
Sample records for nrf2 deficient transgenic

  1. Effects of Nrf2 deficiency on arsenic metabolism in mice. (United States)

    Wang, Huihui; Zhu, Jiayu; Li, Lu; Li, Yongfang; Lv, Hang; Xu, Yuanyuan; Sun, Guifan; Pi, Jingbo


    Inorganic arsenic (iAs) is a known toxicant and carcinogen. Worldwide arsenic exposure has become a threat to human health. The severity of arsenic toxicity is strongly correlated with the speed of arsenic metabolism (methylation) and clearance. Furthermore, oxidative stress is recognized as a major mechanism for arsenic-induced toxicity. Nuclear factor-E2-related factor 2 (Nrf2), a key regulator in cellular adaptive antioxidant response, is clearly involved in alleviation of arsenic-induced oxidative damage. Multiple studies demonstrate that Nrf2 deficiency mice are more vulnerable to arsenic-induced intoxication. However, what effect Nrf2 deficiency might have on arsenic metabolism in mice is still unknown. In the present study, we measured the key enzymes involved in arsenic metabolism in Nrf2-WT and Nrf2-KO mice. Our results showed that basal transcript levels of glutathione S-transferase omega 2 (Gsto2) were significantly higher and GST mu 1 (Gstm1) lower in Nrf2-KO mice compared to Nrf2-WT control. Arsenic speciation and methylation rate in liver and urine was then studied in mice treated with 5mg/kg sodium arsenite for 12h. Although there were some alterations in arsenic metabolism enzymes between Nrf2-WT and Nrf2-KO mice, the Nrf2 deficiency had no significant effect on arsenic methylation. These results suggest that the Nrf2-KO mice are more sensitive to arsenic than Nrf2-WT mainly because of differences in adaptive antioxidant detoxification capacity rather than arsenic methylation capacity. Copyright © 2017. Published by Elsevier Inc.

  2. Age-related retinopathy in NRF2-deficient mice.

    Directory of Open Access Journals (Sweden)

    Zhenyang Zhao


    Full Text Available Cumulative oxidative damage is implicated in the pathogenesis of age-related macular degeneration (AMD. Nuclear factor erythroid 2-related factor 2 (NRF2 is a transcription factor that plays key roles in retinal antioxidant and detoxification responses. The purposes of this study were to determine whether NRF2-deficient mice would develop AMD-like retinal pathology with aging and to explore the underlying mechanisms.Eyes of both wild type and Nrf2(-/- mice were examined in vivo by fundus photography and electroretinography (ERG. Structural changes of the outer retina in aged animals were examined by light and electron microscopy, and immunofluorescence labeling. Our results showed that Nrf2(-/- mice developed age-dependent degenerative pathology in the retinal pigment epithelium (RPE. Drusen-like deposits, accumulation of lipofuscin, spontaneous choroidal neovascularization (CNV and sub-RPE deposition of inflammatory proteins were present in Nrf2(-/- mice after 12 months. Accumulation of autophagy-related vacuoles and multivesicular bodies was identified by electron microscopy both within the RPE and in Bruch's membrane of aged Nrf2(-/- mice.Our data suggest that disruption of Nfe2l2 gene increased the vulnerability of outer retina to age-related degeneration. NRF2-deficient mice developed ocular pathology similar to cardinal features of human AMD and deregulated autophagy is likely a mechanistic link between oxidative injury and inflammation. The Nrf2(-/- mice can provide a novel model for mechanistic and translational research on AMD.

  3. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D.


    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  4. Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu-Kun Jennifer; Wu, Kai Connie; Liu, Jie; Klaassen, Curtis D., E-mail:


    Nrf2, a master regulator of intracellular redox homeostasis, is indicated to participate in fatty acid metabolism in liver. However, its role in diet-induced obesity remains controversial. In the current study, genetically engineered Nrf2-null, wild-type (WT), and Nrf2-activated, Keap1-knockdown (K1-KD) mice were fed either a control or a high-fat Western diet (HFD) for 12 weeks. The results indicate that the absence or enhancement of Nrf2 activity did not prevent diet-induced obesity, had limited effects on lipid metabolism, but affected blood glucose homeostasis. Whereas the Nrf2-null mice were resistant to HFD-induced glucose intolerance, the Nrf2-activated K1-KD mice exhibited prolonged elevation of circulating glucose during a glucose tolerance test even on the control diet. Feeding a HFD did not activate the Nrf2 signaling pathway in mouse livers. Fibroblast growth factor 21 (Fgf21) is a liver-derived anti-diabetic hormone that exerts glucose- and lipid-lowering effects. Fgf21 mRNA and protein were both elevated in livers of Nrf2-null mice, and Fgf21 protein was lower in K1-KD mice than WT mice. The inverse correlation between Nrf2 activity and hepatic expression of Fgf21 might explain the improved glucose tolerance in Nrf2-null mice. Furthermore, a more oxidative cellular environment in Nrf2-null mice could affect insulin signaling in liver. For example, mRNA of insulin-like growth factor binding protein 1, a gene repressed by insulin in hepatocytes, was markedly elevated in livers of Nrf2-null mice. In conclusion, genetic alteration of Nrf2 does not prevent diet-induced obesity in mice, but deficiency of Nrf2 improves glucose homeostasis, possibly through its effects on Fgf21 and/or insulin signaling. -- Highlights: ► Nrf2 deficiency improves glucose tolerance in mice fed a high-fat diet. ► The anti-diabetic hormone, Fgf21, is highly expressed in livers of Nrf2-null mice. ► The absence of Nrf2 increases the insulin-regulated Igfbp-1 mRNA in liver.

  5. NRF2 deficiency replicates transcriptomic changes in Alzheimer's patients and worsens APP and TAU pathology

    Directory of Open Access Journals (Sweden)

    Ana I. Rojo


    Full Text Available Failure to translate successful neuroprotective preclinical data to a clinical setting in Alzheimer's disease (AD indicates that amyloidopathy and tauopathy alone provide an incomplete view of disease. We have tested here the relevance of additional homeostatic deviations that result from loss of activity of transcription factor NRF2, a crucial regulator of multiple stress responses whose activity declines with ageing. A transcriptomic analysis demonstrated that NRF2-KO mouse brains reproduce 7 and 10 of the most dysregulated pathways of human ageing and AD brains, respectively. Then, we generated a mouse that combines amyloidopathy and tauopathy with either wild type (AT-NRF2-WT or NRF2-deficiency (AT-NRF2-KO. AT-NRF2-KO brains presented increased markers of oxidative stress and neuroinflammation as well as higher levels of insoluble phosphorylated-TAU and Aβ*56 compared to AT-NRF2-WT mice. Young adult AT-NRF2-KO mice exhibited deficits in spatial learning and memory and reduced long term potentiation in the perforant pathway. This study demonstrates the relevance of normal homeostatic responses that decline with ageing, such as NRF2 activity, in the protection against proteotoxic, inflammatory and oxidative stress and provide a new strategy to fight AD.

  6. Effects of Nrf2 Deficiency on Bone Microarchitecture in an Experimental Model of Osteoporosis

    Directory of Open Access Journals (Sweden)

    Lidia Ibáñez


    Full Text Available Objective. Redox imbalance contributes to bone fragility. We have evaluated the in vivo role of nuclear factor erythroid derived 2-related factor-2 (Nrf2, an important regulator of cellular responses to oxidative stress, in bone metabolism using a model of postmenopausal osteoporosis. Methods. Ovariectomy was performed in both wild-type and mice deficient in Nrf2 (Nrf2−/−. Bone microarchitecture was analyzed by μCT. Serum markers of bone metabolism were also measured. Reactive oxygen species production was determined using dihydrorhodamine 123. Results. Sham-operated or ovariectomized Nrf2−/− mice exhibit a loss in trabecular bone mineral density in femur, accompanied by a reduction in cortical area in vertebrae. Nrf2 deficiency tended to increase osteoblastic markers and significantly enhanced osteoclastic markers in sham-operated animals indicating an increased bone turnover with a main effect on bone resorption. We have also shown an increased production of oxidative stress in bone marrow-derived cells from sham-operated or ovariectomized Nrf2−/− mice and a higher responsiveness of bone marrow-derived cells to osteoclastogenic stimuli in vitro. Conclusion. We have demonstrated in vivo a key role of Nrf2 in the maintenance of bone microarchitecture.

  7. Nrf2 deficiency potentiates methamphetamine-induced dopaminergic axonal damage and gliosis in the striatum. (United States)

    Granado, Noelia; Lastres-Becker, Isabel; Ares-Santos, Sara; Oliva, Idaira; Martin, Eduardo; Cuadrado, Antonio; Moratalla, Rosario


    Oxidative stress that correlates with damage to nigrostriatal dopaminergic neurons and reactive gliosis in the basal ganglia is a hallmark of methamphetamine (METH) toxicity. In this study, we analyzed the protective role of the transcription factor Nrf2 (nuclear factor-erythroid 2-related factor 2), a master regulator of redox homeostasis, in METH-induced neurotoxicity. We found that Nrf2 deficiency exacerbated METH-induced damage to dopamine neurons, shown by an increase in loss of tyrosine hydroxylase (TH)- and dopamine transporter (DAT)-containing fibers in striatum. Consistent with these effects, Nrf2 deficiency potentiated glial activation, indicated by increased striatal expression of markers for microglia (Mac-1 and Iba-1) and astroglia (GFAP) one day after METH administration. At the same time, Nrf2 inactivation dramatically potentiated the increase in TNFα mRNA and IL-15 protein expression in GFAP+ cells in the striatum. In sharp contrast to the potentiation of striatal damage, Nrf2 deficiency did not affect METH-induced dopaminergic neuron death or expression of glial markers or proinflammatory molecules in the substantia nigra. This study uncovers a new role for Nrf2 in protection against METH-induced inflammatory and oxidative stress and striatal degeneration. Copyright © 2011 Wiley‐Liss, Inc.

  8. Enhanced expression of Nrf2 in mice attenuates the fatty liver produced by a methionine- and choline-deficient diet

    International Nuclear Information System (INIS)

    Zhang, Yu-Kun Jennifer; Yeager, Ronnie L.; Tanaka, Yuji; Klaassen, Curtis D.


    Oxidative stress has been proposed as an important promoter of the progression of fatty liver diseases. The current study investigates the potential functions of the Nrf2-Keap1 signaling pathway, an important hepatic oxidative stress sensor, in a rodent fatty liver model. Mice with no (Nrf2-null), normal (wild type, WT), and enhanced (Keap1 knockdown, K1-kd) expression of Nrf2 were fed a methionine- and choline-deficient (MCD) diet or a control diet for 5 days. Compared to WT mice, the MCD diet-caused hepatosteatosis was more severe in the Nrf2-null mice and less in the K1-kd mice. The Nrf2-null mice had lower hepatic glutathione and exhibited more lipid peroxidation, whereas the K1-kd mice had the highest amount of glutathione in the liver and developed the least lipid peroxidation among the three genotypes fed the MCD diet. The Nrf2 signaling pathway was activated by the MCD diet, and the Nrf2-targeted cytoprotective genes Nqo1 and Gstα1/2 were induced in WT and even more in K1-kd mice. In addition, Nrf2-null mice on both control and MCD diets exhibited altered expression profiles of fatty acid metabolism genes, indicating Nrf2 may influence lipid metabolism in liver. For example, mRNA levels of long chain fatty acid translocase CD36 and the endocrine hormone Fgf21 were higher in livers of Nrf2-null mice and lower in the K1-kd mice than WT mice fed the MCD diet. Taken together, these observations indicate that Nrf2 could decelerate the onset of fatty livers caused by the MCD diet by increasing hepatic antioxidant and detoxification capabilities.

  9. Melatonin Attenuates Memory Impairment Induced by Klotho Gene Deficiency Via Interactive Signaling Between MT2 Receptor, ERK, and Nrf2-Related Antioxidant Potential (United States)

    Shin, Eun-Joo; Chung, Yoon Hee; Le, Hoang-Lan Thi; Jeong, Ji Hoon; Dang, Duy-Khanh; Nam, Yunsung; Wie, Myung Bok; Nah, Seung-Yeol; Nabeshima, Yo-Ichi; Nabeshima, Toshitaka; Kim, Hyoung-Chun


    Background: We demonstrated that oxidative stress plays a crucial role in cognitive impairment in klotho mutant mice, a genetic model of aging. Since down-regulation of melatonin due to aging is well documented, we used this genetic model to determine whether the antioxidant property of melatonin affects memory impairment. Methods: First, we examined the effects of melatonin on hippocampal oxidative parameters and the glutathione/oxidized glutathione (GSH/GSSG) ratio and memory dysfunction of klotho mutant mice. Second, we investigated whether a specific melatonin receptor is involved in the melatonin-mediated pharmacological response by application with melatonin receptor antagonists. Third, we examined phospho-extracellular-signal-regulated kinase (ERK) expression, nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation, Nrf2 DNA binding activity, and glutamate-cysteine ligase (GCL) mRNA expression. Finally, we examined effects of the ERK inhibitor SL327 in response to antioxidant efficacy and memory enhancement mediated by melatonin. Results: Treatment with melatonin resulted in significant attenuations of oxidative damage, a decrease in the GSH/GSSG ratio, and a significant amelioration of memory impairment in this aging model. These effects of melatonin were significantly counteracted by the selective MT2 receptor antagonist 4-P-PDOT. Importantly, 4-P-PDOT or SL327 also counteracted melatonin-mediated attenuation in response to the decreases in phospho-ERK expression, Nrf2 nuclear translocation, Nrf2 DNA-binding activity, and GCL mRNA expression in the hippocampi of klotho mutant mice. SL327 also counteracted the up-regulation of the GSH/GSSG ratio and the memory enhancement mediated by melatonin in klotho mutant mice. Conclusions: Melatonin attenuates oxidative stress and the associated memory impairment induced by klotho deficiency via signaling interaction between the MT2 receptor and ERK- and Nrf2-related antioxidant potential. PMID

  10. Epigallocatechin-3-gallate enhances key enzymatic activities of hepatic thioredoxin and glutathione systems in selenium-optimal mice but activates hepatic Nrf2 responses in selenium-deficient mice

    Directory of Open Access Journals (Sweden)

    Ruixia Dong


    Full Text Available Selenium participates in the antioxidant defense mainly through a class of selenoproteins, including thioredoxin reductase. Epigallocatechin-3-gallate (EGCG is the most abundant and biologically active catechin in green tea. Depending upon the dose and biological systems, EGCG may function either as an antioxidant or as an inducer of antioxidant defense via its pro-oxidant action or other unidentified mechanisms. By manipulating the selenium status, the present study investigated the interactions of EGCG with antioxidant defense systems including the thioredoxin system comprising of thioredoxin and thioredoxin reductase, the glutathione system comprising of glutathione and glutathione reductase coupled with glutaredoxin, and the Nrf2 system. In selenium-optimal mice, EGCG increased hepatic activities of thioredoxin reductase, glutathione reductase and glutaredoxin. These effects of EGCG appeared to be not due to overt pro-oxidant action because melatonin, a powerful antioxidant, did not influence the increase. However, in selenium-deficient mice, with low basal levels of thioredoxin reductase 1, the same dose of EGCG did not elevate the above-mentioned enzymes; intriguingly EGCG in turn activated hepatic Nrf2 response, leading to increased heme oxygenase 1 and NAD(PH:quinone oxidoreductase 1 protein levels and thioredoxin activity. Overall, the present work reveals that EGCG is a robust inducer of the Nrf2 system only in selenium-deficient conditions. Under normal physiological conditions, in selenium-optimal mice, thioredoxin and glutathione systems serve as the first line defense systems against the stress induced by high doses of EGCG, sparing the activation of the Nrf2 system.

  11. Flesh quality loss in response to dietary isoleucine deficiency and excess in fish: a link to impaired Nrf2-dependent antioxidant defense in muscle.

    Directory of Open Access Journals (Sweden)

    Lu Gan

    Full Text Available The present study explored the impact of dietary isoleucine (Ile on fish growth and flesh quality and revealed a possible role of muscle antioxidant defense in flesh quality in relation to dietary Ile. Grass carp (weighing 256.8±3.5 g were fed diets containing six graded levels of Ile (3.8, 6.6, 9.3, 12.5, 15.2 and 18.5 g/kg for eight weeks. The results indicated that compared with Ile deficiency (3.8 g/kg diets and excess (18.5 g/kg diets groups, 9.3-15.2 g Ile/kg diet supplementations promoted fish growth and muscle fat deposition, whereas 6.6-15.2 g Ile/kg diets supplementation enhanced muscle nutrients (protein and total EAAs deposition. Furthermore, muscle shear force, pH value, and hydroxyproline concentration were improved by 9.3-12.5, 9.3 and 9.3 g Ile/kg diet supplementations, respectively. However, muscle cooking loss, lactate content, and activities of cathepsin B and L were decreased by 6.6-15.2, 9.3-12.5, 9.3-12.5 and 9.3-15.2 g Ile/kg diet supplementations, respectively. Additionally, 6.6-15.2 and 6.6-12.5 g Ile/kg diet supplementations attenuated malondialdehyde and protein carbonyl contents, respectively. The activities of copper/zinc superoxide dismutase (Cu/Zn-SOD and glutathione peroxidase (GPx, and glutathione content were enhanced by 6.6-9.3, 6.6-12.5 and 6.6-15.2 g Ile/kg diet supplementations, respectively. Moreover, the relative mRNA expressions of antioxidant enzymes, including Cu/Zn-SOD (6.6-12.5 g/kg diets and GPx (12.5 g/kg diets, as well as antioxidant-related signaling molecules, including NF-E2-related factor 2 (Nrf2 (6.6-12.5 g/kg diets, target of rapamycin (6.6-12.5 g/kg diets, ribosomal S6 protein kinase 1 (9.3-12.5 g/kg diets and casein kinase 2 (6.6-12.5 g/kg diets, were up-regulated when Ile diet supplementations were administered at these levels, respectively, whereas the relative mRNA expression of Kelch-like ECH-associated protein 1 was down-regulated with 9.3 g Ile/kg diet supplementations. Collectively

  12. Targeted deletion of Nrf2 reduces urethane-induced lung tumor development in mice.

    Directory of Open Access Journals (Sweden)

    Alison K Bauer

    Full Text Available Nrf2 is a key transcription factor that regulates cellular redox and defense responses. However, permanent Nrf2 activation in human lung carcinomas promotes pulmonary malignancy and chemoresistance. We tested the hypothesis that Nrf2 has cell survival properties and lack of Nrf2 suppresses chemically-induced pulmonary neoplasia by treating Nrf2(+/+ and Nrf2(-/- mice with urethane. Airway inflammation and injury were assessed by bronchoalveolar lavage analyses and histopathology, and lung tumors were analyzed by gross and histologic analysis. We used transcriptomics to assess Nrf2-dependent changes in pulmonary gene transcripts at multiple stages of neoplasia. Lung hyperpermeability, cell death and apoptosis, and inflammatory cell infiltration were significantly higher in Nrf2(-/- mice compared to Nrf2(+/+ mice 9 and 11 wk after urethane. Significantly fewer lung adenomas were found in Nrf2(-/- mice than in Nrf2(+/+ mice at 12 and 22 wk. Nrf2 modulated expression of genes involved cell-cell signaling, glutathione metabolism and oxidative stress response, and immune responses during early stage neoplasia. In lung tumors, Nrf2-altered genes had roles in transcriptional regulation of cell cycle and proliferation, carcinogenesis, organismal injury and abnormalities, xenobiotic metabolism, and cell-cell signaling genes. Collectively, Nrf2 deficiency decreased susceptibility to urethane-induced lung tumorigenesis in mice. Cell survival properties of Nrf2 were supported, at least in part, by reduced early death of initiated cells and heightened advantage for tumor cell expansion in Nrf2(+/+ mice relative to Nrf2(-/- mice. Our results were consistent with the concept that Nrf2 over-activation is an adaptive response of cancer conferring resistance to anti-cancer drugs and promoting malignancy.

  13. Equol Attenuates Atherosclerosis in Apolipoprotein E-Deficient Mice by Inhibiting Endoplasmic Reticulum Stress via Activation of Nrf2 in Endothelial Cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available The development of atherosclerosis is closely related to excessive endoplasmic reticulum stress (ERs. Equol reportedly protects against cardiovascular disease; however, the underlying mechanism for this protection remains unknown. Herein, the mechanisms contributing to the atheroprotective effect of equol were addressed using apolipoprotein E knockout (apoE-/- mice fed a high-fat diet (HFD with or without equol. Equol intervention reduced atherosclerotic lesions in the aorta in HFD-fed apoE-/- mice. Plasma lipid analysis showed that equol intervention reduced triglycerides, total cholesterol and LDL-cholesterol and increased HDL-cholesterol. Additionally, equol administration decreased lipid accumulation in the liver. Simultaneously, equol treatment inhibited cell apoptosis induced by t-BHP and thapsigargin in human umbilical vein endothelial cells (HUVECs. Furthermore, equol treatment attenuated palmitate, t-BHP or thapsigargin-induced upregulation of ER stress markers, including p-PERK, p-eIF2α, GRP78, ATF6 and CHOP proteins expression. The same tendency was also observed in aortic lysates in apoE-/- mice fed with equol plus HFD compared with HFD alone. Moreover, equol treatment dose dependently activated the Nrf2 signaling pathway under oxidative stress. Additionally, elevation of Nrf2 induction was found in aortic lysates in apoE-/- mice fed with a HFD diet containing equol compared with a HFD diet without equol. Importantly, Nrf2 siRNA interference induced CHOP and attenuated the effect of equol to inhibit t-BHP mediated CHOP induction, furthermore, abrogated cell apoptosis induced by t-BHP, suggesting a role for Nrf2 in the protective effect of equol in HUVECs. Collectively, these findings implicate that the improvement of atherosclerosis by equol through attenuation of ER stress is mediated, at least in part, by activating the Nrf2 signaling pathway.

  14. Pyrrolidine dithiocarbamate activates the Nrf2 pathway in astrocytes. (United States)

    Liddell, Jeffrey R; Lehtonen, Sarka; Duncan, Clare; Keksa-Goldsteine, Velta; Levonen, Anna-Liisa; Goldsteins, Gundars; Malm, Tarja; White, Anthony R; Koistinaho, Jari; Kanninen, Katja M


    Endogenous defense against oxidative stress is controlled by nuclear factor erythroid 2-related factor 2 (Nrf2). The normal compensatory mechanisms to combat oxidative stress appear to be insufficient to protect against the prolonged exposure to reactive oxygen species during disease. Counterbalancing the effects of oxidative stress by up-regulation of Nrf2 signaling has been shown to be effective in various disease models where oxidative stress is implicated, including Alzheimer's disease. Stimulation of Nrf2 signaling by small-molecule activators is an appealing strategy to up-regulate the endogenous defense mechanisms of cells. Here, we investigate Nrf2 induction by the metal chelator and known nuclear factor-κB inhibitor pyrrolidine dithiocarbamate (PDTC) in cultured astrocytes and neurons, and mouse brain. Nrf2 induction is further examined in cultures co-treated with PDTC and kinase inhibitors or amyloid-beta, and in Nrf2-deficient cultures. We show that PDTC is a potent inducer of Nrf2 signaling specifically in astrocytes and demonstrate the critical role of Nrf2 in PDTC-mediated protection against oxidative stress. This induction appears to be regulated by both Keap1 and glycogen synthase kinase 3β. Furthermore, the presence of amyloid-beta magnifies PDTC-mediated induction of endogenous protective mechanisms, therefore suggesting that PDTC may be an effective Nrf2 inducer in the context of Alzheimer's disease. Finally, we show that PDTC increases brain copper content and glial expression of heme oxygenase-1, and decreases lipid peroxidation in vivo, promoting a more antioxidative environment. PDTC activates Nrf2 and its antioxidative targets in astrocytes but not neurons. These effects may contribute to the neuroprotection observed for PDTC in models of Alzheimer's disease.

  15. Induction of Mrp3 and Mrp4 transporters during acetaminophen hepatotoxicity is dependent on Nrf2

    International Nuclear Information System (INIS)

    Aleksunes, Lauren M.; Slitt, Angela L.; Maher, Jonathan M.; Augustine, Lisa M.; Goedken, Michael J.; Chan, Jefferson Y.; Cherrington, Nathan J.; Klaassen, Curtis D.; Manautou, Jose E.


    The transcription factor NFE2-related factor 2 (Nrf2) mediates detoxification and antioxidant gene transcription following electrophile exposure and oxidative stress. Mice deficient in Nrf2 (Nrf2-null) are highly susceptible to acetaminophen (APAP) hepatotoxicity and exhibit lower basal and inducible expression of cytoprotective genes, including NADPH quinone oxidoreductase 1 (Nqo1) and glutamate cysteine ligase (catalytic subunit, or Gclc). Administration of toxic APAP doses to C57BL/6J mice generates electrophilic stress and subsequently increases levels of hepatic Nqo1, Gclc and the efflux multidrug resistance-associated protein transporters 1-4 (Mrp1-4). It was hypothesized that induction of hepatic Mrp1-4 expression following APAP is Nrf2 dependent. Plasma and livers from wild-type (WT) and Nrf2-null mice were collected 4, 24 and 48 h after APAP. As expected, hepatotoxicity was greater in Nrf2-null compared to WT mice. Gene and protein expression of Mrp1-4 and the Nrf2 targets, Nqo1 and Gclc, was measured. Induction of Nqo1 and Gclc mRNA and protein after APAP was dependent on Nrf2 expression. Similarly, APAP treatment increased hepatic Mrp3 and Mrp4 mRNA and protein in WT, but not Nrf2-null mice. Mrp1 was induced in both genotypes after APAP, suggesting that elevated expression of this transporter was independent of Nrf2. Mrp2 was not induced in either genotype at the mRNA or protein levels. These results show that Nrf2 mediates induction of Mrp3 and Mrp4 after APAP but does not affect Mrp1 or Mrp2. Thus coordinated regulation of detoxification enzymes and transporters by Nrf2 during APAP hepatotoxicity is a mechanism by which hepatocytes may limit intracellular accumulation of potentially toxic chemicals

  16. Hepatocyte-specific deletion of the keap1 gene activates Nrf2 and confers potent resistance against acute drug toxicity

    International Nuclear Information System (INIS)

    Okawa, Hiromi; Motohashi, Hozumi; Kobayashi, Akira; Aburatani, Hiroyuki; Kensler, Thomas W.; Yamamoto, Masayuki


    Nrf2 is a key regulator of many detoxifying enzyme genes, and cytoplasmic protein Keap1 represses the Nrf2 activity under quiescent conditions. Germ line deletion of the keap1 gene results in constitutive activation of Nrf2, but the pups unexpectedly died before weaning. To investigate how constitutive activation of Nrf2 influences the detoxification system in adult mice, we generated mice bearing a hepatocyte-specific disruption of the keap1 gene. Homozygous mice were viable and their livers displayed no apparent abnormalities, but nuclear accumulation of Nrf2 is elevated. Microarray analysis revealed that, while many detoxifying enzyme genes are highly expressed, some of the typical Nrf2-dependent genes are only marginally increased in the Keap1-deficient liver. The mutant mice were significantly more resistant to toxic doses of acetaminophen than control animals. These results demonstrate that chronic activation of Nrf2 confers animals with resistance to xenobiotics without affecting the morphological and physiological integrity of hepatocytes

  17. Nrf2 protects against airway disorders

    International Nuclear Information System (INIS)

    Cho, Hye-Youn; Kleeberger, Steven R.


    Nuclear factor-erythroid 2 related factor 2 (Nrf2) is a ubiquitous master transcription factor that regulates antioxidant response elements (AREs)-mediated expression of antioxidant enzyme and cytoprotective proteins. In the unstressed condition, Kelch-like ECH-associated protein 1 (Keap1) suppresses cellular Nrf2 in cytoplasm and drives its proteasomal degradation. Nrf2 can be activated by diverse stimuli including oxidants, pro-oxidants, antioxidants, and chemopreventive agents. Nrf2 induces cellular rescue pathways against oxidative injury, abnormal inflammatory and immune responses, apoptosis, and carcinogenesis. Application of Nrf2 germ-line mutant mice has identified an extensive range of protective roles for Nrf2 in experimental models of human disorders in the liver, gastrointestinal tract, airway, kidney, brain, circulation, and immune or nerve system. In the lung, lack of Nrf2 exacerbated toxicity caused by multiple oxidative insults including supplemental respiratory therapy (e.g., hyperoxia, mechanical ventilation), cigarette smoke, allergen, virus, bacterial endotoxin and other inflammatory agents (e.g., carrageenin), environmental pollution (e.g., particles), and a fibrotic agent bleomycin. Microarray analyses and bioinformatic studies elucidated functional AREs and Nrf2-directed genes that are critical components of signaling mechanisms in pulmonary protection by Nrf2. Association of loss of function with promoter polymorphisms in NRF2 or somatic and epigenetic mutations in KEAP1 and NRF2 has been found in cohorts of patients with acute lung injury/acute respiratory distress syndrome or lung cancer, which further supports the role for NRF2 in these lung diseases. In the current review, we address the role of Nrf2 in airways based on emerging evidence from experimental oxidative disease models and human studies.

  18. Vitamin E deficiency depressed fish growth, disease resistance, and the immunity and structural integrity of immune organs in grass carp (Ctenopharyngodon idella): Referring to NF-κB, TOR and Nrf2 signaling. (United States)

    Pan, Jia-Hong; Feng, Lin; Jiang, Wei-Dan; Wu, Pei; Kuang, Sheng-Yao; Tang, Ling; Zhang, Yong-An; Zhou, Xiao-Qiu; Liu, Yang


    This study investigated the effects of dietary vitamin E on growth, disease resistance and the immunity and structural integrity of head kidney, spleen and skin in grass carp (Ctenopharyngodon idella). The fish were fed six diets containing graded levels of vitamin E (0, 45, 90, 135, 180 and 225 mg/kg diet) for 10 weeks. Subsequently, a challenge test was conducted by injection of Aeromonas hydrophila. The results showed that compared with optimal vitamin E supplementation, vitamin E deficiency caused depressed growth, poor survival rates and increased skin lesion morbidity in grass carp. Meanwhile, vitamin E deficiency decreased lysozyme and acid phosphatase activities, complement component 3 and complement component 4 contents in the head kidney, spleen and skin of grass carp (P vitamin E deficiency down-regulated antimicrobial peptides (Hepcidin, liver-expressed antimicrobial peptide-2A, -2B, β-defensin), IL-10, TGFβ1, IκBα, TOR and S6K1 mRNA levels (P vitamin E deficiency caused oxidative damage, decreased superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) and glutathione reductase (GR) activities, and down-regulated the mRNA levels of antioxidant enzymes and signaling molecules Nrf2 (P Vitamin E deficiency also induced apoptosis by up-regulating capase-2, -3, -7, and -8 mRNA levels in the head kidney, spleen and skin of grass carp. In conclusion, this study indicated that dietary vitamin E deficiency depressed fish growth, impaired the immune function and disturbed the structural integrity of the head kidney, spleen and skin in grass carp, but optimal vitamin E supplementation can reverse those negative effects in fish. The optimal vitamin E requirements for young grass carp (266.39-1026.63 g) to achieve optimal growth performance and disease resistance based on the percent weight gain (PWG) and skin lesion morbidity were estimated to be 116.2 and 130.9 mg/kg diet, respectively. Meanwhile, based on immune indicator (LA activity

  19. Expression of Nrf2 in neurodegenerative diseases. (United States)

    Ramsey, Chenere P; Glass, Charles A; Montgomery, Marshall B; Lindl, Kathryn A; Ritson, Gillian P; Chia, Luis A; Hamilton, Ronald L; Chu, Charleen T; Jordan-Sciutto, Kelly L


    In response to oxidative stress, the nuclear factor E2-related factor 2 (Nrf2) transcription factor translocates from the cytoplasm into the nucleus and transactivates expression of genes with antioxidant activity. Despite this cellular mechanism, oxidative damage is abundant in Alzheimer and Parkinson disease (AD and PD). To investigate mechanisms by which Nrf2 activity may be aberrant or insufficient in neurodegenerative conditions, we assessed Nrf2 localization in affected brain regions of AD, Lewy body variant of AD (LBVAD), and PD. By immunohistochemistry, Nrf2 is expressed in both the nucleus and the cytoplasm of neurons in normal hippocampi with predominant expression in the nucleus. In AD and LBVAD, Nrf2 was predominantly cytoplasmic in hippocampal neurons and was not a major component of beta amyloid plaques or neurofibrillary tangles. By immunoblotting, we observed a significant decrease in nuclear Nrf2 levels in AD cases. In contrast, Nrf2 was strongly nuclear in PD nigral neurons but cytoplasmic in substantia nigra of normal, AD, and LBVAD cases. These findings suggest that Nrf2-mediated transcription is not induced in neurons in AD despite the presence of oxidative stress. In PD, nuclear localization of Nrf2 is strongly induced, but this response may be insufficient to protect neurons from degeneration.

  20. Nrf2: bane or blessing in cancer? (United States)

    Xiang, MingJun; Namani, Akhileshwar; Wu, ShiJun; Wang, XiaoLi


    The Kelch-like ECH-associated protein 1 (Keap1)-nuclear factor-E2-related factor 2 (Nrf2)-antioxidant response element pathway serves a major function in endogenous cytoprotection in normal cells. Nrf2 is a transcription factor that mainly regulates the expression of a wide array of genes that produce the antioxidants and other proteins responsible for the detoxification of xenobiotics and reactive oxygen species. Nrf2 mediates the chemoprevention of cancer in normal cells. Growing body of evidence suggests that Nrf2 is not only involved in the chemoprevention of normal cells but also promotes the growth of cancer cells. However, the mechanism underlying the function of Nrf2 in oncogenesis and tumor protection in cancer cells remains unclear and thus requires further study. This review aims to rationalize the existing functions of Nrf2 in chemoprevention and tumorigenesis, as well as the somatic mutations of Nrf2 and Keap1 in cancer and Nrf2 cross talk with miRNAs. This review also discusses the future challenges in Nrf2 research.

  1. Disruption of Nrf2, a key inducer of antioxidant defenses, attenuates ApoE-mediated atherosclerosis in mice.

    Directory of Open Access Journals (Sweden)

    Thomas E Sussan

    Full Text Available BACKGROUND: Oxidative stress and inflammation are two critical factors that drive the formation of plaques in atherosclerosis. Nrf2 is a redox-sensitive transcription factor that upregulates a battery of antioxidative genes and cytoprotective enzymes that constitute the cellular response to oxidative stress. Our previous studies have shown that disruption of Nrf2 in mice (Nrf2(-/- causes increased susceptibility to pulmonary emphysema, asthma and sepsis due to increased oxidative stress and inflammation. Here we have tested the hypothesis that disruption of Nrf2 in mice causes increased atherosclerosis. PRINCIPAL FINDINGS: To investigate the role of Nrf2 in the development of atherosclerosis, we crossed Nrf2(-/- mice with apoliporotein E-deficient (ApoE(-/- mice. ApoE(-/- and ApoE(-/-Nrf2(-/- mice were fed an atherogenic diet for 20 weeks, and plaque area was assessed in the aortas. Surprisingly, ApoE(-/-Nrf2(-/- mice exhibited significantly smaller plaque area than ApoE(-/- controls (11.5% vs 29.5%. This decrease in plaque area observed in ApoE(-/-Nrf2(-/- mice was associated with a significant decrease in uptake of modified low density lipoproteins (AcLDL by isolated macrophages from ApoE(-/-Nrf2(-/- mice. Furthermore, atherosclerotic plaques and isolated macrophages from ApoE(-/-Nrf2(-/- mice exhibited decreased expression of the scavenger receptor CD36. CONCLUSIONS: Nrf2 is pro-atherogenic in mice, despite its antioxidative function. The net pro-atherogenic effect of Nrf2 may be mediated via positive regulation of CD36. Our data demonstrates that the potential effects of Nrf2-targeted therapies on cardiovascular disease need to be investigated.

  2. Nrf2 impacts cellular bioenergetics by controlling substrate availability for mitochondrial respiration

    Directory of Open Access Journals (Sweden)

    Kira M. Holmström


    Transcription factor Nrf2 and its repressor Keap1 regulate a network of cytoprotective genes involving more than 1% of the genome, their best known targets being drug-metabolizing and antioxidant genes. Here we demonstrate a novel role for this pathway in directly regulating mitochondrial bioenergetics in murine neurons and embryonic fibroblasts. Loss of Nrf2 leads to mitochondrial depolarisation, decreased ATP levels and impaired respiration, whereas genetic activation of Nrf2 increases the mitochondrial membrane potential and ATP levels, the rate of respiration and the efficiency of oxidative phosphorylation. We further show that Nrf2-deficient cells have increased production of ATP in glycolysis, which is then used by the F1Fo-ATPase for maintenance of the mitochondrial membrane potential. While the levels and in vitro activities of the respiratory complexes are unaffected by Nrf2 deletion, their activities in isolated mitochondria and intact live cells are substantially impaired. In addition, the rate of regeneration of NADH after inhibition of respiration is much slower in Nrf2-knockout cells than in their wild-type counterparts. Taken together, these results show that Nrf2 directly regulates cellular energy metabolism through modulating the availability of substrates for mitochondrial respiration. Our findings highlight the importance of efficient energy metabolism in Nrf2-mediated cytoprotection.

  3. Targeting NRF2 signaling for cancer chemoprevention

    International Nuclear Information System (INIS)

    Kwak, Mi-Kyoung; Kensler, Thomas W.


    Modulation of the metabolism and disposition of carcinogens through induction of cytoprotective enzymes is one of several promising strategies to prevent cancer. Chemopreventive efficacies of inducers such as dithiolethiones and sulforaphane have been extensively studied in animals as well as in humans. The KEAP1-NRF2 system is a key, but not unilateral, molecular target for these chemopreventive agents. The transcription factor NRF2 (NF-E2-related factor 2) is a master regulator of the expression of a subset of genes, which produce proteins responsible for the detoxication of electrophiles and reactive oxygen species as well as the removal or repair of some of their damage products. It is believed that chemopreventive enzyme inducers affect the interaction between KEAP1 and NRF2 through either mediating conformational changes of the KEAP1 protein or activating phosphorylation cascades targeting the KEAP1-NRF2 complex. These events in turn affect NRF2 stability and trafficking. Recent advances elucidating the underlying structural biology of KEAP1-NRF2 signaling and identification of the gene clusters under the transcriptional control of NRF2 are facilitating understanding of the potential pleiotropic effects of NRF2 activators and discovery of novel classes of potent chemopreventive agents such as the triterpenoids. Although there is appropriately a concern regarding a deleterious role of the KEAP1-NRF2 system in cancer cell biology, especially as the pathway affects cell survival and drug resistance, the development and the use of NRF2 activators as chemopreventive agents still holds a great promise for protection of normal cells from a diversity of environmental stresses that contribute to the burden of cancer and other chronic, degenerative diseases.

  4. Constitutive activation of Nrf2 induces a stable reductive state in the mouse myocardium

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam


    Full Text Available Redox homeostasis regulates key cellular signaling pathways in both physiology and pathology. The cell's antioxidant response provides a defense against oxidative stress and establishes a redox tone permissive for cell signaling. The molecular regulation of the well-known Keap1/Nrf2 system acts as sensor responding to changes in redox homeostasis and is poorly studied in the heart. Importantly, it is not yet known whether Nrf2 alone can serve as a master regulator of cellular redox homeostasis without compensation of the transcriptional regulation of antioxidant response element (ARE genes through alternate mechanisms. Here, we addressed this question using cardiac-specific transgenic expression at two different levels of constitutively active nuclear erythroid related factor 2 (caNrf2 functioning independently of Keap1. The caNrf2 mice showed augmentation of glutathione (GSH, the key regulator of the cellular thiol redox state. The Trans-AM assay for Nrf2-binding to the antioxidant response element (ARE showed a dose-dependent increase associated with upregulation of several major antioxidant genes and proteins. This was accompanied by a significant decrease in dihydroethidium staining and malondialdehyde (MDA in the caNrf2-TG mice myocardium. Interestingly, caNrf2 gene-dosage dependent redox changes were noted resulting in generation of a multi-stage model of pro-reductive and reductive conditions in the myocardium of TG-low and TG-high mice, respectively. These data clearly show that Nrf2 levels alone are capable of serving as the master regulator of the ARE. These models provide an important platform to investigate the impact of the Nrf2 system independent of the need to regulate the activity of Keap1 and the consequent exposure to pro-oxidants or electrophiles, which have numerous off-target effects.

  5. Nrf2 mediates redox adaptations to exercise

    Directory of Open Access Journals (Sweden)

    Aaron J. Done


    Full Text Available The primary aim of this review is to summarize the current literature on the effects of acute exercise and regular exercise on nuclear factor erythroid 2-related factor 2 (Nrf2 activity and downstream targets of Nrf2 signaling. Nrf2 (encoded in humans by the NFE2L2 gene is the master regulator of antioxidant defenses, a transcription factor that regulates expression of more than 200 cytoprotective genes. Increasing evidence indicates that Nrf2 signaling plays a key role in how oxidative stress mediates the beneficial effects of exercise. Episodic increases in oxidative stress induced through bouts of acute exercise stimulate Nrf2 activation and when applied repeatedly, as with regular exercise, leads to upregulation of endogenous antioxidant defenses and overall greater ability to counteract the damaging effects of oxidative stress. The evidence of Nrf2 activation in response to exercise across variety of tissues may be an important mechanism of how exercise exerts its well-known systemic effects that are not limited to skeletal muscle and myocardium. Additionally there are emerging data that results from animal studies translate to humans.

  6. Mechanism of testosterone deficiency in the transgenic sickle cell mouse.

    Directory of Open Access Journals (Sweden)

    Biljana Musicki

    Full Text Available Testosterone deficiency is associated with sickle cell disease (SCD, but its underlying mechanism is not known. We investigated the possible occurrence and mechanism of testosterone deficiency in a mouse model of human SCD. Transgenic sickle male mice (Sickle exhibited decreased serum and intratesticular testosterone and increased luteinizing hormone (LH levels compared with wild type (WT mice, indicating primary hypogonadism in Sickle mice. LH-, dbcAMP-, and pregnenolone- (but not 22-hydroxycholesterol- stimulated testosterone production by Leydig cells isolated from the Sickle mouse testis was decreased compared to that of WT mice, implying defective Leydig cell steroidogenesis. There also was reduced protein expression of steroidogenic acute regulatory protein (STAR, but not cholesterol side-chain cleavage enzyme (P450scc, in the Sickle mouse testis. These data suggest that the capacity of P450scc to support testosterone production may be limited by the supply of cholesterol to the mitochondria in Sickle mice. The sickle mouse testis exhibited upregulated NADPH oxidase subunit gp91phox and increased oxidative stress, measured as 4-hydroxy-2-nonenal, and unchanged protein expression of an antioxidant glutathione peroxidase-1. Mice heterozygous for the human sickle globin (Hemi exhibited intermediate hypogonadal changes between those of WT and Sickle mice. These results demonstrate that testosterone deficiency occurs in Sickle mice, mimicking the human condition. The defects in the Leydig cell steroidogenic pathway in Sickle mice, mainly due to reduced availability of cholesterol for testosterone production, may be related to NADPH oxidase-derived oxidative stress. Our findings suggest that targeting testicular oxidative stress or steroidogenesis mechanisms in SCD offers a potential treatment for improving phenotypic changes associated with testosterone deficiency in this disease.

  7. Isorhamnetin protects against oxidative stress by activating Nrf2 and inducing the expression of its target genes

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ji Hye; Shin, Bo Yeon; Han, Jae Yun; Kim, Mi Gwang; Wi, Ji Eun [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Kim, Young Woo; Cho, Il Je; Kim, Sang Chan [Medical Research Center for Globalization of Herbal Formulation, College of Korean Medicine, Daegu Haany University, Gyeongsan 712-715 (Korea, Republic of); Shin, Sang Mi [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of); Ki, Sung Hwan, E-mail: [College of Pharmacy, Chosun University, Gwangju, 501-759 (Korea, Republic of)


    Isorhamentin is a 3′-O-methylated metabolite of quercetin, and has been reported to have anti-inflammatory and anti-proliferative effects. However, the effects of isorhamnetin on Nrf2 activation and on the expressions of its downstream genes in hepatocytes have not been elucidated. Here, we investigated whether isorhamnetin has the ability to activate Nrf2 and induce phase II antioxidant enzyme expression, and to determine the protective role of isorhamnetin on oxidative injury in hepatocytes. In HepG2 cells, isorhamnetin increased the nuclear translocation of Nrf2 in a dose- and time-dependent manner, and consistently, increased antioxidant response element (ARE) reporter gene activity and the protein levels of hemeoxygenase (HO-1) and of glutamate cysteine ligase (GCL), which resulted in intracellular GSH level increases. The specific role of Nrf2 in isorhamnetin-induced Nrf2 target gene expression was verified using an ARE-deletion mutant plasmid and Nrf2-knockout MEF cells. Deletion of the ARE in the promoter region of the sestrin2 gene, which is recently identified as the Nrf2 target gene by us, abolished the ability of isorhamnetin to increase luciferase activity. In addition, Nrf2 deficiency completely blocked the ability of isorhamnetin to induce HO-1 and GCL. Furthermore, isorhamnetin pretreatment blocked t-BHP-induced ROS production and reversed GSH depletion by t-BHP and consequently, due to reduced ROS levels, decreased t-BHP-induced cell death. In addition isorhamnetin increased ERK1/2, PKCδ and AMPK phosphorylation. Finally, we showed that Nrf2 deficiency blocked the ability of isorhamnetin to protect cells from injury induced by t-BHP. Taken together, our results demonstrate that isorhamnetin is efficacious in protecting hepatocytes against oxidative stress by Nrf2 activation and in inducing the expressions of its downstream genes. - Highlights: • We investigated the effect of isorhamnetin on Nrf2 activation. • Isorhamnetin increased Nrf2

  8. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Wu, Kai C.; Liu, Jie J.; Klaassen, Curtis D.


    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H 2 DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  9. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)


    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  10. Reduced metastasis of transgenic mammary cancer in urokinase-deficient mice

    DEFF Research Database (Denmark)

    Almholt, Kasper; Lund, L.R.; Rygaard, Jørgen


    A prominent phenotype of plasmin deficiency in mice is reduced metastasis in the MMTV-PymT transgenic breast cancer model. Proteolytically active plasmin is generated from inactive plasminogen by one of 2 activators, uPA or tPA. We now find that uPA deficiency alone significantly reduces metastasis...... >7-fold in the MMTV-PymT model. We studied a cohort of 55 MMTV-PymT transgenic mice, either uPA-deficient or wild-type controls. Tumor incidence, latency, growth rate and final primary tumor burden were not significantly affected by uPA deficiency. In contrast, average lung metastasis volume...

  11. Increased Energy Expenditure, Ucp1 Expression, and Resistance to Diet-induced Obesity in Mice Lacking Nuclear Factor-Erythroid-2-related Transcription Factor-2 (Nrf2). (United States)

    Schneider, Kevin; Valdez, Joshua; Nguyen, Janice; Vawter, Marquis; Galke, Brandi; Kurtz, Theodore W; Chan, Jefferson Y


    The NRF2 (also known as NFE2L2) transcription factor is a critical regulator of genes involved in defense against oxidative stress. Previous studies suggest thatNrf2plays a role in adipogenesisin vitro, and deletion of theNrf2gene protects against diet-induced obesity in mice. Here, we demonstrate that resistance to diet-induced obesity inNrf2(-/-)mice is associated with a 20-30% increase in energy expenditure. Analysis of bioenergetics revealed thatNrf2(-/-)white adipose tissues exhibit greater oxygen consumption. White adipose tissue showed a >2-fold increase inUcp1gene expression. Oxygen consumption is also increased nearly 2.5-fold inNrf2-deficient fibroblasts. Oxidative stress induced by glucose oxidase resulted in increasedUcp1expression. Conversely, antioxidant chemicals (such asN-acetylcysteine and Mn(III)tetrakis(4-benzoic acid)porphyrin chloride) and SB203580 (a known suppressor ofUcp1expression) decreasedUcp1and oxygen consumption inNrf2-deficient fibroblasts. These findings suggest that increasing oxidative stress by limitingNrf2function in white adipocytes may be a novel means to modulate energy balance as a treatment of obesity and related clinical disorders. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Pharmacological targeting of GSK-3 and NRF2 provides neuroprotection in a preclinical model of tauopathy

    Directory of Open Access Journals (Sweden)

    Antonio Cuadrado


    Full Text Available Tauopathies are a group of neurodegenerative disorders where TAU protein is presented as aggregates or is abnormally phosphorylated, leading to alterations of axonal transport, neuronal death and neuroinflammation. Currently, there is no treatment to slow progression of these diseases. Here, we have investigated whether dimethyl fumarate (DMF, an inducer of the transcription factor NRF2, could mitigate tauopathy in a mouse model. The signaling pathways modulated by DMF were also studied in mouse embryonic fibroblast (MEFs from wild type or KEAP1-deficient mice. The effect of DMF on neurodegeneration, astrocyte and microglial activation was examined in Nrf2+/+ and Nrf2−/− mice stereotaxically injected in the right hippocampus with an adeno-associated vector expressing human TAUP301L and treated daily with DMF (100 mg/kg, i.g during three weeks. DMF induces the NRF2 transcriptional through a mechanism that involves KEAP1 but also PI3K/AKT/GSK-3-dependent pathways. DMF modulates GSK-3β activity in mouse hippocampi. Furthermore, DMF modulates TAU phosphorylation, neuronal impairment measured by calbindin-D28K and BDNF expression, and inflammatory processes involved in astrogliosis, microgliosis and pro-inflammatory cytokines production. This study reveals neuroprotective effects of DMF beyond disruption of the KEAP1/NRF2 axis by inhibiting GSK3 in a mouse model of tauopathy. Our results support repurposing of this drug for treatment of these diseases. Keywords: DMF, Inflammation, Neurodegeneration, NRF2, Oxidative stress, TAU/ GSK-3

  13. Translational control of Nrf2 within the open reading frame

    International Nuclear Information System (INIS)

    Perez-Leal, Oscar; Barrero, Carlos A.; Merali, Salim


    Highlights: •Identification of a novel Nrf2 translational repression mechanism. •The repressor is within the 3′ portion of the Nrf2 ORF. •The translation of Nrf2 or eGFP is reduced by the regulatory element. •The translational repression can be reversed with synonymous codon substitutions. •The molecular mechanism requires the mRNA sequence, but not the encoded amino acids. -- Abstract: Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) is a transcription factor that is essential for the regulation of an effective antioxidant and detoxifying response. The regulation of its activity can occur at transcription, translation and post-translational levels. Evidence suggests that under environmental stress conditions, new synthesis of Nrf2 is required – a process that is regulated by translational control and is not fully understood. Here we described the identification of a novel molecular process that under basal conditions strongly represses the translation of Nrf2 within the open reading frame (ORF). This mechanism is dependent on the mRNA sequence within the 3′ portion of the ORF of Nrf2 but not in the encoded amino acid sequence. The Nrf2 translational repression can be reversed with the use of synonymous codon substitutions. This discovery suggests an additional layer of control to explain the reason for the low Nrf2 concentration under quiescent state

  14. NRF2 Protection against Liver Injury Produced by Various Hepatotoxicants

    Directory of Open Access Journals (Sweden)

    Jie Liu


    Full Text Available To investigate the role of Nrf2 as a master defense against the hepatotoxicity produced by various chemicals, Nrf2-null, wild-type, Keap1-knock down (Keap1-Kd and Keap1-hepatocyte knockout (Keap1-HKO mice were used as a “graded Nrf2 activation” model. Mice were treated with 14 hepatotoxicants at appropriate doses, and blood and liver samples were collected thereafter (6 h to 7 days depending on the hepatotoxicant. Graded activation of Nrf2 offered a Nrf2-dependent protection against the hepatotoxicity produced by carbon tetrachloride, acetaminophen, microcystin, phalloidin, furosemide, cadmium, and lithocholic acid, as evidenced by serum alanine aminotransferase (ALT activities and by histopathology. Nrf2 activation also offered moderate protection against liver injury produced by ethanol, arsenic, bromobenzene, and allyl alcohol but had no effects on the hepatotoxicity produced by D-galactosamine/endotoxin and the Fas ligand antibody Jo-2. Graded Nrf2 activation reduced the expression of inflammatory genes (MIP-2, mKC, IL-1β, IL-6, and TNFα, oxidative stress genes (Ho-1, Egr1, ER stress genes (Gadd45 and Gadd153, and genes encoding cell death (Noxa, Bax, Bad, and caspase3. Thus, this study demonstrates that Nrf2 prevents the liver from many, but not all, hepatotoxicants. The Nrf2-mediated protection is accompanied by induction of antioxidant genes, suppression of inflammatory responses, and attenuation of oxidative stress.

  15. Hydrogen gas reduces hyperoxic lung injury via the Nrf2 pathway in vivo (United States)

    Kawamura, Tomohiro; Wakabayashi, Nobunao; Shigemura, Norihisa; Huang, Chien-Sheng; Masutani, Kosuke; Tanaka, Yugo; Noda, Kentaro; Peng, Ximei; Takahashi, Toru; Billiar, Timothy R.; Okumura, Meinoshin; Toyoda, Yoshiya; Kensler, Thomas W.


    Hyperoxic lung injury is a major concern in critically ill patients who receive high concentrations of oxygen to treat lung diseases. Successful abrogation of hyperoxic lung injury would have a huge impact on respiratory and critical care medicine. Hydrogen can be administered as a therapeutic medical gas. We recently demonstrated that inhaled hydrogen reduced transplant-induced lung injury and induced heme oxygenase (HO)-1. To determine whether hydrogen could reduce hyperoxic lung injury and investigate the underlying mechanisms, we randomly assigned rats to four experimental groups and administered the following gas mixtures for 60 h: 98% oxygen (hyperoxia), 2% nitrogen; 98% oxygen (hyperoxia), 2% hydrogen; 98% balanced air (normoxia), 2% nitrogen; and 98% balanced air (normoxia), 2% hydrogen. We examined lung function by blood gas analysis, extent of lung injury, and expression of HO-1. We also investigated the role of NF-E2-related factor (Nrf) 2, which regulates HO-1 expression, by examining the expression of Nrf2-dependent genes and the ability of hydrogen to reduce hyperoxic lung injury in Nrf2-deficient mice. Hydrogen treatment during exposure to hyperoxia significantly improved blood oxygenation, reduced inflammatory events, and induced HO-1 expression. Hydrogen did not mitigate hyperoxic lung injury or induce HO-1 in Nrf2-deficient mice. These findings indicate that hydrogen gas can ameliorate hyperoxic lung injury through induction of Nrf2-dependent genes, such as HO-1. The findings suggest a potentially novel and applicable solution to hyperoxic lung injury and provide new insight into the molecular mechanisms and actions of hydrogen. PMID:23475767

  16. PFOS induces adipogenesis and glucose uptake in association with activation of Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jialin [Institute of Biochemistry and Molecular Biology, College of Life and Health Sciences, Northeastern University, Shenyang 110819 (China); Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Shimpi, Prajakta; Armstrong, Laura; Salter, Deanna [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States); Slitt, Angela L., E-mail: [Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881 (United States)


    PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1 cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association

  17. Contribution of Nrf2 to Atherogenic Phenotype Switching of Coronary Arterial Smooth Muscle Cells Lacking CD38 Gene

    Directory of Open Access Journals (Sweden)

    Ming Xu


    Full Text Available Background/Aims: Recent studies have indicated that CD38 gene deficiency results in dedifferentiation or transdifferentiation of arterial smooth muscle cells upon atherogenic stimulations. However, the molecular mechanisms mediating this vascular smooth muscle (SMC phenotypic switching remain unknown. Methods & Results: In the present study, we first characterized the phenotypic change in the primary cultures of coronary arterial myocytes (CAMs from CD38-/- mice. It was shown that CD38 deficiency decreased the expression of contractile marker calponin, SM22α and α-SMA but increased the expression of SMC dedifferentiation marker, vimentin, which was accompanied by enhanced cell proliferation. This phenotypic change in CD38-/- CAMs was enhanced by 7-ketocholesterol (7-Ket, an atherogenic stimulus. We further found that the CD38 deficiency decreased the expression and activity of nuclear factor E2-related factor 2 (Nrf2, a basic leucine zipper (bZIP transcription factor sensitive to redox regulation. Similar to CD38 deletion, Nrf2 gene silencing increased CAM dedifferentiation upon 7-Ket stimulation. In contrast, the overexpression of Nrf2 gene abolished 7-Ket-induced dedifferentiation in CD38-/- CAMs. Given the sensitivity of Nrf2 to oxidative stress, we determined the role of redox signaling in the regulation of Nrf2 expression and activity associated with CD38 effect in CAM phenotype changes. It was demonstrated that in CD38-/- CAMs, 7-Ket failed to stimulate the production of O2-., while in CD38+/+ CAMs 7-Ket induced marked O2-. production and enhancement of Nrf2 activity, which was substantially attenuated by NOX4 gene silencing. Finally, we demonstrated that 7-Ket-induced and NOX4-dependent O2-. production was inhibited by 8-Br-cADPR, an antagonist of cADPR or NED-19, an antagonist of NAADP as product of CD38 ADP-ribosylcyclase, which significantly inhibited the level of cytosolic Ca2+ and the activation of Nrf2 under 7-Ket. Conclusion

  18. Nrf2 transcription factor gene regulates basal transcription of ...

    African Journals Online (AJOL)



    Oct 19, 2009 ... induction in the Nrf2(-/-) mouse brain. In contrast, there ... mouse brain by any of the chemicals used . Key words: .... The blots were then probed with the human SOD2 .... Nrf2, null and wild mice as part of my PhD work. I wish.

  19. Metastasis of transgenic breast cancer in plasminogen activator inhibitor-1 gene-deficient mice

    DEFF Research Database (Denmark)

    Almholt, Kasper; Nielsen, Boye Schnack; Frandsen, Thomas Leth


    , high levels of PAI-1 as well as uPA are equally associated with poor prognosis in cancer patients. PAI-1 is thought to play a vital role for the controlled extracellular proteolysis during tumor neovascularization. We have studied the effect of PAI-1 deficiency in a transgenic mouse model...... of metastasizing breast cancer. In these tumors, the expression pattern of uPA and PAI-1 resembles that of human ductal breast cancer and plasminogen is required for efficient metastasis. In a cohort of 63 transgenic mice that were either PAI-1-deficient or wild-type sibling controls, primary tumor growth...

  20. Failure of pulmonary clearance of Rhodococcus equi infection in CD4+ T-lymphocyte-deficient transgenic mice.


    Kanaly, S T; Hines, S A; Palmer, G H


    Pulmonary clearance of Rhodococcus equi requires functional T lymphocytes. In this study, CD8+ T-lymphocyte-deficient transgenic mice cleared virulent R. equi from the lungs while infection in CD4+ T-lymphocyte-deficient transgenic mice persisted. Although both CD4+ and CD8+ T cells function early in pulmonary defense against R. equi, clearance is dependent on CD4+ T lymphocytes.

  1. Activation of Nrf2 protects against triptolide-induced hepatotoxicity.

    Directory of Open Access Journals (Sweden)

    Jia Li

    Full Text Available Triptolide, the major active component of Tripterygium wilfordii Hook f. (TWHF, has a wide range of pharmacological activities. However, the toxicities of triptolide, particularly the hepatotoxicity, limit its clinical application. The hepatotoxicity of triptolide has not been well characterized yet. The aim of this study was to investigate the role of NF-E2-related factor 2 (Nrf2 in triptolide-induced toxicity and whether activation of Nrf2 could protect against triptolide-induced hepatotoxicity. The results showed that triptolide caused oxidative stress and cell damage in HepG2 cells, and these toxic effects could be aggravated by Nrf2 knockdown or be counteracted by overexpression of Nrf2. Treatment with a typical Nrf2 agonist, sulforaphane (SFN, attenuated triptolide-induced liver dysfunction, structural damage, glutathione depletion and decrease in antioxidant enzymes in BALB/C mice. Moreover, the hepatoprotective effect of SFN on triptolide-induced liver injury was associated with the activation of Nrf2 and its downstream targets. Collectively, these results indicate that Nrf2 activation protects against triptolide-induced hepatotoxicity.

  2. Nrf2, the Master Regulator of Anti-Oxidative Responses

    Directory of Open Access Journals (Sweden)

    Sandra Vomund


    Full Text Available Tight regulation of inflammation is very important to guarantee a balanced immune response without developing chronic inflammation. One of the major mediators of the resolution of inflammation is the transcription factor: the nuclear factor erythroid 2-like 2 (Nrf2. Stabilized following oxidative stress, Nrf2 induces the expression of antioxidants as well as cytoprotective genes, which provoke an anti-inflammatory expression profile, and is crucial for the initiation of healing. In view of this fundamental modulatory role, it is clear that both hyper- or hypoactivation of Nrf2 contribute to the onset of chronic diseases. Understanding the tight regulation of Nrf2 expression/activation and its interaction with signaling pathways, known to affect inflammatory processes, will facilitate development of therapeutic approaches to prevent Nrf2 dysregulation and ameliorate chronic inflammatory diseases. We discuss in this review the principle mechanisms of Nrf2 regulation with a focus on inflammation and autophagy, extending the role of dysregulated Nrf2 to chronic diseases and tumor development.

  3. The PTEN/NRF2 Axis Promotes Human Carcinogenesis

    DEFF Research Database (Denmark)

    Rojo, Ana I; Rada, Patricia; Mendiola, Marta


    and tumorigenic advantage. Tissue microarrays from endometrioid carcinomas showed that 80% of PTEN-negative tumors expressed high levels of NRF2 or its target heme oxygenase-1 (HO-1). INNOVATION: These results uncover a new mechanism of oncogenic activation of NRF2 by loss of its negative regulation by PTEN/GSK-3....../β-TrCP that may be relevant to a large number of tumors, including endometrioid carcinomas. CONCLUSION: Increased activity of NRF2 due to loss of PTEN is instrumental in human carcinogenesis and represents a novel therapeutic target. Antioxid. Redox Signal. 21, 2498-2514....

  4. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang


    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  5. Dietary zinc deficiency reduced growth performance, intestinal immune and physical barrier functions related to NF-κB, TOR, Nrf2, JNK and MLCK signaling pathway of young grass carp (Ctenopharyngodon idella). (United States)

    Song, Zheng-Xing; Jiang, Wei-Dan; Liu, Yang; Wu, Pei; Jiang, Jun; Zhou, Xiao-Qiu; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Feng, Lin


    Our study investigated the effects of dietary zinc (Zn) deficiency on growth performance, intestinal immune and physical barrier functions of young grass carp (Ctenopharyngodon idella). A total of 630 grass carp (244.14 ± 0.40 g) were fed graded levels of zinc lactate (10.71, 30.21, 49.84, 72.31, 92.56, 110.78 mg Zn/kg diet) and one zinc sulfate group (56.9 mg Zn/kg diet) for 60 days. At the end of the feeding trial, fish were challenged with Aeromonas hydrophila for 14 days. These results indicated that compared with optimal dietary Zn level, dietary Zn deficiency (10.71 mg/kg diet) decreased the production of antibacterial compounds, up-regulated pro-inflammatory cytokines related to nuclear factor kappa B (NF-κB) and down-regulated anti-inflammatory cytokines related to target of rapamycin (TOR) in three intestinal segments of young grass carp (P zinc lactate as Zn source) based on percent weight gain (PWG), against enteritis morbidity, acid phosphatase (ACP) activity in the proximal intestine (PI) and malondialdehyde (MDA) content in the PI of young grass carp was estimated to be 61.2, 61.4, 69.2 and 69.5 mg/kg diet, respectively. Finally, based on specific growth rate (SGR), feed efficiency (FE) and against enteritis morbidity of young grass carp, the efficacy of zinc lactate relative to zinc sulfate were 132.59%, 135.27% and 154.04%, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Nrf2 and Redox Status in Prediabetic and Diabetic Patients

    Directory of Open Access Journals (Sweden)

    Angélica S. Jiménez-Osorio


    Full Text Available The redox status associated with nuclear factor erythroid 2-related factor-2 (Nrf2 was evaluated in prediabetic and diabetic subjects. Total antioxidant status (TAS in plasma and erythrocytes, glutathione (GSH and malondialdehyde (MDA content and activity of antioxidant enzymes were measured as redox status markers in 259 controls, 111 prediabetics and 186 diabetic type 2 subjects. Nrf2 was measured in nuclear extract fractions from peripheral blood mononuclear cells (PBMC. Nrf2 levels were lower in prediabetic and diabetic patients. TAS, GSH and activity of glutamate cysteine ligase were lower in diabetic subjects. An increase of MDA and superoxide dismutase activity was found in diabetic subjects. These results suggest that low levels of Nrf2 are involved in the development of oxidative stress and redox status disbalance in diabetic patients.

  7. Increased Alzheimer's disease-like pathology in the APP/ PS1ΔE9 mouse model lacking Nrf2 through modulation of autophagy. (United States)

    Joshi, Gururaj; Gan, Kok Ann; Johnson, Delinda A; Johnson, Jeffrey A


    The presence of senile plaques is one of the major pathologic hallmarks of the brain with Alzheimer's disease (AD). The plaques predominantly contain insoluble amyloid β-peptide, a cleavage product of the larger amyloid precursor protein (APP). Two enzymes, named β and γ secretase, generate the neurotoxic amyloid-β peptide from APP. Mature APP is also turned over endogenously by autophagy, more specifically by the endosomal-lysosomal pathway. A defective lysosomal system is known to be pathogenic in AD. Modulation of NF-E2 related factor 2 (Nrf2) has been shown in several neurodegenerative disorders, and Nrf2 has become a potential therapeutic target for various neurodegenerative disorders, including AD, Parkinson's disease, and amyotrophic lateral sclerosis. In the current study, we explored the effect of genetic ablation of Nrf2 on APP/Aβ processing and/or aggregation as well as changes in autophagic dysfunction in APP/PS1 mice. There was a significant increase in inflammatory response in APP/PS1 mice lacking Nrf2. This was accompanied by increased intracellular levels of APP, Aβ (1-42), and Aβ (1-40), without a change total full-length APP. There was a shift of APP and Aβ into the insoluble fraction, as well as increased poly-ubiquitin conjugated proteins in mice lacking Nrf2. APP/PS1-mediated autophagic dysfunction is also enhanced in Nrf2-deficient mice. Finally, neurons in the APP/PS1/Nrf2-/- mice had increased accumulation of multivesicular bodies, endosomes, and lysosomes. These outcomes provide a better understanding of the role of Nrf2 in modulating autophagy in an AD mouse model and may help design better Nrf2 targeted therapeutics that could be efficacious in the treatment of AD. Published by Elsevier Inc.

  8. Sulforaphane is a Nrf2-independent inhibitor of mitochondrial fission

    Directory of Open Access Journals (Sweden)

    Gary B. O'Mealey


    Full Text Available The KEAP1-Nrf2-ARE antioxidant system is a principal means by which cells respond to oxidative and xenobiotic stresses. Sulforaphane (SFN, an electrophilic isothiocyanate derived from cruciferous vegetables, activates the KEAP1-Nrf2-ARE pathway and has become a molecule-of-interest in the treatment of diseases in which chronic oxidative stress plays a major etiological role. We demonstrate here that the mitochondria of cultured, human retinal pigment epithelial (RPE-1 cells treated with SFN undergo hyperfusion that is independent of both Nrf2 and its cytoplasmic inhibitor KEAP1. Mitochondrial fusion has been reported to be cytoprotective by inhibiting pore formation in mitochondria during apoptosis, and consistent with this, we show Nrf2-independent, cytoprotection of SFN-treated cells exposed to the apoptosis-inducer, staurosporine. Mechanistically, SFN mitigates the recruitment and/or retention of the soluble fission factor Drp1 to mitochondria and to peroxisomes but does not affect overall Drp1 abundance. These data demonstrate that the beneficial properties of SFN extend beyond activation of the KEAP1-Nrf2-ARE system and warrant further interrogation given the current use of this agent in multiple clinical trials.

  9. Neutrophils in oral paracoccidioidomycosis and the involvement of Nrf2.

    Directory of Open Access Journals (Sweden)

    Vera Cavalcanti Araújo

    Full Text Available Neutrophils have been implicated in granuloma formation in several infectious diseases, in addition to their main phagocytic and pathogen destruction role. It has been demonstrated that Nrf2 regulates antioxidant protection in neutrophils, attenuating inflammation without compromising the hosts bacterial defense. In this study, we analyzed the presence of neutrophils in Paracoccidioides brasiliensis mycosis (PCM, as well as the immunoexpression of Nrf2. Thirty-nine cases of oral PCM were classified according to quantity of fungi and to the presence of loose or well-organized granulomas and microabscesses. An Nrf2 antibody was used for immunohistochemical analysis. The results showed that neutrophils are present in microabscesses and loose granulomas, but were absent in structured granulomas. A greater quantity of fungi was shown in cases with only loose granulomas when compared to loose and well organized granulomas. Nrf2 was observed in the nuclei of neutrophils of loose granulomas and abscesses, with its expression in loose granulomas maintained despite the additional presence of well organized granulomas in the same specimen. This study suggests that neutrophils participate in P. brasiliensis granuloma formation and that Nrf2 has a possible role in neutrophil survival, via modulation of the inflammatory response.

  10. Omega-3 fatty acids protect the brain against ischemic injury by activating Nrf2 and upregulating heme oxygenase 1. (United States)

    Zhang, Meijuan; Wang, Suping; Mao, Leilei; Leak, Rehana K; Shi, Yejie; Zhang, Wenting; Hu, Xiaoming; Sun, Baoliang; Cao, Guodong; Gao, Yanqin; Xu, Yun; Chen, Jun; Zhang, Feng


    Ischemic stroke is a debilitating clinical disorder that affects millions of people, yet lacks effective neuroprotective treatments. Fish oil is known to exert beneficial effects against cerebral ischemia. However, the underlying protective mechanisms are not fully understood. The present study tests the hypothesis that omega-3 polyunsaturated fatty acids (n-3 PUFAs) attenuate ischemic neuronal injury by activating nuclear factor E2-related factor 2 (Nrf2) and upregulating heme oxygenase-1 (HO-1) in both in vitro and in vivo models. We observed that pretreatment of rat primary neurons with docosahexaenoic acid (DHA) significantly reduced neuronal death following oxygen-glucose deprivation. This protection was associated with increased Nrf2 activation and HO-1 upregulation. Inhibition of HO-1 activity with tin protoporphyrin IX attenuated the protective effects of DHA. Further studies showed that 4-hydroxy-2E-hexenal (4-HHE), an end-product of peroxidation of n-3 PUFAs, was a more potent Nrf2 inducer than 4-hydroxy-2E-nonenal derived from n-6 PUFAs. In an in vivo setting, transgenic mice overexpressing fatty acid metabolism-1, an enzyme that converts n-6 PUFAs to n-3 PUFAs, were remarkably resistant to focal cerebral ischemia compared with their wild-type littermates. Regular mice fed with a fish oil-enhanced diet also demonstrated significant resistance to ischemia compared with mice fed with a regular diet. As expected, the protection was associated with HO-1 upregulation, Nrf2 activation, and 4-HHE generation. Together, our data demonstrate that n-3 PUFAs are highly effective in protecting the brain, and that the protective mechanisms involve Nrf2 activation and HO-1 upregulation by 4-HHE. Further investigation of n-3 PUFA neuroprotective mechanisms may accelerate the development of stroke therapies.

  11. Overview of Nrf2 as Therapeutic Target in Epilepsy

    Directory of Open Access Journals (Sweden)

    Liliana Carmona-Aparicio


    Full Text Available Oxidative stress is a biochemical state of imbalance in the production of reactive oxygen and nitrogen species and antioxidant defenses. It is involved in the physiopathology of degenerative and chronic neuronal disorders, such as epilepsy. Experimental evidence in humans and animals support the involvement of oxidative stress before and after seizures. In the past few years, research has increasingly focused on the molecular pathways of this process, such as that involving transcription factor nuclear factor E2-related factor 2 (Nrf2, which plays a central role in the regulation of antioxidant response elements (ARE and modulates cellular redox status. The aim of this review is to present experimental evidence on the role of Nrf2 in this neurological disorder and to further determine the therapeutic impact of Nrf2 in epilepsy.

  12. Insulin deficiency exacerbates cerebral amyloidosis and behavioral deficits in an Alzheimer transgenic mouse model

    Directory of Open Access Journals (Sweden)

    Teng Wei-Ping


    Full Text Available Abstract Background Although increasing evidence has indicated that brain insulin dysfunction is a risk factor for Alzheimer disease (AD, the underlying mechanisms by which insulin deficiency may impact the development of AD are still obscure. Using a streptozotocin (STZ-induced insulin deficient diabetic AD transgenic mouse model, we evaluated the effect of insulin deficiency on AD-like behavior and neuropathology. Results Our data showed that administration of STZ increased the level of blood glucose and reduced the level of serum insulin, and further decreased the phosphorylation levels of insulin receptors, and increased the activities of glycogen synthase kinase-3α/β and c-Jun N-terminal kinase in the APP/PS1 mouse brain. We further showed that STZ treatment promoted the processing of amyloid-β (Aβ precursor protein resulting in increased Aβ generation, neuritic plaque formation, and spatial memory deficits in transgenic mice. Conclusions Our present data indicate that there is a close link between insulin deficient diabetes and cerebral amyloidosis in the pathogenesis of AD.

  13. The Amelioration of N-Acetyl-p-Benzoquinone Imine Toxicity by Ginsenoside Rg3: The Role of Nrf2-Mediated Detoxification and Mrp1/Mrp3 Transports

    Directory of Open Access Journals (Sweden)

    Sang Il Gum


    Full Text Available Previously, we found that Korean red ginseng suppressed acetaminophen (APAP-induced hepatotoxicity via alteration of its metabolic profile involving GSTA2 induction and that ginsenoside Rg3 was a major component of this gene induction. In the present study, therefore, we assessed the protective effect of Rg3 against N-acetyl-p-benzoquinone imine (NAPQI, a toxic metabolic intermediate of APAP. Excess NAPQI resulted in GSH depletion with increases in the ALT and AST activities in H4IIE cells. Rg3 pretreatment reversed GSH depletion by NAPQI. Rg3 resulted in increased mRNA levels of the catalytic and modulatory subunit of glutamate cysteine ligase (GCL, the rate-limiting steps in GSH synthesis and subsequently increased GSH content. Rg3 increased levels of nuclear Nrf2, an essential transcriptional factor of these genes. The knockdown or knockout of the Nrf2 gene abrogated the inductions of mRNA and protein by Rg3. Abolishment of the reversal of GSH depletion by Rg3 against NAPQI was observed in Nrf2-deficient cells. Rg3 induced multidrug resistance-associated protein (Mrp 1 and Mrp3 mRNA levels, but not in Nrf2-deficient cells. Taken together, these results demonstrate that Rg3 is efficacious in protecting hepatocytes against NAPQI insult, due to GSH repletion and coordinated gene regulations of GSH synthesis and Mrp family genes by Nrf2.

  14. Nrf2 regulates cellular behaviors and Notch signaling in oral squamous cell carcinoma cells. (United States)

    Fan, Hong; Paiboonrungruan, Chorlada; Zhang, Xinyan; Prigge, Justin R; Schmidt, Edward E; Sun, Zheng; Chen, Xiaoxin


    Oxidative stress is known to play a pivotal role in the development of oral squamous cell carcinoma (OSCC). We have demonstrated that activation of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway has chemopreventive effects against oxidative stress-associated OSCC. However, Nrf2 have dual roles in cancer development; while it prevents carcinogenesis of normal cells, hyperactive Nrf2 also promotes the survival of cancer cells. This study is aimed to understand the function of Nrf2 in regulating cellular behaviors of OSCC cells, and the potential mechanisms through which Nrf2 facilitates OSCC. We established the Nrf2-overexpressing and Nrf2-knockdown OSCC cell lines, and examined the function of Nrf2 in regulating cell proliferation, migration, invasion, cell cycle and colony formation. Our data showed that Nrf2 overexpression promoted cancer phenotypes in OSCC cells, whereas Nrf2 silencing inhibited these phenotypes. In addition, Nrf2 positively regulated Notch signaling pathway in OSCC cells in vitro. Consistent with this observation, Nrf2 activation in Keap1 -/- mice resulted in not only hyperproliferation of squamous epithelial cells in mouse tongue as evidenced by increased expression of PCNA, but also activation of Notch signaling in these cells as evidenced by increased expression of NICD1 and Hes1. In conclusion, Nrf2 regulates cancer behaviors and Notch signaling in OSCC cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Hyperactivation of Nrf2 in early tubular development induces nephrogenic diabetes insipidus (United States)

    Suzuki, Takafumi; Seki, Shiori; Hiramoto, Keiichiro; Naganuma, Eriko; Kobayashi, Eri H.; Yamaoka, Ayaka; Baird, Liam; Takahashi, Nobuyuki; Sato, Hiroshi; Yamamoto, Masayuki


    NF-E2-related factor-2 (Nrf2) regulates cellular responses to oxidative and electrophilic stress. Loss of Keap1 increases Nrf2 protein levels, and Keap1-null mice die of oesophageal hyperkeratosis because of Nrf2 hyperactivation. Here we show that deletion of oesophageal Nrf2 in Keap1-null mice allows survival until adulthood, but the animals develop polyuria with low osmolality and bilateral hydronephrosis. This phenotype is caused by defects in water reabsorption that are the result of reduced aquaporin 2 levels in the kidney. Renal tubular deletion of Keap1 promotes nephrogenic diabetes insipidus features, confirming that Nrf2 activation in developing tubular cells causes a water reabsorption defect. These findings suggest that Nrf2 activity should be tightly controlled during development in order to maintain renal homeostasis. In addition, tissue-specific ablation of Nrf2 in Keap1-null mice might create useful animal models to uncover novel physiological functions of Nrf2. PMID:28233855

  16. Transgenic neuronal expression of proopiomelanocortin attenuates hyperphagic response to fasting and reverses metabolic impairments in leptin-deficient obese mice. (United States)

    Mizuno, Tooru M; Kelley, Kevin A; Pasinetti, Giulio M; Roberts, James L; Mobbs, Charles V


    Hypothalamic proopiomelanocortin (POMC) gene expression is reduced in many forms of obesity and diabetes, particularly in those attributable to deficiencies in leptin or its receptor. To assess the functional significance of POMC in mediating metabolic phenotypes associated with leptin deficiency, leptin-deficient mice bearing a transgene expressing the POMC gene under control of the neuron-specific enolase promoter were produced. The POMC transgene attenuated fasting-induced hyperphagia in wild-type mice. Furthermore, the POMC transgene partially reversed obesity, hyperphagia, and hypothermia and effectively normalized hyperglycemia, glucosuria, glucose intolerance, and insulin resistance in leptin-deficient mice. Effects of the POMC transgene on glucose homeostasis were independent of the partial correction of hyperphagia and obesity. Furthermore, the POMC transgene normalized the profile of hepatic and adipose gene expression associated with gluconeogenesis, glucose output, and insulin sensitivity. These results indicate that central POMC is a key modulator of glucose homeostasis and that agonists of POMC products may provide effective therapy in treating impairments in glucose homeostasis when hypothalamic POMC expression is reduced, as occurs with leptin deficiency, hypothalamic damage, and aging.

  17. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin (United States)

    Rojo de la Vega, Montserrat; Zhang, Donna D.; Wondrak, Georg T.


    Environmental exposure to solar ultraviolet (UV) radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2)-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana). Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-)]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA)-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches. PMID:29636694

  18. Transgene expression of Drosophila melanogaster nucleoside kinase reverses mitochondrial thymidine kinase 2 deficiency. (United States)

    Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A; Kuiper, Raoul V; Curbo, Sophie; Karlsson, Anna


    A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK(+/-) transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK(+/-)TK2(-/-) mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK(+/-)TK2(-/-) mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency.

  19. Transgene Expression of Drosophila melanogaster Nucleoside Kinase Reverses Mitochondrial Thymidine Kinase 2 Deficiency*♦ (United States)

    Krishnan, Shuba; Zhou, Xiaoshan; Paredes, João A.; Kuiper, Raoul V.; Curbo, Sophie; Karlsson, Anna


    A strategy to reverse the symptoms of thymidine kinase 2 (TK2) deficiency in a mouse model was investigated. The nucleoside kinase from Drosophila melanogaster (Dm-dNK) was expressed in TK2-deficient mice that have been shown to present with a severe phenotype caused by mitochondrial DNA depletion. The Dm-dNK+/− transgenic mice were shown to be able to rescue the TK2-deficient mice. The Dm-dNK+/−TK2−/− mice were normal as judged by growth and behavior during the observation time of 6 months. The Dm-dNK-expressing mice showed a substantial increase in thymidine-phosphorylating activity in investigated tissues. The Dm-dNK expression also resulted in highly elevated dTTP pools. The dTTP pool alterations did not cause specific mitochondrial DNA mutations or deletions when 6-month-old mice were analyzed. The mitochondrial DNA was also detected at normal levels. In conclusion, the Dm-dNK+/−TK2−/− mouse model illustrates how dTMP synthesized in the cell nucleus can compensate for loss of intramitochondrial dTMP synthesis in differentiated tissue. The data presented open new possibilities to treat the severe symptoms of TK2 deficiency. PMID:23288848

  20. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    International Nuclear Information System (INIS)

    Mercado, Nicolas; Thimmulappa, Rajesh; Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E.; Biswal, Shyam; Ito, Kazuhiro; Barnes, Peter J.


    Research highlights: → Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. → HDAC inhibition decreases Nrf2 protein stability. → HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. → HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H 2 O 2 ) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H 2 O 2 -induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  1. Decreased histone deacetylase 2 impairs Nrf2 activation by oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Mercado, Nicolas [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Thimmulappa, Rajesh [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Thomas, Catherine M.R.; Fenwick, Peter S.; Chana, Kirandeep K.; Donnelly, Louise E. [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Biswal, Shyam [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Ito, Kazuhiro [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom); Barnes, Peter J., E-mail: [Airway Disease Section, National Heart and Lung Institute, Imperial College, London SW3 6LY (United Kingdom)


    Research highlights: {yields} Nrf2 anti-oxidant function is impaired when HDAC activity is inhibited. {yields} HDAC inhibition decreases Nrf2 protein stability. {yields} HDAC2 is involved in reduced Nrf2 stability and both correlate in COPD samples. {yields} HDAC inhibition increases Nrf2 acetylation. -- Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) plays a crucial role in cellular defence against oxidative stress by inducing the expression of multiple anti-oxidant genes. However, where high levels of oxidative stress are observed, such as chronic obstructive pulmonary disease (COPD), Nrf2 activity is reduced, although the molecular mechanism for this defect is uncertain. Here, we show that down-regulation of histone deacetylase (HDAC) 2 causes Nrf2 instability, resulting in reduced anti-oxidant gene expression and increase sensitivity to oxidative stress. Although Nrf2 protein was clearly stabilized after hydrogen peroxide (H{sub 2}O{sub 2}) stimulation in a bronchial epithelial cell line (BEAS2B), Nrf2 stability was decreased and Nrf2 acetylation increased in the presence of an HDAC inhibitor, trichostatin A (TSA). TSA also reduced Nrf2-regulated heme-oxygenase-1 (HO-1) expression in these cells, and this was confirmed in acute cigarette-smoke exposed mice in vivo. HDAC2 knock-down by RNA interference resulted in reduced H{sub 2}O{sub 2}-induced Nrf2 protein stability and activity in BEAS2B cells, whereas HDAC1 knockdown had no effect. Furthermore, monocyte-derived macrophages obtained from healthy volunteers (non-smokers and smokers) and COPD patients showed a significant correlation between HDAC2 expression and Nrf2 expression (r = 0.92, p < 0.0001). Thus, reduced HDAC2 activity in COPD may account for increased Nrf2 acetylation, reduced Nrf2 stability and impaired anti oxidant defences.

  2. Nitroxide delivery system for Nrf2 activation and skin protection. (United States)

    Ben Yehuda Greenwald, Maya; Frušić-Zlotkin, Marina; Soroka, Yoram; Sasson, Shmuel Ben; Bianco-Peled, Havazelet; Bitton, Ronit; Kohen, Ron


    Cyclic nitroxides are a large group of compounds composed of diverse stable radicals also known as synthetic antioxidants. Although nitroxides are valuable for use in several skin conditions, in in vivo conditions they have several drawbacks, such as nonspecific dispersion in normal tissue, preferential renal clearance and rapid reduction of the nitroxide to the corresponding hydroxylamine. However, these drawbacks can be easily addressed by encapsulating the nitroxides within microemulsions. This approach would allow nitroxide activity and therefore their valuable effects (e.g. activation of the Keap1-Nrf2-EpRE pathway) to continue. In this work, nitroxides were encapsulated in a microemulsion composed of biocompatible ingredients. The nanometric size and shape of the vehicle microemulsion and nitroxide microemulsion displayed high similarity, indicating that the stability of the microemulsions was preserved. Our studies demonstrated that nitroxide microemulsions were more potent inducers of the Keap1-Nrf2-EpRE pathway than the free nitroxides, causing the activation of phase II enzymes. Moreover, microemulsions containing nitroxides significantly reduced UVB-induced cytotoxicity in the skin. Understanding the mechanism of this improved activity may expand the usage of many other Nrf2 modulating molecules in encapsulated form, as a skin protection strategy against oxidative stress-related conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell


    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  4. Interplay between VEGF and Nrf2 regulates angiogenesis due to intracranial venous hypertension. (United States)

    Li, Liwen; Pan, Hao; Wang, Handong; Li, Xiang; Bu, Xiaomin; Wang, Qiang; Gao, Yongyue; Wen, Guodao; Zhou, Yali; Cong, Zixiang; Yang, Youqing; Tang, Chao; Liu, Zhengwei


    Venous hypertension(VH) plays an important role in the pathogenesis of cerebral arteriovenous malformations (AVMs) and is closely associated with the HIF-1α/VEGF signaling pathway. Nuclear factor erythroid 2-related factor 2(Nrf2) significantly influences angiogenesis; however, the interplay between Nrf2 and VEGF under VH in brain AVMs remains unclear. Therefore, our study aimed to investigate the interplay between Nrf2 and VEGF due to VH in brain AVMs. Immunohistochemistry indicated that Nrf2 and VEGF were highly expressed in human brain AVM tissues. In vivo, we established a VH model in both wild-type (WT) and siRNA-mediated Nrf2 knockdown rats. VH significantly increased the expression of Nrf2 and VEGF. Loss of Nrf2 markedly inhibited the upregulation of VEGF, as determined by Western blot analysis and qRT-PCR. In vitro, primary brain microvascular endothelial cells (BMECs) were isolated from WT and Nrf2 -/- mice, and a VEGF-Nrf2 positive feed-back loop was observed in BMECs. By trans well assay and angiogenesis assay, Nrf2 knockout significantly inhibited the migration and vascular tube formation of BMECs. These findings suggest that the interplay between Nrf2 and VEGF can contribute to VH-induced angiogenesis in brain AVMs pathogenesis.

  5. The Keap1-Nrf2 system in cancers: Stress response and anabolic metabolism

    Directory of Open Access Journals (Sweden)

    Yoichiro eMitsuishi


    Full Text Available The Keap1-Nrf2 pathway plays a central role in the protection of cells against oxidative and xenobiotic stresses. Nrf2 is a potent transcription activator that recognizes a unique DNA sequence known as the antioxidant response element (ARE. Under normal conditions, Nrf2 binds to Keap1 in the cytoplasm, resulting in proteasomal degradation. Following exposure to electrophiles or reactive oxygen species, Nrf2 becomes stabilized, translocates into the nucleus and activates the transcription of various cytoprotective genes. Increasing attention has been paid to the role of Nrf2 in cancer cells because the constitutive stabilization of Nrf2 has been observed in many human cancers with poor prognosis. Recent studies have shown that the antioxidant and detoxification activities of Nrf2 confer chemo- and radio-resistance to cancer cells. In this review, we provide an overview of the Keap1-Nrf2 system and discuss its role under physiological and pathological conditions, including cancers. We also introduce the results of our recent study describing Nrf2 function in the metabolism of cancer cells. Nrf2 likely confers a growth advantage to cancer cells through enhancing cytoprotection and anabolism. Finally, we discuss the possible impact of Nrf2 inhibitors on cancer therapy.

  6. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)


    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  7. Inhibition of early T cell cytokine production by arsenic trioxide occurs independently of Nrf2.

    Directory of Open Access Journals (Sweden)

    Kelly R VanDenBerg

    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is a stress-activated transcription factor that induces a variety of cytoprotective genes. Nrf2 also mediates immunosuppressive effects in multiple inflammatory models. Upon activation, Nrf2 dissociates from its repressor protein, Keap1, and translocates to the nucleus where it induces Nrf2 target genes. The Nrf2-Keap1 interaction is disrupted by the environmental toxicant and chemotherapeutic agent arsenic trioxide (ATO. The purpose of the present study was to determine the effects of ATO on early events of T cell activation and the role of Nrf2 in those effects. The Nrf2 target genes Hmox-1, Nqo-1, and Gclc were all upregulated by ATO (1-2 μM in splenocytes derived from wild-type, but not Nrf2-null, mice, suggesting that Nrf2 is activated by ATO in splenocytes. ATO also inhibited IFNγ, IL-2, and GM-CSF mRNA and protein production in wild-type splenocytes activated with the T cell activator, anti-CD3/anti-CD28. However, ATO also decreased production of these cytokines in activated splenocytes from Nrf2-null mice, suggesting the inhibition is independent of Nrf2. Interestingly, ATO inhibited TNFα protein secretion, but not mRNA expression, in activated splenocytes suggesting the inhibition is due to post-transcriptional modification. In addition, c-Fos DNA binding was significantly diminished by ATO in wild-type and Nrf2-null splenocytes activated with anti-CD3/anti-CD28, consistent with the observed inhibition of cytokine production by ATO. Collectively, this study suggests that although ATO activates Nrf2 in splenocytes, inhibition of early T cell cytokine production by ATO occurs independently of Nrf2 and may instead be due to impaired AP-1 DNA binding.

  8. Ectodermal-neural cortex 1 down-regulates Nrf2 at the translational level.

    Directory of Open Access Journals (Sweden)

    Xiao-Jun Wang

    Full Text Available The transcription factor Nrf2 is the master regulator of a cellular defense mechanism against environmental insults. The Nrf2-mediated antioxidant response is accomplished by the transcription of a battery of genes that encode phase II detoxifying enzymes, xenobiotic transporters, and antioxidants. Coordinated expression of these genes is critical in protecting cells from toxic and carcinogenic insults and in maintaining cellular redox homeostasis. Activation of the Nrf2 pathway is primarily controlled by Kelch-like ECH-associated protein 1 (Keap1, which is a molecular switch that turns on or off the Nrf2 signaling pathway according to intracellular redox conditions. Here we report our finding of a novel Nrf2 suppressor ectodermal-neural cortex 1 (ENC1, which is a BTB-Kelch protein and belongs to the same family as Keap1. Transient expression of ENC1 reduced steady-state levels of Nrf2 and its downstream gene expression. Although ENC1 interacted with Keap1 indirectly, the ENC1-mediated down-regulation of Nrf2 was independent of Keap1. The negative effect of ENC1 on Nrf2 was not due to a change in the stability of Nrf2 because neither proteasomal nor lysosomal inhibitors had any effects. Overexpression of ENC1 did not result in a change in the level of Nrf2 mRNA, rather, it caused a decrease in the rate of Nrf2 protein synthesis. These results demonstrate that ENC1 functions as a negative regulator of Nrf2 through suppressing Nrf2 protein translation, which adds another level of complexity in controlling the Nrf2 signaling pathway.

  9. Selenoprotein-deficient transgenic mice exhibit enhanced exercise-induced muscle growth. (United States)

    Hornberger, Troy A; McLoughlin, Thomas J; Leszczynski, Jori K; Armstrong, Dustin D; Jameson, Ruth R; Bowen, Phyllis E; Hwang, Eun-Sun; Hou, Honglin; Moustafa, Mohamed E; Carlson, Bradley A; Hatfield, Dolph L; Diamond, Alan M; Esser, Karyn A


    Dietary intake of selenium has been implicated in a wide range of health issues, including aging, heart disease and cancer. Selenium deficiency, which can reduce selenoprotein levels, has been associated with several striated muscle pathologies. To investigate the role of selenoproteins in skeletal muscle biology, we used a transgenic mouse (referred to as i6A-) that has reduced levels of selenoproteins due to the introduction and expression of a dominantly acting mutant form of selenocysteine transfer RNA (tRNA[Ser]Sec). As a consequence, each organ contains reduced levels of most selenoproteins, yet these mice are normal with regard to fertility, overall health, behavior and blood chemistries. In the present study, although skeletal muscles from i6A- mice were phenotypically indistinguishable from those of wild-type mice, plantaris muscles were approximately 50% heavier after synergist ablation, a model of exercise overload. Like muscle in wild-type mice, the enhanced growth in the i6A- mice was completely blocked by inhibition of the mammalian target of rapamycin (mTOR) pathway. Muscles of transgenic mice exhibited increased site-specific phosphorylation on both Akt and p70 ribosomal S6 kinase (p70S6k) (P accounting for the enhanced response to synergist ablation. Thus, a single genetic alteration resulted in enhanced skeletal muscle adaptation after exercise, and this is likely through subtle changes in the resting phosphorylation state of growth-related kinases.

  10. Melatonin successfully rescues hippocampal bioenergetics and improves cognitive function following drug intoxication by promoting Nrf2-ARE signaling activity. (United States)

    Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming


    Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from

  11. NRF2 Mutation Confers Malignant Potential and Resistance to Chemoradiation Therapy in Advanced Esophageal Squamous Cancer

    Directory of Open Access Journals (Sweden)

    Tatsuhiro Shibata


    Full Text Available Esophageal squamous cancer (ESC is one of the most aggressive tumors of the gastrointestinal tract. A combination of chemotherapy and radiation therapy (CRT has improved the clinical outcome, but the molecular background determining the effectiveness of therapy remains unknown. NRF2 is a master transcriptional regulator of stress adaptation, and gain of-function mutation of NRF2 in cancer confers resistance to stressors including anticancer therapy. Direct resequencing analysis revealed that Nrf2 gain-of-function mutation occurred recurrently (18/82, 22% in advanced ESC tumors and ESC cell lines (3/10. The presence of Nrf2 mutation was associated with tumor recurrence and poor prognosis. Short hairpin RNA-mediated down-regulation of NRF2 in ESC cells that harbor only mutated Nrf2 allele revealed that themutant NRF2 conferred increased cell proliferation, attachment-independent survival, and resistance to 5-fluorouracil and γ-irradiation. Based on the Nrf2 mutation status, gene expression signatures associated with NRF2 mutation were extracted from ESC cell lines, and their potential utility for monitoring and prognosis was examined in a cohort of 33 pre-CRT cases of ESC. The molecular signatures of NRF2 mutation were significantly predictive and prognostic for CRT response. In conclusion, recurrent NRF2 mutation confers malignant potential and resistance to therapy in advanced ESC, resulting in a poorer outcome. Molecular signatures of NRF2 mutation can be applied as predictive markers of response to CRT, and efficient inhibition of aberrant NRF2 activation could be a promising approach in combination with CRT.


    Directory of Open Access Journals (Sweden)

    Velio eBocci


    Full Text Available A chronic increase of oxidative stress is typical of serious pathologies such as myocardial infarction, stroke, chronic limb ischemia, chronic obstructive pulmonary disease (COPD, type II-diabetes, age-related macular degeneration leads to an epic increase of morbidity and mortality in all countries of the world. The initial inflammation followed by an excessive release of reactive oxygen species (ROS implies a diffused cellular injury that needs to be corrected by an inducible expression of the innate detoxifying and antioxidant system. The transcription factor Nrf2, when properly activated, is able to restore a redox homeostasis and possibly improve human health.

  13. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    Energy Technology Data Exchange (ETDEWEB)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Mattson, Mark P. [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States); Department of Neuroscience, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Camandola, Simonetta, E-mail: [Laboratory of Neurosciences, National Institute on Aging, Intramural Research Program, 251 Bayview Blvd., Baltimore, MD 21224 (United States)


    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity.

  14. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway

    International Nuclear Information System (INIS)

    Son, Tae Gen; Kawamoto, Elisa M.; Yu, Qian-Sheng; Greig, Nigel H.; Mattson, Mark P.; Camandola, Simonetta


    Highlights: •Naphthazarin activates the Nrf2/ARE pathway. •Naphthazarin induces Nrf2-driven genes in neurons and astrocytes. •Naphthazarin protects neurons against excitotoxicity. -- Abstract: Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity

  15. Sulforaphane Protects against Cardiovascular Disease via Nrf2 Activation

    Directory of Open Access Journals (Sweden)

    Yang Bai


    Full Text Available Cardiovascular disease (CVD causes an unparalleled proportion of the global burden of disease and will remain the main cause of mortality for the near future. Oxidative stress plays a major role in the pathophysiology of cardiac disorders. Several studies have highlighted the cardinal role played by the overproduction of reactive oxygen or nitrogen species in the pathogenesis of ischemic myocardial damage and consequent cardiac dysfunction. Isothiocyanates (ITC are sulfur-containing compounds that are broadly distributed among cruciferous vegetables. Sulforaphane (SFN is an ITC shown to possess anticancer activities by both in vivo and epidemiological studies. Recent data have indicated that the beneficial effects of SFN in CVD are due to its antioxidant and anti-inflammatory properties. SFN activates NF-E2-related factor 2 (Nrf2, a basic leucine zipper transcription factor that serves as a defense mechanism against oxidative stress and electrophilic toxicants by inducing more than a hundred cytoprotective proteins, including antioxidants and phase II detoxifying enzymes. This review will summarize the evidence from clinical studies and animal experiments relating to the potential mechanisms by which SFN modulates Nrf2 activation and protects against CVD.

  16. Topical Bixin Confers NRF2-Dependent Protection Against Photodamage and Hair Graying in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega


    Full Text Available Environmental exposure to solar ultraviolet (UV radiation causes acute photodamage, premature aging, and skin cancer, attributable to UV-induced genotoxic, oxidative, and inflammatory stress. The transcription factor NRF2 [nuclear factor erythroid 2 (E2-related factor 2] is the master regulator of the cellular antioxidant response protecting skin against various environmental stressors including UV radiation and electrophilic pollutants. NRF2 in epidermal keratinocytes can be activated using natural chemopreventive compounds such as the apocarotenoid bixin, an FDA-approved food additive and cosmetic ingredient from the seeds of the achiote tree (Bixa orellana. Here, we tested the feasibility of topical use of bixin for NRF2-dependent skin photoprotection in two genetically modified mouse models [SKH1 and C57BL/6J (Nrf2+/+ versus Nrf2-/-]. First, we observed that a bixin formulation optimized for topical NRF2 activation suppresses acute UV-induced photodamage in Nrf2+/+ but not Nrf2-/- SKH1 mice, a photoprotective effect indicated by reduced epidermal hyperproliferation and oxidative DNA damage. Secondly, it was demonstrated that topical bixin suppresses PUVA (psoralen + UVA-induced hair graying in Nrf2+/+ but not Nrf2-/- C57BL/6J mice. Collectively, this research provides the first in vivo evidence that topical application of bixin can protect against UV-induced photodamage and PUVA-induced loss of hair pigmentation through NRF2 activation. Topical NRF2 activation using bixin may represent a novel strategy for human skin photoprotection, potentially complementing conventional sunscreen-based approaches.

  17. NRF2 Pathway Activation and Adjuvant Chemotherapy Benefit in Lung Squamous Cell Carcinoma. (United States)

    Cescon, David W; She, Desmond; Sakashita, Shingo; Zhu, Chang-Qi; Pintilie, Melania; Shepherd, Frances A; Tsao, Ming-Sound


    Genomic profiling of lung squamous cell carcinomas (SCC) has identified NRF2 pathway alterations, which activate oxidative response pathways, in one third of tumors. Preclinical data suggest these tumors may be resistant to platinum-based chemotherapy. We evaluated the clinical relevance of these findings and assessed whether NRF2 activation predicts benefit from adjuvant chemotherapy in SCC. Logistic regression (LR) and significance analysis of microarrays (SAM) were applied to all 104 TCGA (The Cancer Genome Atlas) SCC cases that had microarray gene expression and mutation data to identify genes associated with somatic NRF2 pathway alterations. The resulting signature (NRF2(ACT)) was tested in 3 independent SCC datasets to evaluate its prognostic and predictive effects. IHC and sequencing for NRF2 and KEAP1 were evaluated in one cohort (n = 43) to assess the relationship between gene expression, mutational status, and protein expression. Twenty-eight genes were identified by overlap between LR (291 genes) and SAM (30 genes), and these consistently separated SCC into 2 groups in all datasets, corresponding to putatively NRF pathway-activated and wild-type (WT) tumors. NRF2(ACT) was not prognostic. However, improved survival with adjuvant chemotherapy in the JBR.10-randomized trial appears limited to patients with the WT signature (HR 0.32, P = 0.16; NRF2(ACT) HR 2.28, P = 0.48; interaction P = 0.15). NRF2(ACT) was highly correlated with mutations in NRF2 and KEAP1, and with high NRF2 protein expression. A gene expression signature of NRF2 pathway activation is associated with benefit from adjuvant cisplatin/vinorelbine in SCC. Patients with NRF2 pathway-activating somatic alterations may have reduced benefit from this therapy. ©2015 American Association for Cancer Research.

  18. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    International Nuclear Information System (INIS)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy


    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H 2 O 2 ) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H 2 O 2 levels. Furthermore, H 2 O 2 independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H 2 O 2 levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H 2 O 2 -independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H 2 O 2 - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments omeprazole-mediated induction of HO-1.

  19. Omeprazole induces heme oxygenase-1 in fetal human pulmonary microvascular endothelial cells via hydrogen peroxide-independent Nrf2 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Patel, Ananddeep; Zhang, Shaojie; Shrestha, Amrit Kumar; Maturu, Paramahamsa; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail:


    Omeprazole (OM) is an aryl hydrocarbon receptor (AhR) agonist and a proton pump inhibitor that is used to treat humans with gastric acid related disorders. Recently, we showed that OM induces NAD (P) H quinone oxidoreductase-1 (NQO1) via nuclear factor erythroid 2-related factor 2 (Nrf2)-dependent mechanism. Heme oxygenase-1 (HO-1) is another cytoprotective and antioxidant enzyme that is regulated by Nrf2. Whether OM induces HO-1 in fetal human pulmonary microvascular endothelial cells (HPMEC) is unknown. Therefore, we tested the hypothesis that OM will induce HO-1 expression via Nrf2 in HPMEC. OM induced HO-1 mRNA and protein expression in a dose-dependent manner. siRNA-mediated knockdown of AhR failed to abrogate, whereas knockdown of Nrf2 abrogated HO-1 induction by OM. To identify the underlying molecular mechanisms, we determined the effects of OM on cellular hydrogen peroxide (H{sub 2}O{sub 2}) levels since oxidative stress mediated by the latter is known to activate Nrf2. Interestingly, the concentration at which OM induced HO-1 also increased H{sub 2}O{sub 2} levels. Furthermore, H{sub 2}O{sub 2} independently augmented HO-1 expression. Although N-acetyl cysteine (NAC) significantly decreased H{sub 2}O{sub 2} levels in OM-treated cells, we observed that OM further increased HO-1 mRNA and protein expression in NAC-pretreated compared to vehicle-pretreated cells, suggesting that OM induces HO-1 via H{sub 2}O{sub 2}-independent mechanisms. In conclusion, we provide evidence that OM transcriptionally induces HO-1 via AhR - and H{sub 2}O{sub 2} - independent, but Nrf2 - dependent mechanisms. These results have important implications for human disorders where Nrf2 and HO-1 play a beneficial role. - Highlights: • Omeprazole induces HO-1 in human fetal lung cells. • AhR deficiency fails to abrogate omeprazole-mediated induction of HO-1. • Nrf2 knockdown abrogates omeprazole-mediated HO-1 induction in human lung cells. • Hydrogen peroxide depletion augments

  20. Perspectives of the Nrf-2 signaling pathway in cancer progression and therapy

    Directory of Open Access Journals (Sweden)

    Priyanka Basak

    Full Text Available The Nuclear factor erythroid2-related factor2 (Nrf2, a master regulator of redox homoeostasis, is a key transcription factor regulating a wide array of genes for antioxidant and detoxification enzymes. It protects organs from various kinds of toxic insults. On the other hand, activation of Nrf2 is also correlated with cancer progression and chemoresistance. Downregulation of Nrf2 activity has attracted an increasing amount of attention as it may provide an alternative cancer therapy. In this review, we examine recent studies on roles of Nrf2 in several pathophysiological conditions emphasising cancer. We discuss elaborately the current knowledge on Nrf2 regulation including KEAP1-dependent and KEAP1-independent cascades. KEAP1/Nrf2 system is a master regulator of cellular response against a variety of environmental stresses. We also highlight several tightly controlled regulations of Nrf2 by numerous proteins, small molecules, toxic metals, etc. In addition, we evaluate the possible therapeutic approaches of increasing chemosensitivity via modulating Nrf2 signaling. Keywords: Nrf2, Transcription factor, KEAP1, Oxidative stress, Cell proliferation, Carcinogenesis, Chemoprevention

  1. Direct Keap1-Nrf2 disruption as a potential therapeutic target for Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Fiona Kerr


    Full Text Available Nrf2, a transcriptional activator of cell protection genes, is an attractive therapeutic target for the prevention of neurodegenerative diseases, including Alzheimer's disease (AD. Current Nrf2 activators, however, may exert toxicity and pathway over-activation can induce detrimental effects. An understanding of the mechanisms mediating Nrf2 inhibition in neurodegenerative conditions may therefore direct the design of drugs targeted for the prevention of these diseases with minimal side-effects. Our study provides the first in vivo evidence that specific inhibition of Keap1, a negative regulator of Nrf2, can prevent neuronal toxicity in response to the AD-initiating Aβ42 peptide, in correlation with Nrf2 activation. Comparatively, lithium, an inhibitor of the Nrf2 suppressor GSK-3, prevented Aβ42 toxicity by mechanisms independent of Nrf2. A new direct inhibitor of the Keap1-Nrf2 binding domain also prevented synaptotoxicity mediated by naturally-derived Aβ oligomers in mouse cortical neurons. Overall, our findings highlight Keap1 specifically as an efficient target for the re-activation of Nrf2 in AD, and support the further investigation of direct Keap1 inhibitors for the prevention of neurodegeneration in vivo.

  2. DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model

    Directory of Open Access Journals (Sweden)

    Huimin eCao


    Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.

  3. Naphthazarin protects against glutamate-induced neuronal death via activation of the Nrf2/ARE pathway. (United States)

    Son, Tae Gen; Kawamoto, Elisa M; Yu, Qian-Sheng; Greig, Nigel H; Mattson, Mark P; Camandola, Simonetta


    Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. We previously screened several natural phytochemicals and identified plumbagin as a novel activator of the Nrf2/ARE pathway that can protect neurons against ischemic injury. Here we extended our studies to natural and synthetic derivatives of plumbagin. We found that 5,8-dimethoxy-1,4-naphthoquinone (naphthazarin) is a potent activator of the Nrf2/ARE pathway, up-regulates the expression of Nrf2-driven genes in primary neuronal and glial cultures, and protects neurons against glutamate-induced excitotoxicity. Published by Elsevier Inc.

  4. Enhanced B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation contributes to ABCC1-mediated chemoresistance and glutathione-mediated survival in acquired topoisomerase II poison-resistant cancer cells. (United States)

    Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan


    Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Transgenic petunia with the iron(III)-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments. (United States)

    Murata, Yoshiko; Itoh, Yoshiyuki; Iwashita, Takashi; Namba, Kosuke


    Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III) to iron(II) and the uptake of iron(II) by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III). Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III)-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III)-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III)-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III) complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III)-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems to diverse

  6. Transgenic petunia with the iron(III-phytosiderophore transporter gene acquires tolerance to iron deficiency in alkaline environments.

    Directory of Open Access Journals (Sweden)

    Yoshiko Murata

    Full Text Available Iron is an essential nutrient for all plants. However, terrestrial plants often suffer from iron deficiency in alkaline soil due to its extremely low solubility. Alkaline soil accounts for about 30% of all cultivated ground in the world. Plants have evolved two distinct strategies, I and II, for iron uptake from the soil. Dicots and non-graminaceous monocots use Strategy I, which is primarily based on the reduction of iron(III to iron(II and the uptake of iron(II by the iron-regulated transporter, IRT1. In contrast, graminaceous plants use Strategy II to efficiently acquire insoluble iron(III. Strategy II comprises the synthesis and secretion of iron-chelating phytosiderophores, such as mugineic acids and the Yellow Stripe 1 transporter proteins of the iron(III-phytosiderophore complex. Barley, which exhibits the highest tolerance to iron deficiency in alkaline soil among graminaceous plants, utilizes mugineic acids and the specific iron(III-mugineic acids transporter, HvYS1. In this study, we established the transgenic plant Petunia hybrida, which originally had only Strategy I, by introducing the HvYS1 transporter gene derived from barley. When the transgenic plants were grown hydroponically in media containing the iron(III-2'-deoxymugineic acid complex, free 2'-deoxymugineic acid and its iron(III complex were detected in the root extract of the transgenic plant by electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry. The growth of the transgenic petunia was significantly better than that of the control host in alkaline conditions. Consequently, the transgenic plant acquired a significantly enhanced tolerance to alkaline hydroponic media in the presence of the iron(III-2'-deoxymugineic acid complex. Furthermore, the flower color of the transgenic plant deepened. The results showed that iron-phytosiderophore complexes and their transporters can potentially be utilized to overcome the worldwide iron uptake problems

  7. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    International Nuclear Information System (INIS)

    Li, Bin; Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S.; Ward, Keith W.; Meyer, Colin J.; Wang, Xing Li; Tang, Dongqi; Cui, Taixing


    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  8. Nrf2 and Keap1 Abnormalities in 104 Lung Adenocarcinoma Cases and Association with Clinicopathologic Features

    Directory of Open Access Journals (Sweden)

    Yu XIAO


    Full Text Available Background and objective There are significantly interindividual variations of the expression level of nuclear factor erythroid-2-related factor 2 (Nrf2 and/or Kelch-like ECH-associated protein 1 (Keap1 in our previous studies. It has been proven that Nrf2 or Keap1 is related to resistance of chemotherapeutic drugs and/or epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs. However, the expression of Nrf2 and Keap1 in lung adenocarcinoma patients with different “driver gene” is not clear. The aim of this study is to investigate the protein expression level of Nrf2 and Keap1 in lung adenocarcinoma and to elucidate the correlation between Nrf2 or Keap1 expression and the status of EGFR gene mutation and to determine the effects of Nrf2 and Keap1 on the patients. Methods Immunohistochemical analysis of Nrf2 and Keap1 in tumor specimens was performed in a total of 104 lung adenocarcinoma patients with the status of EGFR gene mutations or EGFR wide-type. Results The Nrf2 positive rate was 71.2% and Keap1 high expression rate was 34.6% in 104 patients. The Nrf2 positive rate significantly correlated with gender, stage and status of EGFR gene mutation (P0.05. The high expression of Keap1 was not significantly correlated with gender, age, smoking, differentiation, subtype of lung adenocarcinoma and status of EGFR gene mutation (P>0.05. The progression -free survival (PFS and overall survival (OS of the patients treated by EGFR-TKIs were significantly correlated with the expression level of Nrf2, but not with Keap1. The PFS and OS of the patients with Nrf2 high expression were significantly shorter than the patients with low/negative expression (P<0.05. Furthermore, Nrf2 high expression was the independent predictive factor for EGFR-TKIs induced PFS and OS (P<0.05. Conclusion The Nrf2 positive rate significantly correlated with the status of EGFR gene mutation in lung adenocarcinoma. The Nrf2 high expression significantly

  9. Dihydro-CDDO-trifluoroethyl amide suppresses inflammatory responses in macrophages via activation of Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Li, Bin [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Abdalrahman, Akram; Lai, Yimu; Janicki, Joseph S. [Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Ward, Keith W.; Meyer, Colin J. [Department of Pharmacology, Reata Pharmaceuticals, Inc., Irving, TX 75063 (United States); Wang, Xing Li [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Tang, Dongqi, E-mail: [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States); Cui, Taixing, E-mail: [Shandong University Qilu Hospital Research Center for Cell Therapy, Key Laboratory of Cardiovascular Remodeling and Function Research, Qilu Hospital of Shandong University, Jinan 250012 (China); Department of Cell Biology and Anatomy, University of South Carolina School of Medicine, Columbia, SC 29208 (United States)


    Highlights: • Dh404 suppresses the expression of a selected set of pro-inflammatory cytokines in inflamed macrophages via activating Nrf2. • Dh404 activates Nrf2 while keeping Keap1 function intact in macrophages. • Dh404 minimally regulates NF-κB pathway in macrophages. - Abstract: Nuclear factor erythroid 2-related factor (Nrf2) is the major regulator of cellular defenses against various pathological stresses in a variety of organ systems, thus Nrf2 has evolved to be an attractive drug target for the treatment and/or prevention of human disease. Several synthetic oleanolic triterpenoids including dihydro-CDDO-trifluoroethyl amide (dh404) appear to be potent activators of Nrf2 and exhibit chemopreventive promises in multiple disease models. While the pharmacological efficacy of Nrf2 activators may be dependent on the nature of Nrf2 activation in specific cell types of target organs, the precise role of Nrf2 in mediating biological effects of Nrf2 activating compounds in various cell types remains to be further explored. Herein we report a unique and Nrf2-dependent anti-inflammatory profile of dh404 in inflamed macrophages. In lipopolysaccharide (LPS)-inflamed RAW264.7 macrophages, dh404 dramatically suppressed the expression of pro-inflammatory cytokines including inducible nitric oxide synthase (iNOS), monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 beta (MIP-1β), while minimally regulating the expression of interleulin-6 (IL-6), IL-1β, and tumor necrosis factor alpha (TNFα). Dh404 potently activated Nrf2 signaling; however, it did not affect LPS-induced NF-κB activity. Dh404 did not interrupt the interaction of Nrf2 with its endogenous inhibitor Kelch-like ECH associating protein 1 (Keap1) in macrophages. Moreover, knockout of Nrf2 blocked the dh404-induced anti-inflammatory responses in LPS-inflamed macrophages. These results demonstrated that dh404 suppresses pro-inflammatory responses in macrophages via an activation

  10. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    International Nuclear Information System (INIS)

    Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang


    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury

  11. Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury

    Energy Technology Data Exchange (ETDEWEB)

    Jing, Xu [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Ren, Dongmei [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China); Wei, Xinbing; Shi, Huanying; Zhang, Xiumei [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Perez, Ruth G. [Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905 (United States); Lou, Haiyan, E-mail: [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Lou, Hongxiang [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China)


    Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.

  12. Cytoprotective Role of Nrf2 in Electrical Pulse Stimulated C2C12 Myotube.

    Directory of Open Access Journals (Sweden)

    Masaki Horie

    Full Text Available Regular physical exercise is central to a healthy lifestyle. However, exercise-related muscle contraction can induce reactive oxygen species and reactive nitrogen species (ROS/RNS production in skeletal muscle. The nuclear factor-E2-related factor-2 (Nrf2 transcription factor is a cellular sensor for oxidative stress. Regulation of nuclear Nrf2 signaling regulates antioxidant responses and protects organ structure and function. However, the role of Nrf2 in exercise- or contraction-induced ROS/RNS production in skeletal muscle is not clear. In this study, using differentiated C2C12 cells and electrical pulse stimulation (EPS of muscle contraction, we explored whether Nrf2 plays a role in the skeletal muscle response to muscle contraction-induced ROS/RNS. We found that EPS (40 V, 1 Hz, 2 ms stimulated ROS/RNS accumulation and Nrf2 activation. We also showed that expression of NQO1, HO-1 and GCLM increased after EPS-induced muscle contraction and was remarkably suppressed in cells with Nrf2 knockdown. We also found that the antioxidant N-acetylcysteine (NAC significantly attenuated Nrf2 activation after EPS, whereas the nitric oxide synthetase inhibitor Nω-nitro-L-arginine methyl ester (L-NAME did not. Furthermore, Nrf2 knockdown after EPS markedly decreased ROS/RNS redox potential and cell viability and increased expression of the apoptosis marker Annexin V in C2C12 myotubes. These results indicate that Nrf2 activation and expression of Nrf2 regulated-genes protected muscle against the increased ROS caused by EPS-induced muscle contraction. Thus, our findings suggest that Nrf2 may be a key factor for preservation of muscle function during muscle contraction.

  13. Nrf2 protects human bladder urothelial cells from arsenite and monomethylarsonous acid toxicity

    International Nuclear Information System (INIS)

    Wang Xiaojun; Sun Zheng; Chen Weimin; Eblin, Kylee E.; Gandolfi, Jay A.; Zhang, Donna D.


    Arsenic is widely spread in our living environment and imposes a big challenge on human health worldwide. Arsenic damages biological systems through multiple mechanisms including the generation of reactive oxygen species. The transcription factor Nrf2 regulates the cellular antioxidant response that protects cells from various insults. In this study, the protective role of Nrf2 in arsenic toxicity was investigated in a human bladder urothelial cell line, UROtsa. Using a UROtsa cell line stably infected with Nrf2-siRNA, we clearly demonstrate that compromised Nrf2 expression sensitized the cells to As(III)- and MMA(III)-induced toxicity. On the other hand, the activation of the Nrf2 pathway by tert-butylhydroquinone (tBHQ) and sulforaphane (SF), the known Nrf2-inducers, rendered UROtsa cells more resistant to As(III) and MMA(III). Furthermore, the wild-type mouse embryo fibroblast (WT-MEF) cells were protected from As(III)- and MMA(III)-induced toxicity following Nrf2 activation by tBHQ or SF, whereas neither tBHQ nor SF conferred protection in the Nrf2 -/- MEF cells, demonstrating that tBHQ- or SF-mediated protection against As(III)- and MMA(III)-induced toxicity depends on Nrf2 activation. These results, obtained by both loss of function and gain of function analyses, clearly demonstrate the protective role of Nrf2 in arsenic-induced toxicity. The current work lays the groundwork for using Nrf2 activators for therapeutic and dietary interventions against adverse effects of arsenic

  14. Cardiac and renal upregulation of Nox2 and NF-κB and repression of Nox4 and Nrf2 in season- and diabetes-mediated models of vascular oxidative stress in guinea-pig and rat. (United States)

    Gajos-Draus, Anna; Duda, Monika; Beręsewicz, Andrzej


    The superoxide-forming NADPH oxidase homologues, Nox1, Nox2, and Nox5, seem to mediate the pro-atherosclerotic vascular phenotype. The hydrogen peroxide-forming Nox4 afforded vascular protection, likely via NF-E2-related factor-2 (Nrf2) activation and/or Nox2 downregulation in transgenic mice. We hypothesized that oxidative stress in the intact vasculature involves, aside from the upregulation of the superoxide-forming Noxs, the downregulation of the Nox4/Nrf2 pathway. Guinea-pigs and rats were studied either in winter or in summer, and the streptozotocin diabetic rats in winter. Plasma nitrite, and superoxide production by isolated hearts were measured, while frozen tissues served in biochemical analyses. Summer in both species and diabetes in rats downregulated myocardial Nox4 while reciprocally upregulating Nox2 and Nox5 in guinea-pigs, and Nox2 in rats. Simultaneously, myocardial Nrf2 activity and the expression of the Nrf2-directed heme oxygenase-1 and endothelial NO synthase were reduced while activity of the nuclear factor κ B (NF- κ B) and the expression of NF- κ B-directed inducible NO synthase and the vascular cell adhesion molecule-1 were increased. Cardiac superoxide production was increased while plasma nitrite was decreased reciprocally. Analogous disregulation of Noxs, Nrf2, and NF- κ B, occurred in diabetic rat kidneys. Given the diversity of the experimental settings and the uniform pattern of the responses, we speculate that: (1) chronic vascular oxidative stress is a nonspecific (model-, species-, organ-independent) response involving the induction of Nox2 (and Nox5 in guinea-pigs) and the NF- κ B pathway, and the repression of Nox4 and the Nrf2 pathway; and (2) the systems Nox2-NF- κ B and Nox4-Nrf2 regulate each other negatively. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  15. Salidroside Suppresses HUVECs Cell Injury Induced by Oxidative Stress through Activating the Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Yao Zhu


    Full Text Available Oxidative stress plays an important role in the pathogenesis of cardiovascular diseases. Salidroside (SAL, one of the main effective constituents of Rhodiola rosea, has been reported to suppress oxidative stress-induced cardiomyocyte injury and necrosis by promoting transcription of nuclear factor E2-related factor 2 (Nrf2-regulated genes such as heme oxygenase-1 (HO-1 and NAD(PH dehydrogenase (quinone1 (NQO1. However, it has not been indicated whether SAL might ameliorate endothelial injury induced by oxidative stress. Here, our study demonstrated that SAL might suppress HUVEC cell injury induced by oxidative stress through activating the Nrf2 signaling pathway. The results of our study indicated that SAL decreased the levels of intercellular reactive oxygen species (ROS and malondialdehyde (MDA, and improved the activities of superoxide dismutase (SOD and catalase (CAT, resulting in protective effects against oxidative stress-induced cell damage in HUVECs. It suppressed oxidative stress damage by inducing Nrf2 nuclear translocation and activating the expression of Nrf2-regulated antioxidant enzyme genes such as HO-1 and NQO1 in HUVECs. Knockdown of Nrf2 with siRNA abolished the cytoprotective effects against oxidative stress, decreased the expression of Nrf2, HO-1, and NQO1, and inhibited the nucleus translocation of Nrf2 in HUVECs. This study is the first to demonstrate that SAL suppresses HUVECs cell injury induced by oxidative stress through activating the Nrf2 signaling pathway.

  16. Activation of apoptosis signal-regulating kinase 1 is a key factor in paraquat-induced cell death: modulation by the Nrf2/Trx axis. (United States)

    Niso-Santano, Mireia; González-Polo, Rosa A; Bravo-San Pedro, José M; Gómez-Sánchez, Rubén; Lastres-Becker, Isabel; Ortiz-Ortiz, Miguel A; Soler, Germán; Morán, José M; Cuadrado, Antonio; Fuentes, José M


    Although oxidative stress is fundamental to the etiopathology of Parkinson disease, the signaling molecules involved in transduction after oxidant exposure to cell death are ill-defined, thus making it difficult to identify molecular targets of therapeutic relevance. We have addressed this question in human dopaminergic neuroblastoma SH-SY5Y cells exposed to the parkinsonian toxin paraquat (PQ). This toxin elicited a dose-dependent increase in reactive oxygen species and cell death that correlated with activation of ASK1 and the stress kinases p38 and JNK. The relevance of these kinases in channeling PQ neurotoxicity was demonstrated with the use of interference RNA for ASK1 and two well-established pharmaceutical inhibitors for JNK and p38. The toxic effect of PQ was substantially attenuated by preincubation with vitamin E, blocking ASK1 pathways and preventing oxidative stress and cell death. In a search for a physiological pathway that might counterbalance PQ-induced ASK1 activation, we analyzed the role of the transcription factor Nrf2, master regulator of redox homeostasis, and its target thioredoxin (Trx), which binds and inhibits ASK1. Trx levels were undetectable in Nrf2-deficient mouse embryo fibroblasts (MEFs), whereas they were constitutively high in Keap1-deficient MEFs as well as in SH-SY5Y cells treated with sulforaphane (SFN). Consistent with these data, Nrf2-deficient MEFs were more sensitive and Keap1-deficient MEFs and SH-SY5Y cells incubated with SFN were more resistant to PQ-induced cell death. This study identifies ASK1/JNK and ASK1/p38 as two critical pathways involved in the activation of cell death under oxidative stress conditions and identifies the Nrf2/Trx axis as a new target to block these pathways and protect from oxidant exposure such as that found in Parkinson and other neurodegenerative diseases. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Natural product-derived pharmacological modulators of Nrf2/ARE pathway for chronic diseases. (United States)

    Kumar, Hemant; Kim, In-Su; More, Sandeep Vasant; Kim, Byung-Wook; Choi, Dong-Kug


    Covering: 2000 to 2013. Oxidative stress is the central component of chronic diseases. The nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2/ARE) pathway is vital in the up-regulation of cytoprotective genes and enzymes in response to oxidative stress and treatment with certain dietary phytochemicals. Herein, we classify bioactive compounds derived from natural products that are Nrf2/ARE pathway activators and recapitulate the molecular mechanisms for inducing Nrf2 to provide favorable effects in experimental models of chronic diseases. Moreover, pharmacological inhibition of Nrf2 signalling has emerged as promising strategy against multi-drug resistance thereby improving the treatment efficacy. We have also enlisted natural product-derived inhibitors of Nrf2/ARE pathway.

  18. When defense becomes dangerous – transcription factor Nrf2 and cancer

    Directory of Open Access Journals (Sweden)

    Adam Krysztofiak


    Full Text Available The transcription factor Nrf2 controls the expression of genes encoding cytoprotective enzymes and proteins. Its activation is related to conformational changes in the inhibitory protein Keap1 and/or Nrf2 phosphorylation by upstream kinases. Activation of Nrf2 can lead to the induction of phase II enzymes responsible for the inactivation of potential carcinogens. This may constitute an important strategy of chemoprevention. Moreover, these enzymatic systems participating in the biotransformation of drugs can reduce their therapeutic effects, contributing to drug resistance. For this reason, a clear understanding of the role of Nrf2 is essential to assess the beneficial and adverse effects of its up-regulation, particularly in relation to the prevention and treatment of cancer. This article summarizes the current state of knowledge on the significance of Nrf2 in tumorigenesis.

  19. The rise of antioxidant signaling-The evolution and hormetic actions of Nrf2

    International Nuclear Information System (INIS)

    Maher, Jonathan; Yamamoto, Masayuki


    Organisms have evolved sophisticated and redundant mechanisms to manage oxidative and electrophilic challenges that arise from internal metabolism or xenobiotic challenge for survival. NF-E2-related factor 2 (Nrf2) is a transcription factor that has evolved over millennia from primitive origins, with homologues traceable back to invertebrate Caenorhabditis and Drosophila species. The ancestry of Nrf2 clearly has deep-seated roots in hematopoiesis, yet has diversified into a transcription factor that can mediate a multitude of antioxidant signaling and detoxification genes. In higher organisms, a more sophisticated means of tightly regulating Nrf2 activity was introduced via the cysteine-rich kelch-like ECH-associated protein 1 (Keap1), thus suggesting a need to modulate Nrf2 activity. This is evidenced in Keap1 -/- mice, which succumb to juvenile mortality due to hyperkeratosis of the gastrointestinal tract. Although Nrf2 activation protects against acute toxicity and prevents or attenuates several disease states, constitutive activation in some tumors leads to poor clinical outcomes, suggesting Nrf2 has evolved in response to a multitude of selective pressures. The purpose of this review is to examine the origins of Nrf2, while highlighting the versatility and protective abilities elicited upon activation. Various model systems in which Nrf2 is normally beneficial but in which exaggerated pharmacology exacerbates a physiological or pathological condition will be addressed. Although Darwinian principles have selected Nrf2 activity for maximal beneficial effect based on environmental and oxidative challenge, both sub- or super-physiological effects have been noted to be detrimental. The functions of Nrf2 thus suggest a hormetic factor that has evolved empirically over time.

  20. Curcumin plays neuroprotective roles against traumatic brain injury partly via Nrf2 signaling. (United States)

    Dong, Wenwen; Yang, Bei; Wang, Linlin; Li, Bingxuan; Guo, Xiangshen; Zhang, Miao; Jiang, Zhenfei; Fu, Jingqi; Pi, Jingbo; Guan, Dawei; Zhao, Rui


    Traumatic brain injury (TBI), which leads to high mortality and morbidity, is a prominent public health problem worldwide with no effective treatment. Curcumin has been shown to be beneficial for neuroprotection in vivo and in vitro, but the underlying mechanism remains unclear. This study determined whether the neuroprotective role of curcumin in mouse TBI is dependent on the NF-E2-related factor (Nrf2) pathway. The Feeney weight-drop contusion model was used to mimic TBI. Curcumin was administered intraperitoneally 15 min after TBI induction, and brains were collected at 24 h after TBI. The levels of Nrf2 and its downstream genes (Hmox-1, Nqo1, Gclm, and Gclc) were detected by Western blot and qRT-PCR at 24 h after TBI. In addition, edema, oxidative damage, cell apoptosis and inflammatory reactions were evaluated in wild type (WT) and Nrf2-knockout (Nrf2-KO) mice to explore the role of Nrf2 signaling after curcumin treatment. In wild type mice, curcumin treatment resulted in reduced ipsilateral cortex injury, neutrophil infiltration, and microglia activation, improving neuron survival against TBI-induced apoptosis and degeneration. These effects were accompanied by increased expression and nuclear translocation of Nrf2, and enhanced expression of antioxidant enzymes. However, Nrf2 deletion attenuated the neuroprotective effects of curcumin in Nrf2-KO mice after TBI. These findings demonstrated that curcumin effects on TBI are associated with the activation the Nrf2 pathway, providing novel insights into the neuroprotective role of Nrf2 and the potential therapeutic use of curcumin for TBI. Copyright © 2018. Published by Elsevier Inc.

  1. 3H-1,2-Dithiole-3-thione as a novel therapeutic agent for the treatment of ischemic stroke through Nrf2 defense pathway. (United States)

    Kuo, Ping-Chang; Yu, I-Chen; Scofield, Barbara A; Brown, Dennis A; Curfman, Eric T; Paraiso, Hallel C; Chang, Fen-Lei; Yen, Jui-Hung


    Cerebral ischemic stroke accounts for more than 80% of all stroke cases. During cerebral ischemia, reactive oxygen species produced in brain tissue induce oxidative stress and inflammatory responses. D3T, the simplest compound of the cyclic, sulfur-containing dithiolethiones, is found in cruciferous vegetables and has been reported to induce antioxidant genes and glutathione biosynthesis through activation of Nrf2. In addition to antioxidant activity, D3T was also reported to possess anti-inflammatory effects. In this study, we evaluated the therapeutic potential of D3T for the treatment of ischemic stroke and investigated the mechanisms underlying the protective effects of D3T in ischemic stroke. Mice subjected to transient middle cerebral artery occlusion/reperfusion (tMCAO/R) were administered with vehicle or D3T to evaluate the effect of D3T in cerebral brain injury. We observed D3T reduced infarct size, decreased brain edema, lessened blood-brain barrier disruption, and ameliorated neurological deficits. Further investigation revealed D3T suppressed microglia (MG) activation and inhibited peripheral inflammatory immune cell infiltration of CNS in the ischemic brain. The protective effect of D3T in ischemic stroke is mediated through Nrf2 induction as D3T-attenuated brain injury was abolished in Nrf2 deficient mice subjected to tMCAO/R. In addition, in vitro results indicate the induction of Nrf2 by D3T is required for its suppressive effect on MG activation and cytokine production. In summary, we demonstrate for the first time that D3T confers protection against ischemic stroke, which is mediated through suppression of MG activation and inhibition of CNS peripheral cell infiltration, and that the protective effect of D3T in ischemic stroke is dependent on the activation of Nrf2. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Dihydro-CDDO-trifluoroethyl amide (dh404, a novel Nrf2 activator, suppresses oxidative stress in cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Tomonaga Ichikawa

    Full Text Available Targeting Nrf2 signaling appears to be an attractive approach for the treatment of maladaptive cardiac remodeling and dysfunction; however, pharmacological modulation of the Nrf2 pathway in the cardiovascular system remains to be established. Herein, we report that a novel synthetic triterpenoid derivative, dihydro-CDDO-trifluoroethyl amide (dh404, activates Nrf2 and suppresses oxidative stress in cardiomyocytes. Dh404 interrupted the Keap1-Cul3-Rbx1 E3 ligase complex-mediated Nrf2 ubiquitination and subsequent degradation saturating the binding capacity of Keap1 to Nrf2, thereby rendering more Nrf2 to be translocated into the nuclei to activate Nrf2-driven gene transcription. A mutant Keap1 protein containing a single cysteine-to-serine substitution at residue 151 within the BTB domain of Keap1 was resistant to dh404-induced stabilization of Nrf2 protein. In addition, dh404 did not dissociate the interaction of Nrf2 with the Keap1-Cul3-Rbx1 E3 ligase complex. Thus, it is likely that dh404 inhibits the ability of Keap1-Cul3-Rbx1 E3 ligase complex to target Nrf2 for ubiquitination and degradation via modifying Cys-151 of Keap1 to change the conformation of the complex. Moreover, dh404 was able to stabilize Nrf2 protein, to enhance Nrf2 nuclear translocation, to activate Nrf2-driven transcription, and to suppress angiotensin II (Ang II-induced oxidative stress in cardiomyocytes. Knockdown of Nrf2 almost blocked the anti-oxidative effect of dh404. Dh404 activated Nrf2 signaling in the heart. Taken together, dh404 appears to be a novel Nrf2 activator with a therapeutic potential for cardiac diseases via suppressing oxidative stress.

  3. Nrf2 the rescue: Effects of the antioxidative/electrophilic response on the liver

    International Nuclear Information System (INIS)

    Klaassen, Curtis D.; Reisman, Scott A.


    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that positively regulates the basal and inducible expression of a large battery of cytoprotective genes. These gene products include proteins that catalyze reduction reactions (NAD(P)H:quinone oxidoreductase 1, Nqo1), conjugation reactions (glutathione-S-transferases, Gsts and UDP-glucuronosyltransferases, Ugts), as well as the efflux of potentially toxic xenobiotics and xenobiotic conjugates (multidrug resistance-associated proteins, Mrps). The significance of Nrf2 in the liver has been established, as livers of Nrf2-null mice are more susceptible to various oxidative/electrophilic stress-induced pathologies than wild-type mice. In contrast, both pharmacological and genetic models of hepatic Nrf2 activation are protective against oxidative/electrophilic stress. Furthermore, because certain Nrf2-target genes in the liver could affect the distribution, metabolism, and excretion of xenobiotics, the effects of Nrf2 on the kinetics of drugs and other xenobiotics should also be considered, with a special emphasis on metabolism and excretion. Therefore, this review highlights the research that has contributed to the understanding of the importance of Nrf2 in toxicodynamics and toxicokinetics, especially that which pertains to the liver.

  4. Resveratrol, an Nrf2 activator, ameliorates aging-related progressive renal injury. (United States)

    Kim, Eun Nim; Lim, Ji Hee; Kim, Min Young; Ban, Tae Hyun; Jang, In-Ae; Yoon, Hye Eun; Park, Cheol Whee; Chang, Yoon Sik; Choi, Bum Soon


    Two important issues in the aging kidney are mitochondrial dysfunction and oxidative stress. An Nrf2 activator, resveratrol, is known to have various effects. Resveratrol may prevent inflammation and oxidative stress by activating Nrf2 and SIRT1 signaling. We examined whether resveratrol could potentially ameliorate the cellular condition, such as renal injury due to cellular oxidative stress and mitochondrial dysfunction caused by aging. Male 18-month-old C57BL/6 mice were used. Resveratrol (40 mg/kg) was administered to aged mice for 6 months. We compared histological changes, oxidative stress, and aging-related protein expression in the kidney between the resveratrol-treated group (RSV) and the control group (cont). We performed experiments using small-interfering RNAs (siRNAs) for Nrf2 and SIRT1 in cultured HK2 cells. Resveratrol improved renal function, proteinuria, histological changes and inflammation in aging mice. Also, expression of Nrf2-HO-1-NOQ-1 signaling and SIRT1-AMPK-PGC-1α signaling was increased in the RSV group. Transfection with Nrf2 and SIRT1 siRNA prevented resveratrol-induced anti-oxidative effect in HK2 cells in media treated with H 2 O 2 . Activation of the Nrf2 and SIRT1 signaling pathways ameliorated oxidative stress and mitochondrial dysfunction. Pharmacological targeting of Nrf2 signaling molecules may reduce the pathologic changes of aging in the kidney.

  5. Targeting of the Glutathione, Thioredoxin, and Nrf2 Antioxidant Systems in Head and Neck Cancer. (United States)

    Roh, Jong-Lyel; Jang, Hyejin; Kim, Eun Hye; Shin, Daiha


    The glutathione (GSH), thioredoxin (Trx), and Nrf2 systems represent a major defense against reactive oxygen species (ROS), the cellular imbalance of which in cancer promotes growth and therapeutic resistance. This study investigated whether targeting the GSH, Trx, and Nrf2 antioxidant systems effectively eliminated head and neck cancer (HNC). At high concentrations, auranofin, but not buthionine sulfoximine (BSO) alone, decreased the viability of HNC, whereas even at low concentrations, auranofin plus BSO synergized to kill HNC cells. Dual silencing of the genes for GCLM and TrxR1 induced GSH depletion, Trx activity inhibition, and ROS accumulation, synergistically killing HNC cells. Inhibition of the GSH and Trx systems resulted in activation of the Nrf2-antioxidant response element (ARE) pathway, which may result in suboptimal GSH and Trx inhibition where HNC is resistant. Genetic inhibition of Nrf2 and/or HO-1 or trigonelline enhanced growth suppression, ROS accumulation, and cell death from GSH and Trx inhibition. The in vivo effects of GSH, Trx, and Nrf2 system inhibition were confirmed in a mouse HNC xenograft model by achieving growth inhibition >60% compared with those of control. Innovations: This study is the first to show that triple inhibition of GSH, Trx, and Nrf2 pathways could be an effective method to overcome the resistance of HNC. Inhibition of the Nrf2-ARE pathway in addition to dual inhibition of the GSH and Trx antioxidant systems can effectively eliminate resistant HNC. Antioxid. Redox Signal. 27, 106-114.

  6. Soybean-Derived Phytoalexins Improve Cognitive Function through Activation of Nrf2/HO-1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo


    Full Text Available As soy-derived glyceollins are known to induce antioxidant enzymes in various types of cells and tissues, we hypothesized that the compounds could protect neurons from damage due to reactive oxygen species (ROS. In order to examine the neuroprotective effect of glyceollins, primary cortical neurons collected from mice and mouse hippocampal HT22 cells were challenged with glutamate. Glyceollins attenuated glutamate-induced cytotoxicity in primary cortical neuron isolated from mice carrying wild-type nuclear factor (erythroid-derived 2-like 2 (Nrf2, but the compounds were ineffective in those isolated from Nrf2 knockout mice, suggesting the involvement of the Nrf2 signaling pathway in glyceollin-mediated neuroprotection. Furthermore, the inhibition of heme oxygenase-1 (HO-1, a major downstream enzyme of Nrf2, abolished the suppressive effect of glyceollins against glutamate-induced ROS production and cytotoxicity, confirming that activation of HO-1 by glyceollins is responsible for the neuroprotection. To examine whether glyceollins also improve cognitive ability, mice pretreated with glyceollins were challenged with scopolamine and subjected to behavioral tests. Glyceollins attenuated scopolamine-induced cognitive impairment of mice, but failed to enhance memory in Nrf2 knockout mice, suggesting that the memory-enhancing effect is also mediated by the Nrf2 signaling pathway. Overall, glyceollins showed neuroprotection against glutamate-induced damage, and attenuated scopolamine-induced memory deficits in an Nrf2-dependent manner.

  7. Aldose Reductase Inhibitor Protects against Hyperglycemic Stress by Activating Nrf2-Dependent Antioxidant Proteins

    Directory of Open Access Journals (Sweden)

    Kirtikar Shukla


    Full Text Available We have shown earlier that pretreatment of cultured cells with aldose reductase (AR inhibitors prevents hyperglycemia-induced mitogenic and proinflammatory responses. However, the effects of AR inhibitors on Nrf2-mediated anti-inflammatory responses have not been elucidated yet. We have investigated how AR inhibitor fidarestat protects high glucose- (HG- induced cell viability changes by increasing the expression of Nrf2 and its dependent phase II antioxidant enzymes. Fidarestat pretreatment prevents HG (25 mM-induced Thp1 monocyte viability. Further, treatment of Thp1 monocytes with fidarestat caused a time-dependent increase in the expression as well as the DNA-binding activity of Nrf2. In addition, fidarestat augmented the HG-induced Nrf2 expression and activity and also upregulated the expression of Nrf2-dependent proteins such as hemeoxygenase-1 (HO1 and NQO1 in Thp1 cells. Similarly, treatment with AR inhibitor also induced the expression of Nrf2 and HO1 in STZ-induced diabetic mice heart and kidney tissues. Further, AR inhibition increased the HG-induced expression of antioxidant enzymes such as SOD and catalase and activation of AMPK-α1 in Thp1 cells. Our results thus suggest that pretreatment with AR inhibitor prepares the monocytes against hyperglycemic stress by overexpressing the Nrf2-dependent antioxidative proteins.

  8. Aldose Reductase Inhibitor Protects against Hyperglycemic Stress by Activating Nrf2-Dependent Antioxidant Proteins. (United States)

    Shukla, Kirtikar; Pal, Pabitra Bikash; Sonowal, Himangshu; Srivastava, Satish K; Ramana, Kota V


    We have shown earlier that pretreatment of cultured cells with aldose reductase (AR) inhibitors prevents hyperglycemia-induced mitogenic and proinflammatory responses. However, the effects of AR inhibitors on Nrf2-mediated anti-inflammatory responses have not been elucidated yet. We have investigated how AR inhibitor fidarestat protects high glucose- (HG-) induced cell viability changes by increasing the expression of Nrf2 and its dependent phase II antioxidant enzymes. Fidarestat pretreatment prevents HG (25 mM)-induced Thp1 monocyte viability. Further, treatment of Thp1 monocytes with fidarestat caused a time-dependent increase in the expression as well as the DNA-binding activity of Nrf2. In addition, fidarestat augmented the HG-induced Nrf2 expression and activity and also upregulated the expression of Nrf2-dependent proteins such as hemeoxygenase-1 (HO1) and NQO1 in Thp1 cells. Similarly, treatment with AR inhibitor also induced the expression of Nrf2 and HO1 in STZ-induced diabetic mice heart and kidney tissues. Further, AR inhibition increased the HG-induced expression of antioxidant enzymes such as SOD and catalase and activation of AMPK- α 1 in Thp1 cells. Our results thus suggest that pretreatment with AR inhibitor prepares the monocytes against hyperglycemic stress by overexpressing the Nrf2-dependent antioxidative proteins.

  9. Activation of anti-oxidant Nrf2 signaling by enone analogues of curcumin. (United States)

    Deck, Lorraine M; Hunsaker, Lucy A; Vander Jagt, Thomas A; Whalen, Lisa J; Royer, Robert E; Vander Jagt, David L


    Inflammation and oxidative stress are common in many chronic diseases. Targeting signaling pathways that contribute to these conditions may have therapeutic potential. The transcription factor Nrf2 is a major regulator of phase II detoxification and anti-oxidant genes as well as anti-inflammatory and neuroprotective genes. Nrf2 is widespread in the CNS and is recognized as an important regulator of brain inflammation. The natural product curcumin exhibits numerous biological activities including ability to induce the expression of Nrf2-dependent phase II and anti-oxidant enzymes. Curcumin has been examined in a number of clinical studies with limited success, mainly owing to limited bioavailability and rapid metabolism. Enone analogues of curcumin were examined with an Nrf2 reporter assay to identify Nrf2 activators. Analogues were separated into groups with a 7-carbon dienone spacer, as found in curcumin; a 5-carbon enone spacer with and without a ring; and a 3-carbon enone spacer. Activators of Nrf2 were found in all three groups, many of which were more active than curcumin. Dose-response studies demonstrated that a range of substituents on the aromatic rings of these enones influenced not only the sensitivity to activation, reflected in EC 50 values, but also the extent of activation, which suggests that multiple mechanisms are involved in the activation of Nrf2 by these analogues. Copyright © 2017. Published by Elsevier Masson SAS.

  10. Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells. (United States)

    Wan Hasan, Wan Nuraini; Kwak, Mi-Kyoung; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum


    Nuclear factor-erythroid 2 p45 related factor 2 (Nrf2) is a primary transcription factor, protecting cells from oxidative stress by regulating a number of antioxidants and phase II detoxifying enzymes. Dietary components such as sulforaphane in broccoli and quercetin in onions have been shown to be inducers of Nrf2. Piper betle (PB) grows well in tropical climate and the leaves are used in a number of traditional remedies for the treatment of stomach ailments and infections among Asians. The aim of this study was to elucidate the effect of Piper betle (PB) leaves extract in Nrf2 signaling pathway by using 2 types of cells; mouse embryonic fibroblasts (MEFs) derived from wild-type (WT) and Nrf2 knockout (N0) mice. WT and N0 cells were treated with 5 and 10 μg/ml of PB for 10 and 12-h for the determination of nuclear translocation of Nrf2 protein. Luciferase reporter gene activity was performed to evaluate the antioxidant response element (ARE)-induction by PB. Real-time PCR and Western blot were conducted on both WT and N0 cells after PB treatment for the determination of antioxidant enzymes [superoxide dismutase (SOD1) and heme-oxygenase (HO-1)], phase I oxidoreductase enzymes [ quinone oxidoreductase (NQO1)] and phase II detoxifying enzyme [glutathione S-transferase (GST)]. Nuclear translocation of Nrf2 by PB in WT cells was better after 10 h incubation compared to 12 h. Real time PCR and Western blot analysis showed increased expressions of Nrf2, NQO1 and GSTA1 genes with corresponding increases in glutathione, NQO1 and HO-1 proteins in WT cells. Reporter gene ARE was stimulated by PB as shown by ARE/luciferase assay. Interestingly, PB induced SOD1 gene and protein expressions in N0 cells but not in WT cells. The results of this study confirmed that PB activated Nrf2-ARE signaling pathway which subsequently induced some phase I oxidoreductase, phase II detoxifying and antioxidant genes expression via ARE reporter gene involved in the Nrf2 pathway with the

  11. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    Energy Technology Data Exchange (ETDEWEB)

    Han, Jae Yun [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Cho, Seung Sik [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Da Eon [College of Pharmacy, Mokpo National University, Muan, Jeonnam 535-729 (Korea, Republic of); Bang, Joon Seok [Graduate School of Clinical Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Jung, Young Suk [College of Pharmacy, Pusan National University, Busan (Korea, Republic of); Ki, Sung Hwan, E-mail: [College of Pharmacy, Chosun University, Gwangju 501-759 (Korea, Republic of)


    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  12. Nrf2 Activation Protects against Solar-Simulated Ultraviolet Radiation in Mice and Humans. (United States)

    Knatko, Elena V; Ibbotson, Sally H; Zhang, Ying; Higgins, Maureen; Fahey, Jed W; Talalay, Paul; Dawe, Robert S; Ferguson, James; Huang, Jeffrey T-J; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L; Honda, Tadashi; Proby, Charlotte M; Dinkova-Kostova, Albena T


    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative, and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity, and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated are lower than those that arise in their wild-type counterparts. Pharmacologic Nrf2 activation by topical biweekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacologic Nrf2 activation lowers the expression of the pro-inflammatory factors IL6 and IL1β, and COX2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate endpoint for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation. ©2015 American Association for Cancer Research.

  13. MDM2 controls NRF2 antioxidant activity in prevention of diabetic kidney disease. (United States)

    Guo, Weiying; Tian, Dan; Jia, Ye; Huang, Wenlin; Jiang, Mengnan; Wang, Junnan; Sun, Weixia; Wu, Hao


    Oxidative stress and P53 contribute to the pathogenesis of diabetic kidney disease (DKD). Nuclear factor erythroid 2-related factor 2 (NRF2) is a master regulator of cellular antioxidant defense system, is negatively regulated by P53 and prevents DKD. Recent findings revealed an important role of mouse double minute 2 (MDM2) in protection against DKD. However, the mechanism remained unclear. We hypothesized that MDM2 enhances NRF2 antioxidant signaling in DKD given that MDM2 is a key negative regulator of P53. The MDM2 inhibitor nutlin3a elevated renal P53, inhibited NRF2 signaling and induced oxidative stress, inflammation, fibrosis, DKD-like renal pathology and albuminuria in the wild-type (WT) non-diabetic mice. These effects exhibited more prominently in nutlin3a-treated WT diabetic mice. Interestingly, nutlin3a failed to induce greater renal injuries in the Nrf2 knockout (KO) mice under both the diabetic and non-diabetic conditions, indicating that NRF2 predominantly mediates MDM2's action. On the contrary, P53 inhibition by pifithrin-α activated renal NRF2 signaling and the expression of Mdm2, and attenuated DKD in the WT diabetic mice, but not in the Nrf2 KO diabetic mice. In high glucose-treated mouse mesangial cells, P53 gene silencing completely abolished nutlin3a's inhibitory effect on NRF2 signaling. The present study demonstrates for the first time that MDM2 controls renal NRF2 antioxidant activity in DKD via inhibition of P53, providing MDM2 activation and P53 inhibition as novel strategies in the management of DKD. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Activation of Nrf2-mediated oxidative stress response in macrophages by hypochlorous acid

    International Nuclear Information System (INIS)

    Pi Jingbo; Zhang Qiang; Woods, Courtney G.; Wong, Victoria; Collins, Sheila; Andersen, Melvin E.


    Hypochlorous acid (HOCl), a potent oxidant generated when chlorine gas reacts with water, is important in the pathogenesis of many disorders. Transcription factor Nrf2-mediated antioxidant response represents a critical cellular defense mechanism that serves to maintain intracellular redox homeostasis and limit oxidative damage. In the present study, the effect of HOCl on Nrf2 activation was investigated in macrophages, one of the target cells of chlorine gas exposure. Exposure of RAW 264.7 macrophages to HOCl resulted in increased protein levels of Nrf2 in nuclear extractions, as well as a time- and dose-dependent increase in the expression of Nrf2 target genes, including heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 (NQO-1), glutamate cysteine ligase catalytic subunit (GCLC), and glutathione synthetase (GS). Additionally, intracellular glutathione (GSH), which is the prime scavenger for HOCl in cells, decreased within the first hour of HOCl exposure. The decline was followed by a GSH rebound that surpassed the initial basal levels by up to 4-fold. This reversal in GSH levels closely correlated with the gene expression profile of GCLC and GS. To study the mechanisms of Nrf2 activation in response to HOCl exposure, we examined the effects of several antioxidants on Nrf2-mediated response. Pretreatment with cell-permeable catalase, N-acetyl-L-cysteine or GSH-monoethyl ester markedly reduced expression of NQO-1 and GCLC under HOCl challenge conditions, suggesting intracellular ROS-scavenging capacity affects HOCl-induced Nrf2 activation. Importantly, pre-activation of Nrf2 with low concentrations of pro-oxidants protected the cells against HOCl-induced cell damage. Taken together, we provide direct evidence that HOCl activates Nrf2-mediated antioxidant response, which protects cells from oxidative damage

  15. The chalcone compound isosalipurposide (ISPP) exerts a cytoprotective effect against oxidative injury via Nrf2 activation

    International Nuclear Information System (INIS)

    Han, Jae Yun; Cho, Seung Sik; Yang, Ji Hye; Kim, Kyu Min; Jang, Chang Ho; Park, Da Eon; Bang, Joon Seok; Jung, Young Suk; Ki, Sung Hwan


    The chalcone compound isosalipurposide (ISPP) has been successfully isolated from the native Korean plant species Corylopsis coreana Uyeki (Korean winter hazel). However, the therapeutic efficacy of ISPP remains poorly understood. This study investigated whether ISPP has the capacity to activate NF-E2-related factor (Nrf2)-antioxidant response element (ARE) signaling and induce its target gene expression, and to determined the protective role of ISPP against oxidative injury of hepatocytes. In HepG2 cells, nuclear translocation of Nrf2 is augmented by ISPP treatment. Consistently, ISPP increased ARE reporter gene activity and the protein levels of glutamate cysteine ligase (GCL) and hemeoxygenase (HO-1), resulting in increased intracellular glutathione levels. Cells pretreated with ISPP were rescued from tert-butylhydroperoxide-induced reactive oxygen species (ROS) production and glutathione depletion and consequently, apoptotic cell death. Moreover, ISPP ameliorated the mitochondrial dysfunction and apoptosis induced by rotenone which is an inhibitor of complex 1 of the mitochondrial respiratory chain. The specific role of Nrf2 activation by ISPP was demonstrated using an ARE-deletion mutant plasmid and Nrf2-knockout cells. Finally, we observed that extracellular signal-regulated kinase (ERK) and AMP-activated protein kinase (AMPK), but not protein kinase C (PKC)-δ or other mitogen-activated protein kinases (MAPKs), are involved in the activation of Nrf2 by ISPP. Taken together, our results demonstrate that ISPP has a cytoprotective effect against oxidative damage mediated through Nrf2 activation and induction of its target gene expression in hepatocytes. - Highlights: • We investigated the effect of ISPP on Nrf2 activation. • ISPP increased Nrf2 activity and its target gene expression. • ISPP inhibited the mitochondrial dysfunction and ROS production. • Nrf2 activation by ISPP is dependent on ERK1/2 and AMPK phosphorylation. • ISPP may be a promising

  16. Nrf2 mediates redox adaptation in NOX4-overexpressed non-small cell lung cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qipeng; Yao, Bei; Li, Ning; Ma, Lei; Deng, Yanchao; Yang, Yang; Zeng, Cheng; Yang, Zhicheng [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Liu, Bing, E-mail: [Department of Clinical Pharmacy, School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006 (China); Guangdong Key Laboratory of Pharmaceutical Bioactive Substances, Guangdong Pharmaceutical University, Guangzhou 510006 (China)


    The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells. However, the comprehensive mechanisms for NOX4-mediated oxidative resistance of cancer cells remain still undentified. The present study found that NOX4-derived H{sub 2}O{sub 2} enhanced the nuclear factor erythroid 2-related factor 2 (Nrf2) stability via disruption of redox-dependent proteasomal degradation and stimulated its activity through activation of PI3K signaling. Specifically, the results showed that ectopic NOX4 expression did not induce apoptosis of A549 cells; however, inhibition of Nrf2 resulted in obvious apoptotic death of NOX4-overexpressed A549 cells, accompanied by a significant increase in H{sub 2}O{sub 2} level and decrease in GSH content. Besides, inhibition of Nrf2 could suppress cell growth and efficiently reverse the enhancement effect of NOX4 on cell growth. The in vivo data confirmed that inhibition of Nrf2 could interfere apoptosis resistance in NOX4-overexpressed A549 tumors and led to cell growth inhibition. In conclusion, these results reveal that Nrf2 is critically involved in redox adaptation regulation in NOX4-overexpressed NSCLC cells. Therefore, NOX4 and Nrf2 may be promising combination targets against malignant progression of NSCLC. - Highlights: • NOX4-derived H{sub 2}O{sub 2} upregulates Nrf2 expression and activity in NSCLC. • Nrf2 confers apoptosis resistance in NOX4-overexpressed NSCLC cells. • Inhibition of Nrf2 reverses the enhancement effect of NOX4 on cell growth.

  17. Britanin Ameliorates Cerebral Ischemia-Reperfusion Injury by Inducing the Nrf2 Protective Pathway. (United States)

    Wu, Guozhen; Zhu, Lili; Yuan, Xing; Chen, Hao; Xiong, Rui; Zhang, Shoude; Cheng, Hao; Shen, Yunheng; An, Huazhang; Li, Tiejun; Li, Honglin; Zhang, Weidong


    Oxidative stress is considered the major cause of tissue injury after cerebral ischemia. The nuclear factor erythroid 2-related factor 2 (Nrf2) pathway is one of the most important defensive mechanisms against oxidative stresses and has been confirmed as a target for stroke treatment. Thus, we desired to find new Nrf2 activators and test their neuronal protective activity both in vivo and in vitro. The herb-derived compound, Britanin, is a potent inducer of the Nrf2 system. Britanin can induce the expression of protective enzymes and reverse oxygen-glucose deprivation, followed by reperfusion (OGD-R)-induced neuronal injury in primary cortical neurons in vitro. Furthermore, the administration of Britanin significantly ameliorated middle cerebral artery occlusion-reperfusion (MCAO-R) insult in vivo. We report here the crystal structure of the complex of Britanin and the BTB domain of Keap1. Britanin selectively binds to a conserved cysteine residue, cysteine 151, of Keap1 and inhibits Keap1-mediated ubiquitination of Nrf2, leading to induction of the Nrf2 pathway. Britanin is a potent inducer of Nrf2. The complex crystal structure of Britanin and the BTB domain of Keap1 help clarify the mechanism of Nrf2 induction. Britanin was proven to protect primary cortical neurons against OGD-R-induced injury in an Nrf2-dependant way. Additionally, Britanin had excellent cerebroprotective effect in an MCAO-R model. Our results demonstrate that the natural product Britanin with potent Nrf2-activating and neural protective activities both in vitro and in vivo could be developed into a cerebroprotective therapeutic agent. Antioxid. Redox Signal. 27, 754-768.

  18. ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells. (United States)

    Bao, Lingjie; Wu, Jianfa; Dodson, Matthew; Rojo de la Vega, Elisa Montserrat; Ning, Yan; Zhang, Zhenbo; Yao, Ming; Zhang, Donna D; Xu, Congjian; Yi, Xiaofang


    Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer cells, respectively. These two pairs of stable cell lines were then subjected to microarray analysis, where we identified 18 putative NRF2 target genes. Among these genes, ABCF2, a cytosolic member of the ABC superfamily of transporters, has previously been reported to contribute to chemoresistance in clear cell ovarian cancer. A detailed analysis on ABCF2 revealed a functional antioxidant response element (ARE) in its promoter region, establishing ABCF2 as an NRF2 target gene. Next, we investigated the contribution of ABCF2 in NRF2-mediated cisplatin resistance using our stable ovarian cancer cell lines. The NRF2-overexpressing cell line, containing high levels of ABCF2, was more resistant to cisplatin-induced apoptosis compared to its control cell line; whereas the NRF2 knockdown cell line with low levels of ABCF2, was more sensitive to cisplatin treatment than its control cell line. Furthermore, transient overexpression of ABCF2 in the parental cells decreased apoptosis and increased cell viability following cisplatin treatment. Conversely, knockdown of ABCF2 using specific siRNA notably increased apoptosis and decreased cell viability in cisplatin-resistant cells treated with cisplatin. This data indicate that the novel NRF2 target gene, ABCF2, plays a critical role in cisplatin resistance in ovarian cancer, and that targeting ABCF2 may be a new strategy to improve chemotherapeutic efficiency. © 2017 Wiley Periodicals, Inc.

  19. Nrf2 is required to maintain the self-renewal of glioma stem cells

    International Nuclear Information System (INIS)

    Zhu, Jianhong; Wang, Handong; Sun, Qing; Ji, Xiangjun; Zhu, Lin; Cong, Zixiang; Zhou, Yuan; Liu, Huandong; Zhou, Mengliang


    Glioblastomas are deadly cancers that display a functional cellular hierarchy maintained by self-renewing glioma stem cells (GSCs). Self-renewal is a complex biological process necessary for maintaining the glioma stem cells. Nuclear factor rythroid 2-related factor 2(Nrf2) plays a significant role in protecting cells from endogenous and exogenous stresses. Nrf2 is a key nuclear transcription factor that regulates antioxidant response element (ARE)-containing genes. Previous studies have demonstrated the significant role of Nrf2 in the proliferation of glioblastoma, and in their resistance to radioactive therapies. We examined the effect of knocking down Nrf2 in GSCs. Nrf2 expression was down-regulated by shRNA transinfected with lentivirus. Expression levels of Nestin, Nrf2, BMI-1, Sox2 and Cyclin E were assessed by western blotting, quantitative polymerase chain reaction (qPCR) and immunohistochemistry analysis. The capacity for self-renewal in vitro was assessed by genesis of colonies. The capacity for self-renewal in vivo was analyzed by tumor genesis of xenografts in nude mice. Knockdown of Nrf2 inhibited the proliferation of GSCs, and significantly reduced the expression of BMI-1, Sox2 and CyclinE. Knocking down of Nrf2 changed the cell cycle distribution of GSCs by causing an uncharacteristic increase in the proportion of cells in the G2 phase and a decrease in the proportion of cells in the S phase of the cell cycle. Nrf2 is required to maintain the self-renewal of GSCs, and its down-regulation can attenuate the self-renewal of GSCs significantly

  20. Epigenetics Reactivation of Nrf2 in Prostate TRAMP C1 Cells by Curcumin Analogue FN1. (United States)

    Li, Wenji; Pung, Doug; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Yang, Anne Yuqing; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng


    It has previously been shown that curcumin can effectively inhibit prostate cancer proliferation and progression in TRAMP mice, potentially acting through the hypomethylation of the Nrf2 gene promoter and hence activation of the Nrf2 pathway to enhance cell antioxidative defense. FN1 is a synthetic curcumin analogue that shows stronger anticancer activity than curcumin in other reports. We aimed to explore the epigenetic modification of FN1 that restores Nrf2 expression in TRAMP-C1 cells. Stably transfected HepG2-C8 cells were used to investigate the effect of FN1 on the Nrf2- antioxidant response element (ARE) pathway. Real-time quantitative PCR and Western blotting were applied to study the influence of FN1 on endogenous Nrf2 and its downstream genes. Bisulfite genomic sequencing (BGS) and methylated DNA immunoprecipitation (MeDIP) were then performed to examine the methylation profile of the Nrf2 promoter. An anchorage-independent colony-formation analysis was conducted to examine the tumor inhibition activity of FN1. Epigenetic modification enzymes, including DNMTs and HDACs, were investigated by Western blotting. The luciferase reporter assay indicated that FN1 was more potent than curcumin in activating the Nrf2-ARE pathway. FN1 increased the expression of Nrf2 and its downstream detoxifying enzymes. FN1 significantly inhibited the colony formation of TRAMP-C1 cells. BGS and MeDIP assays revealed that FN1 treatment (250 nM for 3 days) reduced the percentage of CpG methylation of the Nrf2 promoter. FN1 also downregulated epigenetic modification enzymes. In conclusion, our results suggest that FN1 is a novel anticancer agent for prostate cancer. In the TRAMP-C1 cell line, FN1 can increase the level of Nrf2 and downstream genes via activating the Nrf2-ARE pathway and inhibit the colony formation potentially through the decreased expression of keap1 coupled with CpG demethylation of the Nrf2 promoter. This CpG demethylation effect may come from decreased

  1. Novel function of transcription factor Nrf2 as an inhibitor of RON tyrosine kinase receptor-mediated cancer cell invasion. (United States)

    Thangasamy, Amalraj; Rogge, Jessica; Krishnegowda, Naveen K; Freeman, James W; Ammanamanchi, Sudhakar


    Recepteur d' origine nantais (RON), a tyrosine kinase receptor, is aberrantly expressed in human tumors and promotes cancer cell invasion. RON receptor activation is also associated with resistance to tamoxifen treatment in breast cancer cells. Nrf2 is a positive regulator of cytoprotective genes. Using chromatin immunoprecipitation (ChIP) and site-directed mutagenesis studies of the RON promoter, we identified Nrf2 as a negative regulator of RON gene expression. High Nrf2 and low RON expression was observed in normal mammary tissue whereas high RON and low or undetectable expression of Nrf2 was observed in breast tumors. The Nrf2 inducer sulforaphane (SFN) as well as ectopic Nrf2 expression or knock-down of the Nrf2 negative regulator keap1, which stabilizes Nrf2, inhibited RON expression and invasion of carcinoma cells. Consequently, our studies identified a novel functional role for Nrf2 as a "repressor" and RON kinase as a molecular target of SFN, which mediates the anti-tumor effects of SFN. These results are not limited to breast cancer cells since the Nrf2 inducer SFN stabilized Nrf2 and inhibited RON expression in carcinoma cells from various tumor types.

  2. The Role of Nrf2: Adipocyte Differentiation, Obesity, and Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Hyun-Ae Seo


    Full Text Available Metabolic diseases, such as type 2 diabetes and obesity, are increasing globally, and much work has been performed to elucidate the regulatory mechanisms of these diseases. Nuclear factor E2-related factor 2 (Nrf2 is a basic leucine zipper transcription factor that serves as a primary cellular defense against the cytotoxic effects of oxidative stress. Recent studies have proposed a close relationship between oxidative stress and energy metabolism-associated disease. The Nrf2 pathway, as a master regulator of cellular defense against oxidative stress, has emerged as a critical target of energy metabolism; however, its effects are controversial. This review examines the current state of research on the role of Nrf2 on energy metabolism, specifically with respect to its participation in adipocyte differentiation, obesity, and insulin resistance, and discusses the possibility of using Nrf2 as a therapeutic target in the clinic.

  3. Naturally Occurring Nrf2 Activators: Potential in Treatment of Liver Injury

    Directory of Open Access Journals (Sweden)

    Ravirajsinh N. Jadeja


    Full Text Available Oxidative stress plays a major role in acute and chronic liver injury. In hepatocytes, oxidative stress frequently triggers antioxidant response by activating nuclear erythroid 2-related factor 2 (Nrf2, a transcription factor, which upregulates various cytoprotective genes. Thus, Nrf2 is considered a potential therapeutic target to halt liver injury. Several studies indicate that activation of Nrf2 signaling pathway ameliorates liver injury. The hepatoprotective potential of naturally occurring compounds has been investigated in various models of liver injuries. In this review, we comprehensively appraise various phytochemicals that have been assessed for their potential to halt acute and chronic liver injury by enhancing the activation of Nrf2 and have the potential for use in humans.

  4. Introducing the "TCDD-inducible AhR-Nrf2 gene battery". (United States)

    Yeager, Ronnie L; Reisman, Scott A; Aleksunes, Lauren M; Klaassen, Curtis D


    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces genes via the transcription factor aryl hydrocarbon receptor (AhR), including Cyp1a1, NAD(P)H:quinone oxidoreductase 1 (Nqo1), UDP-glucuronosyltransferase 1a6 (Ugt1a6), and glutathione S-transferase a1 (Gsta1). These genes are referred to as the "AhR gene battery." However, Nqo1 is also considered a prototypical target gene of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2). In mice, TCDD induction of Nrf2 and Nrf2 target, Nqo1, is dependent on AhR, and thus TCDD induction of drug-processing genes may be routed through an AhR-Nrf2 sequence. There has been speculation that Nrf2 may be involved in the TCDD induction of drug-processing genes; however, the data are not definitive. Therefore, to address whether TCDD induction of Nqo1, Ugts, and Gsts is dependent on Nrf2, we conducted the definitive experiment by administering TCDD (50 mug/kg, ip) to Nrf2-null and wild-type (WT) mice and collecting livers 24 h later to quantify the mRNA of drug-processing genes. TCDD induction of Cyp1a1 and Ugt1a1 was similar in WT and Nrf2-null mice, whereas TCDD induction of Ugt1a5 and 1a9 was blunted in Nrf2-null mice. TCDD induced Nqo1, Ugt1a6, 2b34, 2b35, 2b36, UDP-glucuronic acid-synthesizing gene UDP-glucose dehydrogenase, and Gsta1, m1, m2, m3, m6, p2, t2, and microsomal Gst1 in WT mice but not in Nrf2-null mice. Therefore, the present study demonstrates the novel finding that Nrf2 is required for TCDD induction of classical AhR battery genes Nqo1, Ugt1a6, and Gsta1, as well as most Ugt and Gst isoforms in livers of mice.

  5. Proteomics analysis of dendritic cell activation by contact allergens reveals possible biomarkers regulated by Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Mussotter, Franz, E-mail: [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Tomm, Janina Melanie [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); El Ali, Zeina; Pallardy, Marc; Kerdine-Römer, Saadia [INSERM UMR 996, Univ Paris-Sud, Université Paris-Saclay, Chátenay-Malabry (France); Götz, Mario [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany); Bergen, Martin von [Helmholtz Centre for Environmental Research (UFZ), Department of Molecular Systems Biology, Leipzig (Germany); University of Leipzig, Institute of Biochemistry, Leipzig (Germany); Aalborg University, Department of Chemistry and Bioscience, Aalborg (Denmark); Haase, Andrea; Luch, Andreas [German Federal Institute for Risk Assessment (BfR), Department of Chemical and Product Safety, Berlin (Germany)


    Allergic contact dermatitis is a widespread disease with high clinical relevance affecting approximately 20% of the general population. Typically, contact allergens are low molecular weight electrophilic compounds which can activate the Keap1/Nrf2 pathway. We performed a proteomics study to reveal possible biomarkers for dendritic cell (DC) activation by contact allergens and to further elucidate the role of Keap1/Nrf2 signaling in this process. We used bone marrow derived dendritic cells (BMDCs) of wild-type (nrf2{sup +/+}) and Nrf2 knockout (nrf2{sup −/−}) mice and studied their response against the model contact sensitizers 2,4-dinitrochlorobenzene (DNCB), cinnamaldehyde (CA) and nickel(II) sulfate by 2-dimensional polyacrylamide gel electrophoresis (2D-PAGE) in combination with electrospray ionization tandem mass spectrometry (ESI-MS/MS). Sodium dodecyl sulfate (SDS, 100 μM) served as irritant control. While treatment with nickel(II) sulfate and SDS had only little effects, CA and DNCB led to significant changes in protein expression. We found 18 and 30 protein spots up-regulated in wild-type cells treated with 50 and 100 μM CA, respectively. For 5 and 10 μM DNCB, 32 and 37 spots were up-regulated, respectively. Almost all of these proteins were not differentially expressed in nrf2{sup −/−} BMDCs, indicating an Nrf2-dependent regulation. Among them proteins were detected which are involved in oxidative stress and heat shock responses, as well as in signal transduction or basic cellular pathways. The applied approach allowed us to differentiate between Nrf2-dependent and Nrf2-independent cellular biomarkers differentially regulated upon allergen-induced DC activation. The data presented might contribute to the further development of suitable in vitro testing methods for chemical-mediated sensitization. - Highlights: • Contact allergens induce proteins involved in DC maturation Nrf2-dependently. • Induction of these proteins points to a functional

  6. Clinical significance of Keap1 and Nrf2 in oral squamous cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Cong-Fa Huang

    Full Text Available Oxidative stress has been reported to play an important role in progression and prognostication in various kinds of cancers. However, the role and clinical significance of oxidative stress markers Keap1 and Nrf2 in oral squamous cell carcinoma (OSCC has not been elucidated. This study aimed to investigate the correlation of oxidative stress markers Keap1 and Nrf2 expression and pathological features in OSCC by using tissue microarray. Tissue microarrays containing 17 normal oral mucosa, 7 oral epithelial dysplasia and 43 OSCC specimens were studied by immunohistochemistry. The association among these proteins and pathological features were analyzed. Expression of oxidative stress markers Keap1, Nrf2, and antioxidants PPIA, Prdx6, as well as CD147 was found to increase consecutively from normal oral mucosa to OSCC, and the Keap1, Nrf2, PPIA, Prdx6, CD147 expression in OSCC were significantly higher when compared to normal oral mucosa. Expression of Keap1, Nrf2 in tumors was not found to be significantly associated with T category, lymph node metastases, and pathological grade. Furthermore, we checked the relationship among these oxidative stress markers and found that Keap1 was significantly correlated with Nrf2, Prdx6 and CD147. Significant relationship between Nrf2 and Prdx6 was also detected. Finally, we found patients with overexpression of Keap1 and Nrf2 had not significantly worse overall survival by Kaplan-Meier analysis. These findings suggest that ROS markers are associated with carcinogenesis and progression of OSCC, which may have prognostic value and could be regarded as potential therapeutic targets in OSCC.

  7. NRF2 and P73 polymorphisms in Egyptian women with breast cancer

    African Journals Online (AJOL)

    The aim of the study was to assess the role of Nrf2 promoter and P73 G4C14 to A4T14 polymorphisms in breast cancer and the potential relation to the onset of the disease. Eighty six female patients with breast tumor were included in this study. Nrf2 (rs6721961) and p73 (G4A) genetic polymorphisms in promoter and ...

  8. 4-Hydroxy hexenal derived from docosahexaenoic acid protects endothelial cells via Nrf2 activation.

    Directory of Open Access Journals (Sweden)

    Atsushi Ishikado

    Full Text Available Recent studies have proposed that n-3 polyunsaturated fatty acids (n-3 PUFAs have direct antioxidant and anti-inflammatory effects in vascular tissue, explaining their cardioprotective effects. However, the molecular mechanisms are not yet fully understood. We tested whether n-3 PUFAs showed antioxidant activity through the activation of nuclear factor erythroid 2-related factor 2 (Nrf2, a master transcriptional factor for antioxidant genes. C57BL/6 or Nrf2(-/- mice were fed a fish-oil diet for 3 weeks. Fish-oil diet significantly increased the expression of heme oxygenase-1 (HO-1, and endothelium-dependent vasodilation in the aorta of C57BL/6 mice, but not in the Nrf2(-/- mice. Furthermore, we observed that 4-hydroxy hexenal (4-HHE, an end-product of n-3 PUFA peroxidation, was significantly increased in the aorta of C57BL/6 mice, accompanied by intra-aortic predominant increase in docosahexaenoic acid (DHA rather than that in eicosapentaenoic acid (EPA. Human umbilical vein endothelial cells were incubated with DHA or EPA. We found that DHA, but not EPA, markedly increased intracellular 4-HHE, and nuclear expression and DNA binding of Nrf2. Both DHA and 4-HHE also increased the expressions of Nrf2 target genes including HO-1, and the siRNA of Nrf2 abolished these effects. Furthermore, DHA prevented oxidant-induced cellular damage or reactive oxygen species production, and these effects were disappeared by an HO-1 inhibitor or the siRNA of Nrf2. Thus, we found protective effects of DHA through Nrf2 activation in vascular tissue, accompanied by intra-vascular increases in 4-HHE, which may explain the mechanism of the cardioprotective effects of DHA.

  9. Photoprotection by dietary phenolics against melanogenesis induced by UVA through Nrf2-dependent antioxidant responses (United States)

    Chaiprasongsuk, Anyamanee; Onkoksoong, Tasanee; Pluemsamran, Thanyawan; Limsaengurai, Saowalak; Panich, Uraiwan


    Dietary phenolics may play a protective role in UV-mediated skin pigmentation through their antioxidant and UV-absorbing actions. In this study, we investigated whether genetic silencing of Nrf2, regulating the transcription of antioxidant genes, affected melanogenesis in primary human epidermal melanocytes (HEMn) and B16F10 melanoma cells subjected to UVA (8 J/cm2) exposure. Then, we explored the antimelanogenic actions of phenolics; caffeic acid (CA) and ferulic acid (FA) providing partial UVA protection; quercetin (QU) and rutin (RU) providing strong UVA protection and; avobenzone (AV), an efficient UVA filter, in association with modulation of Nrf2-mediated antioxidant defenses in response to UVA insults in B16F10 cells. Upon oxidative insults, Nrf2 silencing promoted melanogenesis in both HEMn and B16F10 cells irradiated with UVA. Stimulation of melanogenesis by UVA correlated with increased ROS and oxidative DNA damage (8-OHdG), GSH depletion as well as a transient downregulation of Nrf2 nuclear translocation and of Nrf2-ARE signaling in B16F10 cells. All test compounds exerted antimelanogenic effects with respect to their abilities to reverse UVA-mediated oxidative damage as well as downregulation of Nrf2 activity and its target antioxidants (GCLC, GST and NQO1) in B16F10 cells. In conclusion, defective Nrf2 may promote melanogenesis under UVA irradiation through oxidative stress mechanisms. Compounds with antioxidant and/or UVA absorption properties could protect against UVA-induced melanogenesis through indirect regulatory effect on Nrf2-ARE pathway. PMID:26765101

  10. Nrf2 signaling contributes to the neuroprotective effects of urate against 6-OHDA toxicity.

    Directory of Open Access Journals (Sweden)

    Ning Zhang

    Full Text Available BACKGROUND: Mounting evidence shows that urate may become a biomarker of Parkinson's disease (PD diagnosis and prognosis and a neuroprotectant candidate for PD therapy. However, the cellular and molecular mechanisms underlying its neuroprotective actions remain poorly understood. RESULTS: In this study, we showed that urate pretreatment protected dopaminergic cell line (SH-SY5Y and MES23.5 against 6-hydroxydopamine (6-OHDA- and hydrogen peroxide- induced cell damage. Urate was found to be accumulated into SH-SY5Y cells after 30 min treatment. Moreover, urate induced NF-E2-related factor 2 (Nrf2 accumulation by inhibiting its ubiquitinationa and degradation, and also promoted its nuclear translocation; however, it did not modulate Nrf2 mRNA level or Kelch-like ECH-associated protein 1 (Keap1 expression. In addition, urate markedly up-regulated the transcription and protein expression of γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC and heme oxygenase-1 (HO-1, both of which are controlled by Nrf2 activity. Furthermore, Nrf2 knockdown by siRNA abolished the intracellular glutathione augmentation and the protection exerted by urate pretreatment. CONCLUSION: Our findings demonstrated that urate treatment may result in Nrf2-targeted anti-oxidant genes transcription and expression by reducing Nrf2 ubiquitination and degradation and promoting its nuclear translocation, and thus offer neuroprotection on dopaminergic cells against oxidative stresses.

  11. Design, synthesis, and evaluation of curcumin derivatives as Nrf2 activators and cytoprotectors against oxidative death. (United States)

    Tu, Zhi-Shan; Wang, Qi; Sun, Dan-Dan; Dai, Fang; Zhou, Bo


    Activation of nuclear factor erythroid-2-related factor 2 (Nrf2) has been proven to be an effective means to prevent the development of cancer, and natural curcumin stands out as a potent Nrf2 activator and cancer chemopreventive agent. In this study, we synthesized a series of curcumin analogs by introducing the geminal dimethyl substituents on the active methylene group to find more potent Nrf2 activators and cytoprotectors against oxidative death. The geminally dimethylated and catechol-type curcumin analog (compound 3) was identified as a promising lead molecule in terms of its increased stability and cytoprotective activity against the tert-butyl hydroperoxide (t-BHP)-induced death of HepG2 cells. Mechanism studies indicate that its cytoprotective effects are mediated by activating the Nrf2 signaling pathway in the Michael acceptor- and catechol-dependent manners. Additionally, we verified by using copper and iron ion chelators that the two metal ion-mediated oxidations of compound 3 to its corresponding electrophilic o-quinone, contribute significantly to its Nrf2-dependent cytoprotection. This work provides an example of successfully designing natural curcumin-directed Nrf2 activators by a stability-increasing and proelectrophilic strategy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. An overview of the molecular mechanisms and novel roles of Nrf2 in neurodegenerative disorders. (United States)

    Yang, Yang; Jiang, Shuai; Yan, Juanjuan; Li, Yue; Xin, Zhenlong; Lin, Yan; Qu, Yan


    Recently, growing evidence has demonstrated that nuclear factor erythroid 2-related factor 2 (Nrf2) is a pivotal regulator of endogenous defense systems that function via the activation of a set of protective genes, and this is particularly clear in the central nervous system (CNS). Therefore, it is highly useful to summarize the current literature on the molecular mechanisms and role of Nrf2 in the CNS. In this review, we first briefly introduce the molecular features of Nrf2. We then discuss the regulation, cerebral actions, upstream modulators and downstream targets of Nrf2 pathway. Following this background, we expand our discussion to the role of Nrf2 in several major neurodegenerative disorders (NDDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis and amyotrophic lateral sclerosis. Lastly, we discuss some potential future directions. The information reviewed here may be significant in the design of further experimental research and increase the potential of Nrf2 as a therapeutic target in the future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Identification of a Novel and Potent Nrf2 inhibitor as a Radiosensitizer with High Throughput Screening

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Ji Yeon; Park, Sa Rah; Yun, Yeon Sook; Song, Jie Young [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)


    Lung cancer is the leading cause of cancer death in both men and women in the United States. Non-small cell lung cancer (NSCLC) accounts for more than 75% of all lung cancers and radiotherapy (RT) is the general treatment modality for these lung cancer patients. Nuclear factor erythroid-2. related factor 2 (Nrf2) is a redox-sensitive transcription factor that regulates the expression of genes encoding electrophiles and xenobiotic detoxification enzymes and efflux proteins, which confer cytoprotection against oxidative stress and xenobiotics in normal cells. Kelch-like ECH-associated protein (Keap1) sequesters Nrf2 and leads to proteasomal degradation of Nrf2 in non-stressed condition. Keap1 is often found with biallelic mutation in NSCLC cell lines and NSCLC patients, results in constitutive activation of Nrf2 function, and contributes to resistance of chemotherapy (CT) or RT (3, 4). We thus postulated that inhibition of Nrf2 in cancer cells could increase sensitivity to RT. Our primary results show that IM3829, a putative Nrf2 inhibitor, enhances the efficacy of RT and CT in H1299 lung cancer cell.

  14. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response. (United States)

    Seo, Ji Yeon; Pyo, Euisun; An, Jin-Pyo; Kim, Jinwoong; Sung, Sang Hyun; Oh, Won Keun


    Therapeutic approach of Alzheimer's disease (AD) has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata , and focused on the Kelch-like ECH-associated protein 1 (Keap1)/nuclear factor (erythroid-derived 2)-like 2 (Nrf2)-mediated heme oxygenase (HO)-1-inducing effects and the inhibitory activity of amyloid beta (A β ) 42 -induced microglial activation related to Nrf2 and nuclear factor κ B (NF- κ B)-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE) gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular A β 42 in BV-2 cells and decreased the production of interleukin (IL)-6, IL-1 β , prostaglandin (PG)E 2 , and nitric oxide (NO) because of artificial phagocytic A β 42 . It decreased pNF- κ B accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS) and cyclooxygenase II (COX-II) in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits A β 42 -overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  15. Andrographolide Activates Keap1/Nrf2/ARE/HO-1 Pathway in HT22 Cells and Suppresses Microglial Activation by Aβ42 through Nrf2-Related Inflammatory Response

    Directory of Open Access Journals (Sweden)

    Ji Yeon Seo


    Full Text Available Therapeutic approach of Alzheimer’s disease (AD has been gradually diversified. We examined the therapeutic and preventive potential of andrographolide, which is a lactone diterpenoid from Andrographis paniculata, and focused on the Kelch-like ECH-associated protein 1 (Keap1/nuclear factor (erythroid-derived 2-like 2 (Nrf2-mediated heme oxygenase (HO-1-inducing effects and the inhibitory activity of amyloid beta (Aβ42-induced microglial activation related to Nrf2 and nuclear factor κB (NF-κB-mediated inflammatory responses. Andrographolide induced the expression and translocation of Nrf2 from the cytoplasm to the nucleus, thereby activating antioxidant response element (ARE gene transcription and HO-1 expression in murine hippocampal HT22 cells. Andrographolide eliminated intracellular Aβ42 in BV-2 cells and decreased the production of interleukin (IL-6, IL-1β, prostaglandin (PGE2, and nitric oxide (NO because of artificial phagocytic Aβ42. It decreased pNF-κB accumulation in the nucleus and the expression of inducible nitric oxide synthase (i-NOS and cyclooxygenase II (COX-II in the microglial BV-2 cell line. In summary, andrographolide activates Nrf2-mediated HO-1 expression and inhibits Aβ42-overexpressed microglial BV-2 cell activation. These results suggested that andrographolide might have the potential for further examination of the therapeutics of AD.

  16. Role of the Nrf2-heme oxygenase-1 pathway in silver nanoparticle-mediated cytotoxicity

    International Nuclear Information System (INIS)

    Kang, Su Jin; Ryoo, In-geun; Lee, Young Joon; Kwak, Mi-Kyoung


    Silver nanoparticles (nano-Ag) have been widely used in various commercial products including textiles, electronic appliances and biomedical products. However, there remains insufficient information on the potential risk of nano-Ag to human health and environment. In the current study, we have investigated the role of NF-E2-related factor 2 (Nrf2) transcription factor in nano-Ag-induced cytotoxicity. When Nrf2 expression was blocked using interring RNA expression in ovarian carcinoma cell line, nano-Ag treatment showed a substantial decrease in cell viability with concomitant increases in apoptosis and DNA damage compared to the control cells. Target gene analysis revealed that the expression of heme oxygenase-1 (HO-1) was highly elevated by nano-Ag in nonspecific shRNA expressing cells, while Nrf2 knockdown cells (NRF2i) did not increase HO-1 expression. The role of HO-1 in cytoprotection against nano-Ag was reinforced by results using pharmacological inducer of HO-1: cobalt protoporphyrin-mediated HO-1 activation in the NRF2i cells prevented nano-Ag-mediated cell death. Similarly, pharmacological or genetic inhibition of HO-1 in nonspecific control cells exacerbated nano-Ag toxicity. As the upstream signaling mechanism, nano-Ag required the phosphoinositide 3-kinase (PI3K) and p38MAPK signaling cascades for HO-1 induction. The treatment with either PI3K inhibitor or p38MAPK inhibitor suppressed HO-1 induction and intensified nano-Ag-induced cell death. Taken together, these results suggest that Nrf2-dependent HO-1 up-regulation plays a protective role in nano-Ag-induced DNA damage and consequent cell death. In addition, nano-Ag-mediated HO-1 induction is associated with the PI3K and p38MAPK signaling pathways. -- Highlights: ► Role of Nrf2 signaling in silver nanoparticle toxicity. ► Silver nanoparticle toxicity is increased by Nrf2 blockade. ► Nrf2-dependent HO-1 induction protects cells from silver nanoparticle toxicity. ► PI3K and p38MAPK cascades are

  17. Scavenger receptor deficiency leads to more complex atherosclerotic lesions in APOE3Leiden transgenic mice

    NARCIS (Netherlands)

    Winther, M.P.J. de; Gijbels, M.J.J.; Dijk, K.W. van; Gorp, P.J.J. van; Suzuki, H.; Kodama, T.; Frants, R.R.; Havekes, L.M.; Hofker, M.H.


    Apolipoprotein (apo) E3Leiden is a dysfunctional apo E variant associated with familial dysbetalipoproteinemia in humans. Transgenic mice carrying the APOE3Leiden gene develop hyperlipidemia and are highly susceptible to diet-induced atherosclerosis. An early step in atherosclerosis is foam cell

  18. Systemic administration of the apocarotenoid bixin protects skin against solar UV-induced damage through activation of NRF2. (United States)

    Tao, Shasha; Park, Sophia L; Rojo de la Vega, Montserrat; Zhang, Donna D; Wondrak, Georg T


    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photodamage and carcinogenesis, and an urgent need exists for improved molecular photoprotective strategies different from (or synergistic with) photon absorption. Recent studies suggest a photoprotective role of cutaneous gene expression orchestrated by the transcription factor NRF2 (nuclear factor-E2-related factor 2). Here we have explored the molecular mechanism underlying carotenoid-based systemic skin photoprotection in SKH-1 mice and provide genetic evidence that photoprotection achieved by the FDA-approved apocarotenoid and food additive bixin depends on NRF2 activation. Bixin activates NRF2 through the critical Cys-151 sensor residue in KEAP1, orchestrating a broad cytoprotective response in cultured human keratinocytes as revealed by antioxidant gene expression array analysis. Following dose optimization studies for cutaneous NRF2 activation by systemic administration of bixin, feasibility of bixin-based suppression of acute cutaneous photodamage from solar UV exposure was investigated in Nrf2(+/+) versus Nrf2(-/-) SKH-1 mice. Systemic administration of bixin suppressed skin photodamage, attenuating epidermal oxidative DNA damage and inflammatory responses in Nrf2(+/+) but not in Nrf2(-/-) mice, confirming the NRF2-dependence of bixin-based cytoprotection. Taken together, these data demonstrate feasibility of achieving NRF2-dependent cutaneous photoprotection by systemic administration of the apocarotenoid bixin, a natural food additive consumed worldwide. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: [Severance Biomedical Science Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)


    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  20. Inorganic Arsenic Induces NRF2-Regulated Antioxidant Defenses in Both Cerebral Cortex and Hippocampus in Vivo. (United States)

    Zhang, Yang; Duan, Xiaoxu; Li, Jinlong; Zhao, Shuo; Li, Wei; Zhao, Lu; Li, Wei; Nie, Huifang; Sun, Guifang; Li, Bing


    Inorganic arsenic is reported to induce the reactive oxygen species-mediated oxidative stress, which is supposed to be one of the main mechanisms of arsenic-related neurological diseases. Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of antioxidant defense systems, up-regulates the expression of target genes to fight against oxidative damages caused by harmful substances, including metals. In the present study, mice were used as a model to investigate the oxidative stress levels and the expressions of NRF2-regulated antioxidant substances in both cerebral cortex and hippocampus with 5, 10 and 20 mg/kg NaAsO2 exposure intra-gastrically. Our results showed that acute NaAsO2 treatment resulted in decreased total anti-oxidative capacity (T-AOC) and increased maleic dialdehyde production in the nervous system. We also detected rapidly elevation of NRF2 protein levels by enhancement of Nrf2 transcription, especially at 20 mg/kg NaAsO2 exposure group. In the meantime, mRNA and protein levels of Nrf2 encoding antioxidant enzymes heme oxygenase-1 (HO-1), NAD(P)H: quinine oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) were consistently elevated time- and dose-dependently both in the cerebral cortex and hippocampus. Taken together, the presence study demonstrated the activation of NRF2 pathway, an early antioxidant defensive response, in both cerebral cortex and hippocampus upon inorganic arsenic (iAs) exposure in vivo. A better knowledge on the roles of NRF2 pathway in maintaining cellular redox homeostasis would be helpful for the strategies on improvement of neurotoxicity related to this metalloid.

  1. Concerted action of p62 and Nrf2 protects cells from palmitic acid-induced lipotoxicity

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han


    Nonalcoholic fatty liver disease (NAFLD), frequently associated with obesity and diabetes mellitus, is caused by the accumulation of excess fatty acids within liver cells. Palmitic acid (PA), a common saturated fatty acid found in mammals, induces the generation of reactive oxygen species (ROS) and elicits apoptotic cell death, known as lipotoxicity. However, protective mechanisms against PA-induced lipotoxicity have not been elucidated. In this study, we aimed to clarify the role of p62, an adapter protein in the autophagic process, as well as the nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway, in protecting cells from PA-induced lipotoxicity. The Nrf2-Keap1 pathway is essential for the protection of cells from oxidative stress. p62 enhances its binding to Keap1 and leads to Nrf2 activation. Here, we show that PA potentiates Keap1 degradation and thereby activates the transcription of Nrf2 target genes partially through autophagy. Furthermore, this PA-mediated Keap1 degradation depends on p62. Correspondingly, a lack of p62 attenuates the PA-mediated Nrf2 activation and increases the susceptibility of cells to oxidative stress. These results indicate that p62 plays an important role in protecting cells against lipotoxicity through Keap1 degradation-mediated Nrf2 activation. - Highlights: • PA induces Keap1 downregulation and activates Nrf2 target gene transcription. • PA-induced Keap1 degradation is partly mediated by the autophagic pathway. • PA-induced Keap1 degradation depends on p62. • Ablation of p62 exacerbates PA-mediated apoptotic cell death.

  2. Luteolin inhibits the Nrf2 signaling pathway and tumor growth in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Chian, Song; Thapa, Ruby; Chi, Zhexu [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Wang, Xiu Jun [Department of Pharmacology, School of Medicine, Zhejiang University, Hangzhou 310058 (China); Tang, Xiuwen, E-mail: [Department of Biochemistry and Genetics, School of Medicine, Zhejiang University, Hangzhou 310058 (China)


    Highlights: • Luteolin inhibits the Nrf2 pathway in mouse liver and in xenografted tumors. • Luteolin markedly inhibits the growth of xenograft tumors. • Luteolin enhances the anti-cancer effect of cisplatin in mice in vivo. • Luteolin could serve as an adjuvant in the chemotherapy of NSCLC. - Abstract: Nuclear factor erythroid 2-related factor 2 (Nrf2) is over-expressed in many types of tumor, promotes tumor growth, and confers resistance to anticancer therapy. Hence, Nrf2 is regarded as a novel therapeutic target in cancer. Previously, we reported that luteolin is a strong inhibitor of Nrf2 in vitro. Here, we showed that luteolin reduced the constitutive expression of NAD(P)H quinone oxidoreductase 1 in mouse liver in a time- and dose-dependent manner. Further, luteolin inhibited the expression of antioxidant enzymes and glutathione transferases, decreasing the reduced glutathione in the liver of wild-type mice under both constitutive and butylated hydroxyanisole-induced conditions. In contrast, such distinct responses were not detected in Nrf2{sup −/−} mice. In addition, oral administration of luteolin, either alone or combined with intraperitoneal injection of the cytotoxic drug cisplatin, greatly inhibited the growth of xenograft tumors from non-small-cell lung cancer (NSCLC) cell line A549 cells grown subcutaneously in athymic nude mice. Cell proliferation, the expression of Nrf2, and antioxidant enzymes were all reduced in tumor xenograft tissues. Furthermore, luteolin enhanced the anti-cancer effect of cisplatin. Together, our findings demonstrated that luteolin inhibits the Nrf2 pathway in vivo and can serve as an adjuvant in the chemotherapy of NSCLC.

  3. Mena deficiency delays tumor progression and decreases metastasis in polyoma middle-T transgenic mouse mammary tumors. (United States)

    Roussos, Evanthia T; Wang, Yarong; Wyckoff, Jeffrey B; Sellers, Rani S; Wang, Weigang; Li, Jiufeng; Pollard, Jeffrey W; Gertler, Frank B; Condeelis, John S


    The actin binding protein Mammalian enabled (Mena), has been implicated in the metastatic progression of solid tumors in humans. Mena expression level in primary tumors is correlated with metastasis in breast, cervical, colorectal and pancreatic cancers. Cells expressing high Mena levels are part of the tumor microenvironment for metastasis (TMEM), an anatomical structure that is predictive for risk of breast cancer metastasis. Previously we have shown that forced expression of Mena adenocarcinoma cells enhances invasion and metastasis in xenograft mice. Whether Mena is required for tumor progression is still unknown. Here we report the effects of Mena deficiency on tumor progression, metastasis and on normal mammary gland development. To investigate the role of Mena in tumor progression and metastasis, Mena deficient mice were intercrossed with mice carrying a transgene expressing the polyoma middle T oncoprotein, driven by the mouse mammary tumor virus. The progeny were investigated for the effects of Mena deficiency on tumor progression via staging of primary mammary tumors and by evaluation of morbidity. Stages of metastatic progression were investigated using an in vivo invasion assay, intravital multiphoton microscopy, circulating tumor cell burden, and lung metastases. Mammary gland development was studied in whole mount mammary glands of wild type and Mena deficient mice. Mena deficiency decreased morbidity and metastatic dissemination. Loss of Mena increased mammary tumor latency but had no affect on mammary tumor burden or histologic progression to carcinoma. Elimination of Mena also significantly decreased epidermal growth factor (EGF) induced in vivo invasion, in vivo motility, intravasation and metastasis. Non-tumor bearing mice deficient for Mena also showed defects in mammary gland terminal end bud formation and branching. Deficiency of Mena decreases metastasis by slowing tumor progression and reducing tumor cell invasion and intravasation. Mena

  4. Gene expression profiling following NRF2 and KEAP1 siRNA knockdown in human lung fibroblasts identifies CCL11/Eotaxin-1 as a novel NRF2 regulated gene (United States)


    Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798

  5. Sulforaphane Prevents Angiotensin II-Induced Testicular Cell Death via Activation of NRF2

    Directory of Open Access Journals (Sweden)

    Yonggang Wang


    Full Text Available Although angiotensin II (Ang II was reported to facilitate sperm motility and intratesticular sperm transport, recent findings shed light on the efficacy of Ang II in stimulating inflammatory events in testicular peritubular cells, effect of which may play a role in male infertility. It is still unknown whether Ang II can induce testicular apoptotic cell death, which may be a more direct action of Ang II in male infertility. Therefore, the present study aims to determine whether Ang II can induce testicular apoptotic cell death and whether this action can be prevented by sulforaphane (SFN via activating nuclear factor (erythroid-derived 2-like 2 (NRF2, the governor of antioxidant-redox signalling. Eight-week-old male C57BL/6J wild type (WT and Nrf2 gene knockout mice were treated with Ang II, in the presence or absence of SFN. In WT mice, SFN activated testicular NRF2 expression and function, along with a marked attenuation in Ang II-induced testicular oxidative stress, inflammation, endoplasmic reticulum stress, and apoptotic cell death. Deletion of the Nrf2 gene led to a complete abolishment of these efficacies of SFN. The present study indicated that Ang II may result in testicular apoptotic cell death, which can be prevented by SFN via the activation of NRF2.

  6. The Role of the Nrf2/ARE Antioxidant System in Preventing Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Robert E. Smith


    Full Text Available It is widely believed that consuming foods and beverages that have high concentrations of antioxidants can prevent cardiovascular diseases and many types of cancer. As a result, many articles have been published that give the total antioxidant capacities of foods in vitro. However, many antioxidants behave quite differently in vivo. Some of them, such as resveratrol (in red wine and epigallocatechin gallate or EGCG (in green tea can activate the nuclear erythroid-2 like factor-2 (Nrf2 transcription factor. It is a master regulator of endogenous cellular defense mechanisms. Nrf2 controls the expression of many antioxidant and detoxification genes, by binding to antioxidant response elements (AREs that are commonly found in the promoter region of antioxidant (and other genes, and that control expression of those genes. The mechanisms by which Nrf2 relieves oxidative stress and limits cardiac injury as well as the progression to heart failure are described. Also, the ability of statins to induce Nrf2 in the heart, brain, lung, and liver is mentioned. However, there is a negative side of Nrf2. When over-activated, it can cause (not prevent cardiovascular diseases and multi-drug resistance cancer.

  7. Nrf2 and Notch Signaling in Lung Cancer: Near the Crossroad

    Directory of Open Access Journals (Sweden)

    Angelo Sparaneo


    Full Text Available The transcription factor Nrf2 (NF-E2 related factor 2 is a master regulator of the cell antioxidant response associated with tumor growth and resistance to cytotoxic treatments. In particular, Nrf2 induces upregulation of cytoprotective genes by interacting with the closely situated AREs (Antioxidant Response Elements in response to endogenous or exogenous stress stimuli and takes part to several oncogenic signaling pathways. Among these, the crosstalk with Notch pathway has been shown to enhance cytoprotection and maintenance of cellular homeostasis, tissue organization by modulating cell proliferation kinetics, and stem cell self-renewal in several organs. The role of Notch and Nrf2 related pathways in tumorigenesis is highly variable and when they are both abnormally activated they can synergistically cause neoplastic proliferation by promoting cell survival, differentiation, invasion, and metastases. NFE2L2, KEAP1, and NOTCH genes family appear in the list of significantly mutated genes in tumors in both combined and individual sets, supporting the crucial role that the aberrant Nrf2-Notch crosstalk might have in cancerogenesis. In this review, we summarize current knowledge about the alterations of Nrf2 and Notch pathways and their reciprocal transcriptional regulation throughout tumorigenesis and progression of lung tumors, supporting the potentiality of putative biomarkers and therapeutic targets.

  8. Nrf2-peroxiredoxin I axis in polymorphous adenocarcinoma is associated with low matrix metalloproteinase 2 level. (United States)

    Brod, J M; Demasi, Ana Paula Dias; Montalli, V A; Teixeira, L N; Furuse, C; Aguiar, M C; Soares, A B; Sperandio, M; Araujo, V C


    Polymorphous adenocarcinoma (PAC) is a malignant epithelial neoplasm that affects almost exclusively the minor salivary glands, generally described as having a relatively good prognosis. Aberrant nuclear factor erythroid 2 (NF-E2)-related factor (Nrf2) activation in tumor cells has been associated with induction of antioxidant enzymes, such as peroxiredoxin I (Prx I) and increased matrix metalloproteinase (MMP) expression. In this context, the aim of the present study was to evaluate the expression of Nrf2 and correlate it with Prx I and MMP-2 secretion in PAC. Thirty-one cases of PAC from oral biopsies were selected and immunohistochemically analyzed for Nrf2 and Prx I. MMP-2 quantification was performed on primary cell cultures derived from PAC. Oral squamous cell carcinoma (OSCC) cell cultures were used as control. A high immunoexpression of Nrf2 was observed in both the cytoplasm and the nucleus of neoplastic cells from PAC. Nuclear staining for Nrf2 suggested its activation in the majority of the PAC cells, which was confirmed by the high expression of its target gene, Prx I. Quantification of MMP-2 secretion showed lower levels in PAC cell cultures when compared to OSCC cell cultures (p high-grade malignancies, such relationship is not infallible and, in fact, the opposite may occur in low-grade tumors, such as PAC of minor salivary glands.

  9. Lansoprazole halts contrast induced nephropathy through activation of Nrf2 pathway in rats. (United States)

    Khaleel, Sahar A; Alzokaky, Amany A; Raslan, Nahed A; Alwakeel, Asmaa I; Abd El-Aziz, Heba G; Abd-Allah, Adel R


    Contrast-induced nephropathy (CIN) is an important cause of acute kidney injury characterized by significant mortality and morbidity. To date, there is no successful protective regimen for CIN especially in poor kidney function patients. Lansoprazole has been shown to exert antioxidant action through induction of nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway. The aim of the present study is to investigate the potential of lansoprazole to activate Nrf2 pathway in the kidney and consequently to protect against oxidative stress induced by iodinated contrast media. Lansoprazole, at a dose of 100 mg/kg, showed a significant induction of Nrf2 mRNA after 3 h. Administration of contrast media induced significant increase in serum creatinine and blood urea nitrogen, histological deterioration, and reduction in total antioxidant capacity. Moreover, it instigated the defensive Nrf2 gene expression and immunoreactivity. In addition, there were overexpression of HO-1, caspase 3, p53 and IL6 genes and downregulation of Bcl2 gene. Pre-treatment with lansoprazole (100 mg/kg) ameliorated the nephrotoxicity parameters and oxidative stress, improved histological lesions, and hijacked apoptotic and inflammatory markers that were provoked by contrast media. In conclusion, lansoprazole attenuates experimental CIN which might be due to activation of Nrf2 antioxidant defence pathway. These findings highlight the potential benefit of incorporating lansoprazole in the protective regimen against CIN especially for susceptible patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Targeting the Nrf2/Amyloid-Beta Liaison in Alzheimer's Disease: A Rational Approach. (United States)

    Simoni, Elena; Serafini, Melania M; Caporaso, Roberta; Marchetti, Chiara; Racchi, Marco; Minarini, Anna; Bartolini, Manuela; Lanni, Cristina; Rosini, Michela


    Amyloid is a prominent feature of Alzheimer's disease (AD). Yet, a linear linkage between amyloid-β peptide (Aβ) and the disease onset and progression has recently been questioned. In this context, the crucial partnership between Aβ and Nrf2 pathways is acquiring paramount importance, offering prospects for deciphering the Aβ-centered disease network. Here, we report on a new class of antiaggregating agents rationally designed to simultaneously activate transcription-based antioxidant responses, whose lead 1 showed interesting properties in a preliminary investigation. Relying on the requirements of Aβ recognition, we identified the catechol derivative 12. In SH-SY5Y neuroblastoma cells, 12 combined remarkable free radical scavenger properties to the ability to trigger the Nrf2 pathway and induce the Nrf2-dependent defensive gene NQO1 by means of electrophilic activation of the transcriptional response. Moreover, 12 prevented the formation of cytotoxic stable oligomeric intermediates, being significantly more effective, and per se less toxic, than prototype 1. More importantly, as different chemical features were exploited to regulate Nrf2 and Aβ activities, the two pathways could be tuned independently. These findings point to compound 12 and its derivatives as promising tools for investigating the therapeutic potential of the Nrf2/Aβ cellular network, laying foundation for generating new drug leads to confront AD.

  11. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician's Expectation Be Matched by the Reality? (United States)

    Houghton, Christine A.; Fassett, Robert G.; Coombes, Jeff S.


    The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2), comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements. PMID:26881038

  12. Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis.

    Directory of Open Access Journals (Sweden)

    Ning Chen

    Full Text Available To explore the expression level of Nrf2 in adenomyosis and study the mechanism of abnormal expression of Nrf2 in the pathogenesis of adenomyosis.Western blot, immunohistochemistry(IHC and real time PCR were used to measure Nrf2 expression levels in tissue and cell samples. Knockdown and overexpression of Nrf2 were used to investigate the variation of migration ability of endometrial glandular cells as well as the regulatory mechanism.Nrf2 protein levels were significantly higher in the eutopic and ectopic endometrial glands when compared with control cases using IHC and western blot methods. (p< 0.05. However, there was no statistical difference in Nrf2 mRNA expression levels between the adenomyosis and control groups. Using an agonist and Nrf2 siRNA, we regulated the Nrf2 protein levels of primary cultured endometrial glandular cells. With increased expression of Nrf2, cell scratch assay showed that the agonist-treated group migrated significantly faster than the control group, with MMP9 protein level markedly elevated. In contrast, Nrf2 siRNA-treated group migrated slower than the control group, with decreased expression of MMP9 protein. All of the scratching healing spaces and protein levels between the treated and control groups were statistically significant (p< 0.05.Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. Specified reduction of Nrf2 expression could prove to be a new therapeutic target in the clinical treatment of adenomyosis.

  13. Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9

    Directory of Open Access Journals (Sweden)

    So-Jung Kim


    Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.

  14. Stabilization of Nrf2 protein by D3T provides protection against ethanol-induced apoptosis in PC12 cells.

    Directory of Open Access Journals (Sweden)

    Jian Dong


    Full Text Available Previous studies have demonstrated that maternal ethanol exposure induces a moderate increase in Nrf2 protein expression in mouse embryos. Pretreatment with the Nrf2 inducer, 3H-1, 2-dithiole-3-thione (D3T, significantly increases the Nrf2 protein levels and prevents apoptosis in ethanol-exposed embryos. The present study, using PC12 cells, was designed to determine whether increased Nrf2 stability is a mechanism by which D3T enhances Nrf2 activation and subsequent antioxidant protection. Ethanol and D3T treatment resulted in a significant accumulation of Nrf2 protein in PC 12 cells. CHX chase analysis has shown that ethanol treatment delayed the degradation of Nrf2 protein in PC12 cells. A significantly greater decrease in Nrf2 protein degradation was observed in the cells treated with D3T alone or with both ethanol and D3T. In addition, D3T treatment significantly reduced ethanol-induced apoptosis. These results demonstrate that the stabilization of Nrf2 protein by D3T confers protection against ethanol-induced apoptosis.

  15. Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. (United States)

    Chen, Ning; Du, Baoying; Zhou, Hao; Shen, Fengxian; Li, Juan; Xie, Zhenwei


    To explore the expression level of Nrf2 in adenomyosis and study the mechanism of abnormal expression of Nrf2 in the pathogenesis of adenomyosis. Western blot, immunohistochemistry(IHC) and real time PCR were used to measure Nrf2 expression levels in tissue and cell samples. Knockdown and overexpression of Nrf2 were used to investigate the variation of migration ability of endometrial glandular cells as well as the regulatory mechanism. Nrf2 protein levels were significantly higher in the eutopic and ectopic endometrial glands when compared with control cases using IHC and western blot methods. (pendometrial glandular cells. With increased expression of Nrf2, cell scratch assay showed that the agonist-treated group migrated significantly faster than the control group, with MMP9 protein level markedly elevated. In contrast, Nrf2 siRNA-treated group migrated slower than the control group, with decreased expression of MMP9 protein. All of the scratching healing spaces and protein levels between the treated and control groups were statistically significant (p< 0.05). Abnormal expression of Nrf2 may play an important role in the pathogenesis and development of adenomyosis. Specified reduction of Nrf2 expression could prove to be a new therapeutic target in the clinical treatment of adenomyosis.

  16. Marine Natural Product Honaucin A Attenuates Inflammation by Activating the Nrf2-ARE Pathway. (United States)

    Mascuch, Samantha J; Boudreau, Paul D; Carland, Tristan M; Pierce, N Tessa; Olson, Joshua; Hensler, Mary E; Choi, Hyukjae; Campanale, Joseph; Hamdoun, Amro; Nizet, Victor; Gerwick, William H; Gaasterland, Teresa; Gerwick, Lena


    The cyanobacterial marine natural product honaucin A inhibits mammalian innate inflammation in vitro and in vivo. To decipher its mechanism of action, RNA sequencing was used to evaluate differences in gene expression of cultured macrophages following honaucin A treatment. This analysis led to the hypothesis that honaucin A exerts its anti-inflammatory activity through activation of the cytoprotective nuclear erythroid 2-related factor 2 (Nrf2)-antioxidant response element/electrophile response element (ARE/EpRE) signaling pathway. Activation of this pathway by honaucin A in cultured human MCF7 cells was confirmed using an Nrf2 luciferase reporter assay. In vitro alkylation experiments with the natural product and N-acetyl-l-cysteine suggest that honaucin A activates this pathway through covalent interaction with the sulfhydryl residues of the cytosolic repressor protein Keap1. Honaucin A presents a potential therapeutic lead for diseases with an inflammatory component modulated by Nrf2-ARE.

  17. Escin activates AKT-Nrf2 signaling to protect retinal pigment epithelium cells from oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Kaijun [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Jiang, Yiqian [The First People Hospital of Xiaoshan, Hangzhou (China); Wang, Wei; Ma, Jian [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China); Chen, Min, E-mail: [Eye Center, The 2nd Affiliated Hospital, Medical College of Zhejiang University, Hangzhou (China); Zhejiang Provincial Key Lab of Ophthalmology, Hangzhou (China)


    Here we explored the anti-oxidative and cytoprotective potentials of escin, a natural triterpene-saponin, against hydrogen peroxide (H{sub 2}O{sub 2}) in retinal pigment epithelium (RPE) cells. We showed that escin remarkably attenuated H{sub 2}O{sub 2}-induced death and apoptosis of established (ARPE-19) and primary murine RPE cells. Meanwhile, ROS production and lipid peroxidation by H{sub 2}O{sub 2} were remarkably inhibited by escin. Escin treatment in RPE cells resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by transcription of anti-oxidant-responsive element (ARE)-regulated genes, including HO-1, NQO-1 and SRXN-1. Knockdown of Nrf2 through targeted shRNAs/siRNAs alleviated escin-mediated ARE gene transcription, and almost abolished escin-mediated anti-oxidant activity and RPE cytoprotection against H{sub 2}O{sub 2}. Reversely, escin was more potent against H{sub 2}O{sub 2} damages in Nrf2-over-expressed ARPE-19 cells. Further studies showed that escin-induced Nrf2 activation in RPE cells required AKT signaling. AKT inhibitors (LY294002 and perifosine) blocked escin-induced AKT activation, and dramatically inhibited Nrf2 phosphorylation, its cytosol accumulation and nuclear translocation in RPE cells. Escin-induced RPE cytoprotection against H{sub 2}O{sub 2} was also alleviated by the AKT inhibitors. Together, these results demonstrate that escin protects RPE cells from oxidative stress possibly through activating AKT-Nrf2 signaling.

  18. Effects of trigonelline inhibition of the Nrf2 transcription factor in vitro on Echinococcus granulosus. (United States)

    Qin, Wenjuan; Guan, Dongfang; Ma, Rongji; Yang, Rentan; Xing, Guoqiang; Shi, Hongjuan; Tang, Guangyao; Li, Jiajie; Lv, Hailong; Jiang, Yufeng


    The aim of this study was to investigate the impact of trigonelline (TRG) on Echinococcus granulosus, and to explore the inhibition impact of nuclear factor erythroid-2-related factor 2 (Nrf2) signaling pathway on E. granulosus protoscoleces. Echinococcus granulosus protoscoleces were incubated with various concentrations of TRG, and then Nrf2 protein expression and its localization in protoscoleces were detected by western blot analysis and immunofluorescence assay, respectively. Reactive oxygen species (ROS) level in protoscoleces was measured using ROS detection kit. Caspase-3 activity was measured using a caspase-3 activity assay kit, and NAD(P)H quinone oxidoreductase (NQO)-1 and heme oxygenase (HO)-1 activities in protoscoleces were measured by ELISA. The effect of TRG on protoscoleces viability was investigated using 0.1% eosin staining, and ultrastructural alterations in protoscoleces were examined by scanning electron microscopy (SEM). Immunolocalization experiment clearly showed that Nrf2 protein was predominantly present in cells of protoscoleces. TRG treatment reduced NQO-1 and HO-1 activities in protoscoleces, but could increase ROS level at early time. Protoscoleces could not survive when treated with 250 μM TRG for 12 days. SEM results showed that TRG-treated protoscoleces presented damage in the protoscoleces region, including hook deformation, lesions, and digitiform protuberance. Nrf2 protein expression was significantly decreased and caspase-3 activity was clearly increased in protoscoleces treated with TRG for 24 and 48 h, respectively, when compared with that in controls (P granulosus protoscoleces. Nrf2 protein was mainly expressed in the cells and TRG could efficiently inhibit the Nrf2 signaling pathway in E. granulosus. © The Author 2017. Published by Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All rights reserved. For

  19. Dimethylfumarate attenuates restenosis after acute vascular injury by cell-specific and Nrf2-dependent mechanisms

    Directory of Open Access Journals (Sweden)

    Chang Joo Oh


    Full Text Available Excessive proliferation of vascular smooth muscle cells (VSMCs and incomplete re-endothelialization is a major clinical problem limiting the long-term efficacy of percutaneous coronary angioplasty. We tested if dimethylfumarate (DMF, an anti-psoriasis drug, could inhibit abnormal vascular remodeling via NF−E2-related factor 2 (Nrf2-NAD(PH quinone oxidoreductase 1 (NQO1 activity. DMF significantly attenuated neointimal hyperplasia induced by balloon injury in rat carotid arteries via suppression of the G1 to S phase transition resulting from induction of p21 protein in VSMCs. Initially, DMF increased p21 protein stability through an enhancement in Nrf2 activity without an increase in p21 mRNA. Later on, DMF stimulated p21 mRNA expression through a process dependent on p53 activity. However, heme oxygenase-1 (HO-1 or NQO1 activity, well-known target genes induced by Nrf2, were dispensable for the DMF induction of p21 protein and the effect on the VSMC proliferation. Likewise, DMF protected endothelial cells from TNF-α-induced apoptosis and the dysfunction characterized by decreased eNOS expression. With knock-down of Nrf2 or NQO1, DMF failed to prevent TNF-α-induced cell apoptosis and decreased eNOS expression. Also, CD31 expression, an endothelial specific marker, was restored in vivo by DMF. In conclusion, DMF prevented abnormal proliferation in VSMCs by G1 cell cycle arrest via p21 upregulation driven by Nrf2 and p53 activity, and had a beneficial effect on TNF-α-induced apoptosis and dysfunction in endothelial cells through Nrf2–NQO1 activity suggesting that DMF might be a therapeutic drug for patients with vascular disease.

  20. Nrf2 Inhibits Periodontal Ligament Stem Cell Apoptosis under Excessive Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Yanli Liu


    Full Text Available The present study aimed to analyze novel mechanisms underlying Nrf2-mediated anti-apoptosis in periodontal ligament stem cells (PDLSCs in the periodontitis oxidative microenvironment. We created an oxidative stress model with H2O2-treated PDLSCs. We used real-time PCR, Western blotting, TUNEL staining, fluorogenic assay and transfer genetics to confirm the degree of oxidative stress and apoptosis as well as the function of nuclear factor-erythroid 2-related factor 2 (Nrf2. We demonstrated that with upregulated levels of reactive oxygen species (ROS and malondialdehyde (MDA, the effect of oxidative stress was obvious under H2O2 treatment. Oxidative molecules were altered after the H2O2 exposure, whereby the signaling of Nrf2 was activated with an increase in its downstream effectors, heme oxygenase-1 (HO-1, NAD(PH:quinone oxidoreductase 1 (NQO1 and γ-glutamyl cysteine synthetase (γ-GCS. Additionally, the apoptosis levels gradually increased with oxidative stress by the upregulation of caspase-9, caspase-3, Bax and c-Fos levels in addition to the downregulation of Bcl-2. However, there was no alterations in levels of caspase-8. The enhanced antioxidant effect could not mitigate the occurrence of apoptosis. Furthermore, Nrf2 overexpression effectively improved the anti-oxidative levels and increased cell proliferation. At the same time, overexpression effectively restrained TUNEL staining and decreased the molecular levels of caspase-9, caspase-3, Bax and c-Fos, but not that of caspase-8. In contrast, silencing the expression of Nrf2 levels had the opposite effect. Collectively, Nrf2 alleviates PDLSCs via its effects on regulating oxidative stress and anti-intrinsic apoptosis by the activation of oxidative enzymes.

  1. Licochalcone A Upregulates Nrf2 Antioxidant Pathway and Thereby Alleviates Acetaminophen-Induced Hepatotoxicity

    Directory of Open Access Journals (Sweden)

    Hongming Lv


    Full Text Available Acetaminophen (APAP overdose-induced fatal hepatotoxicity is majorly characterized by overwhelmingly increased oxidative stress while enhanced nuclear factor-erythroid 2-related factor 2 (Nrf2 is involved in prevention of hepatotoxicity. Although Licochalcone A (Lico A upregulates Nrf2 signaling pathway against oxidative stress-triggered cell injury, whether it could protect from APAP-induced hepatotoxicity by directly inducing Nrf2 activation is still poorly elucidated. This study aims to explore the protective effect of Lico A against APAP-induced hepatotoxicity and its underlying molecular mechanisms. Our findings indicated that Lico A effectively decreased tert-butyl hydroperoxide (t-BHP- and APAP-stimulated cell apoptosis, mitochondrial dysfunction and reactive oxygen species generation and increased various anti-oxidative enzymes expression, which is largely dependent on upregulating Nrf2 nuclear translocation, reducing the Keap1 protein expression, and strengthening the antioxidant response element promoter activity. Meanwhile, Lico A dramatically protected against APAP-induced acute liver failure by lessening the lethality; alleviating histopathological liver changes; decreasing the alanine transaminase and aspartate aminotransferase levels, malondialdehyde formation, myeloperoxidase level and superoxide dismutase depletion, and increasing the GSH-to-GSSG ratio. Furthermore, Lico A not only significantly modulated apoptosis-related protein by increasing Bcl-2 expression, and decreasing Bax and caspase-3 cleavage expression, but also efficiently alleviated mitochondrial dysfunction by reducing c-jun N-terminal kinase phosphorylation and translocation, inhibiting Bax mitochondrial translocation, apoptosis-inducing factor and cytochrome c release. However, Lico A-inhibited APAP-induced the lethality, histopathological changes, hepatic apoptosis, and mitochondrial dysfunction in WT mice were evidently abrogated in Nrf2-/- mice. These

  2. Synthesis and Nrf2 Activating Ability of Thiourea and Vinyl Sulfoxide Derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Shim, Young Sun; Hwang, Hyun Sook; Nam, Ghilsoo; Choi, Kyung Il [Korea Institute of Science and Technology, Seoul (Korea, Republic of)


    Thiourea and vinyl sulfoxide derivatives were designed based on the structures of sulforaphene and gallic acid, prepared and tested for HO-1 inducing activity as a measure of Nrf2 activation, and inhibitory effect on NO production as a measure of anti-inflammatory activity. Both series of compounds showed moderate activity on HO-1 induction, and no inhibitory effect on NO production. Interestingly the thiourea compound 6d showed better HO-1 induction (71% SFN) than the corresponding isothiocyanate compound 6a (55% SFN). Overall, it seemed that more efficient electrophile is needed to get more effective Nrf2 activator.

  3. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)


    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

  4. Modulation of Nrf2 by Olive Oil and Wine Polyphenols and Neuroprotection

    Directory of Open Access Journals (Sweden)

    Miriam Martínez-Huélamo


    Full Text Available Strong adherence to a Mediterranean diet is associated with improved cognitive function and a lower prevalence of mild cognitive impairment. Olive oil and red wine are rich sources of polyphenols which are responsible in part for the beneficial effects on cognitive functioning. Polyphenols induce endogenous antioxidant defense mechanisms by modulating transcription factors such as the nuclear factor (erythroid-derived 2-like 2 (Nrf2. This review discusses the scientific data supporting the modulating effect of olive oil and red wine polyphenols on Nrf2 expression, and the potential health benefits associated with cognitive functioning.

  5. PCB 126 toxicity is modulated by cross-talk between caveolae and Nrf2 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Petriello, Michael C. [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Han, Sung Gu [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Food Science and Biotechnology of Animal Resources, College of Animal Bioscience and Technology, Konkuk University, Seoul 143-701 (Korea, Republic of); Newsome, Bradley J. [University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Chemistry, College of Arts and Sciences, University of Kentucky, Lexington, KY 40506 (United States); Hennig, Bernhard [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY 40536 (United States); University of Kentucky Superfund Research Center, Lexington, KY 40536 (United States); Department of Animal and Food Sciences, College of Agriculture, Food and Environment, University of Kentucky, KY 40506 (United States)


    Environmental toxicants such as polychlorinated biphenyls (PCBs) have been implicated in the promotion of multiple inflammatory disorders including cardiovascular disease, but information regarding mechanisms of toxicity and cross-talk between relevant cell signaling pathways is lacking. To examine the hypothesis that cross-talk between membrane domains called caveolae and nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathways alters PCB-induced inflammation, caveolin-1 was silenced in vascular endothelial cells, resulting in a decreased PCB-induced inflammatory response. Cav-1 silencing (siRNA treatment) also increased levels of Nrf2-ARE transcriptional binding, resulting in higher mRNA levels of the antioxidant genes glutathione s-transferase and NADPH dehydrogenase quinone-1 in both vehicle and PCB-treated systems. Along with this upregulated antioxidant response, Cav-1 siRNA treated cells exhibited decreased mRNA levels of the Nrf2 inhibitory protein Keap1 in both vehicle and PCB-treated samples. Silencing Cav-1 also decreased protein levels of Nrf2 inhibitory proteins Keap1 and Fyn kinase, especially in PCB-treated cells. Further, endothelial cells from wildtype and Cav-1 −/− mice were isolated and treated with PCB to better elucidate the role of functional caveolae in PCB-induced endothelial inflammation. Cav-1 −/− endothelial cells were protected from PCB-induced cellular dysfunction as evidenced by decreased vascular cell adhesion molecule (VCAM-1) protein induction. Compared to wildtype cells, Cav-1 −/− endothelial cells also allowed for a more effective antioxidant response, as observed by higher levels of the antioxidant genes. These data demonstrate novel cross-talk mechanisms between Cav-1 and Nrf2 and implicate the reduction of Cav-1 as a protective mechanism for PCB-induced cellular dysfunction and inflammation. - Highlights: • Reduction of caveolin-1 protein protects against polychlorinated biphenyl toxicity. • Decreasing

  6. Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

    International Nuclear Information System (INIS)

    Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching


    Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and

  7. Effect of choline on antioxidant defenses and gene expressions of Nrf2 signaling molecule in the spleen and head kidney of juvenile Jian carp (Cyprinus carpio var. Jian). (United States)

    Wu, Pei; Jiang, Wei-Dan; Liu, Yang; Chen, Gang-Fu; Jiang, Jun; Li, Shu-Hong; Feng, Lin; Zhou, Xiao-Qiu


    The present work evaluates the effects of various levels of dietary choline on antioxidant defenses and gene expressions of Nrf2 signaling molecule in spleen and head kidney of juvenile Jian carp (Cyprinus carpio var. Jian). Fish were fed with six different experimental diets containing graded levels of choline at 165 (choline-deficient control), 310, 607, 896, 1167 and 1820 mg kg(-1) diet for 65 days. At the end of the feeding trail, fish were challenged with Aeromonas hydrophila and mortalities were recorded over 17 days. Dietary choline significantly decreased malondialdehyde and protein carbonyl contents in spleen and head kidney. However, anti-superoxide anion and anti-hydroxyl radical activities in spleen and head kidney also decreased. Interestingly, activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione-S-transferase (GST) and glutathione reductase (GR) in spleen, GPx activity in head kidney, and glutathione contents in spleen and head kidney were decreased with increase of dietary choline levels up to a certain point, whereas, activities of SOD, GST and GR in head kidney showed no significantly differences among groups. Similarly, expression levels of CuZnSOD, MnSOD, CAT, GPx1a, GPx1b and GR gene in spleen and head kidney were significantly lower in group with choline level of 607 mg kg(-1) diet than those in the choline-deficient group. The relative gene expressions of Nrf2 in head kidney and Keap1a in spleen and head kidney were decreased with increasing of dietary choline up to a certain point. However, the relative gene expression of Nrf2 in spleen were not significantly affected by dietary choline. In conclusion, dietary choline decreased the oxidant damage and regulated the antioxidant system in immune organs of juvenile Jian carp. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Keap1/Nrf2 pathway in kidney cancer : frequent methylation of KEAP1 gene promoter in clear renal cell carcinoma

    NARCIS (Netherlands)

    Fabrizio, Federico Pio; Costantini, Manuela; Copetti, Massimiliano; la Torre, Annamaria; Sparaneo, Angelo; Fontana, Andrea; Poeta, Luana; Gallucci, Michele; Sentinelli, Steno; Graziano, Paolo; Parente, Paola; Pompeo, Vincenzo; De Salvo, Laura; Simone, Giuseppe; Papalia, Rocco; Picardo, Francesco; Balsamo, Teresa; Flammia, Gerardo Paolo; Trombetta, Domenico; Pantalone, Angela; Kok, Klaas; Paranita, Ferronika; Muscarella, Lucia Anna; Fazio, Vito Michele


    The Keap1/Nrf2 pathway is a master regulator of the cellular redox state through the induction of several antioxidant defence genes implicated in chemotherapeutic drugs resistance of tumor cells. An increasing body of evidence supports a key role for Keap1/Nrf2 pathway in kidney diseases and renal

  9. Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

    International Nuclear Information System (INIS)

    Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai; Hu, Ji-Wei; Ouyang, Pin


    Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB +/− mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species. The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity

  10. Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Hsu-Pin; Hsu, Shu-Yuan [Department of Anatomy, Chang Gung University Medical College, Taiwan (China); Wu, Wen-Ai; Hu, Ji-Wei [Transgenic Mouse Core Laboratory, Chang Gung University, Taiwan (China); Ouyang, Pin, E-mail: [Department of Anatomy, Chang Gung University Medical College, Taiwan (China); Transgenic Mouse Core Laboratory, Chang Gung University, Taiwan (China); Molecular Medicine Research Center, Chang Gung University, Taiwan (China)


    Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species. The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.

  11. Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases

    Directory of Open Access Journals (Sweden)

    Marta Pajares


    Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.

  12. Can Co-Activation of Nrf2 and Neurotrophic Signaling Pathway Slow Alzheimer’s Disease?

    Directory of Open Access Journals (Sweden)

    Kelsey E. Murphy


    Full Text Available Alzheimer’s disease (AD is a multifaceted disease that is hard to treat by single-modal treatment. AD starts with amyloid peptides, mitochondrial dysfunction, and oxidative stress and later is accompanied with chronic endoplasmic reticulum (ER stress and autophagy dysfunction, resulting in more complicated pathogenesis. Currently, few treatments can modify the complicated pathogenic progress of AD. Compared to the treatment with exogenous antioxidants, the activation of global antioxidant defense system via Nrf2 looks more promising in attenuating oxidative stress in AD brains. Accompanying the activation of the Nrf2-mediated antioxidant defense system that reduce the AD-causative factor, oxidative stress, it is also necessary to activate the neurotrophic signaling pathway that replaces damaged organelles and molecules with new ones. Thus, the dual actions to activate both the Nrf2 antioxidant system and neurotrophic signaling pathway are expected to provide a better strategy to modify AD pathogenesis. Here, we review the current understanding of AD pathogenesis and neuronal defense systems and discuss a possible way to co-activate the Nrf2 antioxidant system and neurotrophic signaling pathway with the hope of helping to find a better strategy to slow AD.

  13. Nrf2 Expression Modifies Influenza A Entry and Replication inNasal Epithelial Cells (United States)

    Influenza infection is a major cause of morbidity and mortality worldwide, especially during pandemics outbreaks. Emerging data indicate that phase II antioxidant enzyme pathways could playa role in virus-associated inflammation and immune clearance. While Nrf2-dependent gene exp...

  14. NRF2 Oxidative Stress Induced by Heavy Metals is Cell Type Dependent (United States)

    Exposure to metallic environmental toxicants has been demonstrated to induce a variety of oxidative stress responses in mammalian cells. The transcription factor Nrf2 is activated in response to oxidative stress and coordinates the expression of antioxidant gene products. In this...

  15. Role of Nrf2 and protective effects of Metformin against tobacco smoke-induced cerebrovascular toxicity

    Directory of Open Access Journals (Sweden)

    Shikha Prasad


    Full Text Available Cigarette smoking (CS is associated with vascular endothelial dysfunction in a causative way primarily related to the TS content of reactive oxygen species (ROS, nicotine, and inflammation. TS promotes glucose intolerance and increases the risk of developing type-2 diabetes mellitus (2DM with which it shares other pathogenic traits including the high risk of cerebrovascular and neurological disorders like stroke via ROS generation, inflammation, and blood-brain barrier (BBB impairment. Herein we provide evidence of the role played by nuclear factor erythroid 2-related factor (Nrf2 in CS-induced cerebrobvascular/BBB impairments and how these cerebrovascular harmful effects can be circumvented by the use of metformin (MF; a widely prescribed, firstline anti-diabetic drug treatment. Our data in fact revealed that MF activates counteractive mechanisms primarily associated with the Nrf2 pathway which drastically reduce CS toxicity at the cerebrovascular level. These include the suppression of tight junction (TJ protein downregulation and loss of BBB integrity induced by CS, reduction of inflammation and oxidative stress, renormalization of the expression levels of the major BBB glucose transporter Glut-1 and that of the anticoagulant factor thrombomodulin. Further, we provide additional insights on the controversial interplay between Nrf2 and AMPK. Keywords: Oxidative stress, Cigarette smoke, Metformin, Blood hemostasis, Blood brain barrier, Tight junctions, Nrf2, Glucose transporter

  16. Curcumin Derivative Epigenetically Reactivates Nrf2 Antioxidative Stress Signaling in Mouse Prostate Cancer TRAMP C1 Cells. (United States)

    Li, Wenji; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Wu, Renyi; Gao, Linbo; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng


    The carcinogenesis of prostate cancer (PCa) in TRAMP model is highly correlated with hypermethylation in the promoter region of Nrf2 and the accompanying reduced transcription of Nrf2 and its regulated detoxifying genes. We aimed to investigate the effects of (3E,5E)-3,5-bis-(3,4,5-trimethoxybenzylidene)-tetrahydro-thiopyran-4-one (F10) and (3E,5E)-3,5-bis-(3,4,5-trimethoxy-benzylidene)-tetrahydropyran-4-one (E10), two synthetic curcumin derivatives, on restoring Nrf2 activity in TRAMP C1 cells. HepG2-C8 cells transfected with an antioxidant-response element (ARE)-luciferase vector were treated with F10, E10, curcumin, and sulforaphane (SFN) to compare their effects on Nrf2-ARE pathways. We performed real-time quantitative PCR and Western blotting to investigate the effects of F10 and E10 on Nrf2, correlated phase II detoxification genes. We also measured expression and activity of DNMTand HDAC enzymes. Enrichment of H3K27me3 on the promoter region of Nrf2 was explored with a chromatin immunoprecipitation (ChIP) assay. Methylation of the CpG region in Nrf2 promoter was doubly examined by bisulfite genomic sequencing (BGS) and methylation DNA immunoprecipitation (MeDIP). Compared with curcumin and SFN, F10 is more potent in activating Nrf2-ARE pathways. Both F10 and E10 enhanced level of Nrf2 and the correlated phase II detoxifying genes. BGS and MeDIP assays indicated that F10 but not E10 hypomethylated the Nrf2 promoter. F10 also downregulated the protein level of DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC4, and HDAC7 and the activity of DNMTs and HDACs. F10 but not E10 effectively reduced the accumulation of H3k27me3 on the promoter of Nrf2. F10 and E10 can activate the Nrf2-ARE pathway and increase the level of Nrf2 and correlated phase II detoxification genes. The reactivation effect on Nrf2 by F10 in TRAMP C1 may come from demethylation, decrease of HDACs, and inhibition of H3k27me3 accumulation.

  17. An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes. (United States)

    Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing


    Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral

  18. Dl-3-n-Butylphthalide Inhibits NLRP3 Inflammasome and Mitigates Alzheimer's-Like Pathology via Nrf2-TXNIP-TrX Axis. (United States)

    Wang, Chun-Yan; Xu, Ye; Wang, Xu; Guo, Chuang; Wang, Tao; Wang, Zhan-You


    Oxidative stress and neuroinflammation play important roles in the pathology of Alzheimer's disease (AD). Thioredoxin-interacting protein (TXNIP), an endogenous inhibitor of antioxidant thioredoxin, is suspected to be an important modulator of oxidative stress and inflammation. However, the underlying mechanism involved in the abnormal homeostasis of TXNIP-thioredoxin (TrX) in AD pathogenesis remains unclear. Using the Swedish mutant form of APP (APPswe)/PSEN1dE9 transgenic mouse (APP/PS1) and human-derived neuronal cells as model systems, we disclosed the impairment of the nuclear factor erythroid 2-related factor 2 (Nrf2)-TXNIP-TrX signaling in Alzheimer's-like pathology. We observed that the immune staining of TXNIP was increased in postmortem AD brain. The chronic accumulation of inflammatory mediator in neuronal cells facilitates interactions of TXNIP-nucleotide binding oligomerization domain-like receptor family, pyrin domain containing 3 (NLRP3) and NLRP3-ASC, which increases β-amyloid (Aβ) secretion. The antioxidant Dl-3-n-butylphthalide (Dl-NBP) is commonly used for cerebral ischemia treatment. In our study, we elucidated for new mechanisms by which Dl-NBP enhanced TrX activity, suppressed TXNIP, and ameliorated neuronal apoptosis in the APP/PS1 mouse brains. In human glioblastoma A172 cells and neuroblastoma SH-SY5Y cells, we delineated the Dl-NBP-mediated signaling pathways by which Dl-NBP-dependent upregulation of Nrf2 mediated the reciprocal regulation of reducing proinflammatory cytokine and inhibiting Aβ production in the glial and neuronal cells overexpressing APPswe. Our data provide a novel insight into the molecular mechanism that impairments of Nrf2-TXNIP-TrX system may be involved in the imbalance of cellular redox homeostasis and inflammatory damage in the AD brain. Dl-NBP treatment could suppress TXNIP-NLRP3 interaction and inhibit NLRP3 inflammasome activation via upregulating Nrf2. These findings may provide an instrumental therapeutic

  19. Dendritic cells' death induced by contact sensitizers is controlled by Nrf2 and depends on glutathione levels

    Energy Technology Data Exchange (ETDEWEB)

    El Ali, Zeina [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France); Deloménie, Claudine [IFR141 IPSIT, Univ Paris-Sud, Université Paris-Saclay, Châtenay-Malabry (France); Botton, Jérémie [INSERM, UMR1153 Epidemiology and Biostatistics Sorbonne Paris Cité Center (CRESS), Team (France); Pallardy, Marc [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France); Kerdine-Römer, Saadia, E-mail: [UMR996 - Inflammation, Chemokines and Immunopathology-, INSERM, Univ Paris-Sud, Université Paris-Saclay, 92296 Châtenay-Malabry (France)


    Dendritic cells (DC) are known to play a major role during contact allergy induced by contact sensitizers (CS). Our previous studies showed that Nrf2 was induced in DC and controlled allergic skin inflammation in mice in response to chemicals. In this work, we raised the question of the role of Nrf2 in response to a stress provoked by chemical sensitizers in DC. We used two well-described chemical sensitizers, dinitrochlorobenzene (DNCB) and cinnamaldehyde (CinA), known to have different chemical reactivity and mechanism of action. First, we performed a RT-qPCR array showing that CinA was a higher inducer of immune and detoxification genes compared to DNCB. Interestingly, in the absence of Nrf2, gene expression was dramatically affected in response to DNCB but was slightly affected in response to CinA. These observations prompted us to study DC's cell death in response to both chemicals. DNCB and CinA increased apoptotic cells and decreased living cells in the absence of Nrf2. The characterization of DC apoptosis induced by both CS involved the mitochondrial-dependent caspase pathway and was regulated via Nrf2 in response to both chemicals. Oxidative stress induced by DNCB, and leading to cell death, was regulated by Nrf2. Unlike CinA, DNCB treatment provoked a significant reduction of intracellular GSH levels and up-regulated bcl-2 gene expression, under the control of Nrf2. This work underlies that chemical reactivity may control Nrf2-dependent gene expression leading to different cytoprotective mechanisms in DC. - Highlights: • Nrf2 controls cell death induced by contact sensitizers in dendritic cells. • DNCB reduced GSH levels and up-regulated bcl-2 gene expression unlike CinA. • Chemical reactivity controls Nrf2-dependent genes having protective effect in DC.

  20. Identification of an unintended consequence of Nrf2-directed cytoprotection against a key tobacco carcinogen plus a counteracting chemopreventive intervention (United States)

    Paonessa, Joseph D.; Ding, Yi; Randall, Kristen L.; Munday, Rex; Argoti, Dayana; Vouros, Paul; Zhang, Yuesheng


    Nrf2 is a major cytoprotective gene and is a key chemopreventive target against cancer and other diseases. Here we show that Nrf2 faces a dilemma in defense against 4-aminobiphenyl (ABP), a major human bladder carcinogen from tobacco smoke and other environmental sources. While Nrf2 protected mouse liver against ABP (which is metabolically activated in liver), the bladder level of N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP), the predominant ABP-DNA adduct formed in bladder cells and tissues, was markedly higher in Nrf2+/+ mice than in Nrf2−/− mice after ABP exposure. Notably, Nrf2 protected bladder cells against ABP in vitro. Mechanistic investigations showed that the dichotomous effects of Nrf2 could be explained at least partly by upregulation of UDP-glucuronosyltransferase (UGT). Nrf2 promoted conjugation of ABP with glucuronic acid in the liver, increasing urinary excretion of the conjugate. While glucuronidation of ABP and its metabolites is a detoxification process, these conjugates, which are excreted in urine, are known to be unstable in acidic urine, leading to delivery of the parent compounds to bladder. Hence, while higher liver UGT activity may protect the liver against ABP it increases bladder exposure to ABP. These findings raise concerns of potential bladder toxicity when Nrf2-activating chemopreventive agents are used in humans exposed to ABP, especially in smokers. We further demonstrate that 5,6-dihydrocyclopenta[c][1,2]-dithiole-3(4H)-thione (CPDT) significantly inhibits dG-C8-ABP formation in bladder cells and tissues, but does not appear to significantly modulate ABP-catalyzing UGT in liver. Thus, CPDT exemplifies a counteracting solution to the dilemma posed by Nrf2. PMID:21487034

  1. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    International Nuclear Information System (INIS)

    Park, Jeong Su; Kang, Dong Hoon; Lee, Da Hyun; Bae, Soo Han


    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death

  2. Curcumin ameliorates dopaminergic neuronal oxidative damage via activation of the Akt/Nrf2 pathway. (United States)

    Cui, Qunli; Li, Xin; Zhu, Hongcan


    Parkinson's disease (PD) is an age-related complex neurodegenerative disease that affects ≤ 80% of dopaminergic neurons in the substantia nigra pars compacta (SNpc). It has previously been suggested that mitochondrial dysfunction, oxidative stress and oxidative damage underlie the pathogenesis of PD. Curcumin, which is a major active polyphenol component extracted from the rhizomes of Curcuma longa (Zingiberaceae), has been reported to exert neuroprotective effects on an experimental model of PD. The present study conducted a series of in vivo experiments, in order to investigate the effects of curcumin on behavioral deficits, oxidative damage and related mechanisms. The results demonstrated that curcumin was able to significantly alleviate motor dysfunction and increase suppressed tyrosine hydroxylase (TH) activity in the SNpc of rotenone (ROT)-injured rats. Biochemical measurements indicated that rats pretreated with curcumin exhibited increased glutathione (GSH) levels, and reduced reactive oxygen species activity and malondialdehyde content. Mechanistic studies demonstrated that curcumin significantly restored the expression levels of heme oxygenase-1 and quinone oxidoreductase 1, thus ameliorating ROT-induced damage in vivo, via the phosphorylation of Akt and nuclear factor erythroid 2-related factor 2 (Nrf2). Further studies indicated that the Akt/Nrf2 signaling pathway was associated with the protective role of curcumin in ROT-treated rats. Inhibiting the Akt/Nrf2 pathway using a lentiviral vector containing Nrf2-specific short hairpin RNA, or the phosphoinositide 3-kinase inhibitor LY294002, markedly reduced the expression levels of TH and GSH, ultimately attenuating the neuroprotective effects of curcumin against oxidative damage. These results indicated that curcumin was able to significantly ameliorate ROT-induced dopaminergic neuronal oxidative damage in the SNpc of rats via activation of the Akt/Nrf2 signaling pathway.

  3. Epalrestat increases glutathione, thioredoxin, and heme oxygenase-1 by stimulating Nrf2 pathway in endothelial cells

    Directory of Open Access Journals (Sweden)

    Kaori Yama


    Full Text Available Epalrestat (EPS is the only aldose reductase inhibitor that is currently available for the treatment of diabetic neuropathy. Recently, we found that EPS at near-plasma concentration increases the intracellular levels of glutathione (GSH in rat Schwann cells. GSH plays a crucial role in protecting endothelial cells from oxidative stress, thereby preventing vascular diseases. Here we show that EPS increases GSH levels in not only Schwann cells but also endothelial cells. Treatment of bovine aortic endothelial cells (BAECs, an in vitro model of the vascular endothelium, with EPS caused a dramatic increase in intracellular GSH levels. This was concomitant with the up-regulation of glutamate cysteine ligase, an enzyme catalyzing the first and rate-limiting step in de novo GSH synthesis. Moreover, EPS stimulated the expression of thioredoxin and heme oxygenase-1, which have important redox regulatory functions in endothelial cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a key transcription factor that regulates the expression of antioxidant genes. EPS increased nuclear Nrf2 levels in BAECs. Nrf2 knockdown by siRNA suppressed the EPS-induced glutamate cysteine ligase, thioredoxin-1, and heme oxygenase-1 expression. Interestingly, LY294002, an inhibitor of phosphatidylinositol 3-kinase, abolished the EPS-stimulated GSH synthesis, suggesting that the kinase is associated with Nrf2 activation induced by EPS. Furthermore, EPS reduced the cytotoxicity induced by H2O2 and tert-butylhydroperoxide, indicating that EPS plays a role in protecting cells from oxidative stress. Taken together, the results provide evidence that EPS exerts new beneficial effects on endothelial cells by increasing GSH, thioredoxin, and heme oxygenase-1 levels through the activation of Nrf2. We suggest that EPS has the potential to prevent several vascular diseases caused by oxidative stress.

  4. Mitigation of radiation induced hematopoietic injury via regulation of Nrf-2 and increasing hematopoietic stem cells

    International Nuclear Information System (INIS)

    Patwardhan, R.S.; Sharma, Deepak; Checker, Rahul; Santosh Kumar, S.


    Therapeutic doses of ionizing radiation (IR) that can be delivered to tumors are restricted due to radiation induced damage to surrounding normal tissues thereby limiting the effectiveness of radiotherapy. Strategies to develop agents that selectively protect normal cells yielded limited success in the past. There is pressing need to develop safe, syndrome specific and effective radiation countermeasures to prevent or mitigate the harmful consequences of radiation exposure. Survival of bone marrow stem cells (HSCs) play a key role in protecting against IR induced hematopoietic injury. Many studies have shown manipulation of HSC frequency and/or survival as principal mechanism of radioprotection. It is known that, Nrf-2 plays crucial role in HSC survival and maintenance under oxidative stress conditions. In the present study, we have investigated the radioprotective ability of a flavonoid baicalein (5,6,7-trihydroxyflavone), extracted from the root of Scutellaria baicalensis Georgi, a medicinal plant traditionally used in Oriental medicine. There are numerous reports showing anti-inflammatory, anti-apoptotic, anti-oxidant, anti-cancer, anti-microbial, anti-mutagenic and neuroprotective properties of baicalein. Based on these reports, we have investigated the ability of baicalein to protect against radiation induced hematopoietic injury. Baicalein administration to mice protected against WBI induced mortality. Interestingly, the stem cell frequency increased in bone marrow cells obtained from baicalein administered mice as compared to vehicle treated mice. Baicalein treatment led to increased phospho-Nrf-2 levels in lineage negative BM-MNC. Administration of mice with Nrf-2 inhibitor prior to baicalein treatment led to significant abrogation of radioprotective ability of baicalein. This result suggests that, Nrf-2 may be playing a key role in baicalein mediated radioprotection. Here, we have shown that baicalein administration augments stem cell frequency, induces

  5. Fenofibrate activates Nrf2 through p62-dependent Keap1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)


    Peroxisome proliferator-activated receptor α (PPARα) activates the β-oxidation of fatty acids in the liver. Fenofibrate is a potent agonist of PPARα and is used in the treatment of hyperlipidemia. Fenofibrate treatment often induces the production of intracellular reactive oxygen species (ROS), leading to cell death. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is an essential component of the defense mechanism against oxidative stress. However, the molecular mechanism underlying the regulation of the Nrf2-Keap1 pathway in fenofibrate-induced cell death is not known. In this study, we demonstrated that fenofibrate induces Keap1 degradation and Nrf2 activation. This fenofibrate-mediated Keap1 degradation is partly dependent on autophagy. Furthermore, fenofibrate-induced Keap1 degradation followed by Nrf2 activation is mainly mediated by p62, which functions as an adaptor protein in the autophagic pathway. Consistent with these findings, ablation of p62 increased fenofibrate-mediated apoptotic cell death associated with ROS accumulation. These results strongly suggest that p62 plays a crucial role in preventing fenofibrate-induced cell death. - Highlights: • Fenofibrate induces cell death by increasing ROS production. • The underlying defense mechanism against this effect is unknown. • Fenofibrate induces autophagy-dependent Keap1 degradation and Nrf2 activation. • This process is p62-dependent; lack of p62 enhanced fenofibrate-mediated apoptosis. • p62 plays a crucial role in preventing fenofibrate-induced cell death.

  6. Sinomenine attenuates renal fibrosis through Nrf2-mediated inhibition of oxidative stress and TGFβ signaling

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Tian [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Yin, Shasha; Yang, Jun; Zhang, Qin; Liu, Yangyang [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China); Huang, Fengjie, E-mail: [School of Life Science & Technology, China Pharmaceutical University, Nanjing 210009 (China); Cao, Wangsen, E-mail: [Jiangsu Key Laboratory of Molecular Medicine, Nanjing University School of Medicine, Nanjing 210093 (China)


    Renal fibrosis is the common feature of chronic kidney disease and mainly mediated by TGFβ-associated pro-fibrogenic signaling, which causes excessive extracellular matrix accumulation and successive loss of kidney functions. Sinomenine (SIN), an alkaloid derived from medicinal herb extensively used in treatment of rheumatoid arthritis and various inflammatory disorders, displays renal protective properties in experimental animals; however its pharmacological potency against renal fibrosis is not explored. In this study we report that SIN possesses strong anti-renal fibrosis functions in kidney cell and in mouse fibrotic kidney. SIN beneficially modulated the pro-fibrogenic protein expression in TGFβ-treated kidney cells and attenuated the renal fibrotic pathogenesis incurred by unilateral ureteral obstruction (UUO), which correlated with its activation of Nrf2 signaling - the key defender against oxidative stress with anti-fibrotic potentials. Further investigation on its regulation of Nrf2 downstream events revealed that SIN significantly balanced oxidative stress via improving the expression and activity of anti-oxidant and detoxifying enzymes, and interrupted the pro-fibrogenic signaling of TGFβ/Smad and Wnt/β-catenin. Even more impressively SIN achieved its anti-fibrotic activities in an Nrf2-dependent manner, suggesting that SIN regulation of Nrf2-associated anti-fibrotic activities constitutes a critical component of SIN's renoprotective functions. Collectively our studies have demonstrated a novel anti-fibrotic property of SIN and its upstream events and provided a molecular basis for SIN's potential applications in treatment of renal fibrosis-associated kidney disorders. - Highlights: • Sinomenine has strong potency of inhibiting renal fibrosis in UUO mouse kidney. • Sinomenine attenuates the expression of profibrogenic proteins. • Sinomenine balances renal fibrosis-associated oxidative stress. • Sinomenine mitigates profibrogenic

  7. Therapeutic advantage of pro-electrophilic drugs to activate the Nrf2/ARE pathway in Alzheimer's disease models. (United States)

    Lipton, Stuart A; Rezaie, Tayebeh; Nutter, Anthony; Lopez, Kevin M; Parker, James; Kosaka, Kunio; Satoh, Takumi; McKercher, Scott R; Masliah, Eliezer; Nakanishi, Nobuki


    Alzheimer's disease (AD) is characterized by synaptic and neuronal loss, which occurs at least partially through oxidative stress induced by oligomeric amyloid-β (Aβ)-peptide. Carnosic acid (CA), a chemical found in rosemary and sage, is a pro-electrophilic compound that is converted to its active form by oxidative stress. The active form stimulates the Keap1/Nrf2 transcriptional pathway and thus production of phase 2 antioxidant enzymes. We used both in vitro and in vivo models. For in vitro studies, we evaluated protective effects of CA on primary neurons exposed to oligomeric Aβ. For in vivo studies, we used two transgenic mouse models of AD, human amyloid precursor protein (hAPP)-J20 mice and triple transgenic (3xTg AD) mice. We treated these mice trans-nasally with CA twice weekly for 3 months. Subsequently, we performed neurobehavioral tests and quantitative immunohistochemistry to assess effects on AD-related phenotypes, including learning and memory, and synaptic damage. In vitro, CA reduced dendritic spine loss in rat neurons exposed to oligomeric Aβ. In vivo, CA treatment of hAPP-J20 mice improved learning and memory in the Morris water maze test. Histologically, CA increased dendritic and synaptic markers, and decreased astrogliosis, Aβ plaque number, and phospho-tau staining in the hippocampus. We conclude that CA exhibits therapeutic benefits in rodent AD models and since the FDA has placed CA on the 'generally regarded as safe' (GRAS) list, thus obviating the need for safety studies, human clinical trials will be greatly expedited.

  8. Chronic Endurance Exercise Impairs Cardiac Structure and Function in Middle-Aged Mice with Impaired Nrf2 Signaling

    Directory of Open Access Journals (Sweden)

    Gobinath Shanmugam


    Full Text Available Nuclear factor erythroid 2 related factor 2 (Nrf2 signaling maintains the redox homeostasis and its activation is shown to suppress cardiac maladaptation. Earlier we reported that acute endurance exercise (2 days evoked antioxidant cytoprotection in young WT animals but not in aged WT animals. However, the effect of repeated endurance exercise during biologic aging (WT characterized by an inherent deterioration in Nrf2 signaling and pathological aging (pronounced oxidative susceptibility—Nrf2 absence in the myocardium remains elusive. Thus, the purpose of our study was to determine the effect of chronic endurance exercise-induced cardiac adaptation in aged mice with and without Nrf2. Age-matched WT and Nrf2-null mice (Nrf2−/− (>22 months were subjected to 6 weeks chronic endurance exercise (25 meter/min, 12% grade. The myocardial redox status was assessed by expression of antioxidant defense genes and proteins along with immunochemical detection of DMPO-radical adduct, GSH-NEM, and total ubiquitination. Cardiac functions were assessed by echocardiography and electrocardiogram. At sedentary state, loss of Nrf2 resulted in significant downregulation of antioxidant gene expression (Nqo1, Ho1, Gclm, Cat, and Gst-α with decreased GSH-NEM immuno-fluorescence signals. While Nrf2−/− mice subjected to CEE showed an either similar or more pronounced reduction in the transcript levels of Gclc, Nqo1, Gsr, and Gst-α in relation to WT littermates. In addition, the hearts of Nrf2−/− on CEE showed a substantial reduction in specific antioxidant proteins, G6PD and CAT along with decreased GSH, a pronounced increase in DMPO-adduct and the total ubiquitination levels. Further, CEE resulted in a significant upregulation of hypertrophy genes (Anf, Bnf, and β-Mhc (p < 0.05 in the Nrf2−/− hearts in relation to WT mice. Moreover, the aged Nrf2−/− mice exhibited a higher degree of cardiac remodeling in association with a significant decrease in

  9. Nrf2 protects against 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced oxidative injury and steatohepatitis

    International Nuclear Information System (INIS)

    Lu Hong; Cui Wei; Klaassen, Curtis D.


    Previous studies demonstrate that Nrf2, a master regulator of antioxidative responses, is essential in mediating induction of many antioxidative enzymes by acute activation of the AhR. However, the role of Nrf2 in protecting against oxidative stress and DNA damage induced by sustained activation of the AhR remains unknown and was investigated herein. Tissue and blood samples were collected from wild-type (WT) and Nrf2-null mice 21 days after administration of a low-toxic dose (10 μg/kg ip) of TCDD. Only Nrf2-null mice lost body weight after TCDD treatment; however, blood levels of ALT were not markedly changed in either genotype, indicating a lack of extensive necrosis. Compared to livers of TCDD-treated WT mice, livers of TCDD-treated Nrf2-null mice had: 1) degenerated hepatocytes, lobular inflammation, marked fat accumulation, and higher mRNA expression of inflammatory and fibrotic genes; 2) depletion of glutathione, elevation in lipid peroxidation and marker of DNA damage; 3) attenuated induction of phase-II enzymes Nqo1, Gsta1/2, and Ugt2b35 mRNAs, but higher induction of cytoprotective Ho-1, Prdx1, Trxr1, Gclc, and Epxh1 mRNAs; 4) higher mRNA expression of Fgf21 and triglyceride-synthesis genes, but down-regulation of bile-acid-synthesis genes and cholesterol-efflux transporters; and 5) trend of induction/activation of c-jun and NF-kB. Additionally, TCDD-treated Nrf2-null mice had impaired adipogenesis in white adipose tissue. In conclusion, Nrf2 protects livers of mice against oxidative stress, DNA damage, and steatohepatitis induced by TCDD-mediated sustained activation of the AhR. The aggravated hepatosteatosis in TCDD-treated Nrf2-null mice is due to increased lipogenesis in liver and impaired lipogenesis in white adipose tissue. - Highlights: → TCDD causes hepatosteatosis and induction of Nrf2-target genes in wild-type mice. → TCDD causes weight loss, oxidative injury, and steatohepatitis in Nrf2-null mice. → Livers of TCDD-treated Nrf2-null mice

  10. Estrogen increases Nrf2 activity through activation of the PI3K pathway in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Juanjuan, E-mail: [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Williams, Devin [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Walter, Grant A. [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States); Thompson, Winston E. [Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA 30310 (United States); Sidell, Neil [Department of Gynecology and Obstetrics, Emory University School of Medicine, 101 Woodruff Circle, Suite 4211 WMB, Atlanta, GA 30322 (United States)


    The actions of the transcription factor Nuclear factor erythroid 2-related factor (Nrf2) in breast cancer have been shown to include both pro-oncogenic and anti-oncogenic activities which is influenced, at least in part, by the hormonal environment. However, direct regulation of Nrf2 by steroid hormones (estrogen and progesterone) has received only scant attention. Nrf2 is known to be regulated by its cytosolic binding protein, Kelch-like ECH-associated protein 1 (Keap1), and by a Keap1-independent mechanism involving a series of phosphorylation steps mediated by phosphatidylinositol 3-kinase (PI3K) and glycogen synthase kinase 3 beta (GSK3β). Here, we report that estrogen (E2) increases Nrf2 activity in MCF7 breast cancer cells through activation of the PI3K/GSK3β pathway. Utilizing antioxidant response element (ARE)-containing luciferase reporter constructs as read-outs for Nrf2 activity, our data indicated that E2 increased ARE activity >14-fold and enhanced the action of the Nrf2 activators, tertiary butylhydroquinone (tBHQ) and sulforaphane (Sul) 4 to 9 fold compared with cells treated with tBHQ or Sul as single agents. This activity was shown to be an estrogen receptor-mediated phenomenon and was antagonized by progesterone. In addition to its action on the reporter constructs, mRNA and protein levels of heme oxygenase 1, an endogenous target gene of Nrf2, was markedly upregulated by E2 both alone and in combination with tBHQ. Importantly, E2-induced Nrf2 activation was completely suppressed by the PI3K inhibitors LY294002 and Wortmannin while the GSK3β inhibitor CT99021 upregulated Nrf2 activity. Confirmation that E2 was, at least partly, acting through the PI3K/GSK3β pathway was indicated by our finding that E2 increased the phosphorylation status of both GSK3β and Akt, a well-characterized downstream target of PI3K. Together, these results demonstrate a novel mechanism by which E2 can regulate Nrf2 activity in estrogen receptor-positive breast cancer

  11. Alteration of Nrf2 and Glutamate Cysteine Ligase expression contribute to lesions growth and fibrogenesis in ectopic endometriosis. (United States)

    Marcellin, L; Santulli, P; Chouzenoux, S; Cerles, O; Nicco, C; Dousset, B; Pallardy, M; Kerdine-Römer, S; Just, P A; Chapron, C; Batteux, F


    The redox-sensitive nuclear factor erythroid-derived 2-like 2 (NRF2) controls endogenous antioxidant enzymes' transcription and protects against oxidative damage which is triggered by inflammation and known to favor progression of endometriosis. Glutamate Cysteine Ligase (GCL), a target gene of NRF2, is the first enzyme in the synthesis cascade of glutathione, an important endogenous antioxidant. Sixty-one patients, with thorough surgical examination of the abdominopelvic cavity, were recruited for the study: 31 with histologically-proven endometriosis and 30 disease-free women taken as controls. Expressions of NRF2 and GCL were investigated by quantitative RT-PCR and immunohistochemistry in eutopic and ectopic endometria from endometriosis-affected women and in endometrium of disease-free women. Ex vivo stromal and epithelial cells were extracted and purified from endometrial and endometriotic biopsies to explore expression of NRF2 and GCL in both stromal and epithelial compartments by western blot. Finally, in order to strengthen the role of NRF2 in endometriosis pathogenesis, we evaluated the drop of NRF2 expression in a mouse model of endometriosis using NRF2 knockout (NRF2 -/- ) mice. The mRNA levels of NRF2 and GCL were significantly lower in ectopic endometria of endometriosis-affected women compared to eutopic endometria of disease-free women. The immunohistochemical analysis confirmed the decreased expression of both NRF2 and GCL in ectopic endometriotic tissues compared to eutopic endometria of endometriosis-affected and disease-free women. Immunoblotting revealed a significant decreased of NRF2 and GCL expression in epithelial and stroma cells from ectopic lesions of endometriosis-affected women compared to eutopic endometria from controls. Using a murine model of endometriosis, NRF2 -/- implants were more fibrotic compared to wild-type with an increased weight and volume. These findings indicate that expression of the transcription factor NRF2 and its

  12. Enhanced sensitivity of A549 cells to the cytotoxic action of anticancer drugs via suppression of Nrf2 by procyanidins from Cinnamomi Cortex extract

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuma, Tomokazu; Matsumoto, Takashi; Itoi, Ayano; Kawana, Ayako; Nishiyama, Takahito; Ogura, Kenichiro [Department of Drug Metabolism and Molecular Toxicology, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji-shi, Tokyo 192-0392 (Japan); Hiratsuka, Akira, E-mail: [Department of Drug Metabolism and Molecular Toxicology, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji-shi, Tokyo 192-0392 (Japan)


    Highlights: {yields} We found a novel inhibitor of Nrf2 known as a chemoresistance factor. {yields} Overexpressed Nrf2 in lung cancer cells was suppressed by Cinnamomi Cortex extract. {yields} Cytotoxic action of anticancer drugs in cells treated with the extract was enhanced. {yields} Procyanidin tetramers and pentamers were active components in suppressing Nrf2. -- Abstract: Nuclear factor-E2-related factor 2 (Nrf2) is an important cytoprotective transcription factor because Nrf2-regulated enzymes play a key role in antioxidant and detoxification processes. Recent studies have reported that lung cancer cells overexpressing Nrf2 exhibit increased resistance to chemotherapy. Suppression of overexpressed Nrf2 is needed for a new therapeutic approach against lung cancers. In the present study, we found that Cinnamomi Cortex extract (CCE) has an ability to suppress Nrf2-regulated enzyme activity and Nrf2 expression in human lung cancer A549 cells with high Nrf2 activity. Moreover, we demonstrated that CCE significantly enhances sensitivity of A549 cells to the cytotoxic action of doxorubicin and etoposide as well as increasing the intracellular accumulation of both drugs. These results suggest that CCE might be an effective concomitant agent to reduce anticancer drug resistance derived from Nrf2 overexpression. Bioactivity-guided fractionation revealed that procyanidin tetramers and pentamers contained in CCE were active components in suppressing Nrf2.

  13. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone. (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela


    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon


    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  15. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)


    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  16. Novel cytoprotective mechanism of anti-parkinsonian drug deprenyl: PI3K and Nrf2-derived induction of antioxidative proteins

    International Nuclear Information System (INIS)

    Nakaso, Kazuhiro; Nakamura, Chiharu; Sato, Hiromi; Imamura, Keiko; Takeshima, Takao; Nakashima, Kenji


    Neuroprotection has received considerable attention as a strategy for the treatment of Parkinson's disease (PD). Deprenyl (Selegiline) is a promising candidate for neuroprotection; however, its cytoprotective mechanism has not been fully clarified. Here, we report a novel cytoprotective mechanism of deprenyl involving PI3K and Nrf2-mediated induction of oxidative stress-related proteins. Deprenyl increased the expression of HO-1, PrxI, TrxI, TrxRxI, γGCS, and p62/A170 in SH-SY5Y cells. Deprenyl also induced the nuclear accumulation of Nrf2 and increased the binding activity of Nrf2 to the enhancer region of human genomic HO-1. The Nrf2-mediated induction of antioxidative molecules was controlled by PI3K. Indeed, furthermore, neurotrophin receptor TrkB was identified as an upstream signal for PI3K-Nrf2 activation by deprenyl. These results suggest that the cytoprotective effect of deprenyl is, in part, dependent on Nrf2-mediated induction of antioxidative proteins, suggesting that activation of the PI3K-Nrf2 system may be a useful therapeutic strategy for PD

  17. VPA and MEL induce apoptosis by inhibiting the Nrf2-ARE signaling pathway in TMZ-resistant U251 cells. (United States)

    Pan, Hao; Wang, Handong; Jia, Yue; Wang, Qiang; Li, Liwen; Wu, Qi; Chen, Longbang


    Chemoresistance is the primary obstacle to effective treatment of glioblastoma, the most lethal brain tumor. Our previous study demonstrated that Nf-E2 related factor 2 (Nrf2), a traditional cytoprotective transcription factor, was overexpressed in gliomas and promoted malignancy. The present study aimed to investigate the expression levels of Nrf2‑antioxidant response element (ARE) signaling pathway genes in temozolomide (TMZ)‑resistant U251 human glioblastoma cells (U251‑TMZ). Additionally, the effect of valproic acid (VPA) and melatonin (MEL) on Nrf2 expression in U251‑TMZ cells and their association with chemoresistance was investigated. The results of the present study indicated that the expression levels of components of the Nrf2‑ARE signaling pathway were increased in U251‑TMZ cells compared with U251 parent cells. Silencing of Nrf2 by transfection with small interfering RNA restored the chemosensitivity of U251‑TMZ cells. The Nrf2 inhibitors VPA and MEL successfully reduced Nrf2 expression and survival in U251‑TMZ cells treated with TMZ, accompanied by increased reactive oxygen species levels and apoptosis. Therefore, VPA and MEL may be potential chemotherapeutic sensitizers for the treatment of chemoresistant glioblastoma.

  18. Compensatory role of the Nrf2–ARE pathway against paraquat toxicity: Relevance of 26S proteasome activity

    Directory of Open Access Journals (Sweden)

    Yasuhiko Izumi


    Full Text Available Oxidative stress and the ubiquitin–proteasome system play a key role in the pathogenesis of Parkinson disease. Although the herbicide paraquat is an environmental factor that is involved in the etiology of Parkinson disease, the role of 26S proteasome in paraquat toxicity remains to be determined. Using PC12 cells overexpressing a fluorescent protein fused to the proteasome degradation signal, we report here that paraquat yielded an inhibitory effect on 26S proteasome activity without an obvious decline in 20S proteasome activity. Relative low concentrations of proteasome inhibitors caused the accumulation of nuclear factor erythroid 2-related factor 2 (Nrf2, which is targeted to the ubiquitin–proteasome system, and activated the antioxidant response element (ARE-dependent transcription. Paraquat also upregulated the protein level of Nrf2 without increased expression of Nrf2 mRNA, and activated the Nrf2–ARE pathway. Consequently, paraquat induced expression of Nrf2-dependent ARE-driven genes, such as γ-glutamylcysteine synthetase, catalase, and hemeoxygenase-1. Knockdown of Nrf2 or inhibition of γ-glutamylcysteine synthetase and catalase exacerbated paraquat-induced toxicity, whereas suppression of hemeoxygenase-1 did not. These data indicate that the compensatory activation of the Nrf2–ARE pathway via inhibition of 26S proteasome serves as part of a cellular defense mechanism to protect against paraquat toxicity.

  19. Bardoxolone methyl (BARD) ameliorates aristolochic acid (AA)-induced acute kidney injury through Nrf2 pathway. (United States)

    Wu, Juan; Liu, Xinhui; Fan, Jinjin; Chen, Wenfang; Wang, Juan; Zeng, Youjia; Feng, Xiaorang; Yu, Xueqing; Yang, Xiao


    Bardoxolone methyl (BARD) is an antioxidant modulator that acts through induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway. This study aimed to investigate the role of BARD in protecting kidneys from aristolochic acid (AA)-induced acute kidney injury (AKI). Male C57BL/6 mice received intraperitoneal (i.p.) injections of aristolochic acid I (AAI) (5mg/kg/day) for 5 days to produce acute AA nephropathy (AAN) model. BARD (10mg/kg/day, i.p.) was applied for 7 consecutive days, starting 2 days prior to AAI administration. The mice in the AA group showed AKI as evidenced by worsening kidney function evaluated by blood urea nitrogen (BUN) and serum creatinine (SCr) levels, and severe tubulointerstitial injury marked by massive tubule necrosis in kidney tissues. BARD significantly reduced BUN and SCr levels which were elevated by AAI. Additionally, AAI-induced histopathological renal damage was ameliorated by BARD. Furthermore, the expression of Nrf2 was reduced, and its repressor Kelch-like ECH-associated protein 1 (Keap1) was increased significantly, whereas heme oxygenase-1 (HO-1) was upregulated and NAD(P)H quinone oxidoreductase-1 (NQO1) was barely increased in the cytoplasm of tubules in kidneys after treatment with AAI. BARD significantly upregulated renal Nrf2, NQO1 and HO-1 expression and downregulated Keap1 expression compared with those in the AA group. Moreover, it was found that Nrf2 was expressed both in the cytoplasm and nuclear of glomeruli and tubules, whereas NQO1 and HO-1 were localized in the cytoplasm of tubules only. In conclusion, AA-induced acute renal injury was associated with impaired Nrf2 activation and expression of its downstream target genes in renal tissues. BARD prevented renal damage induced by AAI, and this renoprotective effect may be exerted by activating the Nrf2 signaling pathway and increasing expression of the downstream target genes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Ebselen attenuates cisplatin-induced ROS generation through Nrf2 activation in auditory cells. (United States)

    Kim, Se-Jin; Park, Channy; Han, A Lum; Youn, Myung-Ja; Lee, Jeong-Han; Kim, Yunha; Kim, Eun-Sook; Kim, Hyung-Jin; Kim, Jin-Kyung; Lee, Ho-Kyun; Chung, Sang-Young; So, Hongseob; Park, Raekil


    Ebselen, an organoselenium compound that acts as a glutathione peroxidase mimetic, has been demonstrated to possess antioxidant and anti-inflammatory activities. However, the molecular mechanism underlying this effect is not fully understood in auditory cells. The purpose of the present study is to investigate the protective effect of ebselen against cisplatin-induced toxicity in HEI-OC1 auditory cells, organotypic cultures of cochlear explants from two-day postnatal rats (P(2)) and adult Balb/C mice. Pretreatment with ebselen ameliorated apoptotic death induced by cisplatin in HEI-OC1 cells and organotypic cultures of Corti's organ. Ebselen pretreatment also significantly suppressed cisplatin-induced increases in intracellular reactive oxygen species (ROS), intracellular reactive nitrogen species (RNS) and lipid peroxidation levels. Ebselen dose-dependently increased the expression level of an antioxidant response element (ARE)-luciferase reporter in HEI-OC1 cells through the translocation of Nrf2 into the nucleus. Furthermore, we found that pretreatment with ebselen significantly restored Nrf2 function, whereas it ameliorated the cytotoxicity of cisplatin in cells transfectants with either a pcDNA3.1 (control) or a DN-Nrf2 (dominant-negative) plasmid. We also observed that Nrf2 activation by ebselen increased the expression of phase II antioxidant genes, including heme oxygenase (HO-1), NAD(P)H:quinine oxidoreductase, and gamma-glutamylcysteine synthetase (gamma-GCS). Treatment with ebselen resulted in an increased expression of HO-1 and intranuclear Nrf2 in hair cells of organotypic cultured cochlea. After intraperitoneal injection with cisplatin, auditory brainstem responses (ABRs) threshold was measured on 8th day in Balb/C mice. ABR threshold shift was marked occurred in mice injected with cisplatin (16 mg/kg, n=5; Click and 8-kHz stimuli, pebselen was not significantly changed. These results suggest that ebselen activates the Nrf2-ARE signaling pathway

  1. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    International Nuclear Information System (INIS)

    Peng, Hui; Wang, Huihui; Xue, Peng; Hou, Yongyong; Dong, Jian; Zhou, Tong; Qu, Weidong; Peng, Shuangqing; Li, Jin; Carmichael, Paul L.; Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo


    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As 2 O 3 ), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As 2 O 3 -challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As 2 O 3 -induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As 2 O 3 -induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As 2 O 3 in AML cells. • Sensitization of THP-1 cells to As 2 O 3 toxicity by ethionamide is NRF2-dependent.

  2. Nrf2 represses FGF21 during long-term high-fat diet-induced obesity in mice. (United States)

    Chartoumpekis, Dionysios V; Ziros, Panos G; Psyrogiannis, Agathoklis I; Papavassiliou, Athanasios G; Kyriazopoulou, Venetsana E; Sykiotis, Gerasimos P; Habeos, Ioannis G


    Obesity is characterized by chronic oxidative stress. Fibroblast growth factor 21 (FGF21) has recently been identified as a novel hormone that regulates metabolism. NFE2-related factor 2 (Nrf2) is a transcription factor that orchestrates the expression of a battery of antioxidant and detoxification genes under both basal and stress conditions. The current study investigated the role of Nrf2 in a mouse model of long-term high-fat diet (HFD)-induced obesity and characterized its crosstalk to FGF21 in this process. Wild-type (WT) and Nrf2 knockout (Nrf2-KO) mice were fed an HFD for 180 days. During this period, food consumption and body weights were measured. Glucose metabolism was assessed by an intraperitoneal glucose tolerance test and intraperitoneal insulin tolerance test. Total RNA was prepared from liver and adipose tissue and was used for quantitative real-time RT-PCR. Fasting plasma was collected and analyzed for blood chemistries. The ST-2 cell line was used for transfection studies. Nrf2-KO mice were partially protected from HFD-induced obesity and developed a less insulin-resistant phenotype. Importantly, Nrf2-KO mice had higher plasma FGF21 levels and higher FGF21 mRNA levels in liver and white adipose tissue than WT mice. Thus, the altered metabolic phenotype of Nrf2-KO mice under HFD was associated with higher expression and abundance of FGF21. Consistently, the overexpression of Nrf2 in ST-2 cells resulted in decreased FGF21 mRNA levels as well as in suppressed activity of a FGF21 promoter luciferase reporter. The identification of Nrf2 as a novel regulator of FGF21 expands our understanding of the crosstalk between metabolism and stress defense.

  3. The maize CorA/MRS2/MGT-type Mg transporter, ZmMGT10, responses to magnesium deficiency and confers low magnesium tolerance in transgenic Arabidopsis. (United States)

    Li, Hongyou; Wang, Ning; Ding, Jianzhou; Liu, Chan; Du, Hanmei; Huang, Kaifeng; Cao, Moju; Lu, Yanli; Gao, Shibin; Zhang, Suzhi


    ZmMGT10 was specifically expressed in maize roots and induced by a deficiency of magnesium. Overexpression of ZmMGT10 restored growth deficiency of the Salmonella typhimurium MM281 strain and enhanced the tolerance in Arabidopsis to stress induced by low magnesium levels by increasing uptake of Mg 2+ via roots. CorA/MRS2/MGT-type Mg 2+ transporters play a significant role in maintaining magnesium (Mg) homeostasis in plants. Although the maize CorA/MRS2/MGT family comprises of 12 members, currently no member has been functionally characterized. Here, we report the isolation and functional characterization of ZmMGT10 from the maize MRS2/MGT gene family. ZmMGT10 has a typical structure feature which includes two conserved TMs near the C-terminal end and an altered AMN tripeptide motif. The high sequence similarity and close phylogenetic relationship indicates that ZmMGT10 is probably the counterpart of Arabidopsis AtMGT6. The complementation of the Salmonella typhimurium mutated MM281 strain indicates that ZmMGT10 possesses the ability to transport Mg 2+ . ZmMGT10 was specifically expressed in the plant roots and it can be stimulated by a deficiency of Mg. Transgenic Arabidopsis plants which overexpressed ZmMGT10 grew more vigorously than wild-type plants under low Mg conditions, exhibited by longer root length, higher plant fresh weight and chlorophyll content, suggesting ZmMGT10 was essential for plant growth and development under low Mg conditions. Further investigations found that high accumulation of Mg 2+ occurred in transgenic plants attributed to improved Mg 2+ uptake and thereby enhanced tolerance to Mg deficiency. Results from this investigation illustrate that ZmMGT10 is a Mg transporter of maize which can enhance the tolerance to Mg deficient conditions by improving Mg 2+ uptake in the transgenic plants of Arabidopsis.

  4. Role of Keap1-Nrf2 signaling in depression and dietary intake of glucoraphanin confers stress resilience in mice


    Yao, Wei; Zhang, Ji-chun; Ishima, Tamaki; Dong, Chao; Yang, Chun; Ren, Qian; Ma, Min; Han, Mei; Wu, Jin; Suganuma, Hiroyuki; Ushida, Yusuke; Yamamoto, Masayuki; Hashimoto, Kenji


    The transcription factor Keap1-Nrf2 system plays a key role in inflammation which is involved in depression. We found lower expression of Keap1 and Nrf2 proteins in the prefrontal cortex (PFC), CA3 and dentate gyrus (DG) of hippocampus in mice with depression-like phenotype compared to control mice. Serum levels of pro-inflammatory cytokines in Nrf2 knock-out (KO) mice were higher than those of wild-type mice, suggestive of enhanced inflammation in KO mice. Decreased brain-derived neurotrophi...

  5. N-acetylcysteine Ameliorates Prostatitis via miR-141 Regulating Keap1/Nrf2 Signaling. (United States)

    Wang, Liang-Liang; Huang, Yu-Hua; Yan, Chun-Yin; Wei, Xue-Dong; Hou, Jian-Quan; Pu, Jin-Xian; Lv, Jin-Xing


    Chronic prostatitis was the most common type of prostatitis and oxidative stress was reported to be highly elevated in prostatitis patients. In this study, we determined the effect of N-acetylcysteine (NAC) on prostatitis and the molecular mechanism involved in it. Male Sprague-Dawley rats were divided into three groups: control group (group A, n = 20), carrageenan-induced chronic nonbacterial prostatitis (CNP) model group (group B, n = 20), and carrageenan-induced CNP model group with NAC injection (group C, n = 20). Eye score, locomotion score, inflammatory cell count, cyclooxygenase 2 (COX2) expression, and Evans blue were compared in these three groups. The expression of miR-141 was determined by quantitative real-time PCR (qRT-PCR). Moreover, protein expressions of Kelch-like ECH-associated protein-1 (Keap1) and nuclear factor erythroid-2 related factor 2 (Nrf2) and its target genes were examined by Western blot. Luciferase reporter assay was performed in RWPE-1 cells transfected miR-141 mimic or inhibitor and the plasmid carrying 3'-UTR of Keap1. The value of eye score, locomotion score, inflammatory cell count, and Evans blue were significantly decreased in group C, as well as the expression of COX2, when comparing to that of group B. These results indicated that NAC relieved the carrageenan-induced CNP. Further, we found that NAC increased the expression of miR-141 and activated the Keap1/Nrf2 signaling. Luciferase reporter assay revealed that miR-141 mimic could suppress the activity of Keap1 and stimulate the downstream target genes of Nrf2. In addition, miR-141 inhibitor could reduce the effect of NAC on prostatitis. NAC ameliorates the carrageenan-induced prostatitis and prostate inflammation pain through miR-141 regulating Keap1/Nrf2 signaling.

  6. Cordycepin alleviates lipopolysaccharide-induced acute lung injury via Nrf2/HO-1 pathway. (United States)

    Qing, Rui; Huang, Zezhi; Tang, Yufei; Xiang, Qingke; Yang, Fan


    The present study is to investigate the protective effect of cordycepin on inflammatory reactions in rats with acute lung injury (ALI) induced by lipopolysaccharide (LPS), as well as the underlying mechanism. Wistar rat model of ALI was induced by intravenous injection of LPS (30 mg/kg body weight). One hour later, intravenous injection of cordycepin (1, 10 or 30 mg/kg body weight) was administered. The wet-to-dry weight ratio of lung tissues and myeloperoxidase activity in the lung tissues were measured. The contents of nitrite and nitrate were measured by reduction method, while chemiluminescence was used to determine the content of superoxide. Quantitative real-time polymerase chain reaction and Western blotting were used to determine the expression of mRNA and protein, respectively. Colorimetry was performed to determine the enzymatic activity of heme oxygenase-1 (HO-1). Nuclear translocation of Nrf2 was identified by Western blotting. The plasma contents of cytokines were measured by enzyme-linked immunosorbent assay. Cordycepin enhanced the expression and enzymatic activity of HO-1 in ALI rats, and activated Nrf2 by inducing the translocation of Nrf2 from cytoplasm to nucleus. In addition, cordycepin regulated the secretion of TNF-α, IL-6 and IL-10 via HO-1, and suppressed inflammation in lung tissues of ALI rats by inducing the expression of HO-1. HO-1 played important roles in the down-regulation of superoxide levels in lung tissues by cordycepin, and HO-1 expression induced by cordycepin affected nitrite and nitrate concentrations in plasma and iNOS protein expression in lung tissues. Cordycepin showed protective effect on injuries in lung tissues. The present study demonstrates that cordycepin alleviates inflammation induced by LPS via the activation of Nrf2 and up-regulation of HO-1 expression. Copyright © 2018. Published by Elsevier B.V.

  7. Andrographolide protects against cigarette smoke-induced oxidative lung injury via augmentation of Nrf2 activity (United States)

    Guan, SP; Tee, W; Ng, DSW; Chan, TK; Peh, HY; Ho, WE; Cheng, C; Mak, JC; Wong, WSF


    Background and Purpose Cigarette smoke is a major cause for chronic obstructive pulmonary disease (COPD). Andrographolide is an active biomolecule isolated from the plant Andrographis paniculata. Andrographolide has been shown to activate nuclear factor erythroid-2-related factor 2 (Nrf2), a redox-sensitive antioxidant transcription factor. As Nrf2 activity is reduced in COPD, we hypothesize that andrographolide may have therapeutic value for COPD. Experimental Approach Andrographolide was given i.p. to BALB/c mice daily 2 h before 4% cigarette smoke exposure for 1 h over five consecutive days. Bronchoalveolar lavage fluid and lungs were collected for analyses of cytokines, oxidative damage markers and antioxidant activities. BEAS-2B bronchial epithelial cells were exposed to cigarette smoke extract (CSE) and used to study the antioxidant mechanism of action of andrographolide. Key Results Andrographolide suppressed cigarette smoke-induced increases in lavage fluid cell counts; levels of IL-1β, MCP-1, IP-10 and KC; and levels of oxidative biomarkers 8-isoprostane, 8-OHdG and 3-nitrotyrosine in a dose-dependent manner. Andrographolide promoted inductions of glutathione peroxidase (GPx) and glutathione reductase (GR) activities in lungs from cigarette smoke-exposed mice. In BEAS-2B cells, andrographolide markedly increased nuclear Nrf2 accumulation, promoted binding to antioxidant response element (ARE) and total cellular glutathione level in response to CSE. Andrographolide up-regulated ARE-regulated gene targets including glutamate-cysteine ligase catalytic (GCLC) subunit, GCL modifier (GCLM) subunit, GPx, GR and heme oxygenase-1 in BEAS-2B cells in response to CSE. Conclusions Andrographolide possesses antioxidative properties against cigarette smoke-induced lung injury probably via augmentation of Nrf2 activity and may have therapeutic potential for treating COPD. PMID:23146110

  8. Prolonged fasting activates Nrf2 in post-weaned elephant seals. (United States)

    Vázquez-Medina, José Pablo; Soñanez-Organis, José G; Rodriguez, Ruben; Viscarra, Jose A; Nishiyama, Akira; Crocker, Daniel E; Ortiz, Rudy M


    Elephant seals naturally experience prolonged periods of absolute food and water deprivation (fasting). In humans, rats and mice, prolonged food deprivation activates the renin-angiotensin system (RAS) and increases oxidative damage. In elephant seals, prolonged fasting activates RAS without increasing oxidative damage likely due to an increase in antioxidant defenses. The mechanism leading to the upregulation of antioxidant defenses during prolonged fasting remains elusive. Therefore, we investigated whether prolonged fasting activates the redox-sensitive transcription factor Nrf2, which controls the expression of antioxidant genes, and if such activation is potentially mediated by systemic increases in RAS. Blood and skeletal muscle samples were collected from seals fasting for 1, 3, 5 and 7 weeks. Nrf2 activity and nuclear content increased by 76% and 167% at week 7. Plasma angiotensin II (Ang II) and transforming growth factor β (TGF-β) were 5000% and 250% higher at week 7 than at week 1. Phosphorylation of Smad2, an effector of Ang II and TGF signaling, increased by 120% at week 7 and by 84% in response to intravenously infused Ang II. NADPH oxidase 4 (Nox4) mRNA expression, which is controlled by smad proteins, increased 430% at week 7, while Nox4 protein expression, which can activate Nrf2, was 170% higher at week 7 than at week 1. These results demonstrate that prolonged fasting activates Nrf2 in elephant seals and that RAS stimulation can potentially result in increased Nox4 through Smad phosphorylation. The results also suggest that Nox4 is essential to sustain the hormetic adaptive response to oxidative stress in fasting seals.

  9. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2. (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun


    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway.

  10. Minocycline attenuates sevoflurane-induced cell injury via activation of Nrf2 (United States)

    Tian, Yue; Wu, Xiuying; Guo, Shanbin; Ma, Ling; Huang, Wei; Zhao, Xiaochun


    Minocycline has been demonstrated to exert neuroprotective effects in various experimental models. In the present study, we investigated the mechanisms underlying the protective effects of minocycline on cell injury induced by the inhalation of the anesthetic, sevoflurane. In our in vivo experiments using rats, minocycline attenuated sevoflurane-induced neuronal degeneration and apoptosis in the rat hippocampus, and this effect was associated with the minocycline-mediated suppression of oxidative stress in the hippocampus. In in vitro experiments, minocycline inhibited sevoflurane-induced apoptosis and the production of reactive oxygen species (ROS) in H4 human neuroglioma cells. In addition, minocycline suppressed the sevoflurane-induced upregulation of interleukin (IL)-6 and the activation of the nuclear factor-κB (NF-κB) signaling pathway in H4 cells. Furthermore, we found that nuclear factor E2-related factor 2 (Nrf2), an activator of the stress response, was upregulated and activated upon sevoflurane treatment both in the rat hippocampus and in H4 cells. In addition, minocycline further augmented the upregulation and activation of Nrf2 when used in conjunction with sevoflurane. Moreover, the knockdown of Nrf2 in H4 cells by small interfering RNA (siRNA) diminished the cytoprotective effect of minocycline, and attenuated the inhibitory effect of minocycline on ROS production, IL-6 upregulation and the activation of the NF-κB signaling pathway. On the whole, our findings indicate that minocycline may exert protective effects against sevoflurane-induced cell injury via the Nrf2-modulated antioxidant response and the inhibition of the activation of the NF-κB signaling pathway. PMID:28260081

  11. Skin Redox Balance Maintenance: The Need for an Nrf2-Activator Delivery System

    Directory of Open Access Journals (Sweden)

    Maya Ben-Yehuda Greenwald


    Full Text Available The skin, being the largest organ of the body, functions as a barrier between our body and the environment. It is consistently exposed to various exogenous and endogenous stressors (e.g., air pollutants, ionizing and non-ionizing irradiation, toxins, mitochondrial metabolism, enzyme activity, inflammatory process, etc. producing reactive oxygen species (ROS and physical damage (e.g., wounds, sunburns also resulting in reactive oxygen species production. Although skin is equipped with an array of defense mechanisms to counteract reactive oxygen species, augmented exposure and continued reactive oxygen species might result in excessive oxidative stress leading to many skin disorders including inflammatory diseases, pigmenting disorders and some types of cutaneous malignancy. The nuclear factor erythroid 2-related factor 2 (Nrf2 is an emerging regulator of cellular resistance and of defensive enzymes such as the phase II enzymes. Induction of the Keap1–Nrf2 pathway may have a beneficial effect in the treatment of a large number of skin disorders by stimulating an endogenous defense mechanism. However, prolonged and enhanced activation of this pathway is detrimental and, thus, limits the therapeutic potential of Keap1–Nrf2 modulators. Here, we review the consequences of oxidative stress to the skin, and the defense mechanisms that skin is equipped with. We describe the challenges of maintaining skin redox balance and its impact on skin status and function. Finally, we suggest a novel strategy for maintenance of skin redox homeostasis by modulating the Keap1–Nrf2 pathway using nanotechnology-based delivery systems.

  12. Cardiac Aging - Benefits of Exercise, Nrf2 Activation and Antioxidant Signaling. (United States)

    Narasimhan, Madhusudhanan; Rajasekaran, Namakkal-Soorappan


    Cardiovascular dysfunction and heart failure associated with aging not only impairs the cardiac function but also the quality of life eventually decreasing the life expectancy of the elderly. Notably, cardiac tissue can prematurely age under certain conditions such as genetic mutation, persistent redox stress and overload, aberrant molecular signaling, DNA damage, telomere attrition, and other pathological insults. While cardiovascular-related morbidity and mortality is on the rise and remains a global health threat, there has been only little to moderate improvements in its medical management. This is due to the fact that the lifestyle changes to molecular mechanisms underlying age-related myocardial structure and functional remodeling are multifactorial and intricately operate at different levels. Along these lines, the intrinsic redox mechanisms and oxidative stress (OS) are widely studied in the myocardium. The accumulation of reactive oxygen species (ROS) with age and the resultant oxidative damage has been shown to increase the susceptibility of the myocardium to multiple complications such as atherosclerosis, hypertension, ischemic heart disease, cardiac myopathy, and heart failure. There has been growing interest in trying to enhance the mechanisms that neutralize the ROS and curtailing OS as a possible anti-aging intervention and as a treatment for age-related disorders. Natural defense system to fight against OS involves a master transcription factor named nuclear erythroid-2-p45-related factor-2 (Nrf2) that regulates several antioxidant genes. Compelling evidence exists on the Nrf2 gain of function through pharmacological interventions in counteracting the oxidative damage and affords cytoprotection in several organs including but not limited to lung, liver, kidney, brain, etc. Nevertheless, thus far, only a few studies have described the potential role of Nrf2 and its non-pharmacological induction in cardiac aging. This chapter explores the effects of

  13. Piper betle Induced Cytoprotective Genes and Proteins via the Nrf2/ARE Pathway in Aging Mice. (United States)

    Aliahmat, Nor Syahida; Abdul Sani, Nur Fathiah; Wan Hasan, Wan Nuraini; Makpol, Suzana; Wan Ngah, Wan Zurinah; Mohd Yusof, Yasmin Anum


    The objective of this study was to elucidate the underlying antioxidant mechanism of aqueous extract of Piper betle (PB) in aging rats. The nuclear factor erythroid 2-related factor 2 (Nrf2)/ARE pathway involving phase II detoxifying and antioxidant enzymes plays an important role in the antioxidant system by reducing electrophiles and reactive oxygen species through induction of phase II enzymes and proteins. Genes and proteins of phase II detoxifying antioxidant enzymes were analyzed by QuantiGenePlex 2.0 Assay and Western blot analysis. PB significantly induced genes and proteins of phase II and antioxidant enzymes, NAD(P)H quinone oxidoreductase 1, and catalase in aging mice (p < 0.05). The expression of these enzymes were stimulated via translocation of Nrf2 into the nucleus, indicating the involvement of ARE, a cis-acting motif located in the promoter region of nearly all phase II genes. PB was testified for the first time to induce cytoprotective genes through the Nrf2/ARE signaling pathway, thus unraveling the antioxidant mechanism of PB during the aging process. © 2016 S. Karger AG, Basel.

  14. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ. (United States)

    Pallauf, Kathrin; Duckstein, Nils; Hasler, Mario; Klotz, Lars-Oliver; Rimbach, Gerald


    Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPAR γ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones) to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays), we tested their free radical scavenging activities and used α -tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPAR γ -dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPAR γ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  15. NRF2 Orchestrates the Metabolic Shift during Induced Pluripotent Stem Cell Reprogramming

    Directory of Open Access Journals (Sweden)

    Kate E. Hawkins


    Full Text Available The potential of induced pluripotent stem cells (iPSCs in disease modeling and regenerative medicine is vast, but current methodologies remain inefficient. Understanding the cellular mechanisms underlying iPSC reprogramming, such as the metabolic shift from oxidative to glycolytic energy production, is key to improving its efficiency. We have developed a lentiviral reporter system to assay longitudinal changes in cell signaling and transcription factor activity in living cells throughout iPSC reprogramming of human dermal fibroblasts. We reveal early NF-κB, AP-1, and NRF2 transcription factor activation prior to a temporal peak in hypoxia inducible factor α (HIFα activity. Mechanistically, we show that an early burst in oxidative phosphorylation and elevated reactive oxygen species generation mediates increased NRF2 activity, which in turn initiates the HIFα-mediated glycolytic shift and may modulate glucose redistribution to the pentose phosphate pathway. Critically, inhibition of NRF2 by KEAP1 overexpression compromises metabolic reprogramming and results in reduced efficiency of iPSC colony formation.

  16. Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ

    Directory of Open Access Journals (Sweden)

    Kathrin Pallauf


    Full Text Available Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPARγ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays, we tested their free radical scavenging activities and used α-tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPARγ-dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPARγ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.

  17. Uric acid demonstrates neuroprotective effect on Parkinson's disease mice through Nrf2-ARE signaling pathway. (United States)

    Huang, Ting-Ting; Hao, Dong-Lin; Wu, Bo-Na; Mao, Lun-Lin; Zhang, Jin


    Uric acid has neuroprotective effect on Parkinson's disease (PD) by inhibiting oxidative damage and neuronal cell death. Our previous study has shown that uric acid protected dopaminergic cell line damage through inhibiting accumulation of NF-E2-related factor 2 (Nrf2). This study aimed to investigate its in vivo neuroprotective effect. PD was induced by MPTP intraperitoneally injection for 7 d in male C57BL/6 mice. Mice were treated with either uric acid (intraperitoneally injection 250 mg/kg) or saline for a total of 13 d. We showed that uric acid improved behavioral performances and cognition of PD mice, increased TH-positive dopaminergic neurons and decreased GFAP-positive astrocytes in substantia nigra (SN). Uric acid increased mRNA and protein expressions of Nrf2 and three Nrf2-responsive genes, including γ-glutamate-cysteine ligase catalytic subunit (γ-GCLC), heme oxygenase-1 (HO-1) and NQO1. Uric acid significantly increased superoxide dismutase (SOD), CAT, glutathione (GSH) levels and decreased malondialdehyde (MDA) level in SN regions of MPTP-treated mice. Uric acid inhibited the hippocampal expression of IL-1β and decreased serum and hippocampus levels of interleukin-1β (IL-1β), IL-6 and tumor necrosis factor-α (TNF-α). In conclusion, uric acid demonstrates neuroprotective properties for dopaminergic neurons in PD mice through modulation of neuroinflammation and oxidative stress. Copyright © 2017. Published by Elsevier Inc.

  18. Fisetin alleviates oxidative stress after traumatic brain injury via the Nrf2-ARE pathway. (United States)

    Zhang, Li; Wang, Handong; Zhou, Yali; Zhu, Yihao; Fei, Maoxin


    Fisetin, a natural flavonoid, has neuroprotection properties in many brain injury models. However, its role in traumatic brain injury (TBI) has not been fully explained. In the present study, we aimed to explore the neuroprotective effects of fisetin in a mouse model of TBI. We found that fisetin improved neurological function, reduced cerebral edema, attenuated brain lesion and ameliorated blood-brain barrier (BBB) disruption after TBI. Moreover, the up-regulation of malondialdehyde (MDA) and the activity of glutathione peroxidase (GPx) were reversed by fisetin treatment. Furthermore, administration of fisetin suppressed neuron cell death and apoptosis, increased the expression of B-cell lymphoma 2 (Bcl-2), while decreased the expression of Bcl-2-associated X protein (Bax) and caspase-3 after TBI. In addition, fisetin activated the nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway following TBI. However, fisetin only failed to suppress oxidative stress in Nrf2 -/- mice. In conclusion, our data provided the first evidence that fisetin played a critical role in neuroprotection after TBI partly through the activation of the Nrf2-ARE pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway

    Directory of Open Access Journals (Sweden)

    W. Rungratanawanich


    Full Text Available γ-Oryzanol (ORY is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293. The 24 h ORY exposure significantly prevented hydrogen peroxide- (H2O2- induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD and glutathione peroxidase (GPX. Interestingly, ORY induced the nuclear factor (erythroid-derived 2-like 2 (Nrf2 nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(PH quinone reductase (NQO1, heme oxygenase-1 (HO-1, and glutathione synthetase (GSS at mRNA and protein levels in both basal condition and after H2O2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  20. Characterization of the Antioxidant Effects of γ-Oryzanol: Involvement of the Nrf2 Pathway. (United States)

    Rungratanawanich, W; Abate, G; Serafini, M M; Guarienti, M; Catanzaro, M; Marziano, M; Memo, M; Lanni, C; Uberti, D


    γ -Oryzanol (ORY) is well known for its antioxidant potential. However, the mechanism by which ORY exerts its antioxidant effect is still unclear. In this paper, the antioxidant properties of ORY were investigated for its potential effects as a reactive oxygen and nitrogen species (ROS/RNS) scavenger and in activating antioxidant-promoting intracellular pathways utilizing the human embryonic kidney cells (HEK-293). The 24 h ORY exposure significantly prevented hydrogen peroxide- (H 2 O 2 -) induced ROS/RNS production at 3 h, and this effect was sustained for at least 24 h. ORY pretreatment also enhanced the activity of antioxidant enzymes: superoxide dismutase (SOD) and glutathione peroxidase (GPX). Interestingly, ORY induced the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) nuclear translocation and upregulation of Nrf2-dependent defensive genes such as NAD(P)H quinone reductase (NQO1), heme oxygenase-1 (HO-1), and glutathione synthetase (GSS) at mRNA and protein levels in both basal condition and after H 2 O 2 insult. Thus, this study suggested an intriguing effect of ORY in modulating the Nrf2 pathway, which is also involved in regulating longevity as well as age-related diseases.

  1. Docosahexaenoic Acid (DHA) Provides Neuroprotection in Traumatic Brain Injury Models via Activating Nrf2-ARE Signaling. (United States)

    Zhu, Wei; Ding, Yuexia; Kong, Wei; Li, Tuo; Chen, Hongguang


    In this study, we explored the neuroprotective effects of docosahexaenoic acid (DHA) in traumatic brain injury (TBI) models. In this study, we first confirmed that DHA was neuroprotective against TBI via the NSS test and Morris water maze experiment. Western blot was conducted to identify the expression of Bax, caspase-3, and Bcl-2. And the cell apoptosis of the TBI models was validated by TUNEL staining. Relationships between nuclear factor erythroid 2-related factor 2-antioxidant response element (Nrf2-ARE) pathway-related genes and DHA were explored by RT-PCR and Western blot. Rats of the DHA group performed remarkably better than those of the TBI group in both NSS test and water maze experiment. DHA conspicuously promoted the expression of Bcl-2 and diminished that of cleaved caspase-3 and Bax, indicating the anti-apoptotic role of DHA. Superoxide dismutase (SOD) activity and cortical malondialdehyde content, glutathione peroxidase (GPx) activity were renovated in rats receiving DHA treatment, implying that the neuroprotective influence of DHA was derived from lightening the oxidative stress caused by TBI. Moreover, immunofluorescence and Western blot experiments revealed that DHA facilitated the translocation of Nrf2 to the nucleus. DHA administration also notably increased the expression of the downstream factors NAD(P)H:quinone oxidoreductase (NQO-1) and heme oxygenase 1(HO-1). DHA exerted neuroprotective influence on the TBI models, potentially through activating the Nrf2- ARE pathway.

  2. A novel Nrf2 activator from microbial transformation inhibits radiation-induced dermatitis in mice

    International Nuclear Information System (INIS)

    Nakagami, Yasuhiro; Masuda, Kayoko


    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcriptional factor that regulates many antioxidants, and we have recently succeeded in obtaining a novel Nrf2 activator, RS9, from microbial transformation. RS9 is categorized as a triterpenoid, and well-known triterpenoids such as RTA 402 (bardoxolone methyl) and RTA 408 have been tested in clinical trials. RTA 408 lotion is currently being tested in patients at risk for radiation dermatitis. This prompted us to study the profiles of RS9 in the skin. All the above triterpenoids increased the level of an Nrf2-targeted gene, NADPH:quinone oxidoreductase-1, in normal human epidermal keratinocytes. Among them, the activity of RS9 was prominent; furthermore, the cellular toxicity was less compared with RTA compounds. BALB/c mice were irradiated with 30 Gy/day on Day 0, and compounds were topically applied on the back once daily from Day 1 to Day 30. Dermatitis scores peaked on Day 18, with a score of 2.6 in vehicle-treated mice, and topical applications of 0.1% RTA 402, RTA 408 and RS9 reduced the scores to 1.8, 2.0 and 1.4, respectively. Moreover, the percentage of animals with scores ≥2 was analyzed, and 0.1% RS9 suppressed the percentage from 100% to 47%. These results imply that RS9 has potential efficacy for treating radiation dermatitis.

  3. Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway.

    Directory of Open Access Journals (Sweden)

    Jingxian Wu

    Full Text Available Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(PH: quinone oxidoreductase1 (NQO1 induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2 to antioxidant response element (ARE were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage.

  4. Neuroprotection by Curcumin in Ischemic Brain Injury Involves the Akt/Nrf2 Pathway (United States)

    Wu, Jingxian; Li, Qiong; Wang, Xiaoyan; Yu, Shanshan; Li, Lan; Wu, Xuemei; Chen, Yanlin; Zhao, Jing; Zhao, Yong


    Oxidative damage plays a critical role in many diseases of the central nervous system. This study was conducted to determine the molecular mechanisms involved in the putative anti-oxidative effects of curcumin against experimental stroke. Oxygen and glucose deprivation/reoxygenation (OGD/R) was used to mimic ischemic insult in primary cultured cortical neurons. A rapid increase in the intracellular expression of NAD(P)H: quinone oxidoreductase1 (NQO1) induced by OGD was counteracted by curcumin post-treatment, which paralleled attenuated cell injury. The reduction of phosphorylation Akt induced by OGD was restored by curcumin. Consequently, NQO1 expression and the binding activity of nuclear factor-erythroid 2-related factor 2 (Nrf2) to antioxidant response element (ARE) were increased. LY294002 blocked the increase in phospho-Akt evoked by curcumin and abolished the associated protective effect. Adult male Sprague-Dawley rats were subjected to transient middle cerebral artery occlusion for 60 minutes. Curcumin administration significantly reduced infarct size. Curcumin also markedly reduced oxidative stress levels in middle cerebral artery occlusion (MCAO) rats; hence, these effects were all suppressed by LY294002. Taken together, these findings provide evidence that curcumin protects neurons against ischemic injury, and this neuroprotective effect involves the Akt/Nrf2 pathway. In addition, Nrf2 is involved in the neuroprotective effects of curcumin against oxidative damage. PMID:23555802

  5. The Role of Nrf2-Mediated Pathway in Cardiac Remodeling and Heart Failure

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou


    Full Text Available Heart failure (HF is frequently the consequence of sustained, abnormal neurohormonal, and mechanical stress and remains a leading cause of death worldwide. The key pathophysiological process leading to HF is cardiac remodeling, a term referring to maladaptation to cardiac stress at the molecular, cellular, tissue, and organ levels. HF and many of the conditions that predispose one to HF are associated with oxidative stress. Increased generation of reactive oxygen species (ROS in the heart can directly lead to increased necrosis and apoptosis of cardiomyocytes which subsequently induce cardiac remodeling and dysfunction. Nuclear factor-erythroid-2- (NF-E2- related factor 2 (Nrf2 is a transcription factor that controls the basal and inducible expression of a battery of antioxidant genes and other cytoprotective phase II detoxifying enzymes that are ubiquitously expressed in the cardiovascular system. Emerging evidence has revealed that Nrf2 and its target genes are critical regulators of cardiovascular homeostasis via the suppression of oxidative stress, which is the key player in the development and progression of HF. The purpose of this review is to summarize evidence that activation of Nrf2 enhances endogenous antioxidant defenses and counteracts oxidative stress-associated cardiac remodeling and HF.

  6. Embryotoxicity Caused by DON-Induced Oxidative Stress Mediated by Nrf2/HO-1 Pathway

    Directory of Open Access Journals (Sweden)

    Miao Yu


    Full Text Available Deoxynivalenol (DON belongs to the type B group of trichothecenes family, which is composed of sesquiterpenoid metabolites produced by Fusarium and other fungi in grain. DON may cause various toxicities, such as cytotoxicity, immunotoxicity, genotoxicity as well as teratogenicity and carcinogenicity. In the present study, we focus on a hypothesis that DON alters the expressions of Nrf2/HO-1 pathway by inducing embryotoxicity in C57BL/6 mouse (5.0, 2.5, 1.0, and 0 mg/kg/day and BeWo cell lines (0 and 50 nM; 3 h, 12 h and 24 h. Our results indicate that DON treatment in mice during pregnancy leads to ROS accumulation in the placenta, which results in embryotoxicity. At the same time Nrf2/HO-1 pathway is up-regulated by ROS to protect placenta cells from oxidative damage. In DON-treated BeWo cells, the level of ROS has time–effect and dose–effect relationships with HO-1 expression. Moderate increase in HO-1 protects the cell from oxidative damage, while excessive increase in HO-1 aggravates the oxidative damage, which is called in some studies the “threshold effect”. Therefore, oxidative stress may be the critical molecular mechanism for DON-induced embryotoxicity. Besides, Nrf2/HO-1 pathway accompanied by the “threshold effect” also plays an important role against DON-induced oxidative damage in this process.

  7. Global mapping of binding sites for Nrf2 identifies novel targets in cell survival response through ChIP-Seq profiling and network analysis (United States)

    Malhotra, Deepti; Portales-Casamar, Elodie; Singh, Anju; Srivastava, Siddhartha; Arenillas, David; Happel, Christine; Shyr, Casper; Wakabayashi, Nobunao; Kensler, Thomas W.; Wasserman, Wyeth W.; Biswal, Shyam


    The Nrf2 (nuclear factor E2 p45-related factor 2) transcription factor responds to diverse oxidative and electrophilic environmental stresses by circumventing repression by Keap1, translocating to the nucleus, and activating cytoprotective genes. Nrf2 responses provide protection against chemical carcinogenesis, chronic inflammation, neurodegeneration, emphysema, asthma and sepsis in murine models. Nrf2 regulates the expression of a plethora of genes that detoxify oxidants and electrophiles and repair or remove damaged macromolecules, such as through proteasomal processing. However, many direct targets of Nrf2 remain undefined. Here, mouse embryonic fibroblasts (MEF) with either constitutive nuclear accumulation (Keap1−/−) or depletion (Nrf2−/−) of Nrf2 were utilized to perform chromatin-immunoprecipitation with parallel sequencing (ChIP-Seq) and global transcription profiling. This unique Nrf2 ChIP-Seq dataset is highly enriched for Nrf2-binding motifs. Integrating ChIP-Seq and microarray analyses, we identified 645 basal and 654 inducible direct targets of Nrf2, with 244 genes at the intersection. Modulated pathways in stress response and cell proliferation distinguish the inducible and basal programs. Results were confirmed in an in vivo stress model of cigarette smoke-exposed mice. This study reveals global circuitry of the Nrf2 stress response emphasizing Nrf2 as a central node in cell survival response. PMID:20460467

  8. Nrf2 pathway modulates Substance P-induced human mast cell activation and degranulation in the hair follicle. (United States)

    Jadkauskaite, Laura; Bahri, Rajia; Farjo, Nilofer; Farjo, Bessam; Jenkins, Gail; Bhogal, Ranjit; Haslam, Iain; Bulfone-Paus, Silvia; Paus, Ralf


    Activation of Nrf2 in primary human mast cells exposed to oxidative stress induced by substance P suppresses pro-inflammatory gene transcription, activation and degranulation. Copyright © 2018. Published by Elsevier Inc.

  9. Role of Nrf2 antioxidant defense in mitigating cadmium-induced oxidative stress in the olfactory system of zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lu; Gallagher, Evan P., E-mail:


    Exposure to trace metals can disrupt olfactory function in fish leading to a loss of behaviors critical to survival. Cadmium (Cd) is an olfactory toxicant that elicits cellular oxidative stress as a mechanism of toxicity while also inducing protective cellular antioxidant genes via activation of the nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway. However, the molecular mechanisms of Cd-induced olfactory injury have not been characterized. In the present study, we investigated the role of the Nrf2-mediated antioxidant defense pathway in protecting against Cd-induced olfactory injury in zebrafish. A dose-dependent induction of Nrf2-regulated antioxidant genes associated with cellular responses to oxidative stress was observed in the olfactory system of adult zebrafish following 24 h Cd exposure. Zebrafish larvae exposed to Cd for 3 h showed increased glutathione S-transferase pi (gst pi), glutamate–cysteine ligase catalytic subunit (gclc), heme oxygenase 1 (hmox1) and peroxiredoxin 1 (prdx1) mRNA levels indicative of Nrf2 activation, and which were blocked by morpholino-mediated Nrf2 knockdown. The inhibition of antioxidant gene induction in Cd-exposed Nrf2 morphants was associated with disruption of olfactory driven behaviors, increased cell death and loss of olfactory sensory neurons (OSNs). Nrf2 morphants also exhibited a downregulation of OSN-specific genes after Cd exposure. Pre-incubation of embryos with sulforaphane (SFN) partially protected against Cd-induced olfactory tissue damage. Collectively, our results indicate that oxidative stress is an important mechanism of Cd-mediated injury in the zebrafish olfactory system. Moreover, the Nrf2 pathway plays a protective role against cellular oxidative damage and is important in maintaining zebrafish olfactory function. -- Highlights: ► Oxidative stress is an important mechanism of Cd-mediated olfactory injury. ► Cd induces antioxidant gene expression in the zebrafish olfactory system. ► The

  10. Dose-dependent transitions in Nrf2-mediated adaptive response and related stress responses to hypochlorous acid in mouse macrophages

    International Nuclear Information System (INIS)

    Woods, Courtney G.; Fu Jingqi; Xue Peng; Hou Yongyong; Pluta, Linda J.; Yang Longlong; Zhang Qiang; Thomas, Russell S.; Andersen, Melvin E.; Pi Jingbo


    Hypochlorous acid (HOCl) is potentially an important source of cellular oxidative stress. Human HOCl exposure can occur from chlorine gas inhalation or from endogenous sources of HOCl, such as respiratory burst by phagocytes. Transcription factor Nrf2 is a key regulator of cellular redox status and serves as a primary source of defense against oxidative stress. We recently demonstrated that HOCl activates Nrf2-mediated antioxidant response in cultured mouse macrophages in a biphasic manner. In an effort to determine whether Nrf2 pathways overlap with other stress pathways, gene expression profiling was performed in RAW 264.7 macrophages exposed to HOCl using whole genome mouse microarrays. Benchmark dose (BMD) analysis on gene expression data revealed that Nrf2-mediated antioxidant response and protein ubiquitination were the most sensitive biological pathways that were activated in response to low concentrations of HOCl (< 0.35 mM). Genes involved in chromatin architecture maintenance and DNA-dependent transcription were also sensitive to very low doses. Moderate concentrations of HOCl (0.35 to 1.4 mM) caused maximal activation of the Nrf2 pathway and innate immune response genes, such as IL-1β, IL-6, IL-10 and chemokines. At even higher concentrations of HOCl (2.8 to 3.5 mM) there was a loss of Nrf2-target gene expression with increased expression of numerous heat shock and histone cluster genes, AP-1-family genes, cFos and Fra1 and DNA damage-inducible Gadd45 genes. These findings confirm an Nrf2-centric mechanism of action of HOCl in mouse macrophages and provide evidence of interactions between Nrf2, inflammatory, and other stress pathways.

  11. Involvement of ERK-Nrf-2 signaling in ionizing radiation induced cell death in normal and tumor cells.

    Directory of Open Access Journals (Sweden)

    Raghavendra S Patwardhan

    Full Text Available Prolonged oxidative stress favors tumorigenic environment and inflammation. Oxidative stress may trigger redox adaptation mechanism(s in tumor cells but not normal cells. This may increase levels of intracellular antioxidants and establish a new redox homeostasis. Nrf-2, a master regulator of battery of antioxidant genes is constitutively activated in many tumor cells. Here we show that, murine T cell lymphoma EL-4 cells show constitutive and inducible radioresistance via activation of Nrf-2/ERK pathway. EL-4 cells contained lower levels of ROS than their normal counterpart murine splenic lymphocytes. In response to radiation, the thiol redox circuits, GSH and thioredoxin were modified in EL-4 cells. Pharmacological inhibitors of ERK and Nrf-2 significantly enhanced radiosensitivity and reduced clonogenic potential of EL-4 cells. Unirradiated lymphoma cells showed nuclear accumulation of Nrf-2, upregulation of its dependent genes and protein levels. Interestingly, MEK inhibitor abrogated its nuclear translocation suggesting role of ERK in basal and radiation induced Nrf-2 activation in tumor cells. Double knockdown of ERK and Nrf-2 resulted in higher sensitivity to radiation induced cell death as compared to individual knockdown cells. Importantly, NF-kB which is reported to be constitutively active in many tumors was not present at basal levels in EL-4 cells and its inhibition did not influence radiosensitivity of EL-4 cells. Thus our results reveal that, tumor cells which are subjected to heightened oxidative stress employ master regulator cellular redox homeostasis Nrf-2 for prevention of radiation induced cell death. Our study reveals the molecular basis of tumor radioresistance and highlights role of Nrf-2 and ERK.

  12. High Nrf2 expression in alveolar type I pneumocytes is associated with low recurrences in primary spontaneous pneumothorax. (United States)

    Chen, Yu-Wen; Chiu, Wen-Chin; Chou, Shah-Hwa; Su, Yu-Han; Huang, Ying-Fong; Lee, Yen-Lung; Yuan, Shyng-Shiou F; Lee, Yi-Chen


    Recurrent primary spontaneous pneumothorax (PSP) is a troublesome problem and a major concern for the patients. This study examined whether nuclear factor erythroid 2-related factor 2 (Nrf2) expression in alveolar type I pneumocytes was associated with the clinical manifestations of PSP patients including disease recurrence. Eighty-eight PSP patients who were managed with needlescopic video-assisted thoracoscopic surgery (NVATS) were included in this study. Immunohistochemistry (IHC) was assessed to determine Nrf2 expression in resected lung tissues and the results were correlated with clinicopathological characteristics by the chi-square or the Fisher's exact test. The prognostic value of Nrf2 for overall recurrence was evaluated by univariate and multivariable Cox regression model. The expression of Nrf2 was observed in type I pneumocytes of lung tissues from PSP patients by IHC. We found that low Nrf2 expression in PSP patients, especially in young (age ≤ 20, p = 0.033) and body mass index (BMI) ≥18 kg/m 2 (p = 0.019) groups, was significantly correlated with PSP recurrence. In the univariate and multivariate analyses, high Nrf2 expression was a significant protective factor for overall recurrence in PSP patients (univariate: p = 0.026; multivariate: p = 0.004). The expression level of Nrf2 in alveolar type I pneumocytes was a potential factor involved in PSP recurrence. Our findings suggest that elevated Nrf2 expression in PSP patients may be a promising way for reducing PSP recurrence. Copyright © 2017. Published by Elsevier Taiwan.

  13. Genetic Nrf2 Overactivation Inhibits the Deleterious Effects Induced by Hepatocyte-Specific c-met Deletion during the Progression of NASH

    Directory of Open Access Journals (Sweden)

    Pierluigi Ramadori


    Full Text Available We have recently shown that hepatocyte-specific c-met deficiency accelerates the progression of nonalcoholic steatohepatitis in experimental murine models resulting in augmented production of reactive oxygen species and accelerated development of fibrosis. The aim of this study focuses on the elucidation of the underlying cellular mechanisms driven by Nrf2 overactivation in hepatocytes lacking c-met receptor characterized by a severe unbalance between pro-oxidant and antioxidant functions. Control mice (c-metfx/fx, single c-met knockouts (c-metΔhepa, and double c-met/Keap1 knockouts (met/Keap1Δhepa were then fed a chow or a methionine-choline-deficient (MCD diet, respectively, for 4 weeks to reproduce the features of nonalcoholic steatohepatitis. Upon MCD feeding, met/Keap1Δhepa mice displayed increased liver mass albeit decreased triglyceride accumulation. The marked increase of oxidative stress observed in c-metΔhepa was restored in the double mutants as assessed by 4-HNE immunostaining and by the expression of genes responsible for the generation of free radicals. Moreover, double knockout mice presented a reduced amount of liver-infiltrating cells and the exacerbation of fibrosis progression observed in c-metΔhepa livers was significantly inhibited in met/Keap1Δhepa. Therefore, genetic activation of the antioxidant transcription factor Nrf2 improves liver damage and repair in hepatocyte-specific c-met-deficient mice mainly through restoring a balance in the cellular redox homeostasis.

  14. Andrographolide induces Nrf2 and heme oxygenase 1 in astrocytes by activating p38 MAPK and ERK. (United States)

    Wong, Siew Ying; Tan, Michelle G K; Wong, Peter T H; Herr, Deron R; Lai, Mitchell K P


    Andrographolide is the major labdane diterpenoid originally isolated from Andrographis paniculata and has been shown to have anti-inflammatory and antioxidative effects. However, there is a dearth of studies on the potential therapeutic utility of andrographolide in neuroinflammatory conditions. Here, we aimed to investigate the mechanisms underlying andrographolide's effect on the expression of anti-inflammatory and antioxidant heme oxygenase-1 (HO-1) in primary astrocytes. Measurements of the effects of andrograholide on antioxidant HO-1 and its transcription factor, Nrf2, include gene expression, protein turnover, and activation of putative signaling regulators. Andrographolide potently activated Nrf2 and also upregulated HO-1 expression in primary astrocytes. Andrographolide's effects on Nrf2 seemed to be biphasic, with acute (within 1 h) reductions in Nrf2 ubiquitination efficiency and turnover rate, followed by upregulation of Nrf2 mRNA between 8 and 24 h. The acute regulation of Nrf2 by andrographolide seemed to be independent of Keap1 and partly mediated by p38 MAPK and ERK signaling. These data provide further insights into the mechanisms underlying andrographolide's effects on astrocyte-mediated antioxidant, and anti-inflammatory responses and support the further assessment of andrographolide as a potential therapeutic for neurological conditions in which oxidative stress and neuroinflammation are implicated.

  15. Thyroid Hormone-Induced Cytosol-to-Nuclear Translocation of Rat Liver Nrf2 Is Dependent on Kupffer Cell Functioning

    Directory of Open Access Journals (Sweden)

    Luis A. Videla


    Full Text Available L-3,3′,5-triiodothyronine (T3 administration upregulates nuclear factor-E2-related factor 2 (Nrf2 in rat liver, which is redox-sensitive transcription factor mediating cytoprotection. In this work, we studied the role of Kupffer cell respiratory burst activity, a process related to reactive oxygen species generation and liver homeostasis, in Nrf2 activation using the macrophage inactivator gadolinium chloride (GdCl3; 10 mg/kg i.v. 72 h before T3 [0.1 mg/kg i.p.] or NADPH oxidase inhibitor apocynin (1.5 mmol/L added to the drinking water for 7 days before T3, and determinations were performed 2 h after T3. T3 increased nuclear/cytosolic Nrf2 content ratio and levels of heme oxygenase 1 (HO-1, catalytic subunit of glutamate cysteine ligase, and thioredoxin (Western blot over control values, proteins whose gene transcription is induced by Nrf2. These changes were suppressed by GdCl3 treatment prior to T3, an agent-eliciting Kupffer-cell depletion, inhibition of colloidal carbon phagocytosis, and the associated respiratory burst activity, with enhancement in nuclear inhibitor of Nrf2 kelch-like ECH-associated protein 1 (Keap1/Nrf2 content ratios suggesting Nrf2 degradation. Under these conditions, T3-induced tumor necrosis factor-α (TNF-α response was eliminated by previous GdCl3 administration. Similar to GdCl3, apocynin given before T3 significantly reduced liver Nrf2 activation and HO-1 expression, a NADPH oxidase inhibitor eliciting abolishment of colloidal carbon-induced respiratory burst activity without altering carbon phagocytosis. It is concluded that Kupffer cell functioning is essential for upregulation of liver Nrf2-signaling pathway by T3. This contention is supported by suppression of the respiratory burst activity of Kupffer cells and the associated reactive oxygen species production by GdCl3 or apocynin given prior to T3, thus hindering Nrf2 activation.

  16. Coenzyme Q10 Supplementation Modulates NFκB and Nrf2 Pathways in Exercise Training

    Directory of Open Access Journals (Sweden)

    Ragip Pala, Cemal Orhan, Mehmet Tuzcu, Nurhan Sahin, Shakir Ali, Vedat Cinar, Mustafa Atalay, Kazim Sahin


    Full Text Available This study reports the effects of Q10, coenzyme Q10 or ubiquinone, a component of the electron transport chain in mitochondria, on nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB, inhibitors of kappa B (IκB, nuclear factor (erythroid-derived 2-like 2 (Nrf2 and hemeoxygenase 1 (HO-1 in rats after chronic exercise training for 6 weeks. 8-week old male Wistar rats were assigned randomly to one of four treatments planned in a 2 x 2 factorial arrangement of two condition (sedentary vs. exercise training, and two coenzyme Q10 levels (0 and 300 mg/kg per day for 6 weeks. The expression levels of the target proteins were determined in the heart, liver and muscle, and biochemical parameters including creatinine, urea, glucose and lipid profile were investigated in plasma. When compared with sedentary group, significant decreases in heart, liver and muscle NFκB levels by 45%, 26% and 44% were observed in Q10 supplemented rats after exercise training, respectively, while the inhibitory protein IκB increased by 179%, 111% and 127% in heart, liver and muscle tissues. Q10 supplementation caused an increase in Nrf2 (167%, 165% and 90% and HO-1 (107%, 156% and 114% after exercise training in heart, liver and muscle tissues (p < 0.05. No significant change was observed in any of the parameters associated with protein, carbohydrate and lipid metabolism, except that exercise caused a decrease in plasma triglyceride, which was further decreased by Q10. In conclusion, these results suggest that Q10 modulates the expression of NFκB, IκB, Nrf2 and HO-1 in exercise training, indicating an anti-inflammatory effect of Q10 and emphasizes its role in antioxidant defense.

  17. Protection from cyanide-induced brain injury by the Nrf2 transcriptional activator carnosic acid. (United States)

    Zhang, Dongxian; Lee, Brian; Nutter, Anthony; Song, Paul; Dolatabadi, Nima; Parker, James; Sanz-Blasco, Sara; Newmeyer, Traci; Ambasudhan, Rajesh; McKercher, Scott R; Masliah, Eliezer; Lipton, Stuart A


    Cyanide is a life-threatening, bioterrorist agent, preventing cellular respiration by inhibiting cytochrome c oxidase, resulting in cardiopulmonary failure, hypoxic brain injury, and death within minutes. However, even after treatment with various antidotes to protect cytochrome oxidase, cyanide intoxication in humans can induce a delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Additional mechanisms are thought to underlie cyanide-induced neuronal damage, including generation of reactive oxygen species. This may account for the fact that antioxidants prevent some aspects of cyanide-induced neuronal damage. Here, as a potential preemptive countermeasure against a bioterrorist attack with cyanide, we tested the CNS protective effect of carnosic acid (CA), a pro-electrophilic compound found in the herb rosemary. CA crosses the blood-brain barrier to up-regulate endogenous antioxidant enzymes via activation of the Nrf2 transcriptional pathway. We demonstrate that CA exerts neuroprotective effects on cyanide-induced brain damage in cultured rodent and human-induced pluripotent stem cell-derived neurons in vitro, and in vivo in various brain areas of a non-Swiss albino mouse model of cyanide poisoning that simulates damage observed in the human brain. Cyanide, a potential bioterrorist agent, can produce a chronic delayed-onset neurological syndrome that includes symptoms of Parkinsonism. Here, cyanide poisoning treated with the proelectrophillic compound carnosic acid, results in reduced neuronal cell death in both in vitro and in vivo models through activation of the Nrf2/ARE transcriptional pathway. Carnosic acid is therefore a potential treatment for the toxic central nervous system (CNS) effects of cyanide poisoning. ARE, antioxidant responsive element; Nrf2 (NFE2L2, Nuclear factor (erythroid-derived 2)-like 2). © 2015 International Society for Neurochemistry.

  18. Role of Nrf2 in preventing oxidative stress induced chloride current alteration in human lung cells. (United States)

    Canella, Rita; Benedusi, Mascia; Martini, Marta; Cervellati, Franco; Cavicchio, Carlotta; Valacchi, Giuseppe


    The lung tissue is one of the main targets of oxidative stress due to external sources and respiratory activity. In our previous work, we have demonstrated in that O 3 exposure alters the Cl - current-voltage relationship, with the appearance of a large outward rectifier component mainly sustained by outward rectifier chloride channels (ORCCs) in human lung epithelial cells (A549 line). In the present study, we have performed patch clamp experiments, in order to identify which one of the O 3 byproducts (4hydroxynonenal (HNE) and/or H 2 O 2 ) was responsible for chloride current change. While 4HNE exposition (up to 25 μM for 30' before electrophysiological analysis) did not reproduce O 3 effect, H 2 O 2 produced by glucose oxidase 10 mU for 24 hr before electrophysiological analysis mimicked O 3 response. This result was confirmed treating the cell with catalase (CAT) before O 3 exposure (1,000 U/ml for 2 hr): CAT was able to rescue Cl - current alteration. Since CAT is regulated by Nrf2 transcription factor, we pre-treated the cells with the Nrf2 activators, resveratrol and tBHQ. Immunochemical and immunocytochemical results showed Nrf2 activation with both substances that lead to prevent OS effect on Cl - current. These data bring new insights into the mechanisms involved in OS-induced lung tissue damage, pointing out the role of H 2 O 2 in chloride current alteration and the ability of Nfr2 activation in preventing this effect. © 2017 Wiley Periodicals, Inc.

  19. Activating Nrf-2 signaling depresses unilateral ureteral obstruction-evoked mitochondrial stress-related autophagy, apoptosis and pyroptosis in kidney.

    Directory of Open Access Journals (Sweden)

    Shue Dong Chung

    Full Text Available Exacerbated oxidative stress and inflammation may induce three types of programmed cell death, autophagy, apoptosis and pyroptosis in unilateral ureteral obstruction (UUO kidney. Sulforaphane activating NF-E2-related nuclear factor erythroid-2 (Nrf-2 signaling may ameliorate UUO-induced renal damage. UUO was induced in the left kidney of female Wistar rats. The level of renal blood flow, cortical and medullary oxygen tension and reactive oxygen species (ROS was evaluated. Fibrosis, ED-1 (macrophage/monocyte infiltration, oxidative stress, autophagy, apoptosis and pyroptosis were evaluated by immunohistochemistry and Western blot in UUO kidneys. Effects of sulforaphane, an Nrf-2 activator, on Nrf-2- and mitochondrial stress-related proteins and renal injury were examined. UUO decreased renal blood flow and oxygen tension and increased renal ROS, 3-nitrotyrosine stain, ED-1 infiltration and fibrosis. Enhanced renal tubular Beclin-1 expression started at 4 h UUO and further enhanced at 3d UUO, whereas increased Atg-5-Atg12 and LC3-II expression were found at 3d UUO. Increased renal Bax/Bcl-2 ratio, caspase 3 and PARP fragments, apoptosis formation associated with increased caspase 1 and IL-1β expression for pyroptosis formation were started from 3d UUO. UUO reduced nuclear Nrf-2 translocation, increased cytosolic and inhibitory Nrf-2 expression, increased cytosolic Bax translocation to mitochondrial and enhanced mitochondrial Cytochrome c release into cytosol of the UUO kidneys. Sulforaphane significantly increased nuclear Nrf-2 translocation and decreased mitochondrial Bax translocation and Cytochrome c release into cytosol resulting in decreased renal injury. In conclusion, sulforaphane via activating Nrf-2 signaling preserved mitochondrial function and suppressed UUO-induced renal oxidative stress, inflammation, fibrosis, autophagy, apoptosis and pyroptosis.

  20. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin. (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T


    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  1. Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605 Reduces Asbestos-Induced Cytotoxicity in an Nrf2-Dependent and -Independent Manner

    Directory of Open Access Journals (Sweden)

    Ralph A. Pietrofesa


    Full Text Available Asbestos exposure triggers inflammatory processes associated with oxidative stress and tissue damage linked to malignancy. LGM2605 is the synthetic lignan secoisolariciresinol diglucoside (SDG with free radical scavenging, antioxidant, and anti-inflammatory properties in diverse inflammatory cell and mouse models, including exposure to asbestos fibers. Nuclear factor-E2 related factor 2 (Nrf2 activation and boosting of endogenous tissue defenses were associated with the protective action of LGM2605 from asbestos-induced cellular damage. To elucidate the role of Nrf2 induction by LGM2605 in protection from asbestos-induced cellular damage, we evaluated LGM2605 in asbestos-exposed macrophages from wild-type (WT and Nrf2 disrupted (Nrf2−/− mice. Cells were pretreated with LGM2605 (50 µM and 100 µM and exposed to asbestos fibers (20 µg/cm2 and evaluated 8 h and 24 h later for inflammasome activation, secreted cytokine levels (interleukin-1β (IL-1β, interleukin-18 (IL-18, interleukin-6 (IL-6, and tumor necrosis factor alpha (TNFα, cytotoxicity and cell death, nitrosative stress, and Nrf2-regulated enzyme levels. Asbestos exposure induced robust oxidative and nitrosative stress, cell death and cytotoxicity, which were equally mitigated by LGM2605. Inflammasome activation was significantly attenuated in Nrf2−/− macrophages compared to WT, and the protective action of LGM2605 was seen only in WT cells. In conclusion, in a cell model of asbestos-induced toxicity, LGM2605 acts via protective mechanisms that may not involve Nrf2 activation.

  2. Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605) Reduces Asbestos-Induced Cytotoxicity in an Nrf2-Dependent and -Independent Manner (United States)

    Pietrofesa, Ralph A.; Chatterjee, Shampa; Park, Kyewon; Arguiri, Evguenia; Albelda, Steven M.; Christofidou-Solomidou, Melpo


    Asbestos exposure triggers inflammatory processes associated with oxidative stress and tissue damage linked to malignancy. LGM2605 is the synthetic lignan secoisolariciresinol diglucoside (SDG) with free radical scavenging, antioxidant, and anti-inflammatory properties in diverse inflammatory cell and mouse models, including exposure to asbestos fibers. Nuclear factor-E2 related factor 2 (Nrf2) activation and boosting of endogenous tissue defenses were associated with the protective action of LGM2605 from asbestos-induced cellular damage. To elucidate the role of Nrf2 induction by LGM2605 in protection from asbestos-induced cellular damage, we evaluated LGM2605 in asbestos-exposed macrophages from wild-type (WT) and Nrf2 disrupted (Nrf2−/−) mice. Cells were pretreated with LGM2605 (50 µM and 100 µM) and exposed to asbestos fibers (20 µg/cm2) and evaluated 8 h and 24 h later for inflammasome activation, secreted cytokine levels (interleukin-1β (IL-1β), interleukin-18 (IL-18), interleukin-6 (IL-6), and tumor necrosis factor alpha (TNFα)), cytotoxicity and cell death, nitrosative stress, and Nrf2-regulated enzyme levels. Asbestos exposure induced robust oxidative and nitrosative stress, cell death and cytotoxicity, which were equally mitigated by LGM2605. Inflammasome activation was significantly attenuated in Nrf2−/− macrophages compared to WT, and the protective action of LGM2605 was seen only in WT cells. In conclusion, in a cell model of asbestos-induced toxicity, LGM2605 acts via protective mechanisms that may not involve Nrf2 activation. PMID:29498660

  3. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega


    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  4. SPBP is a sulforaphane induced transcriptional coactivator of NRF2 regulating expression of the autophagy receptor p62/SQSTM1.

    Directory of Open Access Journals (Sweden)

    Sagar Ramesh Darvekar

    Full Text Available Organisms exposed to oxidative stress respond by orchestrating a stress response to prevent further damage. Intracellular levels of antioxidant agents increase, and damaged components are removed by autophagy induction. The KEAP1-NRF2 signaling pathway is the main pathway responsible for cell defense against oxidative stress and for maintaining the cellular redox balance at physiological levels. Sulforaphane, an isothiocyanate derived from cruciferous vegetables, is a potent inducer of KEAP1-NRF2 signaling and antioxidant response element driven gene expression. In this study, we show that sulforaphane enhances the expression of the transcriptional coregulator SPBP. The expression curve peaks 6-8 hours post stimulation, and parallels the sulforaphane-induced expression of NRF2 and the autophagy receptor protein p62/SQSTM1. Reporter gene assays show that SPBP stimulates the expression of p62/SQSTM1 via ARE elements in the promoter region, and siRNA mediated knock down of SPBP significantly decreases the expression of p62/SQSTM1 and the formation of p62/SQSTM1 bodies in HeLa cells. Furthermore, SPBP siRNA reduces the sulforaphane induced expression of NRF2, and the expression of the autophagy marker protein LC3B. Both these proteins contain ARE-like elements in their promoter regions. Over-expressed SPBP and NRF2 acts synergistically on the p62/SQSTM1 promoter and colocalize in nuclear speckles in HeLa cells. Collectively, these results suggest that SPBP is a coactivator of NRF2, and hence may be important for securing enhanced and sustained expression of NRF2 induced genes such as proteins involved in selective autophagy.

  5. Sulforaphane reverses glucocorticoid-induced apoptosis in osteoblastic cells through regulation of the Nrf2 pathway

    Directory of Open Access Journals (Sweden)

    Lin H


    Full Text Available Hao Lin,1,* Bo Wei,1,* Guangsheng Li,1 Jinchang Zheng,1 Jiecong Sun,1 Jiaqi Chu,2 Rong Zeng,1 Yanru Niu21Department of Spinal Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang, People’s Republic of China; 2Laboratory Institute of Minimally Invasive Orthopedic Surgery, Affiliated Hospital of Guangdong Medical College, Zhanjiang, People’s Republic of China *These authors contributed equally to this work Abstract: Apoptosis of osteoblasts triggered by high-dose glucocorticoids (GCs has been identified as a major cause of osteoporosis. However, the underlying molecular mechanisms accounting for this action remain elusive, which has impeded the prevention and cure of this side effect. Sulforaphane (SFP is a naturally occurring isothiocyanate that has huge health benefits for humans. In this study, by using osteoblastic MC3T3-E1 cells as a model, we demonstrate the protective effects of SFP against dexamethasone (Dex-induced apoptosis and elucidate the underlying molecular mechanisms. The results show that SFP could effectively inhibit the Dex-induced growth inhibition and release of lactate dehydrogenase in MC3T3-E1 cells. Treatment with Dex induced caspase-dependent apoptosis in MC3T3-E1 cells, as evidenced by an increase in the Sub-G1 phase, chromatin condensation, and deoxyribonucleic acid fragmentation, which were significantly suppressed by coincubation with SFP. Mitochondria-mediated apoptosis pathway contributed importantly to Dex-induced apoptosis, as revealed by the activation of caspase-3/-9 and subsequent cleavage of poly adenosine diphosphate ribose polymerase, which was also effectively blocked by SFP. Moreover, treatments of Dex strongly induced overproduction of reactive oxygen species and inhibited the expression of nuclear factor erythroid 2-related factor 2 (Nrf2 and the downstream effectors HO1 and NQO1. However, cotreatment with SFP effectively reversed this action of Dex. Furthermore, silencing of Nrf2 by

  6. NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells

    International Nuclear Information System (INIS)

    Pecorelli, Alessandra; Bocci, Velio; Acquaviva, Alessandra; Belmonte, Giuseppe; Gardi, Concetta; Virgili, Fabio; Ciccoli, Lucia; Valacchi, Giuseppe


    During the last decade, it has been shown that the activation of NRF2 and the binding to electrophile-responsive element (EpREs), stimulates the expression of a great number of genes responsible for the synthesis of phase I and phase II proteins, including antioxidants enzymes and heme oxygenase-1 (HO-1). This critical cell response occurs in cardiovascular, degenerative and chronic infective diseases aggravated by a chronic oxidative stress. In our previous reports we have shown that ozonated plasma is able to up-regulate HO-1 expression in endothelial cells. In the present work we investigated a candidate mechanism involved in this process. After treatment with increasing doses of ozonated serum (20, 40 and 80 μg/mL O 3 per mL of serum), a clear dose dependent activation of NRF2 and the subsequent induction of HO-1 and NAD(P)H quinone oxidoreductase 1(NQO1) was observed. This effect was also present when cells were treated with serum and hydrogen peroxide (H 2 O 2 ) or serum and 4-hydroxynonenal (4HNE). Moreover, the treatment with ozonated serum was associated with a dose-dependent activation of extracellular-signal-regulated kinases (ERK1/2) and p38 MAP kinases (p38), not directly involved in NRF2 activation. These data, provide a new insight on the mechanism responsible for the induction of HO-1 expression by ozonated serum in the endothelium, and have a practical importance as an expedient approach to the treatment of patients with both effective orthodox drugs and ozonated autohemotherapy, targeted to the restoration of redox homeostasis. - Highlights: ► Endothelial HO1 is upregulated by ozonated plasma ► This activation is induced by NRF2 and it is ERK independent. ► 4HNE and H 2 O 2 are the main molecules involved in this process. ► Ozonated plasma induced a hormetic effect ► Combination of orthodox medicine and ozonated plasma can be a useful treatment

  7. NRF2 activation is involved in ozonated human serum upregulation of HO-1 in endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Pecorelli, Alessandra [Department of Molecular and Developmental Medicine, University of Siena (Italy); Child Neuropsychiatry Unit, University Hospital, AOUS, Siena (Italy); Bocci, Velio [Department of Physiology, University of Siena (Italy); Acquaviva, Alessandra [Department of Molecular and Developmental Medicine, University of Siena (Italy); Belmonte, Giuseppe [Department of Biomedical Sciences, University of Siena (Italy); Gardi, Concetta [Department of Molecular and Developmental Medicine, University of Siena (Italy); Virgili, Fabio [INRAN, Rome (Italy); Ciccoli, Lucia [Department of Molecular and Developmental Medicine, University of Siena (Italy); Valacchi, Giuseppe, E-mail: [Department of Life Sciences and Biotechnology, University of Ferrara (Italy); Department of Food and Nutrition, Kyung Hee University, Seoul (Korea, Republic of)


    During the last decade, it has been shown that the activation of NRF2 and the binding to electrophile-responsive element (EpREs), stimulates the expression of a great number of genes responsible for the synthesis of phase I and phase II proteins, including antioxidants enzymes and heme oxygenase-1 (HO-1). This critical cell response occurs in cardiovascular, degenerative and chronic infective diseases aggravated by a chronic oxidative stress. In our previous reports we have shown that ozonated plasma is able to up-regulate HO-1 expression in endothelial cells. In the present work we investigated a candidate mechanism involved in this process. After treatment with increasing doses of ozonated serum (20, 40 and 80 μg/mL O{sub 3} per mL of serum), a clear dose dependent activation of NRF2 and the subsequent induction of HO-1 and NAD(P)H quinone oxidoreductase 1(NQO1) was observed. This effect was also present when cells were treated with serum and hydrogen peroxide (H{sub 2}O{sub 2}) or serum and 4-hydroxynonenal (4HNE). Moreover, the treatment with ozonated serum was associated with a dose-dependent activation of extracellular-signal-regulated kinases (ERK1/2) and p38 MAP kinases (p38), not directly involved in NRF2 activation. These data, provide a new insight on the mechanism responsible for the induction of HO-1 expression by ozonated serum in the endothelium, and have a practical importance as an expedient approach to the treatment of patients with both effective orthodox drugs and ozonated autohemotherapy, targeted to the restoration of redox homeostasis. - Highlights: ► Endothelial HO1 is upregulated by ozonated plasma ► This activation is induced by NRF2 and it is ERK independent. ► 4HNE and H{sub 2}O{sub 2} are the main molecules involved in this process. ► Ozonated plasma induced a hormetic effect ► Combination of orthodox medicine and ozonated plasma can be a useful treatment.

  8. Nrf2-inducing anti-oxidation stress response in the rat liver--new beneficial effect of lansoprazole. (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao


    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10-100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and phase

  9. Nrf2-Inducing Anti-Oxidation Stress Response in the Rat Liver - New Beneficial Effect of Lansoprazole (United States)

    Yamashita, Yasunobu; Ueyama, Takashi; Nishi, Toshio; Yamamoto, Yuta; Kawakoshi, Akatsuki; Sunami, Shogo; Iguchi, Mikitaka; Tamai, Hideyuki; Ueda, Kazuki; Ito, Takao; Tsuruo, Yoshihiro; Ichinose, Masao


    Lansoprazole is a potent anti-gastric ulcer drug that inhibits gastric proton pump activity. We identified a novel function for lansoprazole, as an inducer of anti-oxidative stress responses in the liver. Gastric administration of lansoprazole (10–100 mg/kg) to male Wistar rats produced a dose-dependent increase in hepatic mRNA levels of nuclear factor, erythroid-derived 2, -like 2 (Nrf2), a redox-sensitive transcription factor, at 3 h and Nrf2 immunoreactivity (IR) in whole hepatic lysates at 6 h. Conversely, the levels of Kelch-like ECH-associated protein (Keap1), which sequesters Nrf2 in the cytoplasm under un-stimulated conditions, were unchanged. Translocation of Nrf2 into the nuclei of hepatocytes was observed using western blotting and immunohistochemistry. Expression of mRNAs for Nrf2-dependent antioxidant and phase II enzymes, such as heme oxygenase 1 (HO-1), NAD (P) H dehydrogenase, quinone 1 (Nqo1), glutathione S-transferase A2 (Gsta2), UDP glucuronosyltransferase 1 family polypeptide A6 (Ugt1a6), were dose-dependently up-regulated at 3 h. Furthermore, the levels of HO-1 IR were dose-dependently increased in hepatocytes at 6 h. Subcutaneous administration of lansoprazole (30 mg/kg/day) for 7 successive days resulted in up-regulation and nuclear translocation of Nrf2 IR in hepatocytes and up-regulation of HO-1 IR in the liver. Pretreatment with lansoprazole attenuated thioacetamide (500 mg/kg)-induced acute hepatic damage via both HO-1-dependent and -independent pathways. Up-stream networks related to Nrf2 expression were investigated using microarray analysis, followed by data mining with Ingenuity Pathway Analysis. Up-regulation of the aryl hydrocarbon receptor (AhR)-cytochrome P450, family 1, subfamily a, polypeptide 1 (Cyp1a1) pathway was associated with up-regulation of Nrf2 mRNA. In conclusion, lansoprazole might have an alternative indication in the prevention and treatment of oxidative hepatic damage through the induction of both phase I and

  10. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Hui [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Wang, Huihui [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Xue, Peng [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Hou, Yongyong [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Dong, Jian [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Biology and Medicine, Wuhan University of Science and Technology, Wuhan (China); Zhou, Tong [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Peng, Shuangqing [Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Li, Jin; Carmichael, Paul L. [Unilever, Safety & Environmental Assurance Centre, Colworth Science Park, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E. [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Pi, Jingbo, E-mail: [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States)


    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As{sub 2}O{sub 3}), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As{sub 2}O{sub 3}-challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As{sub 2}O{sub 3}-induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As{sub 2}O{sub 3}-induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As{sub 2}O{sub 3} in AML cells. • Sensitization of THP-1 cells to As{sub 2}O{sub 3} toxicity by ethionamide is NRF2-dependent.

  11. The Dual Role of Nrf2 in Nonalcoholic Fatty Liver Disease: Regulation of Antioxidant Defenses and Hepatic Lipid Metabolism

    Directory of Open Access Journals (Sweden)

    Sílvia S. Chambel


    Full Text Available Nonalcoholic fatty liver disease (NAFLD is a progressive liver disease with ever-growing incidence in the industrialized world. It starts with the simple accumulation of lipids in the hepatocyte and can progress to the more severe nonalcoholic steatohepatitis (NASH, which is associated with inflammation, fibrosis, and cirrhosis. There is increasing awareness that reactive oxygen species and electrophiles are implicated in the pathogenesis of NASH. Transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2 is a positive regulator of the expression of a battery of genes involved in the protection against oxidative/electrophilic stress. In rodents, Nrf2 is also known to participate in hepatic fatty acid metabolism, as a negative regulator of genes that promote hepatosteatosis. We review relevant evidence in the literature that these two mechanisms may contribute to the protective role of Nrf2 in the development of hepatic steatosis and in the progression to steatohepatitis, particularly in young animals. We propose that age may be a key to explain contradictory findings in the literature. In summary, Nrf2 mediates the crosstalk between lipid metabolism and antioxidant defense mechanisms in experimental models of NAFLD, and the nutritional or pharmacological induction of Nrf2 represents a promising potential new strategy for its prevention and treatment.

  12. Activation of Nrf2 Signaling Augments Vesicular Stomatitis Virus Oncolysis via Autophagy-Driven Suppression of Antiviral Immunity. (United States)

    Olagnier, David; Lababidi, Rassin R; Hadj, Samar Bel; Sze, Alexandre; Liu, Yiliu; Naidu, Sharadha Dayalan; Ferrari, Matteo; Jiang, Yuan; Chiang, Cindy; Beljanski, Vladimir; Goulet, Marie-Line; Knatko, Elena V; Dinkova-Kostova, Albena T; Hiscott, John; Lin, Rongtuan


    Oncolytic viruses (OVs) offer a promising therapeutic approach to treat multiple types of cancer. In this study, we show that the manipulation of the antioxidant network via transcription factor Nrf2 augments vesicular stomatitis virus Δ51 (VSVΔ51) replication and sensitizes cancer cells to viral oncolysis. Activation of Nrf2 signaling by the antioxidant compound sulforaphane (SFN) leads to enhanced VSVΔ51 spread in OV-resistant cancer cells and improves the therapeutic outcome in different murine syngeneic and xenograft tumor models. Chemoresistant A549 lung cancer cells that display constitutive dominant hyperactivation of Nrf2 signaling are particularly vulnerable to VSVΔ51 oncolysis. Mechanistically, enhanced Nrf2 signaling stimulated viral replication in cancer cells and disrupted the type I IFN response via increased autophagy. This study reveals a previously unappreciated role for Nrf2 in the regulation of autophagy and the innate antiviral response that complements the therapeutic potential of VSV-directed oncolysis against multiple types of OV-resistant or chemoresistant cancer. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Rosemary Extracts Upregulate Nrf2, Sestrin2, and MRP2 Protein Level in Human Hepatoma HepG2 Cells

    Directory of Open Access Journals (Sweden)

    Xiao-pei Tong


    Full Text Available In the past few decades, the incidence of liver cancer has been rapidly rising across the world. Rosemary is known to possess antioxidant activity and is used as natural antioxidant food preservative. It is proposed to have anticancer activity in treating different tumor models. In this study, we try to explore the impact of rosemary extracts on upregulating the level of Nrf2 and Nrf2-regulatory proteins, Sestrin2 and MRP2 in HepG2 cells, and to speculate its potential mechanism. The anticancer activity of rosemary extract, including its polyphenolic diterpenes carnosic acid and carnosol, was evaluated to understand the potential effect on HepG2 cells. Rosemary extract, carnosic acid, and carnosol induced the expression of Sestrin2 and MRP2 associate with enhancement of Nrf2 protein level in HepG2 cells, in which carnosic acid showed most obvious effect. Although the activation pathway of Nrf2/ARE was not exactly assessed, it can be assumed that the enhancement of expression of Sestrin2 and MRP2 may result from upregulation of Nrf2.

  14. Taurine protects against As2O3-induced autophagy in pancreas of rat offsprings through Nrf2/Trx pathway. (United States)

    Bai, Jie; Yao, Xiaofeng; Jiang, Liping; Qiu, Tianming; Liu, Shuang; Qi, Baoxu; Zheng, Yue; Kong, Yuan; Yang, Guang; Chen, Min; Liu, Xiaofang; Sun, Xiance


    Arsenic was increasingly to blame as a risk factor for type 2 diabetes mellitus. In our previous study, we had found iAs stimulated autophagic flux and caused autophagic cell death through ROS pathway in INS-1 cells. Since NF-E2-related factor 2 (Nrf2) and the thioredoxin (Trx) system was a crucial line of defense against ROS, we investigated whether Nrf2/Trx pathway contributed to As2O3-stimulated autophagy and the role of taurine in this study. After treatment with 2 mg/kg BW-8 mg/kg BW As2O3 for 57 d, the expression of Nrf2 protein was decreased significantly in offsprings' pancreas. The expression of Trx gene was decreased significantly in pancreas subsequently. Finally, the generation of reactive oxygen species stimulated autophagy in arsenic-treated pancreas. Taurine could reverse arsenic-inhibited Nrf2 and Trx and inhibit autophagy. In short, inhibition of Nrf2/Trx pathway might play an important role in the pathogenesis of arsenic-related diabetes. Taurine could serve as nutrition supplementation against arsenic-related diabetes in high arsenic exposure area. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  15. Impaired transcriptional activity of Nrf2 in age-related myocardial oxidative stress is reversible by moderate exercise training.

    Directory of Open Access Journals (Sweden)

    Sellamuthu S Gounder

    Full Text Available Aging promotes accumulation of reactive oxygen/nitrogen species (ROS/RNS in cardiomyocytes, which leads to contractile dysfunction and cardiac abnormalities. These changes may contribute to increased cardiovascular disease in the elderly. Inducible antioxidant pathways are regulated by nuclear erythroid 2 p45-related factor 2 (Nrf2 through antioxidant response cis-elements (AREs and are impaired in the aging heart. Whereas acute exercise stress (AES activates Nrf2 signaling and promotes myocardial antioxidant function in young mice (~2 months, aging mouse (>23 months hearts exhibit significant oxidative stress as compared to those of the young. The purpose of this study was to investigate age-dependent regulation of Nrf2-antioxidant mechanisms and redox homeostasis in mouse hearts and the impact of exercise. Old mice were highly susceptible to oxidative stress following high endurance exercise stress (EES, but demonstrated increased adaptive redox homeostasis after moderate exercise training (MET; 10m/min, for 45 min/day for ~6 weeks. Following EES, transcription and protein levels for most of the ARE-antioxidants were increased in young mice but their induction was blunted in aging mice. In contrast, 6-weeks of chronic MET promoted nuclear levels of Nrf2 along with its target antioxidants in the aging heart to near normal levels as seen in young mice. These observations suggest that enhancing Nrf2 function and endogenous cytoprotective mechanisms by MET, may combat age-induced ROS/RNS and protect the myocardium from oxidative stress diseases.

  16. Sulforaphane and Other Nutrigenomic Nrf2 Activators: Can the Clinician’s Expectation Be Matched by the Reality?

    Directory of Open Access Journals (Sweden)

    Christine A. Houghton


    Full Text Available The recognition that food-derived nonnutrient molecules can modulate gene expression to influence intracellular molecular mechanisms has seen the emergence of the fields of nutrigenomics and nutrigenetics. The aim of this review is to describe the properties of nutrigenomic activators of transcription factor Nrf2 (nuclear factor erythroid 2-related factor 2, comparing the potential for sulforaphane and other phytochemicals to demonstrate clinical efficacy as complementary medicines. Broccoli-derived sulforaphane emerges as a phytochemical with this capability, with oral doses capable of favourably modifying genes associated with chemoprevention. Compared with widely used phytochemical-based supplements like curcumin, silymarin, and resveratrol, sulforaphane more potently activates Nrf2 to induce the expression of a battery of cytoprotective genes. By virtue of its lipophilic nature and low molecular weight, sulforaphane displays significantly higher bioavailability than the polyphenol-based dietary supplements that also activate Nrf2. Nrf2 activation induces cytoprotective genes such as those playing key roles in cellular defense mechanisms including redox status and detoxification. Both its high bioavailability and significant Nrf2 inducer capacity contribute to the therapeutic potential of sulforaphane-yielding supplements.

  17. Oxidative Stress in Cardiovascular Diseases: Involvement of Nrf2 Antioxidant Redox Signaling in Macrophage Foam Cells Formation

    Directory of Open Access Journals (Sweden)

    Bee Kee Ooi


    Full Text Available Oxidative stress is an important risk factor contributing to the pathogenesis of cardiovascular diseases. Oxidative stress that results from excessive reactive oxygen species (ROS production accounts for impaired endothelial function, a process which promotes atherosclerotic lesion or fatty streaks formation (foam cells. Nuclear factor erythroid 2-related factor 2 (Nrf2 is a transcription factor involved in cellular redox homeostasis. Upon exposure to oxidative stress, Nrf2 is dissociated from its inhibitor Keap-1 and translocated into the nucleus, where it results in the transcriptional activation of cell defense genes. Nrf2 has been demonstrated to be involved in the protection against foam cells formation by regulating the expression of antioxidant proteins (HO-1, Prxs, and GPx1, ATP-binding cassette (ABC efflux transporters (ABCA1 and ABCG1 and scavenger receptors (scavenger receptor class B (CD36, scavenger receptor class A (SR-A and lectin-type oxidized LDL receptor (LOX-1. However, Nrf2 has also been reported to exhibit pro-atherogenic effects. A better understanding on the mechanism of Nrf2 in oxidative stress-induced cardiac injury, as well as the regulation of cholesterol uptake and efflux, are required before it can serve as a novel therapeutic target for cardiovascular diseases prevention and treatment.

  18. Neutral sphingomyelinase (SMPD3) deficiency causes a novel form of chondrodysplasia and dwarfism that is rescued by Col2A1-driven smpd3 transgene expression. (United States)

    Stoffel, Wilhelm; Jenke, Britta; Holz, Barbara; Binczek, Erika; Günter, Robert Heinz; Knifka, Jutta; Koebke, Jürgen; Niehoff, Anja


    Neutral sphingomyelinase SMPD3 (nSMase2), a sphingomyelin phosphodiesterase, resides in the Golgi apparatus and is ubiquitously expressed. Gene ablation of smpd3 causes a generalized prolongation of the cell cycle that leads to late embryonic and juvenile hypoplasia because of the SMPD3 deficiency in hypothalamic neurosecretory neurons. We show here that this novel form of combined pituitary hormone deficiency is characterized by the perturbation of the hypothalamus-pituitary growth axis, associated with retarded chondrocyte development and enchondral ossification in the epiphyseal growth plate. To study the contribution by combined pituitary hormone deficiency and by the local SMPD3 deficiency in the epiphyseal growth plate to the skeletal phenotype, we introduced the full-length smpd3 cDNA transgene under the control of the chondrocyte-specific promoter Col2a1. A complete rescue of the smpd3(-/-) mouse from severe short-limbed skeletal dysplasia was achieved. The smpd3(-/-) mouse shares its dwarf and chondrodysplasia phenotype with the most common form of human achondrodysplasia, linked to the fibroblast-growth-factor receptor 3 locus, not linked to deficits in the hypothalamic-pituitary epiphyseal growth plate axis. The rescue of smpd3 in vivo has implications for future research into dwarfism and, particularly, growth and development of the skeletal system and for current screening and future treatment of combined dwarfism and chondrodysplasia.

  19. Neutral Sphingomyelinase (SMPD3) Deficiency Causes a Novel Form of Chondrodysplasia and Dwarfism That Is Rescued by Col2A1-Driven smpd3 Transgene Expression (United States)

    Stoffel, Wilhelm; Jenke, Britta; Holz, Barbara; Binczek, Erika; Günter, Robert Heinz; Knifka, Jutta; Koebke, Jürgen; Niehoff, Anja


    Neutral sphingomyelinase SMPD3 (nSMase2), a sphingomyelin phosphodiesterase, resides in the Golgi apparatus and is ubiquitously expressed. Gene ablation of smpd3 causes a generalized prolongation of the cell cycle that leads to late embryonic and juvenile hypoplasia because of the SMPD3 deficiency in hypothalamic neurosecretory neurons. We show here that this novel form of combined pituitary hormone deficiency is characterized by the perturbation of the hypothalamus-pituitary growth axis, associated with retarded chondrocyte development and enchondral ossification in the epiphyseal growth plate. To study the contribution by combined pituitary hormone deficiency and by the local SMPD3 deficiency in the epiphyseal growth plate to the skeletal phenotype, we introduced the full-length smpd3 cDNA transgene under the control of the chondrocyte-specific promoter Col2a1. A complete rescue of the smpd3−/− mouse from severe short-limbed skeletal dysplasia was achieved. The smpd3−/− mouse shares its dwarf and chondrodysplasia phenotype with the most common form of human achondrodysplasia, linked to the fibroblast-growth-factor receptor 3 locus, not linked to deficits in the hypothalamic-pituitary epiphyseal growth plate axis. The rescue of smpd3 in vivo has implications for future research into dwarfism and, particularly, growth and development of the skeletal system and for current screening and future treatment of combined dwarfism and chondrodysplasia. PMID:17591962

  20. ROS signaling, oxidative stress and Nrf2 in pancreatic beta-cell function

    International Nuclear Information System (INIS)

    Pi Jingbo; Zhang Qiang; Fu Jingqi; Woods, Courtney G.; Hou Yongyong; Corkey, Barbara E.; Collins, Sheila; Andersen, Melvin E.


    This review focuses on the emerging evidence that reactive oxygen species (ROS) derived from glucose metabolism, such as H 2 O 2 , act as metabolic signaling molecules for glucose-stimulated insulin secretion (GSIS) in pancreatic beta-cells. Particular emphasis is placed on the potential inhibitory role of endogenous antioxidants, which rise in response to oxidative stress, in glucose-triggered ROS and GSIS. We propose that cellular adaptive response to oxidative stress challenge, such as nuclear factor E2-related factor 2 (Nrf2)-mediated antioxidant induction, plays paradoxical roles in pancreatic beta-cell function. On the one hand, induction of antioxidant enzymes protects beta-cells from oxidative damage and possible cell death, thus minimizing oxidative damage-related impairment of insulin secretion. On the other hand, the induction of antioxidant enzymes by Nrf2 activation blunts glucose-triggered ROS signaling, thus resulting in reduced GSIS. These two premises are potentially relevant to impairment of beta-cells occurring in the late and early stage of Type 2 diabetes, respectively. In addition, we summarized our recent findings that persistent oxidative stress due to absence of uncoupling protein 2 activates cellular adaptive response which is associated with impaired pancreatic beta-cell function.

  1. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo [Food and Drug Administration, Silver Spring, MD (United States); Yamada, Kenneth M. [National Institutes of Health, Bethesda, MD (United States); Dhawan, Subhash, E-mail: [Food and Drug Administration, Silver Spring, MD (United States)


    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  2. Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

    International Nuclear Information System (INIS)

    Huang, Hanxia; Falgout, Barry; Takeda, Kazuyo; Yamada, Kenneth M.; Dhawan, Subhash


    We identified primary human monocyte-derived macrophages (MDM) as vulnerable target cells for Zika virus (ZIKV) infection. We demonstrate dramatic effects of hemin, the natural inducer of the heme catabolic enzyme heme oxygenase-1 (HO-1), in the reduction of ZIKV replication in vitro. Both LLC-MK2 monkey kidney cells and primary MDM exhibited hemin-induced HO-1 expression with major reductions of >90% in ZIKV replication, with little toxicity to infected cells. Silencing expression of HO-1 or its upstream regulatory gene, nuclear factor erythroid-related factor 2 (Nrf2), attenuated hemin-induced suppression of ZIKV infection, suggesting an important role for induction of these intracellular mediators in retarding ZIKV replication. The inverse correlation between hemin-induced HO-1 levels and ZIKV replication provides a potentially useful therapeutic modality based on stimulation of an innate cellular response against Zika virus infection. - Highlights: •Hemin treatment protected monocyte-derived macrophages against Zika virus (ZIKV) infection. •Innate cellular protection against ZIKV infection correlated with Nrf2-dependent HO-1 expression. •Stimulation of innate cellular responses may provide a therapeutic strategy against ZIKV infection.

  3. Agmatine induces Nrf2 and protects against corticosterone effects in hippocampal neuronal cell line. (United States)

    Freitas, Andiara E; Egea, Javier; Buendía, Izaskun; Navarro, Elisa; Rada, Patricia; Cuadrado, Antonio; Rodrigues, Ana Lúcia S; López, Manuela G


    Hyperactivation of the hypothalamic-pituitary-adrenal axis is a common finding in major depression; this may lead to increased levels of cortisol, which are known to cause oxidative stress imbalance and apoptotic neuronal cell death, particularly in the hippocampus, a key region implicated in mood regulation. Agmatine, an endogenous metabolite of L-arginine, has been proposed for the treatment of major depression. Corticosterone induced apoptotic cell death and increased ROS production in cultured hippocampal neuronal cells, effects that were abolished in a concentration- and time-dependent manner by agmatine. Interestingly, the combination of sub-effective concentrations of agmatine with fluoxetine or imipramine afforded synergic protection. The neuroprotective effect of agmatine was abolished by yohimbine (α2-adrenoceptor antagonist), ketanserin (5-HT2A receptor antagonist), LY294002 (PI3K inhibitor), PD98059 (MEK1/2 inhibitor), SnPP (HO-1 inhibitor), and cycloheximide (protein synthesis inhibitor). Agmatine increased Akt and ERK phosphorylation and induced the transcription factor Nrf2 and the proteins HO-1 and GCLc; induction of these proteins was prevented by yohimbine, ketanserin, LY294002, and PD98059. In conclusion, agmatine affords neuroprotection against corticosterone effects by a mechanism that implicates Nrf2 induction via α2-adrenergic and 5-HT2A receptors, Akt and ERK pathways, and HO-1 and GCLc expression.

  4. Modulatory Mechanism of Polyphenols and Nrf2 Signaling Pathway in LPS Challenged Pregnancy Disorders

    Directory of Open Access Journals (Sweden)

    Tarique Hussain


    Full Text Available Early embryonic loss and adverse birth outcomes are the major reproductive disorders that affect both human and animals. The LPS induces inflammation by interacting with robust cellular mechanism which was considered as a plethora of numerous reproductive disorders such as fetal resorption, preterm birth, teratogenicity, intrauterine growth restriction, abortion, neural tube defects, fetal demise, and skeletal development retardation. LPS-triggered overproduction of free radicals leads to oxidative stress which mediates inflammation via stimulation of NF-κB and PPARγ transcription factors. Flavonoids, which exist in copious amounts in nature, possess a wide array of functions; their supplementation during pregnancy activates Nrf2 signaling pathway which encounters pregnancy disorders. It was further presumed that the development of strong antioxidant uterine environment during gestation can alleviate diseases which appear at adult stages. The purpose of this review is to focus on modulatory properties of flavonoids on oxidative stress-mediated pregnancy insult and abnormal outcomes and role of Nrf2 activation in pregnancy disorders. These findings would be helpful for providing new insights in ameliorating oxidative stress-induced pregnancy disorders.

  5. Carbon monoxide mediates heme oxygenase 1 induction via Nrf2 activation in hepatoma cells

    International Nuclear Information System (INIS)

    Lee, Bok-Soo; Heo, JungHee; Kim, Yong-Man; Shim, Sang Moo; Pae, Hyun-Ock; Kim, Young-Myeong; Chung, Hun-Taeg


    Carbon monoxide (CO) and nitric oxide (NO) are two gas molecules which have cytoprotective functions against oxidative stress and inflammatory responses in many cell types. Currently, it is known that NO produced by nitric oxide synthase (NOS) induces heme oxygenase 1 (HO1) expression and CO produced by the HO1 inhibits inducible NOS expression. Here, we first show CO-mediated HO1 induction and its possible mechanism in human hepatocytes. Exposure of HepG2 cells or primary hepatocytes to CO resulted in dramatic induction of HO1 in dose- and time-dependent manner. The CO-mediated HO1 induction was abolished by MAP kinase inhibitors (MAPKs) but not affected by inhibitors of PI3 kinase or NF-κB. In addition, CO induced the nuclear translocation and accumulation of Nrf2, which suppressed by MAPKs inhibitors. Taken together, we suggest that CO induces Nrf2 activation via MAPKs signaling pathways, thereby resulting in HO1 expression in HepG2 cells

  6. Molecular Evolution of the Nuclear Factor (Erythroid-Derived 2)-Like 2 Gene Nrf2 in Old World Fruit Bats (Chiroptera: Pteropodidae). (United States)

    Yin, Qiuyuan; Zhu, Lei; Liu, Di; Irwin, David M; Zhang, Shuyi; Pan, Yi-Hsuan


    Mammals developed antioxidant systems to defend against oxidative damage in their daily life. Enzymatic antioxidants and low molecular weight antioxidants (LMWAs) constitute major parts of the antioxidant systems. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2, encoded by the Nrf2 gene) is a central transcriptional regulator, regulating transcription, of many antioxidant enzymes. Frugivorous bats eat large amounts of fruits that contain high levels of LMWAs such as vitamin C, thus, a reliance on LMWAs might greatly reduce the need for antioxidant enzymes in comparison to insectivorous bats. Therefore, it is possible that frugivorous bats have a reduced need for Nrf2 function due to their substantial intake of diet-antioxidants. To test whether the Nrf2 gene has undergone relaxed evolution in fruit-eating bats, we obtained Nrf2 sequences from 16 species of bats, including four Old World fruit bats (Pteropodidae) and one New World fruit bat (Phyllostomidae). Our molecular evolutionary analyses revealed changes in the selection pressure acting on Nrf2 gene and identified seven specific amino acid substitutions that occurred on the ancestral lineage leading to Old World fruit bats. Biochemical experiments were conducted to examine Nrf2 in Old World fruit bats and showed that the amount of catalase, which is regulated by Nrf2, was significantly lower in the brain, heart and liver of Old World fruit bats despite higher levels of Nrf2 protein in Old World fruit bats. Computational predictions suggest that three of these seven amino acid replacements might be deleterious to Nrf2 function. Therefore, the results suggest that Nrf2 gene might have experienced relaxed constraint in Old World fruit bats, however, we cannot rule out the possibility of positive selection. Our study provides the first data on the molecular adaptation of Nrf2 gene in frugivorous bats in compensation to the increased levels of LWMAs from their fruit-diet.

  7. Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Xu [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Wang, Dapeng [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Department of Toxicology, School of Public Health, Guizhou Medical University, Guiyang, Guizhou (China); Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China); Yamanaka, Kenzo [Laboratory of Environmental Toxicology and Carcinogenesis, School of Pharmacy, Nihon University, Chiba (Japan); An, Yan, E-mail: [Department of Toxicology, School of Public Health, Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric Diseases, Medical College of Soochow University, Suzhou, Jiangsu (China)


    Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

  8. Continuous activation of Nrf2 and its target antioxidant enzymes leads to arsenite-induced malignant transformation of human bronchial epithelial cells

    International Nuclear Information System (INIS)

    Yang, Xu; Wang, Dapeng; Ma, Yuan; Xu, Xiguo; Zhu, Zhen; Wang, Xiaojuan; Deng, Hanyi; Li, Chunchun; Chen, Min; Tong, Jian; Yamanaka, Kenzo; An, Yan


    Long-term exposure to arsenite leads to human lung cancer, but the underlying mechanisms of carcinogenesis remain obscure. The transcription factor of nuclear factor-erythroid-2 p45-related factor (Nrf2)-mediated antioxidant response represents a critical cellular defense mechanism and protection against various diseases. Paradoxically, emerging data suggest that the constitutive activation of Nrf2 is associated with cancer development, progression and chemotherapy resistance. However, the role of Nrf2 in the occurrence of cancer induced by long-term arsenite exposure remains to be fully understood. By establishing transformed human bronchial epithelial (HBE) cells via chronic low-dose arsenite treatment, we showed that, in acquiring this malignant phenotype, continuous low level of ROS and sustained enhancement of Nrf2 and its target antioxidant enzyme levels were observed in the later-stage of arsenite-induced cell transformation. The downregulation of Keap1 level may be responsible for the over-activation of Nrf2 and its target enzymes. To validate these observations, Nrf2 was knocked down in arsenite-transformed HBE cells by SiRNA transfection, and the levels of Nrf2 and its target antioxidant enzymes, ROS, cell proliferation, migration, and colony formation were determined following these treatments. Results showed that blocked Nrf2 expression significantly reduced Nrf2 and its target antioxidant enzyme levels, restored ROS levels, and eventually suppressed cell proliferation, migration, and colony formation of the transformed cells. In summary, the results of the study strongly suggested that the continuous activation of Nrf2 and its target antioxidant enzymes led to the over-depletion of intracellular ROS levels, which contributed to arsenite-induced HBE cell transformation. - Highlights: • Low level, long term arsenite exposure induces malignant transformation in vitro. • Long term arsenite exposure reduces ROS and MDA levels. • Long term arsenite

  9. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing. (United States)

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao


    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  10. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail:


    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  11. A novel natural Nrf2 activator with PPARγ-agonist (monascin) attenuates the toxicity of methylglyoxal and hyperglycemia

    Energy Technology Data Exchange (ETDEWEB)

    Hsu, Wei-Hsuan; Lee, Bao-Hong; Chang, Yu-Ying [Department of Biochemical Science and Technology, College of Life Science, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China); Hsu, Ya-Wen [SunWay Biotechnology Company, Taipei, Taiwan (China); Pan, Tzu-Ming, E-mail: [Department of Biochemical Science and Technology, College of Life Science, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 10617, Taiwan (China)


    Methylglyoxal (MG) is a toxic-glucose metabolite and a major precursor of advanced glycation endproducts (AGEs). MG has been reported to result in inflammation by activating receptor for AGEs (RAGE). We recently found that Monascus-fermented metabolite monascin acts as a novel natural peroxisome proliferator-activated receptor-γ (PPARγ) agonist that improves insulin sensitivity. We investigated the metabolic, biochemical, and molecular abnormalities characteristic of type 2 diabetes in MG-treated Wistar rats treated with oral administration of monascin or rosiglitazone. Monascin (a novel PPARγ agonist) activated nuclear factor-erythroid 2-related factor 2 (Nrf2) and down-regulated hyperinsulinmia in oral glucose tolerance test (OGTT). Monascin was able to elevate glyoxalase-1 expression via activation of hepatic Nrf2, hence, resulting in MG metabolism to D-lactic acid and protected from AGEs production in MG-treated rats. Rosiglitazone did not activate Nrf2 nor glyoxalase expression to lower serum and hepatic AGEs levels. Monascin acts as a novel natural Nrf2 activator with PPARγ-agonist activity were confirmed by Nrf2 and PPARγ reporter assays in Hep G2 cells. These findings suggest that monascin acts as an anti-diabetic and anti-oxidative stress agent to a greater degree than rosiglitazone and thus may have therapeutic potential for the prevention of diabetes. - Highlights: • Monascin acts as a PPARgamma agonist. • Monascin activates Nrf2 and AMPK. • Monascin promotes MG metabolism into D-lactic acid. • Monascin attenuates inflammation and diabetes in vivo.

  12. Selenium antagonizes cadmium-induced apoptosis in chicken spleen but not involving Nrf2-regulated antioxidant response. (United States)

    Chen, Menghao; Li, Xiaojing; Fan, Ruifeng; Cao, Changyu; Yao, Haidong; Xu, Shiwen


    The nuclear transcription factor NF-E2-related factor 2 (Nrf2) binds to antioxidant response elements (AREs) and is involved in the regulation of genes participated in defending cells against oxidative damage, which have been confirmed in animal models. Selenium (Se), known as an important element in the regulation of antioxidant activity, can antagonize Cadmium (Cd) toxicity in birds. However, the role of Nrf2 in selenium-cadmium interaction has not been reported in birds. To further explore the mechanism of selenium attenuating spleen toxicity induced by cadmium in chickens, cadmium chloride (CdCl 2 , 150mg/kg) and sodium selenite (Na 2 SeO 3 , 2mg/kg) were co-administrated or individually administered in the diet of chickens for 90 days. The results showed that Cd exposure increased the level of hydrogen peroxide (H 2 O 2 ) and malondialdehyde (MDA) and decreased the antioxidant enzyme activities, including superoxide dismutase (SOD), glutathione peroxidase (Gpx), total antioxidative capacity (T-AOC), catalase (CAT). Cd exposure increased obviously nuclear accumulation of Nrf2, and the expression of Nrf2 downstream heme oxygenase-1 (HO-1) and NAD(P)H: quinine oxidoreductase 1 (NQO1), reduced the expression of Kelch-like ECH-associated protein (keap1), Gpx-1 and thioredoxin reductase-1 (TrxR1). In addition, Cd induced the increase of bak, caspase9, p53, Cyt c mRNA levels, increased bax/bcl-2 ratio, increased caspase3 mRNA and protein levels. Selenium treatment reduced the accumulation of Cd in the spleen, attenuates Cd-induced Nrf2 nuclear accumulation, enhanced antioxidant enzyme activities, ameliorated Cd-induced oxidative stress and apoptosis in the spleen. In summary, our results demonstrate that Se ameliorated spleen toxicity induced by cadmium by modulating the antioxidant system, independently of Nrf2-regulated antioxidant response pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Naringenin protects against 6-OHDA-induced neurotoxicity via activation of the Nrf2/ARE signaling pathway. (United States)

    Lou, Haiyan; Jing, Xu; Wei, Xinbing; Shi, Huanying; Ren, Dongmei; Zhang, Xiumei


    There is increasing evidence that oxidative stress is critically involved in the pathogenesis of Parkinson's disease (PD), suggesting that pharmacological targeting of the antioxidant machinery may have therapeutic value. Naringenin, a natural flavonoid compound, has been reported to possess neuroprotective effect against PD related pathology; however the mechanisms underlying its beneficial effects are poorly defined. Thus, the purpose of the present study was to investigate the potential neuroprotective role of naringenin and to delineate its mechanism of action against 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in models of PD both in vitro and in vivo. Naringenin treatment resulted in an increase in nuclear factor E2-related factor 2 (Nrf2) protein levels and subsequent activation of antioxidant response element (ARE) pathway genes in SH-SY5Y cells and in mice. Exposure of SH-SY5Y cells to naringenin provided protection against 6-OHDA-induced oxidative insults that was dependent on Nrf2, since treatment with Nrf2 siRNA failed to block against 6-OHDA neurotoxicity or induce Nrf2-dependent cytoprotective genes in SH-SY5Y cells. In mice, oral administration of naringenin resulted in significant protection against 6-OHDA-induced nigrostriatal dopaminergic neurodegeneration and oxidative damage. Our results indicate that activation of Nrf2/ARE signaling by naringenin is strongly associated with its neuroprotective effects against 6-OHDA neurotoxicity and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in PD. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Agmatine, by Improving Neuroplasticity Markers and Inducing Nrf2, Prevents Corticosterone-Induced Depressive-Like Behavior in Mice. (United States)

    Freitas, Andiara E; Egea, Javier; Buendia, Izaskun; Gómez-Rangel, Vanessa; Parada, Esther; Navarro, Elisa; Casas, Ana Isabel; Wojnicz, Aneta; Ortiz, José Avendaño; Cuadrado, Antonio; Ruiz-Nuño, Ana; Rodrigues, Ana Lúcia S; Lopez, Manuela G


    Agmatine, an endogenous neuromodulator, is a potential candidate to constitute an adjuvant/monotherapy for the management of depression. A recent study by our group demonstrated that agmatine induces Nrf2 and protects against corticosterone effects in a hippocampal neuronal cell line. The present study is an extension of this previous study by assessing the antidepressant-like effect of agmatine in an animal model of depression induced by corticosterone in mice. Swiss mice were treated simultaneously with agmatine or imipramine at a dose of 0.1 mg/kg/day (p.o.) and corticosterone for 21 days and the daily administrations of experimental drugs were given immediately prior to corticosterone (20 mg/kg/day, p.o.) administrations. Wild-type C57BL/6 mice (Nrf2 (+/+)) and Nrf2 KO (Nrf2 (-/-)) were treated during 21 days with agmatine (0.1 mg/kg/day, p.o.) or vehicle. Twenty-four hours after the last treatments, the behavioral tests and biochemical assays were performed. Agmatine treatment for 21 days was able to abolish the corticosterone-induced depressive-like behavior and the alterations in the immunocontent of mature BDNF and synaptotagmin I, and in the serotonin and glutamate levels. Agmatine also abolished the corticosterone-induced changes in the morphology of astrocytes and microglia in CA1 region of hippocampus. In addition, agmatine treatment in control mice increased noradrenaline, serotonin, and dopamine levels, CREB phosphorylation, mature BDNF and synaptotagmin I immunocontents, and reduced pro-BDNF immunocontent in the hippocampus. Agmatine's ability to produce an antidepressant-like effect was abolished in Nrf2 (-/-) mice. The present results reinforce the participation of Nrf2 in the antidepressant-like effect produced by agmatine and expand literature data concerning its mechanisms of action.

  15. Topical application of the synthetic triterpenoid RTA 408 activates Nrf2 and induces cytoprotective genes in rat skin. (United States)

    Reisman, Scott A; Lee, Chun-Yue I; Meyer, Colin J; Proksch, Joel W; Ward, Keith W


    RTA 408 is a member of the synthetic oleanane triterpenoid class of compounds known to potently activate the cytoprotective transcription factor Nrf2. Because skin is constantly exposed to external oxidative stress, such as that from ultraviolet radiation, from chemical exposure, during improper wound healing, and throughout the course of cancer radiation therapy, it may benefit from activation of Nrf2. This study was conducted to evaluate the transdermal penetration properties and Nrf2 activation potential of RTA 408 in normal rat skin. RTA 408 (0.1, 1.0, or 3.0%) was applied topically to the shaved skin of male Sprague-Dawley rats twice daily for 4 days and once on Day 5. Topical application of RTA 408 resulted in transdermal penetration, with low but dose-dependent plasma exposure with AUC(0-24 h) values of 3.6, 26.0, and 41.1 h ng/mL for the 0.1, 1.0, and 3.0% doses, respectively. Further, topical application of RTA 408 resulted in increased translocation of Nrf2 to the nucleus, dose-dependent mRNA induction of Nrf2 target genes (e.g. Nqo1, Srxn1, Gclc, and Gclm), and induction of the protein expression of the prototypical Nrf2 target gene Nqo1 and increased total glutathione (GSH) in normal rat skin. Immunohistochemistry demonstrated that increased staining for Nqo1 and total GSH of structures in both the epidermis and dermis was consistent with the full transdermal penetration of RTA 408. Finally, topically administered RTA 408 was well tolerated with no adverse in-life observations and normal skin histology. Thus, the data support the further development of RTA 408 for the potential treatment of skin diseases.

  16. The triterpenoid corosolic acid blocks transformation and epigenetically reactivates Nrf2 in TRAMP-C1 prostate cells. (United States)

    Yang, Jie; Wu, Renyi; Li, Wenji; Gao, Linbo; Yang, Yuqing; Li, Ping; Kong, Ah-Ng


    Corosolic acid (CRA) is found in various plants and has been used as a health food supplement worldwide. Although it has been reported that CRA exhibits significant anticancer activity, the effect of this compound on prostate cancer remains unknown. In this study, we investigated the effect of CRA on cellular transformation and the reactivation of nuclear factor erythroid 2-related factor 2 (Nrf2) through epigenetic regulation in TRAMP-C1 prostate cells. Specifically, we found that CRA inhibited anchorage-independent growth of prostate cancer TRAMP-C1 cells but not Nrf2 knockout prostate cancer TRAMP-C1 cells. Moreover, CRA induced mRNA and protein expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H Quinone Oxidoreductase 1 (NQO1). Bisulfite genomic sequencing and methylated DNA immunoprecipitation results revealed that CRA treatment decreased the level of methylation of the first five CpG sites of the Nrf2 promoter. Histone modification was analyzed using a chromatin immunoprecipitation (ChIP) assay, which revealed that CRA treatment increased the acetylation of histone H3 lysine 27 (H3K27ac) while decreasing the trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of Nrf2. Furthermore, CRA treatment attenuated the protein expression of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). These findings indicate that CRA has a significant anticancer effect in TRAMP-C1 cells, which could be partly attributed to epigenetics including its ability to epigenetically restore the expression of Nrf2. © 2017 Wiley Periodicals, Inc.

  17. O papel do fator nuclear eritróide 2 relacionado ao fator 2 (Nrf2 no diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Gabriela Fernandes Hahn


    Full Text Available O diabetes mellitus (DM é uma doença metabólica complexa. Sua etiologia é atribuída a uma combinação entre fatores genéticos, ambientais e de estilo de vida. Contudo, sabe-se que o estresse oxidativo desempenha papel crucial na patogênese do DM, acarretando em disfunção das células β pancreáticas e resistência à insulina. Neste contexto, o fator nuclear eritroide 2 relacionado ao fator 2 (Nrf2 é considerado o regulador mestre da resposta antioxidante do organismo, sendo um mecanismo de importância crítica para a manutenção da homeostase e sobrevivência celular. Todavia, a função do Nrf2 não se limita somente à resposta antioxidante. Ao interagir com outras vias metabólicas, o Nrf2 possui importante papel na regulação do metabolismo, atuando no metabolismo dos lipídios, manutenção da glicemia, resposta inflamatória, entre outros. Entretanto, a exata relação do Nrf2 com outras vias metabólicas ainda não é totalmente conhecida. Contudo, sabe-se que o comprometimento da função do Nrf2 é evidente na fisiopatologia do DM bem como no desenvolvimento de suas complicações clínicas. A ativação do Nrf2 protege contra os danos mediados pelo DM, podendo ser adequada uma intervenção exógena para aumentar a sua atividade. Palavras-chave: Complicações do diabetes; estresse oxidativo; antioxidantes; inflamação; obesidade

  18. Mangiferin Upregulates Glyoxalase 1 Through Activation of Nrf2/ARE Signaling in Central Neurons Cultured with High Glucose. (United States)

    Liu, Yao-Wu; Cheng, Ya-Qin; Liu, Xiao-Li; Hao, Yun-Chao; Li, Yu; Zhu, Xia; Zhang, Fan; Yin, Xiao-Xing


    Mangiferin, a natural C-glucoside xanthone, has anti-inflammatory, anti-oxidative, neuroprotective actions. Our previous study showed that mangiferin could attenuate diabetes-associated cognitive impairment of rats by enhancing the function of glyoxalase 1 (Glo-1) in brain. The aim of this study was to investigate whether Glo-1 upregulation by mangiferin in central neurons exposed to chronic high glucose may be related to activation of Nrf2/ARE pathway. Compared with normal glucose (25 mmol/L) culture, Glo-1 protein, mRNA, and activity levels were markedly decreased in primary hippocampal and cerebral cortical neurons cultured with high glucose (50 mmol/L) for 72 h, accompanied by the declined Nrf2 nuclear translocation and protein expression of Nrf2 in cell nucleus, as well as protein expression and mRNA level of γ-glutamylcysteine synthetase (γ-GCS) and superoxide dismutase activity, target genes of Nrf2/ARE signaling. Nonetheless, high glucose cotreating with mangiferin or sulforaphane, a typical inducer of Nrf2 activation, attenuated the above changes in both central neurons. In addition, mangiferin and sulforaphane significantly prevented the formation of advanced glycation end-products (AGEs) reflecting Glo-1 activity, while elevated the level of glutathione, a cofactor of Glo-1 activity and production of γ-GCS, in high glucose cultured central neurons. These findings demonstrated that Glo-1 was greatly downregulated in central neurons exposed to chronic high glucose, which is expected to lead the formation of AGEs and oxidative stress damages. We also proved that mangiferin enhanced the function of Glo-1 under high glucose condition by inducing activation of Nrf2/ARE signaling pathway.

  19. Tolerance to water deficiency between two soybean cultivars: transgenic versus conventional Tolerância à deficiência hídrica entre dois cultivares de soja: transgênico versus convencional

    Directory of Open Access Journals (Sweden)

    Tiago Aranda Catuchi


    Full Text Available The main goal of the study was to evaluate the effects on the development and physiological aspects of soybean plants grown under water deficiency at greenhouse conditions, comparing the levels of tolerance to water deficiency between one transgenic and one conventional cultivar, enabling a systematic way to carried out physiological comparisons between soybean cultivars under drought. The study was divided into completely randomized using a factorial 2×2 design, with five replicates. The experimental design included two replenishment levels of daily irrigation (100% and 40%, applied to the leaves during the V4 developmental stage (fourth trifoliate fully expanded and two cultivars, 'CD 202' conventional and 'CD 226RR' transgenic. The results showed that both cultivars had similar effects, caused by water deficiency, on dry mass production, but the transgenic cultivar tended to maintain higher biomass allocation in pods, as well as, higher efficiency of leaves to support dry mass production than conventional cultivar in both water conditions. Moreover, the higher maximum CO2 assimilation values and lower membranes damages in the transgenic cultivar under water deficiency showed that the expected higher drought tolerance of the conventional cultivar was not supported by a more accurate physiological investigation.O principal objetivo do estudo foi avaliar os efeitos sobre o desenvolvimento e aspectos fisiológicos de plantas de soja cultivadas sob deficiência hídrica em condições de casa de vegetação, comparando os níveis de tolerância à deficiência de água entre um cultivar transgênico e um convencional, gerando uma forma sistemática de realizar comparações fisiológicas entre cultivares de soja sob déficit hídrico. O delineamento experimental foi inteiramente casualizado, em esquema fatorial 2×2, com cinco repetições. Os tratamentos hídricos foram dois níveis de reposição de irrigação diária (100% e 40%, aplicados a

  20. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV☆ (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D.; Wondrak, Georg T.


    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  1. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV. (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D; Wondrak, Georg T


    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm(2) UVB; 1.53 J/cm(2) UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  2. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV

    Directory of Open Access Journals (Sweden)

    Shasha Tao


    Full Text Available Exposure to solar ultraviolet (UV radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2, a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I, dihydrotanshinone (DHT, tanshinone IIA (T-II-A and cryptotanshinone (CT] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1 with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA. The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities was significantly attenuated in DHT

  3. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Zhiqin [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Department of Laboratory Diagnosis, Hebei Medical University, Shijiazhuang (China); Niu, Yujie [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Wang, Qian [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Shi, Lei [Department of Occupational Health and Environmental Health, Hebei Medical University, Shijiazhuang (China); Guo, Huicai; Liu, Yi; Zhu, Yue [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Liu, Shufeng; Liu, Chao [Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China); Chen, Xin [Xiumen Community Health Service Centre, Shijiazhuang (China); Zhang, Rong, E-mail: [Department of Toxicology, Hebei Medical University, Shijiazhuang (China); Hebei Keylab of Laboratory Animal Science, Shijiazhuang (China)


    Highlights: • Nrf2 signals were partly responsible for the DNA damage induced by Nano-TiO{sub 2}. • Nrf2 loss could aggravate the DNA damage induced by Nano-TiO{sub 2}. • Acquired Nrf2 decreased the susceptibility to DNA damage induced by Nano-TiO{sub 2}. - Abstract: Titanium dioxide nanoparticles (Nano-TiO{sub 2}) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO{sub 2} induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO{sub 2}. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO{sub 2}. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO{sub 2} exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO{sub 2} treatment. After treatment with Nano-TiO{sub 2}, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO{sub 2} and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO{sub 2} toxication.

  4. Overexpression of MfPIP2-7 from Medicago falcata promotes cold tolerance and growth under NO3 (-) deficiency in transgenic tobacco plants. (United States)

    Zhuo, Chunliu; Wang, Ting; Guo, Zhenfei; Lu, Shaoyun


    Plasma membrane intrinsic proteins (PIPs), which belong to aquaporins (AQPs) superfamily, are subdivided into two groups, PIP1 and PIP2, based on sequence similarity. Several PIP2s function as water channels, while PIP1s have low or no water channel activity, but have a role in water permeability through interacting with PIP2. A cold responsive PIP2 named as MfPIP2-7 was isolated from Medicago falcata (hereafter falcata), a forage legume with great cold tolerance, and transgenic tobacco plants overexpressing MfPIP2-7 were analyzed in tolerance to multiple stresses including freezing, chilling, and nitrate reduction in this study. MfPIP2-7 transcript was induced by 4 to 12 h of cold treatment and 2 h of abscisic acid (ABA) treatment. Pretreatment with inhibitor of ABA synthesis blocked the cold induced MfPIP2-7 transcript, indicating that ABA was involved in cold induced transcription of MfPIP2-7 in falcata. Overexpression of MfPIP2-7 resulted in enhanced tolerance to freezing, chilling and NO3 (-) deficiency in transgenic tobacco (Nicotiana tabacum L.) plants as compared with the wild type. Moreover, MfPIP2-7 was demonstrated to facilitate H2O2 diffusion in yeast. Higher transcript levels of several stress responsive genes, such as NtERD10B, NtERD10C, NtDREB1, and 2, and nitrate reductase (NR) encoding genes (NtNIA1, and NtNIA2) were observed in transgenic plants as compared with the wild type with dependence upon H2O2. In addition, NR activity was increased in transgenic plants, which led to alterations in free amino acid components and concentrations. The results suggest that MfPIP2-7 plays an important role in plant tolerance to freezing, chilling, and NO3 (-) deficiency by promoted H2O2 diffusion that in turn up-regulates expression of NIAs and multiple stress responsive genes.

  5. Alkylating Agent-Induced NRF2 Blocks Endoplasmic Reticulum Stress-Mediated Apoptosis via Control of Glutathione Pools and Protein Thiol Homeostasis. (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V Pragathi; Loranc, Eva; Tonapi, Sonal S; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C F; Chen, Yidong; Bishop, Alexander J R


    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis, and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival, an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine or glutathione-ethyl-ester, decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 target overexpression and poor survival. In KEAP1-mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. Mol Cancer Ther; 15(12); 3000-14. ©2016 AACR. ©2016 American Association for Cancer Research.

  6. Alkylating agent induced NRF2 blocks endoplasmic reticulum stress-mediated apoptosis via control of glutathione pools and protein thiol homeostasis (United States)

    Zanotto-Filho, Alfeu; Masamsetti, V. Pragathi; Loranc, Eva; Tonapi, Sonal S.; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C. F.; Chen, Yidong; Bishop, Alexander J. R.


    Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival; an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine (BSO) caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine (NAC) or glutathione-ethyl-ester (GSH-E), decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 targets overexpression and poor survival. In KEAP1 mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. PMID:27638861

  7. Partial contribution of the Keap1–Nrf2 system to cadmium-mediated metallothionein expression in vascular endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Shinkai, Yasuhiro [Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575 (Japan); Kimura, Tomoki [Faculty of Science and Engineering, Setsunan University, 17-8 Ikedanaka-machi, Neyagawa, Osaka 572-8508 (Japan); Itagaki, Ayaka [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Yamamoto, Chika [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi, Chiba 274-8510 (Japan); Taguchi, Keiko; Yamamoto, Masayuki [Department of Medical Biochemistry, Tohoku University Graduate School of Medicine, 2-1 Seiryo-cho, Aoba-ku, Sendai 980-8575 (Japan); Kumagai, Yoshito, E-mail: [Environmental Biology Laboratory, Faculty of Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8575 (Japan); Kaji, Toshiyuki, E-mail: [Faculty of Pharmaceutical Sciences, Hokuriku University, Ho-3 Kanagawa, Kanazawa, 920-1181, Ishikawa (Japan); Faculty of Pharmaceutical Sciences, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510 (Japan)


    Cadmium is an environmental electrophile that modifies protein reactive thiols such as Kelch-like ECH-associated protein 1 (Keap1), a negative regulator of nuclear factor-erythroid 2-related factor 2 (Nrf2). In the present study, we investigated a role of the Keap1–Nrf2 system in cellular response to cadmium in vascular endothelial cells. Exposure of bovine aortic endothelial cells to cadmium resulted in modification of Keap1 and Nrf2 activation, thereby up-regulating not only its typical downstream proteins but also metallothionein-1/2. Experiments with siRNA-mediated knockdown of Nrf2 or Keap1 supported participation of the Keap1–Nrf2 system in the modulation of metallothionein-1/2 expression. Furthermore, chromatin immunoprecipitation assay showed that Nrf2 was recruited to the antioxidant response element of the promoter region of the bovine metallothionein-2 gene in the presence of cadmium. These results suggest that the transcription factor Nrf2 plays, at least in part, a role in the changes in metallothionein expression mediated by exposure to cadmium. - Highlights: • Role of the Keap1–Nrf2 system in cellular response to cadmium was examined. • We used bovine aortic endothelial cells as a model of the vascular endothelium. • Exposure of cells to cadmium resulted in modification of Keap1 and Nrf2 activation. • Keap1–Nrf2 system participated in the modulation of metallothionein-1/2 expression. • Nrf2 was recruited to the antioxidant response element of MT2 promoter region.

  8. 4-methoxychalcone enhances cisplatin-induced oxidative stress and cytotoxicity by inhibiting the Nrf2/ARE-mediated defense mechanism in A549 lung cancer cells. (United States)

    Lim, Juhee; Lee, Sung Ho; Cho, Sera; Lee, Ik-Soo; Kang, Bok Yun; Choi, Hyun Jin


    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key transcriptional regulator for the protection of cells against oxidative and xenobiotic stresses. Recent studies have demonstrated that high constitutive expression of Nrf2 is observed in many types of cancer cells showing resistance to anti-cancer drugs, suggesting that the suppression of overexpressed Nrf2 could be an attractive therapeutic strategy to overcome cancer drug resistance. In the present study, we aimed to find small molecule compounds that enhance the sensitivity of tumor cells to cisplatin induced cytotoxicity by suppressing Nrf2-mediated defense mechanism. A549 lung cancer cells were shown to be more resistant to the anti-cancer drug cisplatin than HEK293 cells, with higher Nrf2 signaling activity; constitutively high amounts of Nrf2-downstream target proteins were observed in A549 cells. Among the three chalcone derivatives 4-methoxy-chalcone (4-MC), hesperidin methylchalcone, and neohesperidin dihydrochalcone, 4-MC was found to suppress transcriptional activity of Nrf2 in A549 cells but to activate it in HEK293 cells. 4-MC was also shown to down-regulate expression of Nrf2 and the downstream phase II detoxifying enzyme NQO1 in A549 cells. The PI3K/Akt pathway was found to be involved in the 4-MC-induced inhibition of Nrf2/ARE activity in A549 cells. This inhibition of Nrf2 signaling results in the accelerated generation of reactive oxygen species and exacerbation of cytotoxicity in cisplatin-treated A549 cells. Taken together, these results suggest that the small molecule compound 4-MC could be used to enhance the sensitivity of tumor cells to the therapeutic effect of cisplatin through the regulation of Nrf2/ARE signaling.

  9. Polydatin Protects Bone Marrow Stem Cells against Oxidative Injury: Involvement of Nrf 2/ARE Pathways

    Directory of Open Access Journals (Sweden)

    Meihui Chen


    Full Text Available Polydatin, a glucoside of resveratrol, has been reported to possess potent antioxidative effects. In the present study, we aimed to investigate the effects of polydatin in bone marrow-derived mesenchymal stem cells (BMSCs death caused by hydrogen peroxide (H2O2, imitating the microenvironment surrounding transplanted cells in the injured spinal cord in vitro. In our study, MTT results showed that polydatin effectively prevented the decrease of cell viability caused by H2O2. Hochest 33258, Annexin V-PI, and Western blot assay showed H2O2-induced apoptosis in BMSCs, which was attenuated by polydatin. Further studies indicated that polydatin significantly protects BMSCs against apoptosis due to its antioxidative effects and the regulation of Nrf 2/ARE pathway. Taken together, our results indicate that polydatin could be used in combination with BMSCs for the treatment of spinal cord injury by improving the cell survival and oxidative stress microenvironments.

  10. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    International Nuclear Information System (INIS)

    Yang, Bei; Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo


    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs 3+ ) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs 3+ exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs 3+ and monomethylarsonous acid (MMA 3+ )-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs 3+ -induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs 3+ . The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs 3+ in β-cells. ► Deficiency of Nrf2 in β-cells sensitized to iAs 3+ and MMA 3

  11. Deficiency in the nuclear factor E2-related factor 2 renders pancreatic β-cells vulnerable to arsenic-induced cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Bei [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Department of Histology and Embryology, College of Basic Medical Sciences, China Medical University, Shenyang 110001 (China); Fu, Jingqi; Zheng, Hongzhi; Xue, Peng; Yarborough, Kathy; Woods, Courtney G.; Hou, Yongyong; Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)


    Chronic human exposure to inorganic arsenic (iAs), a potent environmental oxidative stressor, is associated with increased prevalence of type 2 diabetes, where impairment of pancreatic β-cell function is a key pathogenic factor. Nuclear factor E2-related factor 2 (Nrf2) is a central transcription factor regulating cellular adaptive response to oxidative stress. However, persistent activation of Nrf2 in response to chronic oxidative stress, including inorganic arsenite (iAs{sup 3+}) exposure, blunts glucose-triggered reactive oxygen species (ROS) signaling and impairs glucose-stimulated insulin secretion (GSIS). In the current study, we found that MIN6 pancreatic β-cells with stable knockdown of Nrf2 (Nrf2-KD) by lentiviral shRNA and pancreatic islets isolated from Nrf2-knockout (Nrf2−/−) mice exhibited reduced expression of several antioxidant and detoxification enzymes in response to acute iAs{sup 3+} exposure. As a result, Nrf2-KD MIN6 cells and Nrf2−/− islets were more susceptible to iAs{sup 3+} and monomethylarsonous acid (MMA{sup 3+})-induced cell damage, as measured by decreased cell viability, augmented apoptosis and morphological change. Pretreatment of MIN6 cells with Nrf2 activator tert-butylhydroquinone protected the cells from iAs{sup 3+}-induced cell damage in an Nrf2-dependent fashion. In contrast, antioxidant N‐acetyl cysteine protected Nrf2-KD MIN6 cells against acute cytotoxicity of iAs{sup 3+}. The present study demonstrates that Nrf2-mediated antioxidant response is critical in the pancreatic β-cell defense mechanism against acute cytotoxicity by arsenic. The findings here, combined with our previous results on the inhibitory effect of antioxidants on ROS signaling and GSIS, suggest that Nrf2 plays paradoxical roles in pancreatic β-cell dysfunction induced by environmental arsenic exposure. -- Highlights: ► Lack of Nrf2 reduced expression of antioxidant genes induced by iAs{sup 3+} in β-cells. ► Deficiency of Nrf2 in

  12. Pomegranate-mediated chemoprevention of experimental hepatocarcinogenesis involves Nrf2-regulated antioxidant mechanisms (United States)

    Bishayee, Anupam; Bhatia, Deepak; Thoppil, Roslin J.; Darvesh, Altaf S.; Nevo, Eviatar; Lansky, Ephraim P.


    Hepatocellular carcinoma (HCC), one of the most prevalent and lethal cancers, has shown an alarming rise in the USA. Without effective therapy for HCC, novel chemopreventive strategies may effectively circumvent the current morbidity and mortality. Oxidative stress predisposes to hepatocarcinogenesis and is the major driving force of HCC. Pomegranate, an ancient fruit, is gaining tremendous attention due to its powerful antioxidant properties. Here, we examined mechanism-based chemopreventive potential of a pomegranate emulsion (PE) against dietary carcinogen diethylnitrosamine (DENA)-induced rat hepatocarcinogenesis that mimics human HCC. PE treatment (1 or 10 g/kg), started 4 weeks prior to the DENA challenge and continued for 18 weeks thereafter, showed striking chemopreventive activity demonstrated by reduced incidence, number, multiplicity, size and volume of hepatic nodules, precursors of HCC. Both doses of PE significantly attenuated the number and area of γ-glutamyl transpeptidase-positive hepatic foci compared with the DENA control. PE also attenuated DENA-induced hepatic lipid peroxidation and protein oxidation. Mechanistic studies revealed that PE elevated gene expression of an array of hepatic antioxidant and carcinogen detoxifying enzymes in DENA-exposed animals. PE elevated protein and messenger RNA expression of the hepatic nuclear factor E2-related factor 2 (Nrf2). Our results provide substantial evidence, for the first time, that pomegranate constituents afford chemoprevention of hepatocarcinogenesis possibly through potent antioxidant activity achieved by upregulation of several housekeeping genes under the control of Nrf2 without toxicity. The outcome of this study strongly supports the development of pomegranate-derived products in the prevention and treatment of human HCC, which remains a devastating disease. PMID:21389260

  13. Early induction of NRF2 antioxidant pathway by RHBDF2 mediates rapid cutaneous wound healing. (United States)

    Hosur, Vishnu; Burzenski, Lisa M; Stearns, Timothy M; Farley, Michelle L; Sundberg, John P; Wiles, Michael V; Shultz, Leonard D


    Rhomboid family protein RHBDF2, an upstream regulator of the epidermal growth factor (EGF) receptor signaling, has been implicated in cutaneous wound healing. However, the underlying molecular mechanisms are still emerging. In humans, a gain-of-function mutation in the RHBDF2 gene accelerates cutaneous wound healing in an EGFR-dependent manner. Likewise, a gain-of-function mutation in the mouse Rhbdf2 gene (Rhbdf2 cub/cub ) shows a regenerative phenotype (rapid ear-hole closure) resulting from constitutive activation of the EGFR pathway. Because the RHBDF2-regulated EGFR pathway is relevant to cutaneous wound healing in humans, we used Rhbdf2 cub/cub mice to investigate the biological networks and pathways leading to accelerated ear-hole closure, with the goal of identifying therapeutic targets potentially effective in promoting wound healing in humans. Comparative transcriptome analysis of ear pinna tissue from Rhbdf2 cub/cub and Rhbdf2 +/+ mice at 0h, 15min, 2h, and 24h post-wounding revealed an early induction of the nuclear factor E2-related factor 2 (NRF2)-mediated anti-oxidative pathway (0h and 15min), followed by the integrin-receptor aggregation pathway (2h) as early-stage events immediately and shortly after wounding in Rhbdf2 cub/cub mice. Additionally, we observed genes enriched for the Fc fragment of the IgG receptor IIIa (FCGR3A)-mediated phagocytosis pathway 24h post-wounding. Although cutaneous wound repair in healthy individuals is generally non-problematic, it can be severely impaired due to aging, diabetes, and chronic inflammation. This study suggests that activation of the NRF2-antioxidant pathway by rhomboid protein RHBDF2 might be beneficial in treating chronic non-healing wounds. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Nrf2 activation ameliorates cytotoxic effects of arsenic trioxide in acute promyelocytic leukemia cells through increased glutathione levels and arsenic efflux from cells

    Energy Technology Data Exchange (ETDEWEB)

    Nishimoto, Shoichi; Suzuki, Toshihiro; Koike, Shin [Department of Analytical Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588 (Japan); Yuan, Bo; Takagi, Norio [Department of Applied Biochemistry, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, Hachioji, Tokyo 192-0392 (Japan); Ogasawara, Yuki, E-mail: [Department of Analytical Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588 (Japan)


    Carnosic acid (CA), a phenolic diterpene isolated from Rosmarinus officinalis, has been shown to activate nuclear transcription factor E2-related factor 2 (Nrf2), which plays a central role in cytoprotective responses to oxidative and electrophilic stress. Recently, the Nrf2-Kelch ECH associating protein 1 (Keap1) pathway has been associated with cancer drug resistance attributable to modulation of the expression and activation of antioxidant and detoxification enzymes. However, the exact mechanisms by which Nrf2 activation results in chemoresistance are insufficiently understood to date. This study investigated the mechanisms by which the cytotoxic effects of arsenic trioxide (ATO), an anticancer drug, were decreased in acute promyelocytic leukemia cells treated with CA, a typical activator of Nrf2 used to stimulate the Nrf2/Keap1 system. Our findings suggest that arsenic is non-enzymatically incorporated into NB4 cells and forms complexes that are dependent on intracellular glutathione (GSH) concentrations. In addition, the arsenic complexes are recognized as substrates by multidrug resistance proteins and subsequently excreted from the cells. Therefore, Nrf2-associated activation of the GSH biosynthetic pathway, followed by increased levels of intracellular GSH, are key mechanisms underlying accelerated arsenic efflux and attenuation of the cytotoxic effects of ATO. - Highlights: • Nrf2 activation attenuates the effect of arsenic trioxide to acute promyelocytic leukemia cells. • The sensitivity of arsenic trioxide to NB4 cells was dependent on efflux rate of arsenic. • Activation of the GSH biosynthesis is essential in Nrf2-regulated responses for arsenic efflux.

  15. Absence of Nrf2 or its selective overexpression in neurons and muscle does not affect survival in ALS-linked mutant hSOD1 mouse models.

    Directory of Open Access Journals (Sweden)

    Marcelo R Vargas

    Full Text Available The nuclear factor erythroid 2-related factor 2 (Nrf2 governs the expression of antioxidant and phase II detoxifying enzymes. Nrf2 activation can prevent or reduce cellular damage associated with several types of injury in many different tissues and organs. Dominant mutations in Cu/Zn-superoxide dismutase (SOD1 cause familial forms of amyotrophic lateral sclerosis (ALS, a fatal disorder characterized by the progressive loss of motor neurons and subsequent muscular atrophy. We have previously shown that Nrf2 activation in astrocytes delays neurodegeneration in ALS mouse models. To further investigate the role of Nrf2 in ALS we determined the effect of absence of Nrf2 or its restricted overexpression in neurons or type II skeletal muscle fibers on symptoms onset and survival in mutant hSOD1 expressing mice. We did not observe any detrimental effect associated with the lack of Nrf2 in two different mutant hSOD1 animal models of ALS. However, restricted Nrf2 overexpression in neurons or type II skeletal muscle fibers delayed disease onset but failed to extend survival in hSOD1(G93A mice. These results highlight the concept that not only the pharmacological target but also the cell type targeted may be relevant when considering a Nrf2-mediated therapeutic approach for ALS.

  16. Activation of the Nrf2-ARE pathway by siRNA knockdown of Keap1 reduces oxidative stress and provides partial protection from MPTP-mediated neurotoxicity. (United States)

    Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A


    Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Sulforaphane prevents angiotensin II-induced cardiomyopathy by activation of Nrf2 via stimulating the Akt/GSK-3ß/Fyn pathway

    Directory of Open Access Journals (Sweden)

    Ying Xin


    Conclusion: These results suggest that Nrf2 plays a central role in the prevention of Ang II-induced cardiomyopathy, and SFN prevents Ang II-induced cardiomyopathy partially via the Akt/GSK-3β/Fyn-mediated Nrf2 activation.

  18. Inducers of Senescence, Toxic Compounds, and Senolytics: The Multiple Faces of Nrf2-Activating Phytochemicals in Cancer Adjuvant Therapy

    Directory of Open Access Journals (Sweden)

    Marco Malavolta


    Full Text Available The reactivation of senescence in cancer and the subsequent clearance of senescent cells are suggested as therapeutic intervention in the eradication of cancer. Several natural compounds that activate Nrf2 (nuclear factor erythroid-derived 2-related factor 2 pathway, which is involved in complex cytoprotective responses, have been paradoxically shown to induce cell death or senescence in cancer. Promoting the cytoprotective Nrf2 pathway may be desirable for chemoprevention, but it might be detrimental in later stages and advanced cancers. However, senolytic activity shown by some Nrf2-activating compounds could be used to target senescent cancer cells (particularly in aged immune-depressed organisms that escape immunosurveillance. We herein describe in vitro and in vivo effects of fifteen Nrf2-interacting natural compounds (tocotrienols, curcumin, epigallocatechin gallate, quercetin, genistein, resveratrol, silybin, phenethyl isothiocyanate, sulforaphane, triptolide, allicin, berberine, piperlongumine, fisetin, and phloretin on cellular senescence and discuss their use in adjuvant cancer therapy. In light of available literature, it can be concluded that the meaning and the potential of adjuvant therapy with natural compounds in humans remain unclear, also taking into account the existence of few clinical trials mostly characterized by uncertain results. Further studies are needed to investigate the therapeutic potential of those compounds that display senolytic activity.

  19. The berry constituents quercetin, kaempferol, and pterostilbene synergistically attenuate reactive oxygen species: involvement of the Nrf2-ARE signaling pathway. (United States)

    Saw, Constance Lay Lay; Guo, Yue; Yang, Anne Yuqing; Paredes-Gonzalez, Ximena; Ramirez, Christina; Pung, Douglas; Kong, Ah-Ng Tony


    Quercetin, kaempferol, and pterostilbene are abundant in berries. The anti-oxidative properties of these constituents may contribute to cancer chemoprevention. However, their precise mechanisms of action and their combinatorial effects are not completely understood. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates anti-oxidative stress enzymes and Phase II drug metabolizing/detoxifying enzymes by binding to antioxidant response element (ARE). This study aimed to investigate the anti-oxidative stress activities of quercetin, kaempferol, and pterostilbene individually and in combination, as well as the involvement of the Nrf2-ARE signaling pathway. Quercetin, kaempferol, and pterostilbene all exhibited strong free-radical scavenging activity in the DPPH assay. The MTS assay revealed that low concentration combinations we tested were relatively non-toxic to HepG2-C8 cells. The results of the DCFH-DA assay and combination index (CI) indicated that quercetin, kaempferol, and pterostilbene attenuated intracellular reactive oxygen species (ROS) levels when pretreated individually and had synergistic effects when used in combination. In addition, the combination treatment significantly induced ARE and increased the mRNA and protein expression of Nrf2-regulated genes. Collectively, our study demonstrated that the berry constituents quercetin, kaempferol, and pterostilbene activated the Nrf2-ARE signaling pathway and exhibited synergistic anti-oxidative stress activity at appropriate concentrations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. The Biofunctions of Phytochemicals and Their Applications in Farm Animals: The Nrf2/Keap1 System as a Target

    Directory of Open Access Journals (Sweden)

    Si Qin


    Full Text Available Reactive oxygen species (ROS can be caused by mechanical, thermal, infectious, and chemical stimuli, and their negative effects on the health of humans and other animals are of considerable concern. The nuclear factor (erythroid-derived 2-like 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1 system plays a major role in maintaining the balance between the production and elimination of ROS via the regulation of a series of detoxifying and antioxidant enzyme gene expressions by means of the antioxidant response element (ARE. Dietary phytochemicals, which are generally found in vegetables, fruits, grains, and herbs, have been reported to have health benefits and to improve the growth performance and meat quality of farm animals through the regulation of Nrf2-mediated phase II enzymes in a variety of ways. However, the enormous quantity of somewhat chaotic data that is available on the effects of phytochemicals needs to be properly classified according to the functions or mechanisms of phytochemicals. In this review, we first introduce the antioxidant properties of phytochemicals and their relation to the Nrf2/Keap1 system. We then summarize the effects of phytochemicals on the growth performance, meat quality, and intestinal microbiota of farm animals via targeting the Nrf2/Keap1 system. These exhaustive data contribute to better illuminate the underlying biofunctional properties of phytochemicals in farm animals.

  1. Adenovirus-Mediated Over-Expression of Nrf2 Within Mesenchymal Stem Cells (MSCs Protected Rats Against Acute Kidney Injury

    Directory of Open Access Journals (Sweden)

    Mohammad Mohammadzadeh-Vardin


    Full Text Available Purpose: Recent developments in the field of cell therapy have led to a renewed interest in treatment of acute kidney injury (AKI. However, the early death of transplanted mesenchymal stem cells (MSCs in stressful microenvironment of a recipient tissue is a major problem with this kind of treatment. The objective of this study was to determine whether overexpression of a cytoprotective factor, nuclear factor erythroid-2 related factor 2 (Nrf2, in MSCs could protect rats against AKI. Methods: The Nrf2 was overexpressed in MSCs by recombinant adenoviruses, and the MSCs were implanted to rats suffering from cisplatin-induced AKI. Results: The obtained results showed that transplantation with the engineered MSCs ameliorates cisplatin-induced AKI. Morphologic features of the investigated kidneys showed that transplantation with the MSCs in which Nrf2 had been overexpressed significantly improved the complications of AKI. Conclusion: These findings suggested that the engineered MSCs might be a good candidate to be further evaluated in clinical trials. However, detailed studies must be performed to investigate the possible carcinogenic effect of Nrf2 overexpression.

  2. UVA Irradiation Enhances Brusatol-Mediated Inhibition of Melanoma Growth by Downregulation of the Nrf2-Mediated Antioxidant Response (United States)

    Wang, Mei; Shi, Guangwei; Bian, Chunxiang; Nisar, Muhammad Farrukh; Guo, Yingying; Wu, Yan; Li, Wei; Huang, Xiao; Jiang, Xuemei; Bartsch, Jörg W.


    Brusatol (BR) is a potent inhibitor of Nrf2, a transcription factor that is highly expressed in cancer tissues and confers chemoresistance. UVA-generated reactive oxygen species (ROS) can damage both normal and cancer cells and may be of potential use in phototherapy. In order to provide an alternative method to treat the aggressive melanoma, we sought to investigate whether low-dose UVA with BR is more effective in eliminating melanoma cells than the respective single treatments. We found that BR combined with UVA led to inhibition of A375 melanoma cell proliferation by cell cycle arrest in the G1 phase and triggers cell apoptosis. Furthermore, inhibition of Nrf2 expression attenuated colony formation and tumor development from A375 cells in heterotopic mouse models. In addition, cotreatment of UVA and BR partially suppressed Nrf2 and its downstream target genes such as HO-1 along with the PI3K/AKT pathway. We propose that cotreatment increased ROS-induced cell cycle arrest and cellular apoptosis and inhibits melanoma growth by regulating the AKT-Nrf2 pathway in A375 cells which offers a possible therapeutic intervention strategy for the treatment of human melanoma. PMID:29670684

  3. Folate deficiency enhances arsenic effects on expression of genes involved in epidermal differentiation in transgenic K6/ODC mouse skin

    International Nuclear Information System (INIS)

    Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.


    Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis

  4. The Crosstalk between Nrf2 and TGF-β1 in the Epithelial-Mesenchymal Transition of Pancreatic Duct Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Sarah Arfmann-Knübel

    Full Text Available Nrf2 and TGF-β1 both affect tumorigenesis in a dual fashion, either by preventing carcinogen induced carcinogenesis and suppressing tumor growth, respectively, or by conferring cytoprotection and invasiveness to tumor cells during malignant transformation. Given the involvement of Nrf2 and TGF-β1 in the adaptation of epithelial cells to persistent inflammatory stress, e.g. of the pancreatic duct epithelium during chronic pancreatitis, a crosstalk between Nrf2 and TGF-β1 can be envisaged. By using premalignant human pancreatic duct cells (HPDE and the pancreatic ductal adenocarcinoma cell line Colo357, we could show that Nrf2 and TGF-β1 independently but additively conferred an invasive phenotype to HPDE cells, whereas acting synergistically in Colo357 cells. This was accompanied by differential regulation of EMT markers like vimentin, Slug, L1CAM and E-cadherin. Nrf2 activation suppressed E-cadherin expression through an as yet unidentified ARE related site in the E-cadherin promoter, attenuated TGF-β1 induced Smad2/3-activity and enhanced JNK-signaling. In Colo357 cells, TGF-β1 itself was capable of inducing Nrf2 whereas in HPDE cells TGF-β1 per-se did not affect Nrf2 activity, but enhanced Nrf2 induction by tBHQ. In Colo357, but not in HPDE cells, the effects of TGF-β1 on invasion were sensitive to Nrf2 knock-down. In both cell lines, E-cadherin re-expression inhibited the proinvasive effect of Nrf2. Thus, the increased invasion of both cell lines relates to the Nrf2-dependent downregulation of E-cadherin expression. In line, immunohistochemistry analysis of human pancreatic intraepithelial neoplasias in pancreatic tissues from chronic pancreatitis patients revealed strong Nrf2 activity already in premalignant epithelial duct cells, accompanied by partial loss of E-cadherin expression. Our findings indicate that Nrf2 and TGF-β1 both contribute to malignant transformation through distinct EMT related mechanisms accounting for an

  5. Transcription factor Nrf2 mediates an adaptive response to sulforaphane that protects fibroblasts in vitro against the cytotoxic effects of electrophiles, peroxides and redox-cycling agents

    International Nuclear Information System (INIS)

    Higgins, Larry G.; Kelleher, Michael O.; Eggleston, Ian M.; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.


    Sulforaphane can stimulate cellular adaptation to redox stressors through transcription factor Nrf2. Using mouse embryonic fibroblasts (MEFs) as a model, we show herein that the normal homeostatic level of glutathione in Nrf2 -/- MEFs was only 20% of that in their wild-type counterparts. Furthermore, the rate of glutathione synthesis following its acute depletion upon treatment with 3 μmol/l sulforaphane was very substantially lower in Nrf2 -/- MEFs than in wild-type cells, and the rebound leading to a ∼ 1.9-fold increase in glutathione that occurred 12-24 h after Nrf2 +/+ MEFs were treated with sulforaphane was not observed in Nrf2 -/- fibroblasts. Wild-type MEFs that had been pre-treated for 24 h with 3 μmol/l sulforaphane exhibited between 1.4- and 3.2-fold resistance against thiol-reactive electrophiles, including isothiocyanates, α,β-unsaturated carbonyl compounds (e.g. acrolein), aryl halides and alkene epoxides. Pre-treatment of Nrf2 +/+ MEFs with sulforaphane also protected against hydroperoxides (e.g. cumene hydroperoxide, CuOOH), free radical-generating compounds (e.g. menadione), and genotoxic electrophiles (e.g. chlorambucil). By contrast, Nrf2 -/- MEFs were typically ∼ 50% less tolerant of these agents than wild-type fibroblasts, and sulforaphane pre-treatment did not protect the mutant cells against xenobiotics. To test whether Nrf2-mediated up-regulation of glutathione represents the major cytoprotective mechanism stimulated by sulforaphane, 5 μmol/l buthionine sulfoximine (BSO) was used to inhibit glutathione synthesis. In Nrf2 +/+ MEFs pre-treated with sulforaphane, BSO diminished intrinsic resistance and abolished inducible resistance to acrolein, CuOOH and chlorambucil, but not menadione. Thus Nrf2-dependent up-regulation of GSH is the principal mechanism by which sulforaphane pre-treatment induced resistance to acrolein, CuOOH and chlorambucil, but not menadione.

  6. Avenanthramides Prevent Osteoblast and Osteocyte Apoptosis and Induce Osteoclast Apoptosis in Vitro in an Nrf2-Independent Manner

    Directory of Open Access Journals (Sweden)

    Gretel G. Pellegrini


    Full Text Available Oats contain unique bioactive compounds known as avenanthramides (AVAs with antioxidant properties. AVAs might enhance the endogenous antioxidant cellular response by activation of the transcription factor Nrf2. Accumulation of reactive oxygen species plays a critical role in many chronic and degenerative diseases, including osteoporosis. In this disease, there is an imbalance between bone formation by osteoblasts and bone resorption by osteoclasts, which is accompanied by increased osteoblast/osteocyte apoptosis and decreased osteoclast apoptosis. We investigated the ability of the synthethic AVAs 2c, 2f and 2p, to 1-regulate gene expression in bone cells, 2-affect the viability of osteoblasts, osteocytes and osteoclasts, and the generation of osteoclasts from their precursors, and 3-examine the potential involvement of the transcription factor Nrf2 in these actions. All doses of AVA 2c and 1 and 5 µM dose of 2p up-regulated collagen 1A expression. Lower doses of AVAs up-regulated OPG (osteoprotegerin in OB-6 osteoblastic cells, whereas 100 μM dose of 2f and all concentrations of 2c down-regulated RANKL gene expression in MLO-Y4 osteocytic cells. AVAs did not affect apoptosis of OB-6 osteoblastic cells or MLO-Y4 osteocytic cells; however, they prevented apoptosis induced by the DNA topoisomerase inhibitor etoposide, the glucocorticoid dexamethasone, and hydrogen peroxide. AVAs prevented apoptosis of both wild type (WT and Nrf2 Knockout (KO osteoblasts, demonstrating that AVAs-induced survival does not require Nrf2 expression. Further, KO osteoclast precursors produced more mature osteoclasts than WT; and KO cultures exhibited less apoptotic osteoclasts than WT cultures. Although AVAs did not affect WT osteoclasts, AVA 2p reversed the low apoptosis of KO osteoclasts. These in vitro results demonstrate that AVAs regulate, in part, the function of osteoblasts and osteocytes and prevent osteoblast/osteocyte apoptosis and increase osteoclast

  7. Role of miR-155 in fluorooctane sulfonate-induced oxidative hepatic damage via the Nrf2-dependent pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chong; Han, Rui; Liu, Limin [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Zhang, Fang, E-mail: [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Li, Fang [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China); Xiang, Mingdeng [State Key Laboratory of Environmental Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Ding, Wenjun, E-mail: [Laboratory of Environment and Health, College of Life Sciences, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049 (China)


    Studies demonstrated that perfluorooctane sulfonate (PFOS) tends to accumulate in the liver and is capable to cause hepatomegaly. In the present study, we investigated the roles of miR-155 in PFOS-induced hepatotoxicity in SD rats and HepG2 cells. Male SD rats were orally administrated with PFOS at 1 or 10 mg/kg/day for 28 days while HepG2 cells were treated with 0–50 μM of PFOS for 24 h or 50 μM of PFOS for 1, 3, 6, 12 or 24 h, respectively. We found that PFOS significantly increased the liver weight and serum alanine transaminase (ALT) and aspartate amino transferase (AST) levels in rats. Morphologically, PFOS caused actin filament remodeling and endothelial permeability changes in the liver. Moreover, PFOS triggered reactive oxygen species (ROS) generation and induced apoptosis in both in vivo and in vitro assays. Immunoblotting data showed that NF-E2-related factor-2 (Nrf2) expression and activation and its target genes were all suppressed by PFOS in the liver and HepG2 cells. However, PFOS significantly increased miR-155 expression. Further studies showed that pretreatment of HepG2 cells with catalase significantly decreased miR-155 expression and substantially increased Nrf2 expression and activation, resulting in reduction of PFOS-induced cytotoxicity and oxidative stress. Taken together, these results indicated that miR-155 plays an important role in the PFOS-induced hepatotoxicity by disrupting Nrf2/ARE signaling pathway. - Highlights: • PFOS is capable to cause hepatotoxicity. • PFOS triggers ROS generation and induces apoptosis both in vivo and in vitro assays. • PFOS-induced ROS inhibits Nrf2 expression and its transactivation function. • PFOS promotes miR155 expression in liver and HepG2 cells. • miR-155 is involved in PFOS-induced hepatotoxicity by disrupting Nrf2/ARE pathway.

  8. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression (United States)

    Gore, Prashant R.; Prajapati, Chaitali P.; Mahajan, Umesh B.; Goyal, Sameer N.; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R.


    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues. PMID:27489498

  9. Effects of Glycyrrhetinic Acid on GSH Synthesis Induced by Realgar in the Mouse Hippocampus: Involvement of System [Formula: see text], System [Formula: see text], MRP-1, and Nrf2. (United States)

    Wang, Yan-Lei; Chen, Mo; Huo, Tao-Guang; Zhang, Ying-Hua; Fang, Ying; Feng, Cong; Wang, Shou-Yun; Jiang, Hong


    Realgar, a type of mineral drug-containing arsenic, exhibits neurotoxicity. Brain glutathione (GSH) is crucial to protect the nervous system and to resist arsenic toxicity. Therefore, the main aim of this study was to explore the neurotoxic mechanisms of realgar and the protective effects of glycyrrhetinic acid (GA) by observing the effects of GA on the hippocampal GSH biosynthetic pathway after exposure to realgar. Institute of Cancer Research (ICR) mice were randomly divided into five groups: a control group, a GA control group, a realgar alone group, a low-dose GA intervention group, and a high-dose GA intervention group. Cognitive ability was tested using an object recognition task (ORT). The ultrastructures of the hippocampal neurons and synapses were observed. mRNA and protein levels of EAAT1, EAAT2, EAAT3, xCT, Nrf2, HO-1, γ-GCS (GCLC, GCLM), and MRP-1 were measured, as was the cellular localization of EAAT3, xCT, MRP-1, and Nrf2. The levels of GSH in the hippocampus, the levels of glutamate (Glu) and cysteine (Cys) in the extracellular fluid of hippocampal CA1 region, and the levels of active sulfur in the brain were also investigated. The results indicate that realgar lowered hippocampal GSH levels, resulting in ultrastructural changes in hippocampal neurons and synapses and deficiencies in cognitive ability, ultimately inducing neurotoxicity. GA could trigger the expression of Nrf2, HO-1, EAAT1, EAAT2, EAAT3, xCT, MRP-1, GCLC, and GCLM. Additionally, the expression of γ-GT and the supply levels of Glu and Cys increased, ultimately causing a significant increase in hippocampal GSH to alleviate realgar-induced neurotoxicity. In conclusion, the findings from our study indicate that GA can antagonize decreased brain GSH levels induced by realgar and can lessen the neurotoxicity of realgar.

  10. Mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after intracranial hemorrhage

    Directory of Open Access Journals (Sweden)

    Yin XP


    Full Text Available Xiao-ping Yin,1,2 Zhi-ying Chen,2 Jun Zhou,1 Dan Wu,1,3 Bing Bao2 1Department of Neurology, The Second Affiliated Hospital of Nanchang University, Nanchang, People’s Republic of China; 2Department of Neurology, Affiliated Hospital of Jiujiang University, Jiujiang, People’s Republic of China; 3Department of Neurology, The Sixth Hospital of Wuhan, Wuhan, People’s Republic of China Background: It has been found that nuclear factor erythroid 2-related factor 2/antioxidant response element (Nrf2–ARE signaling pathway plays a role in antioxidative response, anti-inflammatory response, and neuron-protection in intracerebral hemorrhage (ICH. The aim of this study is to explore mechanisms underlying the perifocal neuroprotective effect of the Nrf2–ARE signaling pathway after ICH.Methods: There were a total of 90 rats with basal ganglia hemorrhage, which were randomly divided into the following four groups: ICH (Sprague–Dawley rats with autologous femoral arterial blood injection into the basal ganglia, sulforaphane (SFN (SFN was intraperitoneally administered into rats, retinoic acid (RA (RA was intraperitoneally administered into rats, and dimethyl sulfoxide (the rats were treated with dimethyl sulfoxide. We observed the neurological score of the rats in the different groups, and collected brain tissues for immunofluorescence, Western blot, and reverse transcription polymerase chain reaction to detect expression of Nrf2, heme oxygenase (HO-1, nuclear factor-κB (NF-κB, and tumor necrosis factor-α (TNF-α.Results: The results indicated that neurological dysfunction of rats was significantly improved in the SFN group, and the expressions of Nrf2 and HO-1 in tissues surrounding the hemorrhage were increased. Also, the level of NF-κB and TNF-α were reduced compared to the ICH group. The RA group exhibited more severe neurological dysfunction and lower levels of Nrf2 and HO-1 than the SFN and ICH groups. Compared to the ICH group, the NF

  11. Schisandra chinensis regulates drug metabolizing enzymes and drug transporters via activation of Nrf2-mediated signaling pathway

    Directory of Open Access Journals (Sweden)

    He JL


    Full Text Available Jin-Lian He,1 Zhi-Wei Zhou,2,3 Juan-Juan Yin,2 Chang-Qiang He,1 Shu-Feng Zhou,2,3 Yang Yu1 1College of Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong, People’s Republic of China; 2Department of Pharmaceutical Sciences, College of Pharmacy, University of South Florida, Tampa, FL, USA; 3Guizhou Provincial Key Laboratory for Regenerative Medicine, Stem Cell and Tissue Engineering Research Center and Sino-US Joint Laboratory for Medical Sciences, Guiyang Medical University, Guiyang, Guizhou, People’s Republic of China Abstract: Drug metabolizing enzymes (DMEs and drug transporters are regulated via epigenetic, transcriptional, posttranscriptional, and translational and posttranslational modifications. Phase I and II DMEs and drug transporters play an important role in the disposition and detoxification of a large number of endogenous and exogenous compounds. The nuclear factor (erythroid-derived 2-like 2 (Nrf2 is a critical regulator of a variety of important cytoprotective genes that are involved in disposition and detoxification of xenobiotics. Schisandra chinensis (SC is a commonly used traditional Chinese herbal medicine that has been primarily used to protect the liver because of its potent antioxidative and anti-inflammatory activities. SC can modulate some DMEs and drug transporters, but the underlying mechanisms are unclear. In this study, we aimed to explore the role of Nrf2 in the regulatory effect of SC extract (SCE on selected DMEs and drug transporters in human hepatocellular liver carcinoma cell line (HepG2 cells. The results showed that SCE, schisandrin A, and schisandrin B significantly increased the expression of NAD(PH: Nicotinamide Adenine Dinucleotide Phosphate-oxidase or:quinone oxidoreductase 1, heme oxygenase-1, glutamate–cysteine ligase, and glutathione S-transferase A4 at both transcriptional and posttranscriptional levels. Incubation of HepG2 cells with SCE resulted in a significant

  12. The Transcription Factor Nrf2 Protects Angiogenic Capacity of Endothelial Colony-Forming Cells in High-Oxygen Radical Stress Conditions

    Directory of Open Access Journals (Sweden)

    Hendrik Gremmels


    Full Text Available Background. Endothelial colony forming cells (ECFCs have shown a promise in tissue engineering of vascular constructs, where they act as endothelial progenitor cells. After implantation, ECFCs are likely to be subjected to elevated reactive oxygen species (ROS. The transcription factor Nrf2 regulates the expression of antioxidant enzymes in response to ROS. Methods. Stable knockdown of Nrf2 and Keap1 was achieved by transduction with lentiviral shRNAs; activation of Nrf2 was induced by incubation with sulforaphane (SFN. Expression of Nrf2 target genes was assessed by qPCR, oxidative stress was assessed using CM-DCFDA, and angiogenesis was quantified by scratch-wound and tubule-formation assays. Results. Nrf2 knockdown led to a reduction of antioxidant gene expression and increased ROS. Angiogenesis was disturbed after Nrf2 knockdown even in the absence of ROS. Conversely, angiogenesis was preserved in high ROS conditions after knockdown of Keap1. Preincubation of ECFCs with SFN reduced intracellular ROS in the presence of H2O2 and preserved scratch-wound closure and tubule-formation. Conclusion. The results of this study indicate that Nrf2 plays an important role in the angiogenic capacity of ECFCs, particularly under conditions of increased oxidative stress. Pretreatment of ECFCs with SFN prior to implantation may be a protective strategy for tissue-engineered constructs or cell therapies.

  13. Silencing of NRF2 Reduces the Expression of ALDH1A1 and ALDH3A1 and Sensitizes to 5-FU in Pancreatic Cancer Cells

    Directory of Open Access Journals (Sweden)

    Hong-Quan Duong


    Full Text Available Pancreatic cancer remains an intractable cancer with a poor five-year survival rate, which requires new therapeutic modalities based on the biology of pancreatic oncogenesis. Nuclear factor E2 related factor-2 (NRF2, a key cytoprotective nuclear transcription factor, regulates antioxidant production, reduction, detoxification and drug efflux proteins. It also plays an essential role in cell homeostasis, cell proliferation and resistance to chemotherapy. We aimed to evaluate the possibility that modulation of NRF2 expression could be effective in the treatment of pancreatic cancer cells. We investigated whether the depletion of NRF2 by using small interfering RNAs (siRNAs is effective in the expression of biomarkers of pancreatic cancer stemness such as aldehyde dehydrogenase 1 family, member A1 (ALDH1A1 and aldehyde dehydrogenase 3 family, member A1 (ALDH3A1. NRF2 knockdown markedly reduced the expression of NRF2 and glutamate-cysteine ligase catalytic subunit (GCLC in cell lines established from pancreatic cancers. NRF2 silencing also decreased the ALDH1A1 and ALDH3A1 expression. Furthermore, this NRF2 depletion enhanced the antiproliferative effects of the chemotherapeutic agent, 5-fluorouracil (5-FU in pancreatic cancer cells.

  14. Characterization of Nrf2 activation and heme oxygenase-1 expression in NIH3T3 cells exposed to aqueous extracts of cigarette smoke. (United States)

    Knörr-Wittmann, Constanze; Hengstermann, Arnd; Gebel, Stephan; Alam, Jawed; Müller, Thomas


    Cigarette smoke (CS) is a complex chemical mixture estimated to be composed of up to 5000 different chemicals, many of which are prooxidant. Here we show that, at least in vitro, the cellular response designed to combat oxidative stress resulting from CS exposure is primarily controlled by the transcription factor Nrf2, a principal inducer of antioxidant and phase II-related genes. The prominent role of Nrf2 in the cellular response to CS is substantiated by the following observations: In NIH3T3 cells exposed to aqueous extracts of CS (i) Nrf2 is strongly stabilized and becomes detectable in nuclear extracts. (ii) Nuclear localization of Nrf2 coincides with increased DNA binding of a putative Nrf2/MafK heterodimer to its cognate cis-regulatory site, i.e., the antioxidant-responsive element (ARE). (iii) Studies on the regulatory elements of the oxidative stress-inducible gene heme oxygenase-1 (hmox1) using various hmox1 promoter/luciferase reporter constructs revealed that the strong CS-dependent expression of this gene is primarily governed by the distal enhancers 1 ("E1") and 2 ("E2"), which both contain three canonical ARE-like stress-responsive elements (StREs). Notably, depletion of Nrf2 levels caused by RNA interference significantly compromised CS-induced hmox1 promoter activation, based on the distinct Nrf2 sensitivity exhibited by E1 and E2. Finally, (iv) siRNA-dependent knock-down of Nrf2 completely abrogated CS-induced expression of phase II-related genes. Taken together, these results confirm the outstanding role of Nrf2 both in sensing (oxidant) stress and in orchestrating an efficient transcriptional response aimed at resolving the stressing conditions.

  15. Different roles of ROS and Nrf2 in Cr(VI)-induced inflammatory responses in normal and Cr(VI)-transformed cells

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Ram Vinod; Pratheeshkumar, Poyil; Son, Yong-Ok; Wang, Lei [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Hitron, John Andrew [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Divya, Sasidharan Padmaja; Zhang, Zhuo [Department of Toxicology and Cancer Biology, College of Medicine, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States); Shi, Xianglin, E-mail: [Center for Research on Environmental Disease, University of Kentucky, 1095 VA Drive, Lexington, KY 40536 (United States)


    Hexavalent chromium (Cr(VI)) is classified as a human carcinogen. Cr(VI) has been associated with adenocarcinomas and squamous cell carcinoma of the lung. The present study shows that acute Cr(VI) treatment in human bronchial epithelial cells (BEAS-2B) increased inflammatory responses (TNF-α, COX-2, and NF-кB/p65) and expression of Nrf2. Cr(VI)-induced generation of reactive oxygen species (ROS) are responsible for increased inflammation. Despite the fact that Nrf2 is a master regulator of response to oxidative stress, silencing of Nrf2 in the acute Cr(VI) treatment had no effect on Cr(VI)-induced inflammation. In contrast, in Cr(VI)-transformed (CrT) cells, Nrf2 is constitutively activated. Knock-down of this protein resulted in decreased inflammation, while silencing of SOD2 and CAT had no effect in the expression of these inflammatory proteins. Results obtained from the knock-down of Nrf2 in CrT cells are very different from the results obtained in the acute Cr(VI) treatment. In BEAS-2B cells, knock-down of Nrf2 had no effect in the inflammation levels, while in CrT cells a decrease in the expression of inflammation markers was observed. These results indicate that before transformation, ROS plays a critical role while Nrf2 not in Cr(VI)-induced inflammation, whereas after transformation (CrT cells), Nrf2 is constitutively activated and this protein maintains inflammation while ROS not. Constitutively high levels of Nrf2 in CrT binds to the promoter regions of COX-2 and TNF-α, leading to increased inflammation. Collectively, our results demonstrate that before cell transformation ROS are important in Cr(VI)-induced inflammation and after transformation a constitutively high level of Nrf2 is important. - Highlights: • Cr(VI)-induced ROS increased inflammation, while Nrf2 had no effect. • In the CrT cells knock-down of Nrf2 resulted in decreased inflammation. • Mechanistic differences in regulating Cr(VI)-induced inflammation.

  16. Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells.

    Directory of Open Access Journals (Sweden)

    Madhusudhanan Narasimhan

    Full Text Available Nuclear factor-erythroid 2-related factor 2 (Nrf2/NFE2L2, a redox-sensitive transcription factor plays a critical role in adaptation to cellular stress and affords cellular defense by initiating transcription of antioxidative and detoxification genes. While a protein can be regulated at multiple levels, control of Nrf2 has been largely studied at post-translational regulation points by Keap1. Importantly, post-transcriptional/translational based regulation of Nrf2 is less understood and to date there are no reports on such mechanisms in neuronal systems. In this context, studies involving the role of microRNAs (miRs which are normally considered as fine tuning regulators of protein production through translation repression and/or post-transcriptional alterations, are in place. In the current study, based on in-silico analysis followed by immunoblotting and real time analysis, we have identified and validated for the first time that human NFE2L2 could be targeted by miR153/miR27a/miR142-5p/miR144 in neuronal, SH-SY5Y cells. Co-transfection studies with individual miR mimics along with either WT 3' UTR of human Nrf2 or mutated miRNA targeting seed sequence within Nrf2 3' UTR, demonstrated that Nrf2 is a direct regulatory target of these miRs. In addition, ectopic expression of miR153/miR27a/miR142-5p/miR144 affected Nrf2 mRNA abundance and nucleo-cytoplasmic concentration of Nrf2 in a Keap1 independent manner resulting in inefficient transactivating ability of Nrf2. Furthermore, forced expression of miRs diminished GCLC and GSR expression resulting in alteration of Nrf2 dependent redox homeostasis. Finally, bioinformatics based miRNA-disease network analysis (MDN along with extended computational network analysis of Nrf2 associated pathologic processes suggests that if in a particular cellular scenario where any of these miR153/miR27a/miR142-5p/miR144 either individually or as a group is altered, it could affect Nrf2 thus triggering and

  17. Noncanonical SQSTM1/p62-Nrf2 pathway activation mediates proteasome inhibitor resistance in multiple myeloma cells via redox, metabolic and translational reprogramming


    Riz, Irene; Hawley, Teresa S.; Marsal, Jeffrey W.; Hawley, Robert G.


    Multiple Myeloma (MM) is a B-cell malignancy characterized by the accumulation of clonal plasma cells in the bone marrow, with drug resistance being a major cause of therapeutic failure. We established a carfilzomib-resistant derivative of the LP-1 MM cell line (LP-1/Cfz) and found that the transcription factor NF-E2 p45-related factor 2 (Nrf2; gene symbol NFE2L2) contributes to carfilzomib resistance. The mechanism of Nrf2 activation involved enhanced translation of Nrf2 as well as its posit...

  18. Photothrombosis-Induced Infarction of the Mouse Cerebral Cortex Is Not Affected by the Nrf2-Activator Sulforaphane


    Porritt, Michelle J.; Andersson, Helene C.; Hou, Linda; Nilsson, Åsa; Pekna, Marcela; Pekny, Milos; Nilsson, Michael


    Sulforaphane-induced activation of the transcription factor NF-E2 related factor 2 (Nrf2 or the gene Nfe2l2) and subsequent induction of the phase II antioxidant system has previously been shown to exert neuroprotective action in a transient model of focal cerebral ischemia. However, its ability to attenuate functional and cellular deficits after permanent focal cerebral ischemia is not clear. We assessed the neuroprotective effects of sulforaphane in the photothrombotic model of permanent fo...

  19. The NRF2-KEAP1 Pathway Is an Early Responsive Gene Network in Arsenic Exposed Lymphoblastoid Cells (United States)

    Córdova, Emilio J.; Martínez-Hernández, Angélica; Uribe-Figueroa, Laura; Centeno, Federico; Morales-Marín, Mirna; Koneru, Harsha; Coleman, Matthew A.; Orozco, Lorena


    Inorganic arsenic (iAs), a major environmental contaminant, has risen as an important health problem worldwide. More detailed identification of the molecular mechanisms associated with iAs exposure would help to establish better strategies for prevention and treatment. Although chronic iAs exposures have been previously studied there is little to no information regarding the early events of exposure to iAs. To better characterize the early mechanisms of iAs exposure we conducted gene expression studies using sublethal doses of iAs at two different time-points. The major transcripts differentially regulated at 2 hrs of iAs exposure included antioxidants, detoxificants and chaperones. Moreover, after 12 hrs of exposure many of the down-regulated genes were associated with DNA replication and S phase cell cycle progression. Interestingly, the most affected biological pathway by both 2 or 12 hrs of iAs exposure were the Nrf2-Keap1 pathway, represented by the highly up-regulated HMOX1 transcript, which is transcriptionally regulated by the transcription factor Nrf2. Additional Nrf2 targets included SQSTM1 and ABCB6, which were not previously associated with acute iAs exposure. Signalling pathways such as interferon, B cell receptor and AhR route were also responsive to acute iAs exposure. Since HMOX1 expression increased early (20 min) and was responsive to low iAs concentrations (0.1 µM), this gene could be a suitable early biomarker for iAs exposure. In addition, the novel Nrf2 targets SQSTM1 and ABCB6 could play an important and previously unrecognized role in cellular protection against iAs. PMID:24516582

  20. Taurine Protects Mouse Spermatocytes from Ionizing Radiation-Induced Damage Through Activation of Nrf2/HO-1 Signaling. (United States)

    Yang, Wenjun; Huang, Jinfeng; Xiao, Bang; Liu, Yan; Zhu, Yiqing; Wang, Fang; Sun, Shuhan


    The increasing prevalence of ionizing radiation exposure has inevitably raised public concern over the potential detrimental effects of ionizing radiation on male reproductive system function. The detection of drug candidates to prevent reproductive system from damage caused by ionizing radiation is urgent. We aimed to investigate the protective role of taurine on the injury of mouse spermatocyte-derived cells (GC-2) subjected to ionizing radiation. mouse spermatocytes (GC-2 cells) were exposed to ionizing radiation with or without treatment of Taurine. The effect of ionizing radiation and Taurine treatment on GC-2 cells were evaluated by cell viability assay (CCK8), cell cycle and apoptosis. The relative protein abundance change was determined by Western blotting. The siRNA was used to explore whether Nrf2 signaling was involved in the cytoprotection of Taurine. Taurine significantly inhibited the decrease of cell viability, percentage of apoptotic cells and cell cycle arrest induced by ionizing radiation. Western blot analysis showed that taurine significantly limited the ionizing radiation-induced down-regulation of CyclinB1 and CDK1, and suppressed activation of Fas/FasL system pathway. In addition, taurine treatment significantly increased the expression of Nrf2 and HO-1 in GC-2 cells exposed to ionizing radiation, two components in antioxidant pathway. The above cytoprotection of Taurine was blocked by siNrf2. Our results demonstrate that taurine has the potential to effectively protect GC-2 cells from ionizing radiation- triggered damage via upregulation of Nrf2/HO-1 signaling. © 2017 The Author(s). Published by S. Karger AG, Basel.

  1. Effects of realgar on GSH synthesis in the mouse hippocampus: Involvement of system X{sub AG}{sup −}, system X{sub C}{sup −}, MRP-1 and Nrf2

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yanlei [Department of Health Laboratory Technology, School of Public Health, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China); School of Basic Medical Sciences, North China University of Science and Technology, 46 Xinhua Road, Tangshan, Hebei 063009 (China); Chen, Mo; Zhang, Yinghua; Huo, Taoguang [Department of Health Laboratory Technology, School of Public Health, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China); Fang, Ying [Department of Health Laboratory Technology, School of Public Health, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China); School of Pharmacy, Liaoning University of Traditional Chinese Medicine, No. 77 Shenning1 Road, Double D Port, Dalian, Liaoning 116600 (China); Jiao, Xuexin [Department of Health Laboratory Technology, School of Public Health, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China); Yuan, Mingmei [Department of Health Laboratory Technology, School of Public Health, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China); School of Pharmacy, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China); Jiang, Hong, E-mail: [Department of Health Laboratory Technology, School of Public Health, China Medical University, No. 77 Puhe Road, Shenyang North New Area, Shenyang, Liaoning 110122 (China)


    Realgar is a type of mineral drug that contains arsenic and has neurotoxicity. Glutathione (GSH), which is the main antioxidant in the central nervous system, plays a key role in antioxidant defenses and the detoxification of arsenic. However, whether realgar interferes with the synthesis of GSH in the brain and the molecular mechanisms underlying its effects are largely unknown. Here, we used mouse models of exposure to realgar to show that realgar affects the synthesis of GSH in the hippocampus, leading to ultrastructural changes in hippocampal neurons and synapses and deficiencies in cognitive abilities, and that the mechanisms that cause this effect may be associated with alterations in the expression of system X{sub AG}{sup −}, system X{sub C}{sup −}, multidrug resistance-associated protein 1(MRP-1), nuclear factor E2-related factor 2 (Nrf2), γ-glutamylcysteine synthetase (γ-GCS), and the levels of glutamate (Glu) and cysteine (Cys) in the extracellular fluid. These findings provide a theoretical basis for preventing the drug-induced chronic arsenic poisoning in the nervous system that is triggered by realgar. - Highlights: • Realgar can induce neurotoxicity. • Realgar can modulate GSH levels in the hippocampus. • The mechanisms rely on expression changes of system X{sub AG}{sup −}, system X{sub C}{sup −}, MRP-1, Nrf2.

  2. Sulforaphane Prevents Testicular Damage in Kunming Mice Exposed to Cadmium via Activation of Nrf2/ARE Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Shu-Hua Yang


    Full Text Available Sulforaphane (SFN is a natural and highly effective antioxidant. Studies suggest that SFN protects cells and tissues against cadmium (Cd toxicity. This study investigated the protective effect of SFN against oxidative damage in the testes of Kunming mice exposed to cadmium, and explored the possible molecular mechanisms involved. Cadmium greatly reduced the serum testosterone levels in mice, reduced sperm motility, total sperm count, and increased the sperm deformity rate. Cadmium also reduces superoxide dismutase (T-SOD and glutathione (GSH levels and increases malondialdehyde (MDA concentrations. SFN intervention improved sperm quality, serum testosterone, and antioxidant levels. Both mRNA and protein expression of mouse testicular nuclear factor-erythroid 2-related factor 2 (Nrf2 was reduced in cadmium-treated group. Furthermore, the downstream genes of Nrf2, glutathione peroxidase (GSH-Px, γ-glutamyl cysteine synthetase (γ-GCS, heme oxygenase-1 (HO-1, and NAD(PH:quinone oxidoreductase-1 (NQO1 were also decreased in cadmium-treated group. SFN intervention increases the expression of these genes. Sulforaphane prevents cadmium-induced testicular damage, probably via activation of Nrf2/ARE signaling.

  3. The Nrf1 and Nrf2 Balance in Oxidative Stress Regulation and Androgen Signaling in Prostate Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Schultz, Michelle A. [Department of Pharmacology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States); Abdel-Mageed, Asim B. [Department of Urology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States); Mondal, Debasis, E-mail: [Department of Pharmacology, Tulane University Medical Center, 1430 Tulane Avenue, New Orleans, LA 70112 (United States)


    Reactive oxygen species (ROS) signaling has recently sparked a surge of interest as being the molecular underpinning for cancer cell survival, but the precise mechanisms involved have not been completely elucidated. This review covers the possible roles of two ROS-induced transcription factors, Nrf1 and Nrf2, and the antioxidant proteins peroxiredoxin-1 (Prx-1) and Thioredoxin-1 (Txn-1) in modulating AR expression and signaling in aggressive prostate cancer (PCa) cells. In androgen independent (AI) C4-2B cells, in comparison to the parental androgen dependent (AD) LNCaP cells, we present evidence of high Nrf1 and Prx-1 expression and low Nrf2 expression in these aggressive PCa cells. Furthermore, in DHT treated C4-2B cells, increased expression of the p65 (active) isoform of Nrf1 correlated with enhanced AR transactivation. Our findings implicate a crucial balance of Nrf1 and Nrf2 signaling in regulating AR activity in AI-PCa cells. Here we will discuss how understanding the mechanisms by which oxidative stress may affect AR signaling may aid in developing novel therapies for AI-PCa.

  4. Photothrombosis-induced infarction of the mouse cerebral cortex is not affected by the Nrf2-activator sulforaphane.

    Directory of Open Access Journals (Sweden)

    Michelle J Porritt

    Full Text Available Sulforaphane-induced activation of the transcription factor NF-E2 related factor 2 (Nrf2 or the gene Nfe2l2 and subsequent induction of the phase II antioxidant system has previously been shown to exert neuroprotective action in a transient model of focal cerebral ischemia. However, its ability to attenuate functional and cellular deficits after permanent focal cerebral ischemia is not clear. We assessed the neuroprotective effects of sulforaphane in the photothrombotic model of permanent focal cerebral ischemia. Sulforaphane was administered (5 or 50 mg/kg, i.p. after ischemic onset either as a single dose or as daily doses for 3 days. Sulforaphane increased transcription of Nrf2, Hmox1, GCLC and GSTA4 mRNA in the brain confirming activation of the Nrf2 system. Single or repeated administration of sulforaphane had no effect on the infarct volume, nor did it reduce the number of activated glial cells or proliferating cells when analyzed 24 and 72 h after stroke. Motor-function as assessed by beam-walking, cylinder-test, and adhesive test, did not improve after sulforaphane treatment. The results show that sulforaphane treatment initiated after photothrombosis-induced permanent cerebral ischemia does not interfere with key cellular mechanisms underlying tissue damage.

  5. Photothrombosis-induced infarction of the mouse cerebral cortex is not affected by the Nrf2-activator sulforaphane. (United States)

    Porritt, Michelle J; Andersson, Helene C; Hou, Linda; Nilsson, Åsa; Pekna, Marcela; Pekny, Milos; Nilsson, Michael


    Sulforaphane-induced activation of the transcription factor NF-E2 related factor 2 (Nrf2 or the gene Nfe2l2) and subsequent induction of the phase II antioxidant system has previously been shown to exert neuroprotective action in a transient model of focal cerebral ischemia. However, its ability to attenuate functional and cellular deficits after permanent focal cerebral ischemia is not clear. We assessed the neuroprotective effects of sulforaphane in the photothrombotic model of permanent focal cerebral ischemia. Sulforaphane was administered (5 or 50 mg/kg, i.p.) after ischemic onset either as a single dose or as daily doses for 3 days. Sulforaphane increased transcription of Nrf2, Hmox1, GCLC and GSTA4 mRNA in the brain confirming activation of the Nrf2 system. Single or repeated administration of sulforaphane had no effect on the infarct volume, nor did it reduce the number of activated glial cells or proliferating cells when analyzed 24 and 72 h after stroke. Motor-function as assessed by beam-walking, cylinder-test, and adhesive test, did not improve after sulforaphane treatment. The results show that sulforaphane treatment initiated after photothrombosis-induced permanent cerebral ischemia does not interfere with key cellular mechanisms underlying tissue damage.

  6. EGCG evokes Nrf2 nuclear translocation and dampens PTP1B expression to ameliorate metabolic misalignment under insulin resistance condition. (United States)

    Mi, Yashi; Zhang, Wentong; Tian, Haoyu; Li, Runnan; Huang, Shuxian; Li, Xingyu; Qi, Guoyuan; Liu, Xuebo


    As a major nutraceutical component of green tea (-)-epigallocatechin-3-gallate (EGCG) has attracted interest from scientists due to its well-documented antioxidant and antiobesity bioactivities. In the current study, we aimed to investigate the protective effect of EGCG on metabolic misalignment and in balancing the redox status in mice liver and HepG2 cells under insulin resistance condition. Our results indicated that EGCG accelerates the glucose uptake and evokes IRS-1/Akt/GLUT2 signaling pathway via dampening the expression of protein tyrosine phosphatase 1B (PTP1B). Consistently, ectopic expression of PTP1B by Ad-PTP1B substantially impaired EGCG-elicited IRS-1/Akt/GLUT2 signaling pathway. Moreover, EGCG co-treatment stimulated nuclear translocation of Nrf2 by provoking P13K/AKT signaling pathway and thus modulated the downstream expressions of antioxidant enzymes such as HO-1 and NQO-1 in HepG2 cells. Furthermore, knockdown Nrf2 by small interfering RNA (siRNA) notably enhanced the expression of PTP1B and blunt EGCG-stimulated glucose uptake. Consistent with these results, in vivo study revealed that EGCG supplement significantly ameliorated high-fat and high-fructose diet (HFFD)-triggered insulin resistance and oxidative stress by up-regulating the IRS-1/AKT and Keap1/Nrf2 transcriptional pathways. Administration of an appropriate chemopreventive agent, such as EGCG, could potentially serve as an additional therapeutic intervention in the arsenal against obesity.

  7. Troxerutin Reduces Kidney Damage against BDE-47-Induced Apoptosis via Inhibiting NOX2 Activity and Increasing Nrf2 Activity

    Directory of Open Access Journals (Sweden)

    Qun Shan


    Full Text Available 2,2,4,4-Tetrabromodiphenyl ether (BDE-47, one of the persistent organic pollutants, seriously influences the quality of life; however, its pathological mechanism remains unclear. Troxerutin is a flavonoid with pharmacological activity of antioxidation and anti-inflammation. In the present study, we investigated troxerutin against BDE-47-induced kidney cell apoptosis and explored the underlying mechanism. The results show that troxerutin reduced renal cell apoptosis and urinary protein secretion in BDE-47-treated mice. Western blot analysis shows that troxerutin supplement enhanced the ratio of Bcl-2/Bax; inhibited the release of cytochrome c from mitochondria, the activation of procaspase-9 and procaspase-3, and the cleavage of PARP; and reduced FAS, FASL, and caspase-8 levels induced by BDE-47. In addition, troxerutin decreased the production of reactive oxygen species (ROS and increased the activities of antioxidative enzymes. Furthermore, troxerutin blunted Nrf2 ubiquitylation, enhanced the activity of Nrf2, decreased the activity of NOX2, and ameliorated kidney oxidant status of BDE-47-treated mice. Together, these results confirm that troxerutin could alleviate the cytotoxicity of BDE-47 through antioxidation and antiapoptosis, which suggests that its protective mechanism is involved in the inhibition of apoptosis via suppressing NOX2 activity and increasing Nrf2 signaling pathway.

  8. Spatially and Temporally Regulated NRF2 Gene Therapy Using Mcp-1 Promoter in Retinal Ganglion Cell Injury

    Directory of Open Access Journals (Sweden)

    Kosuke Fujita


    Full Text Available Retinal ganglion cell degeneration triggered by axonal injury is believed to underlie many ocular diseases, including glaucoma and optic neuritis. In these diseases, retinal ganglion cells are affected unevenly, both spatially and temporally, such that healthy and unhealthy cells coexist in different patterns at different time points. Herein, we describe a temporally and spatially regulated adeno-associated virus gene therapy aiming to reduce undesired off-target effects on healthy retinal neurons. The Mcp-1 promoter previously shown to be activated in stressed retinal ganglion cells following murine optic nerve injury was combined with the neuroprotective intracellular transcription factor Nrf2. In this model, Mcp-1 promoter-driven NRF2 expression targeting only stressed retinal ganglion cells showed efficacy equivalent to non-selective cytomegalovirus promoter-driven therapy for preventing cell death. However, cytomegalovirus promoter-mediated NRF2 transcription induced cellular stress responses and death of Brn3A-positive uninjured retinal ganglion cells. Such undesired effects were reduced substantially by adopting the Mcp-1 promoter. Combining a stress-responsive promoter and intracellular therapeutic gene is a versatile approach for specifically targeting cells at risk of degeneration. This strategy may be applicable to numerous chronic ocular and non-ocular conditions.

  9. Sulforaphane attenuates di-N-butylphthalate-induced reproductive damage in pubertal mice: Involvement of the Nrf2-antioxidant system. (United States)

    Jiang, Xu-Ping; Tang, Jing-Yuan; Xu, Zhen; Han, Peng; Qin, Zhi-Qiang; Yang, Cheng-di; Wang, Shang-Qian; Tang, Min; Wang, Wei; Qin, Chao; Xu, Yang; Shen, Bai-Xin; Zhou, Wei-Min; Zhang, Wei


    di-N-butylphthalate (DBP) is a ubiquitous environmental pollutant used for plastic coating and in the cosmetics industry. It has toxic effects on body health, especially the male reproductive system. Here, we investigated the effects of DBP on the male reproductive system of pubertal mice and explored the protective role of sulforaphane (SFN). The results showed that DBP significantly reduced the anogenital distance, testicular weight, sperm count and motility, and plasma and testicular testosterone levels and significantly increased the oxidative stress, sperm abnormalities, and testicular cell apoptosis. SFN supplementation ameliorated these effects. After DBP stimulation, the transcription factor nuclear factor erythroid-related factor 2 (Nrf2) was adaptively increased together with its target genes, such as HO-1 and NQO1. Upregulation of Nrf2 by SFN reduced the DBP-mediated intracellular oxidative toxicity and also increased testosterone secretion and spermatogenesis, which were decreased by DBP. These findings indicate that SFN can attenuate DBP-induced reproductive damage in pubertal mice via Nrf2-associated pathways. © 2017 Wiley Periodicals, Inc.

  10. The neuroprotective effects of α-iso-cubebene on dopaminergic cell death: involvement of CREB/Nrf2 signaling. (United States)

    Park, Sun Young; Son, Beung Gu; Park, Young Hoon; Kim, Cheol-Min; Park, Geuntae; Choi, Young-Whan


    As a part of ongoing studies to elucidate pharmacologically active components of Schisandra chinensis, we isolated and studied α-iso-cubebene. The neuroprotective mechanisms of α-iso-cubebene in human neuroblastoma SH-SY5Y cells were investigated. α-Iso-cubebene significantly inhibited cytotoxicity and apoptosis due to 6-hydroxydopamine (6-OHDA)-induced neurotoxicity in dopaminergic SH-SY5Y cells. Pretreatment of cells with α-iso-cubebene reduced intracellular accumulation of ROS and calcium in response to 6-OHDA. The neuroprotective effects of α-iso-cubebene were found to result from protecting the mitochondrial membrane potential. Notably, α-iso-cubebene inhibited the release of apoptosis-inducing factor from the mitochondria into the cytosol and nucleus after 6-OHDA treatment. α-Iso-cubebene also induced the activation of PKA/PKB/CREB/Nrf2 and suppressed 6-OHDA-induced neurotoxicity. α-Iso-cubebene was found to induce phosphorylation of PKA and PKB and activate Nrf2 and CREB signaling pathways in a dose-dependent manner. Additionally, α-iso-cubebene stimulated the expression of the antioxidant response genes NQO1 and HO-1. Finally, α-iso-cubebene-mediated neuroprotective effects were found to be reversible after transfection with CREB and Nrf2 small interfering RNAs.

  11. MdATG18a overexpression improves tolerance to nitrogen deficiency and regulates anthocyanin accumulation through increased autophagy in transgenic apple. (United States)

    Sun, Xun; Jia, Xin; Huo, Liuqing; Che, Runmin; Gong, Xiaoqing; Wang, Ping; Ma, Fengwang


    Nitrogen (N) availability is an essential factor for plant growth. Recycling and remobilization of N have strong impacts on crop yield and quality under N deficiency. Autophagy is a critical nutrient-recycling process that facilitates remobilization under starvation. We previously showed that an important AuTophaGy (ATG) protein from apple, MdATG18a, has a positive role in drought tolerance. In this study, we explored its biological role in response to low-N. Overexpression of MdATG18a in both Arabidopsis and apple improved tolerance to N-depletion and caused a greater accumulation of anthocyanin. The increased anthocyanin concentration in transgenic apple was possibly due to up-regulating flavonoid biosynthetic and regulatory genes (MdCHI, MdCHS, MdANS, MdPAL, MdUFGT, and MdMYB1) and higher soluble sugars concentration. MdATG18a overexpression enhanced starch degradation with up-regulating amylase gene (MdAM1) and up-regulated sugar metabolism related genes (MdSS1, MdHXKs, MdFK1, and MdNINVs). Furthermore, MdATG18a functioned in nitrate uptake and assimilation by up-regulating nitrate reductase MdNIA2 and 3 high-affinity nitrate transporters MdNRT2.1/2.4/2.5. MdATG18a overexpression also elevated other important MdATG genes expression and autophagosomes formation under N-depletion, which play key contributions to above changes. Together, these results demonstrate that overexpression of MdATG18a enhances tolerance to N-deficiencies and plays positive roles in anthocyanin biosynthesis through greater autophagic activity. © 2017 John Wiley & Sons Ltd.

  12. Effects of realgar on GSH synthesis in the mouse hippocampus: Involvement of system XAG(-), system XC(-), MRP-1 and Nrf2. (United States)

    Wang, Yanlei; Chen, Mo; Zhang, Yinghua; Huo, Taoguang; Fang, Ying; Jiao, Xuexin; Yuan, Mingmei; Jiang, Hong


    Realgar is a type of mineral drug that contains arsenic and has neurotoxicity. Glutathione (GSH), which is the main antioxidant in the central nervous system, plays a key role in antioxidant defenses and the detoxification of arsenic. However, whether realgar interferes with the synthesis of GSH in the brain and the molecular mechanisms underlying its effects are largely unknown. Here, we used mouse models of exposure to realgar to show that realgar affects the synthesis of GSH in the hippocampus, leading to ultrastructural changes in hippocampal neurons and synapses and deficiencies in cognitive abilities, and that the mechanisms that cause this effect may be associated with alterations in the expression of system XAG(-), system XC(-), multidrug resistance-associated protein 1(MRP-1), nuclear factor E2-related factor 2 (Nrf2), γ-glutamylcysteine synthetase (γ-GCS), and the levels of glutamate (Glu) and cysteine (Cys) in the extracellular fluid. These findings provide a theoretical basis for preventing the drug-induced chronic arsenic poisoning in the nervous system that is triggered by realgar. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi-Hwi; Kim, Eung-Hwi [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Jung, Hye Seung [Department of Internal Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Yang, Dongki [Department of Physiology, Gachon University College of Medicine, Incheon (Korea, Republic of); Park, Eun-Young, E-mail: [College of Pharmacy, Natural Medicine Research Institute, Mokpo National University, Muan-gun, Jeonnam (Korea, Republic of); Jun, Hee-Sook, E-mail: [College of Pharmacy, Gachon Institute of Pharmaceutical Science, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-ku, Incheon (Korea, Republic of); Gachon Medical Research Institute, Gil Hospital, Incheon (Korea, Republic of)


    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H{sub 2}O{sub 2}. Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is

  14. EX4 stabilizes and activates Nrf2 via PKCδ, contributing to the prevention of oxidative stress-induced pancreatic beta cell damage

    International Nuclear Information System (INIS)

    Kim, Mi-Hwi; Kim, Eung-Hwi; Jung, Hye Seung; Yang, Dongki; Park, Eun-Young; Jun, Hee-Sook


    Oxidative stress in pancreatic beta cells can inhibit insulin secretion and promote apoptotic cell death. Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, can suppress beta cell apoptosis, improve beta cell function and protect against oxidative damage. In this study, we investigated the molecular mechanisms for antioxidative effects of EX4 in pancreatic beta cells. INS-1 cells, a rat insulinoma cell line, were pretreated with EX4 and exposed to palmitate or H 2 O 2 . Reactive oxygen species (ROS) production, and glutathione and insulin secretion were measured. The mRNA and protein expression levels of antioxidant genes were examined. The level of nuclear factor erythroid 2-related factor 2 (Nrf2), its binding to antioxidant response element (ARE), and its ubiquination in the presence of EX4 were determined. The Nrf2 signaling pathway was determined using rottlerin (protein kinase [PK]Cδ inhibitor), H89 (PKA inhibitor) and LY294002 (phosphatidylinositide 3-kinase [PI3K] inhibitor). EX4 treatment decreased ROS production, recovered cellular glutathione levels and insulin secretion in the presence of oxidative stress in INS-1 cells. The expression levels of glutamate-cysteine ligase catalytic subunit and heme oxygenase-1 were increased by EX4 treatment. EX4 promoted Nrf2 translocation, ARE binding activity and enhanced stabilization of Nrf2 by inhibition of ubiquitination. Knockdown of Nrf2 abolished the effect of EX4 on increased insulin secretion. Inhibition of PKCδ attenuated Nrf2 translocation and antioxidative gene expression by EX4 treatment. We suggest that EX4 activates and stabilizes Nrf2 through PKCδ activation, contributing to the increase of antioxidant gene expression and consequently improving beta cell function in the presence of oxidative stress. - Highlights: • EX4 protects against oxidative stress-induced pancreatic beta cell dysfunction. • EX4 increases antioxidant gene expression. • Antioxidative effect of EX4 is mediated by

  15. 5-HMF attenuates striatum oxidative damage via Nrf2/ARE signaling pathway following transient global cerebral ischemia. (United States)

    Ya, Bai-Liu; Li, Hong-Fang; Wang, Hai-Ying; Wu, Fei; Xin, Qing; Cheng, Hong-Ju; Li, Wen-Juan; Lin, Na; Ba, Zai-Hua; Zhang, Ru-Juan; Liu, Qian; Li, Ya-Nan; Bai, Bo; Ge, Feng


    Recent studies have shown 5-hydroxymethyl-2-furfural (5-HMF) has favorable biological effects, and its neuroprotection in a variety of neurological diseases has been noted. Our previous study showed that treatment of 5-HMF led to protection against permanent global cerebral ischemia. However, the underlying mechanisms in cerebral ischemic injury are not fully understood. This study was conducted to investigate the neuroprotective effect of 5-HMF and elucidate the nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathway mechanism in the striatum after transient global cerebral ischemia. C57BL/6 mice were subjected to bilateral common carotid artery occlusion for 20 min and sacrificed 24 h after reperfusion. 5-HMF (12 mg/kg) or an equal volume of vehicle was intraperitoneally injected 30 min before ischemia and 5 min after the onset of reperfusion. At 24 h after reperfusion, neurological function was evaluated by neurological disability status scale, locomotor activity test and inclined beam walking test. Histological injury of the striatum was observed by cresyl violet staining and terminal deoxynucleotidyl transferase (TdT)-mediated dNTP nick end labeling (TUNEL) staining. Oxidative stress was evaluated by the carbonyl groups introduced into proteins, and malondialdehyde (MDA) levels. An enzyme-linked immunosorbent assay (ELISA)-based measurement was used to detect Nrf2 DNA binding activity. Nrf2 and its downstream ARE pathway protein expression such as heme oxygenase-1, NAD (P)H:quinone oxidoreductase 1, glutamate-cysteine ligase catalytic subunit and glutamate-cysteine ligase modulatory subunit were detected by western blot. Our results showed that 5-HMF treatment significantly ameliorated neurological deficits, reduced brain water content, attenuated striatum neuronal damage, decreased the carbonyl groups and MDA levels, and activated Nrf2/ARE signaling pathway. Taken together, these results demonstrated that

  16. Protective Effect of Tempol on Acute Kidney Injury Through PI3K/Akt/Nrf2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Gensheng Zhang


    Full Text Available Background/Aims: Tempol is a protective antioxidant against ischemic injury in many animal models. The molecular mechanisms are not well understood. Nuclear factor erythroid 2-related factor (Nrf2 is a master transcription factor during oxidative stress, which is enhanced by activation of protein kinase C (PKC pathway. Another factor, tubular epithelial apoptosis, is mediated by activation of phosphoinositide 3-kinase (PI3K/protein kinase B (PKB, Akt signaling pathway during renal ischemic injury. We tested the hypothesis that tempol activates PKC or PI3K/Akt/Nrf2 pathways to transcribe many genes that coordinate endogenous antioxidant defense. Methods: The right renal pedicle was clamped for 45 minutes and the left kidney was removed to study renal ischemia/reperfusion (I/R injury in C57BL/6 mice. The response was assessed from serum parameters, renal morphology and renal expression of PKC, phosphorylated-PKC (p-PKC, Nrf2, heme oxygenase-1 (HO-1, Akt, phosphorylated-Akt (p-Akt, pro-caspase-3 and cleaved caspase-3 in groups of sham and I/R mice given vehicle, or tempol (50 or 100 mg/kg, intraperitoneal injection. Results: The serum malondialdehyde (MDA, marker of reactive oxygen species doubled and the BUN and creatinine increased 5- to 10-fold after I/R injury. Tempol (50 or 100 mg/kg prevented the increases in MDA but only tempol (50 mg/kg lessened the increases in BUN and creatinine and moderated the acute tubular necrosis. I/R did not change expression of PKC or p-PKC but reduced renal expression of Nrf2, p-Akt, HO-1 and pro-caspase-3 and increased cleaved caspase-3. Tempol (50 mg/kg prevented these changes produced by I/R whereas tempol (100 mg/kg had lesser or inconsistent effects. Conclusion: Tempol (50 mg/kg prevents lipid peroxidation and attenuates renal damage after I/R injury. The beneficial pathway apparently is not dependent on upregulation or phosphorylation of PKC, at lower tempol doses, does implicate upregulation of Akt with

  17. Sulforaphane protects rodent retinas against ischemia-reperfusion injury through the activation of the Nrf2/HO-1 antioxidant pathway.

    Directory of Open Access Journals (Sweden)

    Hong Pan

    Full Text Available Retinal ischemia-reperfusion (I/R injury induces oxidative stress, leukocyte infiltration, and neuronal cell death. Sulforaphane (SF, which can be obtained in cruciferous vegetables such as broccoli, exerts protective effects in response to oxidative stress in various tissues. These effects can be initiated through nuclear factor E2-related factor 2 (Nrf2-mediated induction of heme oxygenase-1 (HO-1. This investigation was designed to elucidate the neural protective mechanisms of SF in the retinal I/R rat model. Animals were intraperitoneally (i.p. injected with SF (12.5 mg/kg or vehicle (corn oil once a day for 7 consecutive days. Then, retinal I/R was made by elevating the intraocular pressure (IOP to 130 mmHg for 1 h. To determine if HO-1 was involved in the Nrf2 antioxidant pathway, rats were subjected to protoporphyrin IX zinc (II (ZnPP, 30 mg/kg, i.p. treatments at 24 h before retinal ischemia. The neuroprotective effects of SF were assessed by determining the morphology of the retina, counting the infiltrating inflammatory cells and the surviving retinal ganglion cells (RGCs and amacrine cells, and measuring apoptosis in the retinal layers. The expression of Nrf2 and HO-1 was studied by immunofluorescence analysis and western blotting. I/R induced a marked increase of ROS generation, caused pronounced inflammation, increased the apoptosis of RGCs and amacrine cells and caused the thinning of the inner retinal layer (IRL, and these effects were diminished or abolished by SF pretreatment. Meanwhile, SF pretreatment significantly elevated the nuclear accumulation of Nrf2 and the level of HO-1 expression in the I/R retinas; however, ZnPP reversed the protective effects of SF on I/R retinas. Together, we offer direct evidence that SF had protective effects on I/R retinas, which could be attributed, at least in part, to the activation of the Nrf2/HO-1 antioxidant pathway.

  18. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    International Nuclear Information System (INIS)

    Gu, Da-min; Lu, Pei-Hua; Zhang, Ke; Wang, Xiang; Sun, Min; Chen, Guo-Qian; Wang, Qiong


    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R

  19. Induction of cancer chemopreventive enzymes by coffee is mediated by transcription factor Nrf2. Evidence that the coffee-specific diterpenes cafestol and kahweol confer protection against acrolein

    International Nuclear Information System (INIS)

    Higgins, Larry G.; Cavin, Christophe; Itoh, Ken; Yamamoto, Masayuki; Hayes, John D.


    Mice fed diets containing 3% or 6% coffee for 5 days had increased levels of mRNA for NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase class Alpha 1 (GSTA1) of between 4- and 20-fold in the liver and small intestine. Mice fed 6% coffee also had increased amounts of mRNA for UDP-glucuronosyl transferase 1A6 (UGT1A6) and the glutamate cysteine ligase catalytic (GCLC) subunit of between 3- and 10-fold in the small intestine. Up-regulation of these mRNAs was significantly greater in mice possessing Nrf2 (NF-E2 p45 subunit-related factor 2) than those lacking the transcription factor. Basal levels of mRNAs for NQO1, GSTA1, UGT1A6 and GCLC were lower in tissues from nrf2 -/- mice than from nrf2 +/+ mice, but modest induction occurred in the mutant animals. Treatment of mouse embryonic fibroblasts (MEFs) from nrf2 +/+ mice with either coffee or the coffee-specific diterpenes cafestol and kahweol (C + K) increased NQO1 mRNA up to 9-fold. MEFs from nrf2 -/- mice expressed less NQO1 mRNA than did wild-type MEFs, but NQO1 was induced modestly by coffee or C + K in the mutant fibroblasts. Transfection of MEFs with nqo1-luciferase reporter constructs showed that induction by C + K was mediated primarily by Nrf2 and required the presence of an antioxidant response element in the 5'-upstream region of the gene. Luciferase reporter activity did not increase following treatment of MEFs with 100 μmol/l furan, suggesting that this ring structure within C + K is insufficient for gene induction. Priming of nrf2 +/+ MEFs, but not nrf2 -/- MEFs, with C + K conferred 2-fold resistance towards acrolein

  20. EGFR mediates astragaloside IV-induced Nrf2 activation to protect cortical neurons against in vitro ischemia/reperfusion damages

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Da-min [Department of Anesthesiology, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Lu, Pei-Hua, E-mail: [Department of Medical Oncology, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China); Zhang, Ke; Wang, Xiang [Department of Anesthesiology, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Sun, Min [Department of General Surgery, Affiliated Yixing People' s Hospital, Jiangsu University, Yixing (China); Chen, Guo-Qian [Department of Clinical Laboratory, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China); Wang, Qiong, E-mail: [Department of Clinical Laboratory, Wuxi People' s Hospital Affiliated to Nanjing Medical University, Wuxi (China)


    In this study, we tested the potential role of astragaloside IV (AS-IV) against oxygen and glucose deprivation/re-oxygenation (OGD/R)-induced damages in murine cortical neurons, and studied the associated signaling mechanisms. AS-IV exerted significant neuroprotective effects against OGD/R by reducing reactive oxygen species (ROS) accumulation, thereby attenuating oxidative stress and neuronal cell death. We found that AS-IV treatment in cortical neurons resulted in NF-E2-related factor 2 (Nrf2) signaling activation, evidenced by Nrf2 Ser-40 phosphorylation, and its nuclear localization, as well as transcription of antioxidant-responsive element (ARE)-regulated genes: heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO-1) and sulphiredoxin 1 (SRXN-1). Knockdown of Nrf2 through lentiviral shRNAs prevented AS-IV-induced ARE genes transcription, and abolished its anti-oxidant and neuroprotective activities. Further, we discovered that AS-IV stimulated heparin-binding-epidermal growth factor (HB-EGF) release to trans-activate epidermal growth factor receptor (EGFR) in cortical neurons. Blockage or silencing EGFR prevented Nrf2 activation by AS-IV, thus inhibiting AS-IV-mediated anti-oxidant and neuroprotective activities against OGD/R. In summary, AS-IV protects cortical neurons against OGD/R damages through activating of EGFR-Nrf2 signaling. - Highlights: • Pre-treatment of astragaloside IV (AS-IV) protects murine cortical neurons from OGD/R. • AS-IV activates Nrf2-ARE signaling in murine cortical neurons. • Nrf2 is required for AS-IV-mediated anti-oxidant and neuroprotective activities. • AS-IV stimulates HB-EGF release to trans-activate EGFR in murine cortical neurons. • EGFR mediates AS-IV-induced Nrf2 activation and neuroprotection against OGD/R.

  1. Induction of the pi class of glutathione S-transferase by carnosic acid in rat Clone 9 cells via the p38/Nrf2 pathway. (United States)

    Lin, Chia-Yuan; Wu, Chi-Rei; Chang, Shu-Wei; Wang, Yu-Jung; Wu, Jia-Jiuan; Tsai, Chia-Wen


    Induction of phase II enzymes is important in cancer chemoprevention. We compared the effect of rosemary diterpenes on the expression of the pi class of glutathione S-transferase (GSTP) in rat liver Clone 9 cells and the signaling pathways involved. Culturing cells with 1, 5, 10, or 20 μM carnosic acid (CA) or carnosol (CS) for 24 h in a dose-dependent manner increased the GSTP expression. CA was more potent than CS. The RNA level and the enzyme activity of GSTP were also enhanced by CA treatment. Treatment with 10 μM CA highly induced the reporter activity of the enhancer element GPEI. Furthermore, CA markedly increased the translocation of nuclear factor erythroid-2 related factor 2 (Nrf2) from the cytosol to the nucleus after 30 to 60 min. CA the stimulated the protein induction of p38, nuclear Nrf2, and GSTP was diminished in the presence of SB203580 (a p38 inhibitor). In addition, SB203580 pretreatment or silencing of Nrf2 by siRNA suppressed the CA-induced GPEI-DNA binding activity and GSTP protein expression. Knockdown of p38 or Nrf2 by siRNA abolished the activation of p38 and Nrf2 as well as the protein induction and enzyme activity of GSTP by CA. These results suggest that CA up-regulates the expression and enzyme activity of GSTP via the p38/Nrf2/GPEI pathway.

  2. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail:; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail:


    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  3. Schisandra sphenanthera extract (Wuzhi Tablet protects against chronic-binge and acute alcohol-induced liver injury by regulating the NRF2-ARE pathway in mice

    Directory of Open Access Journals (Sweden)

    Xuezhen Zeng


    Full Text Available Alcohol abuse leads to alcoholic liver disease and no effective therapy is currently available. Wuzhi Tablet (WZ, a preparation of extract from Schisandra sphenanthera that is a traditional hepato-protective herb, exerted a significant protective effect against acetaminophen-induced liver injury in our recent studies, but whether WZ can alleviate alcohol-induced toxicity remains unclear. This study aimed to investigate the contribution of WZ to alcohol-induced liver injury by using chronic-binge and acute models of alcohol feeding. The activities of ALT and AST in serum were assessed as well as the level of GSH and the activity of SOD in the liver. The expression of CYP2E1 and proteins in the NRF2-ARE signaling pathway including NRF2, GCLC, GCLM, HO-1 were measured, and the effect of WZ on NRF2 transcriptional activity was determined. We found that both models resulted in liver steatosis accompanied by increased transaminase activities, but that liver injury was significantly attenuated by WZ. WZ administration also inhibited CYP2E1 expression induced by alcohol, and elevated the level of GSH and the activity of SOD in the liver. Moreover, the NRF2-ARE signaling pathway was activated by WZ and the target genes were all upregulated. Furthermore, WZ significantly activated NRF2 transcriptional activity. Collectively, our study demonstrates that WZ protected against alcohol-induced liver injury by reducing oxidative stress and improving antioxidant defense, possibly by activating the NRF2-ARE pathway.

  4. The effect of Mastin® on expression of Nrf2 in the rat heart with subtotally nephrectomy chronic Kidney disease model (United States)

    Nathania, J.; Soetikno, V.


    Chronic kidney disease (CKD) is increasingly prevalent in Indonesia and worldwide. One of the major causes of morbidity and mortality in CKD is the complication of cardiovascular disease. Mastin® is a supplement that is locally produced in Indonesia and is made from extract of mangosteen pericarp, which is reported to have antioxidative, anti-inflammatory, and antitumor properties. The present study aimed to investigate whether Mastin® could improve antioxidant responses in the rat heart during CKD by measuring the expression of nuclear factor erythroid-2-related factor (Nrf)2, a master regulator of antioxidant response elements. RNA was extracted from the heart tissue of three groups of rats: a normal group, a nephrectomy group, and a nephrectomy with Mastin® group. Two-step real-time RT-PCR was then conducted to calculate the relative expression of the Nrf2 gene. Nrf2 expression was markedly decreased in the nephrectomy group vs the normal group, but slightly increas ed in the nephrectomy with Mastin® group vs the nephrectomy group. CKD resulted in impaired activation of the Nrf2 pathway in the rat heart. Although the administration of Mastin® slightly increased Nrf2 expression, it was not enough to confer cardioprotective effects through the Nrf2 pathway.

  5. PF-4708671, a specific inhibitor of p70 ribosomal S6 kinase 1, activates Nrf2 by promoting p62-dependent autophagic degradation of Keap1

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)


    p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.

  6. Carvedilol, a third-generation β-blocker prevents oxidative stress-induced neuronal death and activates Nrf2/ARE pathway in HT22 cells

    Energy Technology Data Exchange (ETDEWEB)

    Ouyang, Ying [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Ziwei [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Tan, Min [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Department of Traditional Chinese Medicine Chemistry, College of Chinese Materia Madica, Guangzhou University of Chinese Medicine, Guangzhou 510006 (China); Liu, Anmin [Department of Neurosurgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Chen, Meihui [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Liu, Jun [Department of Neurology, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China); Pi, Rongbiao, E-mail: [Department of Pharmacology and Toxicology, School of Pharmaceutical Sciences, Sun Yat-Sen University, Guangzhou (China); Fang, Jianpei, E-mail: [Department of Pediatrics, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou (China)


    Highlights: •Carvedilol significantly prevented oxidative stress-induced cell death. •Carvedilol significantly decreased the production of ROS. •Carvedilol activated Nrf2/ARE pathway. •Carvedilol increased the protein levels of HO-1 and NQO-1. -- Abstract: Carvedilol, a nonselective β-adrenoreceptor blocker with pleiotropic activities has been shown to exert neuroprotective effect due to its antioxidant property. However, the neuroprotective mechanism of carvedilol is still not fully uncovered. Nuclear factor E2-related factor 2 (Nrf2)/antioxidant response element (ARE) pathway is an important cellular stress response pathway involved in neuroprotection. Here we investigated the effect of carvedilol on oxidative stress-induced cell death (glutamate 2 mM and H{sub 2}O{sub 2} 600 μM) and the activity of Nrf2/ARE pathway in HT22 hippocampal cells. Carvedilol significantly increased cell viability and decreased ROS in HT22 cells exposed to glutamate or H{sub 2}O{sub 2}. Furthermore, carvedilol activated the Nrf2/ARE pathway in a concentration-dependent manner, and increased the protein levels of heme oxygenase-1(HO-1) and NAD(P)H quinone oxidoreductase-1(NQO-1), two downstream factors of the Nrf2/ARE pathway. Collectively, our results indicate that carvedilol protects neuronal cell against glutamate- and H{sub 2}O{sub 2}-induced neurotoxicity possibly through activating the Nrf2/ARE signaling pathway.

  7. Altered methanol embryopathies in embryo culture with mutant catalase-deficient mice and transgenic mice expressing human catalase

    International Nuclear Information System (INIS)

    Miller, Lutfiya; Wells, Peter G.


    The mechanisms underlying the teratogenicity of methanol (MeOH) in rodents, unlike its acute toxicity in humans, are unclear, but may involve reactive oxygen species (ROS). Embryonic catalase, although expressed at about 5% of maternal activity, may protect the embryo by detoxifying ROS. This hypothesis was investigated in whole embryo culture to remove confounding maternal factors, including metabolism of MeOH by maternal catalase. C57BL/6 (C57) mouse embryos expressing human catalase (hCat) or their wild-type (C57 WT) controls, and C3Ga.Cg-Catb/J acatalasemic (aCat) mouse embryos or their wild-type C3HeB/FeJ (C3H WT) controls, were explanted on gestational day (GD) 9 (plug = GD 1), exposed for 24 h to 4 mg/ml MeOH or vehicle, and evaluated for functional and morphological changes. hCat and C57 WT vehicle-exposed embryos developed normally. MeOH was embryopathic in C57 WT embryos, evidenced by decreases in anterior neuropore closure, somites developed and turning, whereas hCat embryos were protected. Vehicle-exposed aCat mouse embryos had lower yolk sac diameters compared to C3H WT controls, suggesting that endogenous ROS are embryopathic. MeOH was more embryopathic in aCat embryos than WT controls, with reduced anterior neuropore closure and head length only in catalase-deficient embryos. These data suggest that ROS may be involved in the embryopathic mechanism of methanol, and that embryonic catalase activity may be a determinant of teratological risk.

  8. Protective role of Nrf2 against mechanical-stretch-induced apoptosis in mouse fibroblasts: a potential therapeutic target of mechanical-trauma-induced stress urinary incontinence. (United States)

    Li, Qiannan; Li, Bingshu; Liu, Cheng; Wang, Linlin; Tang, Jianming; Hong, Li


    We investigated the protective effect and underlying molecular mechanism of nuclear factor-E2-related factor 2 (Nrf2) against mechanical-stretch-induced apoptosis in mouse fibroblasts. Normal cells, Nrf2 silencing cells, and Nrf2 overexpressing cells were respectively divided into two groups-nonintervention and cyclic mechanical strain (CMS)-subjected to CMS of 5333 μ (1.0 Hz for 4 h), six groups in total (control, CMS, shNfe212, shNfe212 + CMS, LV-shNfe212, and LV-shNfe212 + CMS). After treatment, cell apoptosis; cell-cycle distribution; expressions of Nrf2, Bax, Bcl-2, Cyt-C, caspase-3, caspase-9, cleaved-caspase-3, and cleaved-caspase-9; mitochondrial membrane potential (ΔΨm); reactive oxygen species (ROS); and malondialdehyde (MDA) levels were measured. Thirty virgin female C57BL/6 mice were divided into two groups: control (without intervention) and vaginal distension (VD) groups, which underwent VD for 1 h with an 8-mm dilator (0.3 ml saline). Leak-point pressure (LPP) was tested on day 7 after VD; Nrf2 expression, apoptosis, and MDA levels were then measured in urethra and anterior vaginal wall. Mechanical stretch decreased Nrf2 messenger RNA (mRNA) and protein expressions. Overexpression of Nrf2 alleviated mechanical-stretch-induced cell apoptosis; S-phase arrest of cell cycle; up-regulation of Bax, cytochrome C (Cyt-C), ROS, MDA, ratio of cleaved-caspase-3/caspase-3 and cleaved-caspase-9/caspase-9; and exacerbated the decrease of Bcl2 and ΔΨm in L929 cells. On the contrary, silencing of Nrf2 showed opposite effects. Besides, VD reduced LPP levels and Nrf2 expression and increased cell apoptosis and MDA generation in the urethra and anterior vaginal wall. Nrf2 exhibits a protective role against mechanical-stretch -induced apoptosis on mouse fibroblasts, which might indicate a potential therapeutic target of mechanical-trauma-induced stress urinary incontinence (SUI).

  9. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    International Nuclear Information System (INIS)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun; Yang, Chung S.; Zhang, Jinsong


    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  10. Green tea polyphenol (−)-epigallocatechin-3-gallate triggered hepatotoxicity in mice: Responses of major antioxidant enzymes and the Nrf2 rescue pathway

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dongxu; Wang, Yijun; Wan, Xiaochun [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China); Yang, Chung S. [Department of Chemical Biology, Ernest Mario School of Pharmacy, Rutgers, The State University of New Jersey, Piscataway, NJ 08854 (United States); Zhang, Jinsong, E-mail: [Key Laboratory of Tea Biochemistry & Biotechnology, School of Tea & Food Science, Anhui Agricultural University, Hefei, Anhui 230036 (China)


    (−)-Epigallocatechin-3-gallate (EGCG), a constituent of green tea, has been suggested to have numerous health-promoting effects. On the other hand, high-dose EGCG is able to evoke hepatotoxicity. In the present study, we elucidated the responses of hepatic major antioxidant enzymes and nuclear factor erythroid 2-related factor 2 (Nrf2) rescue pathway to high-dose levels of EGCG in Kunming mice. At a non-lethal toxic dose (75 mg/kg, i.p.), repeated EGCG treatments markedly decreased the levels of superoxide dismutase, catalase, and glutathione peroxidase. As a rescue response, the nuclear distribution of Nrf2 was significantly increased; a battery of Nrf2-target genes, including heme oxygenase 1 (HO1), NAD(P)H:quinone oxidoreductase 1 (NQO1), glutathione S-transferase (GST), and those involved in glutathione and thioredoxin systems, were all up-regulated. At the maximum tolerated dose (45 mg/kg, i.p.), repeated EGCG treatments did not disturb the major antioxidant defense. Among the above-mentioned genes, only HO1, NQO1, and GST genes were significantly but modestly up-regulated, suggesting a comprehensive and extensive activation of Nrf2-target genes principally occurs at toxic levels of EGCG. At a lethal dose (200 mg/kg, i.p.), a single EGCG treatment dramatically decreased not only the major antioxidant defense but also the Nrf2-target genes, demonstrating that toxic levels of EGCG are able to cause a biphasic response of Nrf2. Overall, the mechanism of EGCG-triggered hepatotoxicity involves suppression of major antioxidant enzymes, and the Nrf2 rescue pathway plays a vital role for counteracting EGCG toxicity. - Highlights: • EGCG at maximum tolerated dose does not disturb hepatic major antioxidant defense. • EGCG at maximum tolerated dose modestly upregulates hepatic Nrf2 target genes. • EGCG at toxic dose suppresses hepatic major antioxidant enzymes. • EGCG at non-lethal toxic dose pronouncedly activates hepatic Nrf2 rescue response. • EGCG at

  11. NRF2 Signaling Negatively Regulates Phorbol-12-Myristate-13-Acetate (PMA-Induced Differentiation of Human Monocytic U937 Cells into Pro-Inflammatory Macrophages.

    Directory of Open Access Journals (Sweden)

    Min-Gu Song

    Full Text Available Blood monocytes are recruited to injured tissue sites and differentiate into macrophages, which protect against pathogens and repair damaged tissues. Reactive oxygen species (ROS are known to be an important contributor to monocytes' differentiation and macrophages' function. NF-E2-related factor 2 (NRF2, a transcription factor regulating cellular redox homeostasis, is known to be a critical modulator of inflammatory responses. We herein investigated the role of NRF2 in macrophage differentiation using the human monocytic U937 cell line and phorbol-12-myristate-13-acetate (PMA. In U937 cells with NRF2 silencing, PMA-stimulated cell adherence was significantly facilitated when compared to control U937 cells. Both transcript and protein levels for pro-inflammatory cytokines, including interleukine-1β (IL-1β, IL-6, and tumor necrosis factor-α (TNFα were highly elevated in PMA-stimulated NRF2-silenced U937 compared to the control. In addition, PMA-inducible secretion of monocyte chemotactic protein 1 (MCP-1 was significantly high in NRF2-silenced U937. As an underlying mechanism, we showed that NRF2-knockdown U937 retained high levels of cellular ROS and endoplasmic reticulum (ER stress markers expression; and subsequently, PMA-stimulated levels of Ca2+ and PKCα were greater in NRF2-knockdown U937 cells, which caused enhanced nuclear accumulation of nuclear factor-ҡB (NFҡB p50 and extracellular signal-regulated kinase (ERK-1/2 phosphorylation. Whereas the treatment of NRF2-silenced U937 cells with pharmacological inhibitors of NFҡB or ERK1/2 largely blocked PMA-induced IL-1β and IL-6 expression, indicating that these pathways are associated with cell differentiation. Taken together, our results suggest that the NRF2 system functions to suppress PMA-stimulated U937 cell differentiation into pro-inflammatory macrophages and provide evidence that the ROS-PKCα-ERK-NFҡB axis is involved in PMA-facilitated differentiation of NRF2-silenced U937

  12. Estrogen receptor and PI3K/Akt signaling pathway involvement in S-(-equol-induced activation of Nrf2/ARE in endothelial cells.

    Directory of Open Access Journals (Sweden)

    Ting Zhang

    Full Text Available S-(-equol, a natural product of the isoflavone daidzein, has been reported to offer cytoprotective effects with respect to the cardiovascular system, but how this occurs is unclear. Interestingly, S-(-equol is produced by the human gut, suggesting a role in physiological processes. We report that treatment of human umbilical vein endothelial cells and EA.hy926 cells with S-(-equol induces ARE-luciferase reporter gene activity that is dose and time dependent. S-(-equol (10-250 nM increases nuclear factor-erythroid 2-related factor 2 (Nrf2 as well as gene products of Nrf2 target genes heme oxygenase-1 (HO-1 and NAD(PH (nicotinamide-adenine-dinucleotide-phosphate quinone oxidoreductase 1 (NQO1. Endothelial cells transfected with an HA-Nrf2 expression plasmid had elevated HA-Nrf2, HO-1, and NQO1 in response to S-(-equol exposure. S-(-equol treatment affected Nrf2 mRNA only slightly but significantly increased HO-1 and NQO1 mRNA. The pretreatment of cells with specific ER inhibitors or PI3K/Akt (ICI182,780 and LY294002 increased Nrf2, HO-1, and NQO1 protein, impaired nuclear translocation of HA-Nrf2, and decreased ARE-luciferase activity. Identical experiments were conducted with daidzein, which had effects similar to S-(-equol. In addition, DPN treatment (an ERβ agonist induced the ARE-luciferase reporter gene, promoting Nrf2 nuclear translocation. Cell pretreatment with an ERβ antagonist (PHTPP impaired S-(-equol-induced Nrf2 activation. Pre-incubation of cells followed by co-treatment with S-(-equol significantly improved cell survival in response to H2O2 or tBHP and reduced apoptotic and TUNEL-positively-stained cells. Notably, the ability of S-(-equol to protect against H2O2-induced cell apoptosis was attenuated in cells transfected with an siRNA against Nrf2. Thus, beneficial effects of S-(-equol with respect to cytoprotective antioxidant gene activation may represent a novel strategy to prevent and treat cardiovascular diseases.

  13. Hydrogen Gas Inhalation Attenuates Seawater Instillation-Induced Acute Lung Injury via the Nrf2 Pathway in Rabbits. (United States)

    Diao, Mengyuan; Zhang, Sheng; Wu, Lifeng; Huan, Le; Huang, Fenglou; Cui, Yunliang; Lin, Zhaofen


    Seawater instillation-induced acute lung injury involves oxidative stress and apoptosis. Although hydrogen gas inhalation is reportedly protective in multiple types of lung injury, the effect of hydrogen gas inhalation on seawater instillation-induced acute lung injury remains unknown. This study investigated the effect of hydrogen gas on seawater instillation-induced acute lung injury and explored the mechanisms involved. Rabbits were randomly assigned to control, hydrogen (2 % hydrogen gas inhalation), seawater (3 mL/kg seawater instillation), and seawater + hydrogen (3 mL/kg seawater instillation + 2 % hydrogen gas inhalation) groups. Arterial partial oxygen pressure and lung wet/dry weight ratio were detected. Protein content in bronchoalveolar lavage fluid (BALF) and serum as well as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 levels were determined. Hematoxylin-eosin staining was used to monitor changes in lung specimens, and malondialdehyde (MDA) content and myeloperoxidase (MPO) activity were assayed. In addition, NF-E2-related factor (Nrf) 2 and heme oxygenase (HO)-1 mRNA and protein expression were measured, and apoptosis was assessed by measuring caspase-3 expression and using terminal deoxy-nucleotidyl transferase dUTP nick end-labeling (TUNEL) staining. Hydrogen gas inhalation markedly improved lung endothelial permeability and decreased both MDA content and MPO activity in lung tissue; these changes were associated with decreases in TNF-α, IL-1β, and IL-6 in BALF. Hydrogen gas also alleviated histopathological changes and cell apoptosis. Moreover, Nrf2 and HO-1 expressions were significantly activated and caspase-3 expression was inhibited. These results demonstrate that hydrogen gas inhalation attenuates seawater instillation-induced acute lung injury in rabbits and that the protective effects observed may be related to the activation of the Nrf2 pathway.

  14. Aggressive mammary carcinoma progression in Nrf2 knockout mice treated with 7,12-dimethylbenz[a]anthracene

    International Nuclear Information System (INIS)

    Becks, Lisa; Shi, Runhua; McLarty, Jerry; Pruitt, Kevin; Zhang, Songlin; Kleiner-Hancock, Heather E; Prince, Misty; Burson, Hannah; Christophe, Christopher; Broadway, Mason; Itoh, Ken; Yamamoto, Masayuki; Mathis, Michael; Orchard, Elysse


    Activation of nuclear factor erythroid 2-related factor (Nrf2), which belongs to the basic leucine zipper transcription factor family, is a strategy for cancer chemopreventive phytochemicals. It is an important regulator of genes induced by oxidative stress, such as glutathione S-transferases, heme oxygenase-1 and peroxiredoxin 1, by activating the antioxidant response element (ARE). We hypothesized that (1) the citrus coumarin auraptene may suppress premalignant mammary lesions via activation of Nrf2/ARE, and (2) that Nrf2 knockout (KO) mice would be more susceptible to mammary carcinogenesis. Premalignant lesions and mammary carcinomas were induced by medroxyprogesterone acetate and 7,12-dimethylbenz[a]anthracene treatment. The 10-week pre-malignant study was performed in which 8 groups of 10 each female wild-type (WT) and KO mice were fed either control diet or diets containing auraptene (500 ppm). A carcinogenesis study was also conducted in KO vs. WT mice (n = 30-34). Comparisons between groups were evaluated using ANOVA and Kaplan-Meier Survival statistics, and the Mann-Whitney U-test. All mice treated with carcinogen exhibited premalignant lesions but there were no differences by genotype or diet. In the KO mice, there was a dramatic increase in mammary carcinoma growth rate, size, and weight. Although there was no difference in overall survival, the KO mice had significantly lower mammary tumor-free survival. Also, in the KO mammary carcinomas, the active forms of NF-κB and β-catenin were increased ~2-fold whereas no differences in oxidized proteins were observed. Many other tumors were observed, including lymphomas. Interestingly, the incidences of lung adenomas in the KO mice were significantly higher than in the WT mice. We report, for the first time, that there was no apparent difference in the formation of premalignant lesions, but rather, the KO mice exhibited rapid, aggressive mammary carcinoma progression

  15. Activation of Nrf2 is required for up-regulation of the π class of glutathione S-transferase in rat primary hepatocytes with L-methionine starvation. (United States)

    Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei


    Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.

  16. Cul3-mediated Nrf2 ubiquitination and antioxidant response element (ARE) activation are dependent on the partial molar volume at position 151 of Keap1. (United States)

    Eggler, Aimee L; Small, Evan; Hannink, Mark; Mesecar, Andrew D


    Nrf2 (nuclear factor erythroid 2-related factor 2) is a transcription factor that activates transcription of a battery of cytoprotective genes by binding to the ARE (antioxidant response element). Nrf2 is repressed by the cysteine-rich Keap1 (kelch-like ECH-associated protein 1) protein, which targets Nrf2 for ubiquitination and subsequent degradation by a Cul3 (cullin 3)-mediated ubiquitination complex. We find that modification of Cys(151) of human Keap1, by mutation to a tryptophan, relieves the repression by Keap1 and allows activation of the ARE by Nrf2. The Keap1 C151W substitution has a decreased affinity for Cul3, and can no longer serve to target Nrf2 for ubiquitination, though it retains its affinity for Nrf2. A series of 12 mutant Keap1 proteins, each containing a different residue at position 151, was constructed to explore the chemistry required for this effect. The series reveals that the extent to which Keap1 loses the ability to target Nrf2 for degradation, and hence the ability to repress ARE activation, correlates well with the partial molar volume of the residue. Other physico-chemical properties do not appear to contribute significantly to the effect. Based on this finding, a structural model is proposed whereby large residues at position 151 cause steric clashes that lead to alteration of the Keap1-Cul3 interaction. This model has significant implications for how electrophiles which modify Cys(151), disrupt the repressive function of Keap1.

  17. Evaluation of the rotenone-induced activation of the Nrf2 pathway in a neuronal model derived from human induced pluripotent stem cells. (United States)

    Zagoura, Dimitra; Canovas-Jorda, David; Pistollato, Francesca; Bremer-Hoffmann, Susanne; Bal-Price, Anna


    Human induced pluripotent stem cells (hiPSCs) are considered as a powerful tool for drug and chemical screening and development of new in vitro testing strategies in the field of toxicology, including neurotoxicity evaluation. These cells are able to expand and efficiently differentiate into different types of neuronal and glial cells as well as peripheral neurons. These human cells-based neuronal models serve as test systems for mechanistic studies on different pathways involved in neurotoxicity. One of the well-known mechanisms that are activated by chemically-induced oxidative stress is the Nrf2 signaling pathway. Therefore, in the current study, we evaluated whether Nrf2 signaling machinery is expressed in human induced pluripotent stem cells (hiPSCs)-derived mixed neuronal/glial culture and if so whether it becomes activated by rotenone-induced oxidative stress mediated by complex I inhibition of mitochondrial respiration. Rotenone was found to induce the activation of Nrf2 signaling particularly at the highest tested concentration (100 nM), as shown by Nrf2 nuclear translocation and the up-regulation of the Nrf2-downstream antioxidant enzymes, NQO1 and SRXN1. Interestingly, exposure to rotenone also increased the number of astroglial cells in which Nrf2 activation may play an important role in neuroprotection. Moreover, rotenone caused cell death of dopaminergic neurons since a decreased percentage of tyrosine hydroxylase (TH + ) cells was observed. The obtained results suggest that hiPSC-derived mixed neuronal/glial culture could be a valuable in vitro human model for the establishment of neuronal specific assays in order to link Nrf2 pathway activation (biomarker of oxidative stress) with additional neuronal specific readouts that could be applied to in vitro neurotoxicity evaluation. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Benznidazole, the trypanocidal drug used for Chagas disease, induces hepatic NRF2 activation and attenuates the inflammatory response in a murine model of sepsis

    International Nuclear Information System (INIS)

    Lambertucci, Flavia; Motiño, Omar; Villar, Silvina; Rigalli, Juan Pablo; Luján Alvarez, María de; Catania, Viviana A; Martín-Sanz, Paloma; Carnovale, Cristina Ester; Quiroga, Ariel Darío; Francés, Daniel Eleazar; Ronco, María Teresa


    Molecular mechanisms on sepsis progression are linked to the imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity. Previous studies demonstrated that benznidazole (BZL), known for its antiparasitic action on Trypanosoma cruzi, has immunomodulatory effects, increasing survival in C57BL/6 mice in a model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). The mechanism by which BZL inhibits inflammatory response in sepsis is poorly understood. Also, our group recently reported that BZL is able to activate the nuclear factor erytroide-derived 2-Like 2 (NRF2) in vitro. The aim of the present work was to delineate the beneficial role of BZL during sepsis, analyzing its effects on the cellular redox status and the possible link to the innate immunity receptor TLR4. Specifically, we analyzed the effect of BZL on Nrf2 regulation and TLR4 expression in liver of mice 24 hours post-CLP. BZL was able to induce NRF2 nuclear protein localization in CLP mice. Also, we found that protein kinase C (PKC) is involved in the NRF2 nuclear accumulation and induction of its target genes. In addition, BZL prompted a reduction in hepatic CLP-induced TLR4 protein membrane localization, evidencing its immunomodulatory effects. Together, our results demonstrate that BZL induces hepatic NRF2 activation with the concomitant increase in the antioxidant defenses, and the attenuation of inflammatory response, in part, by inhibiting TLR4 expression in a murine model of sepsis. - Highlights: • BZL improves survival rate after polymicrobial sepsis • BZL enhances hepatic NRF2 nuclear accumulation in a model of sepsis, in part, by a mechanism dependent on PKC activation • BZL-enhanced NRF2 induction regulates antioxidant enzymes and increases antioxidant cellular defenses in sepsis • BZL blocks liver ROS production and ROS-induced TLR4 plasma membrane expression in septic mice

  19. Serum Oxidative Stress-Induced Repression of Nrf2 and GSH Depletion: A Mechanism Potentially Involved in Endothelial Dysfunction of Young Smokers (United States)

    Fratta Pasini, Anna; Albiero, Anna; Stranieri, Chiara; Cominacini, Mattia; Pasini, Andrea; Mozzini, Chiara; Vallerio, Paola; Cominacini, Luciano; Garbin, Ulisse


    Background Although oxidative stress plays a major role in endothelial dysfunction (ED), the role of glutathione (GSH), of nuclear erythroid-related factor 2 (Nrf2) and of related antioxidant genes (ARE) are yet unknown. In this study we combined an in vivo with an in vitro model to assess whether cigarette smoking affects flow-mediated vasodilation (FMD), GSH concentrations and the Nrf2/ARE pathway in human umbilical vein endothelial cells (HUVECs). Methods and Results 52 healthy subjects (26 non-smokers and 26 heavy smokers) were enrolled in this study. In smokers we demonstrated increased oxidative stress, i.e., reduced concentrations of GSH and increased concentrations of oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC) in serum and in peripheral blood mononuclear cells (PBMC), used as in vivo surrogates of endothelial cells. Moreover we showed impairment of FMD in smokers and a positive correlation with the concentration of GSH in PBMC of all subjects. In HUVECs exposed to smokers' serum but not to non-smokers' serum we found that oxidative stress increased, whereas nitric oxide and GSH concentrations decreased; interestingly the expression of Nrf2, of heme oxygenase-1 (HO-1) and of glutamate-cysteine ligase catalytic (GCLC) subunit, the rate-limiting step of synthesis of GSH, was decreased. To test the hypothesis that the increased oxidative stress in smokers may have a causal role in the repression of Nrf2/ARE pathway, we exposed HUVECs to increasing concentrations of oxPAPC and found that at the highest concentration (similar to that found in smokers' serum) the expression of Nrf2/ARE pathway was reduced. The knockdown of Nrf2 was associated to a significant reduction of HO-1 and GCLC expression induced by oxPAPC in ECs. Conclusions In young smokers with ED a novel further consequence of increased oxidative stress is a repression of Nrf2/ARE pathway leading to GSH depletion. PMID:22272327

  20. TGF-β and Hypoxia/Reoxygenation Promote Radioresistance of A549 Lung Cancer Cells through Activation of Nrf2 and EGFR

    Directory of Open Access Journals (Sweden)

    Sae-lo-oom Lee


    Full Text Available Although many studies have examined the roles of hypoxia and transforming growth factor- (TGF- β separately in the tumor microenvironment, the effects of simultaneous treatment with hypoxia/reoxygenation and TGF-β on tumor malignancy are unclear. Here, we investigated the effects of redox signaling and oncogenes on cell proliferation and radioresistance in A549 human lung cancer cells in the presence of TGF-β under hypoxia/reoxygenation conditions. Combined treatment with TGF-β and hypoxia activated epidermal growth factor receptor (EGFR and nuclear factor (erythroid-derived 2-like 2 (Nrf2, a redox-sensitive transcription factor. Interestingly, Nrf2 knockdown suppressed the effects of combined treatment on EGFR phosphorylation. In addition, blockade of EGFR signaling also suppressed induction of Nrf2 following combined treatment with hypoxia and TGF-β, indicating that the combined treatment induced positive crosstalk between Nrf2 and EGFR. TGF-β and hypoxia/reoxygenation increased the accumulation of reactive oxygen species (ROS, while treatment with N-acetyl-L-cysteine abolished the activation of Nrf2 and EGFR. Treatment with TGF-β under hypoxic conditions increased the proliferation of A549 cells compared with that after vehicle treatment. Moreover, cells treated with the combined treatment exhibited resistance to ionizing radiation (IR, and knockdown of Nrf2 increased IR-induced cell death under these conditions. Thus, taken together, our findings suggested that TGF-β and hypoxia/reoxygenation promoted tumor progression and radioresistance of A549 cells through ROS-mediated activation of Nrf2 and EGFR.

  1. Serum oxidative stress-induced repression of Nrf2 and GSH depletion: a mechanism potentially involved in endothelial dysfunction of young smokers.

    Directory of Open Access Journals (Sweden)

    Anna Fratta Pasini

    Full Text Available Although oxidative stress plays a major role in endothelial dysfunction (ED, the role of glutathione (GSH, of nuclear erythroid-related factor 2 (Nrf2 and of related antioxidant genes (ARE are yet unknown. In this study we combined an in vivo with an in vitro model to assess whether cigarette smoking affects flow-mediated vasodilation (FMD, GSH concentrations and the Nrf2/ARE pathway in human umbilical vein endothelial cells (HUVECs.52 healthy subjects (26 non-smokers and 26 heavy smokers were enrolled in this study. In smokers we demonstrated increased oxidative stress, i.e., reduced concentrations of GSH and increased concentrations of oxidation products of the phospholipid 1-palmitoyl-2-arachidonyl-sn-glycero-3-phosphorylcholine (oxPAPC in serum and in peripheral blood mononuclear cells (PBMC, used as in vivo surrogates of endothelial cells. Moreover we showed impairment of FMD in smokers and a positive correlation with the concentration of GSH in PBMC of all subjects. In HUVECs exposed to smokers' serum but not to non-smokers' serum we found that oxidative stress increased, whereas nitric oxide and GSH concentrations decreased; interestingly the expression of Nrf2, of heme oxygenase-1 (HO-1 and of glutamate-cysteine ligase catalytic (GCLC subunit, the rate-limiting step of synthesis of GSH, was decreased. To test the hypothesis that the increased oxidative stress in smokers may have a causal role in the repression of Nrf2/ARE pathway, we exposed HUVECs to increasing concentrations of oxPAPC and found that at the highest concentration (similar to that found in smokers' serum the expression of Nrf2/ARE pathway was reduced. The knockdown of Nrf2 was associated to a significant reduction of HO-1 and GCLC expression induced by oxPAPC in ECs.In young smokers with ED a novel further consequence of increased oxidative stress is a repression of Nrf2/ARE pathway leading to GSH depletion.

  2. Pharmacokinetics of dietary cancer chemopreventive compound dibenzoylmethane in rats and the impact of nanoemulsion and genetic knockout of Nrf2 on its disposition. (United States)

    Lin, Wen; Hong, Jin-Liern; Shen, Guoxiang; Wu, Rachel T; Wang, Yuwen; Huang, Mou-Tuan; Newmark, Harold L; Huang, Qingrong; Khor, Tin Oo; Heimbach, Tycho; Kong, Ah-Ng


    The pharmacokinetic disposition of a dietary cancer chemopreventive compound dibenzoylmethane (DBM) was studied in male Sprague-Dawley rats after intravenous (i.v.) and oral (p.o.) administrations. Following a single i.v. bolus dose, the mean plasma clearance (CL) of DBM was low compared with the hepatic blood flow. DBM displayed a high volume of distribution (Vss). The elimination terminal t1/2 was long. The mean CL, Vss and AUC0-∞/dose were similar between the i.v. 10 and 10 mg/kg doses. After single oral doses (10, 50 and 250 mg/kg), the absolute oral bioavailability (F*) of DBM was 7.4%-13.6%. The increase in AUC was not proportional to the oral doses, suggesting non-linearity. In silico prediction of oral absorption also demonstrated low DBM absorption in vivo. An oil-in-water nanoemulsion containing DBM was formulated to potentially overcome the low F* due to poor water solubility of DBM, with enhanced oral absorption. Finally, to examine the role of Nrf2 on the pharmacokinetics of DBM, since DBM activates the Nrf2-dependent detoxification pathways, Nrf2 wild-type (+/+) mice and Nrf2 knockout (-/-) mice were utilized. There was an increased systemic plasma exposure of DBM in Nrf2 (-/-) mice, suggesting that the Nrf2 genotype could also play a role in the pharmacokinetic disposition of DBM. Taken together, the results show that DBM has low oral bioavailability which could be due in part to poor water solubility and this could be overcome by a nanotechnology-based drug delivery system and furthermore the Nrf2 genotype could also play a role in the pharmacokinetics of DBM. Copyright © 2010 John Wiley & Sons, Ltd.

  3. Activation of Nrf2 Reduces UVA-Mediated MMP-1 Upregulation via MAPK/AP-1 Signaling Cascades: The Photoprotective Effects of Sulforaphane and Hispidulin (United States)

    Chaiprasongsuk, Anyamanee; Lohakul, Jinaphat; Soontrapa, Kitipong; Sampattavanich, Somponnat; Akarasereenont, Pravit


    UVA irradiation plays a role in premature aging of the skin through triggering oxidative stress-associated stimulation of matrix metalloproteinase-1 (MMP-1) responsible for collagen degradation, a hallmark of photoaged skin. Compounds that can activate nuclear factor E2-related factor 2 (Nrf2), a transcription factor regulating antioxidant gene expression, should therefore serve as effective antiphotoaging agents. We investigated whether genetic silencing of Nrf2 could relieve UVA-mediated MMP-1 upregulation via activation of mitogen-activated protein kinase (MAPK)/activator protein 1 (AP-1) signaling using human keratinocyte cell line (HaCaT). Antiphotoaging effects of hispidulin (HPD) and sulforaphane (SFN) were assessed on their abilities to activate Nrf2 in controlling MMP-1 and collagen expressions in association with phosphorylation of MAPKs (extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38), c-Jun, and c-Fos, using the skin of BALB/c mice subjected to repetitive UVA irradiation. Our findings suggested that depletion of Nrf2 promoted both mRNA expression and activity of MMP-1 in the UVA-irradiated HaCaT cells. Treatment of Nrf2 knocked-down HaCaT cells with MAPK inhibitors significantly suppressed UVA-induced MMP-1 and AP-1 activities. Moreover, pretreatment of the mouse skin with HPD and SFN, which could activate Nrf2, provided protective effects against UVA-mediated MMP-1 induction and collagen depletion in correlation with the decreased levels of phosphorylated MAPKs, c-Jun, and c-Fos in the mouse skin. In conclusion, Nrf2 could influence UVA-mediated MMP-1 upregulation through the MAPK/AP-1 signaling cascades. HPD and SFN may therefore represent promising antiphotoaging candidates. PMID:28011874

  4. Benznidazole, the trypanocidal drug used for Chagas disease, induces hepatic NRF2 activation and attenuates the inflammatory response in a murine model of sepsis

    Energy Technology Data Exchange (ETDEWEB)

    Lambertucci, Flavia [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Motiño, Omar [Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Arturo Duperier 4, 28029 Madrid (Spain); Villar, Silvina [Instituto de Inmunología, Facultad de Ciencias Médicas, UNR, Suipacha 531, 2000 Rosario (Argentina); Rigalli, Juan Pablo; Luján Alvarez, María de; Catania, Viviana A [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Martín-Sanz, Paloma [Instituto de Investigaciones Biomédicas Alberto Sols, CSIC-UAM, Arturo Duperier 4, 28029 Madrid (Spain); Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Monforte de Lemos 3-5, 28029 Madrid (Spain); Carnovale, Cristina Ester; Quiroga, Ariel Darío; Francés, Daniel Eleazar [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina); Ronco, María Teresa, E-mail: [Instituto de Fisiología Experimental (IFISE-CONICET), Suipacha 570, 2000 Rosario (Argentina)


    Molecular mechanisms on sepsis progression are linked to the imbalance between reactive oxygen species (ROS) production and cellular antioxidant capacity. Previous studies demonstrated that benznidazole (BZL), known for its antiparasitic action on Trypanosoma cruzi, has immunomodulatory effects, increasing survival in C57BL/6 mice in a model of polymicrobial sepsis induced by cecal ligation and puncture (CLP). The mechanism by which BZL inhibits inflammatory response in sepsis is poorly understood. Also, our group recently reported that BZL is able to activate the nuclear factor erytroide-derived 2-Like 2 (NRF2) in vitro. The aim of the present work was to delineate the beneficial role of BZL during sepsis, analyzing its effects on the cellular redox status and the possible link to the innate immunity receptor TLR4. Specifically, we analyzed the effect of BZL on Nrf2 regulation and TLR4 expression in liver of mice 24 hours post-CLP. BZL was able to induce NRF2 nuclear protein localization in CLP mice. Also, we found that protein kinase C (PKC) is involved in the NRF2 nuclear accumulation and induction of its target genes. In addition, BZL prompted a reduction in hepatic CLP-induced TLR4 protein membrane localization, evidencing its immunomodulatory effects. Together, our results demonstrate that BZL induces hepatic NRF2 activation with the concomitant increase in the antioxidant defenses, and the attenuation of inflammatory response, in part, by inhibiting TLR4 expression in a murine model of sepsis. - Highlights: • BZL improves survival rate after polymicrobial sepsis • BZL enhances hepatic NRF2 nuclear accumulation in a model of sepsis, in part, by a mechanism dependent on PKC activation • BZL-enhanced NRF2 induction regulates antioxidant enzymes and increases antioxidant cellular defenses in sepsis • BZL blocks liver ROS production and ROS-induced TLR4 plasma membrane expression in septic mice.

  5. Novel curcumin analogue 14p protects against myocardial ischemia reperfusion injury through Nrf2-activating anti-oxidative activity

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weixin [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wu, Mingchai [Department of Pharmacy, The Third Affiliated Hospital of Wenzhou Medical University, Wenzou, Zhejiang (China); Tang, Longguang; Pan, Yong; Liu, Zhiguo [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Zeng, Chunlai [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Wang, Jingying [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wei, Tiemin, E-mail: [Department of Cardiology, The 5th Affiliated Hospital of Wenzhou Medical University, Lishui, Zhejiang (China); Liang, Guang, E-mail: [Chemical Biology Research Center, School of Pharmaceutical Science, Wenzhou Medical University, Wenzhou, Zhejiang (China)


    Background: Alleviating the oxidant stress associated with myocardial ischemia reperfusion has been demonstrated as a potential therapeutic approach to limit ischemia reperfusion (I/R)-induced cardiac damage. Curcumin, a natural compound with anti-oxidative activity, exerts beneficial effect against cardiac I/R injury, but poor chemical and metabolic stability. Previously, we have designed and synthesized a series of mono-carbonyl analogues of curcumin (MACs) with high stability. This study aims to find new anti-oxidant MACs and to demonstrate their effects and mechanisms against I/R-induced heart injury. Methods: H9c2 cells challenged with H{sub 2}O{sub 2} or TBHP were used for in vitro bio-screening and mechanistic studies. The MDA, H{sub 2}O{sub 2} and SOD levels in H9C2 cells were determined, and the cell viability was assessed by MTT assay. Myocardial I/R mouse models administrated with or without the compound were used for in vivo studies. Results: The in vitro cell-based screening showed that curcumin analogues 8d and 14p exhibited strong anti-oxidative effects. Pre-treatment of H9c2 cells with 14p activated Nrf2 signaling pathway, attenuated H{sub 2}O{sub 2}-increased MDA and SOD level, followed by the inhibition of TBHP-induced cell death and Bax/Bcl-2–caspase-3 pathway activation. Silencing Nrf2 significantly reversed the protective effects of 14p. In in vivo animal model of myocardial I/R, administration of low dose 14p (10 mg/kg) reduced infarct size and myocardial apoptosis to the same extent as the high dose curcumin (100 mg/kg). Conclusion: These data support the novel curcumin analogue 14p as a promising antioxidant to decrease oxidative stress and limit myocardial ischemia reperfusion injury via activating Nrf2. - Highlights: • Mono-carbonyl analogue of curcumin, 14p, exhibited better chemical stability. • Compound 14p inhibited TBHP-induced apoptosis through activating Nrf2 in vitro. • Compound 14p limited myocardial ischemia

  6. Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer. (United States)

    Namani, Akhileshwar; Matiur Rahaman, Md; Chen, Ming; Tang, Xiuwen


    NRF2 is the key regulator of oxidative stress in normal cells and aberrant expression of the NRF2 pathway due to genetic alterations in the KEAP1 (Kelch-like ECH-associated protein 1)-NRF2 (nuclear factor erythroid 2 like 2)-CUL3 (cullin 3) axis leads to tumorigenesis and drug resistance in many cancers including head and neck squamous cell cancer (HNSCC). The main goal of this study was to identify specific genes regulated by the KEAP1-NRF2-CUL3 axis in HNSCC patients, to assess the prognostic value of this gene signature in different cohorts, and to reveal potential biomarkers. RNA-Seq V2 level 3 data from 279 tumor samples along with 37 adjacent normal samples from patients enrolled in the The Cancer Genome Atlas (TCGA)-HNSCC study were used to identify upregulated genes using two methods (altered KEAP1-NRF2-CUL3 versus normal, and altered KEAP1-NRF2-CUL3 versus wild-type). We then used a new approach to identify the combined gene signature by integrating both datasets and subsequently tested this signature in 4 independent HNSCC datasets to assess its prognostic value. In addition, functional annotation using the DAVID v6.8 database and protein-protein interaction (PPI) analysis using the STRING v10 database were performed on the signature. A signature composed of a subset of 17 genes regulated by the KEAP1-NRF2-CUL3 axis was identified by overlapping both the upregulated genes of altered versus normal (251 genes) and altered versus wild-type (25 genes) datasets. We showed that increased expression was significantly associated with poor survival in 4 independent HNSCC datasets, including the TCGA-HNSCC dataset. Furthermore, Gene Ontology, Kyoto Encyclopedia of Genes and Genomes, and PPI analysis revealed that most of the genes in this signature are associated with drug metabolism and glutathione metabolic pathways. Altogether, our study emphasizes the discovery of a gene signature regulated by the KEAP1-NRF2-CUL3 axis which is strongly associated with

  7. Regulation of hemeoxygenase-1 gene expression by Nrf2 and c-Jun in tertiary butylhydroquinone-stimulated rat primary astrocytes

    International Nuclear Information System (INIS)

    Park, Jin-Sun; Kim, Hee-Sun


    Highlights: • tBHQ increased HO-1 mRNA and protein levels in rat primary astrocytes. • tBHQ enhanced HO-1 gene transcription in an ARE-dependent manner. • tBHQ increased the nuclear translocation and DNA binding of Nrf2 and c-Jun to ARE. • Nrf2 and c-Jun are involved in the differential modulation of HO-1 expression. • Nrf2 and c-Jun regulate HO-1 expression via their coordinated interaction. - Abstract: Hemeoxygenase-1 (HO-1) is a phase II antioxidant enzyme that is primarily involved in detoxification and cytoprotection in a variety of tissues. However, the mechanism underlying HO-1 gene expression remains unclear. In the present study, we investigated the regulation of HO-1 expression in primary cultured astrocytes by using the natural antioxidant compound tertiary butylhydroquinone (tBHQ). We found that tBHQ increased HO-1 mRNA and protein levels. Promoter analysis revealed that tBHQ enhanced HO-1 gene transcription in an antioxidant response element (ARE)-dependent manner. In addition, tBHQ increased the nuclear translocation and DNA binding of Nrf2 and c-Jun to ARE. Small interfering RNA (siRNA) experiments demonstrated that Nrf2 and c-Jun are involved in the dif