonenal (4-HNE is a major end product from lipid peroxidation of omega-6 polyunsaturated fatty acids (PUFA induced by oxidative stress, and it is highly reactive to nucleophilic sites in DNA and proteins, causing cytotoxicity and genotoxicity. In this study, we examined the role of NRF2 in regulating the 4-HNE induced gene expression of antioxidant and detoxifying enzymes. Results When HeLa cells were treated with 4-HNE, NRF2 rapidly transloated into the nucleus, as determined by the distribution of NRF2 tagged with the enhanced green fluorescent protein (EGFP and increased NRF2 protein in the nuclear fraction. Transcriptional activity of ARE-luciferase was significantly induced by 0.01-10 μM of 4-HNE in a dose-dependent manner, and the induction could be blocked by pretreatment with glutathione (GSH. 4-HNE induced transcriptional expression of glutathione S-transferase (GST A4, aldoketone reductase (AKR 1C1 and heme oxygenase-1 (HO-1, and the induction was attenuated by knocking down NRF2 using small interfering RNA. Conclusions NRF2 is critical in mediating 4-HNE induced expression of antioxidant and detoxifying genes. This may account for one of the major cellular defense mechanisms against reactive metabolites of lipids peroxidation induced by oxidative stress and protect cells from cytotoxicity.

  12. Nrf2 impacts cellular bioenergetics by controlling substrate availability for mitochondrial respiration

    Directory of Open Access Journals (Sweden)

    Kira M. Holmström

    2013-06-01

    Transcription factor Nrf2 and its repressor Keap1 regulate a network of cytoprotective genes involving more than 1% of the genome, their best known targets being drug-metabolizing and antioxidant genes. Here we demonstrate a novel role for this pathway in directly regulating mitochondrial bioenergetics in murine neurons and embryonic fibroblasts. Loss of Nrf2 leads to mitochondrial depolarisation, decreased ATP levels and impaired respiration, whereas genetic activation of Nrf2 increases the mitochondrial membrane potential and ATP levels, the rate of respiration and the efficiency of oxidative phosphorylation. We further show that Nrf2-deficient cells have increased production of ATP in glycolysis, which is then used by the F1Fo-ATPase for maintenance of the mitochondrial membrane potential. While the levels and in vitro activities of the respiratory complexes are unaffected by Nrf2 deletion, their activities in isolated mitochondria and intact live cells are substantially impaired. In addition, the rate of regeneration of NADH after inhibition of respiration is much slower in Nrf2-knockout cells than in their wild-type counterparts. Taken together, these results show that Nrf2 directly regulates cellular energy metabolism through modulating the availability of substrates for mitochondrial respiration. Our findings highlight the importance of efficient energy metabolism in Nrf2-mediated cytoprotection.

  13. Nrf2-inducing anti-oxidation stress response in the rat liver--new beneficial effect of lansoprazole.

    Science.gov (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao

    2014-01-01

    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10-100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and phase

  14. Nrf2-Inducing Anti-Oxidation Stress Response in the Rat Liver - New Beneficial Effect of Lansoprazole

    Science.gov (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao

    2014-01-01

    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10–100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and

  15. Schisandra chinensis regulates drug metabolizing enzymes and drug transporters via activation of Nrf2-mediated signaling pathway

    Directory of Open Access Journals (Sweden)

    He JL

    2014-12-01

    increase in the intracellular level of glutathione and total glutathione S-transferase content. SCE significantly elevated the messenger ribonucleic acid and protein levels of P-glycoprotein and multidrug resistance-associated protein 2 and 4, whereas the expression of organic anion transporting peptide 1A2 and 1B1 was significantly downregulated by SCE. Knockdown of Nrf2 by small interfering ribonucleic acid attenuated the regulatory effect of SCE on these DMEs and drug transporters. SCE significantly upregulated Nrf2 and promoted the translocation of Nrf2 from cytoplasm to the nuclei. Additionally, SCE significantly suppressed the expression of cytosolic Kelch-like ECH-associated protein 1 (the repressor of Nrf2 and remarkably increased Nrf2 stability in HepG2 cells. Taken together, our findings suggest that the hepatoprotective effects of SCE may be partially ascribed to the modulation of DMEs and drug transporters via Nrf2-mediated signaling pathway. SCE may alter the pharmacokinetics of other coadministered drugs that are substrates of these DMEs and transporters and thus cause unfavorable herb–drug interactions. Keywords: Nrf2, Keap1, HepG2 cell, drug metabolizing enzyme, drug transporter, P-gp, MRP, OATP, Schisandra chinensis

  16. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  17. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  18. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    International Nuclear Information System (INIS)

    Aleksunes, Lauren M.; Slitt, Angela L.; Maher, Jonathan M.; Augustine, Lisa M.; Goedken, Michael J.; Chan, Jefferson Y.; Cherrington, Nathan J.; Klaassen, Curtis D.; Manautou, Jose E.

    2008-01-01

    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals

  19. Susceptibility of Nrf2-null mice to steatohepatitis and cirrhosis upon consumption of a high-fat diet is associated with oxidative stress, perturbation of the unfolded protein response, and disturbance in the expression of metabolic enzymes but not with insulin resistance.

    Science.gov (United States)

    Meakin, Paul J; Chowdhry, Sudhir; Sharma, Ritu S; Ashford, Fiona B; Walsh, Shaun V; McCrimmon, Rory J; Dinkova-Kostova, Albena T; Dillon, John F; Hayes, John D; Ashford, Michael L J

    2014-09-01

    Mice lacking the transcription factor NF-E2 p45-related factor 2 (Nrf2) develop more severe nonalcoholic steatohepatitis (NASH), with cirrhosis, than wild-type (Nrf2(+/+)) mice when fed a high-fat (HF) diet for 24 weeks. Although NASH is usually associated with insulin resistance, HF-fed Nrf2(-/-) mice exhibited better insulin sensitivity than HF-fed Nrf2(+/+) mice. In livers of HF-fed mice, loss of Nrf2 resulted in greater induction of lipogenic genes, lower expression of β-oxidation genes, greater reduction in AMP-activated protein kinase (AMPK) levels, and diminished acetyl coenzyme A (CoA) carboxylase phosphorylation than in the wild-type livers, which is consistent with greater fatty acid (FA) synthesis in Nrf2(-/-) livers. Moreover, primary Nrf2(-/-) hepatocytes displayed lower glucose and FA oxidation than Nrf2(+/+) hepatocytes, with FA oxidation partially rescued by treatment with AMPK activators. The unfolded protein response (UPR) was perturbed in control regular-chow (RC)-fed Nrf2(-/-) mouse livers, and this was associated with constitutive activation of NF-κB and JNK, along with upregulation of inflammatory genes. The HF diet elicited an antioxidant response in Nrf2(+/+) livers, and as this was compromised in Nrf2(-/-) livers, they suffered oxidative stress. Therefore, Nrf2 protects against NASH by suppressing lipogenesis, supporting mitochondrial function, increasing the threshold for the UPR and inflammation, and enabling adaptation to HF-diet-induced oxidative stress. Copyright © 2014 Meakin et al.

  20. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2.

    Science.gov (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun

    2017-04-01

    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway.

  1. Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases.

    Science.gov (United States)

    Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug

    2014-01-01

    Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.

  2. Translational control of Nrf2 within the open reading frame

    International Nuclear Information System (INIS)

    Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim

    2013-01-01

    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state

  3. Licochalcone A Upregulates Nrf2 Antioxidant Pathway and Thereby Alleviates Acetaminophen-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2018-03-01

    Full Text Available Acetaminophen (APAP overdose-induced fatal hepatotoxicity is majorly characterized by overwhelmingly increased oxidative stress while enhanced nuclear factor-erythroid 2-related factor 2 (Nrf2 is involved in prevention of hepatotoxicity. Although Licochalcone A (Lico A upregulates Nrf2 signaling pathway against oxidative stress-triggered cell injury, whether it could protect from APAP-induced hepatotoxicity by directly inducing Nrf2 activation is still poorly elucidated. This study aims to explore the protective effect of Lico A against APAP-induced hepatotoxicity and its underlying molecular mechanisms. Our findings indicated that Lico A effectively decreased tert-butyl hydroperoxide (t-BHP- and APAP-stimulated cell apoptosis, mitochondrial dysfunction and reactive oxygen species generation and increased various anti-oxidative enzymes expression, which is largely dependent on upregulating Nrf2 nuclear translocation, reducing the Keap1 protein expression, and strengthening the antioxidant response element promoter activity. Meanwhile, Lico A dramatically protected against APAP-induced acute liver failure by lessening the lethality; alleviating histopathological liver changes; decreasing the alanine transaminase and aspartate aminotransferase levels, malondialdehyde formation, myeloperoxidase level and superoxide dismutase depletion, and increasing the GSH-to-GSSG ratio. Furthermore, Lico A not only significantly modulated apoptosis-related protein by increasing Bcl-2 expression, and decreasing Bax and caspase-3 cleavage expression, but also efficiently alleviated mitochondrial dysfunction by reducing c-jun N-terminal kinase phosphorylation and translocation, inhibiting Bax mitochondrial translocation, apoptosis-inducing factor and cytochrome c release. However, Lico A-inhibited APAP-induced the lethality, histopathological changes, hepatic apoptosis, and mitochondrial dysfunction in WT mice were evidently abrogated in Nrf2-/- mice. These

  4. Susceptibility of Nrf2-Null Mice to Steatohepatitis and Cirrhosis upon Consumption of a High-Fat Diet Is Associated with Oxidative Stress, Perturbation of the Unfolded Protein Response, and Disturbance in the Expression of Metabolic Enzymes but Not with Insulin Resistance

    Science.gov (United States)

    Meakin, Paul J.; Chowdhry, Sudhir; Sharma, Ritu S.; Ashford, Fiona B.; Walsh, Shaun V.; McCrimmon, Rory J.; Dinkova-Kostova, Albena T.; Dillon, John F.

    2014-01-01

    Mice lacking the transcription factor NF-E2 p45-related factor 2 (Nrf2) develop more severe nonalcoholic steatohepatitis (NASH), with cirrhosis, than wild-type (Nrf2+/+) mice when fed a high-fat (HF) diet for 24 weeks. Although NASH is usually associated with insulin resistance, HF-fed Nrf2−/− mice exhibited better insulin sensitivity than HF-fed Nrf2+/+ mice. In livers of HF-fed mice, loss of Nrf2 resulted in greater induction of lipogenic genes, lower expression of β-oxidation genes, greater reduction in AMP-activated protein kinase (AMPK) levels, and diminished acetyl coenzyme A (CoA) carboxylase phosphorylation than in the wild-type livers, which is consistent with greater fatty acid (FA) synthesis in Nrf2−/− livers. Moreover, primary Nrf2−/− hepatocytes displayed lower glucose and FA oxidation than Nrf2+/+ hepatocytes, with FA oxidation partially rescued by treatment with AMPK activators. The unfolded protein response (UPR) was perturbed in control regular-chow (RC)-fed Nrf2−/− mouse livers, and this was associated with constitutive activation of NF-κB and JNK, along with upregulation of inflammatory genes. The HF diet elicited an antioxidant response in Nrf2+/+ livers, and as this was compromised in Nrf2−/− livers, they suffered oxidative stress. Therefore, Nrf2 protects against NASH by suppressing lipogenesis, supporting mitochondrial function, increasing the threshold for the UPR and inflammation, and enabling adaptation to HF-diet-induced oxidative stress. PMID:24958099

  5. Fisetin Protects PC12 Cells from Tunicamycin-Mediated Cell Death via Reactive Oxygen Species Scavenging and Modulation of Nrf2-Driven Gene Expression, SIRT1 and MAPK Signaling in PC12 Cells.

    Science.gov (United States)

    Yen, Jui-Hung; Wu, Pei-Shan; Chen, Shu-Fen; Wu, Ming-Jiuan

    2017-04-17

    ) significantly blocked fisetin-mediated cytoprotection. In conclusion, this result shows that fisetin activates Nrf2, MAPK and SIRT1, which may elicit adaptive cellular stress response pathways so as to protect cells from Tm-induced cytotoxicity.

  6. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus

    Science.gov (United States)

    Suzuki, Takafumi; Seki, Shiori; Hiramoto, Keiichiro; Naganuma, Eriko; Kobayashi, Eri H.; Yamaoka, Ayaka; Baird, Liam; Takahashi, Nobuyuki; Sato, Hiroshi; Yamamoto, Masayuki

    2017-01-01

    NF-E2-related factor-2 (Nrf2) regulates cellular responses to oxidative and electrophilic stress. Loss of Keap1 increases Nrf2 protein levels, and Keap1-null mice die of oesophageal hyperkeratosis because of Nrf2 hyperactivation. Here we show that deletion of oesophageal Nrf2 in Keap1-null mice allows survival until adulthood, but the animals develop polyuria with low osmolality and bilateral hydronephrosis. This phenotype is caused by defects in water reabsorption that are the result of reduced aquaporin 2 levels in the kidney. Renal tubular deletion of Keap1 promotes nephrogenic diabetes insipidus features, confirming that Nrf2 activation in developing tubular cells causes a water reabsorption defect. These findings suggest that Nrf2 activity should be tightly controlled during development in order to maintain renal homeostasis. In addition, tissue-specific ablation of Nrf2 in Keap1-null mice might create useful animal models to uncover novel physiological functions of Nrf2. PMID:28233855

  7. SPBP is a sulforaphane induced transcriptional coactivator of NRF2 regulating expression of the autophagy receptor p62/SQSTM1.

    Directory of Open Access Journals (Sweden)

    Sagar Ramesh Darvekar

    Full Text Available Organisms exposed to oxidative stress respond by orchestrating a stress response to prevent further damage. Intracellular levels of antioxidant agents increase, and damaged components are removed by autophagy induction. The KEAP1-NRF2 signaling pathway is the main pathway responsible for cell defense against oxidative stress and for maintaining the cellular redox balance at physiological levels. Sulforaphane, an isothiocyanate derived from cruciferous vegetables, is a potent inducer of KEAP1-NRF2 signaling and antioxidant response element driven gene expression. In this study, we show that sulforaphane enhances the expression of the transcriptional coregulator SPBP. The expression curve peaks 6-8 hours post stimulation, and parallels the sulforaphane-induced expression of NRF2 and the autophagy receptor protein p62/SQSTM1. Reporter gene assays show that SPBP stimulates the expression of p62/SQSTM1 via ARE elements in the promoter region, and siRNA mediated knock down of SPBP significantly decreases the expression of p62/SQSTM1 and the formation of p62/SQSTM1 bodies in HeLa cells. Furthermore, SPBP siRNA reduces the sulforaphane induced expression of NRF2, and the expression of the autophagy marker protein LC3B. Both these proteins contain ARE-like elements in their promoter regions. Over-expressed SPBP and NRF2 acts synergistically on the p62/SQSTM1 promoter and colocalize in nuclear speckles in HeLa cells. Collectively, these results suggest that SPBP is a coactivator of NRF2, and hence may be important for securing enhanced and sustained expression of NRF2 induced genes such as proteins involved in selective autophagy.

  8. Perspectives of the Nrf-2 signaling pathway in cancer progression and therapy

    Directory of Open Access Journals (Sweden)

    Priyanka Basak

    Full Text Available The Nuclear factor erythroid2-related factor2 (Nrf2, a master regulator of redox homoeostasis, is a key transcription factor regulating a wide array of genes for antioxidant and detoxification enzymes. It protects organs from various kinds of toxic insults. On the other hand, activation of Nrf2 is also correlated with cancer progression and chemoresistance. Downregulation of Nrf2 activity has attracted an increasing amount of attention as it may provide an alternative cancer therapy. In this review, we examine recent studies on roles of Nrf2 in several pathophysiological conditions emphasising cancer. We discuss elaborately the current knowledge on Nrf2 regulation including KEAP1-dependent and KEAP1-independent cascades. KEAP1/Nrf2 system is a master regulator of cellular response against a variety of environmental stresses. We also highlight several tightly controlled regulations of Nrf2 by numerous proteins, small molecules, toxic metals, etc. In addition, we evaluate the possible therapeutic approaches of increasing chemosensitivity via modulating Nrf2 signaling. Keywords: Nrf2, Transcription factor, KEAP1, Oxidative stress, Cell proliferation, Carcinogenesis, Chemoprevention

  9. Sulforaphane attenuates di-N-butylphthalate-induced reproductive damage in pubertal mice: Involvement of the Nrf2-antioxidant system.

    Science.gov (United States)

    Jiang, Xu-Ping; Tang, Jing-Yuan; Xu, Zhen; Han, Peng; Qin, Zhi-Qiang; Yang, Cheng-di; Wang, Shang-Qian; Tang, Min; Wang, Wei; Qin, Chao; Xu, Yang; Shen, Bai-Xin; Zhou, Wei-Min; Zhang, Wei

    2017-07-01

    di-N-butylphthalate (DBP) is a ubiquitous environmental pollutant used for plastic coating and in the cosmetics industry. It has toxic effects on body health, especially the male reproductive system. Here, we investigated the effects of DBP on the male reproductive system of pubertal mice and explored the protective role of sulforaphane (SFN). The results showed that DBP significantly reduced the anogenital distance, testicular weight, sperm count and motility, and plasma and testicular testosterone levels and significantly increased the oxidative stress, sperm abnormalities, and testicular cell apoptosis. SFN supplementation ameliorated these effects. After DBP stimulation, the transcription factor nuclear factor erythroid-related factor 2 (Nrf2) was adaptively increased together with its target genes, such as HO-1 and NQO1. Upregulation of Nrf2 by SFN reduced the DBP-mediated intracellular oxidative toxicity and also increased testosterone secretion and spermatogenesis, which were decreased by DBP. These findings indicate that SFN can attenuate DBP-induced reproductive damage in pubertal mice via Nrf2-associated pathways. © 2017 Wiley Periodicals, Inc.

  10. Design, synthesis, and evaluation of curcumin derivatives as Nrf2 activators and cytoprotectors against oxidative death.

    Science.gov (United States)

    Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo

    2017-07-07

    Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

    Directory of Open Access Journals (Sweden)

    Kate E. Hawkins

    2016-03-01

    Full Text Available The potential of induced pluripotent stem cells (iPSCs in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation.

  12. Procyanidins from wild grape (Vitis amurensis) seeds regulate ARE-mediated enzyme expression via Nrf2 coupled with p38 and PI3K/Akt pathway in HepG2 cells.

    Science.gov (United States)

    Bak, Min-Ji; Jun, Mira; Jeong, Woo-Sik

    2012-01-01

    Procyanidins, polymers of flavan-3-ol units, have been reported to exhibit many beneficial health effects such as antioxidant and anti-carcinogenic effects. In this study, we investigated the cancer chemopreventive properties of procyanidins from wild grape (Vitis amurensis) seeds in particular their roles in inducing phase II detoxifying/antioxidant enzymes as well as in modulating the upstream kinases. Ethanolic extract of V. amurensis seeds was fractionated with a series of organic solvents and finally separated into six fractions, F1-F6. Chemical properties of the procyanidins were analyzed by vanillin assay, BuOH-HCl test, and depolymerization with phloroglucinol followed by LC/MS analysis. The F5 had the highest procyanidin content among all the fractions and strongly induced the reporter activity of antioxidant response element as well as the protein expression of nuclear factor E2-related factor (Nrf2) in HepG2 human hepatocarcinoma cells. The procyanidin-rich F5 also strongly induced the expression of the phase II detoxifying and antioxidant enzymes such as NAD(P)H:quinone oxidoreductase1 and hemeoxygenase1. Phosphorylations of the upstream kinases such as MAPKs and PI3K/Akt were significantly increased by treatment with procyanidin fraction. In addition, the procyanidin-mediated Nrf2 expression was partly attenuated by PI3K inhibitor LY294002, and almost completely by p38 inhibitor SB202190, but neither by JNK inhibitor SP600125 nor by MEK1/2 inhibitor U0126. Taken together, the procyanidins from wild grape seeds could be used as a potential natural chemopreventive agent through Nrf2/ARE-mediated phase II detoxifying/antioxidant enzymes induction via p38 and PI3K/Akt pathway.

  13. Nrf2 and Notch Signaling in Lung Cancer: Near the Crossroad

    Directory of Open Access Journals (Sweden)

    Angelo Sparaneo

    2016-01-01

    Full Text Available The transcription factor Nrf2 (NF-E2 related factor 2 is a master regulator of the cell antioxidant response associated with tumor growth and resistance to cytotoxic treatments. In particular, Nrf2 induces upregulation of cytoprotective genes by interacting with the closely situated AREs (Antioxidant Response Elements in response to endogenous or exogenous stress stimuli and takes part to several oncogenic signaling pathways. Among these, the crosstalk with Notch pathway has been shown to enhance cytoprotection and maintenance of cellular homeostasis, tissue organization by modulating cell proliferation kinetics, and stem cell self-renewal in several organs. The role of Notch and Nrf2 related pathways in tumorigenesis is highly variable and when they are both abnormally activated they can synergistically cause neoplastic proliferation by promoting cell survival, differentiation, invasion, and metastases. NFE2L2, KEAP1, and NOTCH genes family appear in the list of significantly mutated genes in tumors in both combined and individual sets, supporting the crucial role that the aberrant Nrf2-Notch crosstalk might have in cancerogenesis. In this review, we summarize current knowledge about the alterations of Nrf2 and Notch pathways and their reciprocal transcriptional regulation throughout tumorigenesis and progression of lung tumors, supporting the potentiality of putative biomarkers and therapeutic targets.

  14. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo.

    Science.gov (United States)

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing

    2016-08-01

    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.

  15. Activation of the Nrf2-ARE pathway by siRNA knockdown of Keap1 reduces oxidative stress and provides partial protection from MPTP-mediated neurotoxicity.

    Science.gov (United States)

    Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A

    2012-06-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    International Nuclear Information System (INIS)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy

    2016-01-01

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H 2 O 2 ) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H 2 O 2 levels. Furthermore, H 2 O 2 independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H 2 O 2 levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H 2 O 2 -independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H 2 O 2 - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments omeprazole-mediated induction of HO-1.

  17. Involvement of ERK-Nrf-2 signaling in ionizing radiation induced cell death in normal and tumor cells.

    Directory of Open Access Journals (Sweden)

    Raghavendra S Patwardhan

    Full Text Available Prolonged oxidative stress favors tumorigenic environment and inflammation. Oxidative stress may trigger redox adaptation mechanism(s in tumor cells but not normal cells. This may increase levels of intracellular antioxidants and establish a new redox homeostasis. Nrf-2, a master regulator of battery of antioxidant genes is constitutively activated in many tumor cells. Here we show that, murine T cell lymphoma EL-4 cells show constitutive and inducible radioresistance via activation of Nrf-2/ERK pathway. EL-4 cells contained lower levels of ROS than their normal counterpart murine splenic lymphocytes. In response to radiation, the thiol redox circuits, GSH and thioredoxin were modified in EL-4 cells. Pharmacological inhibitors of ERK and Nrf-2 significantly enhanced radiosensitivity and reduced clonogenic potential of EL-4 cells. Unirradiated lymphoma cells showed nuclear accumulation of Nrf-2, upregulation of its dependent genes and protein levels. Interestingly, MEK inhibitor abrogated its nuclear translocation suggesting role of ERK in basal and radiation induced Nrf-2 activation in tumor cells. Double knockdown of ERK and Nrf-2 resulted in higher sensitivity to radiation induced cell death as compared to individual knockdown cells. Importantly, NF-kB which is reported to be constitutively active in many tumors was not present at basal levels in EL-4 cells and its inhibition did not influence radiosensitivity of EL-4 cells. Thus our results reveal that, tumor cells which are subjected to heightened oxidative stress employ master regulator cellular redox homeostasis Nrf-2 for prevention of radiation induced cell death. Our study reveals the molecular basis of tumor radioresistance and highlights role of Nrf-2 and ERK.

  18. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    Energy Technology Data Exchange (ETDEWEB)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Mattson, Mark P. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Camandola, Simonetta, E-mail: camandolasi@mail.nih.gov [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States)

    2013-04-19

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  19. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    International Nuclear Information System (INIS)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta

    2013-01-01

    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity

  20. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Zhiqin [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Department of Laboratory Diagnosis, Hebei Medical University, Shijiazhuang (China); Niu, Yujie [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Wang, Qian [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Shi, Lei [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Guo, Huicai; Liu, Yi; Zhu, Yue [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Liu, Shufeng; Liu, Chao [Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China); Chen, Xin [Xiumen Community Health Service Centre, Shijiazhuang (China); Zhang, Rong, E-mail: rongzhang@hebmu.edu.cn [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China)

    2015-11-15

    Highlights: • Nrf2 signals were partly responsible for the DNA damage induced by Nano-TiO{sub 2}. • Nrf2 loss could aggravate the DNA damage induced by Nano-TiO{sub 2}. • Acquired Nrf2 decreased the susceptibility to DNA damage induced by Nano-TiO{sub 2}. - Abstract: Titanium dioxide nanoparticles (Nano-TiO{sub 2}) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO{sub 2} induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO{sub 2}. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO{sub 2}. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO{sub 2} exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO{sub 2} treatment. After treatment with Nano-TiO{sub 2}, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO{sub 2} and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO{sub 2} toxication.

  1. Inhibition of early T cell cytokine production by arsenic trioxide occurs independently of Nrf2.

    Directory of Open Access Journals (Sweden)

    Kelly R VanDenBerg

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is a stress-activated transcription factor that induces a variety of cytoprotective genes. Nrf2 also mediates immunosuppressive effects in multiple inflammatory models. Upon activation, Nrf2 dissociates from its repressor protein, Keap1, and translocates to the nucleus where it induces Nrf2 target genes. The Nrf2-Keap1 interaction is disrupted by the environmental toxicant and chemotherapeutic agent arsenic trioxide (ATO. The purpose of the present study was to determine the effects of ATO on early events of T cell activation and the role of Nrf2 in those effects. The Nrf2 target genes Hmox-1, Nqo-1, and Gclc were all upregulated by ATO (1-2 μM in splenocytes derived from wild-type, but not Nrf2-null, mice, suggesting that Nrf2 is activated by ATO in splenocytes. ATO also inhibited IFNγ, IL-2, and GM-CSF mRNA and protein production in wild-type splenocytes activated with the T cell activator, anti-CD3/anti-CD28. However, ATO also decreased production of these cytokines in activated splenocytes from Nrf2-null mice, suggesting the inhibition is independent of Nrf2. Interestingly, ATO inhibited TNFα protein secretion, but not mRNA expression, in activated splenocytes suggesting the inhibition is due to post-transcriptional modification. In addition, c-Fos DNA binding was significantly diminished by ATO in wild-type and Nrf2-null splenocytes activated with anti-CD3/anti-CD28, consistent with the observed inhibition of cytokine production by ATO. Collectively, this study suggests that although ATO activates Nrf2 in splenocytes, inhibition of early T cell cytokine production by ATO occurs independently of Nrf2 and may instead be due to impaired AP-1 DNA binding.

  2. Procyanidins from Wild Grape (Vitis amurensis Seeds Regulate ARE-Mediated Enzyme Expression via Nrf2 Coupled with p38 and PI3K/Akt Pathway in HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Woo-Sik Jeong

    2012-01-01

    Full Text Available Procyanidins, polymers of flavan-3-ol units, have been reported to exhibit many beneficial health effects such as antioxidant and anti-carcinogenic effects. In this study, we investigated the cancer chemopreventive properties of procyanidins from wild grape (Vitis amurensis seeds in particular their roles in inducing phase II detoxifying/antioxidant enzymes as well as in modulating the upstream kinases. Ethanolic extract of V. amurensis seeds was fractionated with a series of organic solvents and finally separated into six fractions, F1–F6. Chemical properties of the procyanidins were analyzed by vanillin assay, BuOH-HCl test, and depolymerization with phloroglucinol followed by LC/MS analysis. The F5 had the highest procyanidin content among all the fractions and strongly induced the reporter activity of antioxidant response element as well as the protein expression of nuclear factor E2-related factor (Nrf2 in HepG2 human hepatocarcinoma cells. The procyanidin-rich F5 also strongly induced the expression of the phase II detoxifying and antioxidant enzymes such as NAD(PH:quinone oxidoreductase1 and hemeoxygenase1. Phosphorylations of the upstream kinases such as MAPKs and PI3K/Akt were significantly increased by treatment with procyanidin fraction. In addition, the procyanidin-mediated Nrf2 expression was partly attenuated by PI3K inhibitor LY294002, and almost completely by p38 inhibitor SB202190, but neither by JNK inhibitor SP600125 nor by MEK1/2 inhibitor U0126. Taken together, the procyanidins from wild grape seeds could be used as a potential natural chemopreventive agent through Nrf2/ARE-mediated phase II detoxifying/antioxidant enzymes induction via p38 and PI3K/Akt pathway.

  3. When defense becomes dangerous – transcription factor Nrf2 and cancer

    Directory of Open Access Journals (Sweden)

    Adam Krysztofiak

    2015-01-01

    Full Text Available The transcription factor Nrf2 controls the expression of genes encoding cytoprotective enzymes and proteins. Its activation is related to conformational changes in the inhibitory protein Keap1 and/or Nrf2 phosphorylation by upstream kinases. Activation of Nrf2 can lead to the induction of phase II enzymes responsible for the inactivation of potential carcinogens. This may constitute an important strategy of chemoprevention. Moreover, these enzymatic systems participating in the biotransformation of drugs can reduce their therapeutic effects, contributing to drug resistance. For this reason, a clear understanding of the role of Nrf2 is essential to assess the beneficial and adverse effects of its up-regulation, particularly in relation to the prevention and treatment of cancer. This article summarizes the current state of knowledge on the significance of Nrf2 in tumorigenesis.

  4. Investigation of the effect of a panel of model hepatotoxins on the Nrf2-Keap1 defence response pathway in CD-1 mice

    International Nuclear Information System (INIS)

    Randle, Laura E.; Goldring, Chris E.P.; Benson, Craig A.; Metcalfe, Peter N.; Kitteringham, Neil R.; Park, B. Kevin; Williams, Dominic P.

    2008-01-01

    h caused a significant increase in the levels of haem oxygenase-1 (HO-1; 2.85-fold) and glutamate cysteine ligase (GCLC; 1.62-fold) mRNA. BB and FS did not affect the mRNA levels of either gene after 1 h of treatment; however CCl 4 significantly increased HO-1 mRNA at this time point. After 24 h treatment with the hepatotoxins, there was evidence for the initiation of a late defence response. BB significantly increased both HO-1 and GCLC protein at this time point, CCl 4 increased GCLC protein alone, although FS did not alter either of these proteins. In summary, we have demonstrated that the hepatotoxins BB, CCl 4 and FS can induce a small but significant increase in Nrf2 accumulation in hepatic nuclei. However, this was associated with modest changes in hepatic GSH, a delayed development of toxicity and was insufficient to activate an early functional adaptive response to these hepatotoxins

  5. Britanin Ameliorates Cerebral Ischemia-Reperfusion Injury by Inducing the Nrf2 Protective Pathway.

    Science.gov (United States)

    Wu, Guozhen; Zhu, Lili; Yuan, Xing; Chen, Hao; Xiong, Rui; Zhang, Shoude; Cheng, Hao; Shen, Yunheng; An, Huazhang; Li, Tiejun; Li, Honglin; Zhang, Weidong

    2017-10-10

    Oxidative stress is considered the major cause of tissue injury after cerebral ischemia. The nuclear factor erythroid 2-related factor 2 (Nrf2) pathway is one of the most important defensive mechanisms against oxidative stresses and has been confirmed as a target for stroke treatment. Thus, we desired to find new Nrf2 activators and test their neuronal protective activity both in vivo and in vitro. The herb-derived compound, Britanin, is a potent inducer of the Nrf2 system. Britanin can induce the expression of protective enzymes and reverse oxygen-glucose deprivation, followed by reperfusion (OGD-R)-induced neuronal injury in primary cortical neurons in vitro. Furthermore, the administration of Britanin significantly ameliorated middle cerebral artery occlusion-reperfusion (MCAO-R) insult in vivo. We report here the crystal structure of the complex of Britanin and the BTB domain of Keap1. Britanin selectively binds to a conserved cysteine residue, cysteine 151, of Keap1 and inhibits Keap1-mediated ubiquitination of Nrf2, leading to induction of the Nrf2 pathway. Britanin is a potent inducer of Nrf2. The complex crystal structure of Britanin and the BTB domain of Keap1 help clarify the mechanism of Nrf2 induction. Britanin was proven to protect primary cortical neurons against OGD-R-induced injury in an Nrf2-dependant way. Additionally, Britanin had excellent cerebroprotective effect in an MCAO-R model. Our results demonstrate that the natural product Britanin with potent Nrf2-activating and neural protective activities both in vitro and in vivo could be developed into a cerebroprotective therapeutic agent. Antioxid. Redox Signal. 27, 754-768.

  6. Dihydro-CDDO-trifluoroethyl amide (dh404, a novel Nrf2 activator, suppresses oxidative stress in cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Tomonaga Ichikawa

    Full Text Available Targeting Nrf2 signaling appears to be an attractive approach for the treatment of maladaptive cardiac remodeling and dysfunction; however, pharmacological modulation of the Nrf2 pathway in the cardiovascular system remains to be established. Herein, we report that a novel synthetic triterpenoid derivative, dihydro-CDDO-trifluoroethyl amide (dh404, activates Nrf2 and suppresses oxidative stress in cardiomyocytes. Dh404 interrupted the Keap1-Cul3-Rbx1 E3 ligase complex-mediated Nrf2 ubiquitination and subsequent degradation saturating the binding capacity of Keap1 to Nrf2, thereby rendering more Nrf2 to be translocated into the nuclei to activate Nrf2-driven gene transcription. A mutant Keap1 protein containing a single cysteine-to-serine substitution at residue 151 within the BTB domain of Keap1 was resistant to dh404-induced stabilization of Nrf2 protein. In addition, dh404 did not dissociate the interaction of Nrf2 with the Keap1-Cul3-Rbx1 E3 ligase complex. Thus, it is likely that dh404 inhibits the ability of Keap1-Cul3-Rbx1 E3 ligase complex to target Nrf2 for ubiquitination and degradation via modifying Cys-151 of Keap1 to change the conformation of the complex. Moreover, dh404 was able to stabilize Nrf2 protein, to enhance Nrf2 nuclear translocation, to activate Nrf2-driven transcription, and to suppress angiotensin II (Ang II-induced oxidative stress in cardiomyocytes. Knockdown of Nrf2 almost blocked the anti-oxidative effect of dh404. Dh404 activated Nrf2 signaling in the heart. Taken together, dh404 appears to be a novel Nrf2 activator with a therapeutic potential for cardiac diseases via suppressing oxidative stress.

  7. Maresin 1 Ameliorates Lung Ischemia/Reperfusion Injury by Suppressing Oxidative Stress via Activation of the Nrf-2-Mediated HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Quanchao Sun

    2017-01-01

    Full Text Available Lung ischemia/reperfusion (I/R injury occurs in various clinical conditions and heavily damaged lung function. Oxidative stress reaction and antioxidant enzymes play a pivotal role in the etiopathogenesis of lung I/R injury. In the current study, we investigated the impact of Maresin 1 on lung I/R injury and explored the possible mechanism involved in this process. MaR 1 ameliorated I/R-induced lung injury score, wet/dry weight ratio, myeloperoxidase, tumor necrosis factor, bronchoalveolar lavage fluid (BALF leukocyte count, BALF neutrophil ratio, and pulmonary permeability index levels in lung tissue. MaR 1 significantly reduced ROS, methane dicarboxylic aldehyde, and 15-F2t-isoprostane generation and restored antioxidative enzyme (superoxide dismutase, glutathione peroxidase, and catalase activities. Administration of MaR 1 improved the expression of nuclear Nrf-2 and cytosolic HO-1 in I/R-treated lung tissue. Furthermore, we also found that the protective effects of MaR 1 on lung tissue injury and oxidative stress were reversed by HO-1 activity inhibitor, Znpp-IX. Nrf-2 transcription factor inhibitor, brusatol, significantly decreased MaR 1-induced nuclear Nrf-2 and cytosolic HO-1 expression. In conclusion, these results indicate that MaR 1 protects against lung I/R injury through suppressing oxidative stress. The mechanism is partially explained by activation of the Nrf-2-mediated HO-1 signaling pathway.

  8. The Nrf1 CNC-bZIP protein is regulated by the proteasome and activated by hypoxia.

    Science.gov (United States)

    Chepelev, Nikolai L; Bennitz, Joshua D; Huang, Ting; McBride, Skye; Willmore, William G

    2011-01-01

    Nrf1 (nuclear factor-erythroid 2 p45 subunit-related factor 1) is a transcription factor mediating cellular responses to xenobiotic and pro-oxidant stress. Nrf1 regulates the transcription of many stress-related genes through the electrophile response elements (EpREs) located in their promoter regions. Despite its potential importance in human health, the mechanisms controlling Nrf1 have not been addressed fully. We found that proteasomal inhibitors MG-132 and clasto-lactacystin-β-lactone stabilized the protein expression of full-length Nrf1 in both COS7 and WFF2002 cells. Concomitantly, proteasomal inhibition decreased the expression of a smaller, N-terminal Nrf1 fragment, with an approximate molecular weight of 23 kDa. The EpRE-luciferase reporter assays revealed that proteasomal inhibition markedly inhibited the Nrf1 transactivational activity. These results support earlier hypotheses that the 26 S proteasome processes Nrf1 into its active form by removing its inhibitory N-terminal domain anchoring Nrf1 to the endoplasmic reticulum. Immunoprecipitation demonstrated that Nrf1 is ubiquitinated and that proteasomal inhibition increased the degree of Nrf1 ubiquitination. Furthermore, Nrf1 protein had a half-life of approximately 5 hours in COS7 cells. In contrast, hypoxia (1% O(2)) significantly increased the luciferase reporter activity of exogenous Nrf1 protein, while decreasing the protein expression of p65, a shorter form of Nrf1, known to act as a repressor of EpRE-controlled gene expression. Finally, the protein phosphatase inhibitor okadaic acid activated Nrf1 reporter activity, while the latter was repressed by the PKC inhibitor staurosporine. Collectively, our data suggests that Nrf1 is controlled by several post-translational mechanisms, including ubiquitination, proteolytic processing and proteasomal-mediated degradation as well as by its phosphorylation status. © 2011 Chepelev et al.

  9. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    International Nuclear Information System (INIS)

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.

    2011-01-01

    Research highlights: → Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. → HDAC inhibition decreases Nrf2 protein stability. → HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. → HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H 2 O 2 ) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H 2 O 2 -induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  10. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Mercado, Nicolas [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Thimmulappa, Rajesh [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E. [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Biswal, Shyam [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Ito, Kazuhiro [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Barnes, Peter J., E-mail: p.j.barnes@imperial.ac.uk [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom)

    2011-03-11

    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  11. Thyroid Hormone-Induced Cytosol-to-Nuclear Translocation of Rat Liver Nrf2 Is Dependent on Kupffer Cell Functioning

    Directory of Open Access Journals (Sweden)

    Luis A. Videla

    2012-01-01

    Full Text Available L-3,3′,5-triiodothyronine (T3 administration upregulates nuclear factor-E2-related factor 2 (Nrf2 in rat liver, which is redox-sensitive transcription factor mediating cytoprotection. In this work, we studied the role of Kupffer cell respiratory burst activity, a process related to reactive oxygen species generation and liver homeostasis, in Nrf2 activation using the macrophage inactivator gadolinium chloride (GdCl3; 10 mg/kg i.v. 72 h before T3 [0.1 mg/kg i.p.] or NADPH oxidase inhibitor apocynin (1.5 mmol/L added to the drinking water for 7 days before T3, and determinations were performed 2 h after T3. T3 increased nuclear/cytosolic Nrf2 content ratio and levels of heme oxygenase 1 (HO-1, catalytic subunit of glutamate cysteine ligase, and thioredoxin (Western blot over control values, proteins whose gene transcription is induced by Nrf2. These changes were suppressed by GdCl3 treatment prior to T3, an agent-eliciting Kupffer-cell depletion, inhibition of colloidal carbon phagocytosis, and the associated respiratory burst activity, with enhancement in nuclear inhibitor of Nrf2 kelch-like ECH-associated protein 1 (Keap1/Nrf2 content ratios suggesting Nrf2 degradation. Under these conditions, T3-induced tumor necrosis factor-α (TNF-α response was eliminated by previous GdCl3 administration. Similar to GdCl3, apocynin given before T3 significantly reduced liver Nrf2 activation and HO-1 expression, a NADPH oxidase inhibitor eliciting abolishment of colloidal carbon-induced respiratory burst activity without altering carbon phagocytosis. It is concluded that Kupffer cell functioning is essential for upregulation of liver Nrf2-signaling pathway by T3. This contention is supported by suppression of the respiratory burst activity of Kupffer cells and the associated reactive oxygen species production by GdCl3 or apocynin given prior to T3, thus hindering Nrf2 activation.

  12. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu

    2016-11-15

    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H{sub 2}O{sub 2}) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H{sub 2}O{sub 2} levels. Furthermore, H{sub 2}O{sub 2} independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H{sub 2}O{sub 2} levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H{sub 2}O{sub 2}-independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H{sub 2}O{sub 2} - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments

  13. Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury

    Directory of Open Access Journals (Sweden)

    Ravirajsinh N. Jadeja

    2016-01-01

    Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.

  14. NRF2 deficiency replicates transcriptomic changes in Alzheimer's patients and worsens APP and TAU pathology

    Directory of Open Access Journals (Sweden)

    Ana I. Rojo

    2017-10-01

    Full Text Available Failure to translate successful neuroprotective preclinical data to a clinical setting in Alzheimer's disease (AD indicates that amyloidopathy and tauopathy alone provide an incomplete view of disease. We have tested here the relevance of additional homeostatic deviations that result from loss of activity of transcription factor NRF2, a crucial regulator of multiple stress responses whose activity declines with ageing. A transcriptomic analysis demonstrated that NRF2-KO mouse brains reproduce 7 and 10 of the most dysregulated pathways of human ageing and AD brains, respectively. Then, we generated a mouse that combines amyloidopathy and tauopathy with either wild type (AT-NRF2-WT or NRF2-deficiency (AT-NRF2-KO. AT-NRF2-KO brains presented increased markers of oxidative stress and neuroinflammation as well as higher levels of insoluble phosphorylated-TAU and Aβ*56 compared to AT-NRF2-WT mice. Young adult AT-NRF2-KO mice exhibited deficits in spatial learning and memory and reduced long term potentiation in the perforant pathway. This study demonstrates the relevance of normal homeostatic responses that decline with ageing, such as NRF2 activity, in the protection against proteotoxic, inflammatory and oxidative stress and provide a new strategy to fight AD.

  15. Activation of Nrf2 is required for up-regulation of the π class of glutathione S-transferase in rat primary hepatocytes with L-methionine starvation.

    Science.gov (United States)

    Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei

    2012-07-04

    Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.

  16. The NRF2-KEAP1 Pathway Is an Early Responsive Gene Network in Arsenic Exposed Lymphoblastoid Cells

    Science.gov (United States)

    Córdova, Emilio J.; Martínez-Hernández, Angélica; Uribe-Figueroa, Laura; Centeno, Federico; Morales-Marín, Mirna; Koneru, Harsha; Coleman, Matthew A.; Orozco, Lorena

    2014-01-01

    Inorganic arsenic (iAs), a major environmental contaminant, has risen as an important health problem worldwide. More detailed identification of the molecular mechanisms associated with iAs exposure would help to establish better strategies for prevention and treatment. Although chronic iAs exposures have been previously studied there is little to no information regarding the early events of exposure to iAs. To better characterize the early mechanisms of iAs exposure we conducted gene expression studies using sublethal doses of iAs at two different time-points. The major transcripts differentially regulated at 2 hrs of iAs exposure included antioxidants, detoxificants and chaperones. Moreover, after 12 hrs of exposure many of the down-regulated genes were associated with DNA replication and S phase cell cycle progression. Interestingly, the most affected biological pathway by both 2 or 12 hrs of iAs exposure were the Nrf2-Keap1 pathway, represented by the highly up-regulated HMOX1 transcript, which is transcriptionally regulated by the transcription factor Nrf2. Additional Nrf2 targets included SQSTM1 and ABCB6, which were not previously associated with acute iAs exposure. Signalling pathways such as interferon, B cell receptor and AhR route were also responsive to acute iAs exposure. Since HMOX1 expression increased early (20 min) and was responsive to low iAs concentrations (0.1 µM), this gene could be a suitable early biomarker for iAs exposure. In addition, the novel Nrf2 targets SQSTM1 and ABCB6 could play an important and previously unrecognized role in cellular protection against iAs. PMID:24516582

  17. Overview of Nrf2 as Therapeutic Target in Epilepsy

    Directory of Open Access Journals (Sweden)

    Liliana Carmona-Aparicio

    2015-08-01

    Full Text Available Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2, which plays a central role in the regulation of antioxidant response elements (ARE and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy.

  18. Constitutive activation of Nrf2 induces a stable reductive state in the mouse myocardium

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam

    2017-08-01

    Full Text Available Redox homeostasis regulates key cellular signaling pathways in both physiology and pathology. The cell's antioxidant response provides a defense against oxidative stress and establishes a redox tone permissive for cell signaling. The molecular regulation of the well-known Keap1/Nrf2 system acts as sensor responding to changes in redox homeostasis and is poorly studied in the heart. Importantly, it is not yet known whether Nrf2 alone can serve as a master regulator of cellular redox homeostasis without compensation of the transcriptional regulation of antioxidant response element (ARE genes through alternate mechanisms. Here, we addressed this question using cardiac-specific transgenic expression at two different levels of constitutively active nuclear erythroid related factor 2 (caNrf2 functioning independently of Keap1. The caNrf2 mice showed augmentation of glutathione (GSH, the key regulator of the cellular thiol redox state. The Trans-AM assay for Nrf2-binding to the antioxidant response element (ARE showed a dose-dependent increase associated with upregulation of several major antioxidant genes and proteins. This was accompanied by a significant decrease in dihydroethidium staining and malondialdehyde (MDA in the caNrf2-TG mice myocardium. Interestingly, caNrf2 gene-dosage dependent redox changes were noted resulting in generation of a multi-stage model of pro-reductive and reductive conditions in the myocardium of TG-low and TG-high mice, respectively. These data clearly show that Nrf2 levels alone are capable of serving as the master regulator of the ARE. These models provide an important platform to investigate the impact of the Nrf2 system independent of the need to regulate the activity of Keap1 and the consequent exposure to pro-oxidants or electrophiles, which have numerous off-target effects.

  19. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  20. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway.

    Science.gov (United States)

    Son, Tae Gen; Kawamoto, Elisa M; Yu, Qian-Sheng; Greig, Nigel H; Mattson, Mark P; Camandola, Simonetta

    2013-04-19

    Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity. Published by Elsevier Inc.

  1. Effects of Nrf2 Deficiency on Bone Microarchitecture in an Experimental Model of Osteoporosis

    Directory of Open Access Journals (Sweden)

    Lidia Ibáñez

    2014-01-01

    Full Text Available Objective. Redox imbalance contributes to bone fragility. We have evaluated the in vivo role of nuclear factor erythroid derived 2-related factor-2 (Nrf2, an important regulator of cellular responses to oxidative stress, in bone metabolism using a model of postmenopausal osteoporosis. Methods. Ovariectomy was performed in both wild-type and mice deficient in Nrf2 (Nrf2−/−. Bone microarchitecture was analyzed by μCT. Serum markers of bone metabolism were also measured. Reactive oxygen species production was determined using dihydrorhodamine 123. Results. Sham-operated or ovariectomized Nrf2−/− mice exhibit a loss in trabecular bone mineral density in femur, accompanied by a reduction in cortical area in vertebrae. Nrf2 deficiency tended to increase osteoblastic markers and significantly enhanced osteoclastic markers in sham-operated animals indicating an increased bone turnover with a main effect on bone resorption. We have also shown an increased production of oxidative stress in bone marrow-derived cells from sham-operated or ovariectomized Nrf2−/− mice and a higher responsiveness of bone marrow-derived cells to osteoclastogenic stimuli in vitro. Conclusion. We have demonstrated in vivo a key role of Nrf2 in the maintenance of bone microarchitecture.

  2. The Role of Nrf2-Mediated Pathway in Cardiac Remodeling and Heart Failure

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    2014-01-01

    Full Text Available Heart failure (HF is frequently the consequence of sustained, abnormal neurohormonal, and mechanical stress and remains a leading cause of death worldwide. The key pathophysiological process leading to HF is cardiac remodeling, a term referring to maladaptation to cardiac stress at the molecular, cellular, tissue, and organ levels. HF and many of the conditions that predispose one to HF are associated with oxidative stress. Increased generation of reactive oxygen species (ROS in the heart can directly lead to increased necrosis and apoptosis of cardiomyocytes which subsequently induce cardiac remodeling and dysfunction. Nuclear factor-erythroid-2- (NF-E2- related factor 2 (Nrf2 is a transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes that are ubiquitously expressed in the cardiovascular system. Emerging evidence has revealed that Nrf2 and its target genes are critical regulators of cardiovascular homeostasis via the suppression of oxidative stress, which is the key player in the development and progression of HF. The purpose of this review is to summarize evidence that activation of Nrf2 enhances endogenous antioxidant defenses and counteracts oxidative stress-associated cardiac remodeling and HF.

  3. Prolonged inorganic arsenite exposure suppresses insulin-stimulated AKT S473 phosphorylation and glucose uptake in 3T3-L1 adipocytes: involvement of the adaptive antioxidant response.

    Science.gov (United States)

    Xue, Peng; Hou, Yongyong; Zhang, Qiang; Woods, Courtney G; Yarborough, Kathy; Liu, Huiyu; Sun, Guifan; Andersen, Melvin E; Pi, Jingbo

    2011-04-08

    There is growing evidence that chronic exposure of humans to inorganic arsenic, a potent environmental oxidative stressor, is associated with the incidence of type 2 diabetes (T2D). One critical feature of T2D is insulin resistance in peripheral tissues, especially in mature adipocytes, the hallmark of which is decreased insulin-stimulated glucose uptake (ISGU). Despite the deleterious effects of reactive oxygen species (ROS), they have been recognized as a second messenger serving an intracellular signaling role for insulin action. Nuclear factor erythroid 2-related factor 2 (NRF2) is a central transcription factor regulating cellular adaptive response to oxidative stress. This study proposes that in response to arsenic exposure, the NRF2-mediated adaptive induction of endogenous antioxidant enzymes blunts insulin-stimulated ROS signaling and thus impairs ISGU. Exposure of differentiated 3T3-L1 cells to low-level (up to 2 μM) inorganic arsenite (iAs³(+)) led to decreased ISGU in a dose- and time-dependent manner. Concomitant to the impairment of ISGU, iAs³(+) exposure significantly attenuated insulin-stimulated intracellular ROS accumulation and AKT S473 phosphorylation, which could be attributed to the activation of NRF2 and induction of a battery of endogenous antioxidant enzymes. In addition, prolonged iAs³(+) exposure of 3T3-L1 adipocytes resulted in significant induction of inflammatory response genes and decreased expression of adipogenic genes and glucose transporter type 4 (GLUT4), suggesting chronic inflammation and reduction in GLUT4 expression may also be involved in arsenic-induced insulin resistance in adipocytes. Taken together our studies suggest that prolonged low-level iAs³(+) exposure activates the cellular adaptive oxidative stress response, which impairs insulin-stimulated ROS signaling that is involved in ISGU, and thus causes insulin resistance in adipocytes. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. 3H-1,2-Dithiole-3-thione as a novel therapeutic agent for the treatment of ischemic stroke through Nrf2 defense pathway.

    Science.gov (United States)

    Kuo, Ping-Chang; Yu, I-Chen; Scofield, Barbara A; Brown, Dennis A; Curfman, Eric T; Paraiso, Hallel C; Chang, Fen-Lei; Yen, Jui-Hung

    2017-05-01

    Cerebral ischemic stroke accounts for more than 80% of all stroke cases. During cerebral ischemia, reactive oxygen species produced in brain tissue induce oxidative stress and inflammatory responses. D3T, the simplest compound of the cyclic, sulfur-containing dithiolethiones, is found in cruciferous vegetables and has been reported to induce antioxidant genes and glutathione biosynthesis through activation of Nrf2. In addition to antioxidant activity, D3T was also reported to possess anti-inflammatory effects. In this study, we evaluated the therapeutic potential of D3T for the treatment of ischemic stroke and investigated the mechanisms underlying the protective effects of D3T in ischemic stroke. Mice subjected to transient middle cerebral artery occlusion/reperfusion (tMCAO/R) were administered with vehicle or D3T to evaluate the effect of D3T in cerebral brain injury. We observed D3T reduced infarct size, decreased brain edema, lessened blood-brain barrier disruption, and ameliorated neurological deficits. Further investigation revealed D3T suppressed microglia (MG) activation and inhibited peripheral inflammatory immune cell infiltration of CNS in the ischemic brain. The protective effect of D3T in ischemic stroke is mediated through Nrf2 induction as D3T-attenuated brain injury was abolished in Nrf2 deficient mice subjected to tMCAO/R. In addition, in vitro results indicate the induction of Nrf2 by D3T is required for its suppressive effect on MG activation and cytokine production. In summary, we demonstrate for the first time that D3T confers protection against ischemic stroke, which is mediated through suppression of MG activation and inhibition of CNS peripheral cell infiltration, and that the protective effect of D3T in ischemic stroke is dependent on the activation of Nrf2. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae).

    Science.gov (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan

    2016-01-01

    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  6. Dendritic cells' death induced by contact sensitizers is controlled by Nrf2 and depends on glutathione levels

    Energy Technology Data Exchange (ETDEWEB)

    El Ali, Zeina [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France); Deloménie, Claudine [IFR141 IPSIT, Univ Paris-Sud, Université Paris-Saclay, Châtenay-Malabry (France); Botton, Jérémie [INSERM, UMR1153 Epidemiology and Biostatistics Sorbonne Paris Cité Center (CRESS), Team (France); Pallardy, Marc [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France); Kerdine-Römer, Saadia, E-mail: saadia.kerdine-romer@u-psud.fr [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France)

    2017-05-01

    Dendritic cells (DC) are known to play a major role during contact allergy induced by contact sensitizers (CS). Our previous studies showed that Nrf2 was induced in DC and controlled allergic skin inflammation in mice in response to chemicals. In this work, we raised the question of the role of Nrf2 in response to a stress provoked by chemical sensitizers in DC. We used two well-described chemical sensitizers, dinitrochlorobenzene (DNCB) and cinnamaldehyde (CinA), known to have different chemical reactivity and mechanism of action. First, we performed a RT-qPCR array showing that CinA was a higher inducer of immune and detoxification genes compared to DNCB. Interestingly, in the absence of Nrf2, gene expression was dramatically affected in response to DNCB but was slightly affected in response to CinA. These observations prompted us to study DC's cell death in response to both chemicals. DNCB and CinA increased apoptotic cells and decreased living cells in the absence of Nrf2. The characterization of DC apoptosis induced by both CS involved the mitochondrial-dependent caspase pathway and was regulated via Nrf2 in response to both chemicals. Oxidative stress induced by DNCB, and leading to cell death, was regulated by Nrf2. Unlike CinA, DNCB treatment provoked a significant reduction of intracellular GSH levels and up-regulated bcl-2 gene expression, under the control of Nrf2. This work underlies that chemical reactivity may control Nrf2-dependent gene expression leading to different cytoprotective mechanisms in DC. - Highlights: • Nrf2 controls cell death induced by contact sensitizers in dendritic cells. • DNCB reduced GSH levels and up-regulated bcl-2 gene expression unlike CinA. • Chemical reactivity controls Nrf2-dependent genes having protective effect in DC.

  7. NRF2 Pathway Activation and Adjuvant Chemotherapy Benefit in Lung Squamous Cell Carcinoma.

    Science.gov (United States)

    Cescon, David W; She, Desmond; Sakashita, Shingo; Zhu, Chang-Qi; Pintilie, Melania; Shepherd, Frances A; Tsao, Ming-Sound

    2015-06-01

    Genomic profiling of lung squamous cell carcinomas (SCC) has identified NRF2 pathway alterations, which activate oxidative response pathways, in one third of tumors. Preclinical data suggest these tumors may be resistant to platinum-based chemotherapy. We evaluated the clinical relevance of these findings and assessed whether NRF2 activation predicts benefit from adjuvant chemotherapy in SCC. Logistic regression (LR) and significance analysis of microarrays (SAM) were applied to all 104 TCGA (The Cancer Genome Atlas) SCC cases that had microarray gene expression and mutation data to identify genes associated with somatic NRF2 pathway alterations. The resulting signature (NRF2(ACT)) was tested in 3 independent SCC datasets to evaluate its prognostic and predictive effects. IHC and sequencing for NRF2 and KEAP1 were evaluated in one cohort (n = 43) to assess the relationship between gene expression, mutational status, and protein expression. Twenty-eight genes were identified by overlap between LR (291 genes) and SAM (30 genes), and these consistently separated SCC into 2 groups in all datasets, corresponding to putatively NRF pathway-activated and wild-type (WT) tumors. NRF2(ACT) was not prognostic. However, improved survival with adjuvant chemotherapy in the JBR.10-randomized trial appears limited to patients with the WT signature (HR 0.32, P = 0.16; NRF2(ACT) HR 2.28, P = 0.48; interaction P = 0.15). NRF2(ACT) was highly correlated with mutations in NRF2 and KEAP1, and with high NRF2 protein expression. A gene expression signature of NRF2 pathway activation is associated with benefit from adjuvant cisplatin/vinorelbine in SCC. Patients with NRF2 pathway-activating somatic alterations may have reduced benefit from this therapy. ©2015 American Association for Cancer Research.

  8. PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Petriello, Michael C. [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Han, Sung Gu [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Food Science and Biotechnology of Animal Resources, College of Animal Bioscience and Technology, Konkuk University, Seoul 143-701 (Korea, Republic of); Newsome, Bradley J. [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Chemistry, College of Arts and Sciences, University of Kentucky, Lexington, KY 40506 (United States); Hennig, Bernhard [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Animal and Food Sciences, College of Agriculture, Food and Environment, University of Kentucky, KY 40506 (United States)

    2014-06-01

    Environmental toxicants such as polychlorinated biphenyls (PCBs) have been implicated in the promotion of multiple inflammatory disorders including cardiovascular disease, but information regarding mechanisms of toxicity and cross-talk between relevant cell signaling pathways is lacking. To examine the hypothesis that cross-talk between membrane domains called caveolae and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathways alters PCB-induced inflammation, caveolin-1 was silenced in vascular endothelial cells, resulting in a decreased PCB-induced inflammatory response. Cav-1 silencing (siRNA treatment) also increased levels of Nrf2-ARE transcriptional binding, resulting in higher mRNA levels of the antioxidant genes glutathione s-transferase and NADPH dehydrogenase quinone-1 in both vehicle and PCB-treated systems. Along with this upregulated antioxidant response, Cav-1 siRNA treated cells exhibited decreased mRNA levels of the Nrf2 inhibitory protein Keap1 in both vehicle and PCB-treated samples. Silencing Cav-1 also decreased protein levels of Nrf2 inhibitory proteins Keap1 and Fyn kinase, especially in PCB-treated cells. Further, endothelial cells from wildtype and Cav-1 −/− mice were isolated and treated with PCB to better elucidate the role of functional caveolae in PCB-induced endothelial inflammation. Cav-1 −/− endothelial cells were protected from PCB-induced cellular dysfunction as evidenced by decreased vascular cell adhesion molecule (VCAM-1) protein induction. Compared to wildtype cells, Cav-1 −/− endothelial cells also allowed for a more effective antioxidant response, as observed by higher levels of the antioxidant genes. These data demonstrate novel cross-talk mechanisms between Cav-1 and Nrf2 and implicate the reduction of Cav-1 as a protective mechanism for PCB-induced cellular dysfunction and inflammation. - Highlights: • Reduction of caveolin-1 protein protects against polychlorinated biphenyl toxicity. • Decreasing

  9. Dioscin alleviates BDL- and DMN-induced hepatic fibrosis via Sirt1/Nrf2-mediated inhibition of p38 MAPK pathway

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Lina; Tao, Xufeng; Xu, Youwei; Han, Xu; Qi, Yan; Xu, Lina; Yin, Lianhong; Peng, Jinyong, E-mail: jinyongpeng2014@163.com

    2016-02-01

    Oxidative stress is involved in hepatic stellate cells (HSCs) activation and extracellular matrix overproduction. We previously reported the promising effects of dioscin against CCl{sub 4}-induced liver fibrosis, but its effects and mechanisms on BDL- and DMN-induced liver fibrosis remain unknown. The results in the present study indicated that dioscin significantly inhibited HSCs activation and attenuated hepatic fibrosis in rats. Furthermore, dioscin markedly up-regulated the levels of sirtuin 1 (Sirt1), HO-1, GST, GCLC and GCLM via increasing the nuclear translocation of nuclear erythroid factor 2-related factor 2 (Nrf2), which in turn inhibited mitogen-activated protein kinase 14 (p38 MAPK) phosphorylation and reduced the levels of COL1A1, COL3A1, α-SMA and fibronectin. These results were further validated by knockdown of Sirt1 and Nrf2 using siRNAs silencing, and abrogation of p38 MAPK using SB-203580 (a p38 MAPK inhibitor) in HSC-T6 and LX-2 cells. Collectively, our findings confirmed the potent effects of dioscin against liver fibrosis and also provided novel insights into the mechanisms of this compound as a candidate for the prevention of liver fibrosis in the future. - Highlights: • Dioscin showed potent effects against BDL- and DMN-induced liver fibrosis in rats. • Dioscin significantly suppressed oxidative stress. • Dioscin triggered Sirt1/Nrf2-mediated inhibition of p38 MAPK pathway. • Dioscin should be developed as a novel candidate to treat liver fibrosis.

  10. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi-Hwi; Kim, Eung-Hwi [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Jung, Hye Seung [Department of Internal Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Yang, Dongki [Department of Physiology, Gachon University College of Medicine, Incheon (Korea, Republic of); Park, Eun-Young, E-mail: parkey@mokpo.ac.kr [College of Pharmacy, Natural Medicine Research Institute, Mokpo National University, Muan-gun, Jeonnam (Korea, Republic of); Jun, Hee-Sook, E-mail: hsjun@gachon.ac.kr [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Gachon Medical Research Institute, Gil Hospital, Incheon (Korea, Republic of)

    2017-01-15

    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H{sub 2}O{sub 2}. Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is

  11. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    International Nuclear Information System (INIS)

    Kim, Mi-Hwi; Kim, Eung-Hwi; Jung, Hye Seung; Yang, Dongki; Park, Eun-Young; Jun, Hee-Sook

    2017-01-01

    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H 2 O 2 . Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is mediated by

  12. Sulforaphane prevents angiotensin II-induced cardiomyopathy by activation of Nrf2 via stimulating the Akt/GSK-3ß/Fyn pathway

    Directory of Open Access Journals (Sweden)

    Ying Xin

    2018-05-01

    Conclusion: These results suggest that Nrf2 plays a central role in the prevention of Ang II-induced cardiomyopathy, and SFN prevents Ang II-induced cardiomyopathy partially via the Akt/GSK-3β/Fyn-mediated Nrf2 activation.

  13. Dietary supplementation of curcumin augments heat stress tolerance through upregulation of nrf-2-mediated antioxidative enzymes and hsps in Puntius sophore.

    Science.gov (United States)

    Mahanty, Arabinda; Mohanty, Sasmita; Mohanty, Bimal P

    2017-08-01

    Heat stress is one of the major environmental concerns in global warming regime and rising temperature has resulted in mass mortalities of animals including fishes. Therefore, strategies for high temperature stress tolerance and ameliorating the effects of heat stress are being looked for. In an earlier study, we reported that Nrf-2 (nuclear factor E2-related factor 2) mediated upregulation of antioxidative enzymes and heat shock proteins (Hsps) provide survivability to fish under heat stress. In this study, we have evaluated the ameliorative potential of dietary curcumin, a potential Nrf-2 inducer in heat stressed cyprinid Puntius sophore. Fishes were fed with diet supplemented with 0.5, 1.0, and 1.5% curcumin at the rate 2% of body weight daily in three separate groups (n = 40 in each group) for 60 days. Fishes fed with basal diet (without curcumin) served as the control (n = 40). Critical thermal maxima (CTmax) was determined for all the groups (n = 10, in duplicates) after the feeding trial. Significant increase in the CTmax was observed in the group fed with 1.5% curcumin- supplemented fishes whereas it remained similar in groups fed with 0.5%, and 1% curcumin-supplemented diet, as compared to control. To understand the molecular mechanism of elevated thermotolerance in the 1.5% curcumin supplemented group, fishes were given a sub-lethal heat shock treatment (36 °C) for 6 h and expression analysis of nrf-2, keap-1, sod, catalase, gpx, and hsp27, hsp60, hsp70, hsp90, and hsp110 was carried out using RT-PCR. In the gill, expression of nrf-2, sod, catalase, gpx, and hsp60, hsp70, hsp90, and hsp110 was found to be elevated in the 1.5% curcumin-fed heat-shocked group compared to control and the basal diet-fed, heat-shocked fishes. Similarly, in the liver, upregulation in expression of nrf-2, sod, catalase, and hsp70 and hsp110 was observed in 1.5% curcumin supplemented and heat shocked group. Thus, this study showed that supplementation of curcumin

  14. Impaired transcriptional activity of Nrf2 in age-related myocardial oxidative stress is reversible by moderate exercise training.

    Directory of Open Access Journals (Sweden)

    Sellamuthu S Gounder

    Full Text Available Aging promotes accumulation of reactive oxygen/nitrogen species (ROS/RNS in cardiomyocytes, which leads to contractile dysfunction and cardiac abnormalities. These changes may contribute to increased cardiovascular disease in the elderly. Inducible antioxidant pathways are regulated by nuclear erythroid 2 p45-related factor 2 (Nrf2 through antioxidant response cis-elements (AREs and are impaired in the aging heart. Whereas acute exercise stress (AES activates Nrf2 signaling and promotes myocardial antioxidant function in young mice (~2 months, aging mouse (>23 months hearts exhibit significant oxidative stress as compared to those of the young. The purpose of this study was to investigate age-dependent regulation of Nrf2-antioxidant mechanisms and redox homeostasis in mouse hearts and the impact of exercise. Old mice were highly susceptible to oxidative stress following high endurance exercise stress (EES, but demonstrated increased adaptive redox homeostasis after moderate exercise training (MET; 10m/min, for 45 min/day for ~6 weeks. Following EES, transcription and protein levels for most of the ARE-antioxidants were increased in young mice but their induction was blunted in aging mice. In contrast, 6-weeks of chronic MET promoted nuclear levels of Nrf2 along with its target antioxidants in the aging heart to near normal levels as seen in young mice. These observations suggest that enhancing Nrf2 function and endogenous cytoprotective mechanisms by MET, may combat age-induced ROS/RNS and protect the myocardium from oxidative stress diseases.

  15. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita

    2017-06-01

    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  16. The neuroprotective effects of α-iso-cubebene on dopaminergic cell death: involvement of CREB/Nrf2 signaling.

    Science.gov (United States)

    Park, Sun Young; Son, Beung Gu; Park, Young Hoon; Kim, Cheol-Min; Park, Geuntae; Choi, Young-Whan

    2014-09-01

    As a part of ongoing studies to elucidate pharmacologically active components of Schisandra chinensis, we isolated and studied α-iso-cubebene. The neuroprotective mechanisms of α-iso-cubebene in human neuroblastoma SH-SY5Y cells were investigated. α-Iso-cubebene significantly inhibited cytotoxicity and apoptosis due to 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in dopaminergic SH-SY5Y cells. Pretreatment of cells with α-iso-cubebene reduced intracellular accumulation of ROS and calcium in response to 6-OHDA. The neuroprotective effects of α-iso-cubebene were found to result from protecting the mitochondrial membrane potential. Notably, α-iso-cubebene inhibited the release of apoptosis-inducing factor from the mitochondria into the cytosol and nucleus after 6-OHDA treatment. α-Iso-cubebene also induced the activation of PKA/PKB/CREB/Nrf2 and suppressed 6-OHDA-induced neurotoxicity. α-Iso-cubebene was found to induce phosphorylation of PKA and PKB and activate Nrf2 and CREB signaling pathways in a dose-dependent manner. Additionally, α-iso-cubebene stimulated the expression of the antioxidant response genes NQO1 and HO-1. Finally, α-iso-cubebene-mediated neuroprotective effects were found to be reversible after transfection with CREB and Nrf2 small interfering RNAs.

  17. PF-4708671, a specific inhibitor of p70 ribosomal S6 kinase 1, activates Nrf2 by promoting p62-dependent autophagic degradation of Keap1

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: soohanbae@yuhs.ac [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2015-10-23

    p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.

  18. Neutrophils in oral paracoccidioidomycosis and the involvement of Nrf2.

    Directory of Open Access Journals (Sweden)

    Vera Cavalcanti Araújo

    Full Text Available Neutrophils have been implicated in granuloma formation in several infectious diseases, in addition to their main phagocytic and pathogen destruction role. It has been demonstrated that Nrf2 regulates antioxidant protection in neutrophils, attenuating inflammation without compromising the hosts bacterial defense. In this study, we analyzed the presence of neutrophils in Paracoccidioides brasiliensis mycosis (PCM, as well as the immunoexpression of Nrf2. Thirty-nine cases of oral PCM were classified according to quantity of fungi and to the presence of loose or well-organized granulomas and microabscesses. An Nrf2 antibody was used for immunohistochemical analysis. The results showed that neutrophils are present in microabscesses and loose granulomas, but were absent in structured granulomas. A greater quantity of fungi was shown in cases with only loose granulomas when compared to loose and well organized granulomas. Nrf2 was observed in the nuclei of neutrophils of loose granulomas and abscesses, with its expression in loose granulomas maintained despite the additional presence of well organized granulomas in the same specimen. This study suggests that neutrophils participate in P. brasiliensis granuloma formation and that Nrf2 has a possible role in neutrophil survival, via modulation of the inflammatory response.

  19. Nrf2 Inhibits Periodontal Ligament Stem Cell Apoptosis under Excessive Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Yanli Liu

    2017-05-01

    Full Text Available The present study aimed to analyze novel mechanisms underlying Nrf2-mediated anti-apoptosis in periodontal ligament stem cells (PDLSCs in the periodontitis oxidative microenvironment. We created an oxidative stress model with H2O2-treated PDLSCs. We used real-time PCR, Western blotting, TUNEL staining, fluorogenic assay and transfer genetics to confirm the degree of oxidative stress and apoptosis as well as the function of nuclear factor-erythroid 2-related factor 2 (Nrf2. We demonstrated that with upregulated levels of reactive oxygen species (ROS and malondialdehyde (MDA, the effect of oxidative stress was obvious under H2O2 treatment. Oxidative molecules were altered after the H2O2 exposure, whereby the signaling of Nrf2 was activated with an increase in its downstream effectors, heme oxygenase-1 (HO-1, NAD(PH:quinone oxidoreductase 1 (NQO1 and γ-glutamyl cysteine synthetase (γ-GCS. Additionally, the apoptosis levels gradually increased with oxidative stress by the upregulation of caspase-9, caspase-3, Bax and c-Fos levels in addition to the downregulation of Bcl-2. However, there was no alterations in levels of caspase-8. The enhanced antioxidant effect could not mitigate the occurrence of apoptosis. Furthermore, Nrf2 overexpression effectively improved the anti-oxidative levels and increased cell proliferation. At the same time, overexpression effectively restrained TUNEL staining and decreased the molecular levels of caspase-9, caspase-3, Bax and c-Fos, but not that of caspase-8. In contrast, silencing the expression of Nrf2 levels had the opposite effect. Collectively, Nrf2 alleviates PDLSCs via its effects on regulating oxidative stress and anti-intrinsic apoptosis by the activation of oxidative enzymes.

  20. Nrf2 is required to maintain the self-renewal of glioma stem cells

    International Nuclear Information System (INIS)

    Zhu, Jianhong; Wang, Handong; Sun, Qing; Ji, Xiangjun; Zhu, Lin; Cong, Zixiang; Zhou, Yuan; Liu, Huandong; Zhou, Mengliang

    2013-01-01

    Glioblastomas are deadly cancers that display a functional cellular hierarchy maintained by self-renewing glioma stem cells (GSCs). Self-renewal is a complex biological process necessary for maintaining the glioma stem cells. Nuclear factor rythroid 2-related factor 2(Nrf2) plays a significant role in protecting cells from endogenous and exogenous stresses. Nrf2 is a key nuclear transcription factor that regulates antioxidant response element (ARE)-containing genes. Previous studies have demonstrated the significant role of Nrf2 in the proliferation of glioblastoma, and in their resistance to radioactive therapies. We examined the effect of knocking down Nrf2 in GSCs. Nrf2 expression was down-regulated by shRNA transinfected with lentivirus. Expression levels of Nestin, Nrf2, BMI-1, Sox2 and Cyclin E were assessed by western blotting, quantitative polymerase chain reaction (qPCR) and immunohistochemistry analysis. The capacity for self-renewal in vitro was assessed by genesis of colonies. The capacity for self-renewal in vivo was analyzed by tumor genesis of xenografts in nude mice. Knockdown of Nrf2 inhibited the proliferation of GSCs, and significantly reduced the expression of BMI-1, Sox2 and CyclinE. Knocking down of Nrf2 changed the cell cycle distribution of GSCs by causing an uncharacteristic increase in the proportion of cells in the G2 phase and a decrease in the proportion of cells in the S phase of the cell cycle. Nrf2 is required to maintain the self-renewal of GSCs, and its down-regulation can attenuate the self-renewal of GSCs significantly

  1. Increased Alzheimer's disease-like pathology in the APP/ PS1ΔE9 mouse model lacking Nrf2 through modulation of autophagy.

    Science.gov (United States)

    Joshi, Gururaj; Gan, Kok Ann; Johnson, Delinda A; Johnson, Jeffrey A

    2015-02-01

    The presence of senile plaques is one of the major pathologic hallmarks of the brain with Alzheimer's disease (AD). The plaques predominantly contain insoluble amyloid β-peptide, a cleavage product of the larger amyloid precursor protein (APP). Two enzymes, named β and γ secretase, generate the neurotoxic amyloid-β peptide from APP. Mature APP is also turned over endogenously by autophagy, more specifically by the endosomal-lysosomal pathway. A defective lysosomal system is known to be pathogenic in AD. Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders, and Nrf2 has become a potential therapeutic target for various neurodegenerative disorders, including AD, Parkinson's disease, and amyotrophic lateral sclerosis. In the current study, we explored the effect of genetic ablation of Nrf2 on APP/Aβ processing and/or aggregation as well as changes in autophagic dysfunction in APP/PS1 mice. There was a significant increase in inflammatory response in APP/PS1 mice lacking Nrf2. This was accompanied by increased intracellular levels of APP, Aβ (1-42), and Aβ (1-40), without a change total full-length APP. There was a shift of APP and Aβ into the insoluble fraction, as well as increased poly-ubiquitin conjugated proteins in mice lacking Nrf2. APP/PS1-mediated autophagic dysfunction is also enhanced in Nrf2-deficient mice. Finally, neurons in the APP/PS1/Nrf2-/- mice had increased accumulation of multivesicular bodies, endosomes, and lysosomes. These outcomes provide a better understanding of the role of Nrf2 in modulating autophagy in an AD mouse model and may help design better Nrf2 targeted therapeutics that could be efficacious in the treatment of AD. Published by Elsevier Inc.

  2. Synergy between the KEAP1/NRF2 and PI3K Pathways Drives Non-Small-Cell Lung Cancer with an Altered Immune Microenvironment.

    Science.gov (United States)

    Best, Sarah A; De Souza, David P; Kersbergen, Ariena; Policheni, Antonia N; Dayalan, Saravanan; Tull, Dedreia; Rathi, Vivek; Gray, Daniel H; Ritchie, Matthew E; McConville, Malcolm J; Sutherland, Kate D

    2018-04-03

    The lung presents a highly oxidative environment, which is tolerated through engagement of tightly controlled stress response pathways. A critical stress response mediator is the transcription factor nuclear factor erythroid-2-related factor 2 (NFE2L2/NRF2), which is negatively regulated by Kelch-like ECH-associated protein 1 (KEAP1). Alterations in the KEAP1/NRF2 pathway have been identified in 23% of lung adenocarcinomas, suggesting that deregulation of the pathway is a major cancer driver. We demonstrate that inactivation of Keap1 and Pten in the mouse lung promotes adenocarcinoma formation. Notably, metabolites identified in the plasma of Keap1 f/f /Pten f/f tumor-bearing mice indicate that tumorigenesis is associated with reprogramming of the pentose phosphate pathway. Furthermore, the immune milieu was dramatically changed by Keap1 and Pten deletion, and tumor regression was achieved utilizing immune checkpoint inhibition. Thus, our study highlights the ability to exploit both metabolic and immune characteristics in the detection and treatment of lung tumors harboring KEAP1/NRF2 pathway alterations. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Oxidized DNA induces an adaptive response in human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Kostyuk, Svetlana V., E-mail: svet.kostyuk@gmail.com [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Tabakov, Viacheslav J.; Chestkov, Valerij V.; Konkova, Marina S.; Glebova, Kristina V.; Baydakova, Galina V.; Ershova, Elizaveta S.; Izhevskaya, Vera L. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Baranova, Ancha, E-mail: abaranov@gmu.edu [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation); Center for the Study of Chronic Metabolic Diseases, School of System Biology, George Mason University, Fairfax, VA 22030 (United States); Veiko, Natalia N. [Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow (Russian Federation)

    2013-07-15

    Highlights: • We describe the effects of gDNAOX on human fibroblasts cultivated in serum withdrawal conditions. • gDNAOX evokes an adaptive response in human fibroblasts. • gDNAOX increases the survival rates in serum starving cell populations. • gDNAOX enhances the survival rates in cell populations irradiated at 1.2 Gy dose. • gDNAOX up-regulates NRF2 and inhibits NF-kappaB-signaling. - Abstract: Cell-free DNA (cfDNA) released from dying cells contains a substantial proportion of oxidized nucleotides, thus, forming cfDNA{sup OX}. The levels of cfDNA{sup OX} are increased in the serum of patients with chronic diseases. Oxidation of DNA turns it into a stress signal. The samples of genomic DNA (gDNA) oxidized by H{sub 2}O{sub 2}in vitro (gDNA{sup OX}) induce effects similar to that of DNA released from damaged cells. Here we describe the effects of gDNA{sup OX} on human fibroblasts cultivated in the stressful conditions of serum withdrawal. In these cells, gDNA{sup OX} evokes an adaptive response that leads to an increase in the rates of survival in serum starving cell populations as well as in populations irradiated at the dose of 1.2 Gy. These effects are not seen in control populations of fibroblasts treated with non-modified gDNA. In particular, the exposure to gDNA{sup OX} leads to a decrease in the expression of the proliferation marker Ki-67 and an increase in levels of PSNA, a decrease in the proportion of subG1- and G2/M cells, a decrease in proportion of cells with double strand breaks (DSBs). Both gDNA{sup OX} and gDNA suppress the expression of DNA sensors TLR9 and AIM2 and up-regulate nuclear factor-erythroid 2 p45-related factor 2 (NRF2), while only gDNA{sup OX} inhibits NF-κB signaling. gDNA{sup OX} is a model for oxidized cfDNA{sup OX} that is released from the dying tumor cells and being carried to the distant organs. The systemic effects of oxidized DNA have to be taken into account when treating tumors. In particular, the damaged DNA

  4. Benznidazole, the trypanocidal drug used for Chagas disease, induces hepatic NRF2 activation and attenuates the inflammatory response in a murine model of sepsis

    International Nuclear Information System (INIS)

    Lambertucci, Flavia; Motiño, Omar; Villar, Silvina; Rigalli, Juan Pablo; Luján Alvarez, María de; Catania, Viviana A; Martín-Sanz, Paloma; Carnovale, Cristina Ester; Quiroga, Ariel Darío; Francés, Daniel Eleazar; Ronco, María Teresa

    2017-01-01

    Molecular mechanisms on sepsis progression are linked to the imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity. Previous studies demonstrated that benznidazole (BZL), known for its antiparasitic action on Trypanosoma cruzi, has immunomodulatory effects, increasing survival in C57BL/6 mice in a model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). The mechanism by which BZL inhibits inflammatory response in sepsis is poorly understood. Also, our group recently reported that BZL is able to activate the nuclear factor erytroide-derived 2-Like 2 (NRF2) in vitro. The aim of the present work was to delineate the beneficial role of BZL during sepsis, analyzing its effects on the cellular redox status and the possible link to the innate immunity receptor TLR4. Specifically, we analyzed the effect of BZL on Nrf2 regulation and TLR4 expression in liver of mice 24 hours post-CLP. BZL was able to induce NRF2 nuclear protein localization in CLP mice. Also, we found that protein kinase C (PKC) is involved in the NRF2 nuclear accumulation and induction of its target genes. In addition, BZL prompted a reduction in hepatic CLP-induced TLR4 protein membrane localization, evidencing its immunomodulatory effects. Together, our results demonstrate that BZL induces hepatic NRF2 activation with the concomitant increase in the antioxidant defenses, and the attenuation of inflammatory response, in part, by inhibiting TLR4 expression in a murine model of sepsis. - Highlights: • BZL improves survival rate after polymicrobial sepsis • BZL enhances hepatic NRF2 nuclear accumulation in a model of sepsis, in part, by a mechanism dependent on PKC activation • BZL-enhanced NRF2 induction regulates antioxidant enzymes and increases antioxidant cellular defenses in sepsis • BZL blocks liver ROS production and ROS-induced TLR4 plasma membrane expression in septic mice

  5. Benznidazole, the trypanocidal drug used for Chagas disease, induces hepatic NRF2 activation and attenuates the inflammatory response in a murine model of sepsis

    Energy Technology Data Exchange (ETDEWEB)

    Lambertucci, Flavia [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Motiño, Omar [Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Arturo Duperier 4, 28029 Madrid (Spain); Villar, Silvina [Instituto de Inmunología, Facultad de Ciencias Médicas, UNR, Suipacha 531, 2000 Rosario (Argentina); Rigalli, Juan Pablo; Luján Alvarez, María de; Catania, Viviana A [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Martín-Sanz, Paloma [Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Arturo Duperier 4, 28029 Madrid (Spain); Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Monforte de Lemos 3-5, 28029 Madrid (Spain); Carnovale, Cristina Ester; Quiroga, Ariel Darío; Francés, Daniel Eleazar [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Ronco, María Teresa, E-mail: ronco@ifise-conicet.gov.ar [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)

    2017-01-15

    Molecular mechanisms on sepsis progression are linked to the imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity. Previous studies demonstrated that benznidazole (BZL), known for its antiparasitic action on Trypanosoma cruzi, has immunomodulatory effects, increasing survival in C57BL/6 mice in a model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). The mechanism by which BZL inhibits inflammatory response in sepsis is poorly understood. Also, our group recently reported that BZL is able to activate the nuclear factor erytroide-derived 2-Like 2 (NRF2) in vitro. The aim of the present work was to delineate the beneficial role of BZL during sepsis, analyzing its effects on the cellular redox status and the possible link to the innate immunity receptor TLR4. Specifically, we analyzed the effect of BZL on Nrf2 regulation and TLR4 expression in liver of mice 24 hours post-CLP. BZL was able to induce NRF2 nuclear protein localization in CLP mice. Also, we found that protein kinase C (PKC) is involved in the NRF2 nuclear accumulation and induction of its target genes. In addition, BZL prompted a reduction in hepatic CLP-induced TLR4 protein membrane localization, evidencing its immunomodulatory effects. Together, our results demonstrate that BZL induces hepatic NRF2 activation with the concomitant increase in the antioxidant defenses, and the attenuation of inflammatory response, in part, by inhibiting TLR4 expression in a murine model of sepsis. - Highlights: • BZL improves survival rate after polymicrobial sepsis • BZL enhances hepatic NRF2 nuclear accumulation in a model of sepsis, in part, by a mechanism dependent on PKC activation • BZL-enhanced NRF2 induction regulates antioxidant enzymes and increases antioxidant cellular defenses in sepsis • BZL blocks liver ROS production and ROS-induced TLR4 plasma membrane expression in septic mice.

  6. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2018-03-01

    Full Text Available Environmental exposure to solar ultraviolet (UV radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana. Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches.

  7. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Zhang, Donna D.; Wondrak, Georg T.

    2018-01-01

    Environmental exposure to solar ultraviolet (UV) radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2)-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana). Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-)]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA)-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches. PMID:29636694

  8. l-Arginine induces antioxidant response to prevent oxidative stress via stimulation of glutathione synthesis and activation of Nrf2 pathway.

    Science.gov (United States)

    Liang, Mingcai; Wang, Zhengxuan; Li, Hui; Cai, Liang; Pan, Jianghao; He, Hongjuan; Wu, Qiong; Tang, Yinzhao; Ma, Jiapei; Yang, Lin

    2018-05-01

    Arginine is a conditionally essential amino acid. To elucidate the influence of l-arginine on the activation of endogenous antioxidant defence, male Wistar rats were orally administered daily with l-arginine at different levels of 25, 50, 100 mg/100 g body weight. After 7 and 14 days feeding, the antioxidative capacities and glutathione (GSH) contents in the plasma and in the liver were uniformly enhanced with the increasing consumption of l-arginine, whereas the oxidative stress was effectively suppressed by l-arginine treatment. After 14 days feeding, the mRNA levels and protein expressions of Keap1 and Cul3 were gradually reduced by increasing l-arginine intake, resulting that the nuclear factor Nrf2 was activated. Upon activation of Nrf2, the expressions of antioxidant responsive element (ARE)-dependent genes and proteins (GCLC, GCLM, GS, GR, GST, GPx, CAT, SOD, NQO1, HO-1) were up-regulated by l-arginine feeding, indicating an upward trend in antioxidant capacity uniformly with the increasing consumption of l-arginine. The present study demonstrates that the supplementation of l-arginine stimulates GSH synthesis and activates Nrf2 pathway, leading to the up-regulation of ARE-driven antioxidant expressions via Nrf2-Keap1 pathway. Results suggest the availability of l-arginine is a critical factor to suppress oxidative stress and induce an endogenous antioxidant response. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of NRF2.

    Science.gov (United States)

    Tao, Shasha; Park, Sophia L; Rojo de la Vega, Montserrat; Zhang, Donna D; Wondrak, Georg T

    2015-12-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photodamage and carcinogenesis, and an urgent need exists for improved molecular photoprotective strategies different from (or synergistic with) photon absorption. Recent studies suggest a photoprotective role of cutaneous gene expression orchestrated by the transcription factor NRF2 (nuclear factor-E2-related factor 2). Here we have explored the molecular mechanism underlying carotenoid-based systemic skin photoprotection in SKH-1 mice and provide genetic evidence that photoprotection achieved by the FDA-approved apocarotenoid and food additive bixin depends on NRF2 activation. Bixin activates NRF2 through the critical Cys-151 sensor residue in KEAP1, orchestrating a broad cytoprotective response in cultured human keratinocytes as revealed by antioxidant gene expression array analysis. Following dose optimization studies for cutaneous NRF2 activation by systemic administration of bixin, feasibility of bixin-based suppression of acute cutaneous photodamage from solar UV exposure was investigated in Nrf2(+/+) versus Nrf2(-/-) SKH-1 mice. Systemic administration of bixin suppressed skin photodamage, attenuating epidermal oxidative DNA damage and inflammatory responses in Nrf2(+/+) but not in Nrf2(-/-) mice, confirming the NRF2-dependence of bixin-based cytoprotection. Taken together, these data demonstrate feasibility of achieving NRF2-dependent cutaneous photoprotection by systemic administration of the apocarotenoid bixin, a natural food additive consumed worldwide. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells.

    Science.gov (United States)

    Wan Hasan, Wan Nuraini; Kwak, Mi-Kyoung; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2014-02-23

    Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice. WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [ quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)]. Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells. The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the

  11. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares

    2017-04-01

    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  12. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    International Nuclear Information System (INIS)

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-01-01

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  13. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hae-Ryung, E-mail: heaven@umich.edu; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20 μM BDE-47 for 24 h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20 μM BDE-47 for 24 h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. - Highlights: • BDE-47 stimulated ARE reporter activity and GSH production. • BDE-47 resulted in differential

  14. Targeting the Nrf2/Amyloid-Beta Liaison in Alzheimer's Disease: A Rational Approach.

    Science.gov (United States)

    Simoni, Elena; Serafini, Melania M; Caporaso, Roberta; Marchetti, Chiara; Racchi, Marco; Minarini, Anna; Bartolini, Manuela; Lanni, Cristina; Rosini, Michela

    2017-07-19

    Amyloid is a prominent feature of Alzheimer's disease (AD). Yet, a linear linkage between amyloid-β peptide (Aβ) and the disease onset and progression has recently been questioned. In this context, the crucial partnership between Aβ and Nrf2 pathways is acquiring paramount importance, offering prospects for deciphering the Aβ-centered disease network. Here, we report on a new class of antiaggregating agents rationally designed to simultaneously activate transcription-based antioxidant responses, whose lead 1 showed interesting properties in a preliminary investigation. Relying on the requirements of Aβ recognition, we identified the catechol derivative 12. In SH-SY5Y neuroblastoma cells, 12 combined remarkable free radical scavenger properties to the ability to trigger the Nrf2 pathway and induce the Nrf2-dependent defensive gene NQO1 by means of electrophilic activation of the transcriptional response. Moreover, 12 prevented the formation of cytotoxic stable oligomeric intermediates, being significantly more effective, and per se less toxic, than prototype 1. More importantly, as different chemical features were exploited to regulate Nrf2 and Aβ activities, the two pathways could be tuned independently. These findings point to compound 12 and its derivatives as promising tools for investigating the therapeutic potential of the Nrf2/Aβ cellular network, laying foundation for generating new drug leads to confront AD.

  15. Activation of anti-oxidant Nrf2 signaling by enone analogues of curcumin.

    Science.gov (United States)

    Deck, Lorraine M; Hunsaker, Lucy A; Vander Jagt, Thomas A; Whalen, Lisa J; Royer, Robert E; Vander Jagt, David L

    2018-01-01

    Inflammation and oxidative stress are common in many chronic diseases. Targeting signaling pathways that contribute to these conditions may have therapeutic potential. The transcription factor Nrf2 is a major regulator of phase II detoxification and anti-oxidant genes as well as anti-inflammatory and neuroprotective genes. Nrf2 is widespread in the CNS and is recognized as an important regulator of brain inflammation. The natural product curcumin exhibits numerous biological activities including ability to induce the expression of Nrf2-dependent phase II and anti-oxidant enzymes. Curcumin has been examined in a number of clinical studies with limited success, mainly owing to limited bioavailability and rapid metabolism. Enone analogues of curcumin were examined with an Nrf2 reporter assay to identify Nrf2 activators. Analogues were separated into groups with a 7-carbon dienone spacer, as found in curcumin; a 5-carbon enone spacer with and without a ring; and a 3-carbon enone spacer. Activators of Nrf2 were found in all three groups, many of which were more active than curcumin. Dose-response studies demonstrated that a range of substituents on the aromatic rings of these enones influenced not only the sensitivity to activation, reflected in EC 50 values, but also the extent of activation, which suggests that multiple mechanisms are involved in the activation of Nrf2 by these analogues. Copyright © 2017. Published by Elsevier Masson SAS.

  16. TBHQ Alleviated Endoplasmic Reticulum Stress-Apoptosis and Oxidative Stress by PERK-Nrf2 Crosstalk in Methamphetamine-Induced Chronic Pulmonary Toxicity

    Directory of Open Access Journals (Sweden)

    Yun Wang

    2017-01-01

    Full Text Available Methamphetamine (MA leads to cardiac and pulmonary toxicity expressed as increases in inflammatory responses and oxidative stress. However, some interactions may exist between oxidative stress and endoplasmic reticulum stress (ERS. The current study is designed to investigate if both oxidative stress and ERS are involved in MA-induced chronic pulmonary toxicity and if antioxidant tertiary butylhydroquinone (TBHQ alleviated ERS-apoptosis and oxidative stress by PERK-Nrf2 crosstalk. In this study, the rats were randomly divided into control group, MA-treated group (MA, and MA plus TBHQ-treated group (MA + TBHQ. Chronic exposure to MA resulted in slower growth of weight and pulmonary toxicity of the rats by increasing the pulmonary arterial pressure, promoting the hypertrophy of right ventricle and the remodeling of pulmonary arteries. MA inhibited the Nrf2-mediated antioxidative stress by downregulation of Nrf2, GCS, and HO-1 and upregulation of SOD2. MA increased GRP78 to induce ERS. Overexpression and phosphorylation of PERK rapidly phosphorylated eIF2α, increased ATF4, CHOP, bax, caspase 3, and caspase 12, and decreased bcl-2. These changes can be reversed by antioxidant TBHQ through upregulating expression of Nrf2. The above results indicated that TBHQ can alleviate MA-induced oxidative stress which can accelerate ERS to initiate PERK-dependent apoptosis and that PERK/Nrf2 is likely to be the key crosstalk between oxidative stress and ERS in MA-induced chronic pulmonary toxicity.

  17. Activation of Nrf2 protects against triptolide-induced hepatotoxicity.

    Directory of Open Access Journals (Sweden)

    Jia Li

    Full Text Available Triptolide, the major active component of Tripterygium wilfordii Hook f. (TWHF, has a wide range of pharmacological activities. However, the toxicities of triptolide, particularly the hepatotoxicity, limit its clinical application. The hepatotoxicity of triptolide has not been well characterized yet. The aim of this study was to investigate the role of NF-E2-related factor 2 (Nrf2 in triptolide-induced toxicity and whether activation of Nrf2 could protect against triptolide-induced hepatotoxicity. The results showed that triptolide caused oxidative stress and cell damage in HepG2 cells, and these toxic effects could be aggravated by Nrf2 knockdown or be counteracted by overexpression of Nrf2. Treatment with a typical Nrf2 agonist, sulforaphane (SFN, attenuated triptolide-induced liver dysfunction, structural damage, glutathione depletion and decrease in antioxidant enzymes in BALB/C mice. Moreover, the hepatoprotective effect of SFN on triptolide-induced liver injury was associated with the activation of Nrf2 and its downstream targets. Collectively, these results indicate that Nrf2 activation protects against triptolide-induced hepatotoxicity.

  18. Cudarflavone B Provides Neuroprotection against Glutamate-Induced Mouse Hippocampal HT22 Cell Damage through the Nrf2 and PI3K/Akt Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Dong-Sung Lee

    2014-07-01

    Full Text Available Oxidative cell damage contributes to neuronal degeneration in many central nervous system (CNS diseases such as Alzheimer’s disease, Parkinson’s disease, and ischemia. Nrf2 signaling-mediated heme oxygenase (HO-1 expression acts against oxidants that are thought to play a key role in the pathogenesis of neuronal diseases. Cudraflavone B is a prenylated flavone isolated from C. tricuspidata which has shown anti-proliferative activity, mouse brain monoamine oxidase (MAO inhibitory effects, apoptotic actions in human gastric carcinoma cells and mouse melanoma cells, and hepatoprotective activity. In this study, cudraflavone B showed neuroprotective effects and reactive oxygen species (ROS inhibition against glutamate-induced neurotoxicity by inducing the expression of HO-1 in mouse hippocampal HT22 cells. Furthermore, cudraflavone B caused the nuclear accumulation of nuclear factor-E2-related factor 2 (Nrf2 and increased the promoter activity of antioxidant response elements (ARE in mouse hippocampal HT22 cells. In addition, we found that the Nrf2-midiated HO-1 expression by cudraflavone B is involved in the cell protective response and ROS reductions, and cudraflavone B-induced expression of HO-1 was mediated through the phosphatidylinositol 3-kinase (PI3K/Akt pathway in HT22 cells. Our results demonstrated the potential application of naturally occurring cudraflavone B as a therapeutic agent from neurodegenerative disease.

  19. 6-Shogaol, an active compound of ginger, alleviates allergic dermatitis-like skin lesions via cytokine inhibition by activating the Nrf2 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Park, Gunhyuk, E-mail: uranos5@kiom.re.kr [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Oh, Dal-Seok [The K-herb Research Center, Korea Institute of Oriental Medicine, 1672 Yuseong-daero, Yuseong-gu, Daejeon 34054 (Korea, Republic of); Lee, Mi Gi; Lee, Chang Eon [Major in Cosmeceutical Science, Division of Bio-technology and Convergence, Daegu Haany University, Gyeongsan (Korea, Republic of); Kim, Yong-ung, E-mail: ykim@dhu.ac.kr [Department of Pharmaceutical Engineering, College of Biomedical Science, Daegu Haany University (Korea, Republic of)

    2016-11-01

    Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.

  20. 6-Shogaol, an active compound of ginger, alleviates allergic dermatitis-like skin lesions via cytokine inhibition by activating the Nrf2 pathway

    International Nuclear Information System (INIS)

    Park, Gunhyuk; Oh, Dal-Seok; Lee, Mi Gi; Lee, Chang Eon; Kim, Yong-ung

    2016-01-01

    Allergic dermatitis (AD) clinically presents with skin erythematous plaques, eruption, and elevated serum IgE, and T helper cell type 2 and 1 (Th2 and Th1) cytokine levels. 6-Shogaol [1-(4-hydroxy-methoxyphenyl)-4-decen-one], a pungent compound isolated from ginger, has shown anti-inflammatory effects, but its inhibitory effects on AD are unknown. The aim of this study was to examine whether 6-shogaol inhibits AD-like skin lesions and their underlying mechanism in vivo and in vitro. An AD-like response was induced by tumor necrosis factor-α (TNF-α) + IFN-γ in human keratinocytes or by 2,4-dinitrochlorobenzene (DNCB) in mice. In vivo, 6-shogaol inhibited the development of DNCB-induced AD-like skin lesions and scratching behavior, and showed significant reduction in Th2/1-mediated inflammatory cytokines, IgE, TNF-α, IFN-γ, thymus and activation-regulated chemokine, IL-1, 4, 12, and 13, cyclooxygenase-2, and nitric oxide synthase levels. In vitro, 6-shogaol inhibited reactive oxygen species (ROS) and mitogen-activated protein kinases (MAPKs) signaling, and increased the levels of total glutathione, heme oxygenase-1, and quinone 1 via nuclear factor erythroid 2 related factor 2 (Nrf2) activation. 6-Shogaol can alleviate AD-like skin lesions by inhibiting immune mediators via regulating the ROS/MAPKs/Nrf2 signaling pathway, and may be an effective alternative therapy for AD. - Highlights: • 6-Shogaol inhibited Th2/1-mediated inflammatory mediators in vitro and in vivo. • 6-Shogaol regulated ROS/MAPKs/Nrf2 signaling pathway. • 6-Shogaol can protect against the development of AD-like skin lesions.

  1. Prolonged inorganic arsenite exposure suppresses insulin-stimulated AKT S473 phosphorylation and glucose uptake in 3T3-L1 adipocytes: Involvement of the adaptive antioxidant response

    International Nuclear Information System (INIS)

    Xue, Peng; Hou, Yongyong; Zhang, Qiang; Woods, Courtney G.; Yarborough, Kathy; Liu, Huiyu; Sun, Guifan; Andersen, Melvin E.; Pi, Jingbo

    2011-01-01

    Highlights: → In 3T3-L1 adipocytes iAs 3+ decreases insulin-stimulated glucose uptake. → iAs 3+ attenuates insulin-induced phosphorylation of AKT S473. → iAs 3+ activates the cellular adaptive oxidative stress response. → iAs 3+ impairs insulin-stimulated ROS signaling. → iAs 3+ decreases expression of adipogenic genes and GLUT4. -- Abstract: There is growing evidence that chronic exposure of humans to inorganic arsenic, a potent environmental oxidative stressor, is associated with the incidence of type 2 diabetes (T2D). One critical feature of T2D is insulin resistance in peripheral tissues, especially in mature adipocytes, the hallmark of which is decreased insulin-stimulated glucose uptake (ISGU). Despite the deleterious effects of reactive oxygen species (ROS), they have been recognized as a second messenger serving an intracellular signaling role for insulin action. Nuclear factor erythroid 2-related factor 2 (NRF2) is a central transcription factor regulating cellular adaptive response to oxidative stress. This study proposes that in response to arsenic exposure, the NRF2-mediated adaptive induction of endogenous antioxidant enzymes blunts insulin-stimulated ROS signaling and thus impairs ISGU. Exposure of differentiated 3T3-L1 cells to low-level (up to 2 μM) inorganic arsenite (iAs 3+ ) led to decreased ISGU in a dose- and time-dependent manner. Concomitant to the impairment of ISGU, iAs 3+ exposure significantly attenuated insulin-stimulated intracellular ROS accumulation and AKT S473 phosphorylation, which could be attributed to the activation of NRF2 and induction of a battery of endogenous antioxidant enzymes. In addition, prolonged iAs 3+ exposure of 3T3-L1 adipocytes resulted in significant induction of inflammatory response genes and decreased expression of adipogenic genes and glucose transporter type 4 (GLUT4), suggesting chronic inflammation and reduction in GLUT4 expression may also be involved in arsenic-induced insulin resistance in

  2. Prolonged inorganic arsenite exposure suppresses insulin-stimulated AKT S473 phosphorylation and glucose uptake in 3T3-L1 adipocytes: Involvement of the adaptive antioxidant response

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Peng [The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States); School of Public Health, China Medical University, Shenyang 110001 (China); Hou, Yongyong; Zhang, Qiang; Woods, Courtney G.; Yarborough, Kathy; Liu, Huiyu [The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States); Sun, Guifan [School of Public Health, China Medical University, Shenyang 110001 (China); Andersen, Melvin E. [The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [The Hamner Institutes for Health Sciences, Research Triangle Park, NC 27709 (United States)

    2011-04-08

    Highlights: {yields} In 3T3-L1 adipocytes iAs{sup 3+} decreases insulin-stimulated glucose uptake. {yields} iAs{sup 3+} attenuates insulin-induced phosphorylation of AKT S473. {yields} iAs{sup 3+} activates the cellular adaptive oxidative stress response. {yields} iAs{sup 3+} impairs insulin-stimulated ROS signaling. {yields} iAs{sup 3+} decreases expression of adipogenic genes and GLUT4. -- Abstract: There is growing evidence that chronic exposure of humans to inorganic arsenic, a potent environmental oxidative stressor, is associated with the incidence of type 2 diabetes (T2D). One critical feature of T2D is insulin resistance in peripheral tissues, especially in mature adipocytes, the hallmark of which is decreased insulin-stimulated glucose uptake (ISGU). Despite the deleterious effects of reactive oxygen species (ROS), they have been recognized as a second messenger serving an intracellular signaling role for insulin action. Nuclear factor erythroid 2-related factor 2 (NRF2) is a central transcription factor regulating cellular adaptive response to oxidative stress. This study proposes that in response to arsenic exposure, the NRF2-mediated adaptive induction of endogenous antioxidant enzymes blunts insulin-stimulated ROS signaling and thus impairs ISGU. Exposure of differentiated 3T3-L1 cells to low-level (up to 2 {mu}M) inorganic arsenite (iAs{sup 3+}) led to decreased ISGU in a dose- and time-dependent manner. Concomitant to the impairment of ISGU, iAs{sup 3+} exposure significantly attenuated insulin-stimulated intracellular ROS accumulation and AKT S473 phosphorylation, which could be attributed to the activation of NRF2 and induction of a battery of endogenous antioxidant enzymes. In addition, prolonged iAs{sup 3+} exposure of 3T3-L1 adipocytes resulted in significant induction of inflammatory response genes and decreased expression of adipogenic genes and glucose transporter type 4 (GLUT4), suggesting chronic inflammation and reduction in GLUT4

  3. The Biofunctions of Phytochemicals and Their Applications in Farm Animals: The Nrf2/Keap1 System as a Target

    Directory of Open Access Journals (Sweden)

    Si Qin

    2017-10-01

    Full Text Available Reactive oxygen species (ROS can be caused by mechanical, thermal, infectious, and chemical stimuli, and their negative effects on the health of humans and other animals are of considerable concern. The nuclear factor (erythroid-derived 2-like 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1 system plays a major role in maintaining the balance between the production and elimination of ROS via the regulation of a series of detoxifying and antioxidant enzyme gene expressions by means of the antioxidant response element (ARE. Dietary phytochemicals, which are generally found in vegetables, fruits, grains, and herbs, have been reported to have health benefits and to improve the growth performance and meat quality of farm animals through the regulation of Nrf2-mediated phase II enzymes in a variety of ways. However, the enormous quantity of somewhat chaotic data that is available on the effects of phytochemicals needs to be properly classified according to the functions or mechanisms of phytochemicals. In this review, we first introduce the antioxidant properties of phytochemicals and their relation to the Nrf2/Keap1 system. We then summarize the effects of phytochemicals on the growth performance, meat quality, and intestinal microbiota of farm animals via targeting the Nrf2/Keap1 system. These exhaustive data contribute to better illuminate the underlying biofunctional properties of phytochemicals in farm animals.

  4. Adenovirus-Mediated Over-Expression of Nrf2 Within Mesenchymal Stem Cells (MSCs Protected Rats Against Acute Kidney Injury

    Directory of Open Access Journals (Sweden)

    Mohammad Mohammadzadeh-Vardin

    2015-06-01

    Full Text Available Purpose: Recent developments in the field of cell therapy have led to a renewed interest in treatment of acute kidney injury (AKI. However, the early death of transplanted mesenchymal stem cells (MSCs in stressful microenvironment of a recipient tissue is a major problem with this kind of treatment. The objective of this study was to determine whether overexpression of a cytoprotective factor, nuclear factor erythroid-2 related factor 2 (Nrf2, in MSCs could protect rats against AKI. Methods: The Nrf2 was overexpressed in MSCs by recombinant adenoviruses, and the MSCs were implanted to rats suffering from cisplatin-induced AKI. Results: The obtained results showed that transplantation with the engineered MSCs ameliorates cisplatin-induced AKI. Morphologic features of the investigated kidneys showed that transplantation with the MSCs in which Nrf2 had been overexpressed significantly improved the complications of AKI. Conclusion: These findings suggested that the engineered MSCs might be a good candidate to be further evaluated in clinical trials. However, detailed studies must be performed to investigate the possible carcinogenic effect of Nrf2 overexpression.

  5. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: subhash.dhawan@fda.hhs.gov [Food and Drug Administration, Silver Spring, MD (United States)

    2017-03-15

    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  6. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    International Nuclear Information System (INIS)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash

    2017-01-01

    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  7. 6-OHDA-induced apoptosis and mitochondrial dysfunction are mediated by early modulation of intracellular signals and interaction of Nrf2 and NF-κB factors

    International Nuclear Information System (INIS)

    Tobón-Velasco, Julio C.; Limón-Pacheco, Jorge H.; Orozco-Ibarra, Marisol; Macías-Silva, Marina; Vázquez-Victorio, Genaro; Cuevas, Elvis; Ali, Syed F.

    2013-01-01

    6-Hydroxydopamine (6-OHDA) is a neurotoxin that generates an experimental model of Parkinson's disease in rodents and is commonly employed to induce a lesion in dopaminergic pathways. The characterization of those molecular mechanisms linked to 6-OHDA-induced early toxicity is needed to better understand the cellular events further leading to neurodegeneration. The present work explored how 6-OHDA triggers early downstream signaling pathways that activate neurotoxicity in the rat striatum. Mitochondrial function, caspases-dependent apoptosis, kinases signaling (Akt, ERK 1/2, SAP/JNK and p38) and crosstalk between nuclear factor kappa B (NF-κB) and nuclear factor-erythroid-2-related factor 2 (Nrf2) were evaluated at early times post-lesion. We found that 6-OHDA initiates cell damage via mitochondrial complex I inhibition, cytochrome c and apoptosis-inducing factor (AIF) release, as well as activation of caspases 9 and 3 to induce apoptosis, kinase signaling modulation and NF-κB-mediated inflammatory responses, accompanied by inhibition of antioxidant systems regulated by the Nrf2 pathway. Our results suggest that kinases SAP/JNK and p38 up-regulation may play a role in the early stages of 6-OHDA toxicity to trigger intrinsic pathways for apoptosis and enhanced NF-κB activation. In turn, these cellular events inhibit the activation of cytoprotective mechanisms, thereby leading to a condition of general damage

  8. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Chian, Song; Thapa, Ruby; Chi, Zhexu [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China)

    2014-05-16

    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  9. Acrylamide-induced oxidative stress and inflammatory response are alleviated by N-acetylcysteine in PC12 cells: Involvement of the crosstalk between Nrf2 and NF-κB pathways regulated by MAPKs.

    Science.gov (United States)

    Pan, Xiaoqi; Wu, Xu; Yan, Dandan; Peng, Cheng; Rao, Chaolong; Yan, Hong

    2018-05-15

    Acrylamide (ACR) is a classic neurotoxin in animals and humans. However, the mechanism underlying ACR neurotoxicity remains controversial, and effective prevention and treatment measures against this condition are scarce. This study focused on clarifying the crosstalk between the involved signaling pathways in ACR-induced oxidative stress and inflammatory response and investigating the protective effect of antioxidant N-acetylcysteine (NAC) against ACR in PC12 cells. Results revealed that ACR exposure led to oxidative stress characterized by significant increase in reactive oxygen species (ROS) and malondialdehyde (MDA) levels and glutathione (GSH) consumption. Inflammatory response was observed based on the dose-dependently increased levels of pro-inflammatory cytokines tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6). NAC attenuated ACR-induced enhancement of MDA and ROS levels and TNF-α generation. In addition, ACR activated nuclear transcription factor E2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB) signaling pathways. Knockdown of Nrf2 by siRNA significantly blocked the increased NF-κB p65 protein expression in ACR-treated PC12 cells. Down-regulation of NF-κB by specific inhibitor BAY11-7082 similarly reduced ACR-induced increase in Nrf2 protein expression. NAC treatment increased Nrf2 expression and suppressed NF-κB p65 expression to ameliorate oxidative stress and inflammatory response caused by ACR. Further results showed that mitogen-activated protein kinases (MAPKs) pathway was activated prior to the activation of Nrf2 and NF-κB pathways. Inhibition of MAPKs blocked Nrf2 and NF-κB pathways. Collectively, ACR activated Nrf2 and NF-κB pathways which were regulated by MAPKs. A crosstalk between Nrf2 and NF-κB pathways existed in ACR-induced cell damage. NAC protected against oxidative damage and inflammatory response induced by ACR by activating Nrf2 and inhibiting NF-κB pathways in PC12 cells. Copyright © 2018 Elsevier B

  10. Can Co-Activation of Nrf2 and Neurotrophic Signaling Pathway Slow Alzheimer’s Disease?

    Directory of Open Access Journals (Sweden)

    Kelsey E. Murphy

    2017-05-01

    Full Text Available Alzheimer’s disease (AD is a multifaceted disease that is hard to treat by single-modal treatment. AD starts with amyloid peptides, mitochondrial dysfunction, and oxidative stress and later is accompanied with chronic endoplasmic reticulum (ER stress and autophagy dysfunction, resulting in more complicated pathogenesis. Currently, few treatments can modify the complicated pathogenic progress of AD. Compared to the treatment with exogenous antioxidants, the activation of global antioxidant defense system via Nrf2 looks more promising in attenuating oxidative stress in AD brains. Accompanying the activation of the Nrf2-mediated antioxidant defense system that reduce the AD-causative factor, oxidative stress, it is also necessary to activate the neurotrophic signaling pathway that replaces damaged organelles and molecules with new ones. Thus, the dual actions to activate both the Nrf2 antioxidant system and neurotrophic signaling pathway are expected to provide a better strategy to modify AD pathogenesis. Here, we review the current understanding of AD pathogenesis and neuronal defense systems and discuss a possible way to co-activate the Nrf2 antioxidant system and neurotrophic signaling pathway with the hope of helping to find a better strategy to slow AD.

  11. The Role of the Nrf2/ARE Antioxidant System in Preventing Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Robert E. Smith

    2016-11-01

    Full Text Available It is widely believed that consuming foods and beverages that have high concentrations of antioxidants can prevent cardiovascular diseases and many types of cancer. As a result, many articles have been published that give the total antioxidant capacities of foods in vitro. However, many antioxidants behave quite differently in vivo. Some of them, such as resveratrol (in red wine and epigallocatechin gallate or EGCG (in green tea can activate the nuclear erythroid-2 like factor-2 (Nrf2 transcription factor. It is a master regulator of endogenous cellular defense mechanisms. Nrf2 controls the expression of many antioxidant and detoxification genes, by binding to antioxidant response elements (AREs that are commonly found in the promoter region of antioxidant (and other genes, and that control expression of those genes. The mechanisms by which Nrf2 relieves oxidative stress and limits cardiac injury as well as the progression to heart failure are described. Also, the ability of statins to induce Nrf2 in the heart, brain, lung, and liver is mentioned. However, there is a negative side of Nrf2. When over-activated, it can cause (not prevent cardiovascular diseases and multi-drug resistance cancer.

  12. The Nrf1 and Nrf2 Balance in Oxidative Stress Regulation and Androgen Signaling in Prostate Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, Michelle A. [Department of Pharmacology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States); Abdel-Mageed, Asim B. [Department of Urology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States); Mondal, Debasis, E-mail: dmondal@tulane.edu [Department of Pharmacology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States)

    2010-06-21

    Reactive oxygen species (ROS) signaling has recently sparked a surge of interest as being the molecular underpinning for cancer cell survival, but the precise mechanisms involved have not been completely elucidated. This review covers the possible roles of two ROS-induced transcription factors, Nrf1 and Nrf2, and the antioxidant proteins peroxiredoxin-1 (Prx-1) and Thioredoxin-1 (Txn-1) in modulating AR expression and signaling in aggressive prostate cancer (PCa) cells. In androgen independent (AI) C4-2B cells, in comparison to the parental androgen dependent (AD) LNCaP cells, we present evidence of high Nrf1 and Prx-1 expression and low Nrf2 expression in these aggressive PCa cells. Furthermore, in DHT treated C4-2B cells, increased expression of the p65 (active) isoform of Nrf1 correlated with enhanced AR transactivation. Our findings implicate a crucial balance of Nrf1 and Nrf2 signaling in regulating AR activity in AI-PCa cells. Here we will discuss how understanding the mechanisms by which oxidative stress may affect AR signaling may aid in developing novel therapies for AI-PCa.

  13. Embryotoxicity Caused by DON-Induced Oxidative Stress Mediated by Nrf2/HO-1 Pathway

    Directory of Open Access Journals (Sweden)

    Miao Yu

    2017-06-01

    Full Text Available Deoxynivalenol (DON belongs to the type B group of trichothecenes family, which is composed of sesquiterpenoid metabolites produced by Fusarium and other fungi in grain. DON may cause various toxicities, such as cytotoxicity, immunotoxicity, genotoxicity as well as teratogenicity and carcinogenicity. In the present study, we focus on a hypothesis that DON alters the expressions of Nrf2/HO-1 pathway by inducing embryotoxicity in C57BL/6 mouse (5.0, 2.5, 1.0, and 0 mg/kg/day and BeWo cell lines (0 and 50 nM; 3 h, 12 h and 24 h. Our results indicate that DON treatment in mice during pregnancy leads to ROS accumulation in the placenta, which results in embryotoxicity. At the same time Nrf2/HO-1 pathway is up-regulated by ROS to protect placenta cells from oxidative damage. In DON-treated BeWo cells, the level of ROS has time–effect and dose–effect relationships with HO-1 expression. Moderate increase in HO-1 protects the cell from oxidative damage, while excessive increase in HO-1 aggravates the oxidative damage, which is called in some studies the “threshold effect”. Therefore, oxidative stress may be the critical molecular mechanism for DON-induced embryotoxicity. Besides, Nrf2/HO-1 pathway accompanied by the “threshold effect” also plays an important role against DON-induced oxidative damage in this process.

  14. Hepatocyte-protective effect of nectandrin B, a nutmeg lignan, against oxidative stress: Role of Nrf2 activation through ERK phosphorylation and AMPK-dependent inhibition of GSK-3β

    Energy Technology Data Exchange (ETDEWEB)

    Song, Jae-Sook; Kim, Eun-Kyung; Choi, Yong-Won [Department of Pharmacy, College of Pharmacy and Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan, Gyeonggi-do 15588 (Korea, Republic of); Oh, Won Keun [College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University (Korea, Republic of); Kim, Young-Mi, E-mail: ymikim12@hanyang.ac.kr [Department of Pharmacy, College of Pharmacy and Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan, Gyeonggi-do 15588 (Korea, Republic of)

    2016-09-15

    Oxidative stress can contribute to the development and progression of liver diseases, such as drug-induced or alcoholic liver injury, nonalcoholic fatty liver disease, and nonalcoholic steatohepatitis. Nectandrin B is a bioactive lignan isolated from nutmeg extract. To date, little information is available about its pharmacological activities in the liver. This study investigated the hepatocyte-protective effect of nectandrin B against tert-butylhydroperoxide-induced oxidative injury and the underlying molecular mechanism. The cell viability assay revealed that nectandrin B prevents apoptosis stimulated by tert-butylhydroperoxide in both HepG2 cells and primary mouse hepatocytes. Nectandrin B also attenuated ROS production and restored the depleted glutathione level. Real-time PCR and immunoblot analyses showed that the expression of glutamate-cysteine ligase, an enzyme responsible for the glutathione biosynthesis, was induced by nectandrin B, indicating its indirect antioxidative effect. The NF-E2-related factor-2 (Nrf2) regulates gene expression of an array of antioxidant enzymes in hepatocytes. Nectandrin B stimulated Nrf2 activation as evidenced by its enhanced nuclear accumulation and increased antioxidant response element (ARE)-luciferase activity. Intriguingly, the hepatocyte-protective effect of nectandrin B against oxidative damage was completely abrogated by Nrf2 knockdown using Nrf2 specific siRNA. Nectandrin B promoted ERK activation, but inactivated GSK-3β through the AMPK-mediated inhibitory phosphorylation. The enforced overexpression of dominant-negative mutant of MEK1 or AMPKα, or wild-type GSK-3β inhibited the increase in the NQO1-ARE-luciferase activity stimulated by nectandrin B, suggesting that both ERK and AMPK-GSK-3β signalings are involved in the activation of Nrf2/ARE pathway by nectandrin B. Consistent with this, cytoprotection and restoration of glutathione level by nectandrin B was also blocked by the overexpression of dominant

  15. Introducing the "TCDD-inducible AhR-Nrf2 gene battery".

    Science.gov (United States)

    Yeager, Ronnie L; Reisman, Scott A; Aleksunes, Lauren M; Klaassen, Curtis D

    2009-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces genes via the transcription factor aryl hydrocarbon receptor (AhR), including Cyp1a1, NAD(P)H:quinone oxidoreductase 1 (Nqo1), UDP-glucuronosyltransferase 1a6 (Ugt1a6), and glutathione S-transferase a1 (Gsta1). These genes are referred to as the "AhR gene battery." However, Nqo1 is also considered a prototypical target gene of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2). In mice, TCDD induction of Nrf2 and Nrf2 target, Nqo1, is dependent on AhR, and thus TCDD induction of drug-processing genes may be routed through an AhR-Nrf2 sequence. There has been speculation that Nrf2 may be involved in the TCDD induction of drug-processing genes; however, the data are not definitive. Therefore, to address whether TCDD induction of Nqo1, Ugts, and Gsts is dependent on Nrf2, we conducted the definitive experiment by administering TCDD (50 mug/kg, ip) to Nrf2-null and wild-type (WT) mice and collecting livers 24 h later to quantify the mRNA of drug-processing genes. TCDD induction of Cyp1a1 and Ugt1a1 was similar in WT and Nrf2-null mice, whereas TCDD induction of Ugt1a5 and 1a9 was blunted in Nrf2-null mice. TCDD induced Nqo1, Ugt1a6, 2b34, 2b35, 2b36, UDP-glucuronic acid-synthesizing gene UDP-glucose dehydrogenase, and Gsta1, m1, m2, m3, m6, p2, t2, and microsomal Gst1 in WT mice but not in Nrf2-null mice. Therefore, the present study demonstrates the novel finding that Nrf2 is required for TCDD induction of classical AhR battery genes Nqo1, Ugt1a6, and Gsta1, as well as most Ugt and Gst isoforms in livers of mice.

  16. Nrf2 and Keap1 Abnormalities in 104 Lung Adenocarcinoma Cases and Association with Clinicopathologic Features

    Directory of Open Access Journals (Sweden)

    Yu XIAO

    2018-03-01

    correlated with PFS and OS of EGFR-TKIs. Therefore, Nrf2 may be a biomarker for predicting response of EGFR-TKIs and a potential target for overcoming resistance of EGFR-TKIs.

  17. Mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after intracranial hemorrhage

    Directory of Open Access Journals (Sweden)

    Yin XP

    2015-11-01

    Full Text Available Xiao-ping Yin,1,2 Zhi-ying Chen,2 Jun Zhou,1 Dan Wu,1,3 Bing Bao2 1Department of Neurology, The Second Affiliated Hospital of Nanchang University, Nanchang, People’s Republic of China; 2Department of Neurology, Affiliated Hospital of Jiujiang University, Jiujiang, People’s Republic of China; 3Department of Neurology, The Sixth Hospital of Wuhan, Wuhan, People’s Republic of China Background: It has been found that nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2–ARE signaling pathway plays a role in antioxidative response, anti-inflammatory response, and neuron-protection in intracerebral hemorrhage (ICH. The aim of this study is to explore mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after ICH.Methods: There were a total of 90 rats with basal ganglia hemorrhage, which were randomly divided into the following four groups: ICH (Sprague–Dawley rats with autologous femoral arterial blood injection into the basal ganglia, sulforaphane (SFN (SFN was intraperitoneally administered into rats, retinoic acid (RA (RA was intraperitoneally administered into rats, and dimethyl sulfoxide (the rats were treated with dimethyl sulfoxide. We observed the neurological score of the rats in the different groups, and collected brain tissues for immunofluorescence, Western blot, and reverse transcription polymerase chain reaction to detect expression of Nrf2, heme oxygenase (HO-1, nuclear factor-κB (NF-κB, and tumor necrosis factor-α (TNF-α.Results: The results indicated that neurological dysfunction of rats was significantly improved in the SFN group, and the expressions of Nrf2 and HO-1 in tissues surrounding the hemorrhage were increased. Also, the level of NF-κB and TNF-α were reduced compared to the ICH group. The RA group exhibited more severe neurological dysfunction and lower levels of Nrf2 and HO-1 than the SFN and ICH groups. Compared to the ICH group, the NF

  18. Chronic Endurance Exercise Impairs Cardiac Structure and Function in Middle-Aged Mice with Impaired Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam

    2017-05-01

    Full Text Available Nuclear factor erythroid 2 related factor 2 (Nrf2 signaling maintains the redox homeostasis and its activation is shown to suppress cardiac maladaptation. Earlier we reported that acute endurance exercise (2 days evoked antioxidant cytoprotection in young WT animals but not in aged WT animals. However, the effect of repeated endurance exercise during biologic aging (WT characterized by an inherent deterioration in Nrf2 signaling and pathological aging (pronounced oxidative susceptibility—Nrf2 absence in the myocardium remains elusive. Thus, the purpose of our study was to determine the effect of chronic endurance exercise-induced cardiac adaptation in aged mice with and without Nrf2. Age-matched WT and Nrf2-null mice (Nrf2−/− (>22 months were subjected to 6 weeks chronic endurance exercise (25 meter/min, 12% grade. The myocardial redox status was assessed by expression of antioxidant defense genes and proteins along with immunochemical detection of DMPO-radical adduct, GSH-NEM, and total ubiquitination. Cardiac functions were assessed by echocardiography and electrocardiogram. At sedentary state, loss of Nrf2 resulted in significant downregulation of antioxidant gene expression (Nqo1, Ho1, Gclm, Cat, and Gst-α with decreased GSH-NEM immuno-fluorescence signals. While Nrf2−/− mice subjected to CEE showed an either similar or more pronounced reduction in the transcript levels of Gclc, Nqo1, Gsr, and Gst-α in relation to WT littermates. In addition, the hearts of Nrf2−/− on CEE showed a substantial reduction in specific antioxidant proteins, G6PD and CAT along with decreased GSH, a pronounced increase in DMPO-adduct and the total ubiquitination levels. Further, CEE resulted in a significant upregulation of hypertrophy genes (Anf, Bnf, and β-Mhc (p < 0.05 in the Nrf2−/− hearts in relation to WT mice. Moreover, the aged Nrf2−/− mice exhibited a higher degree of cardiac remodeling in association with a significant decrease in

  19. Activation of Nrf2 Signaling Augments Vesicular Stomatitis Virus Oncolysis via Autophagy-Driven Suppression of Antiviral Immunity.

    Science.gov (United States)

    Olagnier, David; Lababidi, Rassin R; Hadj, Samar Bel; Sze, Alexandre; Liu, Yiliu; Naidu, Sharadha Dayalan; Ferrari, Matteo; Jiang, Yuan; Chiang, Cindy; Beljanski, Vladimir; Goulet, Marie-Line; Knatko, Elena V; Dinkova-Kostova, Albena T; Hiscott, John; Lin, Rongtuan

    2017-08-02

    Oncolytic viruses (OVs) offer a promising therapeutic approach to treat multiple types of cancer. In this study, we show that the manipulation of the antioxidant network via transcription factor Nrf2 augments vesicular stomatitis virus Δ51 (VSVΔ51) replication and sensitizes cancer cells to viral oncolysis. Activation of Nrf2 signaling by the antioxidant compound sulforaphane (SFN) leads to enhanced VSVΔ51 spread in OV-resistant cancer cells and improves the therapeutic outcome in different murine syngeneic and xenograft tumor models. Chemoresistant A549 lung cancer cells that display constitutive dominant hyperactivation of Nrf2 signaling are particularly vulnerable to VSVΔ51 oncolysis. Mechanistically, enhanced Nrf2 signaling stimulated viral replication in cancer cells and disrupted the type I IFN response via increased autophagy. This study reveals a previously unappreciated role for Nrf2 in the regulation of autophagy and the innate antiviral response that complements the therapeutic potential of VSV-directed oncolysis against multiple types of OV-resistant or chemoresistant cancer. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway.

    Science.gov (United States)

    Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena

    2018-03-23

    The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.

  1. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    International Nuclear Information System (INIS)

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2012-01-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs 3+ ) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs 3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs 3+ and monomethylarsonous acid (MMA 3+ )-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs 3+ -induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs 3+ . The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs 3+ in β-cells. ► Deficiency of Nrf2 in β-cells sensitized to iAs 3+ and MMA 3

  2. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Bei [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang 110001 (China); Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

    2012-11-01

    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  3. Sulforaphane Suppresses Hepatitis C Virus Replication by Up-Regulating Heme Oxygenase-1 Expression through PI3K/Nrf2 Pathway.

    Directory of Open Access Journals (Sweden)

    Jung-Sheng Yu

    Full Text Available Hepatitis C virus (HCV infection-induced oxidative stress is a major risk factor for the development of HCV-associated liver disease. Sulforaphane (SFN is an antioxidant phytocompound that acts against cellular oxidative stress and tumorigenesis. However, there is little known about its anti-viral activity. In this study, we demonstrated that SFN significantly suppressed HCV protein and RNA levels in HCV replicon cells and infectious system, with an IC50 value of 5.7 ± 0.2 μM. Moreover, combination of SFN with anti-viral drugs displayed synergistic effects in the suppression of HCV replication. In addition, we found nuclear factor erythroid 2-related factor 2 (Nrf2/HO-1 induction in response to SFN and determined the signaling pathways involved in this process, including inhibition of NS3 protease activity and induction of IFN response. In contrast, the anti-viral activities were attenuated by knockdown of HO-1 with specific inhibitor (SnPP and shRNA, suggesting that anti-HCV activity of SFN is dependent on HO-1 expression. Otherwise, SFN stimulated the phosphorylation of phosphoinositide 3-kinase (PI3K leading Nrf2-mediated HO-1 expression against HCV replication. Overall, our results indicated that HO-1 is essential in SFN-mediated anti-HCV activity and provide new insights in the molecular mechanism of SFN in HCV replication.

  4. Activation of the Nrf2/ARE pathway via S-alkylation of cysteine 151 in the chemopreventive agent-sensor Keap1 protein by falcarindiol, a conjugated diacetylene compound

    International Nuclear Information System (INIS)

    Ohnuma, Tomokazu; Nakayama, Shinji; Anan, Eisaburo; Nishiyama, Takahito; Ogura, Kenichiro; Hiratsuka, Akira

    2010-01-01

    Under basal conditions, the interaction of the cytosolic protein Kelch-like ECH-associated protein 1 (Keap1) with the transcription factor nuclear factor-E2-related factor 2 (Nrf2) results in a low level of expression of cytoprotective genes whose promoter region contains the antioxidant response element (ARE). In response to oxidants and electrophiles, Nrf2 is stabilized and accumulates in the nucleus. The mechanism for this effect has been proposed to involve thiol-dependent modulation of Keap1, leading to loss of its ability to negatively regulate Nrf2. We previously reported that falcarindiol (heptadeca-1,9(Z)-diene-4,6-diyne-3,8-diol), which occurs in Apiaceae and the closely related Araliaceae plants, causes nuclear accumulation of Nrf2 and induces ARE-regulated enzymes. Here, we report the mechanism of Nrf2 induction by falcarindiol. NMR analysis revealed that the conjugated diacetylene carbons of falcarindiol acted as electrophilic moieties to form adducts with a cysteine (Cys) thiol. In addition, using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and circular dichroism spectroscopy, it was demonstrated that falcarindiol alkylated Cys residues in Keap1 and altered the Keap1 secondary structure. Transfection studies using the purified Keap1 protein, a luciferase reporter construct, and an Nrf2-expressing plasmid indicated that the intact Keap1 protein suppressed Nrf2-mediated ARE-luciferase activity. On the other hand, the falcarindiol-alkylated Keap1 protein did not suppress such activity. Treatment of HEK293 cells overexpressing Keap1 with falcarindiol generated a high molecular weight (HMW) form of Keap1. Furthermore, the Cys151 residue in Keap1 was found to be uniquely required for not only the formation of HMW Keap1 but also an increase in ARE-luciferase activity by falcarindiol. Our results demonstrate that falcarindiol having conjugated diacetylene carbons covalently modifies the Cys151 residue in Keap1 and that the

  5. The age- and sex-specific decline of the 20s proteasome and the Nrf2/CncC signal transduction pathway in adaption and resistance to oxidative stress in Drosophila melanogaster.

    Science.gov (United States)

    Pomatto, Laura C D; Wong, Sarah; Carney, Caroline; Shen, Brenda; Tower, John; Davies, Kelvin J A

    2017-04-01

    Hallmarks of aging include loss of protein homeostasis and dysregulation of stress-adaptive pathways. Loss of adaptive homeostasis, increases accumulation of DNA, protein, and lipid damage. During acute stress, the Cnc-C ( Drosophila Nrf2 orthologue) transcriptionally-regulated 20S proteasome degrades damaged proteins in an ATP-independent manner. Exposure to very low, non-toxic, signaling concentrations of the redox-signaling agent hydrogen peroxide (H 2 O 2 ) cause adaptive increases in the de novo expression and proteolytic activity/capacity of the 20S proteasome in female D. melanogaster (fruit-flies). Female 20S proteasome induction was accompanied by increased tolerance to a subsequent normally toxic but sub-lethal amount of H 2 O 2 , and blocking adaptive increases in proteasome expression also prevented full adaptation. We find, however, that this adaptive response is both sex- and age-dependent. Both increased proteasome expression and activity, and increased oxidative-stress resistance, in female flies, were lost with age. In contrast, male flies exhibited no H 2 O 2 adaptation, irrespective of age. Furthermore, aging caused a generalized increase in basal 20S proteasome expression, but proteolytic activity and adaptation were both compromised. Finally, continual knockdown of Keep1 (the cytosolic inhibitor of Cnc-C) in adults resulted in older flies with greater stress resistance than their age-matched controls, but who still exhibited an age-associated loss of adaptive homeostasis.

  6. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    International Nuclear Information System (INIS)

    Peng, Hui; Wang, Huihui; Xue, Peng; Hou, Yongyong; Dong, Jian; Zhou, Tong; Qu, Weidong; Peng, Shuangqing; Li, Jin; Carmichael, Paul L.; Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As 2 O 3 ), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As 2 O 3 -challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As 2 O 3 -induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As 2 O 3 -induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As 2 O 3 in AML cells. • Sensitization of THP-1 cells to As 2 O 3 toxicity by ethionamide is NRF2-dependent.

  7. The Crosstalk between Nrf2 and TGF-β1 in the Epithelial-Mesenchymal Transition of Pancreatic Duct Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Sarah Arfmann-Knübel

    Full Text Available Nrf2 and TGF-β1 both affect tumorigenesis in a dual fashion, either by preventing carcinogen induced carcinogenesis and suppressing tumor growth, respectively, or by conferring cytoprotection and invasiveness to tumor cells during malignant transformation. Given the involvement of Nrf2 and TGF-β1 in the adaptation of epithelial cells to persistent inflammatory stress, e.g. of the pancreatic duct epithelium during chronic pancreatitis, a crosstalk between Nrf2 and TGF-β1 can be envisaged. By using premalignant human pancreatic duct cells (HPDE and the pancreatic ductal adenocarcinoma cell line Colo357, we could show that Nrf2 and TGF-β1 independently but additively conferred an invasive phenotype to HPDE cells, whereas acting synergistically in Colo357 cells. This was accompanied by differential regulation of EMT markers like vimentin, Slug, L1CAM and E-cadherin. Nrf2 activation suppressed E-cadherin expression through an as yet unidentified ARE related site in the E-cadherin promoter, attenuated TGF-β1 induced Smad2/3-activity and enhanced JNK-signaling. In Colo357 cells, TGF-β1 itself was capable of inducing Nrf2 whereas in HPDE cells TGF-β1 per-se did not affect Nrf2 activity, but enhanced Nrf2 induction by tBHQ. In Colo357, but not in HPDE cells, the effects of TGF-β1 on invasion were sensitive to Nrf2 knock-down. In both cell lines, E-cadherin re-expression inhibited the proinvasive effect of Nrf2. Thus, the increased invasion of both cell lines relates to the Nrf2-dependent downregulation of E-cadherin expression. In line, immunohistochemistry analysis of human pancreatic intraepithelial neoplasias in pancreatic tissues from chronic pancreatitis patients revealed strong Nrf2 activity already in premalignant epithelial duct cells, accompanied by partial loss of E-cadherin expression. Our findings indicate that Nrf2 and TGF-β1 both contribute to malignant transformation through distinct EMT related mechanisms accounting for an

  8. 5-HMF attenuates striatum oxidative damage via Nrf2/ARE signaling pathway following transient global cerebral ischemia.

    Science.gov (United States)

    Ya, Bai-Liu; Li, Hong-Fang; Wang, Hai-Ying; Wu, Fei; Xin, Qing; Cheng, Hong-Ju; Li, Wen-Juan; Lin, Na; Ba, Zai-Hua; Zhang, Ru-Juan; Liu, Qian; Li, Ya-Nan; Bai, Bo; Ge, Feng

    2017-01-01

    Recent studies have shown 5-hydroxymethyl-2-furfural (5-HMF) has favorable biological effects, and its neuroprotection in a variety of neurological diseases has been noted. Our previous study showed that treatment of 5-HMF led to protection against permanent global cerebral ischemia. However, the underlying mechanisms in cerebral ischemic injury are not fully understood. This study was conducted to investigate the neuroprotective effect of 5-HMF and elucidate the nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathway mechanism in the striatum after transient global cerebral ischemia. C57BL/6 mice were subjected to bilateral common carotid artery occlusion for 20 min and sacrificed 24 h after reperfusion. 5-HMF (12 mg/kg) or an equal volume of vehicle was intraperitoneally injected 30 min before ischemia and 5 min after the onset of reperfusion. At 24 h after reperfusion, neurological function was evaluated by neurological disability status scale, locomotor activity test and inclined beam walking test. Histological injury of the striatum was observed by cresyl violet staining and terminal deoxynucleotidyl transferase (TdT)-mediated dNTP nick end labeling (TUNEL) staining. Oxidative stress was evaluated by the carbonyl groups introduced into proteins, and malondialdehyde (MDA) levels. An enzyme-linked immunosorbent assay (ELISA)-based measurement was used to detect Nrf2 DNA binding activity. Nrf2 and its downstream ARE pathway protein expression such as heme oxygenase-1, NAD (P)H:quinone oxidoreductase 1, glutamate-cysteine ligase catalytic subunit and glutamate-cysteine ligase modulatory subunit were detected by western blot. Our results showed that 5-HMF treatment significantly ameliorated neurological deficits, reduced brain water content, attenuated striatum neuronal damage, decreased the carbonyl groups and MDA levels, and activated Nrf2/ARE signaling pathway. Taken together, these results demonstrated that

  9. Preconditioning with Gua Lou Gui Zhi decoction enhances H2O2-induced Nrf2/HO-1 activation in PC12 cells

    Science.gov (United States)

    MAO, JINGJIE; LI, ZUANFANG; LIN, RUHUI; ZHU, XIAOQIN; LIN, JIUMAO; PENG, JUN; CHEN, LIDIAN

    2015-01-01

    Spasticity is common in various central neurological conditions, including after a stroke. Such spasticity may cause additional problems, and often becomes a primary concern for afflicted individuals. A number of studies have identified nuclear factor (erythroid-derived 2)-like 2 (Nrf2) as a key regulator in the adaptive survival response to oxidative stress. Elevated expression of Nrf2, combined with heme oxygenase 1 (HO-1) resistance, in the central nervous system is known to elicit key internal and external oxidation protection. Gua Lou Gui Zhi decoction (GLGZD) is a popular traditional Chinese formula with a long history of clinical use in China for the treatment of muscular spasticity following a stroke, epilepsy or a spinal cord injury. However, the mechanism underlying the efficacy of the medicine remains unclear. In the present study, the antioxidative effects of GLGZD were evaluated and the underlying molecular mechanisms were investigated, using hydrogen peroxide (H2O2)-induced rat pheochromocytoma cells (PC12 cells) as an in vitro oxidative stress model of neural cells. Upon application of different concentrations of GLGZD, a 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay and ATP measurement were conducted to assess the impact on PC12 cell proliferation. In addition, inverted microscopy observations, and the MTT and ATP assessments, revealed that GLGZD attenuated H2O2-induced oxidative damage and signaling repression in PC12 cells. Furthermore, the mRNA and protein expression levels of Nrf2 and HO-1, which are associated with oxidative stress, were analyzed using reverse transcription quantitative polymerase chain reaction (PCR) and confocal microscopy. Confocal microscopy observations, as well as the quantitative PCR assay, revealed that GLGZD exerted a neuroprotective function against H2O2-induced oxidative damage in PC12 cells. Therefore, the results demonstrated that GLGZD protected PC12 cells injured by H2O2, which may be

  10. Fluvastatin inhibits AGE-induced cell proliferation and migration via an ERK5-dependent Nrf2 pathway in vascular smooth muscle cells.

    Directory of Open Access Journals (Sweden)

    Ae-Rang Hwang

    Full Text Available Advanced glycation endproduct (AGE-induced vascular smooth muscle cell (VSMC proliferation and reactive oxygen species (ROS production are emerging as important mechanisms of diabetic vasculopathy, but little is known about the molecular mechanism responsible for the antioxidative effects of statins on AGEs. It has been reported that statins exert pleiotropic effects on the cardiovascular system due to decreases in AGE-induced cell proliferation, migration, and vascular inflammation. Thus, in the present study, the authors investigated the molecular mechanism by which statins decrease AGE-induced cell proliferation and VSMC migration. In cultured VSMCs, statins upregulated Nrf2-related antioxidant gene, NQO1 and HO-1, via an ERK5-dependent Nrf2 pathway. Inhibition of ERK5 by siRNA or BIX02189 (a specific ERK5 inhibitor reduced the statin-induced upregulations of Nrf2, NQO1, and HO-1. Furthermore, fluvastatin was found to significantly increase ARE promoter activity through ERK5 signaling, and to inhibit AGE-induced VSMC proliferation and migration as determined by MTT assay, cell counting, FACS analysis, a wound scratch assay, and a migration chamber assay. In addition, AGE-induced proliferation was diminished in the presence of Ad-CA-MEK5α encoding a constitutively active mutant form of MEK5α (an upstream kinase of ERK5, whereas depletion of Nrf2 restored statin-mediated reduction of AGE-induced cell proliferation. Moreover, fluvastatin suppressed the protein expressions of cyclin D1 and Cdk4, but induced p27, and blocked VSMC proliferation by regulating cell cycle. These results suggest statin-induced activation of an ERK5-dependent Nrf2 pathway reduces VSMC proliferation and migration induced by AGEs, and that the ERK5-Nrf2 signal module be viewed as a potential therapeutic target of vasculopathy in patients with diabetes and complications of the disease.

  11. Characterization of Nrf2 activation and heme oxygenase-1 expression in NIH3T3 cells exposed to aqueous extracts of cigarette smoke.

    Science.gov (United States)

    Knörr-Wittmann, Constanze; Hengstermann, Arnd; Gebel, Stephan; Alam, Jawed; Müller, Thomas

    2005-12-01

    Cigarette smoke (CS) is a complex chemical mixture estimated to be composed of up to 5000 different chemicals, many of which are prooxidant. Here we show that, at least in vitro, the cellular response designed to combat oxidative stress resulting from CS exposure is primarily controlled by the transcription factor Nrf2, a principal inducer of antioxidant and phase II-related genes. The prominent role of Nrf2 in the cellular response to CS is substantiated by the following observations: In NIH3T3 cells exposed to aqueous extracts of CS (i) Nrf2 is strongly stabilized and becomes detectable in nuclear extracts. (ii) Nuclear localization of Nrf2 coincides with increased DNA binding of a putative Nrf2/MafK heterodimer to its cognate cis-regulatory site, i.e., the antioxidant-responsive element (ARE). (iii) Studies on the regulatory elements of the oxidative stress-inducible gene heme oxygenase-1 (hmox1) using various hmox1 promoter/luciferase reporter constructs revealed that the strong CS-dependent expression of this gene is primarily governed by the distal enhancers 1 ("E1") and 2 ("E2"), which both contain three canonical ARE-like stress-responsive elements (StREs). Notably, depletion of Nrf2 levels caused by RNA interference significantly compromised CS-induced hmox1 promoter activation, based on the distinct Nrf2 sensitivity exhibited by E1 and E2. Finally, (iv) siRNA-dependent knock-down of Nrf2 completely abrogated CS-induced expression of phase II-related genes. Taken together, these results confirm the outstanding role of Nrf2 both in sensing (oxidant) stress and in orchestrating an efficient transcriptional response aimed at resolving the stressing conditions.

  12. Time in Redox Adaptation Processes: From Evolution to Hormesis

    Directory of Open Access Journals (Sweden)

    Mireille M. J. P. E. Sthijns

    2016-09-01

    Full Text Available Life on Earth has to adapt to the ever changing environment. For example, due to introduction of oxygen in the atmosphere, an antioxidant network evolved to cope with the exposure to oxygen. The adaptive mechanisms of the antioxidant network, specifically the glutathione (GSH system, are reviewed with a special focus on the time. The quickest adaptive response to oxidative stress is direct enzyme modification, increasing the GSH levels or activating the GSH-dependent protective enzymes. After several hours, a hormetic response is seen at the transcriptional level by up-regulating Nrf2-mediated expression of enzymes involved in GSH synthesis. In the long run, adaptations occur at the epigenetic and genomic level; for example, the ability to synthesize GSH by phototrophic bacteria. Apparently, in an adaptive hormetic response not only the dose or the compound, but also time, should be considered. This is essential for targeted interventions aimed to prevent diseases by successfully coping with changes in the environment e.g., oxidative stress.

  13. Modulation of Nrf2 by Olive Oil and Wine Polyphenols and Neuroprotection

    Directory of Open Access Journals (Sweden)

    Miriam Martínez-Huélamo

    2017-09-01

    Full Text Available Strong adherence to a Mediterranean diet is associated with improved cognitive function and a lower prevalence of mild cognitive impairment. Olive oil and red wine are rich sources of polyphenols which are responsible in part for the beneficial effects on cognitive functioning. Polyphenols induce endogenous antioxidant defense mechanisms by modulating transcription factors such as the nuclear factor (erythroid-derived 2-like 2 (Nrf2. This review discusses the scientific data supporting the modulating effect of olive oil and red wine polyphenols on Nrf2 expression, and the potential health benefits associated with cognitive functioning.

  14. Ebselen attenuates cisplatin-induced ROS generation through Nrf2 activation in auditory cells.

    Science.gov (United States)

    Kim, Se-Jin; Park, Channy; Han, A Lum; Youn, Myung-Ja; Lee, Jeong-Han; Kim, Yunha; Kim, Eun-Sook; Kim, Hyung-Jin; Kim, Jin-Kyung; Lee, Ho-Kyun; Chung, Sang-Young; So, Hongseob; Park, Raekil

    2009-05-01

    Ebselen, an organoselenium compound that acts as a glutathione peroxidase mimetic, has been demonstrated to possess antioxidant and anti-inflammatory activities. However, the molecular mechanism underlying this effect is not fully understood in auditory cells. The purpose of the present study is to investigate the protective effect of ebselen against cisplatin-induced toxicity in HEI-OC1 auditory cells, organotypic cultures of cochlear explants from two-day postnatal rats (P(2)) and adult Balb/C mice. Pretreatment with ebselen ameliorated apoptotic death induced by cisplatin in HEI-OC1 cells and organotypic cultures of Corti's organ. Ebselen pretreatment also significantly suppressed cisplatin-induced increases in intracellular reactive oxygen species (ROS), intracellular reactive nitrogen species (RNS) and lipid peroxidation levels. Ebselen dose-dependently increased the expression level of an antioxidant response element (ARE)-luciferase reporter in HEI-OC1 cells through the translocation of Nrf2 into the nucleus. Furthermore, we found that pretreatment with ebselen significantly restored Nrf2 function, whereas it ameliorated the cytotoxicity of cisplatin in cells transfectants with either a pcDNA3.1 (control) or a DN-Nrf2 (dominant-negative) plasmid. We also observed that Nrf2 activation by ebselen increased the expression of phase II antioxidant genes, including heme oxygenase (HO-1), NAD(P)H:quinine oxidoreductase, and gamma-glutamylcysteine synthetase (gamma-GCS). Treatment with ebselen resulted in an increased expression of HO-1 and intranuclear Nrf2 in hair cells of organotypic cultured cochlea. After intraperitoneal injection with cisplatin, auditory brainstem responses (ABRs) threshold was measured on 8th day in Balb/C mice. ABR threshold shift was marked occurred in mice injected with cisplatin (16 mg/kg, n=5; Click and 8-kHz stimuli, pebselen was not significantly changed. These results suggest that ebselen activates the Nrf2-ARE signaling pathway

  15. The PTEN/NRF2 Axis Promotes Human Carcinogenesis

    DEFF Research Database (Denmark)

    Rojo, Ana I; Rada, Patricia; Mendiola, Marta

    2014-01-01

    and tumorigenic advantage. Tissue microarrays from endometrioid carcinomas showed that 80% of PTEN-negative tumors expressed high levels of NRF2 or its target heme oxygenase-1 (HO-1). INNOVATION: These results uncover a new mechanism of oncogenic activation of NRF2 by loss of its negative regulation by PTEN/GSK-3....../β-TrCP that may be relevant to a large number of tumors, including endometrioid carcinomas. CONCLUSION: Increased activity of NRF2 due to loss of PTEN is instrumental in human carcinogenesis and represents a novel therapeutic target. Antioxid. Redox Signal. 21, 2498-2514....

  16. In Vitro Cytotoxicity and Adaptive Stress Responses to Selected Haloacetic Acid and Halobenzoquinone Water Disinfection Byproducts.

    Science.gov (United States)

    Procházka, Erik; Escher, Beate I; Plewa, Michael J; Leusch, Frederic D L

    2015-10-19

    The process of disinfecting drinking water inadvertently leads to the formation of numerous disinfection byproducts (DBPs). Some of these are mutagenic, genotoxic, teratogenic, and cytotoxic, as well as potentially carcinogenic both in vivo and in vitro. We investigated the in vitro biological activity of five DBPs: three monohaloacetic acids (monoHAAs) [chloroacetic acid (CAA), bromoacetic acid (BAA), and iodoacetic acid (IAA)] and two novel halobenzoquinones (HBQs) [2,6-dichloro-p-benzoquinone (DCBQ) and 2,6-dibromo-p-benzoquinone]. We focused particularly on cytotoxicity and induction of two adaptive stress response pathways: the oxidative stress responsive Nrf2/ARE and DNA-damage responsive p53 pathways. All five DBPs were cytotoxic to the Caco-2 cell line after a 4 h exposure, and all DBPs induced both of the adaptive stress response pathways, Nrf2/ARE and p53, in the micromolar range, as measured by two β-lactamase-based reporter gene assays. The decreasing order of potency for all three endpoints for the five DBPs was IAA ∼ BAA > DCBQ ∼ DBBQ > CAA. Induction of oxidative stress was previously proposed to be the molecular initiating event (MIE) for both classes of DBPs. However, comparing the levels of activation of the two pathways uncovered that the Nrf2/ARE pathway was the more sensitive endpoint for HAAs, whereas the p53 pathway was more sensitive in the case of HBQs. Therefore, the DNA damage-responsive p53 pathway may be an important piece of information to fill in a gap in the adverse outcome pathway framework for the assessment of HBQs. Finally, we cautiously compared the potential risk of the two novel HBQs using a benchmarking approach to that of the well-studied CAA, which suggested that their relative risk may be lower than that of BAA and IAA.

  17. Targeting of the Glutathione, Thioredoxin, and Nrf2 Antioxidant Systems in Head and Neck Cancer.

    Science.gov (United States)

    Roh, Jong-Lyel; Jang, Hyejin; Kim, Eun Hye; Shin, Daiha

    2017-07-10

    The glutathione (GSH), thioredoxin (Trx), and Nrf2 systems represent a major defense against reactive oxygen species (ROS), the cellular imbalance of which in cancer promotes growth and therapeutic resistance. This study investigated whether targeting the GSH, Trx, and Nrf2 antioxidant systems effectively eliminated head and neck cancer (HNC). At high concentrations, auranofin, but not buthionine sulfoximine (BSO) alone, decreased the viability of HNC, whereas even at low concentrations, auranofin plus BSO synergized to kill HNC cells. Dual silencing of the genes for GCLM and TrxR1 induced GSH depletion, Trx activity inhibition, and ROS accumulation, synergistically killing HNC cells. Inhibition of the GSH and Trx systems resulted in activation of the Nrf2-antioxidant response element (ARE) pathway, which may result in suboptimal GSH and Trx inhibition where HNC is resistant. Genetic inhibition of Nrf2 and/or HO-1 or trigonelline enhanced growth suppression, ROS accumulation, and cell death from GSH and Trx inhibition. The in vivo effects of GSH, Trx, and Nrf2 system inhibition were confirmed in a mouse HNC xenograft model by achieving growth inhibition >60% compared with those of control. Innovations: This study is the first to show that triple inhibition of GSH, Trx, and Nrf2 pathways could be an effective method to overcome the resistance of HNC. Inhibition of the Nrf2-ARE pathway in addition to dual inhibition of the GSH and Trx antioxidant systems can effectively eliminate resistant HNC. Antioxid. Redox Signal. 27, 106-114.

  18. NRF2 Oxidative Stress Induced by Heavy Metals is Cell Type Dependent

    Science.gov (United States)

    Exposure to metallic environmental toxicants has been demonstrated to induce a variety of oxidative stress responses in mammalian cells. The transcription factor Nrf2 is activated in response to oxidative stress and coordinates the expression of antioxidant gene products. In this...

  19. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.

    2012-01-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  20. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D., E-mail: cklaasse@kumc.edu

    2012-11-01

    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  1. Curcumin Derivative Epigenetically Reactivates Nrf2 Antioxidative Stress Signaling in Mouse Prostate Cancer TRAMP C1 Cells.

    Science.gov (United States)

    Li, Wenji; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Wu, Renyi; Gao, Linbo; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

    2018-02-19

    The carcinogenesis of prostate cancer (PCa) in TRAMP model is highly correlated with hypermethylation in the promoter region of Nrf2 and the accompanying reduced transcription of Nrf2 and its regulated detoxifying genes. We aimed to investigate the effects of (3E,5E)-3,5-bis-(3,4,5-trimethoxybenzylidene)-tetrahydro-thiopyran-4-one (F10) and (3E,5E)-3,5-bis-(3,4,5-trimethoxy-benzylidene)-tetrahydropyran-4-one (E10), two synthetic curcumin derivatives, on restoring Nrf2 activity in TRAMP C1 cells. HepG2-C8 cells transfected with an antioxidant-response element (ARE)-luciferase vector were treated with F10, E10, curcumin, and sulforaphane (SFN) to compare their effects on Nrf2-ARE pathways. We performed real-time quantitative PCR and Western blotting to investigate the effects of F10 and E10 on Nrf2, correlated phase II detoxification genes. We also measured expression and activity of DNMTand HDAC enzymes. Enrichment of H3K27me3 on the promoter region of Nrf2 was explored with a chromatin immunoprecipitation (ChIP) assay. Methylation of the CpG region in Nrf2 promoter was doubly examined by bisulfite genomic sequencing (BGS) and methylation DNA immunoprecipitation (MeDIP). Compared with curcumin and SFN, F10 is more potent in activating Nrf2-ARE pathways. Both F10 and E10 enhanced level of Nrf2 and the correlated phase II detoxifying genes. BGS and MeDIP assays indicated that F10 but not E10 hypomethylated the Nrf2 promoter. F10 also downregulated the protein level of DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC4, and HDAC7 and the activity of DNMTs and HDACs. F10 but not E10 effectively reduced the accumulation of H3k27me3 on the promoter of Nrf2. F10 and E10 can activate the Nrf2-ARE pathway and increase the level of Nrf2 and correlated phase II detoxification genes. The reactivation effect on Nrf2 by F10 in TRAMP C1 may come from demethylation, decrease of HDACs, and inhibition of H3k27me3 accumulation.

  2. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Hui [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Wang, Huihui [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Xue, Peng [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Hou, Yongyong [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Dong, Jian [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Biology and Medicine, Wuhan University of Science and Technology, Wuhan (China); Zhou, Tong [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Peng, Shuangqing [Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Li, Jin; Carmichael, Paul L. [Unilever, Safety & Environmental Assurance Centre, Colworth Science Park, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E. [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Pi, Jingbo, E-mail: jpi@mail.cmu.edu.cn [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States)

    2016-02-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As{sub 2}O{sub 3}), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As{sub 2}O{sub 3}-challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As{sub 2}O{sub 3}-induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As{sub 2}O{sub 3}-induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As{sub 2}O{sub 3} in AML cells. • Sensitization of THP-1 cells to As{sub 2}O{sub 3} toxicity by ethionamide is NRF2-dependent.

  3. Chaetominine reduces MRP1-mediated drug resistance via inhibiting PI3K/Akt/Nrf2 signaling pathway in K562/Adr human leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Jingyun; Wei, Xing [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China); Lu, Yanhua, E-mail: luyanhua@ecust.edu.cn [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China)

    2016-05-13

    Drug resistance limits leukemia treatment and chaetominine, a cytotoxic alkaloid that promotes apoptosis in a K562 human leukemia cell line via the mitochondrial pathway was studied with respect to chemoresistance in a K562/Adr human resistant leukemia cell line. Cytotoxicity assays indicated that K562/Adr resistance to adriamycin (ADR) did not occur in the presence of chaetominine and that chaetominine increased chemosensitivity of K562/Adr to ADR. Data show that chaetominine enhanced ADR-induced apoptosis and intracellular ADR accumulation in K562/Adr cells. Accordingly, chaetominine induced apoptosis by upregulating ROS, pro-apoptotic Bax and downregulating anti-apoptotic Bcl-2. RT-PCR and western-blot confirmed that chaetominine suppressed highly expressed MRP1 at mRNA and protein levels. But little obvious alternation of another drug transporter MDR1 mRNA was observed. Furthermore, inhibition of MRP1 by chaetominine relied on inhibiting Akt phosphorylation and nuclear Nrf2. In summary, chaetominine strongly reverses drug resistance by interfering with the PI3K/Akt/Nrf2 signaling, resulting in reduction of MRP1-mediated drug efflux and induction of Bax/Bcl-2-dependent apoptosis in an ADR-resistant K562/Adr leukemia cell line. - Highlights: • Chaetominine enhanced chemosensitivity of ADR against K562/Adr cells. • Chaetominine increased intracellular ADR levels via inhibiting MRP1. • Chaetominine induced apoptosis of K562/Adr cells through upregulation of ROS and modulation of Bax/Bcl-2. • Inhibition of MRP1 and Nrf2 by chaetominine treatment was correlative with blockade of PI3K/Akt signaling.

  4. Activation of endothelial nitric oxide synthase by dietary isoflavones: role of NO in Nrf2-mediated antioxidant gene expression.

    Science.gov (United States)

    Mann, Giovanni E; Rowlands, David J; Li, Francois Y L; de Winter, Patricia; Siow, Richard C M

    2007-07-15

    The endothelium plays a key role in the maintenance of vascular homeostasis, and increased oxidative stress in vascular disease leads to reduced nitric oxide bioavailability and impaired endothelium-dependent relaxation of resistance vessels. Although epidemiological evidence suggests that diets containing high amounts of natural antioxidants afford protection against coronary heart disease (CHD), antioxidant supplementation trials have largely reported only marginal health benefits. There is controversy concerning the cardiovascular benefits of prolonged estrogen/progestin or soy isoflavone therapy for postmenopausal women and patients with an increased risk of CHD. Research on the potential health benefits of soy isoflavones and other polyphenols contained in red wine, green and black tea and dark chocolate developed rapidly during the 1990's, and recent clinical trials and studies in animal models and cultured endothelial cells provide important and novel insights into the mechanisms by which dietary polyphenols afford protection against oxidative stress. In this review, we highlight that NO and reactive oxygen radicals may mediate dietary polyphenol induced activation of Nrf2, which in turn triggers antioxidant response element (ARE) driven transcription of phase II detoxifying and antioxidant defense enzymes in vascular cells.

  5. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  6. Epigenetics Reactivation of Nrf2 in Prostate TRAMP C1 Cells by Curcumin Analogue FN1.

    Science.gov (United States)

    Li, Wenji; Pung, Doug; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Yang, Anne Yuqing; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

    2016-04-18

    It has previously been shown that curcumin can effectively inhibit prostate cancer proliferation and progression in TRAMP mice, potentially acting through the hypomethylation of the Nrf2 gene promoter and hence activation of the Nrf2 pathway to enhance cell antioxidative defense. FN1 is a synthetic curcumin analogue that shows stronger anticancer activity than curcumin in other reports. We aimed to explore the epigenetic modification of FN1 that restores Nrf2 expression in TRAMP-C1 cells. Stably transfected HepG2-C8 cells were used to investigate the effect of FN1 on the Nrf2- antioxidant response element (ARE) pathway. Real-time quantitative PCR and Western blotting were applied to study the influence of FN1 on endogenous Nrf2 and its downstream genes. Bisulfite genomic sequencing (BGS) and methylated DNA immunoprecipitation (MeDIP) were then performed to examine the methylation profile of the Nrf2 promoter. An anchorage-independent colony-formation analysis was conducted to examine the tumor inhibition activity of FN1. Epigenetic modification enzymes, including DNMTs and HDACs, were investigated by Western blotting. The luciferase reporter assay indicated that FN1 was more potent than curcumin in activating the Nrf2-ARE pathway. FN1 increased the expression of Nrf2 and its downstream detoxifying enzymes. FN1 significantly inhibited the colony formation of TRAMP-C1 cells. BGS and MeDIP assays revealed that FN1 treatment (250 nM for 3 days) reduced the percentage of CpG methylation of the Nrf2 promoter. FN1 also downregulated epigenetic modification enzymes. In conclusion, our results suggest that FN1 is a novel anticancer agent for prostate cancer. In the TRAMP-C1 cell line, FN1 can increase the level of Nrf2 and downstream genes via activating the Nrf2-ARE pathway and inhibit the colony formation potentially through the decreased expression of keap1 coupled with CpG demethylation of the Nrf2 promoter. This CpG demethylation effect may come from decreased

  7. Toll‐Like Receptor‐2 Mediates Adaptive Cardiac Hypertrophy in Response to Pressure Overload Through Interleukin‐1β Upregulation via Nuclear Factor κB Activation

    Science.gov (United States)

    Higashikuni, Yasutomi; Tanaka, Kimie; Kato, Megumi; Nureki, Osamu; Hirata, Yasunobu; Nagai, Ryozo; Komuro, Issei; Sata, Masataka

    2013-01-01

    Background Inflammation is induced in the heart during the development of cardiac hypertrophy. The initiating mechanisms and the role of inflammation in cardiac hypertrophy, however, remain unclear. Toll‐like receptor‐2 (TLR2) recognizes endogenous molecules that induce noninfectious inflammation. Here, we examined the role of TLR2mediated inflammation in cardiac hypertrophy. Methods and Results At 2 weeks after transverse aortic constriction, Tlr2−/− mice showed reduced cardiac hypertrophy and fibrosis with greater left ventricular dilatation and impaired systolic function compared with wild‐type mice, which indicated impaired cardiac adaptation in Tlr2−/− mice. Bone marrow transplantation experiment revealed that TLR2 expressed in the heart, but not in bone marrow–derived cells, is important for cardiac adaptive response to pressure overload. In vitro experiments demonstrated that TLR2 signaling can induce cardiomyocyte hypertrophy and fibroblast and vascular endothelial cell proliferation through nuclear factor–κB activation and interleukin‐1β upregulation. Systemic administration of a nuclear factor–κB inhibitor or anti–interleukin‐1β antibodies to wild‐type mice resulted in impaired adaptive cardiac hypertrophy after transverse aortic constriction. We also found that heat shock protein 70, which was increased in murine plasma after transverse aortic constriction, can activate TLR2 signaling in vitro and in vivo. Systemic administration of anti–heat shock protein 70 antibodies to wild‐type mice impaired adaptive cardiac hypertrophy after transverse aortic constriction. Conclusions Our results demonstrate that TLR2mediated inflammation induced by extracellularly released heat shock protein 70 is essential for adaptive cardiac hypertrophy in response to pressure overload. Thus, modulation of TLR2 signaling in the heart may provide a novel strategy for treating heart failure due to inadequate adaptation to hemodynamic

  8. Salvianolic acid B protects against paraquat-induced pulmonary injury by mediating Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Bin, E-mail: iamicehe@163.com [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Cao, Bo, E-mail: caobo19814@126.com [Logistics University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Tianjin Key Laboratory of Cardiovascular Remodeling and Target Organ Injury, Tianjin, 300162 (China); Zhang, Di, E-mail: zhangdibad@163.com [Department of Otorhinolaryngology Head and Neck Surgery, Institute of Otorhinolaryngology, Tianjin First Center Hospital, Tianjin 300192 (China); Xiao, Na [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Chen, Hong [Logistics University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Li, Guo-qiang; Peng, Shou-chun [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China); Wei, Lu-qing, E-mail: luqing-wei@163.com [Department of Respiratory and Critical Care Medicine, Affiliated Hospital of Logistic University of Chinese People' s Armed Police Force, Tianjin 300162 (China)

    2016-10-15

    The present study was aimed at exploring the protective effects of Salvianolic acid B (SalB) against paraquat (PQ)-induced lung injury in mice. Lung fibrotic injuries were induced in mice by a single intragastrical administration of 300 mg/kg PQ, then the mice were administrated with 200 mg/kg, 400 mg/kg SalB, 100 mg/kg vitamin C (Vit C) and dexamethasone (DXM) for 14 days. PQ-triggered structure distortion, collagen overproduction, excessive inflammatory infiltration, pro-inflammatory cytokine release, and oxidative stress damages in lung tissues and mortality of mice were attenuated by SalB in a dose-dependent manner. Furthermore, SalB was noted to enhance the expression and nuclear translocation of nuclear factor erythroid 2–related factor 2 (Nrf2) and reduce expression of the reactive oxygen species-generating enzyme Nox4 [NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidase-4]. SalB also inhibited the increasing expression of transforming growth factor (TGF)-β1 and the phosphorylation of its downstream target Smad3 which were enhanced by PQ. These results suggest that SalB may exert protective effects against PQ-induced lung injury and pulmonary fibrosis. Its mechanisms involve the mediation of Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling. - Highlights: • Salvianolic acid B (SalB) reduced Paraquat-induced mortality and pulmonary injury in mice. • SalB has anti-oxidation, anti-inflammatory and anti-fibrogenic effects simultaneously. • Its mechanisms were targeting Nrf2-Nox4 redox balance and TGF-β1/Smad3 signaling.

  9. Salvianolic acid B protects against paraquat-induced pulmonary injury by mediating Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling

    International Nuclear Information System (INIS)

    Liu, Bin; Cao, Bo; Zhang, Di; Xiao, Na; Chen, Hong; Li, Guo-qiang; Peng, Shou-chun; Wei, Lu-qing

    2016-01-01

    The present study was aimed at exploring the protective effects of Salvianolic acid B (SalB) against paraquat (PQ)-induced lung injury in mice. Lung fibrotic injuries were induced in mice by a single intragastrical administration of 300 mg/kg PQ, then the mice were administrated with 200 mg/kg, 400 mg/kg SalB, 100 mg/kg vitamin C (Vit C) and dexamethasone (DXM) for 14 days. PQ-triggered structure distortion, collagen overproduction, excessive inflammatory infiltration, pro-inflammatory cytokine release, and oxidative stress damages in lung tissues and mortality of mice were attenuated by SalB in a dose-dependent manner. Furthermore, SalB was noted to enhance the expression and nuclear translocation of nuclear factor erythroid 2–related factor 2 (Nrf2) and reduce expression of the reactive oxygen species-generating enzyme Nox4 [NADPH (reduced form of nicotinamide adenine dinucleotide phosphate) oxidase-4]. SalB also inhibited the increasing expression of transforming growth factor (TGF)-β1 and the phosphorylation of its downstream target Smad3 which were enhanced by PQ. These results suggest that SalB may exert protective effects against PQ-induced lung injury and pulmonary fibrosis. Its mechanisms involve the mediation of Nrf2/Nox4 redox balance and TGF-β1/Smad3 signaling. - Highlights: • Salvianolic acid B (SalB) reduced Paraquat-induced mortality and pulmonary injury in mice. • SalB has anti-oxidation, anti-inflammatory and anti-fibrogenic effects simultaneously. • Its mechanisms were targeting Nrf2-Nox4 redox balance and TGF-β1/Smad3 signaling.

  10. Dietary Lycium barbarum Polysaccharide Induces Nrf2/ARE Pathway and Ameliorates Insulin Resistance Induced by High-Fat via Activation of PI3K/AKT Signaling

    Directory of Open Access Journals (Sweden)

    Yi Yang

    2014-01-01

    Full Text Available Lycium barbarum polysaccharide (LBP, an antioxidant from wolfberry, displays the antioxidative and anti-inflammatory effects on experimental models of insulin resistance in vivo. However, the effective mechanism of LBP on high-fat diet-induced insulin resistance is still unknown. The objective of the study was to investigate the mechanism involved in LBP-mediated phosphatidylinositol 3-kinase (PI3K/AKT/Nrf2 axis against high-fat-induced insulin resistance. HepG2 cells were incubated with LBP for 12 hrs in the presence of palmitate. C57BL/6J mice were fed a high-fat diet supplemented with LBP for 24 weeks. We analyzed the expression of nuclear factor-E2-related factor 2 (Nrf2, Jun N-terminal kinases (JNK, and glycogen synthase kinase 3β (GSK3β involved in insulin signaling pathway in vivo and in vitro. First, LBP significantly induced phosphorylation of Nrf2 through PI3K/AKT signaling. Second, LBP obviously increased detoxification and antioxidant enzymes expression and reduced reactive oxygen species (ROS levels via PI3K/AKT/Nrf2 axis. Third, LBP also regulated phosphorylation levels of GSK3β and JNK through PI3K/AKT signaling. Finally, LBP significantly reversed glycolytic and gluconeogenic genes expression via the activation of Nrf2-mediated cytoprotective effects. In summary, LBP is novel antioxidant against insulin resistance induced by high-fat diet via activation of PI3K/AKT/Nrf2 pathway.

  11. The Dual Role of Nrf2 in Nonalcoholic Fatty Liver Disease: Regulation of Antioxidant Defenses and Hepatic Lipid Metabolism

    Directory of Open Access Journals (Sweden)

    Sílvia S. Chambel

    2015-01-01

    Full Text Available Nonalcoholic fatty liver disease (NAFLD is a progressive liver disease with ever-growing incidence in the industrialized world. It starts with the simple accumulation of lipids in the hepatocyte and can progress to the more severe nonalcoholic steatohepatitis (NASH, which is associated with inflammation, fibrosis, and cirrhosis. There is increasing awareness that reactive oxygen species and electrophiles are implicated in the pathogenesis of NASH. Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2 is a positive regulator of the expression of a battery of genes involved in the protection against oxidative/electrophilic stress. In rodents, Nrf2 is also known to participate in hepatic fatty acid metabolism, as a negative regulator of genes that promote hepatosteatosis. We review relevant evidence in the literature that these two mechanisms may contribute to the protective role of Nrf2 in the development of hepatic steatosis and in the progression to steatohepatitis, particularly in young animals. We propose that age may be a key to explain contradictory findings in the literature. In summary, Nrf2 mediates the crosstalk between lipid metabolism and antioxidant defense mechanisms in experimental models of NAFLD, and the nutritional or pharmacological induction of Nrf2 represents a promising potential new strategy for its prevention and treatment.

  12. NRF TRIGA packaging

    International Nuclear Information System (INIS)

    Clements, M.D.

    1995-11-01

    Training Reactor Isotopes, General Atomics (TRIGA reg-sign) Reactors are in use at four US Department of Energy (DOE) complex facilities and at least 23 university, commercial, or government facilities. The development of the Neutron Radiography Facility (NRF) TRIGA packaging system began in October 1993. The Hanford Site NRF is being shut down and requires an operationally user-friendly transportation and storage packaging system for removal of the TRIGA fuel elements. The NRF TRIGA packaging system is designed to remotely remove the fuel from the reactor and transport the fuel to interim storage (up to 50 years) on the Hanford Site. The packaging system consists of a cask and an overpack. The overpack is used only for transport and is not necessary for storage. Based upon the cask's small size and light weight, small TRIGA reactors will find it versatile for numerous refueling and fuel storage needs. The NRF TRIGA packaging design also provides the basis for developing a certifiable and economical packaging system for other TRIGA reactor facilities. The small size of the NRF TRIGA cask also accommodates placing the cask into a larger certified packaging for offsite transport. The Westinghouse Hanford Company NRF TRIGA packaging, as described herein can serve other DOE sites for their onsite use, and the design can be adapted to serve university reactor facilities, handling a variety of fuel payloads

  13. Modulatory Mechanism of Polyphenols and Nrf2 Signaling Pathway in LPS Challenged Pregnancy Disorders

    Directory of Open Access Journals (Sweden)

    Tarique Hussain

    2017-01-01

    Full Text Available Early embryonic loss and adverse birth outcomes are the major reproductive disorders that affect both human and animals. The LPS induces inflammation by interacting with robust cellular mechanism which was considered as a plethora of numerous reproductive disorders such as fetal resorption, preterm birth, teratogenicity, intrauterine growth restriction, abortion, neural tube defects, fetal demise, and skeletal development retardation. LPS-triggered overproduction of free radicals leads to oxidative stress which mediates inflammation via stimulation of NF-κB and PPARγ transcription factors. Flavonoids, which exist in copious amounts in nature, possess a wide array of functions; their supplementation during pregnancy activates Nrf2 signaling pathway which encounters pregnancy disorders. It was further presumed that the development of strong antioxidant uterine environment during gestation can alleviate diseases which appear at adult stages. The purpose of this review is to focus on modulatory properties of flavonoids on oxidative stress-mediated pregnancy insult and abnormal outcomes and role of Nrf2 activation in pregnancy disorders. These findings would be helpful for providing new insights in ameliorating oxidative stress-induced pregnancy disorders.

  14. Noncanonical SQSTM1/p62-Nrf2 pathway activation mediates proteasome inhibitor resistance in multiple myeloma cells via redox, metabolic and translational reprogramming

    OpenAIRE

    Riz, Irene; Hawley, Teresa S.; Marsal, Jeffrey W.; Hawley, Robert G.

    2016-01-01

    Multiple Myeloma (MM) is a B-cell malignancy characterized by the accumulation of clonal plasma cells in the bone marrow, with drug resistance being a major cause of therapeutic failure. We established a carfilzomib-resistant derivative of the LP-1 MM cell line (LP-1/Cfz) and found that the transcription factor NF-E2 p45-related factor 2 (Nrf2; gene symbol NFE2L2) contributes to carfilzomib resistance. The mechanism of Nrf2 activation involved enhanced translation of Nrf2 as well as its posit...

  15. Nrf2 regulates cellular behaviors and Notch signaling in oral squamous cell carcinoma cells.

    Science.gov (United States)

    Fan, Hong; Paiboonrungruan, Chorlada; Zhang, Xinyan; Prigge, Justin R; Schmidt, Edward E; Sun, Zheng; Chen, Xiaoxin

    2017-11-04

    Oxidative stress is known to play a pivotal role in the development of oral squamous cell carcinoma (OSCC). We have demonstrated that activation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway has chemopreventive effects against oxidative stress-associated OSCC. However, Nrf2 have dual roles in cancer development; while it prevents carcinogenesis of normal cells, hyperactive Nrf2 also promotes the survival of cancer cells. This study is aimed to understand the function of Nrf2 in regulating cellular behaviors of OSCC cells, and the potential mechanisms through which Nrf2 facilitates OSCC. We established the Nrf2-overexpressing and Nrf2-knockdown OSCC cell lines, and examined the function of Nrf2 in regulating cell proliferation, migration, invasion, cell cycle and colony formation. Our data showed that Nrf2 overexpression promoted cancer phenotypes in OSCC cells, whereas Nrf2 silencing inhibited these phenotypes. In addition, Nrf2 positively regulated Notch signaling pathway in OSCC cells in vitro. Consistent with this observation, Nrf2 activation in Keap1 -/- mice resulted in not only hyperproliferation of squamous epithelial cells in mouse tongue as evidenced by increased expression of PCNA, but also activation of Notch signaling in these cells as evidenced by increased expression of NICD1 and Hes1. In conclusion, Nrf2 regulates cancer behaviors and Notch signaling in OSCC cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Resveratrol, an Nrf2 activator, ameliorates aging-related progressive renal injury.

    Science.gov (United States)

    Kim, Eun Nim; Lim, Ji Hee; Kim, Min Young; Ban, Tae Hyun; Jang, In-Ae; Yoon, Hye Eun; Park, Cheol Whee; Chang, Yoon Sik; Choi, Bum Soon

    2018-01-11

    Two important issues in the aging kidney are mitochondrial dysfunction and oxidative stress. An Nrf2 activator, resveratrol, is known to have various effects. Resveratrol may prevent inflammation and oxidative stress by activating Nrf2 and SIRT1 signaling. We examined whether resveratrol could potentially ameliorate the cellular condition, such as renal injury due to cellular oxidative stress and mitochondrial dysfunction caused by aging. Male 18-month-old C57BL/6 mice were used. Resveratrol (40 mg/kg) was administered to aged mice for 6 months. We compared histological changes, oxidative stress, and aging-related protein expression in the kidney between the resveratrol-treated group (RSV) and the control group (cont). We performed experiments using small-interfering RNAs (siRNAs) for Nrf2 and SIRT1 in cultured HK2 cells. Resveratrol improved renal function, proteinuria, histological changes and inflammation in aging mice. Also, expression of Nrf2-HO-1-NOQ-1 signaling and SIRT1-AMPK-PGC-1α signaling was increased in the RSV group. Transfection with Nrf2 and SIRT1 siRNA prevented resveratrol-induced anti-oxidative effect in HK2 cells in media treated with H 2 O 2 . Activation of the Nrf2 and SIRT1 signaling pathways ameliorated oxidative stress and mitochondrial dysfunction. Pharmacological targeting of Nrf2 signaling molecules may reduce the pathologic changes of aging in the kidney.

  17. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Angélica S. Jiménez-Osorio

    2014-11-01

    Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.

  18. Isorhamnetin protects against oxidative stress by activating Nrf2 and inducing the expression of its target genes

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ji Hye; Shin, Bo Yeon; Han, Jae Yun; Kim, Mi Gwang; Wi, Ji Eun [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Kim, Young Woo; Cho, Il Je; Kim, Sang Chan [Medical Research Center for Globalization of Herbal Formulation, College of Korean Medicine, Daegu Haany University, Gyeongsan 712-715 (Korea, Republic of); Shin, Sang Mi [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Ki, Sung Hwan, E-mail: shki@chosun.ac.kr [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of)

    2014-01-15

    Isorhamentin is a 3′-O-methylated metabolite of quercetin, and has been reported to have anti-inflammatory and anti-proliferative effects. However, the effects of isorhamnetin on Nrf2 activation and on the expressions of its downstream genes in hepatocytes have not been elucidated. Here, we investigated whether isorhamnetin has the ability to activate Nrf2 and induce phase II antioxidant enzyme expression, and to determine the protective role of isorhamnetin on oxidative injury in hepatocytes. In HepG2 cells, isorhamnetin increased the nuclear translocation of Nrf2 in a dose- and time-dependent manner, and consistently, increased antioxidant response element (ARE) reporter gene activity and the protein levels of hemeoxygenase (HO-1) and of glutamate cysteine ligase (GCL), which resulted in intracellular GSH level increases. The specific role of Nrf2 in isorhamnetin-induced Nrf2 target gene expression was verified using an ARE-deletion mutant plasmid and Nrf2-knockout MEF cells. Deletion of the ARE in the promoter region of the sestrin2 gene, which is recently identified as the Nrf2 target gene by us, abolished the ability of isorhamnetin to increase luciferase activity. In addition, Nrf2 deficiency completely blocked the ability of isorhamnetin to induce HO-1 and GCL. Furthermore, isorhamnetin pretreatment blocked t-BHP-induced ROS production and reversed GSH depletion by t-BHP and consequently, due to reduced ROS levels, decreased t-BHP-induced cell death. In addition isorhamnetin increased ERK1/2, PKCδ and AMPK phosphorylation. Finally, we showed that Nrf2 deficiency blocked the ability of isorhamnetin to protect cells from injury induced by t-BHP. Taken together, our results demonstrate that isorhamnetin is efficacious in protecting hepatocytes against oxidative stress by Nrf2 activation and in inducing the expressions of its downstream genes. - Highlights: • We investigated the effect of isorhamnetin on Nrf2 activation. • Isorhamnetin increased Nrf2

  19. Nrf2 transcription factor gene regulates basal transcription of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-19

    Oct 19, 2009 ... induction in the Nrf2(-/-) mouse brain. In contrast, there ... mouse brain by any of the chemicals used . Key words: .... The blots were then probed with the human SOD2 .... Nrf2, null and wild mice as part of my PhD work. I wish.

  20. TGF-β and Hypoxia/Reoxygenation Promote Radioresistance of A549 Lung Cancer Cells through Activation of Nrf2 and EGFR

    Directory of Open Access Journals (Sweden)

    Sae-lo-oom Lee

    2016-01-01

    Full Text Available Although many studies have examined the roles of hypoxia and transforming growth factor- (TGF- β separately in the tumor microenvironment, the effects of simultaneous treatment with hypoxia/reoxygenation and TGF-β on tumor malignancy are unclear. Here, we investigated the effects of redox signaling and oncogenes on cell proliferation and radioresistance in A549 human lung cancer cells in the presence of TGF-β under hypoxia/reoxygenation conditions. Combined treatment with TGF-β and hypoxia activated epidermal growth factor receptor (EGFR and nuclear factor (erythroid-derived 2-like 2 (Nrf2, a redox-sensitive transcription factor. Interestingly, Nrf2 knockdown suppressed the effects of combined treatment on EGFR phosphorylation. In addition, blockade of EGFR signaling also suppressed induction of Nrf2 following combined treatment with hypoxia and TGF-β, indicating that the combined treatment induced positive crosstalk between Nrf2 and EGFR. TGF-β and hypoxia/reoxygenation increased the accumulation of reactive oxygen species (ROS, while treatment with N-acetyl-L-cysteine abolished the activation of Nrf2 and EGFR. Treatment with TGF-β under hypoxic conditions increased the proliferation of A549 cells compared with that after vehicle treatment. Moreover, cells treated with the combined treatment exhibited resistance to ionizing radiation (IR, and knockdown of Nrf2 increased IR-induced cell death under these conditions. Thus, taken together, our findings suggested that TGF-β and hypoxia/reoxygenation promoted tumor progression and radioresistance of A549 cells through ROS-mediated activation of Nrf2 and EGFR.

  1. Sulforaphane protects rodent retinas against ischemia-reperfusion injury through the activation of the Nrf2/HO-1 antioxidant pathway.

    Directory of Open Access Journals (Sweden)

    Hong Pan

    Full Text Available Retinal ischemia-reperfusion (I/R injury induces oxidative stress, leukocyte infiltration, and neuronal cell death. Sulforaphane (SF, which can be obtained in cruciferous vegetables such as broccoli, exerts protective effects in response to oxidative stress in various tissues. These effects can be initiated through nuclear factor E2-related factor 2 (Nrf2-mediated induction of heme oxygenase-1 (HO-1. This investigation was designed to elucidate the neural protective mechanisms of SF in the retinal I/R rat model. Animals were intraperitoneally (i.p. injected with SF (12.5 mg/kg or vehicle (corn oil once a day for 7 consecutive days. Then, retinal I/R was made by elevating the intraocular pressure (IOP to 130 mmHg for 1 h. To determine if HO-1 was involved in the Nrf2 antioxidant pathway, rats were subjected to protoporphyrin IX zinc (II (ZnPP, 30 mg/kg, i.p. treatments at 24 h before retinal ischemia. The neuroprotective effects of SF were assessed by determining the morphology of the retina, counting the infiltrating inflammatory cells and the surviving retinal ganglion cells (RGCs and amacrine cells, and measuring apoptosis in the retinal layers. The expression of Nrf2 and HO-1 was studied by immunofluorescence analysis and western blotting. I/R induced a marked increase of ROS generation, caused pronounced inflammation, increased the apoptosis of RGCs and amacrine cells and caused the thinning of the inner retinal layer (IRL, and these effects were diminished or abolished by SF pretreatment. Meanwhile, SF pretreatment significantly elevated the nuclear accumulation of Nrf2 and the level of HO-1 expression in the I/R retinas; however, ZnPP reversed the protective effects of SF on I/R retinas. Together, we offer direct evidence that SF had protective effects on I/R retinas, which could be attributed, at least in part, to the activation of the Nrf2/HO-1 antioxidant pathway.

  2. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ

    Directory of Open Access Journals (Sweden)

    Kathrin Pallauf

    2017-01-01

    Full Text Available Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPARγ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays, we tested their free radical scavenging activities and used α-tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPARγ-dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPARγ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  3. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ.

    Science.gov (United States)

    Pallauf, Kathrin; Duckstein, Nils; Hasler, Mario; Klotz, Lars-Oliver; Rimbach, Gerald

    2017-01-01

    Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPAR γ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones) to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays), we tested their free radical scavenging activities and used α -tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPAR γ -dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPAR γ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  4. Electroacupuncture Ameliorates Acute Renal Injury in Lipopolysaccharide-Stimulated Rabbits via Induction of HO-1 through the PI3K/Akt/Nrf2 Pathways.

    Science.gov (United States)

    Yu, Jian-Bo; Shi, Jia; Zhang, Yuan; Gong, Li-Rong; Dong, Shu-An; Cao, Xin-Shun; Wu, Li-Li; Wu, Li-Na

    2015-01-01

    Electroacupuncture at select acupoints have been verified to protect against organ dysfunctions during endotoxic shock. And, heme oxygenase (HO)-1 as a phase II enzyme and antioxidant contributed to the protection of kidney in septic shock rats. The phosphatidylinositol 3-kinase (PI3K)-Akt pathway mediated the activation of NF-E2 related factor-2 (Nrf2), which was involved in HO-1 induction. To understand the efficacy of electroacupuncture stimulation in ameliorating acute kidney injury (AKI) through the PI3K/Akt/Nrf2 pathway and subsequent HO-1 upregulation, a dose of LPS 5mg/kg was administered intravenously to replicate the rabbit model of AKI induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Neiguan acupoints for five consecutive days while sham electroacupuncture at non-acupoints as control. Results displayed that electroacupuncture stimulation significantly alleviated the morphologic renal damage, attenuated renal tubular apoptosis, suppressed the elevated biochemical indicators of AKI caused by LPS, enhanced the expressions of phospho-Akt, HO-1protein, Nrf2 total and nucleoprotein, and highlighted the proportions of Nrf2 nucleoprotein as a parallel. Furthermore, partial protective effects of elecroacupuncture were counteracted by preconditioning with wortmannin (the selective PI3K inhibitor), indicating a direct involvement of PI3K/Akt pathway. Inconsistently, wortmannin pretreatment made little difference to the expressions of HO-1, Nrf2 nucleoprotein and total protein, which indicated that PI3K/Akt may be not the only pathway responsible for electroacupuncture-afforded protection against LPS-induced AKI. These findings provide new insights into the potential future clinical applications of electroacupuncture for AKI induced by endotoxic shock instead of traditional remedies.

  5. Pomegranate-mediated chemoprevention of experimental hepatocarcinogenesis involves Nrf2-regulated antioxidant mechanisms

    Science.gov (United States)

    Bishayee, Anupam; Bhatia, Deepak; Thoppil, Roslin J.; Darvesh, Altaf S.; Nevo, Eviatar; Lansky, Ephraim P.

    2011-01-01

    Hepatocellular carcinoma (HCC), one of the most prevalent and lethal cancers, has shown an alarming rise in the USA. Without effective therapy for HCC, novel chemopreventive strategies may effectively circumvent the current morbidity and mortality. Oxidative stress predisposes to hepatocarcinogenesis and is the major driving force of HCC. Pomegranate, an ancient fruit, is gaining tremendous attention due to its powerful antioxidant properties. Here, we examined mechanism-based chemopreventive potential of a pomegranate emulsion (PE) against dietary carcinogen diethylnitrosamine (DENA)-induced rat hepatocarcinogenesis that mimics human HCC. PE treatment (1 or 10 g/kg), started 4 weeks prior to the DENA challenge and continued for 18 weeks thereafter, showed striking chemopreventive activity demonstrated by reduced incidence, number, multiplicity, size and volume of hepatic nodules, precursors of HCC. Both doses of PE significantly attenuated the number and area of γ-glutamyl transpeptidase-positive hepatic foci compared with the DENA control. PE also attenuated DENA-induced hepatic lipid peroxidation and protein oxidation. Mechanistic studies revealed that PE elevated gene expression of an array of hepatic antioxidant and carcinogen detoxifying enzymes in DENA-exposed animals. PE elevated protein and messenger RNA expression of the hepatic nuclear factor E2-related factor 2 (Nrf2). Our results provide substantial evidence, for the first time, that pomegranate constituents afford chemoprevention of hepatocarcinogenesis possibly through potent antioxidant activity achieved by upregulation of several housekeeping genes under the control of Nrf2 without toxicity. The outcome of this study strongly supports the development of pomegranate-derived products in the prevention and treatment of human HCC, which remains a devastating disease. PMID:21389260

  6. Protective Effect of Tempol on Acute Kidney Injury Through PI3K/Akt/Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Gensheng Zhang

    2016-02-01

    Full Text Available Background/Aims: Tempol is a protective antioxidant against ischemic injury in many animal models. The molecular mechanisms are not well understood. Nuclear factor erythroid 2-related factor (Nrf2 is a master transcription factor during oxidative stress, which is enhanced by activation of protein kinase C (PKC pathway. Another factor, tubular epithelial apoptosis, is mediated by activation of phosphoinositide 3-kinase (PI3K/protein kinase B (PKB, Akt signaling pathway during renal ischemic injury. We tested the hypothesis that tempol activates PKC or PI3K/Akt/Nrf2 pathways to transcribe many genes that coordinate endogenous antioxidant defense. Methods: The right renal pedicle was clamped for 45 minutes and the left kidney was removed to study renal ischemia/reperfusion (I/R injury in C57BL/6 mice. The response was assessed from serum parameters, renal morphology and renal expression of PKC, phosphorylated-PKC (p-PKC, Nrf2, heme oxygenase-1 (HO-1, Akt, phosphorylated-Akt (p-Akt, pro-caspase-3 and cleaved caspase-3 in groups of sham and I/R mice given vehicle, or tempol (50 or 100 mg/kg, intraperitoneal injection. Results: The serum malondialdehyde (MDA, marker of reactive oxygen species doubled and the BUN and creatinine increased 5- to 10-fold after I/R injury. Tempol (50 or 100 mg/kg prevented the increases in MDA but only tempol (50 mg/kg lessened the increases in BUN and creatinine and moderated the acute tubular necrosis. I/R did not change expression of PKC or p-PKC but reduced renal expression of Nrf2, p-Akt, HO-1 and pro-caspase-3 and increased cleaved caspase-3. Tempol (50 mg/kg prevented these changes produced by I/R whereas tempol (100 mg/kg had lesser or inconsistent effects. Conclusion: Tempol (50 mg/kg prevents lipid peroxidation and attenuates renal damage after I/R injury. The beneficial pathway apparently is not dependent on upregulation or phosphorylation of PKC, at lower tempol doses, does implicate upregulation of Akt with

  7. Eriodictyol Protects Endothelial Cells against Oxidative Stress-Induced Cell Death through Modulating ERK/Nrf2/ARE-Dependent Heme Oxygenase-1 Expression.

    Science.gov (United States)

    Lee, Seung Eun; Yang, Hana; Son, Gun Woo; Park, Hye Rim; Park, Cheung-Seog; Jin, Young-Ho; Park, Yong Seek

    2015-06-26

    The pathophysiology of cardiovascular diseases is complex and may involve oxidative stress-related pathways. Eriodictyol is a flavonoid present in citrus fruits that demonstrates anti-inflammatory, anti-cancer, neurotrophic, and antioxidant effects in a range of pathophysiological conditions including vascular diseases. Because oxidative stress plays a key role in the pathogenesis of cardiovascular disease, the present study was designed to verify whether eriodictyol has therapeutic potential. Upregulation of heme oxygenase-1 (HO-1), a phase II detoxifying enzyme, in endothelial cells is considered to be helpful in cardiovascular disease. In this study, human umbilical vein endothelial cells (HUVECs) treated with eriodictyol showed the upregulation of HO-1 through extracellular-regulated kinase (ERK)/nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathways. Further, eriodictyol treatment provided protection against hydrogen peroxide-provoked cell death. This protective effect was eliminated by treatment with a specific inhibitor of HO-1 and RNA interference-mediated knockdown of HO-1 expression. These data demonstrate that eriodictyol induces ERK/Nrf2/ARE-mediated HO-1 upregulation in human endothelial cells, which is directly associated with its vascular protection against oxidative stress-related endothelial injury, and propose that targeting the upregulation of HO-1 is a promising approach for therapeutic intervention in cardiovascular disease.

  8. Sulforaphane induces apoptosis in T24 human urinary bladder cancer cells through a reactive oxygen species-mediated mitochondrial pathway: the involvement of endoplasmic reticulum stress and the Nrf2 signaling pathway.

    Science.gov (United States)

    Jo, Guk Heui; Kim, Gi-Young; Kim, Wun-Jae; Park, Kun Young; Choi, Yung Hyun

    2014-10-01

    Sulforaphane, a naturally occurring isothiocyanate found in cruciferous vegetables, has received a great deal of attention because of its ability to inhibit cell proliferation and induce apoptosis in cancer cells. In this study, we investigated the anticancer activity of sulforaphane in the T24 human bladder cancer line, and explored its molecular mechanism of action. Our results showed that treatment with sulforaphane inhibited cell viability and induced apoptosis in T24 cells in a concentration-dependent manner. Sulforaphane-induced apoptosis was associated with mitochondria dysfunction, cytochrome c release and Bcl-2/Bax dysregulation. Furthermore, the increased activity of caspase-9 and -3, but not caspase-8, was accompanied by the cleavage of poly ADP-ribose polymerase, indicating the involvement of the mitochondria-mediated intrinsic apoptotic pathway. Concomitant with these changes, sulforaphane triggered reactive oxygen species (ROS) generation, which, along with the blockage of sulforaphane-induced loss of mitochondrial membrane potential and apoptosis, was strongly attenuated by the ROS scavenger N-acetyl-L-cysteine. Furthermore, sulforaphane was observed to activate endoplasmic reticulum (ER) stress and the nuclear factor-E2-related factor-2 (Nrf2) signaling pathway, as demonstrated by the upregulation of ER stress‑related proteins, including glucose-regulated protein 78 and C/EBP-homologous protein, and the accumulation of phosphorylated Nrf2 proteins in the nucleus and induction of heme oxygenase-1 expression, respectively. Taken together, these results demonstrate that sulforaphane has antitumor effects against bladder cancer cells through an ROS-mediated intrinsic apoptotic pathway, and suggest that ER stress and Nrf2 may represent strategic targets for sulforaphane-induced apoptosis.

  9. CNC-bZIP protein Nrf1-dependent regulation of glucose-stimulated insulin secretion.

    Science.gov (United States)

    Zheng, Hongzhi; Fu, Jingqi; Xue, Peng; Zhao, Rui; Dong, Jian; Liu, Dianxin; Yamamoto, Masayuki; Tong, Qingchun; Teng, Weiping; Qu, Weidong; Zhang, Qiang; Andersen, Melvin E; Pi, Jingbo

    2015-04-01

    The inability of pancreatic β-cells to secrete sufficient insulin in response to glucose stimulation is a major contributing factor to the development of type 2 diabetes (T2D). We investigated both the in vitro and in vivo effects of deficiency of nuclear factor-erythroid 2-related factor 1 (Nrf1) in β-cells on β-cell function and glucose homeostasis. Silencing of Nrf1 in β-cells leads to a pre-T2D phenotype with disrupted glucose metabolism and impaired insulin secretion. Specifically, MIN6 β-cells with stable knockdown of Nrf1 (Nrf1-KD) and isolated islets from β-cell-specific Nrf1-knockout [Nrf1(b)-KO] mice displayed impaired glucose responsiveness, including elevated basal insulin release and decreased glucose-stimulated insulin secretion (GSIS). Nrf1(b)-KO mice exhibited severe fasting hyperinsulinemia, reduced GSIS, and glucose intolerance. Silencing of Nrf1 in MIN6 cells resulted in oxidative stress and altered glucose metabolism, with increases in both glucose uptake and aerobic glycolysis, which is associated with the elevated basal insulin release and reduced glucose responsiveness. The elevated glycolysis and reduced glucose responsiveness due to Nrf1 silencing likely result from altered expression of glucose metabolic enzymes, with induction of high-affinity hexokinase 1 and suppression of low-affinity glucokinase. Our study demonstrated a novel role of Nrf1 in regulating glucose metabolism and insulin secretion in β-cells and characterized Nrf1 as a key transcription factor that regulates the coupling of glycolysis and mitochondrial metabolism and GSIS. Nrf1 plays critical roles in regulating glucose metabolism, mitochondrial function, and insulin secretion, suggesting that Nrf1 may be a novel target to improve the function of insulin-secreting β-cells.

  10. Small molecule activators of the Nrf2-HO-1 antioxidant axis modulate heme metabolism and inflammation in BV2 microglia cells.

    Science.gov (United States)

    Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto

    2013-10-01

    The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Antioxidant Opuntia ficus-indica Extract Activates AHR-NRF2 Signaling and Upregulates Filaggrin and Loricrin Expression in Human Keratinocytes.

    Science.gov (United States)

    Nakahara, Takeshi; Mitoma, Chikage; Hashimoto-Hachiya, Akiko; Takahara, Masakazu; Tsuji, Gaku; Uchi, Hiroshi; Yan, Xianghong; Hachisuka, Junichi; Chiba, Takahito; Esaki, Hitokazu; Kido-Nakahara, Makiko; Furue, Masutaka

    2015-10-01

    Opuntia ficus-indica (OFI) is a cactus species widely used as an anti-inflammatory, antilipidemic, and hypoglycemic agent. It has been shown that OFI extract (OFIE) inhibits oxidative stress in animal models of diabetes and hepatic disease; however, its antioxidant mechanism remains largely unknown. In this study, we demonstrated that OFIE exhibited potent antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (NRF2) and the downstream antioxidant enzyme quinone oxidoreductase 1 (NQO1), which inhibited the generation of reactive oxygen species in keratinocytes challenged with tumor necrosis factor α or benzo[α]pyrene. The antioxidant capacity of OFIE was canceled in NRF2 knockdown keratinocytes. OFIE exerted this NRF2-NQO1 upregulation through activation of the aryl hydrocarbon receptor (AHR). Moreover, the ligation of AHR by OFIE upregulated the expression of epidermal barrier proteins: filaggrin and loricrin. OFIE also prevented TH2 cytokine-mediated downregulation of filaggrin and loricrin expression in an AHR-dependent manner because it was canceled in AHR knockdown keratinocytes. Antioxidant OFIE is a potent activator of AHR-NRF2-NQO1 signaling and may be beneficial in treating barrier-disrupted skin disorders.

  12. Compensatory role of the Nrf2–ARE pathway against paraquat toxicity: Relevance of 26S proteasome activity

    Directory of Open Access Journals (Sweden)

    Yasuhiko Izumi

    2015-11-01

    Full Text Available Oxidative stress and the ubiquitin–proteasome system play a key role in the pathogenesis of Parkinson disease. Although the herbicide paraquat is an environmental factor that is involved in the etiology of Parkinson disease, the role of 26S proteasome in paraquat toxicity remains to be determined. Using PC12 cells overexpressing a fluorescent protein fused to the proteasome degradation signal, we report here that paraquat yielded an inhibitory effect on 26S proteasome activity without an obvious decline in 20S proteasome activity. Relative low concentrations of proteasome inhibitors caused the accumulation of nuclear factor erythroid 2-related factor 2 (Nrf2, which is targeted to the ubiquitin–proteasome system, and activated the antioxidant response element (ARE-dependent transcription. Paraquat also upregulated the protein level of Nrf2 without increased expression of Nrf2 mRNA, and activated the Nrf2–ARE pathway. Consequently, paraquat induced expression of Nrf2-dependent ARE-driven genes, such as γ-glutamylcysteine synthetase, catalase, and hemeoxygenase-1. Knockdown of Nrf2 or inhibition of γ-glutamylcysteine synthetase and catalase exacerbated paraquat-induced toxicity, whereas suppression of hemeoxygenase-1 did not. These data indicate that the compensatory activation of the Nrf2–ARE pathway via inhibition of 26S proteasome serves as part of a cellular defense mechanism to protect against paraquat toxicity.

  13. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  14. VPA and MEL induce apoptosis by inhibiting the Nrf2-ARE signaling pathway in TMZ-resistant U251 cells.

    Science.gov (United States)

    Pan, Hao; Wang, Handong; Jia, Yue; Wang, Qiang; Li, Liwen; Wu, Qi; Chen, Longbang

    2017-07-01

    Chemoresistance is the primary obstacle to effective treatment of glioblastoma, the most lethal brain tumor. Our previous study demonstrated that Nf-E2 related factor 2 (Nrf2), a traditional cytoprotective transcription factor, was overexpressed in gliomas and promoted malignancy. The present study aimed to investigate the expression levels of Nrf2‑antioxidant response element (ARE) signaling pathway genes in temozolomide (TMZ)‑resistant U251 human glioblastoma cells (U251‑TMZ). Additionally, the effect of valproic acid (VPA) and melatonin (MEL) on Nrf2 expression in U251‑TMZ cells and their association with chemoresistance was investigated. The results of the present study indicated that the expression levels of components of the Nrf2‑ARE signaling pathway were increased in U251‑TMZ cells compared with U251 parent cells. Silencing of Nrf2 by transfection with small interfering RNA restored the chemosensitivity of U251‑TMZ cells. The Nrf2 inhibitors VPA and MEL successfully reduced Nrf2 expression and survival in U251‑TMZ cells treated with TMZ, accompanied by increased reactive oxygen species levels and apoptosis. Therefore, VPA and MEL may be potential chemotherapeutic sensitizers for the treatment of chemoresistant glioblastoma.

  15. Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

    Directory of Open Access Journals (Sweden)

    Marcelo R Vargas

    Full Text Available The nuclear factor erythroid 2-related factor 2 (Nrf2 governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1 cause familial forms of amyotrophic lateral sclerosis (ALS, a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

  16. Contribution of Nrf2 to Atherogenic Phenotype Switching of Coronary Arterial Smooth Muscle Cells Lacking CD38 Gene

    Directory of Open Access Journals (Sweden)

    Ming Xu

    2015-08-01

    Full Text Available Background/Aims: Recent studies have indicated that CD38 gene deficiency results in dedifferentiation or transdifferentiation of arterial smooth muscle cells upon atherogenic stimulations. However, the molecular mechanisms mediating this vascular smooth muscle (SMC phenotypic switching remain unknown. Methods & Results: In the present study, we first characterized the phenotypic change in the primary cultures of coronary arterial myocytes (CAMs from CD38-/- mice. It was shown that CD38 deficiency decreased the expression of contractile marker calponin, SM22α and α-SMA but increased the expression of SMC dedifferentiation marker, vimentin, which was accompanied by enhanced cell proliferation. This phenotypic change in CD38-/- CAMs was enhanced by 7-ketocholesterol (7-Ket, an atherogenic stimulus. We further found that the CD38 deficiency decreased the expression and activity of nuclear factor E2-related factor 2 (Nrf2, a basic leucine zipper (bZIP transcription factor sensitive to redox regulation. Similar to CD38 deletion, Nrf2 gene silencing increased CAM dedifferentiation upon 7-Ket stimulation. In contrast, the overexpression of Nrf2 gene abolished 7-Ket-induced dedifferentiation in CD38-/- CAMs. Given the sensitivity of Nrf2 to oxidative stress, we determined the role of redox signaling in the regulation of Nrf2 expression and activity associated with CD38 effect in CAM phenotype changes. It was demonstrated that in CD38-/- CAMs, 7-Ket failed to stimulate the production of O2-., while in CD38+/+ CAMs 7-Ket induced marked O2-. production and enhancement of Nrf2 activity, which was substantially attenuated by NOX4 gene silencing. Finally, we demonstrated that 7-Ket-induced and NOX4-dependent O2-. production was inhibited by 8-Br-cADPR, an antagonist of cADPR or NED-19, an antagonist of NAADP as product of CD38 ADP-ribosylcyclase, which significantly inhibited the level of cytosolic Ca2+ and the activation of Nrf2 under 7-Ket. Conclusion

  17. The effect of Mastin® on expression of Nrf2 in the rat heart with subtotally nephrectomy chronic Kidney disease model

    Science.gov (United States)

    Nathania, J.; Soetikno, V.

    2017-08-01

    Chronic kidney disease (CKD) is increasingly prevalent in Indonesia and worldwide. One of the major causes of morbidity and mortality in CKD is the complication of cardiovascular disease. Mastin® is a supplement that is locally produced in Indonesia and is made from extract of mangosteen pericarp, which is reported to have antioxidative, anti-inflammatory, and antitumor properties. The present study aimed to investigate whether Mastin® could improve antioxidant responses in the rat heart during CKD by measuring the expression of nuclear factor erythroid-2-related factor (Nrf)2, a master regulator of antioxidant response elements. RNA was extracted from the heart tissue of three groups of rats: a normal group, a nephrectomy group, and a nephrectomy with Mastin® group. Two-step real-time RT-PCR was then conducted to calculate the relative expression of the Nrf2 gene. Nrf2 expression was markedly decreased in the nephrectomy group vs the normal group, but slightly increas ed in the nephrectomy with Mastin® group vs the nephrectomy group. CKD resulted in impaired activation of the Nrf2 pathway in the rat heart. Although the administration of Mastin® slightly increased Nrf2 expression, it was not enough to confer cardioprotective effects through the Nrf2 pathway.

  18. Calculation of HPGe Detector Response for NRF Photons Scattered from Threat Materials

    International Nuclear Information System (INIS)

    Park, B. G.; Choi, H. D.

    2009-01-01

    Nuclear Resonance Fluorescence (NRF) is a process of resonant nuclear absorption of photons, followed by deexcitation with emission of fluorescence photons. The cross section of NRF photons process is given by σ i max ≡ 2π(λ/2π) 2 2J+1/2J 0 +1 Γ 0 Γ i /Γ tot 2 , where λ is the wavelength of the photon, J 0 and J are the nuclear spins of the ground state and excited state, respectively, Γ 0 , Γ i and Γ tot are decay width for deexcitation to the ground state, to the i-th mode state and total decay width, respectively. NRF based security inspection technique uses the signatures of resonance energies of the fluorescence photon scattered from nuclides of the illicit materials in cargo container. NRF can be used to identify the material type, quantity and location. It is performed by measuring the fluorescence photon and the transmitted photon spectrum while irradiating Bremsstrahlung photon beam to the sample

  19. Sulforaphane is a Nrf2-independent inhibitor of mitochondrial fission

    Directory of Open Access Journals (Sweden)

    Gary B. O'Mealey

    2017-04-01

    Full Text Available The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN, an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1 cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.

  20. Curcumin plays neuroprotective roles against traumatic brain injury partly via Nrf2 signaling.

    Science.gov (United States)

    Dong, Wenwen; Yang, Bei; Wang, Linlin; Li, Bingxuan; Guo, Xiangshen; Zhang, Miao; Jiang, Zhenfei; Fu, Jingqi; Pi, Jingbo; Guan, Dawei; Zhao, Rui

    2018-05-01

    Traumatic brain injury (TBI), which leads to high mortality and morbidity, is a prominent public health problem worldwide with no effective treatment. Curcumin has been shown to be beneficial for neuroprotection in vivo and in vitro, but the underlying mechanism remains unclear. This study determined whether the neuroprotective role of curcumin in mouse TBI is dependent on the NF-E2-related factor (Nrf2) pathway. The Feeney weight-drop contusion model was used to mimic TBI. Curcumin was administered intraperitoneally 15 min after TBI induction, and brains were collected at 24 h after TBI. The levels of Nrf2 and its downstream genes (Hmox-1, Nqo1, Gclm, and Gclc) were detected by Western blot and qRT-PCR at 24 h after TBI. In addition, edema, oxidative damage, cell apoptosis and inflammatory reactions were evaluated in wild type (WT) and Nrf2-knockout (Nrf2-KO) mice to explore the role of Nrf2 signaling after curcumin treatment. In wild type mice, curcumin treatment resulted in reduced ipsilateral cortex injury, neutrophil infiltration, and microglia activation, improving neuron survival against TBI-induced apoptosis and degeneration. These effects were accompanied by increased expression and nuclear translocation of Nrf2, and enhanced expression of antioxidant enzymes. However, Nrf2 deletion attenuated the neuroprotective effects of curcumin in Nrf2-KO mice after TBI. These findings demonstrated that curcumin effects on TBI are associated with the activation the Nrf2 pathway, providing novel insights into the neuroprotective role of Nrf2 and the potential therapeutic use of curcumin for TBI. Copyright © 2018. Published by Elsevier Inc.

  1. Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

    Science.gov (United States)

    Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling

    2014-01-01

    Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

  2. Beneficial Role of Some Natural Products to Attenuate the Diabetic Cardiomyopathy Through Nrf2 Pathway in Cell Culture and Animal Models.

    Science.gov (United States)

    Sathibabu Uddandrao, V V; Brahmanaidu, Parim; Nivedha, P R; Vadivukkarasi, S; Saravanan, Ganapathy

    2017-10-27

    Diabetic cardiomyopathy, as one of the main cardiac complications in diabetic patients, is identified to connect with oxidative stress that is due to interruption in balance between reactive oxygen species or/and reactive nitrogen species generation and their clearance by antioxidant protection systems. Transcription factor the nuclear factor erythroid 2-related factor 2 (Nrf2) plays a significant role in maintaining the oxidative homeostasis by regulating multiple downstream antioxidants. The Nrf2 plays a significant role in ARE-mediated basal and inducible expression of more than 200 genes that can be grouped into numerous categories as well as antioxidant genes and phase II detoxifying enzymes. On the other hand, activation of Nrf2 by natural and synthetic therapeutics or antioxidants has been revealed effective for the prevention and treatment of toxicities and diseases connected with oxidative stress. Hence, recently focus has been shifted toward plants and plant-based medicines in curing such chronic diseases, as they are supposed to be less toxic. In this review, we focused on the role of some natural products on diabetic cardiomyopathy through Nrf2 pathway.

  3. Lico A Enhances Nrf2-Mediated Defense Mechanisms against t-BHP-Induced Oxidative Stress and Cell Death via Akt and ERK Activation in RAW 264.7 Cells

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2015-01-01

    Full Text Available Licochalcone A (Lico A exhibits various biological properties, including anti-inflammatory and antioxidant activities. In this study, we investigated the antioxidative potential and mechanisms of Lico A against tert-butyl hydroperoxide- (t-BHP- induced oxidative damage in RAW 264.7 cells. Our results indicated that Lico A significantly inhibited t-BHP-induced cytotoxicity, apoptosis, and reactive oxygen species (ROS generation and reduced glutathione (GSH depletion but increased the glutamate-cysteine ligase modifier (GCLM subunit and the glutamate-cysteine ligase catalytic (GCLC subunit genes expression. Additionally, Lico A dramatically upregulated the antioxidant enzyme heme oxygenase 1 (HO-1 and nuclear factor erythroid 2-related factor 2 (Nrf2, which were associated with inducing Nrf2 nuclear translocation, decreasing Keap1 protein expression and increasing antioxidant response element (ARE promoter activity. Lico A also obviously induced the activation of serine/threonine kinase (Akt and extracellular signal-regulated kinase (ERK, but PI3K/Akt and ERK inhibitors treatment displayed clearly decreased levels of LicoA-induced Nrf2 nuclear translocation and HO-1 expression, respectively. Furthermore, Lico A treatment markedly attenuated t-BHP-induced oxidative damage, which was reduced by treatment with PI3K/Akt, ERK, and HO-1 inhibitors. Therefore, Lico A might have a protective role against t-BHP-induced cytotoxicity by modulating HO-1 and by scavenging ROS via the activation of the PI3K/Akt and ERK/Nrf2 signaling pathways.

  4. Andrographolide protects against cigarette smoke-induced oxidative lung injury via augmentation of Nrf2 activity

    Science.gov (United States)

    Guan, SP; Tee, W; Ng, DSW; Chan, TK; Peh, HY; Ho, WE; Cheng, C; Mak, JC; Wong, WSF

    2013-01-01

    Background and Purpose Cigarette smoke is a major cause for chronic obstructive pulmonary disease (COPD). Andrographolide is an active biomolecule isolated from the plant Andrographis paniculata. Andrographolide has been shown to activate nuclear factor erythroid-2-related factor 2 (Nrf2), a redox-sensitive antioxidant transcription factor. As Nrf2 activity is reduced in COPD, we hypothesize that andrographolide may have therapeutic value for COPD. Experimental Approach Andrographolide was given i.p. to BALB/c mice daily 2 h before 4% cigarette smoke exposure for 1 h over five consecutive days. Bronchoalveolar lavage fluid and lungs were collected for analyses of cytokines, oxidative damage markers and antioxidant activities. BEAS-2B bronchial epithelial cells were exposed to cigarette smoke extract (CSE) and used to study the antioxidant mechanism of action of andrographolide. Key Results Andrographolide suppressed cigarette smoke-induced increases in lavage fluid cell counts; levels of IL-1β, MCP-1, IP-10 and KC; and levels of oxidative biomarkers 8-isoprostane, 8-OHdG and 3-nitrotyrosine in a dose-dependent manner. Andrographolide promoted inductions of glutathione peroxidase (GPx) and glutathione reductase (GR) activities in lungs from cigarette smoke-exposed mice. In BEAS-2B cells, andrographolide markedly increased nuclear Nrf2 accumulation, promoted binding to antioxidant response element (ARE) and total cellular glutathione level in response to CSE. Andrographolide up-regulated ARE-regulated gene targets including glutamate-cysteine ligase catalytic (GCLC) subunit, GCL modifier (GCLM) subunit, GPx, GR and heme oxygenase-1 in BEAS-2B cells in response to CSE. Conclusions Andrographolide possesses antioxidative properties against cigarette smoke-induced lung injury probably via augmentation of Nrf2 activity and may have therapeutic potential for treating COPD. PMID:23146110

  5. Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line.

    Science.gov (United States)

    Park, Hae-Ryung; Loch-Caruso, Rita

    2014-11-15

    Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20μM BDE-47 for 24h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20μM BDE-47 for 24h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. The Transcription Factor Nrf2 Protects Angiogenic Capacity of Endothelial Colony-Forming Cells in High-Oxygen Radical Stress Conditions

    Directory of Open Access Journals (Sweden)

    Hendrik Gremmels

    2017-01-01

    Full Text Available Background. Endothelial colony forming cells (ECFCs have shown a promise in tissue engineering of vascular constructs, where they act as endothelial progenitor cells. After implantation, ECFCs are likely to be subjected to elevated reactive oxygen species (ROS. The transcription factor Nrf2 regulates the expression of antioxidant enzymes in response to ROS. Methods. Stable knockdown of Nrf2 and Keap1 was achieved by transduction with lentiviral shRNAs; activation of Nrf2 was induced by incubation with sulforaphane (SFN. Expression of Nrf2 target genes was assessed by qPCR, oxidative stress was assessed using CM-DCFDA, and angiogenesis was quantified by scratch-wound and tubule-formation assays. Results. Nrf2 knockdown led to a reduction of antioxidant gene expression and increased ROS. Angiogenesis was disturbed after Nrf2 knockdown even in the absence of ROS. Conversely, angiogenesis was preserved in high ROS conditions after knockdown of Keap1. Preincubation of ECFCs with SFN reduced intracellular ROS in the presence of H2O2 and preserved scratch-wound closure and tubule-formation. Conclusion. The results of this study indicate that Nrf2 plays an important role in the angiogenic capacity of ECFCs, particularly under conditions of increased oxidative stress. Pretreatment of ECFCs with SFN prior to implantation may be a protective strategy for tissue-engineered constructs or cell therapies.

  7. Estrogen receptor and PI3K/Akt signaling pathway involvement in S-(-equol-induced activation of Nrf2/ARE in endothelial cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available S-(-equol, a natural product of the isoflavone daidzein, has been reported to offer cytoprotective effects with respect to the cardiovascular system, but how this occurs is unclear. Interestingly, S-(-equol is produced by the human gut, suggesting a role in physiological processes. We report that treatment of human umbilical vein endothelial cells and EA.hy926 cells with S-(-equol induces ARE-luciferase reporter gene activity that is dose and time dependent. S-(-equol (10-250 nM increases nuclear factor-erythroid 2-related factor 2 (Nrf2 as well as gene products of Nrf2 target genes heme oxygenase-1 (HO-1 and NAD(PH (nicotinamide-adenine-dinucleotide-phosphate quinone oxidoreductase 1 (NQO1. Endothelial cells transfected with an HA-Nrf2 expression plasmid had elevated HA-Nrf2, HO-1, and NQO1 in response to S-(-equol exposure. S-(-equol treatment affected Nrf2 mRNA only slightly but significantly increased HO-1 and NQO1 mRNA. The pretreatment of cells with specific ER inhibitors or PI3K/Akt (ICI182,780 and LY294002 increased Nrf2, HO-1, and NQO1 protein, impaired nuclear translocation of HA-Nrf2, and decreased ARE-luciferase activity. Identical experiments were conducted with daidzein, which had effects similar to S-(-equol. In addition, DPN treatment (an ERβ agonist induced the ARE-luciferase reporter gene, promoting Nrf2 nuclear translocation. Cell pretreatment with an ERβ antagonist (PHTPP impaired S-(-equol-induced Nrf2 activation. Pre-incubation of cells followed by co-treatment with S-(-equol significantly improved cell survival in response to H2O2 or tBHP and reduced apoptotic and TUNEL-positively-stained cells. Notably, the ability of S-(-equol to protect against H2O2-induced cell apoptosis was attenuated in cells transfected with an siRNA against Nrf2. Thus, beneficial effects of S-(-equol with respect to cytoprotective antioxidant gene activation may represent a novel strategy to prevent and treat cardiovascular diseases.

  8. Equol Attenuates Atherosclerosis in Apolipoprotein E-Deficient Mice by Inhibiting Endoplasmic Reticulum Stress via Activation of Nrf2 in Endothelial Cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available The development of atherosclerosis is closely related to excessive endoplasmic reticulum stress (ERs. Equol reportedly protects against cardiovascular disease; however, the underlying mechanism for this protection remains unknown. Herein, the mechanisms contributing to the atheroprotective effect of equol were addressed using apolipoprotein E knockout (apoE-/- mice fed a high-fat diet (HFD with or without equol. Equol intervention reduced atherosclerotic lesions in the aorta in HFD-fed apoE-/- mice. Plasma lipid analysis showed that equol intervention reduced triglycerides, total cholesterol and LDL-cholesterol and increased HDL-cholesterol. Additionally, equol administration decreased lipid accumulation in the liver. Simultaneously, equol treatment inhibited cell apoptosis induced by t-BHP and thapsigargin in human umbilical vein endothelial cells (HUVECs. Furthermore, equol treatment attenuated palmitate, t-BHP or thapsigargin-induced upregulation of ER stress markers, including p-PERK, p-eIF2α, GRP78, ATF6 and CHOP proteins expression. The same tendency was also observed in aortic lysates in apoE-/- mice fed with equol plus HFD compared with HFD alone. Moreover, equol treatment dose dependently activated the Nrf2 signaling pathway under oxidative stress. Additionally, elevation of Nrf2 induction was found in aortic lysates in apoE-/- mice fed with a HFD diet containing equol compared with a HFD diet without equol. Importantly, Nrf2 siRNA interference induced CHOP and attenuated the effect of equol to inhibit t-BHP mediated CHOP induction, furthermore, abrogated cell apoptosis induced by t-BHP, suggesting a role for Nrf2 in the protective effect of equol in HUVECs. Collectively, these findings implicate that the improvement of atherosclerosis by equol through attenuation of ER stress is mediated, at least in part, by activating the Nrf2 signaling pathway.

  9. Naringenin protects against 6-OHDA-induced neurotoxicity via activation of the Nrf2/ARE signaling pathway.

    Science.gov (United States)

    Lou, Haiyan; Jing, Xu; Wei, Xinbing; Shi, Huanying; Ren, Dongmei; Zhang, Xiumei

    2014-04-01

    There is increasing evidence that oxidative stress is critically involved in the pathogenesis of Parkinson's disease (PD), suggesting that pharmacological targeting of the antioxidant machinery may have therapeutic value. Naringenin, a natural flavonoid compound, has been reported to possess neuroprotective effect against PD related pathology; however the mechanisms underlying its beneficial effects are poorly defined. Thus, the purpose of the present study was to investigate the potential neuroprotective role of naringenin and to delineate its mechanism of action against 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in models of PD both in vitro and in vivo. Naringenin treatment resulted in an increase in nuclear factor E2-related factor 2 (Nrf2) protein levels and subsequent activation of antioxidant response element (ARE) pathway genes in SH-SY5Y cells and in mice. Exposure of SH-SY5Y cells to naringenin provided protection against 6-OHDA-induced oxidative insults that was dependent on Nrf2, since treatment with Nrf2 siRNA failed to block against 6-OHDA neurotoxicity or induce Nrf2-dependent cytoprotective genes in SH-SY5Y cells. In mice, oral administration of naringenin resulted in significant protection against 6-OHDA-induced nigrostriatal dopaminergic neurodegeneration and oxidative damage. Our results indicate that activation of Nrf2/ARE signaling by naringenin is strongly associated with its neuroprotective effects against 6-OHDA neurotoxicity and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in PD. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Rosemary Extracts Upregulate Nrf2, Sestrin2, and MRP2 Protein Level in Human Hepatoma HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Xiao-pei Tong

    2017-01-01

    Full Text Available In the past few decades, the incidence of liver cancer has been rapidly rising across the world. Rosemary is known to possess antioxidant activity and is used as natural antioxidant food preservative. It is proposed to have anticancer activity in treating different tumor models. In this study, we try to explore the impact of rosemary extracts on upregulating the level of Nrf2 and Nrf2-regulatory proteins, Sestrin2 and MRP2 in HepG2 cells, and to speculate its potential mechanism. The anticancer activity of rosemary extract, including its polyphenolic diterpenes carnosic acid and carnosol, was evaluated to understand the potential effect on HepG2 cells. Rosemary extract, carnosic acid, and carnosol induced the expression of Sestrin2 and MRP2 associate with enhancement of Nrf2 protein level in HepG2 cells, in which carnosic acid showed most obvious effect. Although the activation pathway of Nrf2/ARE was not exactly assessed, it can be assumed that the enhancement of expression of Sestrin2 and MRP2 may result from upregulation of Nrf2.

  11. PFOS induces adipogenesis and glucose uptake in association with activation of Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jialin [Institute of Biochemistry and Molecular Biology, College of Life and Health Sciences, Northeastern University, Shenyang 110819 (China); Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Shimpi, Prajakta; Armstrong, Laura; Salter, Deanna [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Slitt, Angela L., E-mail: aslitt@uri.edu [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States)

    2016-01-01

    PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1 cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association

  12. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Ying [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Ziwei [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Tan, Min [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Department of Traditional Chinese Medicine Chemistry, College of Chinese Materia Madica, Guangzhou University of Chinese Medicine, Guangzhou 510006 (China); Liu, Anmin [Department of Neurosurgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Meihui [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Liu, Jun [Department of Neurology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Pi, Rongbiao, E-mail: pirb@mail.sysu.edu.cn [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Fang, Jianpei, E-mail: jpf2005@163.com [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China)

    2013-11-29

    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  13. Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

    Science.gov (United States)

    Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

    2017-06-01

    Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Madhusudhanan Narasimhan

    Full Text Available Nuclear factor-erythroid 2-related factor 2 (Nrf2/NFE2L2, a redox-sensitive transcription factor plays a critical role in adaptation to cellular stress and affords cellular defense by initiating transcription of antioxidative and detoxification genes. While a protein can be regulated at multiple levels, control of Nrf2 has been largely studied at post-translational regulation points by Keap1. Importantly, post-transcriptional/translational based regulation of Nrf2 is less understood and to date there are no reports on such mechanisms in neuronal systems. In this context, studies involving the role of microRNAs (miRs which are normally considered as fine tuning regulators of protein production through translation repression and/or post-transcriptional alterations, are in place. In the current study, based on in-silico analysis followed by immunoblotting and real time analysis, we have identified and validated for the first time that human NFE2L2 could be targeted by miR153/miR27a/miR142-5p/miR144 in neuronal, SH-SY5Y cells. Co-transfection studies with individual miR mimics along with either WT 3' UTR of human Nrf2 or mutated miRNA targeting seed sequence within Nrf2 3' UTR, demonstrated that Nrf2 is a direct regulatory target of these miRs. In addition, ectopic expression of miR153/miR27a/miR142-5p/miR144 affected Nrf2 mRNA abundance and nucleo-cytoplasmic concentration of Nrf2 in a Keap1 independent manner resulting in inefficient transactivating ability of Nrf2. Furthermore, forced expression of miRs diminished GCLC and GSR expression resulting in alteration of Nrf2 dependent redox homeostasis. Finally, bioinformatics based miRNA-disease network analysis (MDN along with extended computational network analysis of Nrf2 associated pathologic processes suggests that if in a particular cellular scenario where any of these miR153/miR27a/miR142-5p/miR144 either individually or as a group is altered, it could affect Nrf2 thus triggering and

  15. Nrf2 activation ameliorates cytotoxic effects of arsenic trioxide in acute promyelocytic leukemia cells through increased glutathione levels and arsenic efflux from cells

    Energy Technology Data Exchange (ETDEWEB)

    Nishimoto, Shoichi; Suzuki, Toshihiro; Koike, Shin [Department of Analytical Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588 (Japan); Yuan, Bo; Takagi, Norio [Department of Applied Biochemistry, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, Hachioji, Tokyo 192-0392 (Japan); Ogasawara, Yuki, E-mail: yo@my-pharm.ac.jp [Department of Analytical Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588 (Japan)

    2016-08-15

    Carnosic acid (CA), a phenolic diterpene isolated from Rosmarinus officinalis, has been shown to activate nuclear transcription factor E2-related factor 2 (Nrf2), which plays a central role in cytoprotective responses to oxidative and electrophilic stress. Recently, the Nrf2-Kelch ECH associating protein 1 (Keap1) pathway has been associated with cancer drug resistance attributable to modulation of the expression and activation of antioxidant and detoxification enzymes. However, the exact mechanisms by which Nrf2 activation results in chemoresistance are insufficiently understood to date. This study investigated the mechanisms by which the cytotoxic effects of arsenic trioxide (ATO), an anticancer drug, were decreased in acute promyelocytic leukemia cells treated with CA, a typical activator of Nrf2 used to stimulate the Nrf2/Keap1 system. Our findings suggest that arsenic is non-enzymatically incorporated into NB4 cells and forms complexes that are dependent on intracellular glutathione (GSH) concentrations. In addition, the arsenic complexes are recognized as substrates by multidrug resistance proteins and subsequently excreted from the cells. Therefore, Nrf2-associated activation of the GSH biosynthetic pathway, followed by increased levels of intracellular GSH, are key mechanisms underlying accelerated arsenic efflux and attenuation of the cytotoxic effects of ATO. - Highlights: • Nrf2 activation attenuates the effect of arsenic trioxide to acute promyelocytic leukemia cells. • The sensitivity of arsenic trioxide to NB4 cells was dependent on efflux rate of arsenic. • Activation of the GSH biosynthesis is essential in Nrf2-regulated responses for arsenic efflux.

  16. Amomum tsao-ko suppresses lipopolysaccharide-induced inflammatory responses in RAW264.7 macrophages via Nrf2-dependent heme oxygenase-1 expression.

    Science.gov (United States)

    Li, Bin; Choi, Hee-Jin; Lee, Dong-Sung; Oh, Hyuncheol; Kim, Youn-Chul; Moon, Jin-Young; Park, Won-Hwan; Park, Sun-Dong; Kim, Jai-Eun

    2014-01-01

    Amomum tsao-ko Crevost et Lemaire, used as a spice in Asia, is an important source of Chinese cuisine and traditional Chinese medicines. A. tsao-ko is reported to exert a variety of biological and pharmacological activities, including anti-proliferative, anti-oxidative and neuroprotective effects. In this study, NNMBS227, consisting of the ethanol extract of A. tsao-ko, exhibited potent anti-inflammatory activities in RAW264.7 macrophages. We investigated the effect of NNMBS227 in the suppression of pro-inflammatory mediators, including pro-inflammatory enzymes (inducible nitric oxide synthase and cyclooxygenase-2) and cytokines (tumor necrosis factor-α and interleukin-1β) in LPS stimulated macrophages. NNMBS227 also inhibited the phosphorylation and degradation of IκB-α, as well as the nuclear translocation of nuclear factor kappa B (NF-κB) p65 caused by stimulation with LPS. In addition, NNMBS227 induced heme oxygenase (HO)-1 expression through the nuclear translocation of nuclear factor E2-related factor 2 (Nrf2) in macrophages. Using tin protoporphyrin (SnPP), an HO activity inhibitor, we confirmed an association between the anti-inflammatory effects of NNMBS227 and the up-regulation of HO-1. These findings suggest that Nrf2-dependent increases in the expression of HO-1 induced by NNMBS227 conferred anti-inflammatory activities in LPS stimulated RAW264.7 macrophages.

  17. The Role of Nrf2: Adipocyte Differentiation, Obesity, and Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Hyun-Ae Seo

    2013-01-01

    Full Text Available Metabolic diseases, such as type 2 diabetes and obesity, are increasing globally, and much work has been performed to elucidate the regulatory mechanisms of these diseases. Nuclear factor E2-related factor 2 (Nrf2 is a basic leucine zipper transcription factor that serves as a primary cellular defense against the cytotoxic effects of oxidative stress. Recent studies have proposed a close relationship between oxidative stress and energy metabolism-associated disease. The Nrf2 pathway, as a master regulator of cellular defense against oxidative stress, has emerged as a critical target of energy metabolism; however, its effects are controversial. This review examines the current state of research on the role of Nrf2 on energy metabolism, specifically with respect to its participation in adipocyte differentiation, obesity, and insulin resistance, and discusses the possibility of using Nrf2 as a therapeutic target in the clinic.

  18. The C-terminal domain of Nrf1 negatively regulates the full-length CNC-bZIP factor and its shorter isoform LCR-F1/Nrf1β; both are also inhibited by the small dominant-negative Nrf1γ/δ isoforms that down-regulate ARE-battery gene expression.

    Science.gov (United States)

    Zhang, Yiguo; Qiu, Lu; Li, Shaojun; Xiang, Yuancai; Chen, Jiayu; Ren, Yonggang

    2014-01-01

    The C-terminal domain (CTD, aa 686-741) of nuclear factor-erythroid 2 p45-related factor 1 (Nrf1) shares 53% amino acid sequence identity with the equivalent Neh3 domain of Nrf2, a homologous transcription factor. The Neh3 positively regulates Nrf2, but whether the Neh3-like (Neh3L) CTD of Nrf1 has a similar role in regulating Nrf1-target gene expression is unknown. Herein, we report that CTD negatively regulates the full-length Nrf1 (i.e. 120-kDa glycoprotein and 95-kDa deglycoprotein) and its shorter isoform LCR-F1/Nrf1β (55-kDa). Attachment of its CTD-adjoining 112-aa to the C-terminus of Nrf2 yields the chimaeric Nrf2-C112Nrf1 factor with a markedly decreased activity. Live-cell imaging of GFP-CTD reveals that the extra-nuclear portion of the fusion protein is allowed to associate with the endoplasmic reticulum (ER) membrane through the amphipathic Neh3L region of Nrf1 and its basic c-tail. Thus removal of either the entire CTD or the essential Neh3L portion within CTD from Nrf1, LCR-F1/Nrf1β and Nrf2-C112Nrf1, results in an increase in their transcriptional ability to regulate antioxidant response element (ARE)-driven reporter genes. Further examinations unravel that two smaller isoforms, 36-kDa Nrf1γ and 25-kDa Nrf1δ, act as dominant-negative inhibitors to compete against Nrf1, LCR-F1/Nrf1β and Nrf2. Relative to Nrf1, LCR-F1/Nrf1β is a weak activator, that is positively regulated by its Asn/Ser/Thr-rich (NST) domain and acidic domain 2 (AD2). Like AD1 of Nrf1, both AD2 and NST domain of LCR-F1/Nrf1β fused within two different chimaeric contexts to yield Gal4D:Nrf1β607 and Nrf1β:C270Nrf2, positively regulate their transactivation activity of cognate Gal4- and Nrf2-target reporter genes. More importantly, differential expression of endogenous ARE-battery genes is attributable to up-regulation by Nrf1 and LCR-F1/Nrf1β and down-regulation by Nrf1γ and Nrf1δ.

  19. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  20. Xanthohumol ameliorates lipopolysaccharide (LPS-induced acute lung injury via induction of AMPK/GSK3β-Nrf2 signal axis

    Directory of Open Access Journals (Sweden)

    Hongming Lv

    2017-08-01

    Full Text Available Abundant natural flavonoids can induce nuclear factor-erythroid 2 related factor 2 (Nrf2 and/or AMP-activated protein kinase (AMPK activation, which play crucial roles in the amelioration of various inflammation- and oxidative stress-induced diseases, including acute lung injury (ALI. Xanthohumol (Xn, a principal prenylflavonoid, possesses anti-inflammation and anti-oxidant activities. However, whether Xn could protect from LPS-induced ALI through inducing AMPK/Nrf2 activation and its downstream signals, are still poorly elucidated. Accordingly, we focused on exploring the protective effect of Xn in the context of ALI and the involvement of underlying molecular mechanisms. Our findings indicated that Xn effectively alleviated lung injury by reduction of lung W/D ratio and protein levels, neutrophil infiltration, MDA and MPO formation, and SOD and GSH depletion. Meanwhile, Xn significantly lessened histopathological changes, reactive oxygen species (ROS generation, several cytokines secretion, and iNOS and HMGB1 expression, and inhibited Txnip/NLRP3 inflammasome and NF-κB signaling pathway activation. Additionally, Xn evidently decreased t-BHP-stimulated cell apoptosis, ROS generation and GSH depletion but increased various anti-oxidative enzymes expression regulated by Keap1-Nrf2/ARE activation, which may be associated with AMPK and GSK3β phosphorylation. However, Xn-mediated inflammatory cytokines and ROS production, histopathological changes, Txnip/NLRP3 inflammasome and NF-κB signaling pathway in WT mice were remarkably abrogated in Nrf2-/- mice. Our experimental results firstly provided a support that Xn effectively protected LPS-induced ALI against oxidative stress and inflammation damage which are largely dependent upon upregulation of the Nrf2 pathway via activation of AMPK/GSK3β, thereby suppressing LPS-activated Txnip/NLRP3 inflammasome and NF-κB signaling pathway. Keywords: Xanthohumol, Acute lung injury, Oxidative stress

  1. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  2. Seaweed extracts and unsaturated fatty acid constituents from the green alga Ulva lactuca as activators of the cytoprotective Nrf2-ARE pathway.

    Science.gov (United States)

    Wang, Rui; Paul, Valerie J; Luesch, Hendrik

    2013-04-01

    Increased amounts of reactive oxygen species (ROS) have been implicated in many pathological conditions, including cancer. The major machinery that the cell employs to neutralize excess ROS is through the activation of the antioxidant-response element (ARE) that controls the activation of many phase II detoxification enzymes. The transcription factor that recognizes the ARE, Nrf2, can be activated by a variety of small molecules, most of which contain an α,β-unsaturated carbonyl system. In the pursuit of chemopreventive agents from marine organisms, we built, fractionated, and screened a library of 30 field-collected eukaryotic algae from Florida. An edible green alga, Ulva lactuca, yielded multiple active fractions by ARE-luciferase reporter assay. We isolated three monounsaturated fatty acid (MUFA) derivatives as active components, including a new keto-type C18 fatty acid (1), the corresponding shorter chain C16 acid (2), and an amide derivative (3) of the C18 acid. Their chemical structures were elucidated by NMR and mass spectrometry. All three contain the conjugated enone motif between C7 and C9, which is thought to be responsible for the ARE activity. Subsequent biological studies focused on 1, the most active and abundant ARE activator isolated. C18 acid 1 induced the expression of ARE-regulated cytoprotective genes, including NAD(P)H:quinone oxidoreductase 1, heme oxygenase 1, thioredoxin reductase 1, both subunits of the glutamate-cysteine ligase (catalytic subunit and modifier subunit), and the cystine/glutamate exchange transporter, in IMR-32 human neuroblastoma cells. Its cellular activity requires the presence of Nrf2 and PI3K function, based on RNA interference and pharmacological inhibitor studies, respectively. Treatment with 1 led only to Nrf2 activation, and not the increase in production of NRF2 mRNA. To test its ARE activity and cytoprotective potential in vivo, we treated mice with a single dose of a U. lactuca fraction that was enriched with

  3. Dl-3-n-Butylphthalide Inhibits NLRP3 Inflammasome and Mitigates Alzheimer's-Like Pathology via Nrf2-TXNIP-TrX Axis.

    Science.gov (United States)

    Wang, Chun-Yan; Xu, Ye; Wang, Xu; Guo, Chuang; Wang, Tao; Wang, Zhan-You

    2018-04-25

    Oxidative stress and neuroinflammation play important roles in the pathology of Alzheimer's disease (AD). Thioredoxin-interacting protein (TXNIP), an endogenous inhibitor of antioxidant thioredoxin, is suspected to be an important modulator of oxidative stress and inflammation. However, the underlying mechanism involved in the abnormal homeostasis of TXNIP-thioredoxin (TrX) in AD pathogenesis remains unclear. Using the Swedish mutant form of APP (APPswe)/PSEN1dE9 transgenic mouse (APP/PS1) and human-derived neuronal cells as model systems, we disclosed the impairment of the nuclear factor erythroid 2-related factor 2 (Nrf2)-TXNIP-TrX signaling in Alzheimer's-like pathology. We observed that the immune staining of TXNIP was increased in postmortem AD brain. The chronic accumulation of inflammatory mediator in neuronal cells facilitates interactions of TXNIP-nucleotide binding oligomerization domain-like receptor family, pyrin domain containing 3 (NLRP3) and NLRP3-ASC, which increases β-amyloid (Aβ) secretion. The antioxidant Dl-3-n-butylphthalide (Dl-NBP) is commonly used for cerebral ischemia treatment. In our study, we elucidated for new mechanisms by which Dl-NBP enhanced TrX activity, suppressed TXNIP, and ameliorated neuronal apoptosis in the APP/PS1 mouse brains. In human glioblastoma A172 cells and neuroblastoma SH-SY5Y cells, we delineated the Dl-NBP-mediated signaling pathways by which Dl-NBP-dependent upregulation of Nrf2 mediated the reciprocal regulation of reducing proinflammatory cytokine and inhibiting Aβ production in the glial and neuronal cells overexpressing APPswe. Our data provide a novel insight into the molecular mechanism that impairments of Nrf2-TXNIP-TrX system may be involved in the imbalance of cellular redox homeostasis and inflammatory damage in the AD brain. Dl-NBP treatment could suppress TXNIP-NLRP3 interaction and inhibit NLRP3 inflammasome activation via upregulating Nrf2. These findings may provide an instrumental therapeutic

  4. Protective function of pyridoxamine on retinal photoreceptor cells via activation of the p‑Erk1/2/Nrf2/Trx/ASK1 signalling pathway in diabetic mice.

    Science.gov (United States)

    Ren, Xiang; Sun, Hong; Zhang, Chenghong; Li, Chen; Wang, Jinlei; Shen, Jie; Yu, Dong; Kong, Li

    2016-07-01

    The present study aimed to investigate the mechanisms that mediate the protective effects of pyridoxamine (PM) on light‑damaged retinal photoreceptor cells in diabetic mice. A high‑fat diet and streptozotocin were used to induce a mouse model of type II diabetes. During the experiment, mice were divided the mice into three types of group, as follows: Control groups (negative control and light‑damaged groups); experimental groups (diabetic and diabetic light‑damaged groups); and treatment groups (25, 50 and 100 mg/kg PM‑treated groups). Using hematoxylin‑eosin staining, the number of nuclear layer cells were counted. Western blotting and immunohistochemistry were performed to measure the levels of thioredoxin (Trx), phospho‑extracellular signal‑regulated kinase 1/2 (p‑Erk1/2), nuclear factor erythroid 2‑related factor 2 (Nrf2) and apoptosis signal‑regulating kinase 1 (ASK1). The photoreceptor cell count in the outer nuclear layer of the light‑damaged, diabetic control and diabetic light‑damaged groups were significantly reduced compared with the negative control group (PTrx, p‑Erk1/2 and Nrf2 expression levels (PTrx, p‑Erk1/2 and Nrf2 expression levels were significantly increased (PTrx, p‑Erk1/2 and Nrf2 expression, and the downregulation of ASK1 expression.

  5. HMOX1 and NQO1 genes are upregulated in response to contact sensitizers in dendritic cells and THP-1 cell line: role of the Keap1/Nrf2 pathway.

    Science.gov (United States)

    Ade, Nadège; Leon, Fanny; Pallardy, Marc; Peiffer, Jean-Luc; Kerdine-Romer, Saadia; Tissier, Marie-Hélène; Bonnet, Pierre-Antoine; Fabre, Isabelle; Ourlin, Jean-Claude

    2009-02-01

    Electrophilicity is one of the most common features of skin contact sensitizers and is necessary for protein haptenation. The Keap1 (Kelch-like ECH-associated protein 1)/Nrf2 -signaling pathway is dedicated to the detection of electrophilic stress in cells leading to the upregulation of genes involved in protection or neutralization of chemical reactive species. Signals provided by chemical stress could play an important role in dendritic cell activation and the aim of this work was to test whether contact sensitizers were specific activators of the Keap1/Nrf2 pathway. CD34-derived dendritic cells (CD34-DC) and the THP-1 myeloid cell line were treated by a panel of sensitizers (Ni, 1-chloro 2,4-dinitrobenzene, cinnamaldehyde, 7-hydroxycitronellal, 1,4-dihydroquinone, alpha-methyl-trans-cinnamaldehyde, 2-4-tert-(butylbenzyl)propionaldehyde or Lilial, and 1,4-phenylenediamine), irritants (sodium dodecyl sulfate, benzalkonium chloride), and a nonsensitizer molecule (chlorobenzene). Three well-known Nrf2 activators (tert-butylhydroquinone, lipoic acid, sulforaphane) were also tested. Expression of hmox1 and nqo1 was measured using real-time PCR and cellular accumulation of Nrf2 was assessed by Western blot. Our results showed an increased expression at early time points of hmox1 and nqo1 mRNAs in response to sensitizers but not to irritants. Accumulation of the Nrf2 protein was also observed only with chemical sensitizers. A significant inhibition of the expression of hmox1 and nqo1 mRNAs and CD86 expression was found in 1-chloro 2,4-dinitrobenzene-treated THP-1 cells preincubated with N-acetyl cysteine, a glutathione precursor. Altogether, these data suggested that the Keap1/Nrf2-signaling pathway was activated by electrophilic molecules including sensitizers in dendritic cells and in the THP-1 cell line. Monitoring of this pathway may provide new biomarkers (e.g., Nrf2, hmox1) for the detection of the sensitization potential of chemicals.

  6. Fisetin alleviates oxidative stress after traumatic brain injury via the Nrf2-ARE pathway.

    Science.gov (United States)

    Zhang, Li; Wang, Handong; Zhou, Yali; Zhu, Yihao; Fei, Maoxin

    2018-05-22

    Fisetin, a natural flavonoid, has neuroprotection properties in many brain injury models. However, its role in traumatic brain injury (TBI) has not been fully explained. In the present study, we aimed to explore the neuroprotective effects of fisetin in a mouse model of TBI. We found that fisetin improved neurological function, reduced cerebral edema, attenuated brain lesion and ameliorated blood-brain barrier (BBB) disruption after TBI. Moreover, the up-regulation of malondialdehyde (MDA) and the activity of glutathione peroxidase (GPx) were reversed by fisetin treatment. Furthermore, administration of fisetin suppressed neuron cell death and apoptosis, increased the expression of B-cell lymphoma 2 (Bcl-2), while decreased the expression of Bcl-2-associated X protein (Bax) and caspase-3 after TBI. In addition, fisetin activated the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway following TBI. However, fisetin only failed to suppress oxidative stress in Nrf2 -/- mice. In conclusion, our data provided the first evidence that fisetin played a critical role in neuroprotection after TBI partly through the activation of the Nrf2-ARE pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells

    International Nuclear Information System (INIS)

    Pecorelli, Alessandra; Bocci, Velio; Acquaviva, Alessandra; Belmonte, Giuseppe; Gardi, Concetta; Virgili, Fabio; Ciccoli, Lucia; Valacchi, Giuseppe

    2013-01-01

    During the last decade, it has been shown that the activation of NRF2 and the binding to electrophile-responsive element (EpREs), stimulates the expression of a great number of genes responsible for the synthesis of phase I and phase II proteins, including antioxidants enzymes and heme oxygenase-1 (HO-1). This critical cell response occurs in cardiovascular, degenerative and chronic infective diseases aggravated by a chronic oxidative stress. In our previous reports we have shown that ozonated plasma is able to up-regulate HO-1 expression in endothelial cells. In the present work we investigated a candidate mechanism involved in this process. After treatment with increasing doses of ozonated serum (20, 40 and 80 μg/mL O 3 per mL of serum), a clear dose dependent activation of NRF2 and the subsequent induction of HO-1 and NAD(P)H quinone oxidoreductase 1(NQO1) was observed. This effect was also present when cells were treated with serum and hydrogen peroxide (H 2 O 2 ) or serum and 4-hydroxynonenal (4HNE). Moreover, the treatment with ozonated serum was associated with a dose-dependent activation of extracellular-signal-regulated kinases (ERK1/2) and p38 MAP kinases (p38), not directly involved in NRF2 activation. These data, provide a new insight on the mechanism responsible for the induction of HO-1 expression by ozonated serum in the endothelium, and have a practical importance as an expedient approach to the treatment of patients with both effective orthodox drugs and ozonated autohemotherapy, targeted to the restoration of redox homeostasis. - Highlights: ► Endothelial HO1 is upregulated by ozonated plasma ► This activation is induced by NRF2 and it is ERK independent. ► 4HNE and H 2 O 2 are the main molecules involved in this process. ► Ozonated plasma induced a hormetic effect ► Combination of orthodox medicine and ozonated plasma can be a useful treatment

  8. NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Pecorelli, Alessandra [Department of Molecular and Developmental Medicine, University of Siena (Italy); Child Neuropsychiatry Unit, University Hospital, AOUS, Siena (Italy); Bocci, Velio [Department of Physiology, University of Siena (Italy); Acquaviva, Alessandra [Department of Molecular and Developmental Medicine, University of Siena (Italy); Belmonte, Giuseppe [Department of Biomedical Sciences, University of Siena (Italy); Gardi, Concetta [Department of Molecular and Developmental Medicine, University of Siena (Italy); Virgili, Fabio [INRAN, Rome (Italy); Ciccoli, Lucia [Department of Molecular and Developmental Medicine, University of Siena (Italy); Valacchi, Giuseppe, E-mail: giuseppe.valacchi@unife.it [Department of Life Sciences and Biotechnology, University of Ferrara (Italy); Department of Food and Nutrition, Kyung Hee University, Seoul (Korea, Republic of)

    2013-02-15

    During the last decade, it has been shown that the activation of NRF2 and the binding to electrophile-responsive element (EpREs), stimulates the expression of a great number of genes responsible for the synthesis of phase I and phase II proteins, including antioxidants enzymes and heme oxygenase-1 (HO-1). This critical cell response occurs in cardiovascular, degenerative and chronic infective diseases aggravated by a chronic oxidative stress. In our previous reports we have shown that ozonated plasma is able to up-regulate HO-1 expression in endothelial cells. In the present work we investigated a candidate mechanism involved in this process. After treatment with increasing doses of ozonated serum (20, 40 and 80 μg/mL O{sub 3} per mL of serum), a clear dose dependent activation of NRF2 and the subsequent induction of HO-1 and NAD(P)H quinone oxidoreductase 1(NQO1) was observed. This effect was also present when cells were treated with serum and hydrogen peroxide (H{sub 2}O{sub 2}) or serum and 4-hydroxynonenal (4HNE). Moreover, the treatment with ozonated serum was associated with a dose-dependent activation of extracellular-signal-regulated kinases (ERK1/2) and p38 MAP kinases (p38), not directly involved in NRF2 activation. These data, provide a new insight on the mechanism responsible for the induction of HO-1 expression by ozonated serum in the endothelium, and have a practical importance as an expedient approach to the treatment of patients with both effective orthodox drugs and ozonated autohemotherapy, targeted to the restoration of redox homeostasis. - Highlights: ► Endothelial HO1 is upregulated by ozonated plasma ► This activation is induced by NRF2 and it is ERK independent. ► 4HNE and H{sub 2}O{sub 2} are the main molecules involved in this process. ► Ozonated plasma induced a hormetic effect ► Combination of orthodox medicine and ozonated plasma can be a useful treatment.

  9. Inflammation, oxidative stress, and higher expression levels of Nrf2 and NQO1 proteins in the airways of women chronically exposed to biomass fuel smoke.

    Science.gov (United States)

    Mondal, Nandan Kumar; Saha, Hirak; Mukherjee, Bidisha; Tyagi, Neetu; Ray, Manas Ranjan

    2018-01-24

    The study was carried out to examine whether chronic exposure to smoke during daily household cooking with biomass fuel (BMF) elicits changes in airway cytology and expressions of Nrf2 (nuclear factor erythroid 2 [NF-E2]-related factor 2 [Nrf2]), Keap1 (Kelch-like erythroid-cell-derived protein with CNC homology [ECH]-associated protein 1), and NQO1 (NAD(P)H:quinone oxidoreductase 1) proteins in the airways. For this, 282 BMF-using women (median age 34 year) and 236 age-matched women who cooked with liquefied petroleum gas (LPG) were enrolled. Particulate matter with diameters of LPG. Compared with LPG users, BMF users had 32% more leukocytes in circulation and their sputa were 1.4-times more cellular with significant increase in absolute number of neutrophils, lymphocytes, eosinophils, and alveolar macrophages, suggesting airway inflammation. ROS generation was 1.5-times higher in blood neutrophils and 34% higher in sputum cells of BMF users while erythrocyte SOD was 31% lower and plasma catalase was relatively unchanged, suggesting oxidative stress. In BMF users, Keap1 expression was reduced, the percentage of AEC with nuclear expression of Nrf2 was two- to three-times more, and NQO1 level in sputum cell lysate was two-times higher than that of LPG users. In conclusion, cooking with BMF was associated with Nrf2 activation and elevated NQO1 protein level in the airways. The changes may be adaptive cellular response to counteract biomass smoke-elicited oxidative stress and inflammation-related tissue injury in the airways.

  10. Role of KEAP1/NRF2 and TP53 mutations in lung squamous cell carcinoma development and radiotherapy response prediction

    Science.gov (United States)

    Jeong, Youngtae; Hoang, Ngoc T.; Lovejoy, Alexander; Stehr, Henning; Newman, Aaron M.; Gentles, Andrew J.; Kong, William; Truong, Diana; Martin, Shanique; Chaudhuri, Aadel; Heiser, Diane; Zhou, Li; Say, Carmen; Carter, Justin N.; Hiniker, Susan M.; Loo, Billy W.; West, Robert B.; Beachy, Philip; Alizadeh, Ash A.; Diehn, Maximilian

    2016-01-01

    Lung squamous cell carcinomas (LSCC) pathogenesis remains incompletely understood and biomarkers predicting treatment response remain lacking. Here we describe novel murine LSCC models driven by loss of Trp53 and Keap1, both of which are frequently mutated in human LSCCs. Homozygous inactivation of Keap1 or Trp53 promoted airway basal stem cell (ABSC) self-renewal, suggesting that mutations in these genes lead to expansion of mutant stem cell clones. Deletion of Trp53 and Keap1 in ABSCs, but not more differentiated tracheal cells, produced tumors recapitulating histological and molecular features of human LSCCs, indicating that they represent the likely cell of origin in this model. Deletion of Keap1 promoted tumor aggressiveness, metastasis, and resistance to oxidative stress and radiotherapy (RT). KEAP1/NRF2 mutation status predicted risk of local recurrence after RT in non-small lung cancer (NSCLC) patients and could be non-invasively identified in circulating tumor DNA. Thus, KEAP1/NRF2 mutations could serve as predictive biomarkers for personalization of therapeutic strategies for NSCLCs. PMID:27663899

  11. Seaweed extracts and unsaturated fatty acid constituents from the green alga Ulva lactuca as activators of the cytoprotective Nrf2–ARE pathway

    Science.gov (United States)

    Wang, Rui; Paul, Valerie J.; Luesch, Hendrik

    2013-01-01

    Increased amounts of reactive oxygen species (ROS) have been implicated in many pathological conditions, including cancer. The major machinery that the cell employs to neutralize excess ROS is through the activation of the antioxidant-response element (ARE) that controls the activation of many phase II detoxification enzymes. The transcription factor that recognizes the ARE, Nrf2, can be activated by a variety of small molecules, most of which contain an α,β-unsaturated carbonyl system. In the pursuit of chemopreventive agents from marine organisms, we built, fractionated, and screened a library of 30 field-collected eukaryotic algae from Florida. An edible green alga, Ulva lactuca, yielded multiple active fractions by ARE–luciferase reporter assay. We isolated three monounsaturated fatty acid (MUFA) derivatives as active components, including a new keto-type C18 fatty acid (1), the corresponding shorter chain C16 acid (2), and an amide derivative (3) of the C18 acid. Their chemical structures were elucidated by NMR and mass spectrometry. All three contain the conjugated enone motif between C7 and C9, which is thought to be responsible for the ARE activity. Subsequent biological studies focused on 1, the most active and abundant ARE activator isolated. C18 acid 1 induced the expression of ARE-regulated cytoprotective genes, including NAD(P)H:quinone oxidoreductase 1, heme oxygenase 1, thioredoxin reductase 1, both subunits of the glutamate–cysteine ligase (catalytic subunit and modifier subunit), and the cystine/glutamate exchange transporter, in IMR-32 human neuroblastoma cells. Its cellular activity requires the presence of Nrf2 and PI3K function, based on RNA interference and pharmacological inhibitor studies, respectively. Treatment with 1 led only to Nrf2 activation, and not the increase in production of NRF2 mRNA. To test its ARE activity and cytoprotective potential in vivo, we treated mice with a single dose of a U. lactuca fraction that was enriched

  12. Clinical significance of Keap1 and Nrf2 in oral squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Cong-Fa Huang

    Full Text Available Oxidative stress has been reported to play an important role in progression and prognostication in various kinds of cancers. However, the role and clinical significance of oxidative stress markers Keap1 and Nrf2 in oral squamous cell carcinoma (OSCC has not been elucidated. This study aimed to investigate the correlation of oxidative stress markers Keap1 and Nrf2 expression and pathological features in OSCC by using tissue microarray. Tissue microarrays containing 17 normal oral mucosa, 7 oral epithelial dysplasia and 43 OSCC specimens were studied by immunohistochemistry. The association among these proteins and pathological features were analyzed. Expression of oxidative stress markers Keap1, Nrf2, and antioxidants PPIA, Prdx6, as well as CD147 was found to increase consecutively from normal oral mucosa to OSCC, and the Keap1, Nrf2, PPIA, Prdx6, CD147 expression in OSCC were significantly higher when compared to normal oral mucosa. Expression of Keap1, Nrf2 in tumors was not found to be significantly associated with T category, lymph node metastases, and pathological grade. Furthermore, we checked the relationship among these oxidative stress markers and found that Keap1 was significantly correlated with Nrf2, Prdx6 and CD147. Significant relationship between Nrf2 and Prdx6 was also detected. Finally, we found patients with overexpression of Keap1 and Nrf2 had not significantly worse overall survival by Kaplan-Meier analysis. These findings suggest that ROS markers are associated with carcinogenesis and progression of OSCC, which may have prognostic value and could be regarded as potential therapeutic targets in OSCC.

  13. Evaluation of the rotenone-induced activation of the Nrf2 pathway in a neuronal model derived from human induced pluripotent stem cells.

    Science.gov (United States)

    Zagoura, Dimitra; Canovas-Jorda, David; Pistollato, Francesca; Bremer-Hoffmann, Susanne; Bal-Price, Anna

    2017-06-01

    Human induced pluripotent stem cells (hiPSCs) are considered as a powerful tool for drug and chemical screening and development of new in vitro testing strategies in the field of toxicology, including neurotoxicity evaluation. These cells are able to expand and efficiently differentiate into different types of neuronal and glial cells as well as peripheral neurons. These human cells-based neuronal models serve as test systems for mechanistic studies on different pathways involved in neurotoxicity. One of the well-known mechanisms that are activated by chemically-induced oxidative stress is the Nrf2 signaling pathway. Therefore, in the current study, we evaluated whether Nrf2 signaling machinery is expressed in human induced pluripotent stem cells (hiPSCs)-derived mixed neuronal/glial culture and if so whether it becomes activated by rotenone-induced oxidative stress mediated by complex I inhibition of mitochondrial respiration. Rotenone was found to induce the activation of Nrf2 signaling particularly at the highest tested concentration (100 nM), as shown by Nrf2 nuclear translocation and the up-regulation of the Nrf2-downstream antioxidant enzymes, NQO1 and SRXN1. Interestingly, exposure to rotenone also increased the number of astroglial cells in which Nrf2 activation may play an important role in neuroprotection. Moreover, rotenone caused cell death of dopaminergic neurons since a decreased percentage of tyrosine hydroxylase (TH + ) cells was observed. The obtained results suggest that hiPSC-derived mixed neuronal/glial culture could be a valuable in vitro human model for the establishment of neuronal specific assays in order to link Nrf2 pathway activation (biomarker of oxidative stress) with additional neuronal specific readouts that could be applied to in vitro neurotoxicity evaluation. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Cardiac Aging - Benefits of Exercise, Nrf2 Activation and Antioxidant Signaling.

    Science.gov (United States)

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal-Soorappan

    2017-01-01

    various modes of exercise on Nrf2 signaling along with its responses and ramifications on the cascade of OS in the aging heart.

  15. Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

    International Nuclear Information System (INIS)

    Zhou, Yan; Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing; Zhong, Hua

    2016-01-01

    Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

  16. Nrf2 but not autophagy inhibition is associated with the survival of wild-type epidermal growth factor receptor non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Yan [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China); Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Li, Yuan; Ni, Hong-Min; Ding, Wen-Xing [Department of Pharmacology, Toxicology and Therapeutics, The University of Kansas Medical Center, Kansas City, KS 66160 (United States); Zhong, Hua, E-mail: eddiedong8@hotmail.com [Department of Pulmonary, Shanghai Chest Hospital, Shanghai Jiao Tong University, Shanghai 200030 (China)

    2016-11-01

    Non-small cell lung cancer (NSCLC) is one of the most common malignancies in the world. Icotinib and Gefitinib are two epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) that have been used to treat NSCLC. While it is well known that mutations of EGFR can affect the sensitivity of NSCLC to the EGFR-TKI, other mechanisms may also be adopted by lung cancer cells to develop resistance to EGFR-TKI treatment. Cancer cells can use multiple adaptive mechanisms such as activation of autophagy and Nrf2 to protect against various stresses and chemotherapeutic drugs. Whether autophagy or Nrf2 activation contributes to the resistance of NSCLC to EGFR-TKI treatment in wild-type EGFR NSCLC cells remains elusive. In the present study, we confirmed that Icotinib and Gefitinib induced apoptosis in EGFR mutant HCC827 but not in EGFR wild-type A549 NSCLC cells. Icotinib and Gefitinib did not induce autophagic flux or inhibit mTOR in A549 cells. Moreover, suppression of autophagy by chloroquine, a lysosomal inhibitor, did not affect Icotinib- or Gefitinib-induced cell death in A549 cells. In contrast, Brusatol, an Nrf2 inhibitor, significantly suppressed the cell survival of A549 cells. However, Brusatol did not further sensitize A549 cells to EGFR TKI-induced cell death. Results from this study suggest that inhibition of Nrf2 can decrease cell vitality of EGFR wild-type A549 cells independent of autophagy. - Highlights: • Cancer cells use adaptive mechanisms against chemotherapy. • Autophagy is not essential for the drug resistance of lung cancer A549 cells. • Inhibition of Nrf2 decreases cell survival of lung cancer A549 cells.

  17. Mitigation of radiation induced hematopoietic injury via regulation of Nrf-2 and increasing hematopoietic stem cells

    International Nuclear Information System (INIS)

    Patwardhan, R.S.; Sharma, Deepak; Checker, Rahul; Santosh Kumar, S.

    2014-01-01

    Therapeutic doses of ionizing radiation (IR) that can be delivered to tumors are restricted due to radiation induced damage to surrounding normal tissues thereby limiting the effectiveness of radiotherapy. Strategies to develop agents that selectively protect normal cells yielded limited success in the past. There is pressing need to develop safe, syndrome specific and effective radiation countermeasures to prevent or mitigate the harmful consequences of radiation exposure. Survival of bone marrow stem cells (HSCs) play a key role in protecting against IR induced hematopoietic injury. Many studies have shown manipulation of HSC frequency and/or survival as principal mechanism of radioprotection. It is known that, Nrf-2 plays crucial role in HSC survival and maintenance under oxidative stress conditions. In the present study, we have investigated the radioprotective ability of a flavonoid baicalein (5,6,7-trihydroxyflavone), extracted from the root of Scutellaria baicalensis Georgi, a medicinal plant traditionally used in Oriental medicine. There are numerous reports showing anti-inflammatory, anti-apoptotic, anti-oxidant, anti-cancer, anti-microbial, anti-mutagenic and neuroprotective properties of baicalein. Based on these reports, we have investigated the ability of baicalein to protect against radiation induced hematopoietic injury. Baicalein administration to mice protected against WBI induced mortality. Interestingly, the stem cell frequency increased in bone marrow cells obtained from baicalein administered mice as compared to vehicle treated mice. Baicalein treatment led to increased phospho-Nrf-2 levels in lineage negative BM-MNC. Administration of mice with Nrf-2 inhibitor prior to baicalein treatment led to significant abrogation of radioprotective ability of baicalein. This result suggests that, Nrf-2 may be playing a key role in baicalein mediated radioprotection. Here, we have shown that baicalein administration augments stem cell frequency, induces

  18. Sulforaphane Ameliorates Bladder Dysfunction through Activation of the Nrf2-ARE Pathway in a Rat Model of Partial Bladder Outlet Obstruction

    Directory of Open Access Journals (Sweden)

    Chong Liu

    2016-01-01

    Full Text Available Purpose. We evaluated the effect of sulforaphane (SFN treatment on the function and changes of expression of Nrf2-ARE pathway in the bladder of rats with bladder outlet obstruction (BOO. Materials and Methods. A total of 18 male Sprague-Dawley rats at age of 8 weeks were divided into 3 groups (6 of each: the sham operated group, the BOO group, and the BOO+SFN group. We examined histological alterations and the changes of oxidative stress markers and the protein expression of the Nrf2-ARE pathway. Results. We found that SFN treatment could prolong micturition interval and increase bladder capacity and bladder compliance. However, the peak voiding pressure was lower than BOO group. SFN treatment can ameliorate the increase of collagen fibers induced by obstruction. SFN treatment also increased the activity of SOD, GSH-Px, and CAT compared to the other groups. The level of bladder cell apoptosis was decreased in BOO rats with SFN treatment. Moreover, SFN could reduce the ratio of Bax/Bcl-2 expression. Furthermore, SFN could activate the Nrf2 expression with elevation of its target antioxidant proteins. Conclusions. The sulforaphane-mediated decrease of oxidative stress and activation of the Nrf2-ARE pathway may ameliorate bladder dysfunction caused by bladder outlet obstruction.

  19. Sulforaphane Ameliorates Bladder Dysfunction through Activation of the Nrf2-ARE Pathway in a Rat Model of Partial Bladder Outlet Obstruction

    Science.gov (United States)

    Liu, Chong; Xu, Huan; Fu, Shi; Chen, Yanbo; Chen, Qi; Cai, Zhikang; Zhou, Juan; Wang, Zhong

    2016-01-01

    Purpose. We evaluated the effect of sulforaphane (SFN) treatment on the function and changes of expression of Nrf2-ARE pathway in the bladder of rats with bladder outlet obstruction (BOO). Materials and Methods. A total of 18 male Sprague-Dawley rats at age of 8 weeks were divided into 3 groups (6 of each): the sham operated group, the BOO group, and the BOO+SFN group. We examined histological alterations and the changes of oxidative stress markers and the protein expression of the Nrf2-ARE pathway. Results. We found that SFN treatment could prolong micturition interval and increase bladder capacity and bladder compliance. However, the peak voiding pressure was lower than BOO group. SFN treatment can ameliorate the increase of collagen fibers induced by obstruction. SFN treatment also increased the activity of SOD, GSH-Px, and CAT compared to the other groups. The level of bladder cell apoptosis was decreased in BOO rats with SFN treatment. Moreover, SFN could reduce the ratio of Bax/Bcl-2 expression. Furthermore, SFN could activate the Nrf2 expression with elevation of its target antioxidant proteins. Conclusions. The sulforaphane-mediated decrease of oxidative stress and activation of the Nrf2-ARE pathway may ameliorate bladder dysfunction caused by bladder outlet obstruction. PMID:27433291

  20. Transcription factor Nrf1 is topologically repartitioned across membranes to enable target gene transactivation through its acidic glucose-responsive domains.

    Science.gov (United States)

    Zhang, Yiguo; Ren, Yonggang; Li, Shaojun; Hayes, John D

    2014-01-01

    The membrane-bound Nrf1 transcription factor regulates critical homeostatic and developmental genes. The conserved N-terminal homology box 1 (NHB1) sequence in Nrf1 targets the cap'n'collar (CNC) basic basic-region leucine zipper (bZIP) factor to the endoplasmic reticulum (ER), but it is unknown how its activity is controlled topologically within membranes. Herein, we report a hitherto unknown mechanism by which the transactivation activity of Nrf1 is controlled through its membrane-topology. Thus after Nrf1 is anchored within ER membranes, its acidic transactivation domains (TADs), including the Asn/Ser/Thr-rich (NST) glycodomain situated between acidic domain 1 (AD1) and AD2, are transiently translocated into the lumen of the ER, where NST is glycosylated in the presence of glucose to yield an inactive 120-kDa Nrf1 glycoprotein. Subsequently, portions of the TADs partially repartition across membranes into the cyto/nucleoplasmic compartments, whereupon an active 95-kDa form of Nrf1 accumulates, a process that is more obvious in glucose-deprived cells and may involve deglycosylation. The repartitioning of Nrf1 out of membranes is monitored within this protein by its acidic-hydrophobic amphipathic glucose-responsive domains, particularly the Neh5L subdomain within AD1. Therefore, the membrane-topological organization of Nrf1 dictates its post-translational modifications (i.e. glycosylation, the putative deglycosylation and selective proteolysis), which together control its ability to transactivate target genes.

  1. Long term effect of curcumin in restoration of tumour suppressor p53 and phase-II antioxidant enzymes via activation of Nrf2 signalling and modulation of inflammation in prevention of cancer.

    Directory of Open Access Journals (Sweden)

    Laxmidhar Das

    Full Text Available Inhibition of carcinogenesis may be a consequence of attenuation of oxidative stress via activation of antioxidant defence system, restoration and stabilization of tumour suppressor proteins along with modulation of inflammatory mediators. Previously we have delineated significant role of curcumin during its long term effect in regulation of glycolytic pathway and angiogenesis, which in turn results in prevention of cancer via modulation of stress activated genes. Present study was designed to investigate long term effect of curcumin in regulation of Nrf2 mediated phase-II antioxidant enzymes, tumour suppressor p53 and inflammation under oxidative tumour microenvironment in liver of T-cell lymphoma bearing mice. Inhibition of Nrf2 signalling observed during lymphoma progression, resulted in down regulation of phase II antioxidant enzymes, p53 as well as activation of inflammatory signals. Curcumin potentiated significant increase in Nrf2 activation. It restored activity of phase-II antioxidant enzymes like GST, GR, NQO1, and tumour suppressor p53 level. In addition, curcumin modulated inflammation via upregulation of TGF-β and reciprocal regulation of iNOS and COX2. The study suggests that during long term effect, curcumin leads to prevention of cancer by inducing phase-II antioxidant enzymes via activation of Nrf2 signalling, restoration of tumour suppressor p53 and modulation of inflammatory mediators like iNOS and COX2 in liver of lymphoma bearing mice.

  2. Serum oxidative stress-induced repression of Nrf2 and GSH depletion: a mechanism potentially involved in endothelial dysfunction of young smokers.

    Directory of Open Access Journals (Sweden)

    Anna Fratta Pasini

    Full Text Available Although oxidative stress plays a major role in endothelial dysfunction (ED, the role of glutathione (GSH, of nuclear erythroid-related factor 2 (Nrf2 and of related antioxidant genes (ARE are yet unknown. In this study we combined an in vivo with an in vitro model to assess whether cigarette smoking affects flow-mediated vasodilation (FMD, GSH concentrations and the Nrf2/ARE pathway in human umbilical vein endothelial cells (HUVECs.52 healthy subjects (26 non-smokers and 26 heavy smokers were enrolled in this study. In smokers we demonstrated increased oxidative stress, i.e., reduced concentrations of GSH and increased concentrations of oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC in serum and in peripheral blood mononuclear cells (PBMC, used as in vivo surrogates of endothelial cells. Moreover we showed impairment of FMD in smokers and a positive correlation with the concentration of GSH in PBMC of all subjects. In HUVECs exposed to smokers' serum but not to non-smokers' serum we found that oxidative stress increased, whereas nitric oxide and GSH concentrations decreased; interestingly the expression of Nrf2, of heme oxygenase-1 (HO-1 and of glutamate-cysteine ligase catalytic (GCLC subunit, the rate-limiting step of synthesis of GSH, was decreased. To test the hypothesis that the increased oxidative stress in smokers may have a causal role in the repression of Nrf2/ARE pathway, we exposed HUVECs to increasing concentrations of oxPAPC and found that at the highest concentration (similar to that found in smokers' serum the expression of Nrf2/ARE pathway was reduced. The knockdown of Nrf2 was associated to a significant reduction of HO-1 and GCLC expression induced by oxPAPC in ECs.In young smokers with ED a novel further consequence of increased oxidative stress is a repression of Nrf2/ARE pathway leading to GSH depletion.

  3. Serum Oxidative Stress-Induced Repression of Nrf2 and GSH Depletion: A Mechanism Potentially Involved in Endothelial Dysfunction of Young Smokers

    Science.gov (United States)

    Fratta Pasini, Anna; Albiero, Anna; Stranieri, Chiara; Cominacini, Mattia; Pasini, Andrea; Mozzini, Chiara; Vallerio, Paola; Cominacini, Luciano; Garbin, Ulisse

    2012-01-01

    Background Although oxidative stress plays a major role in endothelial dysfunction (ED), the role of glutathione (GSH), of nuclear erythroid-related factor 2 (Nrf2) and of related antioxidant genes (ARE) are yet unknown. In this study we combined an in vivo with an in vitro model to assess whether cigarette smoking affects flow-mediated vasodilation (FMD), GSH concentrations and the Nrf2/ARE pathway in human umbilical vein endothelial cells (HUVECs). Methods and Results 52 healthy subjects (26 non-smokers and 26 heavy smokers) were enrolled in this study. In smokers we demonstrated increased oxidative stress, i.e., reduced concentrations of GSH and increased concentrations of oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC) in serum and in peripheral blood mononuclear cells (PBMC), used as in vivo surrogates of endothelial cells. Moreover we showed impairment of FMD in smokers and a positive correlation with the concentration of GSH in PBMC of all subjects. In HUVECs exposed to smokers' serum but not to non-smokers' serum we found that oxidative stress increased, whereas nitric oxide and GSH concentrations decreased; interestingly the expression of Nrf2, of heme oxygenase-1 (HO-1) and of glutamate-cysteine ligase catalytic (GCLC) subunit, the rate-limiting step of synthesis of GSH, was decreased. To test the hypothesis that the increased oxidative stress in smokers may have a causal role in the repression of Nrf2/ARE pathway, we exposed HUVECs to increasing concentrations of oxPAPC and found that at the highest concentration (similar to that found in smokers' serum) the expression of Nrf2/ARE pathway was reduced. The knockdown of Nrf2 was associated to a significant reduction of HO-1 and GCLC expression induced by oxPAPC in ECs. Conclusions In young smokers with ED a novel further consequence of increased oxidative stress is a repression of Nrf2/ARE pathway leading to GSH depletion. PMID:22272327

  4. Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis.

    Directory of Open Access Journals (Sweden)

    Ning Chen

    Full Text Available To explore the expression level of Nrf2 in adenomyosis and study the mechanism of abnormal expression of Nrf2 in the pathogenesis of adenomyosis.Western blot, immunohistochemistry(IHC and real time PCR were used to measure Nrf2 expression levels in tissue and cell samples. Knockdown and overexpression of Nrf2 were used to investigate the variation of migration ability of endometrial glandular cells as well as the regulatory mechanism.Nrf2 protein levels were significantly higher in the eutopic and ectopic endometrial glands when compared with control cases using IHC and western blot methods. (p< 0.05. However, there was no statistical difference in Nrf2 mRNA expression levels between the adenomyosis and control groups. Using an agonist and Nrf2 siRNA, we regulated the Nrf2 protein levels of primary cultured endometrial glandular cells. With increased expression of Nrf2, cell scratch assay showed that the agonist-treated group migrated significantly faster than the control group, with MMP9 protein level markedly elevated. In contrast, Nrf2 siRNA-treated group migrated slower than the control group, with decreased expression of MMP9 protein. All of the scratching healing spaces and protein levels between the treated and control groups were statistically significant (p< 0.05.Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. Specified reduction of Nrf2 expression could prove to be a new therapeutic target in the clinical treatment of adenomyosis.

  5. A newly synthesized macakurzin C-derivative attenuates acute and chronic skin inflammation: The Nrf2/heme oxygenase signaling as a potential target

    Energy Technology Data Exchange (ETDEWEB)

    Akram, Muhammad [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of); Shin, Iljin [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Kim, Kyeong-A; Noh, Dabi [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of); Baek, Seung-Hoon; Chang, Sun-Young [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Kim, Hyoungsu, E-mail: hkimajou@ajou.ac.kr [College of Pharmacy and Research Institute of Pharmaceutical Science and Technology (RIPST), Ajou University, Suwon (Korea, Republic of); Bae, Ok-Nam, E-mail: onbae@hanyang.ac.kr [College of Pharmacy Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan (Korea, Republic of)

    2016-09-15

    Impaired immune responses in skin play a pivotal role in the development and progression of chemical-associated inflammatory skin disorders. In this study, we synthesized new flavonoid derivatives from macakurzin C, and identified in vitro and in vivo efficacy of a potent anti-inflammatory flavonoid, Compound 14 (CPD 14), with its underlying mechanisms. In lipopolysaccharide (LPS)-stimulated murine macrophages and IFN-γ/TNF-α-stimulated human keratinocytes, CPD 14 significantly inhibited the release of inflammatory mediators including nitric oxide (NO), prostaglandins, and cytokines (IC{sub 50} for NO inhibition in macrophages: 4.61 μM). Attenuated NF-κB signaling and activated Nrf2/HO-1 pathway were responsible for the anti-inflammatory effects of CPD 14. The in vivo relevance was examined in phorbol 12-myristate 13-acetate (TPA)-induced acute skin inflammation and oxazolone-induced atopic dermatitis models. Topically applied CPD 14 significantly protected both irritation- and sensitization-associated skin inflammation by suppressing the expression of inflammatory mediators. In summary, we demonstrated that a newly synthesized flavonoid, CPD 14, has potent inhibitory effects on skin inflammation, suggesting it is a potential therapeutic candidate to treat skin disorders associated with excessive inflammation. - Highlights: • An anti-inflammatory flavonoid CPD 14 was newly synthesized from macakurzin C. • CPD 14 potently inhibited inflammatory reaction in keratinocytes and macrophages. • Dermal toxicity by irritation or sensitization in rats was protected by CPD 14. • Attenuated NF-κB and activated Nrf2/HO-1 were main mechanisms of CPD 14 action.

  6. Induction of Nrf2-mediated cellular defenses and alteration of phase I activities as mechanisms of chemoprotective effects of coffee in the liver.

    Science.gov (United States)

    Cavin, C; Marin-Kuan, M; Langouët, S; Bezençon, C; Guignard, G; Verguet, C; Piguet, D; Holzhäuser, D; Cornaz, R; Schilter, B

    2008-04-01

    Coffee consumption has been associated with a significant decrease in the risk of developing chronic diseases such as Parkinson disease, diabetes type-2 and several types of cancers (e.g. colon, liver). In the present study, a coffee-dependent induction of enzymes involved in xenobiotic detoxification processes was observed in rat liver and primary hepatocytes. In addition, coffee was found to induce the mRNA and protein expression of enzymes involved in cellular antioxidant defenses. These inductions were correlated with the activation of the Nrf2 transcription factor as shown using an ARE-reporter luciferase assay. The induction of detoxifying enzymes GSTs and AKR is compatible with a protection against both genotoxicity and cytotoxicity of aflatoxin B1 (AFB1). This hypothesis was confirmed in in vitro and ex vivo test systems, where coffee reduced both AFB1-DNA and protein adducts. Interestingly, coffee was also found to inhibit cytochrome CYP1A1/2, indicating that other mechanisms different from a stimulation of detoxification may also play a significant role in the chemoprotective effects of coffee. Further investigations in either human liver cell line and primary hepatocytes indicated that the chemoprotective effects of coffee against AFB1 genotoxicity are likely to be of relevance for humans. These data strongly suggest that coffee may protect against the adverse effects of AFB1. In addition, the coffee-mediated stimulation of the Nrf2-ARE pathway resulting in increased endogenous defense mechanisms against electrophilic but also oxidative insults further support that coffee may be associated with a protection against various types of chemical stresses.

  7. Nrf2 represses FGF21 during long-term high-fat diet-induced obesity in mice.

    Science.gov (United States)

    Chartoumpekis, Dionysios V; Ziros, Panos G; Psyrogiannis, Agathoklis I; Papavassiliou, Athanasios G; Kyriazopoulou, Venetsana E; Sykiotis, Gerasimos P; Habeos, Ioannis G

    2011-10-01

    Obesity is characterized by chronic oxidative stress. Fibroblast growth factor 21 (FGF21) has recently been identified as a novel hormone that regulates metabolism. NFE2-related factor 2 (Nrf2) is a transcription factor that orchestrates the expression of a battery of antioxidant and detoxification genes under both basal and stress conditions. The current study investigated the role of Nrf2 in a mouse model of long-term high-fat diet (HFD)-induced obesity and characterized its crosstalk to FGF21 in this process. Wild-type (WT) and Nrf2 knockout (Nrf2-KO) mice were fed an HFD for 180 days. During this period, food consumption and body weights were measured. Glucose metabolism was assessed by an intraperitoneal glucose tolerance test and intraperitoneal insulin tolerance test. Total RNA was prepared from liver and adipose tissue and was used for quantitative real-time RT-PCR. Fasting plasma was collected and analyzed for blood chemistries. The ST-2 cell line was used for transfection studies. Nrf2-KO mice were partially protected from HFD-induced obesity and developed a less insulin-resistant phenotype. Importantly, Nrf2-KO mice had higher plasma FGF21 levels and higher FGF21 mRNA levels in liver and white adipose tissue than WT mice. Thus, the altered metabolic phenotype of Nrf2-KO mice under HFD was associated with higher expression and abundance of FGF21. Consistently, the overexpression of Nrf2 in ST-2 cells resulted in decreased FGF21 mRNA levels as well as in suppressed activity of a FGF21 promoter luciferase reporter. The identification of Nrf2 as a novel regulator of FGF21 expands our understanding of the crosstalk between metabolism and stress defense.

  8. 4-Hydroxy hexenal derived from docosahexaenoic acid protects endothelial cells via Nrf2 activation.

    Directory of Open Access Journals (Sweden)

    Atsushi Ishikado

    Full Text Available Recent studies have proposed that n-3 polyunsaturated fatty acids (n-3 PUFAs have direct antioxidant and anti-inflammatory effects in vascular tissue, explaining their cardioprotective effects. However, the molecular mechanisms are not yet fully understood. We tested whether n-3 PUFAs showed antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (Nrf2, a master transcriptional factor for antioxidant genes. C57BL/6 or Nrf2(-/- mice were fed a fish-oil diet for 3 weeks. Fish-oil diet significantly increased the expression of heme oxygenase-1 (HO-1, and endothelium-dependent vasodilation in the aorta of C57BL/6 mice, but not in the Nrf2(-/- mice. Furthermore, we observed that 4-hydroxy hexenal (4-HHE, an end-product of n-3 PUFA peroxidation, was significantly increased in the aorta of C57BL/6 mice, accompanied by intra-aortic predominant increase in docosahexaenoic acid (DHA rather than that in eicosapentaenoic acid (EPA. Human umbilical vein endothelial cells were incubated with DHA or EPA. We found that DHA, but not EPA, markedly increased intracellular 4-HHE, and nuclear expression and DNA binding of Nrf2. Both DHA and 4-HHE also increased the expressions of Nrf2 target genes including HO-1, and the siRNA of Nrf2 abolished these effects. Furthermore, DHA prevented oxidant-induced cellular damage or reactive oxygen species production, and these effects were disappeared by an HO-1 inhibitor or the siRNA of Nrf2. Thus, we found protective effects of DHA through Nrf2 activation in vascular tissue, accompanied by intra-vascular increases in 4-HHE, which may explain the mechanism of the cardioprotective effects of DHA.

  9. An overview of the molecular mechanisms and novel roles of Nrf2 in neurodegenerative disorders.

    Science.gov (United States)

    Yang, Yang; Jiang, Shuai; Yan, Juanjuan; Li, Yue; Xin, Zhenlong; Lin, Yan; Qu, Yan

    2015-02-01

    Recently, growing evidence has demonstrated that nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal regulator of endogenous defense systems that function via the activation of a set of protective genes, and this is particularly clear in the central nervous system (CNS). Therefore, it is highly useful to summarize the current literature on the molecular mechanisms and role of Nrf2 in the CNS. In this review, we first briefly introduce the molecular features of Nrf2. We then discuss the regulation, cerebral actions, upstream modulators and downstream targets of Nrf2 pathway. Following this background, we expand our discussion to the role of Nrf2 in several major neurodegenerative disorders (NDDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis and amyotrophic lateral sclerosis. Lastly, we discuss some potential future directions. The information reviewed here may be significant in the design of further experimental research and increase the potential of Nrf2 as a therapeutic target in the future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway.

    Directory of Open Access Journals (Sweden)

    Jingxian Wu

    Full Text Available Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(PH: quinone oxidoreductase1 (NQO1 induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2 to antioxidant response element (ARE were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage.

  11. Neuroprotection by Curcumin in Ischemic Brain Injury Involves the Akt/Nrf2 Pathway

    Science.gov (United States)

    Wu, Jingxian; Li, Qiong; Wang, Xiaoyan; Yu, Shanshan; Li, Lan; Wu, Xuemei; Chen, Yanlin; Zhao, Jing; Zhao, Yong

    2013-01-01

    Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R) was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(P)H: quinone oxidoreductase1 (NQO1) induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2) to antioxidant response element (ARE) were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO) rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage. PMID:23555802

  12. Nrf2 deficiency potentiates methamphetamine-induced dopaminergic axonal damage and gliosis in the striatum.

    Science.gov (United States)

    Granado, Noelia; Lastres-Becker, Isabel; Ares-Santos, Sara; Oliva, Idaira; Martin, Eduardo; Cuadrado, Antonio; Moratalla, Rosario

    2011-12-01

    Oxidative stress that correlates with damage to nigrostriatal dopaminergic neurons and reactive gliosis in the basal ganglia is a hallmark of methamphetamine (METH) toxicity. In this study, we analyzed the protective role of the transcription factor Nrf2 (nuclear factor-erythroid 2-related factor 2), a master regulator of redox homeostasis, in METH-induced neurotoxicity. We found that Nrf2 deficiency exacerbated METH-induced damage to dopamine neurons, shown by an increase in loss of tyrosine hydroxylase (TH)- and dopamine transporter (DAT)-containing fibers in striatum. Consistent with these effects, Nrf2 deficiency potentiated glial activation, indicated by increased striatal expression of markers for microglia (Mac-1 and Iba-1) and astroglia (GFAP) one day after METH administration. At the same time, Nrf2 inactivation dramatically potentiated the increase in TNFα mRNA and IL-15 protein expression in GFAP+ cells in the striatum. In sharp contrast to the potentiation of striatal damage, Nrf2 deficiency did not affect METH-induced dopaminergic neuron death or expression of glial markers or proinflammatory molecules in the substantia nigra. This study uncovers a new role for Nrf2 in protection against METH-induced inflammatory and oxidative stress and striatal degeneration. Copyright © 2011 Wiley‐Liss, Inc.

  13. O papel do fator nuclear eritróide 2 relacionado ao fator 2 (Nrf2 no diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Gabriela Fernandes Hahn

    2017-09-01

    Full Text Available O diabetes mellitus (DM é uma doença metabólica complexa. Sua etiologia é atribuída a uma combinação entre fatores genéticos, ambientais e de estilo de vida. Contudo, sabe-se que o estresse oxidativo desempenha papel crucial na patogênese do DM, acarretando em disfunção das células β pancreáticas e resistência à insulina. Neste contexto, o fator nuclear eritroide 2 relacionado ao fator 2 (Nrf2 é considerado o regulador mestre da resposta antioxidante do organismo, sendo um mecanismo de importância crítica para a manutenção da homeostase e sobrevivência celular. Todavia, a função do Nrf2 não se limita somente à resposta antioxidante. Ao interagir com outras vias metabólicas, o Nrf2 possui importante papel na regulação do metabolismo, atuando no metabolismo dos lipídios, manutenção da glicemia, resposta inflamatória, entre outros. Entretanto, a exata relação do Nrf2 com outras vias metabólicas ainda não é totalmente conhecida. Contudo, sabe-se que o comprometimento da função do Nrf2 é evidente na fisiopatologia do DM bem como no desenvolvimento de suas complicações clínicas. A ativação do Nrf2 protege contra os danos mediados pelo DM, podendo ser adequada uma intervenção exógena para aumentar a sua atividade. Palavras-chave: Complicações do diabetes; estresse oxidativo; antioxidantes; inflamação; obesidade

  14. Nrf2-peroxiredoxin I axis in polymorphous adenocarcinoma is associated with low matrix metalloproteinase 2 level.

    Science.gov (United States)

    Brod, J M; Demasi, Ana Paula Dias; Montalli, V A; Teixeira, L N; Furuse, C; Aguiar, M C; Soares, A B; Sperandio, M; Araujo, V C

    2017-12-01

    Polymorphous adenocarcinoma (PAC) is a malignant epithelial neoplasm that affects almost exclusively the minor salivary glands, generally described as having a relatively good prognosis. Aberrant nuclear factor erythroid 2 (NF-E2)-related factor (Nrf2) activation in tumor cells has been associated with induction of antioxidant enzymes, such as peroxiredoxin I (Prx I) and increased matrix metalloproteinase (MMP) expression. In this context, the aim of the present study was to evaluate the expression of Nrf2 and correlate it with Prx I and MMP-2 secretion in PAC. Thirty-one cases of PAC from oral biopsies were selected and immunohistochemically analyzed for Nrf2 and Prx I. MMP-2 quantification was performed on primary cell cultures derived from PAC. Oral squamous cell carcinoma (OSCC) cell cultures were used as control. A high immunoexpression of Nrf2 was observed in both the cytoplasm and the nucleus of neoplastic cells from PAC. Nuclear staining for Nrf2 suggested its activation in the majority of the PAC cells, which was confirmed by the high expression of its target gene, Prx I. Quantification of MMP-2 secretion showed lower levels in PAC cell cultures when compared to OSCC cell cultures (p high-grade malignancies, such relationship is not infallible and, in fact, the opposite may occur in low-grade tumors, such as PAC of minor salivary glands.

  15. NFE2-Related Transcription Factor 2 Coordinates Antioxidant Defense with Thyroglobulin Production and Iodination in the Thyroid Gland.

    Science.gov (United States)

    Ziros, Panos G; Habeos, Ioannis G; Chartoumpekis, Dionysios V; Ntalampyra, Eleni; Somm, Emmanuel; Renaud, Cédric O; Bongiovanni, Massimo; Trougakos, Ioannis P; Yamamoto, Masayuki; Kensler, Thomas W; Santisteban, Pilar; Carrasco, Nancy; Ris-Stalpers, Carrie; Amendola, Elena; Liao, Xiao-Hui; Rossich, Luciano; Thomasz, Lisa; Juvenal, Guillermo J; Refetoff, Samuel; Sykiotis, Gerasimos P

    2018-06-01

    The thyroid gland has a special relationship with oxidative stress. While generation of oxidative substances is part of normal iodide metabolism during thyroid hormone synthesis, the gland must also defend itself against excessive oxidation in order to maintain normal function. Antioxidant and detoxification enzymes aid thyroid cells to maintain homeostasis by ameliorating oxidative insults, including during exposure to excess iodide, but the factors that coordinate their expression with the cellular redox status are not known. The antioxidant response system comprising the ubiquitously expressed NFE2-related transcription factor 2 (Nrf2) and its redox-sensitive cytoplasmic inhibitor Kelch-like ECH-associated protein 1 (Keap1) defends tissues against oxidative stress, thereby protecting against pathologies that relate to DNA, protein, and/or lipid oxidative damage. Thus, it was hypothesized that Nrf2 should also have important roles in maintaining thyroid homeostasis. Ubiquitous and thyroid-specific male C57BL6J Nrf2 knockout (Nrf2-KO) mice were studied. Plasma and thyroids were harvested for evaluation of thyroid function tests by radioimmunoassays and of gene and protein expression by real-time polymerase chain reaction and immunoblotting, respectively. Nrf2-KO and Keap1-KO clones of the PCCL3 rat thyroid follicular cell line were generated using CRISPR/Cas9 technology and were used for gene and protein expression studies. Software-predicted Nrf2 binding sites on the thyroglobulin enhancer were validated by site-directed in vitro mutagenesis and chromatin immunoprecipitation. The study shows that Nrf2 mediates antioxidant transcriptional responses in thyroid cells and protects the thyroid from oxidation induced by iodide overload. Surprisingly, it was also found that Nrf2 has a dramatic impact on both the basal abundance and the thyrotropin-inducible intrathyroidal abundance of thyroglobulin (Tg), the precursor protein of thyroid hormones. This effect is mediated

  16. Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis.

    Science.gov (United States)

    Chen, Ning; Du, Baoying; Zhou, Hao; Shen, Fengxian; Li, Juan; Xie, Zhenwei

    2017-01-01

    To explore the expression level of Nrf2 in adenomyosis and study the mechanism of abnormal expression of Nrf2 in the pathogenesis of adenomyosis. Western blot, immunohistochemistry(IHC) and real time PCR were used to measure Nrf2 expression levels in tissue and cell samples. Knockdown and overexpression of Nrf2 were used to investigate the variation of migration ability of endometrial glandular cells as well as the regulatory mechanism. Nrf2 protein levels were significantly higher in the eutopic and ectopic endometrial glands when compared with control cases using IHC and western blot methods. (pendometrial glandular cells. With increased expression of Nrf2, cell scratch assay showed that the agonist-treated group migrated significantly faster than the control group, with MMP9 protein level markedly elevated. In contrast, Nrf2 siRNA-treated group migrated slower than the control group, with decreased expression of MMP9 protein. All of the scratching healing spaces and protein levels between the treated and control groups were statistically significant (p< 0.05). Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. Specified reduction of Nrf2 expression could prove to be a new therapeutic target in the clinical treatment of adenomyosis.

  17. Activation of the Nrf2/HO-1 Antioxidant Pathway Contributes to the Protective Effects of Lycium Barbarum Polysaccharides in the Rodent Retina after Ischemia-Reperfusion-Induced Damage

    Science.gov (United States)

    Chang, Raymond Chuen-Chung; So, Kwok-Fai; Brecha, Nicholas C.; Pu, Mingliang

    2014-01-01

    Lycium barbarum polysaccharides (LBP), extracts from the wolfberries, are protective to retina after ischemia-reperfusion (I/R). The antioxidant response element (ARE)–mediated antioxidant pathway plays an important role in maintaining the redox status of the retina. Heme oxygenase-1 (HO-1), combined with potent AREs in its promoter, is a highly effective therapeutic target for the protection against neurodegenerative diseases, including I/R-induced retinal damage. The aim of our present study was to investigate whether the protective effect of LBP after I/R damage was mediated via activation of the Nrf2/HO-1-antioxidant pathway in the retina. Retinal I/R was induced by an increase in intraocular pressure to 130 mm Hg for 60 minutes. Prior to the induction of ischemia, rats were orally treated with either vehicle (PBS) or LBP (1 mg/kg) once a day for 1 week. For specific experiments, zinc protoporphyrin (ZnPP, 20 mg/kg), an HO-1 inhibitor, was intraperitoneally administered at 24 h prior to ischemia. The protective effects of LBP were evaluated by quantifying ganglion cell and amacrine cell survival, and by measuring cell apoptosis in the retinal layers. In addition, HO-1 expression was examined using Western blotting and immunofluorescence analyses. Cytosolic and nuclear Nrf2 was measured using immunofluorescent staining. LBP treatment significantly increased Nrf2 nuclear accumulation and HO-1 expression in the retina after I/R injury. Increased apoptosis and a decrease in the number of viable cells were observed in the ganglion cell layer (GCL) and inner nuclear layer (INL) in the I/R retina, which were reversed by LBP treatment. The HO-1 inhibitor, ZnPP, diminished the LBP treatment-induced protective effects in the retina after I/R. Taken together, these results suggested that LBP partially exerted its beneficial neuroprotective effects via the activation of Nrf2 and an increase in HO-1 protein expression. PMID:24400114

  18. Apigenin inhibits d-galactosamine/LPS-induced liver injury through upregulation of hepatic Nrf-2 and PPARγ expressions in mice.

    Science.gov (United States)

    Zhou, Rui-Jun; Ye, Hua; Wang, Feng; Wang, Jun-Long; Xie, Mei-Lin

    2017-11-04

    Apigenin is a natural flavonoid compound widely distributed in a variety of vegetables, medicinal plants and health foods. This study aimed to examine the protective effect of apigenin against d-galactosamine (D-GalN)/lipopolysaccharide (LPS)-induced mouse liver injury and to investigate the potential biochemical mechanisms. The results showed that after oral administration of apigenin 100-200 mg/kg for 7 days, the levels of serum alanine aminotransferase and aspartate aminotransferase were decreased, and the severity of liver injury was alleviated. Importantly, apigenin pretreatment increased the levels of hepatic nuclear factor erythroid 2-related factor 2 (Nrf-2) and peroxisome proliferator-activated receptor γ (PPARγ) protein expressions as well as superoxide dismutase, catalase, glutathione S-transferase and glutathione reductase activities, decreased the levels of hepatic nuclear factor-κB (NF-κB) protein expression and tumor necrosis factor-α. These findings demonstrated that apigenin could prevent the D-GalN/LPS-induced liver injury in mice, and its mechanisms might be associated with the increments of Nrf-2-mediated antioxidative enzymes and modulation of PPARγ/NF-κB-mediated inflammation. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9

    Directory of Open Access Journals (Sweden)

    So-Jung Kim

    2017-03-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.

  20. Contribution of radiation-induced, nitric oxide-mediated bystander effect to radiation-induced adaptive response.

    Science.gov (United States)

    Matsumoto, H.; Ohnishi, T.

    There has been a recent upsurge of interest in radiation-induced adaptive response and bystander effect which are specific modes in stress response to low-dose low-dose rate radiation Recently we found that the accumulation of inducible nitric oxide NO synthase iNOS in wt p53 cells was induced by chronic irradiation with gamma rays followed by acute irradiation with X-rays but not by each one resulting in an increase in nitrite concentrations of medium It is suggested that the accumulation of iNOS may be due to the depression of acute irradiation-induced p53 functions by pre-chronic irradiation In addition we found that the radiosensitivity of wt p53 cells against acute irradiation with X-rays was reduced after chronic irradiation with gamma rays This reduction of radiosensitivity of wt p53 cells was nearly completely suppressed by the addition of NO scavenger carboxy-PTIO to the medium This reduction of radiosensitivity of wt p53 cells is just radiation-induced adaptive response suggesting that NO-mediated bystander effect may considerably contribute to adaptive response induced by radiation

  1. Nrf2 signaling contributes to the neuroprotective effects of urate against 6-OHDA toxicity.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available BACKGROUND: Mounting evidence shows that urate may become a biomarker of Parkinson's disease (PD diagnosis and prognosis and a neuroprotectant candidate for PD therapy. However, the cellular and molecular mechanisms underlying its neuroprotective actions remain poorly understood. RESULTS: In this study, we showed that urate pretreatment protected dopaminergic cell line (SH-SY5Y and MES23.5 against 6-hydroxydopamine (6-OHDA- and hydrogen peroxide- induced cell damage. Urate was found to be accumulated into SH-SY5Y cells after 30 min treatment. Moreover, urate induced NF-E2-related factor 2 (Nrf2 accumulation by inhibiting its ubiquitinationa and degradation, and also promoted its nuclear translocation; however, it did not modulate Nrf2 mRNA level or Kelch-like ECH-associated protein 1 (Keap1 expression. In addition, urate markedly up-regulated the transcription and protein expression of γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC and heme oxygenase-1 (HO-1, both of which are controlled by Nrf2 activity. Furthermore, Nrf2 knockdown by siRNA abolished the intracellular glutathione augmentation and the protection exerted by urate pretreatment. CONCLUSION: Our findings demonstrated that urate treatment may result in Nrf2-targeted anti-oxidant genes transcription and expression by reducing Nrf2 ubiquitination and degradation and promoting its nuclear translocation, and thus offer neuroprotection on dopaminergic cells against oxidative stresses.

  2. The Amelioration of N-Acetyl-p-Benzoquinone Imine Toxicity by Ginsenoside Rg3: The Role of Nrf2-Mediated Detoxification and Mrp1/Mrp3 Transports

    Directory of Open Access Journals (Sweden)

    Sang Il Gum

    2013-01-01

    Full Text Available Previously, we found that Korean red ginseng suppressed acetaminophen (APAP-induced hepatotoxicity via alteration of its metabolic profile involving GSTA2 induction and that ginsenoside Rg3 was a major component of this gene induction. In the present study, therefore, we assessed the protective effect of Rg3 against N-acetyl-p-benzoquinone imine (NAPQI, a toxic metabolic intermediate of APAP. Excess NAPQI resulted in GSH depletion with increases in the ALT and AST activities in H4IIE cells. Rg3 pretreatment reversed GSH depletion by NAPQI. Rg3 resulted in increased mRNA levels of the catalytic and modulatory subunit of glutamate cysteine ligase (GCL, the rate-limiting steps in GSH synthesis and subsequently increased GSH content. Rg3 increased levels of nuclear Nrf2, an essential transcriptional factor of these genes. The knockdown or knockout of the Nrf2 gene abrogated the inductions of mRNA and protein by Rg3. Abolishment of the reversal of GSH depletion by Rg3 against NAPQI was observed in Nrf2-deficient cells. Rg3 induced multidrug resistance-associated protein (Mrp 1 and Mrp3 mRNA levels, but not in Nrf2-deficient cells. Taken together, these results demonstrate that Rg3 is efficacious in protecting hepatocytes against NAPQI insult, due to GSH repletion and coordinated gene regulations of GSH synthesis and Mrp family genes by Nrf2.

  3. Nitro-oleic acid ameliorates oxygen and glucose deprivation/re-oxygenation triggered oxidative stress in renal tubular cells via activation of Nrf2 and suppression of NADPH oxidase.

    Science.gov (United States)

    Nie, Huibin; Xue, Xia; Liu, Gang; Guan, Guangju; Liu, Haiying; Sun, Lina; Zhao, Long; Wang, Xueling; Chen, Zhixin

    2016-01-01

    Nitroalkene derivative of oleic acid (OA-NO 2 ), due to its ability to mediate revisable Michael addition, has been demonstrated to have various biological properties and become a therapeutic agent in various diseases. Though its antioxidant properties have been reported in different models of acute kidney injury (AKI), the mechanism by which OA-NO 2 attenuates intracellular oxidative stress is not well investigated. Here, we elucidated the anti-oxidative mechanism of OA-NO 2 in an in vitro model of renal ischemia/reperfusion (I/R) injury. Human tubular epithelial cells were subjected to oxygen and glucose deprivation/re-oxygenation (OGD/R) injury. Pretreatment with OA-NO 2 (1.25 μM, 45 min) attenuated OGD/R triggered reactive oxygen species (ROS) generation and subsequent mitochondrial membrane potential disruption. This action was mediated via up-regulating endogenous antioxidant defense components including superoxide dismutase (SOD1), heme oxygenase 1 (HO-1), and γ-glutamyl cysteine ligase modulatory subunits (GCLM). Moreover, subcellular fractionation analyses demonstrated that OA-NO 2 promoted nuclear translocation of nuclear factor-E2- related factor-2 (Nrf2) and Nrf2 siRNA partially abrogated these protective effects. In addition, OA-NO 2 inhibited NADPH oxidase activation and NADPH oxidase 4 (NOX4), NADPH oxidase 2 (NOX2) and p22 phox up-regulation after OGD/R injury, which was not relevant to Nrf2. These results contribute to clarify that the mechanism of OA-NO 2 reno-protection involves both inhibition of NADPH oxidase activity and induction of SOD1, Nrf2-dependent HO-1, and GCLM.

  4. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2).

    Science.gov (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y

    2016-04-01

    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages.

    Directory of Open Access Journals (Sweden)

    Min-Gu Song

    Full Text Available Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS are known to be an important contributor to monocytes' differentiation and macrophages' function. NF-E2-related factor 2 (NRF2, a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA. In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β, IL-6, and tumor necrosis factor-α (TNFα were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1 was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB p50 and extracellular signal-regulated kinase (ERK-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937

  6. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yao Zhu

    2016-08-01

    Full Text Available Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL, one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2-regulated genes such as heme oxygenase-1 (HO-1 and NAD(PH dehydrogenase (quinone1 (NQO1. However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS and malondialdehyde (MDA, and improved the activities of superoxide dismutase (SOD and catalase (CAT, resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway.

  7. Alteration of Nrf2 and Glutamate Cysteine Ligase expression contribute to lesions growth and fibrogenesis in ectopic endometriosis.

    Science.gov (United States)

    Marcellin, L; Santulli, P; Chouzenoux, S; Cerles, O; Nicco, C; Dousset, B; Pallardy, M; Kerdine-Römer, S; Just, P A; Chapron, C; Batteux, F

    2017-09-01

    The redox-sensitive nuclear factor erythroid-derived 2-like 2 (NRF2) controls endogenous antioxidant enzymes' transcription and protects against oxidative damage which is triggered by inflammation and known to favor progression of endometriosis. Glutamate Cysteine Ligase (GCL), a target gene of NRF2, is the first enzyme in the synthesis cascade of glutathione, an important endogenous antioxidant. Sixty-one patients, with thorough surgical examination of the abdominopelvic cavity, were recruited for the study: 31 with histologically-proven endometriosis and 30 disease-free women taken as controls. Expressions of NRF2 and GCL were investigated by quantitative RT-PCR and immunohistochemistry in eutopic and ectopic endometria from endometriosis-affected women and in endometrium of disease-free women. Ex vivo stromal and epithelial cells were extracted and purified from endometrial and endometriotic biopsies to explore expression of NRF2 and GCL in both stromal and epithelial compartments by western blot. Finally, in order to strengthen the role of NRF2 in endometriosis pathogenesis, we evaluated the drop of NRF2 expression in a mouse model of endometriosis using NRF2 knockout (NRF2 -/- ) mice. The mRNA levels of NRF2 and GCL were significantly lower in ectopic endometria of endometriosis-affected women compared to eutopic endometria of disease-free women. The immunohistochemical analysis confirmed the decreased expression of both NRF2 and GCL in ectopic endometriotic tissues compared to eutopic endometria of endometriosis-affected and disease-free women. Immunoblotting revealed a significant decreased of NRF2 and GCL expression in epithelial and stroma cells from ectopic lesions of endometriosis-affected women compared to eutopic endometria from controls. Using a murine model of endometriosis, NRF2 -/- implants were more fibrotic compared to wild-type with an increased weight and volume. These findings indicate that expression of the transcription factor NRF2 and its

  8. Epigallocatechin-3-gallate enhances key enzymatic activities of hepatic thioredoxin and glutathione systems in selenium-optimal mice but activates hepatic Nrf2 responses in selenium-deficient mice

    Directory of Open Access Journals (Sweden)

    Ruixia Dong

    2016-12-01

    Full Text Available Selenium participates in the antioxidant defense mainly through a class of selenoproteins, including thioredoxin reductase. Epigallocatechin-3-gallate (EGCG is the most abundant and biologically active catechin in green tea. Depending upon the dose and biological systems, EGCG may function either as an antioxidant or as an inducer of antioxidant defense via its pro-oxidant action or other unidentified mechanisms. By manipulating the selenium status, the present study investigated the interactions of EGCG with antioxidant defense systems including the thioredoxin system comprising of thioredoxin and thioredoxin reductase, the glutathione system comprising of glutathione and glutathione reductase coupled with glutaredoxin, and the Nrf2 system. In selenium-optimal mice, EGCG increased hepatic activities of thioredoxin reductase, glutathione reductase and glutaredoxin. These effects of EGCG appeared to be not due to overt pro-oxidant action because melatonin, a powerful antioxidant, did not influence the increase. However, in selenium-deficient mice, with low basal levels of thioredoxin reductase 1, the same dose of EGCG did not elevate the above-mentioned enzymes; intriguingly EGCG in turn activated hepatic Nrf2 response, leading to increased heme oxygenase 1 and NAD(PH:quinone oxidoreductase 1 protein levels and thioredoxin activity. Overall, the present work reveals that EGCG is a robust inducer of the Nrf2 system only in selenium-deficient conditions. Under normal physiological conditions, in selenium-optimal mice, thioredoxin and glutathione systems serve as the first line defense systems against the stress induced by high doses of EGCG, sparing the activation of the Nrf2 system.

  9. Stabilization of Nrf2 protein by D3T provides protection against ethanol-induced apoptosis in PC12 cells.

    Directory of Open Access Journals (Sweden)

    Jian Dong

    2011-02-01

    Full Text Available Previous studies have demonstrated that maternal ethanol exposure induces a moderate increase in Nrf2 protein expression in mouse embryos. Pretreatment with the Nrf2 inducer, 3H-1, 2-dithiole-3-thione (D3T, significantly increases the Nrf2 protein levels and prevents apoptosis in ethanol-exposed embryos. The present study, using PC12 cells, was designed to determine whether increased Nrf2 stability is a mechanism by which D3T enhances Nrf2 activation and subsequent antioxidant protection. Ethanol and D3T treatment resulted in a significant accumulation of Nrf2 protein in PC 12 cells. CHX chase analysis has shown that ethanol treatment delayed the degradation of Nrf2 protein in PC12 cells. A significantly greater decrease in Nrf2 protein degradation was observed in the cells treated with D3T alone or with both ethanol and D3T. In addition, D3T treatment significantly reduced ethanol-induced apoptosis. These results demonstrate that the stabilization of Nrf2 protein by D3T confers protection against ethanol-induced apoptosis.

  10. Ganglioside GM1 protects against high altitude cerebral edema in rats by suppressing the oxidative stress and inflammatory response via the PI3K/AKT-Nrf2 pathway.

    Science.gov (United States)

    Gong, Gu; Yin, Liang; Yuan, Libang; Sui, Daming; Sun, Yangyang; Fu, Haiyu; Chen, Liang; Wang, Xiaowu

    2018-03-01

    High altitude cerebral edema (HACE) is a severe type of acute mountain sickness (AMS) that occurs in response to a high altitude hypobaric hypoxic (HH) environment. GM1 monosialoganglioside can alleviate brain injury under adverse conditions including amyloid-β-peptide, ischemia and trauma. However, its role in HACE-induced brain damage remains poorly elucidated. In this study, GM1 supplementation dose-dependently attenuated increase in rat brain water content (BWC) induced by hypobaric chamber (7600 m) exposurefor 24 h. Compared with the HH-treated group, rats injected with GM1 exhibited less brain vascular leakage, lower aquaporin-4 and higher occludin expression, but they also showed increase in Na+/K+-ATPase pump activities. Importantly, HH-incurred consciousness impairment and coordination loss also were ameliorated following GM1 administration. Furthermore, the increased oxidative stress and decrease in anti-oxidant stress system under the HH condition were also reversely abrogated by GM1 treatment via suppressing accumulation of ROS, MDA and elevating the levels of SOD and GSH. Simultaneously, GM1 administration also counteracted the enhanced inflammation in HH-exposed rats by muting pro-inflammatory cytokines IL-1β, TNF-α, and IL-6 levels in serum and brain tissues. Subsequently, GM1 potentiated the activation of the PI3K/AKT-Nrf2 pathway. Cessation of this pathway by LY294002 reversed GM1-mediated inhibitory effects on oxidative stress and inflammation, and ultimately abrogated the protective role of GM1 in abating brain edema, cognitive and motor dysfunction. Overall, GM1 may afford a protective intervention in HACE by suppressing oxidative stress and inflammatory response via activating the PI3K/AKT-Nrf2 pathway, implying a promising agent for the treatment of HACE. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Prunella vulgaris Suppresses HG-Induced Vascular Inflammation via Nrf2/HO-1/eNOS Activation

    Directory of Open Access Journals (Sweden)

    Ho Sub Lee

    2012-01-01

    Full Text Available Vascular inflammation is an important factor which can promote diabetic complications. In this study, the inhibitory effects of aqueous extract from Prunella vulgaris (APV on high glucose (HG-induced expression of cell adhesion molecules in human umbilical vein endothelial cells (HUVEC are reported. APV decreased HG-induced expression of intercellular adhesion molecule-1 (ICAM-1, vascular cell adhesion molecule-1 (VCAM-1, and E-selectin. APV also dose-dependently inhibited HG-induced adhesion of HL-60 monocytic cells. APV suppressed p65 NF-κB activation in HG-treated cells. APV significantly inhibited the formation of intracellular reactive oxygen species (ROS. HG-stimulated HUVEC secreted gelatinases, however, APV inhibited it. APV induced Akt phosphorylation as well as activation of heme oxygenase-1 (HO-1, eNOS, and nuclear factor E2-related factor 2 (Nrf2, which may protect vascular inflammation caused by HG. In conclusion, APV exerts anti-inflammatory effect via inhibition of ROS/NF-κB pathway by inducing HO-1 and eNOS expression mediated by Nrf2, thereby suggesting that Prunella vulgaris may be a possible therapeutic approach to the inhibition of diabetic vascular diseases.

  12. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  13. Sulforaphane Prevents Angiotensin II-Induced Testicular Cell Death via Activation of NRF2

    Directory of Open Access Journals (Sweden)

    Yonggang Wang

    2017-01-01

    Full Text Available Although angiotensin II (Ang II was reported to facilitate sperm motility and intratesticular sperm transport, recent findings shed light on the efficacy of Ang II in stimulating inflammatory events in testicular peritubular cells, effect of which may play a role in male infertility. It is still unknown whether Ang II can induce testicular apoptotic cell death, which may be a more direct action of Ang II in male infertility. Therefore, the present study aims to determine whether Ang II can induce testicular apoptotic cell death and whether this action can be prevented by sulforaphane (SFN via activating nuclear factor (erythroid-derived 2-like 2 (NRF2, the governor of antioxidant-redox signalling. Eight-week-old male C57BL/6J wild type (WT and Nrf2 gene knockout mice were treated with Ang II, in the presence or absence of SFN. In WT mice, SFN activated testicular NRF2 expression and function, along with a marked attenuation in Ang II-induced testicular oxidative stress, inflammation, endoplasmic reticulum stress, and apoptotic cell death. Deletion of the Nrf2 gene led to a complete abolishment of these efficacies of SFN. The present study indicated that Ang II may result in testicular apoptotic cell death, which can be prevented by SFN via the activation of NRF2.

  14. Role of Nrf2 in preventing oxidative stress induced chloride current alteration in human lung cells.

    Science.gov (United States)

    Canella, Rita; Benedusi, Mascia; Martini, Marta; Cervellati, Franco; Cavicchio, Carlotta; Valacchi, Giuseppe

    2018-08-01

    The lung tissue is one of the main targets of oxidative stress due to external sources and respiratory activity. In our previous work, we have demonstrated in that O 3 exposure alters the Cl - current-voltage relationship, with the appearance of a large outward rectifier component mainly sustained by outward rectifier chloride channels (ORCCs) in human lung epithelial cells (A549 line). In the present study, we have performed patch clamp experiments, in order to identify which one of the O 3 byproducts (4hydroxynonenal (HNE) and/or H 2 O 2 ) was responsible for chloride current change. While 4HNE exposition (up to 25 μM for 30' before electrophysiological analysis) did not reproduce O 3 effect, H 2 O 2 produced by glucose oxidase 10 mU for 24 hr before electrophysiological analysis mimicked O 3 response. This result was confirmed treating the cell with catalase (CAT) before O 3 exposure (1,000 U/ml for 2 hr): CAT was able to rescue Cl - current alteration. Since CAT is regulated by Nrf2 transcription factor, we pre-treated the cells with the Nrf2 activators, resveratrol and tBHQ. Immunochemical and immunocytochemical results showed Nrf2 activation with both substances that lead to prevent OS effect on Cl - current. These data bring new insights into the mechanisms involved in OS-induced lung tissue damage, pointing out the role of H 2 O 2 in chloride current alteration and the ability of Nfr2 activation in preventing this effect. © 2017 Wiley Periodicals, Inc.

  15. Nrf1 CNC-bZIP protein promotes cell survival and nucleotide excision repair through maintaining glutathione homeostasis.

    Science.gov (United States)

    Han, Weinong; Ming, Mei; Zhao, Rui; Pi, Jingbo; Wu, Chunli; He, Yu-Ying

    2012-05-25

    Skin cancer is the most common cancer in the United States. Its major environmental risk factor is UVB radiation in sunlight. In response to UVB damage, epidermal keratinocytes activate a specific repair pathway, i.e. nucleotide excision repair, to remove UVB-induced DNA lesions. However, the regulation of UVB response is not fully understood. Here we show that the long isoform of the nuclear factor erythroid 2-related factor 1 (Nrf1, also called NFE2L1), a cytoprotective transcription factor critical for the expression of multiple antioxidant response element-dependent genes, plays an important role in the response of keratinocytes to UVB. Nrf1 loss sensitized keratinocytes to UVB-induced apoptosis by up-regulating the expression of the proapoptotic Bcl-2 family member Bik through reducing glutathione levels. Knocking down Bik reduced UVB-induced apoptosis in Nrf1-inhibited cells. In UVB-irradiated surviving cells, however, disruption of Nrf1 impaired nucleotide excision repair through suppressing the transcription of xeroderma pigmentosum C (XPC), a factor essential for initiating the global genome nucleotide excision repair by recognizing the DNA lesion and recruiting downstream factors. Nrf1 enhanced XPC expression by increasing glutathione availability but was independent of the transcription repressor of XPC. Adding XPC or glutathione restored the DNA repair capacity in Nrf1-inhibited cells. Finally, we demonstrate that Nrf1 levels are significantly reduced by UVB radiation in mouse skin and are lower in human skin tumors than in normal skin. These results indicate a novel role of Nrf1 in UVB-induced DNA damage repair and suggest Nrf1 as a tumor suppressor in the skin.

  16. Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway

    Directory of Open Access Journals (Sweden)

    Lin H

    2014-07-01

    Full Text Available Hao Lin,1,* Bo Wei,1,* Guangsheng Li,1 Jinchang Zheng,1 Jiecong Sun,1 Jiaqi Chu,2 Rong Zeng,1 Yanru Niu21Department of Spinal Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang, People’s Republic of China; 2Laboratory Institute of Minimally Invasive Orthopedic Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang, People’s Republic of China *These authors contributed equally to this work Abstract: Apoptosis of osteoblasts triggered by high-dose glucocorticoids (GCs has been identified as a major cause of osteoporosis. However, the underlying molecular mechanisms accounting for this action remain elusive, which has impeded the prevention and cure of this side effect. Sulforaphane (SFP is a naturally occurring isothiocyanate that has huge health benefits for humans. In this study, by using osteoblastic MC3T3-E1 cells as a model, we demonstrate the protective effects of SFP against dexamethasone (Dex-induced apoptosis and elucidate the underlying molecular mechanisms. The results show that SFP could effectively inhibit the Dex-induced growth inhibition and release of lactate dehydrogenase in MC3T3-E1 cells. Treatment with Dex induced caspase-dependent apoptosis in MC3T3-E1 cells, as evidenced by an increase in the Sub-G1 phase, chromatin condensation, and deoxyribonucleic acid fragmentation, which were significantly suppressed by coincubation with SFP. Mitochondria-mediated apoptosis pathway contributed importantly to Dex-induced apoptosis, as revealed by the activation of caspase-3/-9 and subsequent cleavage of poly adenosine diphosphate ribose polymerase, which was also effectively blocked by SFP. Moreover, treatments of Dex strongly induced overproduction of reactive oxygen species and inhibited the expression of nuclear factor erythroid 2-related factor 2 (Nrf2 and the downstream effectors HO1 and NQO1. However, cotreatment with SFP effectively reversed this action of Dex. Furthermore, silencing of Nrf2 by

  17. L-Arginine ameliorates cardiac left ventricular oxidative stress by upregulating eNOS and Nrf2 target genes in alloxan-induced hyperglycemic rats

    International Nuclear Information System (INIS)

    Ramprasath, Tharmarajan; Hamenth Kumar, Palani; Syed Mohamed Puhari, Shanavas; Senthil Murugan, Ponniah; Vasudevan, Varadaraj; Selvam, Govindan Sadasivam

    2012-01-01

    Highlights: ► L-Arginine treatment reduced the metabolic disturbances in diabetic animals. ► Antioxidant marker proteins were found high in myocardium by L-arginine treatment. ► Elevated antioxidant status, mediates the reduced TBA-reactivity in left ventricle. ► L-Arginine treatment enhanced the Nrf2 and eNOS signaling in left ventricle. ► Improved cell survival signaling by arginine, offers a novel tactic for targeting. -- Abstract: Hyperglycemia is independently related with excessive morbidity and mortality in cardiovascular disorders. L-Arginine-nitric oxide (NO) pathway and the involvement of NO in modulating nuclear factor-E2-related factor-2 (Nrf2) signaling were well established. In the present study we investigated, whether L-arginine supplementation would improve the myocardial antioxidant defense under hyperglycemia through activation of Nrf2 signaling. Diabetes was induced by alloxan monohydrate (90 mg kg −1 body weight) in rats. Both non-diabetic and diabetic group of rats were divided into three subgroups and they were administered either with L-arginine (2.25%) or L-NAME (0.01%) in drinking water for 12 days. Results showed that L-arginine treatment reduced the metabolic disturbances in diabetic rats. Antioxidant enzymes and glutathione levels were found to be increased in heart left ventricles, thereby reduction of lipid peroxidation by L-arginine treatment. Heart histopathological analysis further validates the reversal of typical diabetic characteristics consisting of alterations in myofibers and myofibrillary degeneration. qRT-PCR studies revealed that L-arginine treatment upregulated the transcription of Akt and downregulated NF-κB. Notably, transcription of eNOS and Nrf2 target genes was also upregulated, which were accompanied by enhanced expression of Nrf2 in left ventricular tissue from diabetic and control rats. Under these findings, we suggest that targeting of eNOS and Nrf2 signaling by L-arginine supplementation could be

  18. L-Arginine ameliorates cardiac left ventricular oxidative stress by upregulating eNOS and Nrf2 target genes in alloxan-induced hyperglycemic rats

    Energy Technology Data Exchange (ETDEWEB)

    Ramprasath, Tharmarajan; Hamenth Kumar, Palani; Syed Mohamed Puhari, Shanavas; Senthil Murugan, Ponniah; Vasudevan, Varadaraj [Molecular Cardiology Unit, Department of Biochemistry, Center for Excellence in Genomic Sciences, School of Biological Sciences, Madurai Kamaraj University, Madurai 625 021, Tamilnadu (India); Selvam, Govindan Sadasivam, E-mail: drselvamgsbiochem@rediffmail.com [Molecular Cardiology Unit, Department of Biochemistry, Center for Excellence in Genomic Sciences, School of Biological Sciences, Madurai Kamaraj University, Madurai 625 021, Tamilnadu (India)

    2012-11-23

    Highlights: Black-Right-Pointing-Pointer L-Arginine treatment reduced the metabolic disturbances in diabetic animals. Black-Right-Pointing-Pointer Antioxidant marker proteins were found high in myocardium by L-arginine treatment. Black-Right-Pointing-Pointer Elevated antioxidant status, mediates the reduced TBA-reactivity in left ventricle. Black-Right-Pointing-Pointer L-Arginine treatment enhanced the Nrf2 and eNOS signaling in left ventricle. Black-Right-Pointing-Pointer Improved cell survival signaling by arginine, offers a novel tactic for targeting. -- Abstract: Hyperglycemia is independently related with excessive morbidity and mortality in cardiovascular disorders. L-Arginine-nitric oxide (NO) pathway and the involvement of NO in modulating nuclear factor-E2-related factor-2 (Nrf2) signaling were well established. In the present study we investigated, whether L-arginine supplementation would improve the myocardial antioxidant defense under hyperglycemia through activation of Nrf2 signaling. Diabetes was induced by alloxan monohydrate (90 mg kg{sup -1} body weight) in rats. Both non-diabetic and diabetic group of rats were divided into three subgroups and they were administered either with L-arginine (2.25%) or L-NAME (0.01%) in drinking water for 12 days. Results showed that L-arginine treatment reduced the metabolic disturbances in diabetic rats. Antioxidant enzymes and glutathione levels were found to be increased in heart left ventricles, thereby reduction of lipid peroxidation by L-arginine treatment. Heart histopathological analysis further validates the reversal of typical diabetic characteristics consisting of alterations in myofibers and myofibrillary degeneration. qRT-PCR studies revealed that L-arginine treatment upregulated the transcription of Akt and downregulated NF-{kappa}B. Notably, transcription of eNOS and Nrf2 target genes was also upregulated, which were accompanied by enhanced expression of Nrf2 in left ventricular tissue from diabetic

  19. Identification of a Novel and Potent Nrf2 inhibitor as a Radiosensitizer with High Throughput Screening

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Ji Yeon; Park, Sa Rah; Yun, Yeon Sook; Song, Jie Young [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-05-15

    Lung cancer is the leading cause of cancer death in both men and women in the United States. Non-small cell lung cancer (NSCLC) accounts for more than 75% of all lung cancers and radiotherapy (RT) is the general treatment modality for these lung cancer patients. Nuclear factor erythroid-2. related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates the expression of genes encoding electrophiles and xenobiotic detoxification enzymes and efflux proteins, which confer cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein (Keap1) sequesters Nrf2 and leads to proteasomal degradation of Nrf2 in non-stressed condition. Keap1 is often found with biallelic mutation in NSCLC cell lines and NSCLC patients, results in constitutive activation of Nrf2 function, and contributes to resistance of chemotherapy (CT) or RT (3, 4). We thus postulated that inhibition of Nrf2 in cancer cells could increase sensitivity to RT. Our primary results show that IM3829, a putative Nrf2 inhibitor, enhances the efficacy of RT and CT in H1299 lung cancer cell.

  20. Inducers of Senescence, Toxic Compounds, and Senolytics: The Multiple Faces of Nrf2-Activating Phytochemicals in Cancer Adjuvant Therapy

    Directory of Open Access Journals (Sweden)

    Marco Malavolta

    2018-01-01

    Full Text Available The reactivation of senescence in cancer and the subsequent clearance of senescent cells are suggested as therapeutic intervention in the eradication of cancer. Several natural compounds that activate Nrf2 (nuclear factor erythroid-derived 2-related factor 2 pathway, which is involved in complex cytoprotective responses, have been paradoxically shown to induce cell death or senescence in cancer. Promoting the cytoprotective Nrf2 pathway may be desirable for chemoprevention, but it might be detrimental in later stages and advanced cancers. However, senolytic activity shown by some Nrf2-activating compounds could be used to target senescent cancer cells (particularly in aged immune-depressed organisms that escape immunosurveillance. We herein describe in vitro and in vivo effects of fifteen Nrf2-interacting natural compounds (tocotrienols, curcumin, epigallocatechin gallate, quercetin, genistein, resveratrol, silybin, phenethyl isothiocyanate, sulforaphane, triptolide, allicin, berberine, piperlongumine, fisetin, and phloretin on cellular senescence and discuss their use in adjuvant cancer therapy. In light of available literature, it can be concluded that the meaning and the potential of adjuvant therapy with natural compounds in humans remain unclear, also taking into account the existence of few clinical trials mostly characterized by uncertain results. Further studies are needed to investigate the therapeutic potential of those compounds that display senolytic activity.

  1. Lansoprazole halts contrast induced nephropathy through activation of Nrf2 pathway in rats.

    Science.gov (United States)

    Khaleel, Sahar A; Alzokaky, Amany A; Raslan, Nahed A; Alwakeel, Asmaa I; Abd El-Aziz, Heba G; Abd-Allah, Adel R

    2017-05-25

    Contrast-induced nephropathy (CIN) is an important cause of acute kidney injury characterized by significant mortality and morbidity. To date, there is no successful protective regimen for CIN especially in poor kidney function patients. Lansoprazole has been shown to exert antioxidant action through induction of nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway. The aim of the present study is to investigate the potential of lansoprazole to activate Nrf2 pathway in the kidney and consequently to protect against oxidative stress induced by iodinated contrast media. Lansoprazole, at a dose of 100 mg/kg, showed a significant induction of Nrf2 mRNA after 3 h. Administration of contrast media induced significant increase in serum creatinine and blood urea nitrogen, histological deterioration, and reduction in total antioxidant capacity. Moreover, it instigated the defensive Nrf2 gene expression and immunoreactivity. In addition, there were overexpression of HO-1, caspase 3, p53 and IL6 genes and downregulation of Bcl2 gene. Pre-treatment with lansoprazole (100 mg/kg) ameliorated the nephrotoxicity parameters and oxidative stress, improved histological lesions, and hijacked apoptotic and inflammatory markers that were provoked by contrast media. In conclusion, lansoprazole attenuates experimental CIN which might be due to activation of Nrf2 antioxidant defence pathway. These findings highlight the potential benefit of incorporating lansoprazole in the protective regimen against CIN especially for susceptible patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Dwindling of cardio damaging effect of isoproterenol by Punica granatum L. peel extract involve activation of nitric oxide-mediated Nrf2/ARE signaling pathway and apoptosis inhibition.

    Science.gov (United States)

    Gupta, Mahesh; Sharma, Pallavi; Mazumder, Arindam Ghosh; Patial, Vikram; Singh, Damanpreet

    2015-09-09

    Punica granatum L. (Punicaceae) peel is often considered as a food waste in-spite of its high bioactive metabolite composition. Primarily it is rich in therapeutically active phenolics that act on multiple cellular sites, through diverse mechanisms. Hence, the present study was envisaged to investigate the effect of standardised peel extract of P. granatum against isoproterenol (ISO)-induced myocardial infarction (MI). ISO administration at a dose of 150 mg/kg; s.c., twice at 24 h interval resulted in electrocardiographic abnormalities with increased heart weight and myocardial tissue damage signifying MI. Pretreatment with the extract at 50, 100 and 200 mg/kg; p.o., for 21 days prior to ISO intoxication (30 min prior to intoxication on day 22 and 23) attenuated the observed changes, along with increased myocardial tissue superoxide dismutase activity, reduced glutathione and nitrite levels, and decreased lipid peroxidation. The extract treated groups also showed reduced serum marker enzymes of MI, showing maximum effect at highest tested dose. Immunohistochemical studies revealed increased myocardial expression of nuclear factor erythroid 2-related factor 2 (Nrf2), endothelial nitric oxide synthase (eNOS) and Bcl-2 proteins in the extract treated groups with decreased Bax expression. From the results it can be concluded that the extract pretreatment prevents ISO-induced MI through increased myocardial expression of eNOS, leading to nitric oxide-mediated Nrf2 activation, thus upregulating antioxidant mechanisms, along with inhibition of apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Inhibition of PDGFR by CP-673451 induces apoptosis and increases cisplatin cytotoxicity in NSCLC cells via inhibiting the Nrf2-mediated defense mechanism.

    Science.gov (United States)

    Yang, Yang; Deng, Yanchao; Chen, Xiangcui; Zhang, Jiahao; Chen, Yueming; Li, Huachao; Wu, Qipeng; Yang, Zhicheng; Zhang, Luyong; Liu, Bing

    2018-05-29

    Platelet-derived growth factor receptors (PDGFRs) are abundantly expressed by stromal cells in the non-small cell lung cancer (NSCLC) microenvironment, and in a subset of cancer cells, usually with their overexpression and/or activating mutation. However, the effect of PDGFR inhibition on lung cancer cells themselves has been largely neglected. In this study, we investigated the anticancer activity of CP-673451, a potent and selective inhibitor of PDGFRβ, on NSCLC cell lines (A549 and H358) and the potential mechanism. The results showed that inhibition of PDGFRβ by CP-673451 induced a significant increase in cell apoptosis, accompanied by ROS accumulation. However, CP-673451 exerted less cytotoxicity in normal lung epithelial cell line BEAS-2B cells determined by MTT and apoptosis assay. Elimination of ROS by NAC reversed the CP-673451-induced apoptosis in NSCLC cells. Furthermore, CP-673451 down-regulated the expression of nuclear factor erythroid 2-related factor 2 (Nrf2) probably through inhibition of PI3K/Akt pathway. Rescue of Nrf2 activity counteracted the effects of CP-673451 on cell apoptosis and ROS accumulation. Silencing PDGFRβ expression by PDGFRβ siRNA exerted similar effects with CP-673451 in A549 cells, and when PDGFRβ was knockdowned by PDGFRβ siRNA, CP-673451 produced no additional effects on cell viability, ROS and GSH production, Nrf2 expression as well as PI3K/Akt pathway activity. Specifically, Nrf2 plays an indispensable role in NSCLC cell sensitivity to platinum-based treatments and we found that combination of CP-673451 and cisplatin produced a synergistic anticancer effect and substantial ROS production in vitro. Therefore, these results clearly demonstrate the effectiveness of inhibition of PDGFRβ against NSCLC cells and strongly suggest that CP-673451 may be a promising adjuvant chemotherapeutic drug. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Differential response of DU145 and PC3 prostate cancer cells to ionizing radiation: role of reactive oxygen species, GSH and Nrf2 in radiosensitivity.

    Science.gov (United States)

    Jayakumar, Sundarraj; Kunwar, Amit; Sandur, Santosh K; Pandey, Badri N; Chaubey, Ramesh C

    2014-01-01

    Radioresistance is the major impediment in radiotherapy of many cancers including prostate cancer, necessitating the need to understand the factors contributing to radioresistance in tumor cells. In the present study, the role of cellular redox and redox sensitive transcription factor, Nrf2 in the radiosensitivity of prostate cancer cell lines PC3 and DU145, has been investigated. Differential radiosensitivity of PC3 and DU145 cells was assessed using clonogenic assay, flow cytometry, and comet assay. Their redox status was measured using DCFDA and DHR probes. Expression of Nrf2 and its dependent genes was measured by EMSA and real time PCR. Knockdown studies were done using shRNA transfection. PC3 and DU145 cells differed significantly in their radiosensitivity as observed by clonogenic survival, apoptosis and neutral comet assays. Both basal and inducible levels of ROS were higher in PC3 cells than that of DU145 cells. DU145 cells showed higher level of basal GSH content and GSH/GSSG ratio than that of PC3 cells. Further, significant increase in both basal and induced levels of Nrf2 and its dependent genes was observed in DU145 cells. Knock-down experiments and pharmacological intervention studies revealed the involvement of Nrf2 in differential radio-resistance of these cells. Cellular redox status and Nrf2 levels play a causal role in radio-resistance of prostate cancer cells. The pivotal role Nrf2 has been shown in the radioresistance of tumor cells and this study will further help in exploiting this factor in radiosensitization of other tumor cell types. © 2013.

  5. 17β-Estradiol up-regulates Nrf2 via PI3K/AKT and estrogen receptor signaling pathways to suppress light-induced degeneration in rat retina.

    Science.gov (United States)

    Zhu, C; Wang, S; Wang, B; Du, F; Hu, C; Li, H; Feng, Y; Zhu, R; Mo, M; Cao, Y; Li, A; Yu, X

    2015-09-24

    Human age-related retinal diseases, such as age-related macular degeneration (AMD), are intimately associated with decreased tissue oxygenation and hypoxia. Different antioxidants have been investigated to reverse AMD. In the present study, we describe the antioxidant 17β-estradiol (βE2) and investigate its protective effects on retinal neurons. Fourteen days after ovariectomy, adult Sprague-Dawley rats were exposed to 8000-lux light for 12h to induce retinal degeneration. Reactive oxygen species (ROS) levels were assessed by confocal fluorescence microscopy using 2,7-dichlorofluorescein diacetate. Nuclear factor erythroid 2-related factor 2 (Nrf2) and antioxidant enzyme mRNA expression were detected by real-time PCR. Western blotting was used to evaluate NRF2 activation. NRF2 translocation was determined by immunohistochemistry, with morphological changes monitored by hematoxylin and eosin staining. Following light exposure, βE2 significantly reduced ROS production. βE2 also up-regulated NRF2 mRNA and protein levels, with maximal expression at 4 and 12h post-exposure, respectively. Interestingly, following βE2 administration, NRF2 was translocated from the cytoplasm to the nucleus, primarily in the outer nuclear layer. βE2 also up-regulated NRF2, which triggered phase-2 antioxidant enzyme expression (superoxide dismutases 1 and 2, catalase, glutaredoxins 1 and 2, and thioredoxins 1 and 2), reduced ROS production, and ameliorated retinal damage. However, the beneficial effects of βE2 were markedly suppressed by pretreatment with LY294002 or ICI182780, specific inhibitors of the phosphatidylinositol 3-kinase-Akt (PI3K/AKT), and estrogen receptor (ER) signaling pathways, respectively. Taken together, these observations suggest that βE2 exerts antioxidative effects following light-induced retinal degeneration potentially via NRF2 activation. This protective mechanism may depend on two pathways: a rapid, non-genomic-type PI3K/AKT response, and a genomic-type ER

  6. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  7. Nuclear respiratory factor 2 regulates the expression of the same NMDA receptor subunit genes as NRF-1: both factors act by a concurrent and parallel mechanism to couple energy metabolism and synaptic transmission.

    Science.gov (United States)

    Priya, Anusha; Johar, Kaid; Wong-Riley, Margaret T T

    2013-01-01

    Neuronal activity and energy metabolism are tightly coupled processes. Previously, we found that nuclear respiratory factor 1 (NRF-1) transcriptionally co-regulates energy metabolism and neuronal activity by regulating all 13 subunits of the critical energy generating enzyme, cytochrome c oxidase (COX), as well as N-methyl-d-aspartate (NMDA) receptor subunits 1 and 2B, GluN1 (Grin1) and GluN2B (Grin2b). We also found that another transcription factor, nuclear respiratory factor 2 (NRF-2 or GA-binding protein) regulates all subunits of COX as well. The goal of the present study was to test our hypothesis that NRF-2 also regulates specific subunits of NMDA receptors, and that it functions with NRF-1 via one of three mechanisms: complementary, concurrent and parallel, or a combination of complementary and concurrent/parallel. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation of mouse neuroblastoma cells and rat visual cortical tissue, promoter mutations, real-time quantitative PCR, and western blot analysis, NRF-2 was found to functionally regulate Grin1 and Grin2b genes, but not any other NMDA subunit genes. Grin1 and Grin2b transcripts were up-regulated by depolarizing KCl, but silencing of NRF-2 prevented this up-regulation. On the other hand, over-expression of NRF-2 rescued the down-regulation of these subunits by the impulse blocker TTX. NRF-2 binding sites on Grin1 and Grin2b are conserved among species. Our data indicate that NRF-2 and NRF-1 operate in a concurrent and parallel manner in mediating the tight coupling between energy metabolism and neuronal activity at the molecular level. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Hydrogen gas reduces hyperoxic lung injury via the Nrf2 pathway in vivo

    Science.gov (United States)

    Kawamura, Tomohiro; Wakabayashi, Nobunao; Shigemura, Norihisa; Huang, Chien-Sheng; Masutani, Kosuke; Tanaka, Yugo; Noda, Kentaro; Peng, Ximei; Takahashi, Toru; Billiar, Timothy R.; Okumura, Meinoshin; Toyoda, Yoshiya; Kensler, Thomas W.

    2013-01-01

    Hyperoxic lung injury is a major concern in critically ill patients who receive high concentrations of oxygen to treat lung diseases. Successful abrogation of hyperoxic lung injury would have a huge impact on respiratory and critical care medicine. Hydrogen can be administered as a therapeutic medical gas. We recently demonstrated that inhaled hydrogen reduced transplant-induced lung injury and induced heme oxygenase (HO)-1. To determine whether hydrogen could reduce hyperoxic lung injury and investigate the underlying mechanisms, we randomly assigned rats to four experimental groups and administered the following gas mixtures for 60 h: 98% oxygen (hyperoxia), 2% nitrogen; 98% oxygen (hyperoxia), 2% hydrogen; 98% balanced air (normoxia), 2% nitrogen; and 98% balanced air (normoxia), 2% hydrogen. We examined lung function by blood gas analysis, extent of lung injury, and expression of HO-1. We also investigated the role of NF-E2-related factor (Nrf) 2, which regulates HO-1 expression, by examining the expression of Nrf2-dependent genes and the ability of hydrogen to reduce hyperoxic lung injury in Nrf2-deficient mice. Hydrogen treatment during exposure to hyperoxia significantly improved blood oxygenation, reduced inflammatory events, and induced HO-1 expression. Hydrogen did not mitigate hyperoxic lung injury or induce HO-1 in Nrf2-deficient mice. These findings indicate that hydrogen gas can ameliorate hyperoxic lung injury through induction of Nrf2-dependent genes, such as HO-1. The findings suggest a potentially novel and applicable solution to hyperoxic lung injury and provide new insight into the molecular mechanisms and actions of hydrogen. PMID:23475767

  9. Antcin C from Antrodia cinnamomea Protects Liver Cells Against Free Radical-Induced Oxidative Stress and Apoptosis In Vitro and In Vivo through Nrf2-Dependent Mechanism

    Directory of Open Access Journals (Sweden)

    M. Gokila Vani

    2013-01-01

    Full Text Available In this study, we investigated the cytoprotective effects of antcin C, a steroid-like compound isolated from Antrodia cinnamaomea against AAPH-induced oxidative stress and apoptosis in human hepatic HepG2 cells. Pretreatment with antcin C significantly protects hepatic cells from AAPH-induced cell death through the inhibition of ROS generation. Furthermore, AAPH-induced lipid peroxidation, ALT/AST secretion and GSH depletion was significantly inhibited by antcin C. The antioxidant potential of antcin C was correlated with induction of antioxidant genes including, HO-1, NQO-1, γ-GCLC, and SOD via transcriptional activation of Nrf2. The Nrf2 activation by antcin C is mediated by JNK1/2 and PI3K activation, whereas pharmacologic inhibition of JNK1/2 and PI3K abolished antcin C-induced Nrf2 activity. In addition, AAPH-induced apoptosis was significantly inhibited by antcin C through the down-regulation of pro-apoptotic factors including, Bax, cytochrome c, capase 9, -4, -12, -3, and PARP. In vivo studies also show that antcin C significantly protected mice liver from AAPH-induced hepatic injury as evidenced by reduction in hepatic enzymes in circulation. Further, immunocytochemistry analyses showed that antcin C significantly increased HO-1 and Nrf2 expression in mice liver tissues. These results strongly suggest that antcin C could protect liver cells from oxidative stress and cell death via Nrf2/ARE activation.

  10. Involvement of Nrf2-Mediated Upregulation of Heme Oxygenase-1 in Mollugin-Induced Growth Inhibition and Apoptosis in Human Oral Cancer Cells

    Directory of Open Access Journals (Sweden)

    Young-Man Lee

    2013-01-01

    Full Text Available Although previous studies have shown that mollugin, a bioactive phytochemical isolated from Rubia cordifolia L. (Rubiaceae, exhibits antitumor effects, its biological activity in oral cancer has not been reported. We thus investigated the effects and putative mechanism of apoptosis induced by mollugin in human oral squamous cell carcinoma cells (OSCCs. Results show that mollugin induces cell death in a dose-dependent manner in primary and metastatic OSCCs. Mollugin-induced cell death involved apoptosis, characterized by the appearance of nuclear shrinkage, flow cytometric analysis of sub-G1 phase arrest, and annexin V-FITC and propidium iodide staining. Western blot analysis and RT-PCR revealed that mollugin suppressed activation of NF-κB and NF-κB-dependent gene products involved in antiapoptosis (Bcl-2 and Bcl-xl, invasion (MMP-9 and ICAM-1, and angiogenesis (FGF-2 and VEGF. Furthermore, mollugin induced the activation of p38, ERK, and JNK and the expression of heme oxygenase-1 (HO-1 and nuclear factor E2–related factor 2 (Nrf2. Mollugin-induced growth inhibition and apoptosis of HO-1 were reversed by an HO-1 inhibitor and Nrf2 siRNA. Collectively, this is the first report to demonstrate the effectiveness of mollugin as a candidate for a chemotherapeutic agent in OSCCs via the upregulation of the HO-1 and Nrf2 pathways and the downregulation of NF-κB.

  11. NRF2 and P73 polymorphisms in Egyptian women with breast cancer

    African Journals Online (AJOL)

    The aim of the study was to assess the role of Nrf2 promoter and P73 G4C14 to A4T14 polymorphisms in breast cancer and the potential relation to the onset of the disease. Eighty six female patients with breast tumor were included in this study. Nrf2 (rs6721961) and p73 (G4A) genetic polymorphisms in promoter and ...

  12. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway.

    Science.gov (United States)

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance

    2016-04-01

    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Nrf2-mediated antioxidant response by ethanolic extract of Sida cordifolia provides protection against alcohol-induced oxidative stress in liver by upregulation of glutathione metabolism.

    Science.gov (United States)

    Rejitha, S; Prathibha, P; Indira, M

    2015-03-01

    Objective The study aimed to evaluate the antioxidant property of ethanolic extract of Sida cordifolia (SAE) on alcohol-induced oxidative stress and to elucidate its mechanism of action. Methods Male albino rats of the Sprague-Dawley strain were grouped into four: (1) control, (2) alcohol (4 g/kg body weight), (3) SAE (50 mg/100 g body weight), and (4) alcohol (4 g/kg body weight) + SAE (50 mg/100 g body weight). Alcohol and SAE were given orally each day by gastric intubation. The duration of treatment was 90 days. Results The activities of toxicity markers in liver and serum increased significantly in alcohol-treated rats and to a lesser extent in the group administered SAE + alcohol. The activity of alcohol dehydrogenase and the reactive oxygen species level were increased significantly in alcohol-treated rats but attenuated in the SAE co-administered group. Oxidative stress was increased in alcohol-treated rats as evidenced by the lowered activities of antioxidant enzymes, decreased level of reduced glutathione (GSH), increased lipid peroxidation products, and decreased expression of γ-glutamyl cysteine synthase in liver. The co-administration of SAE with alcohol almost reversed these changes. The activity of glutathione-S-transferase and translocation of Nrf2 from cytosol to nucleus in the liver was increased in both the alcohol and alcohol + SAE groups, but the maximum changes were observed in the latter group. Discussion The SAE most likely elicits its antioxidant potential by reducing oxidative stress, enhancing the translocation of Nrf2 to nucleus and thereby regulating glutathione metabolism, leading to enhanced GSH content.

  14. Hepatocyte-specific deletion of the keap1 gene activates Nrf2 and confers potent resistance against acute drug toxicity

    International Nuclear Information System (INIS)

    Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki

    2006-01-01

    Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes

  15. Enhanced expression of Nrf2 in mice attenuates the fatty liver produced by a methionine- and choline-deficient diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Yeager, Ronnie L.; Tanaka, Yuji; Klaassen, Curtis D.

    2010-01-01

    Oxidative stress has been proposed as an important promoter of the progression of fatty liver diseases. The current study investigates the potential functions of the Nrf2-Keap1 signaling pathway, an important hepatic oxidative stress sensor, in a rodent fatty liver model. Mice with no (Nrf2-null), normal (wild type, WT), and enhanced (Keap1 knockdown, K1-kd) expression of Nrf2 were fed a methionine- and choline-deficient (MCD) diet or a control diet for 5 days. Compared to WT mice, the MCD diet-caused hepatosteatosis was more severe in the Nrf2-null mice and less in the K1-kd mice. The Nrf2-null mice had lower hepatic glutathione and exhibited more lipid peroxidation, whereas the K1-kd mice had the highest amount of glutathione in the liver and developed the least lipid peroxidation among the three genotypes fed the MCD diet. The Nrf2 signaling pathway was activated by the MCD diet, and the Nrf2-targeted cytoprotective genes Nqo1 and Gstα1/2 were induced in WT and even more in K1-kd mice. In addition, Nrf2-null mice on both control and MCD diets exhibited altered expression profiles of fatty acid metabolism genes, indicating Nrf2 may influence lipid metabolism in liver. For example, mRNA levels of long chain fatty acid translocase CD36 and the endocrine hormone Fgf21 were higher in livers of Nrf2-null mice and lower in the K1-kd mice than WT mice fed the MCD diet. Taken together, these observations indicate that Nrf2 could decelerate the onset of fatty livers caused by the MCD diet by increasing hepatic antioxidant and detoxification capabilities.

  16. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

    2013-11-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  17. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    International Nuclear Information System (INIS)

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

    2013-01-01

    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and

  18. Fimasartan, a Novel Angiotensin-Receptor Blocker, Protects against Renal Inflammation and Fibrosis in Mice with Unilateral Ureteral Obstruction: the Possible Role of Nrf2

    Science.gov (United States)

    Kim, Soojeong; Kim, Sung Jun; Yoon, Hye Eun; Chung, Sungjin; Choi, Bum Soon; Park, Cheol Whee; Shin, Seok Joon

    2015-01-01

    Objectives: A newly developed angiotensin II receptor blocker, fimasartan, is effective in lowering blood pressure through its action on the renin-angiotensin system. Renal interstitial fibrosis, believed to be due to oxidative injury, is an end-stage process in the progression of chronic kidney disease. Nuclear factor erythroid 2-related factor 2 (Nrf2) is known to regulate cellular oxidative stress and induce expression of antioxidant genes. In this study we investigated the role of Nrf2 in fimasartan-mediated antioxidant effects in mice with renal fibrosis induced by unilateral ureteral obstruction (UUO). Materials and Methods: UUO was induced surgically in mice, followed by either no treatment with fimasartan or the intraperitoneal administration of fimasartan (3 mg/kg/day). On day 7, we evaluated the changes in the renin-angiotensin system (RAS) and the expression of Nrf2 and its downstream antioxidant genes, as well as renal inflammation, apoptosis, and fibrosis in the obstructed kidneys. The effect of fimasartan on the Nrf2 pathway was also investigated in HK-2 cells stimulated by tumor necrosis factor-α. Results: The mice with surgically induced UUO showed increased renal inflammation and fibrosis as evidenced by histopathologic findings and total collagen content in the kidney. These effects were attenuated in the obstructed kidneys of the fimasartan-treated mice. Fimasartan treatment inhibited RAS activation and the expression of Nox1, Nox2, and Nox4. In contrast, fimasartan upregulated the renal expression of Nrf2 and its downstream signaling molecules (such as NQO1; HO-1; GSTa2 and GSTm3). Furthermore, it increased the expression of antioxidant enzymes, including CuSOD, MnSOD, and catalase. The fimasartan-treated mice had significantly less apoptosis on TUNEL staining, with decreased levels of pro-apoptotic protein and increased levels of anti-apoptotic protein. In the HK-2 cells, fimasartan treatment inhibited RAS activation, decreased expression of

  19. Hyperoside attenuates hydrogen peroxide-induced L02 cell damage via MAPK-dependent Keap{sub 1}-Nrf{sub 2}-ARE signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xing, Hai-Yan; Liu, Yao; Chen, Jian-Hong; Sun, Feng-Jun; Shi, Hui-Qing [Department of Pharmacy, Southwest Hospital, Third Military Medical University, Chongqing 400038 (China); Xia, Pei-Yuan, E-mail: py_xia@yahoo.com.cn [Department of Pharmacy, Southwest Hospital, Third Military Medical University, Chongqing 400038 (China)

    2011-07-15

    Highlights: {yields} Hyperoside attenuated H{sub 2}O{sub 2}-induced L02 cell damage. {yields} Hyperoside up-regulated HO-1 expression at both mRNA and protein levels. {yields} Hyperoside activated both Nrf{sub 2} nuclear translocation and gene expression. {yields} Hyperoside may inhibit Keap{sub 1} mRNA translation or protein degradation. {yields} Phosphorylation of ERK and p38 is involved in hyperoside-mediated Nrf{sub 2} activation. -- Abstract: The flavonoid hyperoside has been reported to elicit cytoprotection against oxidative stress partly by increasing the activity of antioxidant enzymes, such as glutathione peroxidase, superoxide dismutase and catalase. However, the cellular and molecular mechanisms underlying this effect remain unclear. Here, hepatic L02 cells exposed to H{sub 2}O{sub 2} (100 {mu}M) were used to demonstrate that hyperoside protected cells by significantly inhibiting overproduction of intracellular ROS, depletion of the mitochondrial membrane potential and leakage of lactate dehydrogenase. Hyperoside further enhanced the cellular antioxidant defense system through increasing the activity of heme oxygenase-1 (HO-1), and by up-regulating HO-1 expression. Meanwhile, real time PCR, western blot and immunofluorescence studies revealed that hyperoside stimulated nuclear translocation of the Nrf{sub 2} transcription factor in a dose-dependent manner, and this effect was significantly suppressed by pharmacological inhibition of the mitogen-activated protein kinases (MAPK) p38 and ERK. Collectively, our data provide the first description of the mechanism underlying hyperoside's ability to attenuate H{sub 2}O{sub 2}-induced cell damage, namely this compound interacts with the MAPK-dependent Keap{sub 1}-Nrf{sub 2}-ARE signaling pathway to up-regulate HO-1 expression and enhance intracellular antioxidant activity.

  20. Baicalin Ameliorates H2O2 Induced Cytotoxicity in HK-2 Cells through the Inhibition of ER Stress and the Activation of Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Miao Lin

    2014-07-01

    Full Text Available Renal ischemia-reperfusion injury plays a key role in renal transplantation and greatly affects the outcome of allograft. Our previous study proved that Baicalin, a flavonoid glycoside isolated from Scutellaria baicalensis, protects kidney from ischemia-reperfusion injury. This study aimed to study the underlying mechanism in vitro. Human renal proximal tubular epithelial cell line HK-2 cells were stimulated by H2O2 with and without Baicalin pretreatment. The cell viability, apoptosis and oxidative stress level were measured. The expression of endoplasmic reticulum (ER stress hallmarks, such as binding immunoglobulin protein (BiP and C/EBP homologous protein (CHOP, were analyzed by western blot and real-time PCR. NF-E2-related factor 2 (Nrf2 expression was also measured. In the H2O2 group, cell viability decreased and cell apoptosis increased. Reactive Oxygen Species (ROS and Glutathione/Oxidized Glutathione (GSH/GSSG analysis revealed increased oxidative stress. ER stress and Nrf2 signaling also increased. Baicalin pretreatment ameliorated H2O2-induced cytotoxicity, reduced oxidative stress and ER stress and further activated the anti-oxidative Nrf2 signaling pathway. The inducer of ER stress and the inhibitor of Nrf2 abrogated the protective effects, while the inhibitor of ER stress and the inducer of Nrf2 did not improve the outcome. This study revealed that Baicalin pretreatment serves a protective role against H2O2-induced cytotoxicity in HK-2 cells, where the inhibition of ER stress and the activation of downstream Nrf2 signaling are involved.

  1. Reduced blood nrf-2 mRNA in local overweight boys at risk of metabolic complications: a study in San Luis City, San Luis, Argentina.

    Science.gov (United States)

    Santillán, Lucas D; Moyano, Marta; Frau, Martín; Flores, Orlando; Siewert, Susana; Zirulnick, Fanny; Ramirez, Dario C; Giménez, Maria S

    2013-10-01

    Childhood overweight (OW) is a matter of public health concern because of its long-term impact on adulthood health. NF-E2-related factor 2 (Nrf-2) regulates the antioxidant/lipogenic response to a sustained positive energy balance that prevails during weight gain. Here we aimed at studying a possible link between OW and Nrf-2-dependent antioxidant/lipogenic response in a local population of boys at risk of metabolic complications. We measured clinical and biochemical parameters related to lipid metabolism, oxidative stress, and metabolic syndrome in a population of OW boys [body mass index (BMI) percentile ≥85(th) and Luis City, San Luis, Argentina. Compared to NW, OW boys had lower insulin sensitivity, an altered plasma lipid profile, and increased markers of oxidative stress and inflammatory fatty acids. OW boys also had a higher atherogenic index and peripheral insulin resistance than NW boys. We also found that glutathione peroxidase activity and the reduced glutathione to oxidized glutathione ratio were lower in OW boys than NW boys, suggesting that OW boys may have an altered antioxidant response to oxidative stress. Finally, Nrf-2 expression negatively correlated with metabolic syndrome parameters in OW boys. Our data suggest that OW boys have a reduced antioxidant and lipogenic response to a positive energy balance, resulting in oxidative stress, insulin resistance, and risk of developing metabolic complications. Our data also provide a rationale for nutritional interventions aimed at restoring Nrf-2 expression to reduce the risk of metabolic complications in OW boys.

  2. Activation of p62-keap1-Nrf2 antioxidant pathway in the early stage of acetaminophen-induced acute liver injury in mice.

    Science.gov (United States)

    Shen, Zhenyu; Wang, Yu; Su, Zhenhui; Kou, Ruirui; Xie, Keqin; Song, Fuyong

    2018-02-25

    Acetaminophen (APAP) overdose can cause severe liver failure even death. Nearly half of drug-induced liver injury is attributed to APAP in the US and many European countries. Oxidative stress has been validated as a critical event involved in APAP-induced liver failure. p62/SQSTM1, a selective autophagy adaptor protein, is reported to regulate Nrf2-ARE antioxidant pathway in response to oxidative stress. However, the exact role of p62-keap1-Nrf2 antioxidant pathway in APAP-induced hepatotoxicity remains unknown. In the present study, the dose-response and time-course model in C57/BL6 mice were established by intraperitoneal injection of APAP. The results of serum alanine/aspartate aminotransferases (ALT/AST) and histological examination demonstrated that APAP overdose resulted in the severe liver injury. In the meantime, the levels of p62, phospho-p62 and nuclear Nrf2 were significantly increased by APAP in mice liver, suggesting an activation of p62-keap1-Nrf2 pathway. In addition, the expression of GSTA1 mRNA was increased in a dose-dependent manner, while the mRNA levels of HO-1 and GCLC were decreased with the increase of APAP dose. Our further investigation found that expression of HO-1 and GCLC peaked at 3 h∼6 h, and then were decreased gradually. Taken together, these results indicated that p62-keap1-Nrf2 antioxidant pathway was primarily activated in the early stage of APAP hepatotoxicity, which might play a protective role in the process of APAP-induced acute liver injury. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  4. Calcineurin inhibitors recruit protein kinases JAK2 and JNK, TLR signaling and the UPR to activate NF-κB-mediated inflammatory responses in kidney tubular cells

    International Nuclear Information System (INIS)

    González-Guerrero, Cristian; Ocaña-Salceda, Carlos; Berzal, Sergio; Carrasco, Susana; Fernández-Fernández, Beatriz

    2013-01-01

    The calcineurin inhibitors (CNIs) cyclosporine (CsA) and tacrolimus are key drugs in current immunosuppressive regimes for solid organ transplantation. However, they are nephrotoxic and promote death and profibrotic responses in tubular cells. Moreover, renal inflammation is observed in CNI nephrotoxicity but the mechanisms are poorly understood. We have now studied molecular pathways leading to inflammation elicited by the CNIs in cultured and kidney tubular cells. Both CsA and tacrolimus elicited a proinflammatory response in tubular cells as evidenced by a transcriptomics approach. Transcriptomics also suggested several potential pathways leading to expression of proinflammatory genes. Validation and functional studies disclosed that in tubular cells, CNIs activated protein kinases such as the JAK2/STAT3 and TAK1/JNK/AP-1 pathways, TLR4/Myd88/IRAK signaling and the Unfolded Protein Response (UPR) to promote NF-κB activation and proinflammatory gene expression. CNIs also activated an Nrf2/HO-1-dependent compensatory response and the Nrf2 activator sulforaphane inhibited JAK2 and JNK activation and inflammation. A murine model of CsA nephrotoxicity corroborated activation of the proinflammatory pathways identified in cell cultures. Human CNIs nephrotoxicity was also associated with NF-κB, STAT3 and IRE1α activation. In conclusion, CNIs recruit several intracellular pathways leading to previously non-described proinflammatory actions in renal tubular cells. Identification of these pathways provides novel clues for therapeutic intervention to limit CNIs nephrotoxicity. - Highlights: • Molecular mechanisms modulating CNI renal inflammation were investigated. • Kinases, immune receptors and ER stress mediate the inflammatory response to CNIs. • Several intracellular pathways activate NF-κB in CNIs-treated tubular cells. • A NF-κB-dependent cytokine profile characterizes CNIs-induced inflammation. • CNI nephrotoxicity was associated to inflammatory

  5. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Benzo[a]pyrene affects Jurkat T cells in the activated state via the antioxidant response element dependent Nrf2 pathway leading to decreased IL-2 secretion and redirecting glutamine metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Murugaiyan, Jayaseelan; Rockstroh, Maxie; Wagner, Juliane [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Baumann, Sven [Department of Metabolomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Schorsch, Katrin [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Trump, Saskia; Lehmann, Irina [Department of Environmental Immunology, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Bergen, Martin von [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Department of Environmental Immunology, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany); Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aalborg (Denmark); Tomm, Janina M., E-mail: Janina.tomm@ufz.de [Department of Proteomics, Helmholtz-Centre for Environmental Research — UFZ, Permoserstr. 15, 04318 Leipzig (Germany)

    2013-06-15

    There is a clear evidence that environmental pollutants, such as benzo[a]pyrene (B[a]P), can have detrimental effects on the immune system, whereas the underlying mechanisms still remain elusive. Jurkat T cells share many properties with native T lymphocytes and therefore are an appropriate model to analyze the effects of environmental pollutants on T cells and their activation. Since environmental compounds frequently occur at low, not acute toxic concentrations, we analyzed the effects of two subtoxic concentrations, 50 nM and 5 μM, on non- and activated cells. B[a]P interferes directly with the stimulation process as proven by an altered IL-2 secretion. Furthermore, B[a]P exposure results in significant proteomic changes as shown by DIGE analysis. Pathway analysis revealed an involvement of the AhR independent Nrf2 pathway in the altered processes observed in unstimulated and stimulated cells. A participation of the Nrf2 pathway in the change of IL-2 secretion was confirmed by exposing cells to the Nrf2 activator tBHQ. tBHQ and 5 μM B[a]P caused similar alterations of IL-2 secretion and glutamine/glutamate metabolism. Moreover, the proteome changes in unstimulated cells point towards a modified regulation of the cytoskeleton and cellular stress response, which was proven by western blotting. Additionally, there is a strong evidence for alterations in metabolic pathways caused by B[a]P exposure in stimulated cells. Especially the glutamine/glutamate metabolism was indicated by proteome pathway analysis and validated by metabolite measurements. The detrimental effects were slightly enhanced in stimulated cells, suggesting that stimulated cells are more vulnerable to the environmental pollutant model compound B[a]P. - Highlights: • B[a]P affects the proteome of Jurkat T cells also at low concentrations. • Exposure to B[a]P (50 nM, 5 μM) did not change Jurkat T cell viability. • Both B[a]P concentrations altered the IL-2 secretion of stimulated cells.

  7. Involvement of activation of the Nrf2/ARE pathway in protection against 6-OHDA-induced SH-SY5Y cell death by α-iso-cubebenol.

    Science.gov (United States)

    Park, Sun Young; Kim, Do Yeon; Kang, Jong-Koo; Park, Geuntae; Choi, Young-Whan

    2014-09-01

    Free radical-mediated neurodegeneration is one of the many causes of Parkinson's disease (PD). As part of our ongoing studies on the identification of biologically active Schisandra chinensis components, we have isolated and structurally elucidated α-iso-cubebenol. This study was carried out in an attempt to clarify the neuroprotective effect of α-iso-cubebenol on toxin-insulted dopaminergic neuronal death using 6-hydroxy-dopamine (6-OHDA)-induced dopaminergic SH-SY5Y cells. α-iso-cubebenol significantly attenuated the loss of mitochondrial function (MTT assay) and membrane integrity (lactate dehydrogenase assay) associated with 6-OHDA-induced neurotoxicity. Pretreatment of the cells with α-iso-cubebenol diminished the intracellular accumulation of reactive oxygen species (ROS) and calcium in response to 6-OHDA. Moreover, α-iso-cubebenol protected against 6-OHDA-induced neurotoxicity through inhibition of SH-SY5Y cell apoptosis. In addition, JC-1 staining, which is a well-established measure of mitochondrial damage, was decreased after treatment with α-iso-cubebenol. Notably, α-iso-cubebenol inhibited the release of mitochondrial flavoprotein apoptosis inducing factor (AIF) from the mitochondria to the cytosol and nucleus following 6-OHDA treatment. In addition, α-iso-cubebenol reduced the 6-OHDA-induced phosphorylation of ERK and induced the phosphorylation of PKA, PKB, and CREB in a dose-dependent manner. Moreover, α-iso-cubebenol stimulated the activation of Nrf2, a downstream target of CREB. Furthermore, α-iso-cubebenol stimulated the expression of multiple antioxidant response genes (NQO-1 and HO-1). Finally, CREB and Nrf2 siRNA transfection diminished α-iso-cubebenol-mediated neuroprotection. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. High Nrf2 expression in alveolar type I pneumocytes is associated with low recurrences in primary spontaneous pneumothorax.

    Science.gov (United States)

    Chen, Yu-Wen; Chiu, Wen-Chin; Chou, Shah-Hwa; Su, Yu-Han; Huang, Ying-Fong; Lee, Yen-Lung; Yuan, Shyng-Shiou F; Lee, Yi-Chen

    2017-10-01

    Recurrent primary spontaneous pneumothorax (PSP) is a troublesome problem and a major concern for the patients. This study examined whether nuclear factor erythroid 2-related factor 2 (Nrf2) expression in alveolar type I pneumocytes was associated with the clinical manifestations of PSP patients including disease recurrence. Eighty-eight PSP patients who were managed with needlescopic video-assisted thoracoscopic surgery (NVATS) were included in this study. Immunohistochemistry (IHC) was assessed to determine Nrf2 expression in resected lung tissues and the results were correlated with clinicopathological characteristics by the chi-square or the Fisher's exact test. The prognostic value of Nrf2 for overall recurrence was evaluated by univariate and multivariable Cox regression model. The expression of Nrf2 was observed in type I pneumocytes of lung tissues from PSP patients by IHC. We found that low Nrf2 expression in PSP patients, especially in young (age ≤ 20, p = 0.033) and body mass index (BMI) ≥18 kg/m 2 (p = 0.019) groups, was significantly correlated with PSP recurrence. In the univariate and multivariate analyses, high Nrf2 expression was a significant protective factor for overall recurrence in PSP patients (univariate: p = 0.026; multivariate: p = 0.004). The expression level of Nrf2 in alveolar type I pneumocytes was a potential factor involved in PSP recurrence. Our findings suggest that elevated Nrf2 expression in PSP patients may be a promising way for reducing PSP recurrence. Copyright © 2017. Published by Elsevier Taiwan.

  9. Avenanthramides Prevent Osteoblast and Osteocyte Apoptosis and Induce Osteoclast Apoptosis in Vitro in an Nrf2-Independent Manner

    Directory of Open Access Journals (Sweden)

    Gretel G. Pellegrini

    2016-07-01

    Full Text Available Oats contain unique bioactive compounds known as avenanthramides (AVAs with antioxidant properties. AVAs might enhance the endogenous antioxidant cellular response by activation of the transcription factor Nrf2. Accumulation of reactive oxygen species plays a critical role in many chronic and degenerative diseases, including osteoporosis. In this disease, there is an imbalance between bone formation by osteoblasts and bone resorption by osteoclasts, which is accompanied by increased osteoblast/osteocyte apoptosis and decreased osteoclast apoptosis. We investigated the ability of the synthethic AVAs 2c, 2f and 2p, to 1-regulate gene expression in bone cells, 2-affect the viability of osteoblasts, osteocytes and osteoclasts, and the generation of osteoclasts from their precursors, and 3-examine the potential involvement of the transcription factor Nrf2 in these actions. All doses of AVA 2c and 1 and 5 µM dose of 2p up-regulated collagen 1A expression. Lower doses of AVAs up-regulated OPG (osteoprotegerin in OB-6 osteoblastic cells, whereas 100 μM dose of 2f and all concentrations of 2c down-regulated RANKL gene expression in MLO-Y4 osteocytic cells. AVAs did not affect apoptosis of OB-6 osteoblastic cells or MLO-Y4 osteocytic cells; however, they prevented apoptosis induced by the DNA topoisomerase inhibitor etoposide, the glucocorticoid dexamethasone, and hydrogen peroxide. AVAs prevented apoptosis of both wild type (WT and Nrf2 Knockout (KO osteoblasts, demonstrating that AVAs-induced survival does not require Nrf2 expression. Further, KO osteoclast precursors produced more mature osteoclasts than WT; and KO cultures exhibited less apoptotic osteoclasts than WT cultures. Although AVAs did not affect WT osteoclasts, AVA 2p reversed the low apoptosis of KO osteoclasts. These in vitro results demonstrate that AVAs regulate, in part, the function of osteoblasts and osteocytes and prevent osteoblast/osteocyte apoptosis and increase osteoclast

  10. Exercise increases hyper-acetylation of histones on the Cis-element of NRF-1 binding to the Mef2a promoter: Implications on type 2 diabetes.

    Science.gov (United States)

    Joseph, Jitcy S; Ayeleso, Ademola O; Mukwevho, Emmanuel

    2017-04-22

    Exercise brings changes on the chromatin ensuing the upregulation of many genes that confer protection from type 2 diabetes. In type-2 diabetes, critical genes are down-regulated such as those involved in glucose transport (GLUT4, MEF2A) and also oxidative phosphorylation (NRF-1 and its target genes). Recent reports have shown that NRF-1 not only regulate mitochondrial oxidative genes but also controls MEF2A, the main transcription factor for glucose transporter, GLUT4. Such dual control of the two pathways by NRF-1 place it as critical gene in the design of therapeutic modalities much needed to cure or better manage type 2 diabetes. Although it is known that NRF-1 controls these dual pathways (glucose transport and oxidative phosphorylation), the actual molecular mechanisms involved surrounding this regulation remains elusive. NRF-1 itself is regulated through posttranslational modifications (acetylation, methylation and phosphorylation) resulting in enhanced binding to its target genes. This study is therefore aimed at assessing whether CaMKII, a kinase activated by exercise brings about hyper-acetylation of histones in the vicinity of NRF-1 target gene, Mef2a. Five to six weeks old male Wistar rats were used in this study. Chromatin immunoprecipitation (ChIP) assay was used to investigate the extent through which NRF-1 is bound to the Mef2a gene and if this was associated with hyper-acetylation of histones in the region of NRF-1 binding site of the Mef2a gene. Quantitative real time PCR (qPCR) was used to determine the gene expression of MEF2A and NRF-1. Results from this study indicated that exercise-induced CaMKII activation increased hyper-acetylation of histones in the region of NRF-1 binding site on vicinity of Mef2a gene and this was associated with the increased binding of NRF-1 to Mef2a gene. Exercise also increased the expression of NRF-1 and MEF2A genes. Administration of CaMKII inhibitor (KN93) prior to exercise attenuated the observed exercise

  11. Defects of mtDNA Replication Impaired Mitochondrial Biogenesis During Trypanosoma cruzi Infection in Human Cardiomyocytes and Chagasic Patients: The Role of Nrf1/2 and Antioxidant Response

    Science.gov (United States)

    Wan, Xianxiu; Gupta, Shivali; Zago, Maria P.; Davidson, Mercy M.; Dousset, Pierre; Amoroso, Alejandro; Garg, Nisha Jain

    2012-01-01

    Background Mitochondrial dysfunction is a key determinant in chagasic cardiomyopathy development in mice; however, its relevance in human Chagas disease is not known. We determined if defects in mitochondrial biogenesis and dysregulation of peroxisome proliferator-activated receptor gamma (PPARγ) coactivator-1 (PGC-1)–regulated transcriptional pathways constitute a mechanism or mechanisms underlying mitochondrial oxidative-phosphorylation (OXPHOS) deficiency in human Chagas disease. Methods and Results We utilized human cardiomyocytes and left-ventricular tissue from chagasic and other cardiomyopathy patients and healthy donors (n>6/group). We noted no change in citrate synthase activity, yet mRNA and/or protein levels of subunits of the respiratory complexes were significantly decreased in Trypanosoma cruzi–infected cardiomyocytes (0 to 24 hours) and chagasic hearts. We observed increased mRNA and decreased nuclear localization of PGC-1-coactivated transcription factors, yet the expression of genes for PPARγ-regulated fatty acid oxidation and nuclear respiratory factor (NRF1/2)–regulated mtDNA replication and transcription machinery was enhanced in infected cardiomyocytes and chagasic hearts. The D-loop formation was normal or higher, but mtDNA replication and mtDNA content were decreased by 83% and 40% to 65%, respectively. Subsequently, we noted that reactive oxygen species (ROS), oxidative stress, and mtDNA oxidation were significantly increased, yet NRF1/2-regulated antioxidant gene expression remained compromised in infected cardiomyocytes and chagasic hearts. Conclusions The replication of mtDNA was severely compromised, resulting in a significant loss of mtDNA and expression of OXPHOS genes in T cruzi–infected cardiomyocytes and chagasic hearts. Our data suggest increased ROS generation and selective functional incapacity of NRF2-mediated antioxidant gene expression played a role in the defects in mtDNA replication and unfitness of mtDNA for

  12. The berry constituents quercetin, kaempferol, and pterostilbene synergistically attenuate reactive oxygen species: involvement of the Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony

    2014-10-01

    Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Uric acid demonstrates neuroprotective effect on Parkinson's disease mice through Nrf2-ARE signaling pathway.

    Science.gov (United States)

    Huang, Ting-Ting; Hao, Dong-Lin; Wu, Bo-Na; Mao, Lun-Lin; Zhang, Jin

    2017-12-02

    Uric acid has neuroprotective effect on Parkinson's disease (PD) by inhibiting oxidative damage and neuronal cell death. Our previous study has shown that uric acid protected dopaminergic cell line damage through inhibiting accumulation of NF-E2-related factor 2 (Nrf2). This study aimed to investigate its in vivo neuroprotective effect. PD was induced by MPTP intraperitoneally injection for 7 d in male C57BL/6 mice. Mice were treated with either uric acid (intraperitoneally injection 250 mg/kg) or saline for a total of 13 d. We showed that uric acid improved behavioral performances and cognition of PD mice, increased TH-positive dopaminergic neurons and decreased GFAP-positive astrocytes in substantia nigra (SN). Uric acid increased mRNA and protein expressions of Nrf2 and three Nrf2-responsive genes, including γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC), heme oxygenase-1 (HO-1) and NQO1. Uric acid significantly increased superoxide dismutase (SOD), CAT, glutathione (GSH) levels and decreased malondialdehyde (MDA) level in SN regions of MPTP-treated mice. Uric acid inhibited the hippocampal expression of IL-1β and decreased serum and hippocampus levels of interleukin-1β (IL-1β), IL-6 and tumor necrosis factor-α (TNF-α). In conclusion, uric acid demonstrates neuroprotective properties for dopaminergic neurons in PD mice through modulation of neuroinflammation and oxidative stress. Copyright © 2017. Published by Elsevier Inc.

  14. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality?

    Science.gov (United States)

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.

    2016-01-01

    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  15. Nitroxide delivery system for Nrf2 activation and skin protection.

    Science.gov (United States)

    Ben Yehuda Greenwald, Maya; Frušić-Zlotkin, Marina; Soroka, Yoram; Sasson, Shmuel Ben; Bianco-Peled, Havazelet; Bitton, Ronit; Kohen, Ron

    2015-08-01

    Cyclic nitroxides are a large group of compounds composed of diverse stable radicals also known as synthetic antioxidants. Although nitroxides are valuable for use in several skin conditions, in in vivo conditions they have several drawbacks, such as nonspecific dispersion in normal tissue, preferential renal clearance and rapid reduction of the nitroxide to the corresponding hydroxylamine. However, these drawbacks can be easily addressed by encapsulating the nitroxides within microemulsions. This approach would allow nitroxide activity and therefore their valuable effects (e.g. activation of the Keap1-Nrf2-EpRE pathway) to continue. In this work, nitroxides were encapsulated in a microemulsion composed of biocompatible ingredients. The nanometric size and shape of the vehicle microemulsion and nitroxide microemulsion displayed high similarity, indicating that the stability of the microemulsions was preserved. Our studies demonstrated that nitroxide microemulsions were more potent inducers of the Keap1-Nrf2-EpRE pathway than the free nitroxides, causing the activation of phase II enzymes. Moreover, microemulsions containing nitroxides significantly reduced UVB-induced cytotoxicity in the skin. Understanding the mechanism of this improved activity may expand the usage of many other Nrf2 modulating molecules in encapsulated form, as a skin protection strategy against oxidative stress-related conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid.

    Science.gov (United States)

    Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A

    2015-06-01

    Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.

  17. Cytochrome P450 2A5 and bilirubin: Mechanisms of gene regulation and cytoprotection

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sangsoo Daniel; Antenos, Monica [Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, N1G 2W1 (Canada); Squires, E. James [Department of Animal and Poultry Sciences, University of Guelph, Guelph, Ontario, N1G 2W1 (Canada); Kirby, Gordon M., E-mail: gkirby@uoguelph.ca [Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, N1G 2W1 (Canada)

    2013-07-15

    Bilirubin (BR) has recently been identified as the first endogenous substrate for cytochrome P450 2A5 (CYP2A5) and it has been suggested that CYP2A5 plays a major role in BR clearance as an alternative mechanism to BR conjugation by uridine-diphosphate glucuronyltransferase 1A1. This study investigated the mechanisms of Cyp2a5 gene regulation by BR and the cytoprotective role of CYP2A5 in BR hepatotoxicity. BR induced CYP2A5 expression at the mRNA and protein levels in a dose-dependent manner in primary mouse hepatocytes. BR treatment also caused nuclear translocation of Nuclear factor-E2 p45-related factor 2 (Nrf2) in hepatocytes. In reporter assays, BR treatment of primary hepatocytes transfected with a Cyp2a5 promoter-luciferase reporter construct resulted in a 2-fold induction of Cyp2a5 reporter activity. Furthermore, cotransfection of the hepatocytes with a Nrf2 expression vector without BR treatment resulted in an increase in Cyp2a5 reporter activity of approximately 2-fold and BR treatment of Nrf2 cotransfectants further increased reporter activity by 4-fold. In addition, site-directed mutation of the ARE in the reporter construct completely abolished both the BR- and Nrf2-mediated increases in reporter activity. The cytoprotective role of CYP2A5 against BR-mediated apoptosis was also examined in Hepa 1–6 cells that lack endogenous CYP2A5. Transient overexpression of CYP2A5 partially blocked BR-induced caspase-3 cleavage in Hepa 1–6 cells. Furthermore, in vitro degradation of BR was increased by microsomes from Hepa 1–6 cells overexpressing CYP2A5 compared to control cells transfected with an empty vector. Collectively, these results suggest that Nrf2-mediated CYP2A5 transactivation in response to BR may provide an additional mechanism for adaptive cytoprotection against BR hepatotoxicity. - Highlights: • The mechanism of Cyp2a5 gene regulation by BR was investigated. • The cytoprotective role of CYP2A5 in BR hepatotoxicity was determined. • BR

  18. Docosahexaenoic Acid (DHA) Provides Neuroprotection in Traumatic Brain Injury Models via Activating Nrf2-ARE Signaling.

    Science.gov (United States)

    Zhu, Wei; Ding, Yuexia; Kong, Wei; Li, Tuo; Chen, Hongguang

    2018-04-16

    In this study, we explored the neuroprotective effects of docosahexaenoic acid (DHA) in traumatic brain injury (TBI) models. In this study, we first confirmed that DHA was neuroprotective against TBI via the NSS test and Morris water maze experiment. Western blot was conducted to identify the expression of Bax, caspase-3, and Bcl-2. And the cell apoptosis of the TBI models was validated by TUNEL staining. Relationships between nuclear factor erythroid 2-related factor 2-antioxidant response element (Nrf2-ARE) pathway-related genes and DHA were explored by RT-PCR and Western blot. Rats of the DHA group performed remarkably better than those of the TBI group in both NSS test and water maze experiment. DHA conspicuously promoted the expression of Bcl-2 and diminished that of cleaved caspase-3 and Bax, indicating the anti-apoptotic role of DHA. Superoxide dismutase (SOD) activity and cortical malondialdehyde content, glutathione peroxidase (GPx) activity were renovated in rats receiving DHA treatment, implying that the neuroprotective influence of DHA was derived from lightening the oxidative stress caused by TBI. Moreover, immunofluorescence and Western blot experiments revealed that DHA facilitated the translocation of Nrf2 to the nucleus. DHA administration also notably increased the expression of the downstream factors NAD(P)H:quinone oxidoreductase (NQO-1) and heme oxygenase 1(HO-1). DHA exerted neuroprotective influence on the TBI models, potentially through activating the Nrf2- ARE pathway.

  19. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  20. Effects of trigonelline inhibition of the Nrf2 transcription factor in vitro on Echinococcus granulosus.

    Science.gov (United States)

    Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng

    2017-08-01

    The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For

  1. Dimethylfumarate attenuates restenosis after acute vascular injury by cell-specific and Nrf2-dependent mechanisms

    Directory of Open Access Journals (Sweden)

    Chang Joo Oh

    2014-01-01

    Full Text Available Excessive proliferation of vascular smooth muscle cells (VSMCs and incomplete re-endothelialization is a major clinical problem limiting the long-term efficacy of percutaneous coronary angioplasty. We tested if dimethylfumarate (DMF, an anti-psoriasis drug, could inhibit abnormal vascular remodeling via NF−E2-related factor 2 (Nrf2-NAD(PH quinone oxidoreductase 1 (NQO1 activity. DMF significantly attenuated neointimal hyperplasia induced by balloon injury in rat carotid arteries via suppression of the G1 to S phase transition resulting from induction of p21 protein in VSMCs. Initially, DMF increased p21 protein stability through an enhancement in Nrf2 activity without an increase in p21 mRNA. Later on, DMF stimulated p21 mRNA expression through a process dependent on p53 activity. However, heme oxygenase-1 (HO-1 or NQO1 activity, well-known target genes induced by Nrf2, were dispensable for the DMF induction of p21 protein and the effect on the VSMC proliferation. Likewise, DMF protected endothelial cells from TNF-α-induced apoptosis and the dysfunction characterized by decreased eNOS expression. With knock-down of Nrf2 or NQO1, DMF failed to prevent TNF-α-induced cell apoptosis and decreased eNOS expression. Also, CD31 expression, an endothelial specific marker, was restored in vivo by DMF. In conclusion, DMF prevented abnormal proliferation in VSMCs by G1 cell cycle arrest via p21 upregulation driven by Nrf2 and p53 activity, and had a beneficial effect on TNF-α-induced apoptosis and dysfunction in endothelial cells through Nrf2–NQO1 activity suggesting that DMF might be a therapeutic drug for patients with vascular disease.

  2. Complexity of CNC transcription factors as revealed by gene targeting of the Nrf3 locus.

    Science.gov (United States)

    Derjuga, Anna; Gourley, Tania S; Holm, Teresa M; Heng, Henry H Q; Shivdasani, Ramesh A; Ahmed, Rafi; Andrews, Nancy C; Blank, Volker

    2004-04-01

    Cap'n'collar (CNC) family basic leucine zipper transcription factors play crucial roles in the regulation of mammalian gene expression and development. To determine the in vivo function of the CNC protein Nrf3 (NF-E2-related factor 3), we generated mice deficient in this transcription factor. We performed targeted disruption of two Nrf3 exons coding for CNC homology, basic DNA-binding, and leucine zipper dimerization domains. Nrf3 null mice developed normally and revealed no obvious phenotypic differences compared to wild-type animals. Nrf3(-/-) mice were fertile, and gross anatomy as well as behavior appeared normal. The mice showed normal age progression and did not show any apparent additional phenotype during their life span. We observed no differences in various blood parameters and chemistry values. We infected wild-type and Nrf3(-/-) mice with acute lymphocytic choriomeningitis virus and found no differences in these animals with respect to their number of virus-specific CD8 and CD4 T cells as well as their B-lymphocyte response. To determine whether the mild phenotype of Nrf3 null animals is due to functional redundancy, we generated mice deficient in multiple CNC factors. Contrary to our expectations, an absence of Nrf3 does not seem to cause additional lethality in compound Nrf3(-/-)/Nrf2(-/-) and Nrf3(-/-)/p45(-/-) mice. We hypothesize that the role of Nrf3 in vivo may become apparent only after appropriate challenge to the mice.

  3. Identification of an unintended consequence of Nrf2-directed cytoprotection against a key tobacco carcinogen plus a counteracting chemopreventive intervention

    Science.gov (United States)

    Paonessa, Joseph D.; Ding, Yi; Randall, Kristen L.; Munday, Rex; Argoti, Dayana; Vouros, Paul; Zhang, Yuesheng

    2011-01-01

    Nrf2 is a major cytoprotective gene and is a key chemopreventive target against cancer and other diseases. Here we show that Nrf2 faces a dilemma in defense against 4-aminobiphenyl (ABP), a major human bladder carcinogen from tobacco smoke and other environmental sources. While Nrf2 protected mouse liver against ABP (which is metabolically activated in liver), the bladder level of N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP), the predominant ABP-DNA adduct formed in bladder cells and tissues, was markedly higher in Nrf2+/+ mice than in Nrf2−/− mice after ABP exposure. Notably, Nrf2 protected bladder cells against ABP in vitro. Mechanistic investigations showed that the dichotomous effects of Nrf2 could be explained at least partly by upregulation of UDP-glucuronosyltransferase (UGT). Nrf2 promoted conjugation of ABP with glucuronic acid in the liver, increasing urinary excretion of the conjugate. While glucuronidation of ABP and its metabolites is a detoxification process, these conjugates, which are excreted in urine, are known to be unstable in acidic urine, leading to delivery of the parent compounds to bladder. Hence, while higher liver UGT activity may protect the liver against ABP it increases bladder exposure to ABP. These findings raise concerns of potential bladder toxicity when Nrf2-activating chemopreventive agents are used in humans exposed to ABP, especially in smokers. We further demonstrate that 5,6-dihydrocyclopenta[c][1,2]-dithiole-3(4H)-thione (CPDT) significantly inhibits dG-C8-ABP formation in bladder cells and tissues, but does not appear to significantly modulate ABP-catalyzing UGT in liver. Thus, CPDT exemplifies a counteracting solution to the dilemma posed by Nrf2. PMID:21487034

  4. Ameliorating mitochondrial dysfunction restores carbon ion-induced cognitive deficits via co-activation of NRF2 and PINK1 signaling pathway

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2018-07-01

    Full Text Available Carbon ion therapy is a promising modality in radiotherapy to treat tumors, however, a potential risk of induction of late normal tissue damage should still be investigated and protected. The aim of the present study was to explore the long-term cognitive deficits provoked by a high-linear energy transfer (high-LET carbon ions in mice by targeting to hippocampus which plays a crucial role in memory and learning. Our data showed that, one month after 4 Gy carbon ion exposure, carbon ion irradiation conspicuously resulted in the impaired cognitive performance, neurodegeneration and neuronal cell death, as well as the reduced mitochondrial integrity, the disrupted activities of tricarboxylic acid cycle flux and electron transport chain, and the depressed antioxidant defense system, consequently leading to a decline of ATP production and persistent oxidative damage in the hippocampus region. Mechanistically, we demonstrated the disruptions of mitochondrial homeostasis and redox balance typically characterized by the disordered mitochondrial dynamics, mitophagy and glutathione redox couple, which is closely associated with the inhibitions of PINK1 and NRF2 signaling pathway as the key regulators of molecular responses in the context of neurotoxicity and neurodegenerative disorders. Most importantly, we found that administration with melatonin as a mitochondria-targeted antioxidant promoted the PINK1 accumulation on the mitochondrial membrane, and augmented the NRF2 accumulation and translocation. Moreover, melatonin pronouncedly enhanced the molecular interplay between NRF2 and PINK1. Furthermore, in the mouse hippocampal neuronal cells, overexpression of NRF2/PINK1 strikingly protected the hippocampal neurons from carbon ion-elicited toxic insults. Thus, these data suggest that alleviation of the sustained mitochondrial dysfunction and oxidative stress through co-modulation of NRF2 and PINK1 may be in charge of restoration of the cognitive

  5. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying [Department of Biochemical Science and Technology, College of Life Science, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China); Hsu, Ya-Wen [SunWay Biotechnology Company, Taipei, Taiwan (China); Pan, Tzu-Ming, E-mail: tmpan@ntu.edu.tw [Department of Biochemical Science and Technology, College of Life Science, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China)

    2013-11-01

    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to D-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. - Highlights: • Monascin acts as a PPARgamma agonist. • Monascin activates Nrf2 and AMPK. • Monascin promotes MG metabolism into D-lactic acid. • Monascin attenuates inflammation and diabetes in vivo.

  6. Tert-butylhydroquinone alleviates early brain injury and cognitive dysfunction after experimental subarachnoid hemorrhage: role of Keap1/Nrf2/ARE pathway.

    Directory of Open Access Journals (Sweden)

    Zhong Wang

    Full Text Available Tert-butylhydroquinone (tBHQ, an Nrf2 activator, has demonstrated neuroprotection against brain trauma and ischemic stroke in vivo. However, little work has been done with respect to its effect on early brain injury (EBI after subarachnoid hemorrhage (SAH. At the same time, as an oral medication, it may have extensive clinical applications for the treatment of SAH-induced cognitive dysfunction. This study was undertaken to evaluate the influence of tBHQ on EBI, secondary deficits of learning and memory, and the Keap1/Nrf2/ARE pathway in a rat SAH model. SD rats were divided into four groups: (1 Control group (n=40; (2 SAH group (n=40; (3 SAH+vehicle group (n=40; and (4 SAH+tBHQ group (n=40. All SAH animals were subjected to injection of autologous blood into the prechiasmatic cistern once in 20 s. In SAH+tBHQ group, tBHQ was administered via oral gavage at a dose of 12.5 mg/kg at 2 h, 12 h, 24 h, and 36 h after SAH. In the first set of experiments, brain samples were extracted and evaluated 48 h after SAH. In the second set of experiments, changes in cognition and memory were investigated in a Morris water maze. Results shows that administration of tBHQ after SAH significantly ameliorated EBI-related problems, such as brain edema, blood-brain barrier (BBB impairment, clinical behavior deficits, cortical apoptosis, and neurodegeneration. Learning deficits induced by SAH was markedly alleviated after tBHQ therapy. Treatment with tBHQ markedly up-regulated the expression of Keap1, Nrf2, HO-1, NQO1, and GSTα1 after SAH. In conclusion, the administration of tBHQ abated the development of EBI and cognitive dysfunction in this SAH model. Its action was probably mediated by activation of the Keap1/Nrf2/ARE pathway.

  7. Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605 Reduces Asbestos-Induced Cytotoxicity in an Nrf2-Dependent and -Independent Manner

    Directory of Open Access Journals (Sweden)

    Ralph A. Pietrofesa

    2018-03-01

    Full Text Available Asbestos exposure triggers inflammatory processes associated with oxidative stress and tissue damage linked to malignancy. LGM2605 is the synthetic lignan secoisolariciresinol diglucoside (SDG with free radical scavenging, antioxidant, and anti-inflammatory properties in diverse inflammatory cell and mouse models, including exposure to asbestos fibers. Nuclear factor-E2 related factor 2 (Nrf2 activation and boosting of endogenous tissue defenses were associated with the protective action of LGM2605 from asbestos-induced cellular damage. To elucidate the role of Nrf2 induction by LGM2605 in protection from asbestos-induced cellular damage, we evaluated LGM2605 in asbestos-exposed macrophages from wild-type (WT and Nrf2 disrupted (Nrf2−/− mice. Cells were pretreated with LGM2605 (50 µM and 100 µM and exposed to asbestos fibers (20 µg/cm2 and evaluated 8 h and 24 h later for inflammasome activation, secreted cytokine levels (interleukin-1β (IL-1β, interleukin-18 (IL-18, interleukin-6 (IL-6, and tumor necrosis factor alpha (TNFα, cytotoxicity and cell death, nitrosative stress, and Nrf2-regulated enzyme levels. Asbestos exposure induced robust oxidative and nitrosative stress, cell death and cytotoxicity, which were equally mitigated by LGM2605. Inflammasome activation was significantly attenuated in Nrf2−/− macrophages compared to WT, and the protective action of LGM2605 was seen only in WT cells. In conclusion, in a cell model of asbestos-induced toxicity, LGM2605 acts via protective mechanisms that may not involve Nrf2 activation.

  8. Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605) Reduces Asbestos-Induced Cytotoxicity in an Nrf2-Dependent and -Independent Manner

    Science.gov (United States)

    Pietrofesa, Ralph A.; Chatterjee, Shampa; Park, Kyewon; Arguiri, Evguenia; Albelda, Steven M.; Christofidou-Solomidou, Melpo

    2018-01-01

    Asbestos exposure triggers inflammatory processes associated with oxidative stress and tissue damage linked to malignancy. LGM2605 is the synthetic lignan secoisolariciresinol diglucoside (SDG) with free radical scavenging, antioxidant, and anti-inflammatory properties in diverse inflammatory cell and mouse models, including exposure to asbestos fibers. Nuclear factor-E2 related factor 2 (Nrf2) activation and boosting of endogenous tissue defenses were associated with the protective action of LGM2605 from asbestos-induced cellular damage. To elucidate the role of Nrf2 induction by LGM2605 in protection from asbestos-induced cellular damage, we evaluated LGM2605 in asbestos-exposed macrophages from wild-type (WT) and Nrf2 disrupted (Nrf2−/−) mice. Cells were pretreated with LGM2605 (50 µM and 100 µM) and exposed to asbestos fibers (20 µg/cm2) and evaluated 8 h and 24 h later for inflammasome activation, secreted cytokine levels (interleukin-1β (IL-1β), interleukin-18 (IL-18), interleukin-6 (IL-6), and tumor necrosis factor alpha (TNFα)), cytotoxicity and cell death, nitrosative stress, and Nrf2-regulated enzyme levels. Asbestos exposure induced robust oxidative and nitrosative stress, cell death and cytotoxicity, which were equally mitigated by LGM2605. Inflammasome activation was significantly attenuated in Nrf2−/− macrophages compared to WT, and the protective action of LGM2605 was seen only in WT cells. In conclusion, in a cell model of asbestos-induced toxicity, LGM2605 acts via protective mechanisms that may not involve Nrf2 activation. PMID:29498660

  9. Enhanced sensitivity of A549 cells to the cytotoxic action of anticancer drugs via suppression of Nrf2 by procyanidins from Cinnamomi Cortex extract

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuma, Tomokazu; Matsumoto, Takashi; Itoi, Ayano; Kawana, Ayako; Nishiyama, Takahito; Ogura, Kenichiro [Department of Drug Metabolism and Molecular Toxicology, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji-shi, Tokyo 192-0392 (Japan); Hiratsuka, Akira, E-mail: hiratuka@toyaku.ac.jp [Department of Drug Metabolism and Molecular Toxicology, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji-shi, Tokyo 192-0392 (Japan)

    2011-10-07

    Highlights: {yields} We found a novel inhibitor of Nrf2 known as a chemoresistance factor. {yields} Overexpressed Nrf2 in lung cancer cells was suppressed by Cinnamomi Cortex extract. {yields} Cytotoxic action of anticancer drugs in cells treated with the extract was enhanced. {yields} Procyanidin tetramers and pentamers were active components in suppressing Nrf2. -- Abstract: Nuclear factor-E2-related factor 2 (Nrf2) is an important cytoprotective transcription factor because Nrf2-regulated enzymes play a key role in antioxidant and detoxification processes. Recent studies have reported that lung cancer cells overexpressing Nrf2 exhibit increased resistance to chemotherapy. Suppression of overexpressed Nrf2 is needed for a new therapeutic approach against lung cancers. In the present study, we found that Cinnamomi Cortex extract (CCE) has an ability to suppress Nrf2-regulated enzyme activity and Nrf2 expression in human lung cancer A549 cells with high Nrf2 activity. Moreover, we demonstrated that CCE significantly enhances sensitivity of A549 cells to the cytotoxic action of doxorubicin and etoposide as well as increasing the intracellular accumulation of both drugs. These results suggest that CCE might be an effective concomitant agent to reduce anticancer drug resistance derived from Nrf2 overexpression. Bioactivity-guided fractionation revealed that procyanidin tetramers and pentamers contained in CCE were active components in suppressing Nrf2.

  10. Pharmacological targeting of GSK-3 and NRF2 provides neuroprotection in a preclinical model of tauopathy

    Directory of Open Access Journals (Sweden)

    Antonio Cuadrado

    2018-04-01

    Full Text Available Tauopathies are a group of neurodegenerative disorders where TAU protein is presented as aggregates or is abnormally phosphorylated, leading to alterations of axonal transport, neuronal death and neuroinflammation. Currently, there is no treatment to slow progression of these diseases. Here, we have investigated whether dimethyl fumarate (DMF, an inducer of the transcription factor NRF2, could mitigate tauopathy in a mouse model. The signaling pathways modulated by DMF were also studied in mouse embryonic fibroblast (MEFs from wild type or KEAP1-deficient mice. The effect of DMF on neurodegeneration, astrocyte and microglial activation was examined in Nrf2+/+ and Nrf2−/− mice stereotaxically injected in the right hippocampus with an adeno-associated vector expressing human TAUP301L and treated daily with DMF (100 mg/kg, i.g during three weeks. DMF induces the NRF2 transcriptional through a mechanism that involves KEAP1 but also PI3K/AKT/GSK-3-dependent pathways. DMF modulates GSK-3β activity in mouse hippocampi. Furthermore, DMF modulates TAU phosphorylation, neuronal impairment measured by calbindin-D28K and BDNF expression, and inflammatory processes involved in astrogliosis, microgliosis and pro-inflammatory cytokines production. This study reveals neuroprotective effects of DMF beyond disruption of the KEAP1/NRF2 axis by inhibiting GSK3 in a mouse model of tauopathy. Our results support repurposing of this drug for treatment of these diseases. Keywords: DMF, Inflammation, Neurodegeneration, NRF2, Oxidative stress, TAU/ GSK-3

  11. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician’s Expectation Be Matched by the Reality?

    Directory of Open Access Journals (Sweden)

    Christine A. Houghton

    2016-01-01

    Full Text Available The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2, comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements.

  12. PGC-1α-mediated adaptations in skeletal muscle

    DEFF Research Database (Denmark)

    Olesen, Jesper; Kiilerich, Kristian; Pilegaard, Henriette

    2010-01-01

    multiple pathways and functions underline the potential importance of PGC-1alpha in skeletal muscle adaptations in humans. The absence of exercise-induced PGC-1alpha-mediated gene regulation during a physical inactive lifestyle is suggested to lead to reduced oxidative capacity of skeletal muscle...... involved in angiogenesis and the anti-oxidant defence as well as to affect expression of inflammatory markers. Exercise increases PGC-1alpha transcription and potentially PGC-1alpha activity through post-translational modifications, and concomitant PGC-1alpha-mediated gene regulation is suggested...... to be an underlying mechanism for adaptations in skeletal muscle, when exercise is repeated. The current review presents some of the key findings in PGC-1alpha-mediated regulation of metabolically related, anti-oxidant and inflammatory proteins in skeletal muscle in the basal state and in response to exercise...

  13. Geospatial Information Response Team

    Science.gov (United States)

    Witt, Emitt C.

    2010-01-01

    Extreme emergency events of national significance that include manmade and natural disasters seem to have become more frequent during the past two decades. The Nation is becoming more resilient to these emergencies through better preparedness, reduced duplication, and establishing better communications so every response and recovery effort saves lives and mitigates the long-term social and economic impacts on the Nation. The National Response Framework (NRF) (http://www.fema.gov/NRF) was developed to provide the guiding principles that enable all response partners to prepare for and provide a unified national response to disasters and emergencies. The NRF provides five key principles for better preparation, coordination, and response: 1) engaged partnerships, 2) a tiered response, 3) scalable, flexible, and adaptable operations, 4) unity of effort, and 5) readiness to act. The NRF also describes how communities, tribes, States, Federal Government, privatesector, and non-governmental partners apply these principles for a coordinated, effective national response. The U.S. Geological Survey (USGS) has adopted the NRF doctrine by establishing several earth-sciences, discipline-level teams to ensure that USGS science, data, and individual expertise are readily available during emergencies. The Geospatial Information Response Team (GIRT) is one of these teams. The USGS established the GIRT to facilitate the effective collection, storage, and dissemination of geospatial data information and products during an emergency. The GIRT ensures that timely geospatial data are available for use by emergency responders, land and resource managers, and for scientific analysis. In an emergency and response capacity, the GIRT is responsible for establishing procedures for geospatial data acquisition, processing, and archiving; discovery, access, and delivery of data; anticipating geospatial needs; and providing coordinated products and services utilizing the USGS' exceptional pool of

  14. Protective Role of Nuclear Factor E2-Related Factor 2 against Acute Oxidative Stress-Induced Pancreatic β-Cell Damage

    Directory of Open Access Journals (Sweden)

    Jingqi Fu

    2015-01-01

    Full Text Available Oxidative stress is implicated in the pathogenesis of pancreatic β-cell dysfunction that occurs in both type 1 and type 2 diabetes. Nuclear factor E2-related factor 2 (NRF2 is a master regulator in the cellular adaptive response to oxidative stress. The present study found that MIN6 β-cells with stable knockdown of Nrf2 (Nrf2-KD and islets isolated from Nrf2-knockout mice expressed substantially reduced levels of antioxidant enzymes in response to a variety of stressors. In scramble MIN6 cells or wild-type islets, acute exposure to oxidative stressors, including hydrogen peroxide (H2O2 and S-nitroso-N-acetylpenicillamine, resulted in cell damage as determined by decrease in cell viability, reduced ATP content, morphology changes of islets, and/or alterations of apoptotic biomarkers in a concentration- and/or time-dependent manner. In contrast, silencing of Nrf2 sensitized MIN6 cells or islets to the damage. In addition, pretreatment of MIN6 β-cells with NRF2 activators, including CDDO-Im, dimethyl fumarate (DMF, and tert-butylhydroquinone (tBHQ, protected the cells from high levels of H2O2-induced cell damage. Given that reactive oxygen species (ROS are involved in regulating glucose-stimulated insulin secretion (GSIS and persistent activation of NRF2 blunts glucose-triggered ROS signaling and GSIS, the present study highlights the distinct roles that NRF2 may play in pancreatic β-cell dysfunction that occurs in different stages of diabetes.

  15. Inhibition of liver fibrosis by solubilized coenzyme Q10: Role of Nrf2 activation in inhibiting transforming growth factor-β1 expression

    International Nuclear Information System (INIS)

    Choi, Hoo-Kyun; Pokharel, Yuba Raj; Lim, Sung Chul; Han, Hyo-Kyung; Ryu, Chang Seon; Kim, Sang Kyum; Kwak, Mi Kyong; Kang, Keon Wook

    2009-01-01

    Coenzyme Q10 (CoQ10), an endogenous antioxidant, is important in oxidative phosphorylation in mitochondria. It has anti-diabetic and anti-cardiovascular disease effects, but its ability to protect against liver fibrosis has not been studied. Here, we assessed the ability of solubilized CoQ10 to improve dimethylnitrosamine (DMN)-induced liver fibrogenesis in mice. DMN treatments for 3 weeks produced a marked liver fibrosis as assessed by histopathological examination and tissue 4-hydroxyproline content. Solubilized CoQ10 (10 and 30 mg/kg) significantly inhibited both the increases in fibrosis score and 4-hydroxyproline content induced by DMN. Reverse transcription-polymerase chain reaction and Western blot analyses revealed that solubilized CoQ10 inhibited increases in the transforming growth factor-β1 (TGF-β1) mRNA and α-smooth muscle actin (α-SMA) protein by DMN. Interestingly, hepatic glutamate-cysteine ligase (GCL) and glutathione S-transferase A2 (GSTA2) were up-regulated in mice treated with CoQ10. Solubilized CoQ10 also up-regulated antioxidant enzymes such as catalytic subunits of GCL and GSTA2 via activating NF-E2 related factor2 (Nrf2)/antioxidant response element (ARE) in H4IIE hepatoma cells. Moreover, CoQ10's inhibition of α-SMA and TGF-β1 expressions disappeared in Nrf2-null MEF cells. In contrast, Nrf2 overexpression significantly decreased the basal expression levels of α-SMA and TGF-β1 in Nrf2-null MEF cells. These results demonstrated that solubilized CoQ10 inhibited DMN-induced liver fibrosis through suppression of TGF-β1 expression via Nrf2/ARE activation.

  16. Synthesis and Nrf2 Activating Ability of Thiourea and Vinyl Sulfoxide Derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Shim, Young Sun; Hwang, Hyun Sook; Nam, Ghilsoo; Choi, Kyung Il [Korea Institute of Science and Technology, Seoul (Korea, Republic of)

    2013-08-15

    Thiourea and vinyl sulfoxide derivatives were designed based on the structures of sulforaphene and gallic acid, prepared and tested for HO-1 inducing activity as a measure of Nrf2 activation, and inhibitory effect on NO production as a measure of anti-inflammatory activity. Both series of compounds showed moderate activity on HO-1 induction, and no inhibitory effect on NO production. Interestingly the thiourea compound 6d showed better HO-1 induction (71% SFN) than the corresponding isothiocyanate compound 6a (55% SFN). Overall, it seemed that more efficient electrophile is needed to get more effective Nrf2 activator.

  17. Functional Roles of Syk in Macrophage-Mediated Inflammatory Responses

    Science.gov (United States)

    Yi, Young-Su; Son, Young-Jin; Ryou, Chongsuk; Sung, Gi-Ho; Kim, Jong-Hoon; Cho, Jae Youl

    2014-01-01

    Inflammation is a series of complex biological responses to protect the host from pathogen invasion. Chronic inflammation is considered a major cause of diseases, such as various types of inflammatory/autoimmune diseases and cancers. Spleen tyrosine kinase (Syk) was initially found to be highly expressed in hematopoietic cells and has been known to play crucial roles in adaptive immune responses. However, recent studies have reported that Syk is also involved in other biological functions, especially in innate immune responses. Although Syk has been extensively studied in adaptive immune responses, numerous studies have recently presented evidence that Syk has critical functions in macrophage-mediated inflammatory responses and is closely related to innate immune response. This review describes the characteristics of Syk-mediated signaling pathways, summarizes the recent findings supporting the crucial roles of Syk in macrophage-mediated inflammatory responses and diseases, and discusses Syk-targeted drug development for the therapy of inflammatory diseases. PMID:25045209

  18. Functional Roles of Syk in Macrophage-Mediated Inflammatory Responses

    Directory of Open Access Journals (Sweden)

    Young-Su Yi

    2014-01-01

    Full Text Available Inflammation is a series of complex biological responses to protect the host from pathogen invasion. Chronic inflammation is considered a major cause of diseases, such as various types of inflammatory/autoimmune diseases and cancers. Spleen tyrosine kinase (Syk was initially found to be highly expressed in hematopoietic cells and has been known to play crucial roles in adaptive immune responses. However, recent studies have reported that Syk is also involved in other biological functions, especially in innate immune responses. Although Syk has been extensively studied in adaptive immune responses, numerous studies have recently presented evidence that Syk has critical functions in macrophage-mediated inflammatory responses and is closely related to innate immune response. This review describes the characteristics of Syk-mediated signaling pathways, summarizes the recent findings supporting the crucial roles of Syk in macrophage-mediated inflammatory responses and diseases, and discusses Syk-targeted drug development for the therapy of inflammatory diseases.

  19. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway.

    Science.gov (United States)

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao

    2014-04-06

    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Curcumin ameliorates dopaminergic neuronal oxidative damage via activation of the Akt/Nrf2 pathway.

    Science.gov (United States)

    Cui, Qunli; Li, Xin; Zhu, Hongcan

    2016-02-01

    Parkinson's disease (PD) is an age-related complex neurodegenerative disease that affects ≤ 80% of dopaminergic neurons in the substantia nigra pars compacta (SNpc). It has previously been suggested that mitochondrial dysfunction, oxidative stress and oxidative damage underlie the pathogenesis of PD. Curcumin, which is a major active polyphenol component extracted from the rhizomes of Curcuma longa (Zingiberaceae), has been reported to exert neuroprotective effects on an experimental model of PD. The present study conducted a series of in vivo experiments, in order to investigate the effects of curcumin on behavioral deficits, oxidative damage and related mechanisms. The results demonstrated that curcumin was able to significantly alleviate motor dysfunction and increase suppressed tyrosine hydroxylase (TH) activity in the SNpc of rotenone (ROT)-injured rats. Biochemical measurements indicated that rats pretreated with curcumin exhibited increased glutathione (GSH) levels, and reduced reactive oxygen species activity and malondialdehyde content. Mechanistic studies demonstrated that curcumin significantly restored the expression levels of heme oxygenase-1 and quinone oxidoreductase 1, thus ameliorating ROT-induced damage in vivo, via the phosphorylation of Akt and nuclear factor erythroid 2-related factor 2 (Nrf2). Further studies indicated that the Akt/Nrf2 signaling pathway was associated with the protective role of curcumin in ROT-treated rats. Inhibiting the Akt/Nrf2 pathway using a lentiviral vector containing Nrf2-specific short hairpin RNA, or the phosphoinositide 3-kinase inhibitor LY294002, markedly reduced the expression levels of TH and GSH, ultimately attenuating the neuroprotective effects of curcumin against oxidative damage. These results indicated that curcumin was able to significantly ameliorate ROT-induced dopaminergic neuronal oxidative damage in the SNpc of rats via activation of the Akt/Nrf2 signaling pathway.

  1. The triterpenoid corosolic acid blocks transformation and epigenetically reactivates Nrf2 in TRAMP-C1 prostate cells.

    Science.gov (United States)

    Yang, Jie; Wu, Renyi; Li, Wenji; Gao, Linbo; Yang, Yuqing; Li, Ping; Kong, Ah-Ng

    2018-04-01

    Corosolic acid (CRA) is found in various plants and has been used as a health food supplement worldwide. Although it has been reported that CRA exhibits significant anticancer activity, the effect of this compound on prostate cancer remains unknown. In this study, we investigated the effect of CRA on cellular transformation and the reactivation of nuclear factor erythroid 2-related factor 2 (Nrf2) through epigenetic regulation in TRAMP-C1 prostate cells. Specifically, we found that CRA inhibited anchorage-independent growth of prostate cancer TRAMP-C1 cells but not Nrf2 knockout prostate cancer TRAMP-C1 cells. Moreover, CRA induced mRNA and protein expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H Quinone Oxidoreductase 1 (NQO1). Bisulfite genomic sequencing and methylated DNA immunoprecipitation results revealed that CRA treatment decreased the level of methylation of the first five CpG sites of the Nrf2 promoter. Histone modification was analyzed using a chromatin immunoprecipitation (ChIP) assay, which revealed that CRA treatment increased the acetylation of histone H3 lysine 27 (H3K27ac) while decreasing the trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of Nrf2. Furthermore, CRA treatment attenuated the protein expression of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). These findings indicate that CRA has a significant anticancer effect in TRAMP-C1 cells, which could be partly attributed to epigenetics including its ability to epigenetically restore the expression of Nrf2. © 2017 Wiley Periodicals, Inc.

  2. Oxidative Stress in Cardiovascular Diseases: Involvement of Nrf2 Antioxidant Redox Signaling in Macrophage Foam Cells Formation

    Directory of Open Access Journals (Sweden)

    Bee Kee Ooi

    2017-11-01

    Full Text Available Oxidative stress is an important risk factor contributing to the pathogenesis of cardiovascular diseases. Oxidative stress that results from excessive reactive oxygen species (ROS production accounts for impaired endothelial function, a process which promotes atherosclerotic lesion or fatty streaks formation (foam cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a transcription factor involved in cellular redox homeostasis. Upon exposure to oxidative stress, Nrf2 is dissociated from its inhibitor Keap-1 and translocated into the nucleus, where it results in the transcriptional activation of cell defense genes. Nrf2 has been demonstrated to be involved in the protection against foam cells formation by regulating the expression of antioxidant proteins (HO-1, Prxs, and GPx1, ATP-binding cassette (ABC efflux transporters (ABCA1 and ABCG1 and scavenger receptors (scavenger receptor class B (CD36, scavenger receptor class A (SR-A and lectin-type oxidized LDL receptor (LOX-1. However, Nrf2 has also been reported to exhibit pro-atherogenic effects. A better understanding on the mechanism of Nrf2 in oxidative stress-induced cardiac injury, as well as the regulation of cholesterol uptake and efflux, are required before it can serve as a novel therapeutic target for cardiovascular diseases prevention and treatment.

  3. Effects of various feeding patterns of Bacillus coagulans on growth performance, antioxidant response and Nrf2-Keap1 signaling pathway in juvenile gibel carp (Carassius auratus gibelio).

    Science.gov (United States)

    Yu, Yebing; Wang, Changhai; Wang, Aimin; Yang, Wenping; Lv, Fu; Liu, Fei; Liu, Bo; Sun, Cunxin

    2018-02-01

    The present study was conducted to evaluate the effects of various Bacillus coagulans feeding patterns on growth, antioxidant parameter and Nrf2 pathway in juvenile gibel carp. The similar size of gibel carp (initial weight: 14.33 ± 0.15 g) were subjected to three levels of B. coagulans supplementation (0, 500, and 1000 mg/kg) and two feeding modes (supplementing B. coagulans continuously or for two days of B. coagulans after 5 days of a basal diet) according to a 3 × 2 factorial design. The fish that were continuously fed 500 mg/kg B. coagulans (P2) and those fed the first basal diet for 5 days followed by 500 mg/kg or 1000 mg/kg B.coagulans for 2 days (P4 or P5) showed higher weight gain rate and specific growth rate than the other groups. Blood respiratory burst (RB), myeloperoxidase (MPO), and anti-superoxide anion free radical (AFASER) activities in the P4 group were higher than those of the control. White blood cell count (WBC), RB activity, MPO activity, and glutathione (GSH) content in the P5 group were also higher than those of the control. A similar higher trend was observed in the gene expressions of NADPH oxidase 2 (NOX2), NFE2-related factor (Nrf2), Kelch-like-ECH-associated protein(Keap1) in the P4 and NOX2, NRF2, CNC homolog 1 (Bach1), peroxiredoxin 2 (Prx2) in the P5 group compared with the control. Additionally, we observed a significantly lower level of plasma aspartate aminotransferase (AST), lower activity of alanine aminotransferase (ALT), a higher level of MPO, higher GPX activity, and increased NRF2 and Prx2 expression were all observed in the P2 treatment group compared with the control. Furthermore, the malondialdehyde (MDA) content in the P2, P3, and P4 groups was lower than that of the control. These results indicate that a diet supplemented with appropriate levels of B.coagulans could improve the growth, immune response, and antioxidant capability of gibel carp. We concluded that the pattern of two days of 500 or 1000 mg/kg B

  4. Skin Redox Balance Maintenance: The Need for an Nrf2-Activator Delivery System

    Directory of Open Access Journals (Sweden)

    Maya Ben-Yehuda Greenwald

    2016-01-01

    Full Text Available The skin, being the largest organ of the body, functions as a barrier between our body and the environment. It is consistently exposed to various exogenous and endogenous stressors (e.g., air pollutants, ionizing and non-ionizing irradiation, toxins, mitochondrial metabolism, enzyme activity, inflammatory process, etc. producing reactive oxygen species (ROS and physical damage (e.g., wounds, sunburns also resulting in reactive oxygen species production. Although skin is equipped with an array of defense mechanisms to counteract reactive oxygen species, augmented exposure and continued reactive oxygen species might result in excessive oxidative stress leading to many skin disorders including inflammatory diseases, pigmenting disorders and some types of cutaneous malignancy. The nuclear factor erythroid 2-related factor 2 (Nrf2 is an emerging regulator of cellular resistance and of defensive enzymes such as the phase II enzymes. Induction of the Keap1–Nrf2 pathway may have a beneficial effect in the treatment of a large number of skin disorders by stimulating an endogenous defense mechanism. However, prolonged and enhanced activation of this pathway is detrimental and, thus, limits the therapeutic potential of Keap1–Nrf2 modulators. Here, we review the consequences of oxidative stress to the skin, and the defense mechanisms that skin is equipped with. We describe the challenges of maintaining skin redox balance and its impact on skin status and function. Finally, we suggest a novel strategy for maintenance of skin redox homeostasis by modulating the Keap1–Nrf2 pathway using nanotechnology-based delivery systems.

  5. Membrane transporters mediating root signalling and adaptive responses to oxygen deprivation and soil flooding.

    Science.gov (United States)

    Shabala, Sergey; Shabala, Lana; Barcelo, Juan; Poschenrieder, Charlotte

    2014-10-01

    This review provides a comprehensive assessment of a previously unexplored topic: elucidating the role that plasma- and organelle-based membrane transporters play in plant-adaptive responses to flooding. We show that energy availability and metabolic shifts under hypoxia and anoxia are critical in regulating membrane-transport activity. We illustrate the high tissue and time dependence of this regulation, reveal the molecular identity of transporters involved and discuss the modes of their regulation. We show that both reduced oxygen availability and accumulation of transition metals in flooded roots result in a reduction in the cytosolic K(+) pool, ultimately determining the cell's fate and transition to programmed cell death (PCD). This process can be strongly affected by hypoxia-induced changes in the amino acid pool profile and, specifically, ϒ-amino butyric acid (GABA) accumulation. It is suggested that GABA plays an important regulatory role, allowing plants to proceed with H2 O2 signalling to activate a cascade of genes that mediate plant adaptation to flooding while at the same time, preventing the cell from entering a 'suicide program'. We conclude that progress in crop breeding for flooding tolerance can only be achieved by pyramiding the numerous physiological traits that confer efficient energy maintenance, cytosolic ion homeostasis, and reactive oxygen species (ROS) control and detoxification. © 2014 John Wiley & Sons Ltd.

  6. Estrogenic Endocrine Disrupting Chemicals Influencing NRF1 Regulated Gene Networks in the Development of Complex Human Brain Diseases.

    Science.gov (United States)

    Preciados, Mark; Yoo, Changwon; Roy, Deodutta

    2016-12-13

    During the development of an individual from a single cell to prenatal stages to adolescence to adulthood and through the complete life span, humans are exposed to countless environmental and stochastic factors, including estrogenic endocrine disrupting chemicals. Brain cells and neural circuits are likely to be influenced by estrogenic endocrine disruptors (EEDs) because they strongly dependent on estrogens. In this review, we discuss both environmental, epidemiological, and experimental evidence on brain health with exposure to oral contraceptives, hormonal therapy, and EEDs such as bisphenol-A (BPA), polychlorinated biphenyls (PCBs), phthalates, and metalloestrogens, such as, arsenic, cadmium, and manganese. Also we discuss the brain health effects associated from exposure to EEDs including the promotion of neurodegeneration, protection against neurodegeneration, and involvement in various neurological deficits; changes in rearing behavior, locomotion, anxiety, learning difficulties, memory issues, and neuronal abnormalities. The effects of EEDs on the brain are varied during the entire life span and far-reaching with many different mechanisms. To understand endocrine disrupting chemicals mechanisms, we use bioinformatics, molecular, and epidemiologic approaches. Through those approaches, we learn how the effects of EEDs on the brain go beyond known mechanism to disrupt the circulatory and neural estrogen function and estrogen-mediated signaling. Effects on EEDs-modified estrogen and nuclear respiratory factor 1 (NRF1) signaling genes with exposure to natural estrogen, pharmacological estrogen-ethinyl estradiol, PCBs, phthalates, BPA, and metalloestrogens are presented here. Bioinformatics analysis of gene-EEDs interactions and brain disease associations identified hundreds of genes that were altered by exposure to estrogen, phthalate, PCBs, BPA or metalloestrogens. Many genes modified by EEDs are common targets of both 17 β-estradiol (E2) and NRF1. Some of

  7. Estrogenic Endocrine Disrupting Chemicals Influencing NRF1 Regulated Gene Networks in the Development of Complex Human Brain Diseases

    Directory of Open Access Journals (Sweden)

    Mark Preciados

    2016-12-01

    Full Text Available During the development of an individual from a single cell to prenatal stages to adolescence to adulthood and through the complete life span, humans are exposed to countless environmental and stochastic factors, including estrogenic endocrine disrupting chemicals. Brain cells and neural circuits are likely to be influenced by estrogenic endocrine disruptors (EEDs because they strongly dependent on estrogens. In this review, we discuss both environmental, epidemiological, and experimental evidence on brain health with exposure to oral contraceptives, hormonal therapy, and EEDs such as bisphenol-A (BPA, polychlorinated biphenyls (PCBs, phthalates, and metalloestrogens, such as, arsenic, cadmium, and manganese. Also we discuss the brain health effects associated from exposure to EEDs including the promotion of neurodegeneration, protection against neurodegeneration, and involvement in various neurological deficits; changes in rearing behavior, locomotion, anxiety, learning difficulties, memory issues, and neuronal abnormalities. The effects of EEDs on the brain are varied during the entire life span and far-reaching with many different mechanisms. To understand endocrine disrupting chemicals mechanisms, we use bioinformatics, molecular, and epidemiologic approaches. Through those approaches, we learn how the effects of EEDs on the brain go beyond known mechanism to disrupt the circulatory and neural estrogen function and estrogen-mediated signaling. Effects on EEDs-modified estrogen and nuclear respiratory factor 1 (NRF1 signaling genes with exposure to natural estrogen, pharmacological estrogen-ethinyl estradiol, PCBs, phthalates, BPA, and metalloestrogens are presented here. Bioinformatics analysis of gene-EEDs interactions and brain disease associations identified hundreds of genes that were altered by exposure to estrogen, phthalate, PCBs, BPA or metalloestrogens. Many genes modified by EEDs are common targets of both 17 β-estradiol (E2 and

  8. HSPB8 and BAG3 cooperate to promote spatial sequestration of ubiquitinated proteins and coordinate the cellular adaptive response to proteasome insufficiency.

    Science.gov (United States)

    Guilbert, Solenn M; Lambert, Herman; Rodrigue, Marc-Antoine; Fuchs, Margit; Landry, Jacques; Lavoie, Josée N

    2018-02-05

    BCL2-associated athanogene (BAG)-3 is viewed as a platform that would physically and functionally link distinct classes of molecular chaperones of the heat shock protein (HSP) family for the stabilization and clearance of damaged proteins. In this study, we show that HSPB8, a member of the small heat shock protein subfamily, cooperates with BAG3 to coordinate the sequestration of harmful proteins and the cellular adaptive response upon proteasome inhibition. Silencing of HSPB8, like depletion of BAG3, inhibited targeting of ubiquitinated proteins to the juxtanuclear aggresome, a mammalian system of spatial quality control. However, aggresome targeting was restored in BAG3-depleted cells by a mutant BAG3 defective in HSPB8 binding, uncoupling HSPB8 function from its binding to BAG3. Depletion of HSPB8 impaired formation of ubiquitinated microaggregates in an early phase and interfered with accurate modifications of the stress sensor p62/sequestosome (SQSTM)-1. This impairment correlated with decreased coupling of BAG3 to p62/SQSTM1 in response to stress, hindering Kelch-like ECH-associated protein (KEAP)-1 sequestration and stabilization of nuclear factor E2-related factor (Nrf)-2, an important arm of the antioxidant defense. Notably, the myopathy-associated mutation of BAG3 (P209L), which lies within the HSPB8-binding motif, deregulated the association between BAG3 and p62/SQSTM1 and the KEAP1-Nrf2 signaling axis. Together, our findings support a so-far-unrecognized role for the HSPB8-BAG3 connection in mounting of an efficient stress response, which may be involved in BAG3-related human diseases.-Guilbert, S. M., Lambert, H., Rodrigue, M.-A., Fuchs, M., Landry, J., Lavoie, J. N. HSPB8 and BAG3 cooperate to promote spatial sequestration of ubiquitinated proteins and coordinate the cellular adaptive response to proteasome insufficiency.

  9. Activating Nrf-2 signaling depresses unilateral ureteral obstruction-evoked mitochondrial stress-related autophagy, apoptosis and pyroptosis in kidney.

    Directory of Open Access Journals (Sweden)

    Shue Dong Chung

    Full Text Available Exacerbated oxidative stress and inflammation may induce three types of programmed cell death, autophagy, apoptosis and pyroptosis in unilateral ureteral obstruction (UUO kidney. Sulforaphane activating NF-E2-related nuclear factor erythroid-2 (Nrf-2 signaling may ameliorate UUO-induced renal damage. UUO was induced in the left kidney of female Wistar rats. The level of renal blood flow, cortical and medullary oxygen tension and reactive oxygen species (ROS was evaluated. Fibrosis, ED-1 (macrophage/monocyte infiltration, oxidative stress, autophagy, apoptosis and pyroptosis were evaluated by immunohistochemistry and Western blot in UUO kidneys. Effects of sulforaphane, an Nrf-2 activator, on Nrf-2- and mitochondrial stress-related proteins and renal injury were examined. UUO decreased renal blood flow and oxygen tension and increased renal ROS, 3-nitrotyrosine stain, ED-1 infiltration and fibrosis. Enhanced renal tubular Beclin-1 expression started at 4 h UUO and further enhanced at 3d UUO, whereas increased Atg-5-Atg12 and LC3-II expression were found at 3d UUO. Increased renal Bax/Bcl-2 ratio, caspase 3 and PARP fragments, apoptosis formation associated with increased caspase 1 and IL-1β expression for pyroptosis formation were started from 3d UUO. UUO reduced nuclear Nrf-2 translocation, increased cytosolic and inhibitory Nrf-2 expression, increased cytosolic Bax translocation to mitochondrial and enhanced mitochondrial Cytochrome c release into cytosol of the UUO kidneys. Sulforaphane significantly increased nuclear Nrf-2 translocation and decreased mitochondrial Bax translocation and Cytochrome c release into cytosol resulting in decreased renal injury. In conclusion, sulforaphane via activating Nrf-2 signaling preserved mitochondrial function and suppressed UUO-induced renal oxidative stress, inflammation, fibrosis, autophagy, apoptosis and pyroptosis.

  10. Curcumin Pretreatment Induces Nrf2 and an Antioxidant Response and Prevents Hemin-Induced Toxicity in Primary Cultures of Cerebellar Granule Neurons of Rats

    Directory of Open Access Journals (Sweden)

    Susana González-Reyes

    2013-01-01

    Full Text Available Curcumin is a bifunctional antioxidant derived from Curcuma longa. This study identifies curcumin as a neuroprotectant against hemin-induced damage in primary cultures of cerebellar granule neurons (CGNs of rats. Hemin, the oxidized form of heme, is a highly reactive compound that induces cellular injury. Pretreatment of CGNs with 5–30 μM curcumin effectively increased by 2.3–4.9 fold heme oxygenase-1 (HO-1 expression and by 5.6–14.3-fold glutathione (GSH levels. Moreover, 15 μM curcumin attenuated by 55% the increase in reactive oxygen species (ROS production, by 94% the reduction of GSH/glutathione disulfide (GSSG ratio, and by 49% the cell death induced by hemin. The inhibition of heme oxygenase system or GSH synthesis with tin mesoporphyrin and buthionine sulfoximine, respectively, suppressed the protective effect of curcumin against hemin-induced toxicity. These data strongly suggest that HO-1 and GSH play a major role in the protective effect of curcumin. Furthermore, it was found that 24 h of incubation with curcumin increases by 1.4-, 2.3-, and 5.2-fold the activity of glutathione reductase, glutathione S-transferase and superoxide dismutase, respectively. Additionally, it was found that curcumin was capable of inducing nuclear factor (erythroid-derived 2-like 2 (Nrf2 translocation into the nucleus. These data suggest that the pretreatment with curcumin induces Nrf2 and an antioxidant response that may play an important role in the protective effect of this antioxidant against hemin-induced neuronal death.

  11. Curcumin Pretreatment Induces Nrf2 and an Antioxidant Response and Prevents Hemin-Induced Toxicity in Primary Cultures of Cerebellar Granule Neurons of Rats

    Science.gov (United States)

    González-Reyes, Susana; Guzmán-Beltrán, Silvia; Medina-Campos, Omar Noel; Pedraza-Chaverri, José

    2013-01-01

    Curcumin is a bifunctional antioxidant derived from Curcuma longa. This study identifies curcumin as a neuroprotectant against hemin-induced damage in primary cultures of cerebellar granule neurons (CGNs) of rats. Hemin, the oxidized form of heme, is a highly reactive compound that induces cellular injury. Pretreatment of CGNs with 5–30 μM curcumin effectively increased by 2.3–4.9 fold heme oxygenase-1 (HO-1) expression and by 5.6–14.3-fold glutathione (GSH) levels. Moreover, 15 μM curcumin attenuated by 55% the increase in reactive oxygen species (ROS) production, by 94% the reduction of GSH/glutathione disulfide (GSSG) ratio, and by 49% the cell death induced by hemin. The inhibition of heme oxygenase system or GSH synthesis with tin mesoporphyrin and buthionine sulfoximine, respectively, suppressed the protective effect of curcumin against hemin-induced toxicity. These data strongly suggest that HO-1 and GSH play a major role in the protective effect of curcumin. Furthermore, it was found that 24 h of incubation with curcumin increases by 1.4-, 2.3-, and 5.2-fold the activity of glutathione reductase, glutathione S-transferase and superoxide dismutase, respectively. Additionally, it was found that curcumin was capable of inducing nuclear factor (erythroid-derived 2)-like 2 (Nrf2) translocation into the nucleus. These data suggest that the pretreatment with curcumin induces Nrf2 and an antioxidant response that may play an important role in the protective effect of this antioxidant against hemin-induced neuronal death. PMID:24454990

  12. Butylated hydroxyanisole induces distinct expression patterns of Nrf2 and detoxification enzymes in the liver and small intestine of C57BL/6 mice

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Lin [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Department of Pharmacology, University of Nantong, Nantong (China); Chen, Yeru; Wu, Deqi; Shou, Jiafeng [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Shengcun [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Ye, Jie [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: xiuwentang@zju.edu.cn [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun, E-mail: xjwang@zju.edu.cn [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China)

    2015-11-01

    Butylated hydroxyanisole (BHA) is widely used as an antioxidant and preservative in food, food packaging and medicines. Its chemopreventive properties are attributing to its ability to activate the transcription factor NF-E2 p45-related factor 2 (Nrf2), which directs central genetic programs of detoxification and protection against oxidative stress. This study was to investigate the histological changes of Nrf2 and its regulated phase II enzymes Nqo1, AKR1B8, and Ho-1 in wild-type (WT) and Nrf2{sup −/−} mice induced by BHA. The mice were given a 200 mg/kg oral dose of BHA daily for three days. Immunohistochemistry revealed that, in the liver from WT mice, BHA increased Nqo1 staining in hepatocytes, predominately in the pericentral region. In contrast, the induction of AKR1B8 appeared mostly in hepatocytes in the periportal region. The basal and inducible Ho-1 was located almost exclusively in Kupffer cells. In the small intestine from WT mice, the inducible expression patterns of Nqo1 and AKR1B8 were nearly identical to that of Nrf2, with more intense staining in the villus than that the crypt. Conversely, Keap1 was more highly expressed in the crypt, where the proliferative cells reside. Our study demonstrates that BHA elicited differential expression patterns of phase II-detoxifying enzymes in the liver and small intestine from WT but not Nrf2{sup −/−} mice, demonstrating a cell type specific response to BHA in vivo. - Highlights: • Histological view of basal and inducible Nrf2 and its targets in vivo • Induction of detoxification enzymes by BHA is cell-type dependent. • BHA induces the expression of HO-1 in Kupffer cells.

  13. The novel triterpenoid RTA 408 protects human retinal pigment epithelial cells against H2O2-induced cell injury via NF-E2-related factor 2 (Nrf2 activation

    Directory of Open Access Journals (Sweden)

    Xiaobin Liu

    2016-08-01

    Full Text Available Oxidative stress-induced retinal pigment epithelial (RPE cell damage is an important factor in the pathogenesis of age-related macular degeneration (AMD. Previous studies have shown that RTA 408, a synthetic triterpenoid compound, potently activates Nrf2. This study aimed to investigate the protective effects of RTA 408 in cultured RPE cells during oxidative stress and to determine the effects of RTA 408 on Nrf2 and its downstream target genes. Primary human RPE cells were pretreated with RTA 408 and then incubated in 200 μM H2O2 for 6 h. Cell viability was measured with the WST-8 assay. Apoptosis was quantitatively measured by annexin V/propidium iodide (PI double staining and Hoechst 33342 fluorescent staining. Reduced (GSH and oxidized glutathione (GSSG were measured using colorimetric assays. Nrf2 activation and its downstream effects on phase II enzymes were examined by Western blot. Treatment of RPE cells with nanomolar ranges (10 and 100 nM of RTA 408 markedly attenuated H2O2-induced viability loss and apoptosis. RTA 408 pretreatment significantly protected cells from oxidative stress-induced GSH loss, GSSG formation and decreased ROS production. RTA 408 activated Nrf2 and increased the expression of its downstream genes, such as HO-1, NQO1, SOD2, catalase, Grx1, and Trx1. Consequently, the enzyme activities of NQO1, Grx1, and Trx1 were fully protected by RTA 408 pretreatment under oxidative stress. Moreover, knockdown of Nrf2 by siRNA significantly reduced the cytoprotective effects of RTA 408. In conclusion, our data suggest that RTA 408 protect primary human RPE cells from oxidative stress-induced damage by activating Nrf2 and its downstream genes.

  14. Contrast adaptation in cat visual cortex is not mediated by GABA.

    Science.gov (United States)

    DeBruyn, E J; Bonds, A B

    1986-09-24

    The possible involvement of gamma-aminobutyric acid (GABA) in contrast adaptation in single cells in area 17 of the cat was investigated. Iontophoretic application of N-methyl bicuculline increased cell responses, but had no effect on the magnitude of adaptation. These results suggest that contrast adaptation is the result of inhibition through a parallel pathway, but that GABA does not mediate this process.

  15. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation

    Directory of Open Access Journals (Sweden)

    Yang Bai

    2015-01-01

    Full Text Available Cardiovascular disease (CVD causes an unparalleled proportion of the global burden of disease and will remain the main cause of mortality for the near future. Oxidative stress plays a major role in the pathophysiology of cardiac disorders. Several studies have highlighted the cardinal role played by the overproduction of reactive oxygen or nitrogen species in the pathogenesis of ischemic myocardial damage and consequent cardiac dysfunction. Isothiocyanates (ITC are sulfur-containing compounds that are broadly distributed among cruciferous vegetables. Sulforaphane (SFN is an ITC shown to possess anticancer activities by both in vivo and epidemiological studies. Recent data have indicated that the beneficial effects of SFN in CVD are due to its antioxidant and anti-inflammatory properties. SFN activates NF-E2-related factor 2 (Nrf2, a basic leucine zipper transcription factor that serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than a hundred cytoprotective proteins, including antioxidants and phase II detoxifying enzymes. This review will summarize the evidence from clinical studies and animal experiments relating to the potential mechanisms by which SFN modulates Nrf2 activation and protects against CVD.

  16. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Intermittent hypoxia simulating obstructive sleep apnea causes pulmonary inflammation and activates the Nrf2/HO-1 pathway.

    Science.gov (United States)

    Wang, Yeying; Chai, Yanling; He, Xiaojie; Ai, Li; Sun, Xia; Huang, Yiling; Li, Yongxia

    2017-10-01

    Obstructive sleep apnea (OSA) is a disorder with high morbidity in adults. OSA damages multiple organs and tissues, including the cardiovascular and cerebrovascular systems, the metabolism system, the lungs, liver and heart. OSA-induced damage is earliest and greatest to the pulmonary tissue. The present study established a rat OSA model of differing severity by inducing intermittent hypoxia with different concentrations of O 2 and it was determined that OSA caused a severe oxidative stress response and pulmonary inflammation in a dose-dependent manner. OSA increased serum levels of C-reactive protein and 8-isoprostane and elevated the expression of malondialdehyde, tumor necrosis factor α, interleukin (IL)-1β and IL-6 in the pulmonary tissue. Furthermore, the expression of two important antioxidants, superoxide dismutase and glutathione, was downregulated following intermittent hypoxia. By contrast, levels of cylooxygenase 2 and inducible nitric oxide synthase, which are crucial in the antioxidative response, increased. In addition, OSA activates the nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase (OH)-1 antioxidative signaling pathway. Finally, all increases and decreases in levels of inflammatory and antioxidative substances were dependent on oxygen concentrations. Therefore, the present study demonstrated that OSA, simulated by intermittent hypoxia, caused an oxidative stress response and pulmonary inflammation, and activated the canonical antioxidative Nrf2/HO-1 signaling pathway in a dose-dependent manner. These results may facilitate the development of clinical therapies to treat pulmonary diseases caused by OSA.

  18. Role of Nrf2 and protective effects of Metformin against tobacco smoke-induced cerebrovascular toxicity

    Directory of Open Access Journals (Sweden)

    Shikha Prasad

    2017-08-01

    Full Text Available Cigarette smoking (CS is associated with vascular endothelial dysfunction in a causative way primarily related to the TS content of reactive oxygen species (ROS, nicotine, and inflammation. TS promotes glucose intolerance and increases the risk of developing type-2 diabetes mellitus (2DM with which it shares other pathogenic traits including the high risk of cerebrovascular and neurological disorders like stroke via ROS generation, inflammation, and blood-brain barrier (BBB impairment. Herein we provide evidence of the role played by nuclear factor erythroid 2-related factor (Nrf2 in CS-induced cerebrobvascular/BBB impairments and how these cerebrovascular harmful effects can be circumvented by the use of metformin (MF; a widely prescribed, firstline anti-diabetic drug treatment. Our data in fact revealed that MF activates counteractive mechanisms primarily associated with the Nrf2 pathway which drastically reduce CS toxicity at the cerebrovascular level. These include the suppression of tight junction (TJ protein downregulation and loss of BBB integrity induced by CS, reduction of inflammation and oxidative stress, renormalization of the expression levels of the major BBB glucose transporter Glut-1 and that of the anticoagulant factor thrombomodulin. Further, we provide additional insights on the controversial interplay between Nrf2 and AMPK. Keywords: Oxidative stress, Cigarette smoke, Metformin, Blood hemostasis, Blood brain barrier, Tight junctions, Nrf2, Glucose transporter

  19. MicroRNA-140-5p attenuated oxidative stress in Cisplatin induced acute kidney injury by activating Nrf2/ARE pathway through a Keap1-independent mechanism.

    Science.gov (United States)

    Liao, Weitang; Fu, Zongjie; Zou, Yanfang; Wen, Dan; Ma, Hongkun; Zhou, Fangfang; Chen, Yongxi; Zhang, Mingjun; Zhang, Wen

    2017-11-15

    Oxidative stress was predominantly involved in the pathogenesis of acute kidney injury (AKI). Recent studies had reported the protective role of specific microRNAs (miRNAs) against oxidative stress. Hence, we investigated the levels of miR140-5p and its functional role in the pathogenesis of Cisplatin induced AKI. A mice Cisplatin induced-AKI model was established. We found that miR-140-5p expression was markedly increased in mice kidney. Bioinformatics analysis revealed nuclear factor erythroid 2-related factor (Nrf2) was a potential target of miR-140-5p, We demonstrated that miR-140-5p did not affect Kelch-like ECH-associated protein 1 (Keap1) level but directly targeted the 3'-UTR of Nrf2 mRNA and played a positive role in the regulation of Nrf2 expression which was confirmed by luciferase activity assay and western blot. What was more, consistent with miR140-5p expression, the mRNA and protein levels of Nrf2, as well as antioxidant response element (ARE)-driven genes Heme Oxygenase-1 (HO-1) and NAD(P)H:quinone oxidoreductase l (NQO1) were significantly increased in mice kidney tissues. In vitro study, Enforced expression of miR-140-5p in HK2 cells significantly attenuated oxidative stress by decreasing ROS level and increasing the expression of manganese superoxide dismutase (MnSOD). Simultaneously, miR-140-5p decreased lactate dehydrogenase (LDH) leakage and improved cell vitality in HK2 cells under Cisplatin-induced oxidative stress. However, HK2 cells transfected with a siRNA targeting Nrf2 abrogated the protective effects of miR-140-5p against oxidative stress. These results indicated that miR-140-5p might exert its anti-oxidative stress function via targeting Nrf2. Our findings showed the novel transcriptional role of miR140-5p in the expression of Nrf2 and miR-140-5p protected against Cisplatin induced oxidative stress by activating Nrf2-dependent antioxidant pathway, providing a potentially therapeutic target in acute kidney injury. Copyright © 2017

  20. Melatonin successfully rescues hippocampal bioenergetics and improves cognitive function following drug intoxication by promoting Nrf2-ARE signaling activity.

    Science.gov (United States)

    Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming

    2017-09-01

    Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from

  1. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway

    Directory of Open Access Journals (Sweden)

    W. Rungratanawanich

    2018-01-01

    Full Text Available γ-Oryzanol (ORY is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293. The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2- induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD and glutathione peroxidase (GPX. Interestingly, ORY induced the nuclear factor (erythroid-derived 2-like 2 (Nrf2 nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(PH quinone reductase (NQO1, heme oxygenase-1 (HO-1, and glutathione synthetase (GSS at mRNA and protein levels in both basal condition and after H2O2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  2. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway.

    Science.gov (United States)

    Rungratanawanich, W; Abate, G; Serafini, M M; Guarienti, M; Catanzaro, M; Marziano, M; Memo, M; Lanni, C; Uberti, D

    2018-01-01

    γ -Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H 2 O 2 -) induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD) and glutathione peroxidase (GPX). Interestingly, ORY induced the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(P)H quinone reductase (NQO1), heme oxygenase-1 (HO-1), and glutathione synthetase (GSS) at mRNA and protein levels in both basal condition and after H 2 O 2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  3. Regulation by Phloroglucinol of Nrf2/Maf-Mediated Expression of Antioxidant Enzymes and Inhibition of Osteoclastogenesis via the RANKL/RANK Signaling Pathway: In Silico study

    Science.gov (United States)

    Rahim, Agus Hadian; Setiawan, Bambang; Dewi, Firli Rahmah Primula; Noor, Zairin

    2015-01-01

    Introduction: Phloroglucinol is an antioxidant compound with many positive effects on health. The purpose of this study was to determine the role of phloroglucinol in osteoclastogenesis via the RANKL/RANK signaling pathway and the activity of the transcription factor Nrf2. Material and methods: Analysis was performed in silico using the primary method of docking by the use of Hex 8.0 software and Haddock web server. Analysis of interactions was then performed to determine interactions between the ligand and its receptors by using the software LigPlus and LigandScout 3.1. Results: Results indicated that phloroglucinol compound was thought to inhibit osteoclastogenesis via three mechanisms: inhibiting RANKL−RANK interaction, sustaining the RANKL−OPG bond, and increasing the activity of the transcription factor Nrf2. PMID:26483597

  4. Andrographolide exerts anti-hepatitis C virus activity by up-regulating haeme oxygenase-1 via the p38 MAPK/Nrf2 pathway in human hepatoma cells.

    Science.gov (United States)

    Lee, Jin-Ching; Tseng, Chin-Kai; Young, Kung-Chia; Sun, Hung-Yu; Wang, Shainn-Wei; Chen, Wei-Chun; Lin, Chun-Kuang; Wu, Yu-Hsuan

    2014-01-01

    This study aimed to evaluate the anti-hepatitis C virus (HCV) activity of andrographolide, a diterpenoid lactone extracted from Andrographis paniculata, and to identify the signalling pathway involved in its antiviral action. Using HCV replicon and HCVcc infectious systems, we identified anti-HCV activity of andrographolide by measuring protein and RNA levels. A reporter activity assay was used to determine transcriptional regulation of anti-HCV agents. A specific inhibitor and short hairpin RNAs were used to investigate the mechanism responsible for the effect of andrographolide on HCV replication. In HCV replicon and HCVcc infectious systems, andrographolide time- and dose-dependently suppressed HCV replication. When combined with IFN-α, an inhibitor targeting HCV NS3/4A protease (telaprevir), or NS5B polymerase (PSI-7977), andrographolide exhibited a significant synergistic effect. Andrographolide up-regulated the expression of haeme oxygenase-1 (HO-1), leading to increased amounts of its metabolite biliverdin, which was found to suppress HCV replication by promoting the antiviral IFN responses and inhibiting NS3/4A protease activity. Significantly, these antiviral effects were attenuated by an HO-1-specific inhibitor or HO-1 gene knockdown, indicating that HO-1 contributed to the anti-HCV activity of andrographolide. Andrographolide activated p38 MAPK phosphorylation, which stimulated nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated HO-1 expression, and this was found to be associated with its anti-HCV activity. Our results demonstrate that andrographolide has the potential to control HCV replication and suggest that targeting the Nrf2-HO-1 signalling pathway might be a promising strategy for drug development. © 2013 The British Pharmacological Society.

  5. Alteration of serum lipid profile, SRB1 loss, and impaired Nrf2 activation in CDKL5 disorder.

    Science.gov (United States)

    Pecorelli, Alessandra; Belmonte, Giuseppe; Meloni, Ilaria; Cervellati, Franco; Gardi, Concetta; Sticozzi, Claudia; De Felice, Claudio; Signorini, Cinzia; Cortelazzo, Alessio; Leoncini, Silvia; Ciccoli, Lucia; Renieri, Alessandra; Jay Forman, Henry; Hayek, Joussef; Valacchi, Giuseppe

    2015-09-01

    CDKL5 mutation is associated with an atypical Rett syndrome (RTT) variant. Recently, cholesterol homeostasis perturbation and oxidative-mediated loss of the high-density lipoprotein receptor SRB1 in typical RTT have been suggested. Here, we demonstrate an altered lipid serum profile also in CDKL5 patients with decreased levels of SRB1 and impaired activation of the defensive system Nrf2. In addition, CDKL5 fibroblasts showed an increase in 4-hydroxy-2-nonenal- and nitrotyrosine-SRB1 adducts that lead to its ubiquitination and probable degradation. This study highlights a possible common denominator between two different RTT variants (MECP2 and CDKL5) and a possible common future therapeutic target. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Ameliorating mitochondrial dysfunction restores carbon ion-induced cognitive deficits via co-activation of NRF2 and PINK1 signaling pathway.

    Science.gov (United States)

    Liu, Yang; Yan, Jiawei; Sun, Cao; Li, Guo; Li, Sirui; Zhang, Luwei; Di, Cuixia; Gan, Lu; Wang, Yupei; Zhou, Rong; Si, Jing; Zhang, Hong

    2018-07-01

    Carbon ion therapy is a promising modality in radiotherapy to treat tumors, however, a potential risk of induction of late normal tissue damage should still be investigated and protected. The aim of the present study was to explore the long-term cognitive deficits provoked by a high-linear energy transfer (high-LET) carbon ions in mice by targeting to hippocampus which plays a crucial role in memory and learning. Our data showed that, one month after 4 Gy carbon ion exposure, carbon ion irradiation conspicuously resulted in the impaired cognitive performance, neurodegeneration and neuronal cell death, as well as the reduced mitochondrial integrity, the disrupted activities of tricarboxylic acid cycle flux and electron transport chain, and the depressed antioxidant defense system, consequently leading to a decline of ATP production and persistent oxidative damage in the hippocampus region. Mechanistically, we demonstrated the disruptions of mitochondrial homeostasis and redox balance typically characterized by the disordered mitochondrial dynamics, mitophagy and glutathione redox couple, which is closely associated with the inhibitions of PINK1 and NRF2 signaling pathway as the key regulators of molecular responses in the context of neurotoxicity and neurodegenerative disorders. Most importantly, we found that administration with melatonin as a mitochondria-targeted antioxidant promoted the PINK1 accumulation on the mitochondrial membrane, and augmented the NRF2 accumulation and translocation. Moreover, melatonin pronouncedly enhanced the molecular interplay between NRF2 and PINK1. Furthermore, in the mouse hippocampal neuronal cells, overexpression of NRF2/PINK1 strikingly protected the hippocampal neurons from carbon ion-elicited toxic insults. Thus, these data suggest that alleviation of the sustained mitochondrial dysfunction and oxidative stress through co-modulation of NRF2 and PINK1 may be in charge of restoration of the cognitive impairments in a mouse

  7. Agmatine, by Improving Neuroplasticity Markers and Inducing Nrf2, Prevents Corticosterone-Induced Depressive-Like Behavior in Mice.

    Science.gov (United States)

    Freitas, Andiara E; Egea, Javier; Buendia, Izaskun; Gómez-Rangel, Vanessa; Parada, Esther; Navarro, Elisa; Casas, Ana Isabel; Wojnicz, Aneta; Ortiz, José Avendaño; Cuadrado, Antonio; Ruiz-Nuño, Ana; Rodrigues, Ana Lúcia S; Lopez, Manuela G

    2016-07-01

    Agmatine, an endogenous neuromodulator, is a potential candidate to constitute an adjuvant/monotherapy for the management of depression. A recent study by our group demonstrated that agmatine induces Nrf2 and protects against corticosterone effects in a hippocampal neuronal cell line. The present study is an extension of this previous study by assessing the antidepressant-like effect of agmatine in an animal model of depression induced by corticosterone in mice. Swiss mice were treated simultaneously with agmatine or imipramine at a dose of 0.1 mg/kg/day (p.o.) and corticosterone for 21 days and the daily administrations of experimental drugs were given immediately prior to corticosterone (20 mg/kg/day, p.o.) administrations. Wild-type C57BL/6 mice (Nrf2 (+/+)) and Nrf2 KO (Nrf2 (-/-)) were treated during 21 days with agmatine (0.1 mg/kg/day, p.o.) or vehicle. Twenty-four hours after the last treatments, the behavioral tests and biochemical assays were performed. Agmatine treatment for 21 days was able to abolish the corticosterone-induced depressive-like behavior and the alterations in the immunocontent of mature BDNF and synaptotagmin I, and in the serotonin and glutamate levels. Agmatine also abolished the corticosterone-induced changes in the morphology of astrocytes and microglia in CA1 region of hippocampus. In addition, agmatine treatment in control mice increased noradrenaline, serotonin, and dopamine levels, CREB phosphorylation, mature BDNF and synaptotagmin I immunocontents, and reduced pro-BDNF immunocontent in the hippocampus. Agmatine's ability to produce an antidepressant-like effect was abolished in Nrf2 (-/-) mice. The present results reinforce the participation of Nrf2 in the antidepressant-like effect produced by agmatine and expand literature data concerning its mechanisms of action.

  8. Role of Keap1-Nrf2 signaling in depression and dietary intake of glucoraphanin confers stress resilience in mice

    OpenAIRE

    Yao, Wei; Zhang, Ji-chun; Ishima, Tamaki; Dong, Chao; Yang, Chun; Ren, Qian; Ma, Min; Han, Mei; Wu, Jin; Suganuma, Hiroyuki; Ushida, Yusuke; Yamamoto, Masayuki; Hashimoto, Kenji

    2016-01-01

    The transcription factor Keap1-Nrf2 system plays a key role in inflammation which is involved in depression. We found lower expression of Keap1 and Nrf2 proteins in the prefrontal cortex (PFC), CA3 and dentate gyrus (DG) of hippocampus in mice with depression-like phenotype compared to control mice. Serum levels of pro-inflammatory cytokines in Nrf2 knock-out (KO) mice were higher than those of wild-type mice, suggestive of enhanced inflammation in KO mice. Decreased brain-derived neurotrophi...

  9. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV☆

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D.; Wondrak, Georg T.

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  10. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV.

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D; Wondrak, Georg T

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm(2) UVB; 1.53 J/cm(2) UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  11. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV

    Directory of Open Access Journals (Sweden)

    Shasha Tao

    2013-01-01

    Full Text Available Exposure to solar ultraviolet (UV radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2, a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I, dihydrotanshinone (DHT, tanshinone IIA (T-II-A and cryptotanshinone (CT] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1 with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA. The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities was significantly attenuated in DHT

  12. Epalrestat increases glutathione, thioredoxin, and heme oxygenase-1 by stimulating Nrf2 pathway in endothelial cells

    Directory of Open Access Journals (Sweden)

    Kaori Yama

    2015-04-01

    Full Text Available Epalrestat (EPS is the only aldose reductase inhibitor that is currently available for the treatment of diabetic neuropathy. Recently, we found that EPS at near-plasma concentration increases the intracellular levels of glutathione (GSH in rat Schwann cells. GSH plays a crucial role in protecting endothelial cells from oxidative stress, thereby preventing vascular diseases. Here we show that EPS increases GSH levels in not only Schwann cells but also endothelial cells. Treatment of bovine aortic endothelial cells (BAECs, an in vitro model of the vascular endothelium, with EPS caused a dramatic increase in intracellular GSH levels. This was concomitant with the up-regulation of glutamate cysteine ligase, an enzyme catalyzing the first and rate-limiting step in de novo GSH synthesis. Moreover, EPS stimulated the expression of thioredoxin and heme oxygenase-1, which have important redox regulatory functions in endothelial cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a key transcription factor that regulates the expression of antioxidant genes. EPS increased nuclear Nrf2 levels in BAECs. Nrf2 knockdown by siRNA suppressed the EPS-induced glutamate cysteine ligase, thioredoxin-1, and heme oxygenase-1 expression. Interestingly, LY294002, an inhibitor of phosphatidylinositol 3-kinase, abolished the EPS-stimulated GSH synthesis, suggesting that the kinase is associated with Nrf2 activation induced by EPS. Furthermore, EPS reduced the cytotoxicity induced by H2O2 and tert-butylhydroperoxide, indicating that EPS plays a role in protecting cells from oxidative stress. Taken together, the results provide evidence that EPS exerts new beneficial effects on endothelial cells by increasing GSH, thioredoxin, and heme oxygenase-1 levels through the activation of Nrf2. We suggest that EPS has the potential to prevent several vascular diseases caused by oxidative stress.

  13. Role of Nrf2/ARE pathway in protective effect of electroacupuncture against endotoxic shock-induced acute lung injury in rabbits.

    Directory of Open Access Journals (Sweden)

    Jian-bo Yu

    Full Text Available NF-E2 related factor 2 (Nrf2 is a major transcription factor and acts as a key regulator of antioxidant genes to exogenous stimulations. The aim of current study was to determine whether Nrf2/ARE pathway is involved in the protective effect of electroacupuncture on the injured lung in a rabbit model of endotoxic shock. A dose of lipopolysaccharide (LPS 5 mg/kg was administered intravenously to replicate the model of acute lung injury induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Feishu acupoints for five consecutive days while sham electroacupuncture punctured at non-acupoints. Fourty anesthetized New England male rabbits were randomized into normal control group (group C, LPS group (group L, electroacupuncture + LPS group (group EL and sham electroacupuncture + LPS (group SEL. At 6 h after LPS administration, the animals were sacrificed and the blood samples were collected for biochemical measurements. The lungs were removed for calculation of wet-to-dry weight ratios (W/D, histopathologic examination, determination of heme oxygenase (HO-1 protein and mRNA, Nrf2 total and nucleoprotein, as well as Nrf2 mRNA expression, and evaluation of the intracellular distribution of Nrf2 nucleoprotein. LPS caused extensive morphologic lung damage, which was lessened by electroacupuncture treatment. Besides, lung W/D ratios were significantly decreased, the level of malondialdehyde was inhibited, plasma levels of TNF-α and interleukin-6 were decreased, while the activities of superoxide dismutase, glutathione peroxidase and catalase were enhanced in the electroacupucnture treated animals. In addition, electroacupuncture stimulation distinctly increased the expressions of HO-1 and Nrf2 protein including Nrf2 total protein and nucleoprotein as well as mRNA in lung tissue, while these effects were blunted in the sham electroacupuncture group. We concluded that electroacupuncture treatment at ST36 and BL13

  14. Role of Nrf2/ARE pathway in protective effect of electroacupuncture against endotoxic shock-induced acute lung injury in rabbits.

    Science.gov (United States)

    Yu, Jian-bo; Shi, Jia; Gong, Li-rong; Dong, Shu-an; Xu, Yan; Zhang, Yuan; Cao, Xin-shun; Wu, Li-li

    2014-01-01

    NF-E2 related factor 2 (Nrf2) is a major transcription factor and acts as a key regulator of antioxidant genes to exogenous stimulations. The aim of current study was to determine whether Nrf2/ARE pathway is involved in the protective effect of electroacupuncture on the injured lung in a rabbit model of endotoxic shock. A dose of lipopolysaccharide (LPS) 5 mg/kg was administered intravenously to replicate the model of acute lung injury induced by endotoxic shock. Electroacupuncture pretreatment was handled bilaterally at Zusanli and Feishu acupoints for five consecutive days while sham electroacupuncture punctured at non-acupoints. Fourty anesthetized New England male rabbits were randomized into normal control group (group C), LPS group (group L), electroacupuncture + LPS group (group EL) and sham electroacupuncture + LPS (group SEL). At 6 h after LPS administration, the animals were sacrificed and the blood samples were collected for biochemical measurements. The lungs were removed for calculation of wet-to-dry weight ratios (W/D), histopathologic examination, determination of heme oxygenase (HO)-1 protein and mRNA, Nrf2 total and nucleoprotein, as well as Nrf2 mRNA expression, and evaluation of the intracellular distribution of Nrf2 nucleoprotein. LPS caused extensive morphologic lung damage, which was lessened by electroacupuncture treatment. Besides, lung W/D ratios were significantly decreased, the level of malondialdehyde was inhibited, plasma levels of TNF-α and interleukin-6 were decreased, while the activities of superoxide dismutase, glutathione peroxidase and catalase were enhanced in the electroacupucnture treated animals. In addition, electroacupuncture stimulation distinctly increased the expressions of HO-1 and Nrf2 protein including Nrf2 total protein and nucleoprotein as well as mRNA in lung tissue, while these effects were blunted in the sham electroacupuncture group. We concluded that electroacupuncture treatment at ST36 and BL13 effectively

  15. Plasticity and genetic adaptation mediate amphibian and reptile responses to climate change

    Science.gov (United States)

    Urban, Mark C; Richardson, Jonathan L; Freidenfelds, Nicole A

    2014-01-01

    Phenotypic plasticity and genetic adaptation are predicted to mitigate some of the negative biotic consequences of climate change. Here, we evaluate evidence for plastic and evolutionary responses to climate variation in amphibians and reptiles via a literature review and meta-analysis. We included studies that either document phenotypic changes through time or space. Plasticity had a clear and ubiquitous role in promoting phenotypic changes in response to climate variation. For adaptive evolution, we found no direct evidence for evolution of amphibians or reptiles in response to climate change over time. However, we found many studies that documented adaptive responses to climate along spatial gradients. Plasticity provided a mixture of adaptive and maladaptive responses to climate change, highlighting that plasticity frequently, but not always, could ameliorate climate change. Based on our review, we advocate for more experiments that survey genetic changes through time in response to climate change. Overall, plastic and genetic variation in amphibians and reptiles could buffer some of the formidable threats from climate change, but large uncertainties remain owing to limited data. PMID:24454550

  16. Baicalin Ameliorates Experimental Liver Cholestasis in Mice by Modulation of Oxidative Stress, Inflammation, and NRF2 Transcription Factor

    Directory of Open Access Journals (Sweden)

    Kezhen Shen

    2017-01-01

    Full Text Available Experimental cholestatic liver fibrosis was performed by bile duct ligation (BDL in mice, and significant liver injury was observed in 15 days. Administration of baicalin in mice significantly ameliorates liver fibrosis. Experimental cholestatic liver fibrosis was associated with induced gene expression of fibrotic markers such as collagen I, fibronectin, alpha smooth muscle actin (SMA, and connective tissue growth factor (CTGF; increased inflammatory cytokines (TNFα, MIP1α, IL1β, and MIP2; increased oxidative stress and reactive oxygen species- (ROS- inducing enzymes (NOX2 and iNOS; dysfunctional mitochondrial electron chain complexes; and apoptotic/necrotic cell death markers (DNA fragmentation, caspase 3 activity, and PARP activity. Baicalin administration on alternate day reduced fibrosis along with profibrotic gene expression, proinflammatory cytokines, oxidative stress, and cell death whereas improving the function of mitochondrial electron transport chain. We observed baicalin enhanced NRF2 activation by nuclear translocation and induced its target genes HO-1 and GCLM, thus enhancing antioxidant defense. Interplay of oxidative stress/inflammation and NRF2 were key players for baicalin-mediated protection. Stellate cell activation is crucial for initiation of fibrosis. Baicalin alleviated stellate cell activation and modulated TIMP1, SMA, collagen 1, and fibronectin in vitro. This study indicates that baicalin might be beneficial for reducing inflammation and fibrosis in liver injury models.

  17. Mangiferin Upregulates Glyoxalase 1 Through Activation of Nrf2/ARE Signaling in Central Neurons Cultured with High Glucose.

    Science.gov (United States)

    Liu, Yao-Wu; Cheng, Ya-Qin; Liu, Xiao-Li; Hao, Yun-Chao; Li, Yu; Zhu, Xia; Zhang, Fan; Yin, Xiao-Xing

    2017-08-01

    Mangiferin, a natural C-glucoside xanthone, has anti-inflammatory, anti-oxidative, neuroprotective actions. Our previous study showed that mangiferin could attenuate diabetes-associated cognitive impairment of rats by enhancing the function of glyoxalase 1 (Glo-1) in brain. The aim of this study was to investigate whether Glo-1 upregulation by mangiferin in central neurons exposed to chronic high glucose may be related to activation of Nrf2/ARE pathway. Compared with normal glucose (25 mmol/L) culture, Glo-1 protein, mRNA, and activity levels were markedly decreased in primary hippocampal and cerebral cortical neurons cultured with high glucose (50 mmol/L) for 72 h, accompanied by the declined Nrf2 nuclear translocation and protein expression of Nrf2 in cell nucleus, as well as protein expression and mRNA level of γ-glutamylcysteine synthetase (γ-GCS) and superoxide dismutase activity, target genes of Nrf2/ARE signaling. Nonetheless, high glucose cotreating with mangiferin or sulforaphane, a typical inducer of Nrf2 activation, attenuated the above changes in both central neurons. In addition, mangiferin and sulforaphane significantly prevented the formation of advanced glycation end-products (AGEs) reflecting Glo-1 activity, while elevated the level of glutathione, a cofactor of Glo-1 activity and production of γ-GCS, in high glucose cultured central neurons. These findings demonstrated that Glo-1 was greatly downregulated in central neurons exposed to chronic high glucose, which is expected to lead the formation of AGEs and oxidative stress damages. We also proved that mangiferin enhanced the function of Glo-1 under high glucose condition by inducing activation of Nrf2/ARE signaling pathway.

  18. Aggressive mammary carcinoma progression in Nrf2 knockout mice treated with 7,12-dimethylbenz[a]anthracene

    International Nuclear Information System (INIS)

    Becks, Lisa; Shi, Runhua; McLarty, Jerry; Pruitt, Kevin; Zhang, Songlin; Kleiner-Hancock, Heather E; Prince, Misty; Burson, Hannah; Christophe, Christopher; Broadway, Mason; Itoh, Ken; Yamamoto, Masayuki; Mathis, Michael; Orchard, Elysse

    2010-01-01

    Activation of nuclear factor erythroid 2-related factor (Nrf2), which belongs to the basic leucine zipper transcription factor family, is a strategy for cancer chemopreventive phytochemicals. It is an important regulator of genes induced by oxidative stress, such as glutathione S-transferases, heme oxygenase-1 and peroxiredoxin 1, by activating the antioxidant response element (ARE). We hypothesized that (1) the citrus coumarin auraptene may suppress premalignant mammary lesions via activation of Nrf2/ARE, and (2) that Nrf2 knockout (KO) mice would be more susceptible to mammary carcinogenesis. Premalignant lesions and mammary carcinomas were induced by medroxyprogesterone acetate and 7,12-dimethylbenz[a]anthracene treatment. The 10-week pre-malignant study was performed in which 8 groups of 10 each female wild-type (WT) and KO mice were fed either control diet or diets containing auraptene (500 ppm). A carcinogenesis study was also conducted in KO vs. WT mice (n = 30-34). Comparisons between groups were evaluated using ANOVA and Kaplan-Meier Survival statistics, and the Mann-Whitney U-test. All mice treated with carcinogen exhibited premalignant lesions but there were no differences by genotype or diet. In the KO mice, there was a dramatic increase in mammary carcinoma growth rate, size, and weight. Although there was no difference in overall survival, the KO mice had significantly lower mammary tumor-free survival. Also, in the KO mammary carcinomas, the active forms of NF-κB and β-catenin were increased ~2-fold whereas no differences in oxidized proteins were observed. Many other tumors were observed, including lymphomas. Interestingly, the incidences of lung adenomas in the KO mice were significantly higher than in the WT mice. We report, for the first time, that there was no apparent difference in the formation of premalignant lesions, but rather, the KO mice exhibited rapid, aggressive mammary carcinoma progression

  19. N-acetylcysteine Ameliorates Prostatitis via miR-141 Regulating Keap1/Nrf2 Signaling.

    Science.gov (United States)

    Wang, Liang-Liang; Huang, Yu-Hua; Yan, Chun-Yin; Wei, Xue-Dong; Hou, Jian-Quan; Pu, Jin-Xian; Lv, Jin-Xing

    2016-04-01

    Chronic prostatitis was the most common type of prostatitis and oxidative stress was reported to be highly elevated in prostatitis patients. In this study, we determined the effect of N-acetylcysteine (NAC) on prostatitis and the molecular mechanism involved in it. Male Sprague-Dawley rats were divided into three groups: control group (group A, n = 20), carrageenan-induced chronic nonbacterial prostatitis (CNP) model group (group B, n = 20), and carrageenan-induced CNP model group with NAC injection (group C, n = 20). Eye score, locomotion score, inflammatory cell count, cyclooxygenase 2 (COX2) expression, and Evans blue were compared in these three groups. The expression of miR-141 was determined by quantitative real-time PCR (qRT-PCR). Moreover, protein expressions of Kelch-like ECH-associated protein-1 (Keap1) and nuclear factor erythroid-2 related factor 2 (Nrf2) and its target genes were examined by Western blot. Luciferase reporter assay was performed in RWPE-1 cells transfected miR-141 mimic or inhibitor and the plasmid carrying 3'-UTR of Keap1. The value of eye score, locomotion score, inflammatory cell count, and Evans blue were significantly decreased in group C, as well as the expression of COX2, when comparing to that of group B. These results indicated that NAC relieved the carrageenan-induced CNP. Further, we found that NAC increased the expression of miR-141 and activated the Keap1/Nrf2 signaling. Luciferase reporter assay revealed that miR-141 mimic could suppress the activity of Keap1 and stimulate the downstream target genes of Nrf2. In addition, miR-141 inhibitor could reduce the effect of NAC on prostatitis. NAC ameliorates the carrageenan-induced prostatitis and prostate inflammation pain through miR-141 regulating Keap1/Nrf2 signaling.

  20. The adjuvant component α-tocopherol triggers via modulation of Nrf2 the expression and turnover of hypocretin in vitro and its implication to the development of narcolepsy.

    Science.gov (United States)

    Masoudi, Sanita; Ploen, Daniela; Kunz, Katharina; Hildt, Eberhard

    2014-05-23

    After the H1N1 swine flu vaccination campaign an increased number of narcolepsy cases in children and adolescents was observed in Scandinavian and later in further European countries that correlated with the vaccination by an AS03-adjuvanted influenza vaccine (Pandemrix). Narcolepsy is a chronic sleep disorder characterized by the loss of hypocretin in the cerebrospinal fluid due to selective destruction of hypocretin-producing neurons in the perifornical hypothalamus. In >99% of the cases narcolepsy is associated with the HLA-subtype DQB1*602 giving the link to an autoimmune process. In contrast to other squalene-based adjuvants, for which no association with narcolepsy was reported so far, ASO3 contains in addition α-tocopherol. It could be observed recently that α-tocopherol activates the transcription factor Nrf2. Nrf2 triggers the expression of cytoprotective genes, i.e. the catalytic active subunits of the constitutive proteasome, by binding to the antioxidant response element (ARE). It was hypothesized that α-tocopherol via activation of Nrf2 affects expression and turnover of hypocretin, leading to an increased amount of hypocretinα-specific fragments that bind to DQB1*602. α-Tocopherol activates Nrf2 in neuronal cells in vitro. Promoter analysis revealed an ARE sequence in the hypocretin promoter. Indeed, α-tocopherol increases by activation of Nrf2 the expression of hypocretin. In parallel, α-tocopherol -dependent induction of Nrf2 augments expression of catalytic subunits of the proteasome leading to increased degradation of hypocretin. Moreover, elevated activation of Nrf2 is associated with a decreased activity of NF-κB that results in an increased sensitivity to apoptotic stimuli. In case of a genetic predisposition (DQB1*602) α-tocopherol could confer to development of narcolepsy by activation of Nrf2 that finally leads to an elevated formation of longer hypocretin-derived fragments that can be presented by HLA-subtype DQB1*602. These cells

  1. Cordycepin alleviates lipopolysaccharide-induced acute lung injury via Nrf2/HO-1 pathway.

    Science.gov (United States)

    Qing, Rui; Huang, Zezhi; Tang, Yufei; Xiang, Qingke; Yang, Fan

    2018-04-24

    The present study is to investigate the protective effect of cordycepin on inflammatory reactions in rats with acute lung injury (ALI) induced by lipopolysaccharide (LPS), as well as the underlying mechanism. Wistar rat model of ALI was induced by intravenous injection of LPS (30 mg/kg body weight). One hour later, intravenous injection of cordycepin (1, 10 or 30 mg/kg body weight) was administered. The wet-to-dry weight ratio of lung tissues and myeloperoxidase activity in the lung tissues were measured. The contents of nitrite and nitrate were measured by reduction method, while chemiluminescence was used to determine the content of superoxide. Quantitative real-time polymerase chain reaction and Western blotting were used to determine the expression of mRNA and protein, respectively. Colorimetry was performed to determine the enzymatic activity of heme oxygenase-1 (HO-1). Nuclear translocation of Nrf2 was identified by Western blotting. The plasma contents of cytokines were measured by enzyme-linked immunosorbent assay. Cordycepin enhanced the expression and enzymatic activity of HO-1 in ALI rats, and activated Nrf2 by inducing the translocation of Nrf2 from cytoplasm to nucleus. In addition, cordycepin regulated the secretion of TNF-α, IL-6 and IL-10 via HO-1, and suppressed inflammation in lung tissues of ALI rats by inducing the expression of HO-1. HO-1 played important roles in the down-regulation of superoxide levels in lung tissues by cordycepin, and HO-1 expression induced by cordycepin affected nitrite and nitrate concentrations in plasma and iNOS protein expression in lung tissues. Cordycepin showed protective effect on injuries in lung tissues. The present study demonstrates that cordycepin alleviates inflammation induced by LPS via the activation of Nrf2 and up-regulation of HO-1 expression. Copyright © 2018. Published by Elsevier B.V.

  2. skn-1 is required for interneuron sensory integration and foraging behavior in Caenorhabditis elegans.

    Science.gov (United States)

    Wilson, Mark A; Iser, Wendy B; Son, Tae Gen; Logie, Anne; Cabral-Costa, Joao V; Mattson, Mark P; Camandola, Simonetta

    2017-01-01

    Nrf2/skn-1, a transcription factor known to mediate adaptive responses of cells to stress, also regulates energy metabolism in response to changes in nutrient availability. The ability to locate food sources depends upon chemosensation. Here we show that Nrf2/skn-1 is expressed in olfactory interneurons, and is required for proper integration of multiple food-related sensory cues in Caenorhabditis elegans. Compared to wild type worms, skn-1 mutants fail to perceive that food density is limiting, and display altered chemo- and thermotactic responses. These behavioral deficits are associated with aberrant AIY interneuron morphology and migration in skn-1 mutants. Both skn-1-dependent AIY autonomous and non-autonomous mechanisms regulate the neural circuitry underlying multisensory integration of environmental cues related to energy acquisition.

  3. Dextran loading protects macrophages from lipid peroxidation and induces a Keap1/Nrf2/ARE-dependent antioxidant response.

    Science.gov (United States)

    Chechushkov, Anton; Zaitseva, Natalia; Vorontsova, Elena; Kozhin, Petr; Menshchikova, Elena; Shkurupiy, Vyacheslav

    2016-12-01

    Linear dextrans are often proposed as drug delivery systems with milder adverse effects and lower effective drug concentrations. Linear dextrans are polysaccharides that can potentially be used to load macrophages with drugs to transport them to a site of inflammation. Recently, it was reported that dextrans may exert a protective effect vis-à-vis drug cytotoxicity and during wound healing. The aim of the current work was to evaluate molecular mechanisms of action of dextrans that may be relevant to the cytoprotective effects. We determined the effect of treatment with 40- or 70-kDa dextran on production of reactive oxygen species, lipid peroxidation, and lysosomal pH in the J774 macrophage cell line. In addition, induction of Keap1/Nrf2/ARE and autophagic activity were evaluated. Dextrans of both molecular weights protected the cells from oxidative stress induced by cumene hydroperoxide and from lysosomal stress induced by ammonium chloride. The effect was associated with induction of the Keap1/Nrf2/ARE signaling pathway. Furthermore, dextran stimulated autophagy in a dose-dependent manner but inhibited the autophagosome-lysosome fusion in a time-dependent manner. This study shows possible cytoprotective effects of dextran under oxidative stress, and these findings may be used for the development of novel (dextran-based) drug delivery approaches. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  5. Metallothionein-III protects against 6-hydroxydopamine-induced oxidative stress by increasing expression of heme oxygenase-1 in a PI3K and ERK/Nrf2-dependent manner

    International Nuclear Information System (INIS)

    Hwang, Yong Pil; Kim, Hyung Gyun; Han, Eun Hee; Jeong, Hye Gwang

    2008-01-01

    The zinc-binding protein metallothionein-III (MT-III) is associated with resistance to neuronal injury. However, the underlying mechanism for its effects is unclear. In this study, we demonstrate that MT-III prevents the accumulation of reactive oxygen species (ROS) in dopaminergic SH-SY5Y cells challenged with the Parkinson's disease-related neurotoxin 6-hydroxydopamine (6-OHDA) by a mechanism that involves phosphatidylinositol 3-kinase (PI3K) and ERK kinase/NF-E2-related factor 2 (Nrf2) dependent induction of the stress response protein heme oxygenase-1 (HO-1). Pretreatment of SH-SY5Y cells with MT-III significantly reduced 6-OHDA-induced generation of ROS, caspase-3 activation, and subsequent cell death. Also, MT-III up-regulates HO-1 expression and this expression confers neuroprotection against oxidative injury induced by 6-OHDA. Moreover, MT-III induces Nrf2 nuclear translocation, which is upstream of MT-III-induced HO-1 expression, and PI3K and ERK1/2 activation, a pathway that is involved in induced Nrf2 nuclear translocation, HO-1 expression and neuroprotection. Taken together, these results suggest that the PI3K and ERK/Nrf2 signaling pathway controls the intracellular levels of ROS by regulating the expression of the antioxidant enzyme HO-1

  6. Topical application of the synthetic triterpenoid RTA 408 activates Nrf2 and induces cytoprotective genes in rat skin.

    Science.gov (United States)

    Reisman, Scott A; Lee, Chun-Yue I; Meyer, Colin J; Proksch, Joel W; Ward, Keith W

    2014-07-01

    RTA 408 is a member of the synthetic oleanane triterpenoid class of compounds known to potently activate the cytoprotective transcription factor Nrf2. Because skin is constantly exposed to external oxidative stress, such as that from ultraviolet radiation, from chemical exposure, during improper wound healing, and throughout the course of cancer radiation therapy, it may benefit from activation of Nrf2. This study was conducted to evaluate the transdermal penetration properties and Nrf2 activation potential of RTA 408 in normal rat skin. RTA 408 (0.1, 1.0, or 3.0%) was applied topically to the shaved skin of male Sprague-Dawley rats twice daily for 4 days and once on Day 5. Topical application of RTA 408 resulted in transdermal penetration, with low but dose-dependent plasma exposure with AUC(0-24 h) values of 3.6, 26.0, and 41.1 h ng/mL for the 0.1, 1.0, and 3.0% doses, respectively. Further, topical application of RTA 408 resulted in increased translocation of Nrf2 to the nucleus, dose-dependent mRNA induction of Nrf2 target genes (e.g. Nqo1, Srxn1, Gclc, and Gclm), and induction of the protein expression of the prototypical Nrf2 target gene Nqo1 and increased total glutathione (GSH) in normal rat skin. Immunohistochemistry demonstrated that increased staining for Nqo1 and total GSH of structures in both the epidermis and dermis was consistent with the full transdermal penetration of RTA 408. Finally, topically administered RTA 408 was well tolerated with no adverse in-life observations and normal skin histology. Thus, the data support the further development of RTA 408 for the potential treatment of skin diseases.

  7. Protective role of Nrf2 against mechanical-stretch-induced apoptosis in mouse fibroblasts: a potential therapeutic target of mechanical-trauma-induced stress urinary incontinence.

    Science.gov (United States)

    Li, Qiannan; Li, Bingshu; Liu, Cheng; Wang, Linlin; Tang, Jianming; Hong, Li

    2018-01-10

    We investigated the protective effect and underlying molecular mechanism of nuclear factor-E2-related factor 2 (Nrf2) against mechanical-stretch-induced apoptosis in mouse fibroblasts. Normal cells, Nrf2 silencing cells, and Nrf2 overexpressing cells were respectively divided into two groups-nonintervention and cyclic mechanical strain (CMS)-subjected to CMS of 5333 μ (1.0 Hz for 4 h), six groups in total (control, CMS, shNfe212, shNfe212 + CMS, LV-shNfe212, and LV-shNfe212 + CMS). After treatment, cell apoptosis; cell-cycle distribution; expressions of Nrf2, Bax, Bcl-2, Cyt-C, caspase-3, caspase-9, cleaved-caspase-3, and cleaved-caspase-9; mitochondrial membrane potential (ΔΨm); reactive oxygen species (ROS); and malondialdehyde (MDA) levels were measured. Thirty virgin female C57BL/6 mice were divided into two groups: control (without intervention) and vaginal distension (VD) groups, which underwent VD for 1 h with an 8-mm dilator (0.3 ml saline). Leak-point pressure (LPP) was tested on day 7 after VD; Nrf2 expression, apoptosis, and MDA levels were then measured in urethra and anterior vaginal wall. Mechanical stretch decreased Nrf2 messenger RNA (mRNA) and protein expressions. Overexpression of Nrf2 alleviated mechanical-stretch-induced cell apoptosis; S-phase arrest of cell cycle; up-regulation of Bax, cytochrome C (Cyt-C), ROS, MDA, ratio of cleaved-caspase-3/caspase-3 and cleaved-caspase-9/caspase-9; and exacerbated the decrease of Bcl2 and ΔΨm in L929 cells. On the contrary, silencing of Nrf2 showed opposite effects. Besides, VD reduced LPP levels and Nrf2 expression and increased cell apoptosis and MDA generation in the urethra and anterior vaginal wall. Nrf2 exhibits a protective role against mechanical-stretch -induced apoptosis on mouse fibroblasts, which might indicate a potential therapeutic target of mechanical-trauma-induced stress urinary incontinence (SUI).

  8. Catalase overexpression prevents nuclear factor erythroid 2-related factor 2 stimulation of renal angiotensinogen gene expression, hypertension, and kidney injury in diabetic mice.

    Science.gov (United States)

    Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D

    2014-10-01

    This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  9. Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway

    Directory of Open Access Journals (Sweden)

    Qin Wang

    2015-06-01

    Full Text Available Multiple sclerosis (MS is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS. Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12 is an oral formulation of the fumaric acid esters (FAE, containing the active metabolite dimethyl fumarate (DMF. Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF on mouse and rat neural stem/progenitor cells (NPCs and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2 treatment. In addition, utilizing the reactive oxygen species (ROS assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2 at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1. Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS.

  10. Mediator, SWI/SNF and SAGA complexes regulate Yap8-dependent transcriptional activation of ACR2 in response to arsenate.

    Science.gov (United States)

    Menezes, Regina Andrade; Pimentel, Catarina; Silva, Ana Rita Courelas; Amaral, Catarina; Merhej, Jawad; Devaux, Frédéric; Rodrigues-Pousada, Claudina

    2017-04-01

    Response to arsenic stress in Saccharomyces cerevisiae is orchestrated by the regulatory protein Yap8, which mediates transcriptional activation of ACR2 and ACR3. This study contributes to the state of art knowledge of the molecular mechanisms underlying yeast stress response to arsenate as it provides the genetic and biochemical evidences that Yap8, through cysteine residues 132, 137, and 274, is the sensor of presence of arsenate in the cytosol. Moreover, it is here reported for the first time the essential role of the Mediator complex in the transcriptional activation of ACR2 by Yap8. Based on our data, we propose an order-of-function map to recapitulate the sequence of events taking place in cells injured with arsenate. Modification of the sulfhydryl state of these cysteines converts Yap8 in its activated form, triggering the recruitment of the Mediator complex to the ACR2/ACR3 promoter, through the interaction with the tail subunit Med2. The Mediator complex then transfers the regulatory signals conveyed by Yap8 to the core transcriptional machinery, which culminates with TBP occupancy, ACR2 upregulation and cell adaptation to arsenate stress. Additional co-factors are required for the transcriptional activation of ACR2 by Yap8, particularly the nucleosome remodeling activity of SWI/SNF and SAGA complexes. Copyright © 2017. Published by Elsevier B.V.

  11. Glaucocalyxin B Alleviates Lipopolysaccharide-Induced Parkinson’s Disease by Inhibiting TLR/NF-κB and Activating Nrf2/HO-1 Pathway

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2017-12-01

    Full Text Available Background/Aims: Parkinson’s disease (PD is a common neurodegenerative disease in the old population, characterized by dopaminergic neuron loss, inflammation and oxidative stress injury in the substantia nigra. Glaucocalyxin B (GLB, an ent-kauranoid diterpenoid isolated from Rabdosia japonica, has anti-inflammation and anti-tumor effects. However, its effects on PD remain unclear. Methods: PD was introduced in rats via injection of lipopolysaccharide (LPS into cerebral corpus striatum, and GLB was given intracerebroventricularly to these rats. Their walking, climbing and sensory states were detected by Stepping, Whisker and Cylinder Tests. The expression of tyrosine hydroxylase (TH, glial fibrillary acidic protein (GFAP, CD11b and ionized calcium binding adaptor molecule (IBA-1 were detected by immunohischemical staining. The levels of a series of inflammatory factors, oxidative stress-related factors and apoptosis-related factors were measured by real-time PCR, immunoblotting and ELISA. In addition, Toll-like receptor (TLR/nuclear factor kappa B (NF-κB and nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase (HO-1 pathways were investigated to illustrate the underlying mechanism. In vitro, microglial cells exposed to LPS were treated with GLB. Results: The injection of LPS caused walking, climbing and sensory disturbances in rats, induced inflammation, oxidative stress response and apoptosis, and activated TLR/NF-κB and Nrf2/ HO-1 pathways in the cerebral tissue. GLB administration attenuated LPS-induced alterations. The TLR/NF-κB pathway was deactivated and Nrf2/HO-1 was activated after application of GLB. In vitro, cytotoxic effects induced by the conditioned medium derived from microglial cells exposed to LPS in PC12 cells were attenuated by GLB. Conclusion: GLB suppresses LPS-induced PD symptoms by modification of TLR/NF-κB and Nrf2/HO-1 pathways in vivo and in vitro.

  12. Piper betle Induced Cytoprotective Genes and Proteins via the Nrf2/ARE Pathway in Aging Mice.

    Science.gov (United States)

    Aliahmat, Nor Syahida; Abdul Sani, Nur Fathiah; Wan Hasan, Wan Nuraini; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum

    2016-01-01

    The objective of this study was to elucidate the underlying antioxidant mechanism of aqueous extract of Piper betle (PB) in aging rats. The nuclear factor erythroid 2-related factor 2 (Nrf2)/ARE pathway involving phase II detoxifying and antioxidant enzymes plays an important role in the antioxidant system by reducing electrophiles and reactive oxygen species through induction of phase II enzymes and proteins. Genes and proteins of phase II detoxifying antioxidant enzymes were analyzed by QuantiGenePlex 2.0 Assay and Western blot analysis. PB significantly induced genes and proteins of phase II and antioxidant enzymes, NAD(P)H quinone oxidoreductase 1, and catalase in aging mice (p < 0.05). The expression of these enzymes were stimulated via translocation of Nrf2 into the nucleus, indicating the involvement of ARE, a cis-acting motif located in the promoter region of nearly all phase II genes. PB was testified for the first time to induce cytoprotective genes through the Nrf2/ARE signaling pathway, thus unraveling the antioxidant mechanism of PB during the aging process. © 2016 S. Karger AG, Basel.

  13. Troxerutin Reduces Kidney Damage against BDE-47-Induced Apoptosis via Inhibiting NOX2 Activity and Increasing Nrf2 Activity

    Directory of Open Access Journals (Sweden)

    Qun Shan

    2017-01-01

    Full Text Available 2,2,4,4-Tetrabromodiphenyl ether (BDE-47, one of the persistent organic pollutants, seriously influences the quality of life; however, its pathological mechanism remains unclear. Troxerutin is a flavonoid with pharmacological activity of antioxidation and anti-inflammation. In the present study, we investigated troxerutin against BDE-47-induced kidney cell apoptosis and explored the underlying mechanism. The results show that troxerutin reduced renal cell apoptosis and urinary protein secretion in BDE-47-treated mice. Western blot analysis shows that troxerutin supplement enhanced the ratio of Bcl-2/Bax; inhibited the release of cytochrome c from mitochondria, the activation of procaspase-9 and procaspase-3, and the cleavage of PARP; and reduced FAS, FASL, and caspase-8 levels induced by BDE-47. In addition, troxerutin decreased the production of reactive oxygen species (ROS and increased the activities of antioxidative enzymes. Furthermore, troxerutin blunted Nrf2 ubiquitylation, enhanced the activity of Nrf2, decreased the activity of NOX2, and ameliorated kidney oxidant status of BDE-47-treated mice. Together, these results confirm that troxerutin could alleviate the cytotoxicity of BDE-47 through antioxidation and antiapoptosis, which suggests that its protective mechanism is involved in the inhibition of apoptosis via suppressing NOX2 activity and increasing Nrf2 signaling pathway.

  14. Adaptive Redox Response of Mesenchymal Stromal Cells to Stimulation with Lipopolysaccharide Inflammagen: Mechanisms of Remodeling of Tissue Barriers in Sepsis

    Directory of Open Access Journals (Sweden)

    Nikolai V. Gorbunov

    2013-01-01

    Full Text Available Acute bacterial inflammation is accompanied by excessive release of bacterial toxins and production of reactive oxygen and nitrogen species (ROS and RNS, which ultimately results in redox stress. These factors can induce damage to components of tissue barriers, including damage to ubiquitous mesenchymal stromal cells (MSCs, and thus can exacerbate the septic multiple organ dysfunctions. The mechanisms employed by MSCs in order to survive these stress conditions are still poorly understood and require clarification. In this report, we demonstrated that in vitro treatment of MSCs with lipopolysaccharide (LPS induced inflammatory responses, which included, but not limited to, upregulation of iNOS and release of RNS and ROS. These events triggered in MSCs a cascade of responses driving adaptive remodeling and resistance to a “self-inflicted” oxidative stress. Thus, while MSCs displayed high levels of constitutively present adaptogens, for example, HSP70 and mitochondrial Sirt3, treatment with LPS induced a number of adaptive responses that included induction and nuclear translocation of redox response elements such as NFkB, TRX1, Ref1, Nrf2, FoxO3a, HO1, and activation of autophagy and mitochondrial remodeling. We propose that the above prosurvival pathways activated in MSCs in vitro could be a part of adaptive responses employed by stromal cells under septic conditions.

  15. Curcumin analog 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one exhibits enhanced ability on Nrf2 activation and protection against acrolein-induced ARPE-19 cell toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yuan [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China); Zou, Xuan [Center for Translational Medicine, FIST, Xi' an Jiaotong University, Xi' an (China); Cao, Ke; Xu, Jie; Yue, Tingting [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China); Dai, Fang; Zhou, Bo [State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou (China); Lu, Wuyuan [Center for Translational Medicine, FIST, Xi' an Jiaotong University, Xi' an (China); Feng, Zhihui, E-mail: zhfeng@mail.xjtu.edu.cn [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China); Liu, Jiankang, E-mail: j.liu@mail.xjtu.edu.cn [Center for Mitochondrial Biology and Medicine, The Key Laboratory of Biomedical Information Engineering of Ministry of Education, School of Life Science and Technology and Frontier Institute of Life Science, FIST, Xi' an Jiaotong University, Xi' an (China)

    2013-11-01

    Curcumin, a phytochemical agent in the spice turmeric, has received increasing attention for its anticancer, anti-inflammatory and antioxidant properties. However, application of curcumin has been limited due to its insolubility in water and poor bioavailability both clinically and experimentally. In addition, the protective effects and mechanisms of curcumin in eye diseases have been poorly studied. In the present study, we synthesized a curcumin analog, 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one (C3), which displayed improved protective effect against acrolein-induced toxicity in a human retinal pigment epithelial cell line (ARPE-19). At 5 μM, curcumin completely protected against acrolein-induced cell oxidative damage and preserved GSH levels and mitochondrial function. Surprisingly, C3 displayed a complete protective effect at 0.5 μM, which was much more efficient than curcumin. Both 0.5 μM C3 and 5 μM curcumin induced Nrf2 nuclear translocation and Nrf2 target genes transcription similarly. Experiments using Nrf2 siRNA showed that the protective effects of curcumin and C3 were eliminated by Nrf2 knockdown. Additionally, both curcumin and C3 activated the PI3/Akt pathway, however, Nrf2 activation was independent of this pathway, and therefore, we hypothesized that both curcumin and C3 activated phase II enzymes via directly disrupting the Nrf2/Keap1 complex and promoting Nrf2's nuclear translocation. Since acrolein challenge of ARPE-19 cells has been used as a model of smoking and age-related macular degeneration (AMD), we concluded that the curcumin analog, C3, may be a more promising drug candidate for its potential application for the prevention and treatment of eye diseases, such as AMD. - Highlights: • We examine toxicity effects of cigarette smoking component acrolein in retina cells. • We report a more efficient curcumin analog (C3) protecting cellular function. • Mitochondrial function and phase II enzyme activation are the

  16. Curcumin analog 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one exhibits enhanced ability on Nrf2 activation and protection against acrolein-induced ARPE-19 cell toxicity

    International Nuclear Information System (INIS)

    Li, Yuan; Zou, Xuan; Cao, Ke; Xu, Jie; Yue, Tingting; Dai, Fang; Zhou, Bo; Lu, Wuyuan; Feng, Zhihui; Liu, Jiankang

    2013-01-01

    Curcumin, a phytochemical agent in the spice turmeric, has received increasing attention for its anticancer, anti-inflammatory and antioxidant properties. However, application of curcumin has been limited due to its insolubility in water and poor bioavailability both clinically and experimentally. In addition, the protective effects and mechanisms of curcumin in eye diseases have been poorly studied. In the present study, we synthesized a curcumin analog, 1, 5-bis (2-trifluoromethylphenyl)-1, 4-pentadien-3-one (C3), which displayed improved protective effect against acrolein-induced toxicity in a human retinal pigment epithelial cell line (ARPE-19). At 5 μM, curcumin completely protected against acrolein-induced cell oxidative damage and preserved GSH levels and mitochondrial function. Surprisingly, C3 displayed a complete protective effect at 0.5 μM, which was much more efficient than curcumin. Both 0.5 μM C3 and 5 μM curcumin induced Nrf2 nuclear translocation and Nrf2 target genes transcription similarly. Experiments using Nrf2 siRNA showed that the protective effects of curcumin and C3 were eliminated by Nrf2 knockdown. Additionally, both curcumin and C3 activated the PI3/Akt pathway, however, Nrf2 activation was independent of this pathway, and therefore, we hypothesized that both curcumin and C3 activated phase II enzymes via directly disrupting the Nrf2/Keap1 complex and promoting Nrf2's nuclear translocation. Since acrolein challenge of ARPE-19 cells has been used as a model of smoking and age-related macular degeneration (AMD), we concluded that the curcumin analog, C3, may be a more promising drug candidate for its potential application for the prevention and treatment of eye diseases, such as AMD. - Highlights: • We examine toxicity effects of cigarette smoking component acrolein in retina cells. • We report a more efficient curcumin analog (C3) protecting cellular function. • Mitochondrial function and phase II enzyme activation are the major

  17. Induction of 26S proteasome subunit PSMB5 by the bifunctional inducer 3-methylcholanthrene through the Nrf2-ARE, but not the AhR/Arnt-XRE, pathway

    International Nuclear Information System (INIS)

    Kwak, Mi-Kyoung; Kensler, Thomas W.

    2006-01-01

    The 26S proteasome is responsible for degradation of abnormal intracellular proteins, including oxidatively damaged proteins and may play a role as a component of a cellular antioxidative system. However, little is known about regulation of proteasome expression. In the present study, regulation of proteasome expression by the bifunctional enzyme inducer and a specific signaling pathway for this regulation were investigated in murine neuroblastoma cells. Expression of catalytic core subunits including PSMB5 and peptidase activities of the proteasome were elevated following incubation with 3-methylcholanthrene (3-MC). Studies using reporter genes containing the murine Psmb5 promoter showed that transcriptional activity of this gene was enhanced by 3-MC. Overexpression of AhR/Arnt did not affect activation of the Pmsb5 promoter by 3-MC and deletion of the xenobiotic response elements (XREs) from this promoter exerted modest effects on inducibility in response to 3-MC. However, mutation of the proximal AREs of the Psmb5 promoter largely abrogated its inducibility by 3-MC. In addition, this promoter showed a blunted response toward 3-MC in the absence of nrf2; 3-MC incubation increased nuclear levels of Nrf2 only in wild-type cells. Collectively, these results indicate that expression of proteasome subunit PSMB5 is modulated by bifunctional enzyme inducers in a manner independent of the AhR/Arnt-XRE pathway but dependent upon the Nrf2-ARE pathway

  18. Hydrogen-Rich Water Intake Accelerates Oral Palatal Wound Healing via Activation of the Nrf2/Antioxidant Defense Pathways in a Rat Model

    Science.gov (United States)

    Orihuela-Campos, Rita Cristina; Fukui, Makoto; Ito, Hiro-O

    2016-01-01

    The wound healing process attempts to restore the integrity and function of the injured tissue. Additionally, proinflammatory cytokines, growth factors, and oxidative stress play important roles in wound healing. The aim of this study was to determine whether hydrogen-rich water intake induces the activation of the Nrf2/antioxidant defense pathway in rat palatal tissue, thereby reducing systemic oxidative stress and proinflammatory cytokine levels and promoting healing-associated genes. A circular excisional wound was created in the oral palatal region, and the wound healing process was observed. The rats were divided into two experimental groups in which either hydrogen-rich water or distilled water was consumed. In the drinking hydrogen-rich water, the palatal wound healing process was accelerated compared to that in the control group. As molecular hydrogen upregulated the Nrf2 pathway, systemic oxidative stresses were decreased by the activation of antioxidant activity. Furthermore, hydrogen-rich water intake reduced proinflammatory cytokine levels and promoted the expression of healing-associated factors in rat palatal tissue. In conclusion, hydrogen-rich water intake exhibited multiple beneficial effects through activation of the Nrf2/antioxidant defense pathway. The results of this study support the hypothesis that oral administration of hydrogen-rich water benefits the wound healing process by decreasing oxidative stress and inflammatory responses. PMID:26798423

  19. Fluoxetine protects against methamphetamine‑induced lung inflammation by suppressing oxidative stress through the SERT/p38 MAPK/Nrf2 pathway in rats.

    Science.gov (United States)

    Wang, Yun; Gu, Yu-Han; Liu, Ming; Bai, Yang; Wang, Huai-Liang

    2017-02-01

    Methamphetamine (MA) abuse is a major public health and safety concern throughout the world and a growing burden on healthcare costs. The purpose of the present study was to investigate the protective effect of fluoxetine against MA‑induced chronic pulmonary inflammation and to evaluate the potential role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidative stress. Wistar rats were divided into control, MA and two fluoxetine‑treated groups. Rats in the MA and the two fluoxetine‑treated groups were treated daily with intraperitoneal injection of 10 mg/kg MA twice daily. Rats in the two fluoxetine‑treated groups were injected intragastrically with fluoxetine (2 and 10 mg/kg) once daily, respectively. After 5 weeks, the rats were euthanized and hematoxylin and eosin staining, immunohistochemistry, western blot analysis and redox assay were performed. It was demonstrated that chronic exposure to MA can induce pulmonary inflammation in rats, with the symptoms of inflammatory cell infiltration, crowded lung parenchyma, thickened septum and a reduced number of alveolar sacs. Fluoxetine attenuated pulmonary inflammation and the expression of interleukin‑6 and tumor necrosis factor‑α in rat lungs. Fluoxetine inhibited MA‑induced increases in the expression levels of serotonin transporter (SERT) and p‑p38 mitogen‑activated protein kinase (MAPK), and reversed the MA‑induced decrease in nuclear Nrf2 and human heme oxygenase‑1 in lungs. Fluoxetine at 10 mg/kg significantly reversed the reduced glutathione (GSH) level, the ratio of GSH/oxidized glutathione, and the reactive oxygen species level in rat lungs from the MA group. These findings suggested that fluoxetine, a SERT inhibitor, has a protective effect against MA‑induced lung inflammation by suppressing oxidative stress through the SERT/p38 MAPK/Nrf2 pathway in rats.

  20. skn-1 is required for interneuron sensory integration and foraging behavior in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Mark A Wilson

    Full Text Available Nrf2/skn-1, a transcription factor known to mediate adaptive responses of cells to stress, also regulates energy metabolism in response to changes in nutrient availability. The ability to locate food sources depends upon chemosensation. Here we show that Nrf2/skn-1 is expressed in olfactory interneurons, and is required for proper integration of multiple food-related sensory cues in Caenorhabditis elegans. Compared to wild type worms, skn-1 mutants fail to perceive that food density is limiting, and display altered chemo- and thermotactic responses. These behavioral deficits are associated with aberrant AIY interneuron morphology and migration in skn-1 mutants. Both skn-1-dependent AIY autonomous and non-autonomous mechanisms regulate the neural circuitry underlying multisensory integration of environmental cues related to energy acquisition.

  1. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice

    International Nuclear Information System (INIS)

    Nakagami, Yasuhiro; Masuda, Kayoko

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis.

  2. Type 2 immunity and wound healing: evolutionary refinement of adaptive immunity by helminths

    Science.gov (United States)

    Gause, William C.; Wynn, Thomas A.; Allen, Judith E.

    2013-01-01

    Helminth-induced type 2 immune responses, which are characterized by the T helper 2 cell-associated cytokines interleukin-4 (IL-4) and IL-13, mediate host protection through enhanced tissue repair, the control of inflammation and worm expulsion. In this Opinion article, we consider type 2 immunity in the context of helminth-mediated tissue damage. We examine the relationship between the control of helminth infection and the mechanisms of wound repair, and we provide a new understanding of the adaptive type 2 immune response and its contribution to both host tolerance and resistance. PMID:23827958

  3. Keap1/Nrf2 pathway in kidney cancer : frequent methylation of KEAP1 gene promoter in clear renal cell carcinoma

    NARCIS (Netherlands)

    Fabrizio, Federico Pio; Costantini, Manuela; Copetti, Massimiliano; la Torre, Annamaria; Sparaneo, Angelo; Fontana, Andrea; Poeta, Luana; Gallucci, Michele; Sentinelli, Steno; Graziano, Paolo; Parente, Paola; Pompeo, Vincenzo; De Salvo, Laura; Simone, Giuseppe; Papalia, Rocco; Picardo, Francesco; Balsamo, Teresa; Flammia, Gerardo Paolo; Trombetta, Domenico; Pantalone, Angela; Kok, Klaas; Paranita, Ferronika; Muscarella, Lucia Anna; Fazio, Vito Michele

    2017-01-01

    The Keap1/Nrf2 pathway is a master regulator of the cellular redox state through the induction of several antioxidant defence genes implicated in chemotherapeutic drugs resistance of tumor cells. An increasing body of evidence supports a key role for Keap1/Nrf2 pathway in kidney diseases and renal

  4. Responses to reductive stress in the cardiovascular system.

    Science.gov (United States)

    Handy, Diane E; Loscalzo, Joseph

    2017-08-01

    There is a growing appreciation that reductive stress represents a disturbance in the redox state that is harmful to biological systems. On a cellular level, the presence of increased reducing equivalents and the lack of beneficial fluxes of reactive oxygen species can prevent growth factor-mediated signaling, promote mitochondrial dysfunction, increase apoptosis, and decrease cell survival. In this review, we highlight the importance of redox balance in maintaining cardiovascular homeostasis and consider the tenuous balance between oxidative and reductive stress. We explain the role of reductive stress in models of protein aggregation-induced cardiomyopathies, such as those caused by mutations in αB-crystallin. In addition, we discuss the role of NADPH oxidases in models of heart failure and ischemia-reperfusion to illustrate how oxidants may mediate the adaptive responses to injury. NADPH oxidase 4, a hydrogen peroxide generator, also has a major role in promoting vascular homeostasis through its regulation of vascular tone, angiogenic responses, and effects on atherogenesis. In contrast, the lack of antioxidant enzymes that reduce hydrogen peroxide, such as glutathione peroxidase 1, promotes vascular remodeling and is deleterious to endothelial function. Thus, we consider the role of oxidants as necessary signals to promote adaptive responses, such as the activation of Nrf2 and eNOS, and the stabilization of Hif1. In addition, we discuss the adaptive metabolic reprogramming in hypoxia that lead to a reductive state, and the subsequent cellular redistribution of reducing equivalents from NADH to other metabolites. Finally, we discuss the paradoxical ability of excess reducing equivalents to stimulate oxidative stress and promote injury. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. MAT, a Novel Polyherbal Aphrodisiac Formulation, Enhances Sexual Function and Nrf2/HO-1 Pathway While Reducing Oxidative Damage in Male Rats

    Directory of Open Access Journals (Sweden)

    Kazim Sahin

    2018-01-01

    Full Text Available Mucuna pruriens, Ashwagandha, and Tribulus terrestris are known as the enhancers for sexual health, functional activities, vitality, and longevity. These herbs had been widely used in the Ayurveda medicine as aphrodisiacs through the ages, and their efficacy was also verified separately in our previous publication. Therefore, the aim of this study was to determine the effects of Mucuna, Ashwagandha, and Tribulus complexes on sexual function in rats. Twenty-eight male rats allocated to four groups as follows: (i negative control (C; (ii positive control or sildenafil citrate treated group (5 mg/kg (S; (iii MAT1 (combination of 10 mg Mucuna (M + 10 mg Ashwagandha (A + 10 mg Tribulus (T/kg BW; (iv MAT 2 (20 mg Mucuna + 20 mg Ashwagandha + 20 mg Tribulus/kg BW. There was no significant difference found between the MAT1 and MAT2 groups while they showed significantly increased testosterone, follicle-stimulating hormone (FSH, and luteinizing hormone (LH levels when compared to the negative control. Significant increases in Nrf2/HO1 levels and decreases in NF-κB were detected in MAT groups similar to the decrease in serum and testis malondialdehyde (MDA levels as compared to both controls. The sperm motility, count, and rate also significantly improved in both MAT groups, while ALT, AST, creatinine, ALP, and urea levels did not change in any of the groups. Oral consumption of MATs combination in male rats resulted in inhibition of NF-κB and MDA and also increased sex hormones with Nrf2-mediated HO-1 induction. MAT combinations may improve sexual functions by increasing levels of sexual hormones and regulation of NF-κB and Nrf2/HO-1 signaling pathways.

  6. MAT, a Novel Polyherbal Aphrodisiac Formulation, Enhances Sexual Function and Nrf2/HO-1 Pathway While Reducing Oxidative Damage in Male Rats

    Science.gov (United States)

    Tuzcu, Mehmet; Orhan, Cemal; Sahin, Nurhan; Akdemir, Fatih; Yilmaz, Ismet

    2018-01-01

    Mucuna pruriens, Ashwagandha, and Tribulus terrestris are known as the enhancers for sexual health, functional activities, vitality, and longevity. These herbs had been widely used in the Ayurveda medicine as aphrodisiacs through the ages, and their efficacy was also verified separately in our previous publication. Therefore, the aim of this study was to determine the effects of Mucuna, Ashwagandha, and Tribulus complexes on sexual function in rats. Twenty-eight male rats allocated to four groups as follows: (i) negative control (C); (ii) positive control or sildenafil citrate treated group (5 mg/kg) (S); (iii) MAT1 (combination of 10 mg Mucuna (M) + 10 mg Ashwagandha (A) + 10 mg Tribulus (T)/kg BW); (iv) MAT 2 (20 mg Mucuna + 20 mg Ashwagandha + 20 mg Tribulus/kg BW). There was no significant difference found between the MAT1 and MAT2 groups while they showed significantly increased testosterone, follicle-stimulating hormone (FSH), and luteinizing hormone (LH) levels when compared to the negative control. Significant increases in Nrf2/HO1 levels and decreases in NF-κB were detected in MAT groups similar to the decrease in serum and testis malondialdehyde (MDA) levels as compared to both controls. The sperm motility, count, and rate also significantly improved in both MAT groups, while ALT, AST, creatinine, ALP, and urea levels did not change in any of the groups. Oral consumption of MATs combination in male rats resulted in inhibition of NF-κB and MDA and also increased sex hormones with Nrf2-mediated HO-1 induction. MAT combinations may improve sexual functions by increasing levels of sexual hormones and regulation of NF-κB and Nrf2/HO-1 signaling pathways. PMID:29853975

  7. 1,4 Naphthoquinone protects radiation induced cell death and DNA damage in lymphocytes by activation Nrf2/are pathway and enhancing DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Nazir M; Sandur, Santosh K; Checker, Rahul; Sharma, Deepak; Poduval, T.B., E-mail: nazirbiotech@rediffmail.com [Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Mumbai (India)

    2012-07-01

    1,4-Naphthoquinone (NQ) is the parent molecule of many clinically approved anticancer, anti-infective, and antiparasitic drugs such as anthracycline, mitomycin, daunorubicin, doxorubicin, diospyrin, and malarone. Presence of NQ during a-irradiation (4Gy) significantly reduced the death of irradiated murine splenic lymphocytes in a dose dependent manner (0.05-liM), with complete protection at liM as assessed by PI staining. Radioprotection by NQ was further confirmed by inhibition of caspase activation, decrease in cell size, DNA-fragmentation, nuclear-blebbing and clonogenic assay. All trans retinoic acid which is inhibitor of Nrf-2 pathway, completely abrogated the radioprotective effect of NQ, suggesting that radioprotective activity of NQ may be due to activation of Nrf-2 signaling pathways. Further, addition of NQ to lymphocytes activated Nrf-2 in time dependent manner as shown by confocal microscopy, electrophoretic mobility shift assay and quantitative real time PCR. It also increased the expression of Nrf-2 dependent cytoprotective genes like hemeoxygenase-1, MnSOD, catalse as demonstrated by real time PCR and flowcytometry. NQ protected lymphocytes significantly against radiation-induced cell death even when added after irradiation. Complete protection was observed by addition of NQ up to 2 h after irradiation. However, percentage protection decreased with increasing time interval. These results suggested that NQ may offer protection to lymphocytes activating repair pathways. Repair of radiation induced DNA strand breaks was studied by comet assay. Pretreatment of lymphocytes with NQ induced single strand breaks up to 6h but not double strand breaks in DNA. However, NQ mediated single strand breaks were repaired completely at longer time intervals. Addition of NQ to lymphocytes prior to 4 Gy a-radiation exposure showed decrease in the yield of DNA double strand breaks. The observed time-dependent decrease in the DNA strand breaks could be attributed to

  8. Taurine Protects Mouse Spermatocytes from Ionizing Radiation-Induced Damage Through Activation of Nrf2/HO-1 Signaling.

    Science.gov (United States)

    Yang, Wenjun; Huang, Jinfeng; Xiao, Bang; Liu, Yan; Zhu, Yiqing; Wang, Fang; Sun, Shuhan

    2017-01-01

    The increasing prevalence of ionizing radiation exposure has inevitably raised public concern over the potential detrimental effects of ionizing radiation on male reproductive system function. The detection of drug candidates to prevent reproductive system from damage caused by ionizing radiation is urgent. We aimed to investigate the protective role of taurine on the injury of mouse spermatocyte-derived cells (GC-2) subjected to ionizing radiation. mouse spermatocytes (GC-2 cells) were exposed to ionizing radiation with or without treatment of Taurine. The effect of ionizing radiation and Taurine treatment on GC-2 cells were evaluated by cell viability assay (CCK8), cell cycle and apoptosis. The relative protein abundance change was determined by Western blotting. The siRNA was used to explore whether Nrf2 signaling was involved in the cytoprotection of Taurine. Taurine significantly inhibited the decrease of cell viability, percentage of apoptotic cells and cell cycle arrest induced by ionizing radiation. Western blot analysis showed that taurine significantly limited the ionizing radiation-induced down-regulation of CyclinB1 and CDK1, and suppressed activation of Fas/FasL system pathway. In addition, taurine treatment significantly increased the expression of Nrf2 and HO-1 in GC-2 cells exposed to ionizing radiation, two components in antioxidant pathway. The above cytoprotection of Taurine was blocked by siNrf2. Our results demonstrate that taurine has the potential to effectively protect GC-2 cells from ionizing radiation- triggered damage via upregulation of Nrf2/HO-1 signaling. © 2017 The Author(s). Published by S. Karger AG, Basel.

  9. Silencing of NRF2 Reduces the Expression of ALDH1A1 and ALDH3A1 and Sensitizes to 5-FU in Pancreatic Cancer Cells

    Directory of Open Access Journals (Sweden)

    Hong-Quan Duong

    2017-07-01

    Full Text Available Pancreatic cancer remains an intractable cancer with a poor five-year survival rate, which requires new therapeutic modalities based on the biology of pancreatic oncogenesis. Nuclear factor E2 related factor-2 (NRF2, a key cytoprotective nuclear transcription factor, regulates antioxidant production, reduction, detoxification and drug efflux proteins. It also plays an essential role in cell homeostasis, cell proliferation and resistance to chemotherapy. We aimed to evaluate the possibility that modulation of NRF2 expression could be effective in the treatment of pancreatic cancer cells. We investigated whether the depletion of NRF2 by using small interfering RNAs (siRNAs is effective in the expression of biomarkers of pancreatic cancer stemness such as aldehyde dehydrogenase 1 family, member A1 (ALDH1A1 and aldehyde dehydrogenase 3 family, member A1 (ALDH3A1. NRF2 knockdown markedly reduced the expression of NRF2 and glutamate-cysteine ligase catalytic subunit (GCLC in cell lines established from pancreatic cancers. NRF2 silencing also decreased the ALDH1A1 and ALDH3A1 expression. Furthermore, this NRF2 depletion enhanced the antiproliferative effects of the chemotherapeutic agent, 5-fluorouracil (5-FU in pancreatic cancer cells.

  10. Nuclear translocation of Nrf2 and expression of antioxidant defence genes in THP-1 cells exposed to carbon nanotubes.

    Science.gov (United States)

    Brown, David M; Donaldson, Kenneth; Stone, Vicki

    2010-06-01

    Carbon nanotubes have a wide range of applications in various industries and their use is likely to rise in the future. Currently, a major concern is that with the increasing use and production of these materials, there may be increased health risks to exposed workers. Long (> 15 microm) straight nanotubes may undergo frustrated phagocytosis which is likely to result in reduced clearance. We examine here the effects of multiwalled carbon nanotubes of different sizes on monocytic THP-1 cells, with regard to their ability to stimulate increased expression of the HO-1 and GST genes and their ability to produce nuclear translocation of the transcription factor, Nrf2, as well as the release of several pro-inflammatory cytokines and mediators of inflammation. Our results suggest that long (50 microm) carbon nanotubes (62.5 microg/ml for 4 hours) produce increased nuclear translocation of Nrf2 and increased HO-1 gene expression compared with shorter entangled nanotubes. There was no increased gene expression for GST. The long nanotubes (NT1) caused increased release of the proinflammatory cytokine IL-1beta, an effect which was diminished by the antioxidant trolox, suggesting a role of oxidative stress in the upregulation of this cytokine. Tentatively, our study suggests that long carbon nanotubes may exert their effect in THP-1 cells in part via an oxidative stress mechanism.

  11. Ginsenoside Rb1 improves postoperative fatigue syndrome by reducing skeletal muscle oxidative stress through activation of the PI3K/Akt/Nrf2 pathway in aged rats.

    Science.gov (United States)

    Zhuang, Cheng-Le; Mao, Xiang-Yu; Liu, Shu; Chen, Wei-Zhe; Huang, Dong-Dong; Zhang, Chang-Jing; Chen, Bi-Cheng; Shen, Xian; Yu, Zhen

    2014-10-05

    Ginsenoside Rb1 is reported to possess anti-fatigue activity, but the mechanisms remain unknown. The aim of this study was to investigate the molecular mechanisms responsible for the anti-fatigue effect of ginsenoside Rb1 on postoperative fatigue syndrome induced by major small intestinal resection (MSIR) in aged rat. Aged rats with MSIR were administrated with ginsenoside Rb1 (15 mg/kg) once a day from 3 days before surgery to the day of sacrifice, or with saline as corresponding controls. Rats without MSIR but going through the same surgery procedure were administrated with saline as blank controls. Anti-fatigue effect was assessed by an open field test; superoxide dismutase, reactive oxygen species and malondialdehyde in skeletal muscle were determined. The mRNA levels of Akt2 and Nrf2 in skeletal muscle were measured by real-time quantitative PCR. The activation of Akt and Nrf2 was examined by western blot and immunohistofluorescence. Our results revealed that ginsenoside Rb1 significantly increased the journey and the rearing frequency, decreased the time of rest in aged rats with MSIR. In addition, ginsenoside Rb1 significantly reduced reactive oxygen species and malondialdehyde release and increased the superoxide dismutase activity of skeletal muscle in aged rats with MSIR. Ginsenoside Rb1 also increased the expression of Akt2 and Nrf2 mRNA, up-regulated Akt phosphorylation and Nrf2 nuclear translocation. These findings indicate that ginsenoside Rb1 has an anti-fatigue effect on postoperative fatigue syndrome in aged rat, and the mechanism possibly involves activation of the PI3K/Akt pathway with subsequent Nrf2 nuclear translocation and induction of antioxidant enzymes. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Protective effects of curcumin against mercury-induced hepatic injuries in rats, involvement of oxidative stress antagonism, and Nrf2-ARE pathway activation.

    Science.gov (United States)

    Liu, W; Xu, Z; Li, H; Guo, M; Yang, T; Feng, S; Xu, B; Deng, Yu

    2017-09-01

    Mercury (Hg) represents a ubiquitous environmental heavy metal that could lead to severe toxic effects in a variety of organs usually at a low level. The present study focused on the liver oxidative stress, one of the most important roles playing in Hg hepatotoxicity, by evaluation of different concentrations of mercuric chloride (HgCl 2 ) administration. Moreover, the protective potential of curcumin against Hg hepatotoxic effects was also investigated. Eighty-four rats were randomly divided into six groups for a three-days experiment: control, dimethyl sulfoxide control, HgCl 2 treatment (0.6, 1.2, and 2.4 mg kg -1 day -1 ), and curcumin pretreatment (100 mg kg -1 day -1 ) groups. Exposure of HgCl 2 resulted in acute dose-dependent hepatotoxic effects. Administration of 2.4 mg kg -1 HgCl 2 significantly elevated total Hg, nonprotein sulfhydryl, reactive oxygen species formation, malondialdehyde, apoptosis levels, serum lactate dehydrogenase, and alanine transaminase activities, with an impairment of superoxide dismutase and glutathione peroxidase in the liver. Moreover, HgCl 2 treatment activated nuclear factor-E2-related factor 2-antioxidant response element (Nrf2-ARE) signaling pathway in further investigation, with a significant upregulation of Nrf2, heme oxygenase-1, and γ-glutamylcysteine synthetase heavy subunit expression, relative to control. Pretreatment with curcumin obviously prevented HgCl 2 -induced liver oxidative stress, which may be due to its free radical scavenging or Nrf2-ARE pathway-inducing properties. Taking together these data suggest that curcumin counteracts HgCl 2 hepatotoxicity through antagonizing liver oxidative stress.

  13. Nrf2 Expression Modifies Influenza A Entry and Replication inNasal Epithelial Cells

    Science.gov (United States)

    Influenza infection is a major cause of morbidity and mortality worldwide, especially during pandemics outbreaks. Emerging data indicate that phase II antioxidant enzyme pathways could playa role in virus-associated inflammation and immune clearance. While Nrf2-dependent gene exp...

  14. Flavonoids Derived from Abelmoschus esculentus Attenuates UV-B Induced Cell Damage in Human Dermal Fibroblasts Through Nrf2-ARE Pathway.

    Science.gov (United States)

    Patwardhan, Juilee; Bhatt, Purvi

    2016-05-01

    Ultraviolet-B (UV-B) radiation is a smaller fraction of the total radiation reaching the Earth but leads to extensive damage to the deoxyribonucleic acid (DNA) and other biomolecules through formation of free radicals altering redox homeostasis of the cell. Abelmoschus esculentus (okra) has been known in Ayurveda as antidiabetic, hypolipidemic, demulscent, antispasmodic, diuretic, purgative, etc. The aim of this study is to evaluate the protective effect of flavonoids from A. esculentus against UV-B-induced cell damage in human dermal fibroblasts. UV-B protective activity of ethyl acetate (EA) fraction of okra was studied against UV-B-induced cytotoxicity, antioxidant regulation, oxidative DNA damage, intracellular reactive oxygen species (ROS) generation, apoptotic morphological changes, and regulation of heme oxygenase-1 (HO-1) gene through nuclear factor E2-related factor 2-antioxidant response element (Nrf2-ARE) pathway. Flavonoid-rich EA fraction depicted a significant antioxidant potential also showing presence of rutin. Pretreatment of cells with EA fraction (10-30 μg/ml) prevented UV-B-induced cytotoxicity, depletion of endogenous enzymatic antioxidants, oxidative DNA damage, intracellular ROS production, apoptotic changes, and overexpression of Nrf2 and HO-1. Our study demonstrated for the 1(st) time that EA fraction of okra may reduce oxidative stress through Nrf2-ARE pathway as well as through endogenous enzymatic antioxidant system. These results suggested that flavonoids from okra may be considered as potential UV-B protective agents and may also be formulated into herbal sunscreen for topical application. Flavonoid-enriched ethyl acetate (EA) fraction from A. esculentus protected against ultraviolet-B (UV-B)-induced oxidative DNA damageEA fraction prevented UV-B-induced cytotoxicity, depletion of endogenous enzymatic antioxidants, and intracellular reactive oxygen species productionEA fraction could reduce oxidative stress through the Nrf2-ARE

  15. Role of miR-155 in fluorooctane sulfonate-induced oxidative hepatic damage via the Nrf2-dependent pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chong; Han, Rui; Liu, Limin [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Zhang, Fang, E-mail: zhangfang@ucas.ac.cn [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Li, Fang [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Xiang, Mingdeng [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Ding, Wenjun, E-mail: dingwj@ucas.ac.cn [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China)

    2016-03-15

    Studies demonstrated that perfluorooctane sulfonate (PFOS) tends to accumulate in the liver and is capable to cause hepatomegaly. In the present study, we investigated the roles of miR-155 in PFOS-induced hepatotoxicity in SD rats and HepG2 cells. Male SD rats were orally administrated with PFOS at 1 or 10 mg/kg/day for 28 days while HepG2 cells were treated with 0–50 μM of PFOS for 24 h or 50 μM of PFOS for 1, 3, 6, 12 or 24 h, respectively. We found that PFOS significantly increased the liver weight and serum alanine transaminase (ALT) and aspartate amino transferase (AST) levels in rats. Morphologically, PFOS caused actin filament remodeling and endothelial permeability changes in the liver. Moreover, PFOS triggered reactive oxygen species (ROS) generation and induced apoptosis in both in vivo and in vitro assays. Immunoblotting data showed that NF-E2-related factor-2 (Nrf2) expression and activation and its target genes were all suppressed by PFOS in the liver and HepG2 cells. However, PFOS significantly increased miR-155 expression. Further studies showed that pretreatment of HepG2 cells with catalase significantly decreased miR-155 expression and substantially increased Nrf2 expression and activation, resulting in reduction of PFOS-induced cytotoxicity and oxidative stress. Taken together, these results indicated that miR-155 plays an important role in the PFOS-induced hepatotoxicity by disrupting Nrf2/ARE signaling pathway. - Highlights: • PFOS is capable to cause hepatotoxicity. • PFOS triggers ROS generation and induces apoptosis both in vivo and in vitro assays. • PFOS-induced ROS inhibits Nrf2 expression and its transactivation function. • PFOS promotes miR155 expression in liver and HepG2 cells. • miR-155 is involved in PFOS-induced hepatotoxicity by disrupting Nrf2/ARE pathway.

  16. Lycopene inhibits ICAM-1 expression and NF-κB activation by Nrf2-regulated cell redox state in human retinal pigment epithelial cells.

    Science.gov (United States)

    Yang, Po-Min; Wu, Zhi-Zhen; Zhang, Yu-Qi; Wung, Being-Sun

    2016-06-15

    Age-related macular degeneration (AMD) is one of the most common diseases leading to blindness in elderly people. The progression of AMD may be prevented through anti-inflammation and antioxidation in retinal pigment epithelium (RPE) cells. Lycopene, a carotenoid, has been shown to possess both antioxidative and anti-inflammatory properties. This research was conducted to detail the mechanisms of these effects of lycopene-treated RPE cells. We exposed ARPE-19 cells to TNFα after pretreatment with lycopene, and measured monocyte adhesion, ICAM-1 expression, NF-κB nuclear translocation, and transcriptional activity. Cell viability was assayed with Alamar Blue. The cell redox state was tested by glutathione (GSH) and reactive oxygen species (ROS) levels. The importance of the Nrf2 pathway was tested in nuclear translocation, promoter reporter assay, and siRNA. Lycopene could reduce TNF-α-induced monocyte adhesion and H2O2- induced cell damage in RPE cells. Furthermore, lycopene inhibits ICAM-1 expression and abolishes NF-κB activation for up to 12h in TNFα-treated RPE cells. Lycopene upregulates Nrf2 levels in nuclear extracts and increases the transactivity of antioxidant response elements. The use of Nrf2 siRNA blocks the inhibitory effect of lycopene in TNF-α-induced ICAM-1 expression and NF-κB activation. Glutamate-cysteine ligase (GCL) is the rate-limiting enzyme in the de novo synthesis of GSH. We found that lycopene increases intracellular GSH levels and GCL expression. Following lycopene treatment, TNF-α-induced ROS production was abolished. The Nrf2-regulated antioxidant property plays a pivotal role in the anti-inflammatory mechanism underlying the inhibition of NF-κB activation in lycopene-treated ARPE-19 cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Radio-adaptive response

    International Nuclear Information System (INIS)

    Ikushima, Takaji

    1991-01-01

    An adaptive response to radiation stress was found in cultured Chinese hamster V79 cells, as a suppressed induction of micronuclei (MNs) and sister chromatid exchanges (SCEs) in the cells conditioned by very low doses. The important characteristics of the novel chromosomal response, called radio-adaptive response (RAR), that have newly emerged in this study are: 1) Low doses of beta-rays from tritiated water (HTO) as well as tritiated thymidine can cause the RAR. 2) Thermal neutrons, a high LET radiation, can not act as tritium beta-rays or gamma-rays. 3) The RAR expression is suppressed by an inhibition of protein synthesis. 4) Several proteins are newly synthesized concurrently with the RAR expression after adapting doses, viewed by two-dimensional electrophoresis of cellular proteins. These results suggest that the RAR is an adaptive chromosomal DNA repair induced by very low doses of low LET radiations under restricted conditions, accompanying the inducible specific gene expression. (author)

  18. Protection by sulforaphane from type 1 diabetes-induced testicular apoptosis is associated with the up-regulation of Nrf2 expression and function

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Xin; Bai, Yang; Zhang, Zhiguo [The First Hospital of Jilin University, Changchun 130021 (China); KCHRI at the Department of Pediatrics, The University of Louisville, Louisville 40202 (United States); Xin, Ying, E-mail: xiny@jlu.edu.cn [KCHRI at the Department of Pediatrics, The University of Louisville, Louisville 40202 (United States); Key Laboratory of Pathobiology, Ministry of Education, Jilin University, Changchun 130021 (China); Cai, Lu, E-mail: l0cai001@louisville.edu [The First Hospital of Jilin University, Changchun 130021 (China); KCHRI at the Department of Pediatrics, The University of Louisville, Louisville 40202 (United States)

    2014-09-01

    Diabetes-induced testicular apoptosis is predominantly due to increased oxidative stress. The nuclear factor-erythroid 2-related factor 2 (Nrf2), as a master transcription factor in controlling anti-oxidative systems, is able to be induced by sulforaphane (SFN). To examine whether SFN prevents testicular apoptosis, type 1 diabetic mouse model was induced with multiple low-dose streptozotocin. Diabetic and age-matched control mice were treated with and without SFN at 0.5 mg/kg daily in five days of each week for 3 months and then kept until 6 months. Diabetes significantly increased testicular apoptosis that was associated with endoplasmic reticulum stress and mitochondrial cell death pathways, shown by the increased expression of C/EBP homologous protein (CHOP), cleaved caspase-12, Bax to Bcl2 expression ratio, and cleaved caspase-3. Diabetes also significantly increased testicular oxidative damage, inflammation and fibrosis, and decreased germ cell proliferation. All these diabetic effects were significantly prevented by SFN treatment for the first 3 months, and the protective effect could be sustained at 3 months after SFN treatment. SFN was able to up-regulate Nrf2 expression and function. The latter was reflected by the increased phosphorylation of Nrf2 at Ser40 and expression of Nrf2 downstream antioxidants at mRNA and protein levels. These results suggest that type 1 diabetes significantly induced testicular apoptosis and damage along with increasing oxidative stress and cell death and suppressing Nrf2 expression and function. SFN is able to prevent testicular oxidative damage and apoptosis in type 1 diabetes mice, which may be associated with the preservation of testicular Nrf2 expression and function under diabetic condition. - Highlights: • Sulforaphane (SFN) could attenuate diabetes-induced germ cell apoptosis. • SFN could preserve germ cell proliferation under diabetic conditions. • SFN testicular protection was sustained until 3 months after

  19. Protection by sulforaphane from type 1 diabetes-induced testicular apoptosis is associated with the up-regulation of Nrf2 expression and function

    International Nuclear Information System (INIS)

    Jiang, Xin; Bai, Yang; Zhang, Zhiguo; Xin, Ying; Cai, Lu

    2014-01-01

    Diabetes-induced testicular apoptosis is predominantly due to increased oxidative stress. The nuclear factor-erythroid 2-related factor 2 (Nrf2), as a master transcription factor in controlling anti-oxidative systems, is able to be induced by sulforaphane (SFN). To examine whether SFN prevents testicular apoptosis, type 1 diabetic mouse model was induced with multiple low-dose streptozotocin. Diabetic and age-matched control mice were treated with and without SFN at 0.5 mg/kg daily in five days of each week for 3 months and then kept until 6 months. Diabetes significantly increased testicular apoptosis that was associated with endoplasmic reticulum stress and mitochondrial cell death pathways, shown by the increased expression of C/EBP homologous protein (CHOP), cleaved caspase-12, Bax to Bcl2 expression ratio, and cleaved caspase-3. Diabetes also significantly increased testicular oxidative damage, inflammation and fibrosis, and decreased germ cell proliferation. All these diabetic effects were significantly prevented by SFN treatment for the first 3 months, and the protective effect could be sustained at 3 months after SFN treatment. SFN was able to up-regulate Nrf2 expression and function. The latter was reflected by the increased phosphorylation of Nrf2 at Ser40 and expression of Nrf2 downstream antioxidants at mRNA and protein levels. These results suggest that type 1 diabetes significantly induced testicular apoptosis and damage along with increasing oxidative stress and cell death and suppressing Nrf2 expression and function. SFN is able to prevent testicular oxidative damage and apoptosis in type 1 diabetes mice, which may be associated with the preservation of testicular Nrf2 expression and function under diabetic condition. - Highlights: • Sulforaphane (SFN) could attenuate diabetes-induced germ cell apoptosis. • SFN could preserve germ cell proliferation under diabetic conditions. • SFN testicular protection was sustained until 3 months after

  20. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression

    Science.gov (United States)

    Gore, Prashant R.; Prajapati, Chaitali P.; Mahajan, Umesh B.; Goyal, Sameer N.; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R.

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498