WorldWideScience

Sample records for normal skin melanocytes

  1. Antimelanogenic Efficacy of Melasolv (3,4,5-Trimethoxycinnamate Thymol Ester) in Melanocytes and Three-Dimensional Human Skin Equivalent.

    Science.gov (United States)

    Lee, John Hwan; Lee, Eun-Soo; Bae, Il-Hong; Hwang, Jeong-Ah; Kim, Se-Hwa; Kim, Dae-Yong; Park, Nok-Hyun; Rho, Ho Sik; Kim, Yong Jin; Oh, Seong-Geun; Lee, Chang Seok

    2017-01-01

    Excessive melanogenesis often causes unaesthetic hyperpigmentation. In a previous report, our group introduced a newly synthesized depigmentary agent, Melasolv™ (3,4,5-trimethoxycinnamate thymol ester). In this study, we demonstrated the significant whitening efficacy of Melasolv using various melanocytes and human skin equivalents as in vitro experimental systems. The depigmentary effect of Melasolv was tested in melan-a cells (immortalized normal murine melanocytes), α-melanocyte-stimulating hormone (α-MSH)-stimulated B16 murine melanoma cells, primary normal human melanocytes (NHMs), and human skin equivalent (MelanoDerm). The whitening efficacy of Melasolv was further demonstrated by photography, time-lapse microscopy, Fontana-Masson (F&M) staining, and 2-photon microscopy. Melasolv significantly inhibited melanogenesis in the melan-a and α-MSH-stimulated B16 cells. In human systems, Melasolv also clearly showed a whitening effect in NHMs and human skin equivalent, reflecting a decrease in melanin content. F&M staining and 2-photon microscopy revealed that Melasolv suppressed melanin transfer into multiple epidermal layers from melanocytes as well as melanin synthesis in human skin equivalent. Our study showed that Melasolv clearly exerts a whitening effect on various melanocytes and human skin equivalent. These results suggest the possibility that Melasolv can be used as a depigmentary agent to treat pigmentary disorders as well as an active ingredient in cosmetics to increase whitening efficacy. © 2017 S. Karger AG, Basel.

  2. Confocal laser scanning microscopy in vivo for diagnosing melanocytic skin neoplasms

    Directory of Open Access Journals (Sweden)

    A. A. Kubanova

    2014-01-01

    Full Text Available The authors discuss the use of confocal laser scanning microscopy in vivo (CLSM for diagnosing melanocytic skin neoplasms and its value for early diagnostics of melanoma. CLSM is an innovation noninvasive visual examination method for real-time multiple and painless examinations of the patient’s skin without injuring the skin integument. The method ensures early diagnostics of skin melanomas with high sensitivity and specificity, which makes it possible to use CLSM for screening melanocytic skin neoplasms for the sake of the early onset of treatment to save patient life and health.

  3. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  4. Automated Estimation of Melanocytic Skin Tumor Thickness by Ultrasonic Radiofrequency Data.

    Science.gov (United States)

    Andrekute, Kristina; Valiukeviciene, Skaidra; Raisutis, Renaldas; Linkeviciute, Gintare; Makstiene, Jurgita; Kliunkiene, Renata

    2016-05-01

    High-frequency (>20-MHz) ultrasound (US) is a noninvasive preoperative tool for assessment of melanocytic skin tumor thickness. Ultrasonic melanocytic skin tumor thickness estimation is not always easy and is related to the experience of the clinician. In this article, we present an automated thickness measurement method based on time-frequency analysis of US radiofrequency signals. The study was performed on 52 thin (≤1-mm) melanocytic skin tumors (46 melanocytic nevi and 6 melanomas). Radiofrequency signals were obtained with a single-element focused transducer (fundamental frequency, 22 MHz; bandwidth, 12-28 MHz). The radiofrequency data were analyzed in the time-frequency domain to make the tumor boundaries more noticeable. The thicknesses of the tumors were evaluated by 3 different metrics: histologically measured Breslow thickness, manually measured US thickness, and automatically measured US thickness. The results showed a higher correlation coefficient between the automatically measured US thickness and Breslow thickness (r= 0.83; Pmeasured US thickness (r = 0.68; P measurement algorithm was 96.55%, and the specificity was 78.26% compared with histologic measurement. The sensitivity of the manually measured US thickness was 75.86%, and the specificity was 73.91%. The efficient automated tumor thickness measurement method developed could be used as a tool for preoperative assessment of melanocytic skin tumor thickness. © 2016 by the American Institute of Ultrasound in Medicine.

  5. Constitutive activation of the ERK pathway in melanoma and skin melanocytes in Grey horses.

    Science.gov (United States)

    Jiang, Lin; Campagne, Cécile; Sundström, Elisabeth; Sousa, Pedro; Imran, Saima; Seltenhammer, Monika; Pielberg, Gerli; Olsson, Mats J; Egidy, Giorgia; Andersson, Leif; Golovko, Anna

    2014-11-21

    Constitutive activation of the ERK pathway, occurring in the vast majority of melanocytic neoplasms, has a pivotal role in melanoma development. Different mechanisms underlie this activation in different tumour settings. The Grey phenotype in horses, caused by a 4.6 kb duplication in intron 6 of Syntaxin 17 (STX17), is associated with a very high incidence of cutaneous melanoma, but the molecular mechanism behind the melanomagenesis remains unknown. Here, we investigated the involvement of the ERK pathway in melanoma development in Grey horses. Grey horse melanoma tumours, cell lines and normal skin melanocytes were analyzed with help of indirect immunofluorescence and immunoblotting for the expression of phospho-ERK1/2 in comparison to that in non-grey horse and human counterparts. The mutational status of BRAF, RAS, GNAQ, GNA11 and KIT genes in Grey horse melanomas was determined by direct sequencing. The effect of RAS, RAF and PI3K/AKT pathways on the activation of the ERK signaling in Grey horse melanoma cells was investigated with help of specific inhibitors and immunoblotting. Individual roles of RAF and RAS kinases on the ERK activation were examined using si-RNA based approach and immunoblotting. We found that the ERK pathway is constitutively activated in Grey horse melanoma tumours and cell lines in the absence of somatic activating mutations in BRAF, RAS, GNAQ, GNA11 and KIT genes or alterations in the expression of the main components of the pathway. The pathway is mitogenic and is mediated by BRAF, CRAF and KRAS kinases. Importantly, we found high activation of the ERK pathway also in epidermal melanocytes, suggesting a general predisposition to melanomagenesis in these horses. These findings demonstrate that the presence of the intronic 4.6 kb duplication in STX17 is strongly associated with constitutive activation of the ERK pathway in melanocytic cells in Grey horses in the absence of somatic mutations commonly linked to the activation of this

  6. Development and validation of a simple method for the extraction of human skin melanocytes.

    Science.gov (United States)

    Wang, Yinjuan; Tissot, Marion; Rolin, Gwenaël; Muret, Patrice; Robin, Sophie; Berthon, Jean-Yves; He, Li; Humbert, Philippe; Viennet, Céline

    2018-03-21

    Primary melanocytes in culture are useful models for studying epidermal pigmentation and efficacy of melanogenic compounds, or developing advanced therapy medicinal products. Cell extraction is an inevitable and critical step in the establishment of cell cultures. Many enzymatic methods for extracting and growing cells derived from human skin, such as melanocytes, are described in literature. They are usually based on two enzymatic steps, Trypsin in combination with Dispase, in order to separate dermis from epidermis and subsequently to provide a suspension of epidermal cells. The objective of this work was to develop and validate an extraction method of human skin melanocytes being simple, effective and applicable to smaller skin samples, and avoiding animal reagents. TrypLE™ product was tested on very limited size of human skin, equivalent of multiple 3-mm punch biopsies, and was compared to Trypsin/Dispase enzymes. Functionality of extracted cells was evaluated by analysis of viability, morphology and melanin production. In comparison with Trypsin/Dispase incubation method, the main advantages of TrypLE™ incubation method were the easier of separation between dermis and epidermis and the higher population of melanocytes after extraction. Both protocols preserved morphological and biological characteristics of melanocytes. The minimum size of skin sample that allowed the extraction of functional cells was 6 × 3-mm punch biopsies (e.g., 42 mm 2 ) whatever the method used. In conclusion, this new procedure based on TrypLE™ incubation would be suitable for establishment of optimal primary melanocytes cultures for clinical applications and research.

  7. HGF/SF increases number of skin melanocytes but does not alter quality or quantity of follicular melanogenesis.

    Directory of Open Access Journals (Sweden)

    Agnieszka Wolnicka-Glubisz

    Full Text Available Melanins are an important factor determining the vulnerability of mammalian skin to UV radiation and thus to UV-induced skin cancers. Transgenic mice overexpressing hepatocyte growth factor/scatter factor (HGF/SF have extra-follicular dermal melanocytes, notably in the papillary upper dermis, and are susceptible to UV-induced melanoma. Pigmented HGF/SF neonatal mice are more susceptible than albino HGF/SF animals to UVA -induced melanoma, indicating an involvement of melanin in melanoma formation. This raises the question of the effect of transgenic HGF/SF on melanization. We developed a methodology to accurately quantitate both the production of melanin and the efficiency of melanogenesis in normal, and HGF/SF transgenic mice in vivo. Skin and hair shafts of 5 day old and adult (3 week old C57BL/6-HGF/SF and corresponding C57BL/6 wild type mice were investigated by electron paramagnetic resonance spectroscopy (EPR to quantitate melanin, by transmission electron microscopy (TEM for the presence of melanosomes, and by standard histology and by Western blotting and zymography to determine the expression and activity of melanogenesis-related proteins. Eumelanin but no phaeomelanin was detected in transgenic C57BL/6-HGF and C57BL/6 wild type mice. Transgenic HGF/SF overexpression did not change the type of melanin produced in the skin or hair, did not affect the terminal content of melanin production in standard samples of hair and did not influence hair cycle/morphogenesis-related changes in skin thickness. No melanocytes were found in the epidermis and no melanosomes were found in epidermal keratinocytes. HGF/SF transgenic mice thus lack the epidermal melanin UV-protection found in constitutively dark human skin. We conclude that melanocytes in the HGF/SF transgenic mouse, particularly in the papillary dermis, are vulnerable to UVA which interacts with eumelanin but not phaeomelanin to induce melanoma.

  8. Effect of norfloxacin and moxifloxacin on melanin synthesis and antioxidant enzymes activity in normal human melanocytes.

    Science.gov (United States)

    Beberok, Artur; Wrześniok, Dorota; Otręba, Michał; Miliński, Maciej; Rok, Jakub; Buszman, Ewa

    2015-03-01

    Fluoroquinolone antibiotics provide broad-spectrum coverage for a number of infectious diseases, including respiratory as well as urinary tract infections. One of the important adverse effects of these drugs is phototoxicity which introduces a serious limitation to their use. To gain insight the molecular mechanisms underlying the fluoroquinolones-induced phototoxic side effects, the impact of two fluoroquinolone derivatives with different phototoxic potential, norfloxacin and moxifloxacin, on melanogenesis and antioxidant enzymes activity in normal human melanocytes HEMa-LP was determined. Both drugs induced concentration-dependent loss in melanocytes viability. The value of EC50 for these drugs was found to be 0.5 mM. Norfloxacin and moxifloxacin suppressed melanin biosynthesis; antibiotics were shown to inhibit cellular tyrosinase activity and to reduce melanin content in melanocytes. When comparing the both analyzed fluoroquinolones, it was observed that norfloxacin possesses greater inhibitory effect on tyrosinase activity in melanocytes than moxifloxacin. The extent of oxidative stress in cells was assessed by measuring the activity of antioxidant enzymes: SOD, CAT, and GPx. It was observed that norfloxacin caused higher depletion of antioxidant status in melanocytes when compared with moxifloxacin. The obtained results give a new insight into the mechanisms of fluoroquinolones toxicity directed to pigmented tissues. Moreover, the presented differences in modulation of biochemical processes in melanocytes may be an explanation for various phototoxic activities of the analyzed fluoroquinolone derivatives in vivo.

  9. Primary Cilia Negatively Regulate Melanogenesis in Melanocytes and Pigmentation in a Human Skin Model.

    Science.gov (United States)

    Choi, Hyunjung; Shin, Ji Hyun; Kim, Eun Sung; Park, So Jung; Bae, Il-Hong; Jo, Yoon Kyung; Jeong, In Young; Kim, Hyoung-June; Lee, Youngjin; Park, Hea Chul; Jeon, Hong Bae; Kim, Ki Woo; Lee, Tae Ryong; Cho, Dong-Hyung

    2016-01-01

    The primary cilium is an organelle protruding from the cell body that senses external stimuli including chemical, mechanical, light, osmotic, fluid flow, and gravitational signals. Skin is always exposed to the external environment and responds to external stimuli. Therefore, it is possible that primary cilia have an important role in skin. Ciliogenesis was reported to be involved in developmental processes in skin, such as keratinocyte differentiation and hair formation. However, the relation between skin pigmentation and primary cilia is largely unknown. Here, we observed that increased melanogenesis in melanocytes treated with a melanogenic inducer was inhibited by a ciliogenesis inducer, cytochalasin D, and serum-free culture. However, these inhibitory effects disappeared in GLI2 knockdown cells. In addition, activation of sonic hedgehog (SHH)-smoothened (Smo) signaling pathway by a Smo agonist, SAG inhibited melanin synthesis in melanocytes and pigmentation in a human skin model. On the contrary, an inhibitor of primary cilium formation, ciliobrevin A1, activated melanogenesis in melanocytes. These results suggest that skin pigmentation may be regulated partly by the induction of ciliogenesis through Smo-GLI2 signaling.

  10. Primary Cilia Negatively Regulate Melanogenesis in Melanocytes and Pigmentation in a Human Skin Model.

    Directory of Open Access Journals (Sweden)

    Hyunjung Choi

    Full Text Available The primary cilium is an organelle protruding from the cell body that senses external stimuli including chemical, mechanical, light, osmotic, fluid flow, and gravitational signals. Skin is always exposed to the external environment and responds to external stimuli. Therefore, it is possible that primary cilia have an important role in skin. Ciliogenesis was reported to be involved in developmental processes in skin, such as keratinocyte differentiation and hair formation. However, the relation between skin pigmentation and primary cilia is largely unknown. Here, we observed that increased melanogenesis in melanocytes treated with a melanogenic inducer was inhibited by a ciliogenesis inducer, cytochalasin D, and serum-free culture. However, these inhibitory effects disappeared in GLI2 knockdown cells. In addition, activation of sonic hedgehog (SHH-smoothened (Smo signaling pathway by a Smo agonist, SAG inhibited melanin synthesis in melanocytes and pigmentation in a human skin model. On the contrary, an inhibitor of primary cilium formation, ciliobrevin A1, activated melanogenesis in melanocytes. These results suggest that skin pigmentation may be regulated partly by the induction of ciliogenesis through Smo-GLI2 signaling.

  11. Rhododenol and raspberry ketone impair the normal proliferation of melanocytes through reactive oxygen species-dependent activation of GADD45.

    Science.gov (United States)

    Kim, Minjeong; Baek, Heung Soo; Lee, Miri; Park, Hyeonji; Shin, Song Seok; Choi, Dal Woong; Lim, Kyung-Min

    2016-04-01

    Rhododenol or rhododendrol (RD, 4-(4-hydroxyphenyl)-2-butanol) occurs naturally in many plants along with raspberry ketone (RK, 4-(4-hydroxyphenyl)-2-butanone), a ketone derivative, which include Nikko maple tree (Acer nikoense) and white birch (Betula platyphylla). De-pigmenting activity of RD was discovered and it was used as a brightening ingredient for the skin whitening cosmetics. Recently, cosmetics containing RD were withdrawn from the market because a number of consumers developed leukoderma, inflammation and erythema on their face, neck and hands. Here, we explored the mechanism underlying the toxicity of RD and RK against melanocytes using B16F10 murine melanoma cells and human primary epidermal melanocytes. Treatment with RD or RK resulted in the decreased cell viability in a dose-dependent manner which appeared from cell growth arrest. Consistently, ROS generation was significantly increased by RD or RK as determined by DCF-enhanced fluorescence. An antioxidant enzyme, glutathione peroxidase was depleted as well. In line with ROS generation, oxidative damages and the arrest of normal cell proliferation, GADD genes (Growth Arrest and DNA Damage) that include GADD45 and GADD153, were significantly up-regulated. Prevention of ROS generation with an anti-oxidant, N-acetylcysteine (NAC) significantly rescued RD and RK-suppressed melanocyte proliferation. Consistently, up-regulation of GADD45 and GADD153 was significantly attenuated by NAC, suggesting that increased ROS and the resultant growth arrest of melanocytes may contribute to RD and RK-induced leukoderma. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Parameterization using Fourier series expansion of the diffuse reflectance of human skin to vary the concentration of the melanocytes

    Science.gov (United States)

    Narea, J. Freddy; Muñoz, Aarón A.; Castro, Jorge; Muñoz, Rafael A.; Villalba, Caroleny E.; Martinez, María. F.; Bravo, Kelly D.

    2013-11-01

    Human skin has been studied in numerous investigations, given the interest in knowing information about physiology, morphology and chemical composition. These parameters can be determined using non invasively optical techniques in vivo, such as the diffuse reflectance spectroscopy. The human skin color is determined by many factors, but primarily by the amount and distribution of the pigment melanin. The melanin is produced by the melanocytes in the basal layer of the epidermis. This research characterize the spectral response of the human skin using the coefficients of Fourier series expansion. Simulating the radiative transfer equation for the Monte Carlo method to vary the concentration of the melanocytes (fme) in a simplified model of human skin. It fits relating the Fourier series coefficient a0 with fme. Therefore it is possible to recover the skin biophysical parameter.

  13. Regulation of pigmentation by substrate elasticity in normal human melanocytes and melanotic MNT1 human melanoma cells.

    Science.gov (United States)

    Choi, Hyunjung; Kim, Mina; Ahn, Song Ih; Cho, Eun-Gyung; Lee, Tae Ryong; Shin, Jennifer H

    2014-03-01

    The elasticity of the cellular microenvironment is a key regulator of cellular physiology in many cell types. To investigate the effects of substrate stiffness on the pigmentation process, we cultured normal human melanocytes (NHM) and MNT1 melanoma cells on laminin-coated polydimethylsiloxane (PDMS) substrates of different stiffness. The dendricity of NHM and MNT1 cells was reduced as the substrate stiffness decreased, and the degree of melanosome transfer from NHM or MNT1 cells to normal human keratinocytes was decreased on softer substrates with the reduced dendricity. Gene and protein expressions of MITF, tyrosinase, TRP2, and gp100/PMEL17 exhibited a consistent decreasing trend with the decreasing stiffness. Because the stiffness sensing is mediated by focal adhesion complex through integrin receptors, we checked laminin specific integrin alpha 6 and p-FAK for MNT1 cells to observe that the substrate adhesion was weakened as the substrate stiffness decreased. Weaker adhesion on a softer substrate was accompanied by dynamic shape changes in MNT1 cells with higher speed and larger scattering. Dendritic MNT1 cells cultured on a stiffer substrate exhibited lower migration with smaller root mean squared displacement. These results demonstrate the possibility that skin pigmentation can be influenced by mechanical properties of the cellular microenvironment and can increase when the skin becomes stiff. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Malignant Tumor Derived from Skin Melanocytes of a Bovine of Unusual Presentation: A Case Study

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Chaves Velásquez

    2015-05-01

    Full Text Available Melanocytic tumors and melanomas in domestic animals include neoplasms composed of melanin-producing cells. In cattle, these tumors are rare and mostly benign, while malignant tumors are almost non-existent. The article reports the case of a female crossbred cow 38 months of age with a fluctuating mass located between the mandibular border and the left parotid region, about three months duration, with evident growth in the last thirty days. After surgical excision, a sample preserved in buffered formalin (10% was sent to the Laboratory of Pathology (University of Nariño—consisting of a fragment of 7.0 × 10.5 × 8.0 cm, ellipsoid, with skin and hair on one side, irregular surface, blackish brown, semi-soft consistency, and presence of shear translucent slimy content—for processing and inclusion in paraffin, cut to 5 μm thickness and stained with hematoxylin-eosin coloration. The forwarded tissue was classified as a neoplasm of malignant behavior derived from melanocytes, due to its cellular characteristics: growth pattern, pattern of distribution, severe cellular pleomorphism, anisocytosis, megalocytosis, nuclear pleomorphism, anisokaryosis, megalokaryosis, and involvement of blood vessel walls; additionally, the paraffin block was cut for immunohistochemical processing using monoclonal markers (S-100 DAKO® and Melan A DAKO®, contrasted with Mayer’s hematoxylin. Strong immunostaining of neoplastic cells is evident, and it constitutes the first reported case of this disease in Nariño (Colombia.

  15. Cutaneous lasers and skin camouflage make-up: a useful alternative intervention for periorbital hairy congenital melanocytic naevus.

    Science.gov (United States)

    Townley, William A; Bragg, Thomas W H; Wright, Philip A; Cole, Richard P

    2013-12-01

    Periorbital congenital melanocytic naevi can be very disfiguring and difficult to treat effectively. Although surgical excision and reconstruction is the most widely accepted treatment strategy, we describe a case in which cutaneous lasers treatment followed by the application of cosmetic skin camouflage make-up provided an alternative solution delivering a good cosmetic improvement.

  16. Comparison of growth factor signalling pathway utilisation in cultured normal melanocytes and melanoma cell lines

    International Nuclear Information System (INIS)

    Kim, Ji Eun; Stones, Clare; Joseph, Wayne R; Leung, Euphemia; Finlay, Graeme J; Shelling, Andrew N; Phillips, Wayne A; Shepherd, Peter R; Baguley, Bruce C

    2012-01-01

    The phosphatidylinositol-3-kinase (PI3K-PKB), mitogen activated protein kinase (MEK-ERK) and the mammalian target of rapamycin (mTOR- p70S6K), are thought to regulate many aspects of tumour cell proliferation and survival. We have examined the utilisation of these three signalling pathways in a number of cell lines derived from patients with metastatic malignant melanoma of known PIK3CA, PTEN, NRAS and BRAF mutational status. Western blotting was used to compare the phosphorylation status of components of the PI3K-PKB, MEK-ERK and mTOR-p70S6K signalling pathways, as indices of pathway utilisation. Normal melanocytes could not be distinguished from melanoma cells on the basis of pathway utilisation when grown in the presence of serum, but could be distinguished upon serum starvation, where signalling protein phosphorylation was generally abrogated. Surprisingly, the differential utilisation of individual pathways was not consistently associated with the presence of an oncogenic or tumour suppressor mutation of genes in these pathways. Utilisation of the PI3K-PKB, MEK-ERK and mTOR-p70S6K signalling pathways in melanoma, as determined by phosphorylation of signalling components, varies widely across a series of cell lines, and does not directly reflect mutation of genes coding these components. The main difference between cultured normal melanocytes and melanoma cells is not the pathway utilisation itself, but rather in the serum dependence of pathway utilisation

  17. Ultraviolet Radiation-Induced Cytogenetic Damage in White, Hispanic and Black Skin Melanocytes: A Risk for Cutaneous Melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Dasgupta, Amrita [Hampton University Skin of Color Research Institute, Hampton, VA 23668 (United States); Katdare, Meena, E-mail: mkatdare@gmail.com [Hampton University Skin of Color Research Institute, Hampton, VA 23668 (United States); Department of Dermatology, Eastern Virginia Medical School, Norfolk, VA 23507 (United States)

    2015-08-14

    Cutaneous Melanoma (CM) is a leading cause of cancer deaths, with reports indicating a rising trend in the incidence rate of melanoma among Hispanics in certain U.S. states. The level of melanin pigmentation in the skin is suggested to render photoprotection from the DNA-damaging effects of Ultraviolet Radiation (UVR). UVR-induced DNA damage leads to cytogenetic defects visualized as the formation of micronuclei, multinuclei and polymorphic nuclei in cells, and a hallmark of cancer risk. The causative relationship between Sun exposure and CM is controversial, especially in Hispanics and needs further evaluation. This study was initiated with melanocytes from White, Hispanic and Black neonatal foreskins which were exposed to UVR to assess their susceptibility to UVR-induced modulation of cellular growth, cytogenetic damage, intracellular and released melanin. Our results show that White and Hispanic skin melanocytes with similar levels of constitutive melanin are susceptible to UVR-induced cytogenetic damage, whereas Black skin melanocytes are not. Our data suggest that the risk of developing UVR-induced CM in a skin type is correlated with the level of cutaneous pigmentation and its ethnic background. This study provides a benchmark for further investigation on the damaging effects of UVR as risk for CM in Hispanics.

  18. Ultraviolet Radiation-Induced Cytogenetic Damage in White, Hispanic and Black Skin Melanocytes: A Risk for Cutaneous Melanoma

    International Nuclear Information System (INIS)

    Dasgupta, Amrita; Katdare, Meena

    2015-01-01

    Cutaneous Melanoma (CM) is a leading cause of cancer deaths, with reports indicating a rising trend in the incidence rate of melanoma among Hispanics in certain U.S. states. The level of melanin pigmentation in the skin is suggested to render photoprotection from the DNA-damaging effects of Ultraviolet Radiation (UVR). UVR-induced DNA damage leads to cytogenetic defects visualized as the formation of micronuclei, multinuclei and polymorphic nuclei in cells, and a hallmark of cancer risk. The causative relationship between Sun exposure and CM is controversial, especially in Hispanics and needs further evaluation. This study was initiated with melanocytes from White, Hispanic and Black neonatal foreskins which were exposed to UVR to assess their susceptibility to UVR-induced modulation of cellular growth, cytogenetic damage, intracellular and released melanin. Our results show that White and Hispanic skin melanocytes with similar levels of constitutive melanin are susceptible to UVR-induced cytogenetic damage, whereas Black skin melanocytes are not. Our data suggest that the risk of developing UVR-induced CM in a skin type is correlated with the level of cutaneous pigmentation and its ethnic background. This study provides a benchmark for further investigation on the damaging effects of UVR as risk for CM in Hispanics

  19. Multimode optical dermoscopy (SkinSpect) analysis for skin with melanocytic nevus

    Science.gov (United States)

    Vasefi, Fartash; MacKinnon, Nicholas; Saager, Rolf; Kelly, Kristen M.; Maly, Tyler; Chave, Robert; Booth, Nicholas; Durkin, Anthony J.; Farkas, Daniel L.

    2016-04-01

    We have developed a multimode dermoscope (SkinSpect™) capable of illuminating human skin samples in-vivo with spectrally-programmable linearly-polarized light at 33 wavelengths between 468nm and 857 nm. Diffusely reflected photons are separated into collinear and cross-polarized image paths and images captured for each illumination wavelength. In vivo human skin nevi (N = 20) were evaluated with the multimode dermoscope and melanin and hemoglobin concentrations were compared with Spatially Modulated Quantitative Spectroscopy (SMoQS) measurements. Both systems show low correlation between their melanin and hemoglobin concentrations, demonstrating the ability of the SkinSpect™ to separate these molecular signatures and thus act as a biologically plausible device capable of early onset melanoma detection.

  20. Acral melanocytic lesions in the United States: Prevalence, awareness, and dermoscopic patterns in skin-of-color and non-Hispanic white patients.

    Science.gov (United States)

    Madankumar, Reshmi; Gumaste, Priyanka V; Martires, Kathryn; Schaffer, Panta R; Choudhary, Sonal; Falto-Aizpurua, Leyre; Arora, Harleen; Kallis, Penelope J; Patel, Shailee; Damanpour, Shadi; Sanchez, Margaret I; Yin, Natalie; Chan, Aegean; Sanchez, Miguel; Polsky, David; Kanavy, Holly; Grichnik, James M; Stein, Jennifer A

    2016-04-01

    Acral lentiginous melanoma has increased mortality compared with other melanoma subtypes and disproportionately affects ethnic minorities. Acral melanocytic lesions have not been well studied in diverse populations of the United States. We sought to assess the prevalence, awareness, and dermoscopic patterns of acral melanocytic lesions in skin-of-color and non-Hispanic white patients. We prospectively examined the palms and soles of 1052 patients presenting to dermatology clinics in New York, NY, and Miami, FL, from October 2013 to April 2015. Acral melanocytic lesions were observed in 36% of our cohort. Skin-of-color patients were more likely to have acral melanocytic lesions than non-Hispanic white patients (P < .01). Acral melanocytic lesions correlated with increased mole counts, particularly on non-Hispanic white patients. The majority of lesions demonstrated benign dermoscopic patterns. We observed 2 lesions with the parallel ridge pattern in our cohort, both found to be atypical nevi on biopsy specimen. Patients often lacked awareness of the presence of their lesions. Interobserver variability in assessing dermoscopic patterns is a limitation. Melanocytic lesions of the palms and soles are common, particularly in a cohort of multiple ethnicities from the United States. Dermoscopy of acral lesions is an important clinical tool for diagnosis and management of these lesions. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  1. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  2. Human Adipose Mesenchymal Cells Inhibit Melanocyte Differentiation and the Pigmentation of Human Skin via Increased Expression of TGF-β1.

    Science.gov (United States)

    Klar, Agnes S; Biedermann, Thomas; Michalak, Katarzyna; Michalczyk, Teresa; Meuli-Simmen, Claudia; Scherberich, Arnaud; Meuli, Martin; Reichmann, Ernst

    2017-12-01

    There is accumulating evidence that interactions between epidermal melanocytes and stromal cells play an important role in the regulation of skin pigmentation. In this study we established a pigmented dermo-epidermal skin model, melDESS, of human origin to investigate the effects of distinct stromal cells on melanogenesis. melDESS is a complex, clinically relevant skin equivalent composed of an epidermis containing both melanocytes and keratinocytes. Its dermal compartment consists either of adipose tissue-derived stromal cells, dermal fibroblasts (Fbs), or a mixture of both cell types. These skin substitutes were transplanted for 5 weeks on the backs of immuno-incompetent rats and analyzed. Gene expression and Western blot analyses showed a significantly higher expression of transforming growth factor-β1 by adipose tissue-derived stromal cells compared with dermal Fbs. In addition, we showed that melanocytes responded to the increased levels of transforming growth factor-β1 by down-regulating the expression of key melanogenic enzymes such as tyrosinase. This caused decreased melanin synthesis and, consequently, greatly reduced pigmentation of melDESS. The conclusions are of utmost clinical relevance, namely that adipose tissue-derived stromal cells derived from the hypodermis fail to appropriately interact with epidermal melanocytes, thus preventing the sustainable restoration of the patient's native skin color in bioengineered skin grafts. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Heme oxygenase-1 expression protects melanocytes from stress-induced cell death: implications for vitiligo

    NARCIS (Netherlands)

    Elassiuty, Yasser E.; Klarquist, Jared; Speiser, Jodi; Yousef, Randa M.; El Refaee, Abdelaziz A.; Hunter, Nahla S.; Shaker, Olfat G.; Gundeti, Mohan; Nieuweboer-Krobotova, Ludmila; Caroline Le Poole, I.

    2011-01-01

    To study protection of melanocytes from stress-induced cell death by heme oxygenases during depigmentation and repigmentation in vitiligo, expression of isoforms 1 and 2 was studied in cultured control and patient melanocytes and normal skin explants exposed to UV or bleaching agent 4-TBP.

  4. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  5. Association of Multiple Melanocytic Naevi with Education, Sex and Skin Type. A Northern Finland Birth Cohort 1966 Study with 46 Years Follow-up.

    Science.gov (United States)

    Sinikumpu, Suvi-Päivikki; Huilaja, Laura; Jokelainen, Jari; Auvinen, Juha; Timonen, Markku; Tasanen, Kaisa

    2017-02-08

    Having multiple melanocytic naevi (sex, socioeconomic status (education) in childhood and adulthood, skin type and sunbathing habits. The prevalence of multiple melanocytic naevi was 11.6% (223/1,930). Higher education (odds ratio (OR) 2.11, 95% confidence interval (95% CI) 1.51-2.96), male sex (OR 1.48, 95% CI 1.07-2.06), sun-sensitive skin type (OR 2.09, 95% CI 1.34-3.27) and regular use of sunscreen (OR 2.03, 95% CI 1.23-3.37) were associated with increased risk of multiple naevi. Inflammatory skin diseases decreased (OR 0.49, 95 CI% 0.33-0.72) the risk of multiple naevi. In conclusion, several risk factors were found for multiple naevi among adults living in high latitudes, in Northern Finland.

  6. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  7. The pituitary-skin connection in amphibians. Reciprocal regulation of melanotrope cells and dermal melanocytes.

    Science.gov (United States)

    Vaudry, H; Chartrel, N; Desrues, L; Galas, L; Kikuyama, S; Mor, A; Nicolas, P; Tonon, M C

    1999-10-20

    In amphibians, alpha-MSH secreted by the pars intermedia of the pituitary plays a pivotal role in the process of skin color adaptation. Reciprocally, the skin of amphibians contains a number of regulatory peptides, some of which have been found to regulate the activity of pituitary melanotrope cells. In particular, the skin of certain species of amphibians harbours considerable amounts of thyrotropin-releasing hormone, a highly potent stimulator of alpha-MSH release. Recently, we have isolated and sequenced from the skin of the frog Phyllomedusa bicolor--a novel peptide named skin peptide tyrosine tyrosine (SPYY), which exhibits 94% similarity with PYY from the frog Rana ridibunda. For concentrations ranging from 5 x 10(-10) to 10(-7) M, SPYY induces a dose-related inhibition of alpha-MSH secretion. At a dose of 10(-7) M, SPYY totally abolished alpha-MSH release. These data strongly suggest the existence of a regulatory loop between the pars intermedia of the pituitary and the skin in amphibians.

  8. Skin and cutaneous melanocytic lesion simulation in biomedical optics with multilayered phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Urso, P [Department of Occupational and Environmental Health, Hospital L. Sacco Unit, University of Milan, Via G B Grassi, 74-20157 Milan (Italy); Lualdi, M [Medical Physics Unit, Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1-20133 Milan (Italy); Colombo, A [Medical Physics Unit, Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1-20133 Milan (Italy); Carrara, M [Medical Physics Unit, Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1-20133 Milan (Italy); Tomatis, S [Medical Physics Unit, Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1-20133 Milan (Italy); Marchesini, R [Medical Physics Unit, Istituto Nazionale per lo Studio e la Cura dei Tumori, Via Venezian 1-20133 Milan (Italy)

    2007-05-21

    The complex inner layered structure of skin influences the photon diffusion inside the cutaneous tissues and determines the reflectance spectra formation. Phantoms are very useful tools to understand the biophysical meaning of parameters involved in light propagation through the skin. To simulate the skin reflectance spectrum, we realized a multilayered skin-like phantom and a multilayered skin phantom with a melanoma-like phantom embedded inside. Materials used were Al{sub 2}O{sub 3} particles, melanin of sepia officinalis and a calibrator for haematology systems dispersed in transparent silicon. Components were optically characterized with indirect techniques. Reflectance phantom spectra were compared with average values of in vivo spectra acquired on a sample of 573 voluntary subjects and 132 pigmented lesions. The phantoms' reflectance spectra agreed with those measured in vivo, mimicking the optical behaviour of the human skin. Further, the phantoms were optically stable and easily manageable, and represented a valid resource in spectra formation comprehension, in diagnostic laser applications and simulation model implementation, such as the Monte Carlo code for non-homogeneous media. (note)

  9. Skin and cutaneous melanocytic lesion simulation in biomedical optics with multilayered phantoms

    International Nuclear Information System (INIS)

    Urso, P; Lualdi, M; Colombo, A; Carrara, M; Tomatis, S; Marchesini, R

    2007-01-01

    The complex inner layered structure of skin influences the photon diffusion inside the cutaneous tissues and determines the reflectance spectra formation. Phantoms are very useful tools to understand the biophysical meaning of parameters involved in light propagation through the skin. To simulate the skin reflectance spectrum, we realized a multilayered skin-like phantom and a multilayered skin phantom with a melanoma-like phantom embedded inside. Materials used were Al 2 O 3 particles, melanin of sepia officinalis and a calibrator for haematology systems dispersed in transparent silicon. Components were optically characterized with indirect techniques. Reflectance phantom spectra were compared with average values of in vivo spectra acquired on a sample of 573 voluntary subjects and 132 pigmented lesions. The phantoms' reflectance spectra agreed with those measured in vivo, mimicking the optical behaviour of the human skin. Further, the phantoms were optically stable and easily manageable, and represented a valid resource in spectra formation comprehension, in diagnostic laser applications and simulation model implementation, such as the Monte Carlo code for non-homogeneous media. (note)

  10. Role of Melanin in Melanocyte Dysregulation of Reactive Oxygen Species

    Directory of Open Access Journals (Sweden)

    Noah C. Jenkins

    2013-01-01

    Full Text Available We have recently reported a potential alternative tumor suppressor function for p16 relating to its capacity to regulate oxidative stress and observed that oxidative dysregulation in p16-depleted cells was most profound in melanocytes, compared to keratinocytes or fibroblasts. Moreover, in the absence of p16 depletion or exogenous oxidative insult, melanocytes exhibited significantly higher basal levels of reactive oxygen species (ROS than these other epidermal cell types. Given the role of oxidative stress in melanoma development, we speculated that this increased susceptibility of melanocytes to oxidative stress (and greater reliance on p16 for suppression of ROS may explain why genetic compromise of p16 is more commonly associated with predisposition to melanoma rather than other cancers. Here we show that the presence of melanin accounts for this differential oxidative stress in normal and p16-depleted melanocytes. Thus the presence of melanin in the skin appears to be a double-edged sword: it protects melanocytes as well as neighboring keratinocytes in the skin through its capacity to absorb UV radiation, but its synthesis in melanocytes results in higher levels of intracellular ROS that may increase melanoma susceptibility.

  11. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Autoimmune Destruction of Skin Melanocytes by Perilesional T Cells from Vitiligo Patients

    NARCIS (Netherlands)

    van den Boorn, Jasper G.; Konijnenberg, Debby; Dellemijn, Trees A. M.; van der Veen, J. P. Wietze; Bos, Jan D.; Melief, Cornelis J. M.; Vyth-Dreese, Florry A.; Luiten, Rosalie M.

    2009-01-01

    In vitiligo, cytotoxic T cells infiltrating the perilesional margin are suspected to be involved in the pathogenesis of the disease. However, it remains to be elucidated whether these T cells are a cause or a consequence of the depigmentation process. T cells we obtained from perilesional skin

  13. Single treatment with 100-microsecond alexandrite laser clears selected acquired melanocytic nevi in type IV asian facial skin

    Directory of Open Access Journals (Sweden)

    Etienne CE Wang

    2013-01-01

    Full Text Available Context: Small common acquired melanocytic nevi (AMNs are common on Asian facial skin. Aims: To show that the 755 nm Alexandrite laser stacked at the 100-μs long-pulsed mode (μsAL is an effective modality for the removal of selected AMNs. Settings and Design: This was a retrospective case series, followed up with a telephone interview. Materials and Methods: A retrospective analysis of all patients treated between January 2010 and April 2012 with the μsAL laser for small AMNs was conducted. Pre- and post-treatment facial photographs and photographs of the individual lesions were analyzed by two independent dermatological surgeons for degree of clearance and complications. A telephone interview was conducted with the patients to assess their satisfaction with the procedure. Results: A total of 18 patients with 53 lesions were included. 7/18 (38.9% of patients had ′excellent′ results. No patients had ′mild′ or ′poor′ results. At 4 week post-treatment, 49/53 (92.5% were totally cleared, with 14/53 (26.4% reporting mild atrophy, and 11/53 (20.8% reporting mild post-inflammatory hypopigmentation. The majority of lesions had negligible complications. 9/18 (50% judged the procedure to be ′excellent′, and all patients reported that they would recommend this procedure to a friend seeking removal of small facial AMNs. Conclusion: The μsAL is an effective modality for the removal of small facial AMNs.

  14. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  15. Image enhancement of optical images for binary system of melanocytes and keratinocytes

    Science.gov (United States)

    Takanezawa, S.; Baba, A.; Sako, Y.; Ozaki, Y.; Date, A.; Toyama, K.; Morita, S.

    2013-05-01

    Automatic determination of the cell shapes of large numbers of melanocytes based on optical images of human skin models have been largely unsuccessful (the complexities introduced by dendrites and the melanin pigmentation over the keratinocytes to give unclear outlines). Here, we present an image enhancement procedure for enhancing the contrast of images with removing the non-uniformity of background. The brightness is normalized also for the non-uniform population density of melanocytes.

  16. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  17. Melanocyte colonization and pigmentation of breast carcinoma

    DEFF Research Database (Denmark)

    Mele, Marco; Laurberg, Tinne; Engberg Damsgaard, Tine

    2012-01-01

    . The pathogenesis by which melanocyte migration takes place is not known, but a breached basement membrane is considered essential. Conclusion. Histological examination and additional staining of skin are essential to differentiate breast cancer melanosis from malignant melanoma.......Introduction. Melanocyte colonization of breast carcinoma by nonneoplastic melanocytes of epidermal origin is a rare and serious condition first described in 1977. We report on the exceptional clinical and pathological features of this migration phenomenon in a 74-year-old patient. Discussion...

  18. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  19. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  20. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2018-05-01

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  2. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  3. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  4. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  5. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  6. Estudo de distribuição e morfologia dos melanócitos em pele com e sem exposição solar Melanocytes distribution and morphology analysis in skin with and without sun exposure

    Directory of Open Access Journals (Sweden)

    Daniela Mayumi Takano

    2010-02-01

    Full Text Available INTRODUÇÃO E OBJETIVOS: Acredita-se que a exposição solar possa alterar número, distribuição e morfologia dos melanócitos na pele humana, muitas vezes dificultando a interpretação de biópsias de pele, principalmente para o diagnóstico de lesões melanocíticas iniciais e para a avaliação precisa de margens de ressecção. O objetivo deste trabalho foi avaliar os melanócitos da pele humana em área exposta e não exposta ao sol. MÉTODOS: Realizada análise histológica de 60 fragmentos de biópsias de pele obtidas do antebraço (área fotoexposta e região glútea (área coberta de cadáveres do Serviço de Verificação de Óbitos de Recife-PE. A estatística foi realizada com o SPSS Windows versão 12.0. RESULTADOS: Observou-se um número bastante variável de melanócitos nos fragmentos de pele, com maior concentração destes na região do antebraço (área de maior fotoexposição (p INTRODUCTION AND OBJECTIVES: It is believed that sun exposure can change the number, distribution and morphology of melanocytes in human skin, which often hinders the interpretation of skin biopsies, mainly as to diagnosis of initial melanocytic lesions and accurate assessment of resection margins. Our objective was to evaluate melanocytes in sun-exposed and non-exposed skin. METHODS: It was conducted the histological analysis of 60 skin biopsy samples resected from cadaver forearm (sun-exposed skin and cadaver buttock (non-exposed skin from the Death Verification Service (Serviço de Verificação de Óbitos of Recife, state of Pernambuco. The statistical analysis was performed with SPSS Windows version 12.0. RESULTS: There was considerable variability in melanocyte density, with a higher concentration of these cells in sun-exposed areas (p < 0.001. There was also an irregular distribution of melanocytes along the epidermal basal layer, occasionally with cells arranged side by side. This confluence was identified with a higher frequency in sun

  7. Melanocyte biology and function with reference to oral melanin hyperpigmentation in HIV-seropositive subjects.

    Science.gov (United States)

    Feller, Liviu; Chandran, Rakesh; Kramer, Beverley; Khammissa, Razia A G; Altini, Mario; Lemmer, Johan

    2014-09-01

    The color of normal skin and of oral mucosa is not determined by the number of melanocytes in the epithelium but rather by their melanogenic activity. Pigmented biopolymers or melanins are synthesized in melanosomes. Tyrosinase is the critical enzyme in the biosynthesis of both brown/black eumelanin and yellow/red pheomelanin. The number of the melanosomes within the melanocytes, the type of melanin within the melanosomes, and the efficacy of the transfer of melanosomes from the melanocytes to the neighboring keratinocytes all play an important role in tissue pigmentation. Melanin production is regulated by locally produced factors including proopiomelanocortin and its derivative peptides, particularly alpha-melanocyte-stimulating hormone (α-MSH), melanocortin 1 receptor (MC1R), adrenergic and cholinergic agents, growth factors, cytokines, and nitric oxide. Both eumelanin and pheomelanin can be produced by the same melanocytes, and the proportion of the two melanin types is influenced by the degree of functional activity of the α-MSH/MC1R intracellular pathway. The cause of HIV oral melanosis is not fully understood but may be associated with HIV-induced cytokine dysregulation, with the medications commonly prescribed to HIV-seropositive persons, and with adrenocortical dysfunction, which is not uncommon in HIV-seropositive subjects with AIDS. The purpose of this article is to discuss some aspects of melanocyte biology and HIV-associated oral melanin hyperpigmentation.

  8. Sema4D, the ligand for Plexin B1, suppresses c-Met activation and migration and promotes melanocyte survival and growth.

    Science.gov (United States)

    Soong, Joanne; Chen, Yulin; Shustef, Elina M; Scott, Glynis A

    2012-04-01

    Semaphorins are secreted and membrane-bound proteins involved in neural pathfinding, organogenesis, and tumor progression, through Plexin and neuropilin receptors. We recently reported that Plexin B1, the Semaphorin 4D (Sema4D) receptor, is a tumor-suppressor protein for melanoma, which functions, in part, through inhibition of the oncogenic c-Met tyrosine kinase receptor. In this report, we show that Sema4D is a protective paracrine factor for normal human melanocyte survival in response to UV irradiation, and that it stimulates proliferation and regulates the activity of the c-Met receptor. c-Met receptor signaling stimulates melanocyte migration, partly through downregulation of the cell adhesion molecule E-cadherin. Sema4D suppressed activation of c-Met in response to its ligand, hepatocyte growth factor (HGF), and partially blocked the suppressive effects of HGF on E-cadherin expression in melanocytes and HGF-dependent migration. These data demonstrate a role for Plexin B1 in maintenance of melanocyte survival and proliferation in the skin, and suggest that Sema4D and Plexin B1 act cooperatively with HGF and c-Met to regulate c-Met-dependent effects in human melanocytes. Because our data show that Plexin B1 is profoundly downregulated by UVB in melanocytes, loss of Plexin B1 may accentuate HGF-dependent effects on melanocytes, including melanocyte migration.

  9. Is there just one lesion? The need for whole body skin examination in patients presenting with non-melanocytic skin cancer.

    Science.gov (United States)

    Terrill, Patricia Jane; Fairbanks, Sian; Bailey, Michael

    2009-10-01

    In patients presenting with non-melanoma skin cancer (NMSC) the frequency of concurrently presenting tumours is poorly documented. Whole body skin examination is recommended but in a recent survey of Australian General Practitioners and skin cancer clinics doctors it was infrequently performed. The aim of this study was to examine the incidence of concurrent skin cancer at initial presentation and therefore to examine the need for whole body skin examination for NMSC presentations. One hundred consecutive patients with a referral diagnosis indicative of NMSC were examined. Data was analysed as to the referring doctor's diagnosis, whole body skin examination findings and histology of excised lesions. Epidemiological data was obtained by patient questionnaire. One hundred patients, 41 males and 59 females, with a mean age of 70 years (range 39-91 years) underwent whole body skin examination. Sixty-seven per cent of patients were found to have additional lesions requiring treatment, 46% sin cancers (30 patients basal cell carcinomas, five squamous cell carcinomas, seven basal and squamous cell carcinomas, two lentigo maligna, two adenexal tumours) and 21% solar keratoses. Thirty-four of the additional lesions detected were in areas covered by clothing. Sixty-eight patients had a past history of skin cancer excision. In the Australian patient population, the need for whole body skin examination is essential to avoid missing concurrent lesions. Ongoing surveillance is also essential as these patients have a high risk of developing future NMSC.

  10. Topography of Protein Kinase C βII in Benign and Malignant Melanocytic Lesions.

    Science.gov (United States)

    Krasagakis, Konstanin; Tsentelierou, Eleftheria; Chlouverakis, Gregory; Stathopoulos, Efstathios N

    2017-09-01

    Protein kinase C βII promotes melanogenesis and affects proliferation of melanocytic cells but is frequently absent or decreased in melanoma cells in vitro. To investigate PKC-βII expression and spatial distribution within a lesion in various benign and malignant melanocytic proliferations. Expression of PKC-βII was semiquantitatively assessed in the various existing compartments (intraepidermal [not nested], junctional [nested], and dermal) of benign (n = 43) and malignant (n = 28) melanocytic lesions by immunohistochemistry. Melanocytes in the basal layer of normal skin or in lentigo simplex stained strongly for PKC-βII. Common nevi lacked completely PKC-βII. All other lesions expressed variably PKC-βII, with cutaneous melanoma metastases displaying the lowest rate of positivity (14%). In the topographical analysis within a lesion, PKC-βII expression was largely retained in the intraepidermal and junctional part of all other lesions (dysplastic nevus, lentigo maligna, and melanoma). Reduced expression of PKC-βII was found in the dermal component of benign and malignant lesions ( P = .041 vs intraepidermal). PKC-βII expression in the various compartments did not differ significantly between benign and malignant lesions. The current study revealed a significant correlation between PKC-βII expression and spatial localization of melanocytes, with the lowest expression found in the dermal compartment and the highest in the epidermal compartment.

  11. Mammalian melanocytes and radiations

    International Nuclear Information System (INIS)

    Hirobe, Tomohisa

    2008-01-01

    Melanocytes (M) decide the skin and hair color through the synthesis of melanine pigment, which is transported via their melanosome to keratinocytes (K) for body color expression in animals. This paper describes mainly author's studies of M concerning effects of ultraviolet (UV), ionizing radiation and heavy ion (carbon ion) beam on their development and differentiation together with its mechanism. In vitro, studies of UV effect on proliferation and differentiation of M and melanoblast (MB) have been greatly advanced since their culturing in serum-free media became possible using cells from author's black-mouse (C57BL/10JHir strain): Their mixed culture with K firstly revealed that their proliferation and differentiation were enhanced by UV irradiation. The important K's factor to regulate M/MB cells was identified to be GMCSF (granulocyte-macrophage colony-stimulating factor). In vivo studies of the skin color of the black-mouse before and after birth were performed using radiations like 60 Co gamma ray and high linear energy transfer (LET) carbon ion beam and have revealed that abnormal proliferation and differentiation of M/MB, which were expressed as white spot formation, death and mal-differentiation of M/MB, were induced dose-, LET- and developmental stage-dependently. (R.T.)

  12. Human melanocytes form a PAX3-expressing melanocyte cluster on Matrigel by the cell migration process.

    Science.gov (United States)

    Choi, Hyunjung; Jin, Sun Hee; Han, Mi Hwa; Lee, Jinyoung; Ahn, Seyeon; Seong, Minjeong; Choi, Hyun; Han, Jiyeon; Cho, Eun-Gyung; Lee, Tae Ryong; Noh, Minsoo

    2014-10-01

    The interactions between human epidermal melanocytes and their cellular microenvironment are important in the regulation of human melanocyte functions or in their malignant transformation into melanoma. Although the basement membrane extracellular matrix (BM-ECM) is one of major melanocyte microenvironments, the effects of BM-ECM on the human melanocyte functions are not fully explained at a molecular level. This study was aimed to characterize the molecular and cellular interactions between normal human melanocytes (NHMs) and BM-ECM. We investigated cell culture models of normal human melanocytes or melanoma cells on three-dimensional (3D) Matrigel to understand the roles of the basement membrane microenvironment in human melanocyte functions. Melanogenesis and melanobast biomarker expression in both primary human melanocytes and melanoma cells on 3D Matrigel were evaluated. We found that NHMs migrated and formed reversible paired box 3 (PAX3) expressing cell clusters on three-dimensional (3D) Matrigel. The melanogenesis was significantly decreased in the PAX3 expressing cell cluster. The expression profile of PAX3, SOX10, and MITF in the melanocyte cluster on 3D Matrigel was similar to that of melanoblasts. Interestingly, PAX3 and SOX10 showed an inverse expression profile in NHMs, whereas the inverse expression pattern of PAX3 and SOX10 was disrupted in melanoma MNT1 and WM266-4 cells. The human melanocyte culture on 3D Matrigel provides an alternative model system to study functions of human melanoblasts. In addition, this system will contribute to the elucidation of PAX3-related tumorigenic mechanisms to understand human melanoma. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  13. Stereological estimation of nuclear volume in benign and malignant melanocytic lesions of the skin. Inter- and intraobserver variability of malignancy grading

    DEFF Research Database (Denmark)

    Sørensen, Flemming Brandt; Ottosen, P D

    1991-01-01

    The volume-weighted, mean nuclear volume (nuclear vv) may be estimated without any assumptions regarding nuclear shape using modern stereological techniques. As a part of an investigation concerning the prospects of nuclear vv for classification and malignancy grading of cutaneous melanocytic tum...

  14. Melanocyte-secreted fibromodulin promotes an angiogenic microenvironment.

    Science.gov (United States)

    Adini, Irit; Ghosh, Kaustabh; Adini, Avner; Chi, Zai-Long; Yoshimura, Takeru; Benny, Ofra; Connor, Kip M; Rogers, Michael S; Bazinet, Lauren; Birsner, Amy E; Bielenberg, Diane R; D'Amato, Robert J

    2014-01-01

    Studies have established that pigmentation can provide strong, protective effects against certain human diseases. For example, angiogenesis-dependent diseases such as wet age-related macular degeneration and infantile hemangioma are more common in light-skinned individuals of mixed European descent than in African-Americans. Here we found that melanocytes from light-skinned humans and albino mice secrete high levels of fibromodulin (FMOD), which we determined to be a potent angiogenic factor. FMOD treatment stimulated angiogenesis in numerous in vivo systems, including laser-induced choroidal neovascularization, growth factor-induced corneal neovascularization, wound healing, and Matrigel plug assays. Additionally, FMOD enhanced vascular sprouting during normal retinal development. Deletion of Fmod in albino mice resulted in a marked reduction in the amount of neovascularization induced by retinal vein occlusion, corneal growth factor pellets, and Matrigel plugs. Our data implicate the melanocyte-secreted factor FMOD as a key regulator of angiogenesis and suggest an underlying mechanism for epidemiological differences between light-skinned individuals of mixed European descent and African-Americans. Furthermore, inhibition of FMOD in humans has potential as a therapeutic strategy for treating angiogenesis-dependent diseases.

  15. Melanocytes and melanin represent a first line of innate immunity against Candida albicans.

    Science.gov (United States)

    Tapia, Cecilia V; Falconer, Maryanne; Tempio, Fabián; Falcón, Felipe; López, Mercedes; Fuentes, Marisol; Alburquenque, Claudio; Amaro, José; Bucarey, Sergio A; Di Nardo, Anna

    2014-07-01

    Melanocytes are dendritic cells located in the skin and mucosae that synthesize melanin. Some infections induce hypo- or hyperpigmentation, which is associated with the activation of Toll-like receptors (TLRs), especially TLR4. Candida albicans is an opportunist pathogen that can switch between blastoconidia and hyphae forms; the latter is associated with invasion. Our objectives in this study were to ascertain whether C. albicans induces pigmentation in melanocytes and whether this process is dependent on TLR activation, as well as relating this with the antifungal activity of melanin as a first line of innate immunity against fungal infections. Normal human melanocytes were stimulated with C. albicans supernatants or with crude extracts of the blastoconidia or hyphae forms, and pigmentation and TLR2/TLR4 expression were measured. Expression of the melanosomal antigens Melan-A and gp100 was examined for any correlation with increased melanin levels or antifungal activity in melanocyte lysates. Melanosomal antigens were induced earlier than cell pigmentation, and hyphae induced stronger melanization than blastoconidia. Notably, when melanocytes were stimulated with crude extracts of C. albicans, the cell surface expression of TLR2/TLR4 began at 48 h post-stimulation and peaked at 72 h. At this time, blastoconidia induced both TLR2 and TLR4 expression, whereas hyphae only induced TLR4 expression. Taken together, these results suggest that melanocytes play a key role in innate immune responses against C. albicans infections by recognizing pathogenic forms of C. albicans via TLR4, resulting in increased melanin content and inhibition of infection. © The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Ultraviolet Radiation and the Slug Transcription Factor Induce Proinflammatory and Immunomodulatory Mediator Expression in Melanocytes

    Directory of Open Access Journals (Sweden)

    Stephanie H. Shirley

    2012-01-01

    Full Text Available Despite extensive investigation, the precise contribution of the ultraviolet radiation (UVR component of sunlight to melanoma etiology remains unclear. UVR induces keratinocytes to secrete proinflammatory and immunomodulatory mediators that promote inflammation and skin tumor development; expression of the slug transcription factor in keratinocytes is required for maximal production of these mediators. In the present studies we examined the possibility that UVR-exposed melanocytes also produce proinflammatory mediators and that Slug is important in this process. Microarray studies revealed that both UVR exposure and Slug overexpression altered transcription of a variety of proinflammatory mediators by normal human melanocytes; some of these mediators are also known to stimulate melanocyte growth and migration. There was little overlap in the spectra of cytokines produced by the two stimuli. However IL-20 was similarly induced by both stimuli and the NFκB pathway appeared to be important in both circumstances. Further exploration of UVR-induced and Slug-dependent pathways of cytokine induction in melanocytes may reveal novel targets for melanoma therapy.

  17. Ultraviolet Radiation and the Slug Transcription Factor Induce Pro inflammatory and Immunomodulatory Mediator Expression in Melanocytes

    International Nuclear Information System (INIS)

    Shirley, S. H.; Kusewitt, D. F.; Grimm, E. A.

    2012-01-01

    Despite extensive investigation, the precise contribution of the ultraviolet radiation (UVR) component of sunlight to melanoma etiology remains unclear. UVR induces keratinocytes to secrete pro inflammatory and immunomodulatory mediators that promote inflammation and skin tumor development; expression of the slug transcription factor in keratinocytes is required for maximal production of these mediators. In the present studies we examined the possibility that UVR-exposed melanocytes also produce pro inflammatory mediators and that Slug is important in this process. Micro array studies revealed that both UVR exposure and Slug overexpression altered transcription of a variety of pro inflammatory mediators by normal human melanocytes; some of these mediators are also known to stimulate melanocyte growth and migration. There was little overlap in the spectra of cytokines produced by the two stimuli. However IL-20 was similarly induced by both stimuli and the NFκB pathway appeared to be important in both circumstances. Further exploration of UVR-induced and Slug-dependent pathways of cytokine induction in melanocytes may reveal novel targets for melanoma therapy.

  18. Melanosomes are transferred from melanocytes to keratinocytes through the processes of packaging, release, uptake, and dispersion.

    Science.gov (United States)

    Ando, Hideya; Niki, Yoko; Ito, Masaaki; Akiyama, Kaoru; Matsui, Mary S; Yarosh, Daniel B; Ichihashi, Masamitsu

    2012-04-01

    Recent studies have described the role of shedding vesicles as physiological conveyers of intracellular components between neighboring cells. Here we report that melanosomes are one example of shedding vesicle cargo, but are processed by a previously unreported mechanism. Pigment globules were observed to be connected to the filopodia of melanocyte dendrites, which have previously been shown to be conduits for melanosomes. Pigment globules containing multiple melanosomes were released from various areas of the dendrites of normal human melanocytes derived from darkly pigmented skin. The globules were then captured by the microvilli of normal human keratinocytes, also derived from darkly pigmented skin, which incorporated them in a protease-activated receptor-2 (PAR-2)-dependent manner. After the pigment globules were ingested by the keratinocytes, the membrane that surrounded each melanosome cluster was gradually degraded, and the individual melanosomes then spread into the cytosol and were distributed primarily in the perinuclear area of each keratinocyte. These results suggest a melanosome transfer pathway wherein melanosomes are transferred from melanocytes to keratinocytes via the shedding vesicle system. This packaging system generates pigment globules containing multiple melanosomes in a unique manner.

  19. Investigation of cellular signalling responses to non-ionising radiation in melanocytes by microarray analysis

    International Nuclear Information System (INIS)

    Boyle, G.M.; Pedley, J.; Martyn, A.C.; Fraser, L.M.; Banducci, K.J.; Parsons, P.G.; Breit, S.N.

    2003-01-01

    Melanoma is a highly aggressive cancer resulting from the abnormal proliferation and spread of specialised pigment cells in the skin, known as melanocytes. Extensive epidemiological and molecular evidence suggests that a major risk factor for melanoma formation is exposure to non-ionising radiation in the form of solar ultra-violet (UV) light. However, the exact role of solar UV in the development of melanoma is unclear. To elucidate the molecular events that occur in melanocytes following solar UV exposure and determine how they lead to melanoma development, cDNA microarray analysis was used to analyse the gene expression profile of normal melanocytes, melanocytes exposed to simulated solar UV and melanoma cells. The development of cDNA microarray technology has allowed gene expression profiling at the mRNA level to be conducted for many thousands of genes simultaneously by hybridising an array of known sequences with labelled cDNA reverse transcribed form the sample RNA. Gene expression analysis was performed for over 13,000 genes. More than 500 genes were identified as differentially expressed in melanocytes following a single UV exposure, although overall there was a general suppression of transcription. Genes that were up-regulated included oncogenes and cytoskeletal genes; in contrast, genes encoding protein tyrosine kinases and apoptosis effectors were down-regulated. Many of the genes identified as being differentially expressed represent novel UV-regulated targets. Repeated exposure to solar UV resulted in the elevation in expression of a novel member of the transforming growth factor-b (TGF-b) superfamily, the Macrophage Inhibitory Cytokine-1 (MIC-1). Our results have shown that MIC-1 is up-regulated by solar UV in melanocytes, and is highly expressed (>3 fold) in a number of metastatic melanoma cell lines (31/61) in comparison to primary melanocytes. Furthermore functional, dimerised MIC-1 was found to be secreted by melanocytes, and secreted levels were

  20. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  1. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  2. Prostaglandin production by melanocytic cells and the effect of alpha-melanocyte stimulating hormone.

    Science.gov (United States)

    Nicolaou, Anna; Estdale, Sian E; Tsatmali, Marina; Herrero, Daniel Pascual; Thody, Anthony J

    2004-07-16

    Prostaglandins are potent mediators of the inflammatory response and are also involved in cancer development. In this study, we show that human melanocytes and FM55 melanoma cells express cyclooxygenase-1 and -2 (COX-1 and -2) and thus have the capability to produce prostaglandins. The FM55 cells produced predominantly PGE2 and PGF2alpha, whereas the HaCaT keratinocyte cell line produced mainly PGE2. The anti-inflammatory peptide, alpha-melanocyte stimulating hormone (alpha-MSH), reduced prostaglandin production in FM55 and HaCaT cells and reversed the effect of the pro-inflammatory cytokine TNF-alpha in the former. These results indicate that melanocytes produce prostaglandins and that alpha-MSH, by inhibiting this response, may play an important role in regulating inflammatory responses in the skin.

  3. In vivo assessment of optical properties of melanocytic skin lesions and differentiation of melanoma from non-malignant lesions by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, M A L M; Suppa, M; Dhaenens, F.

    2016-01-01

    One of the most challenging problems in clinical dermatology is the early detection of melanoma. Reflectance confocal microscopy (RCM) is an added tool to dermoscopy improving considerably diagnostic accuracy. However, diagnosis strongly depends on the experience of physicians. High-definition op......One of the most challenging problems in clinical dermatology is the early detection of melanoma. Reflectance confocal microscopy (RCM) is an added tool to dermoscopy improving considerably diagnostic accuracy. However, diagnosis strongly depends on the experience of physicians. High......-definition optical coherence tomography (HD-OCT) appears to offer additional structural and cellular information on melanocytic lesions complementary to that of RCM. However, the diagnostic potential of HD-OCT seems to be not high enough for ruling out the diagnosis of melanoma if based on morphology analysis...

  4. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  5. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  6. Infrared A radiation promotes survival of human melanocytes carrying ultraviolet radiation-induced DNA damage.

    Science.gov (United States)

    Kimeswenger, Susanne; Schwarz, Agatha; Födinger, Dagmar; Müller, Susanne; Pehamberger, Hubert; Schwarz, Thomas; Jantschitsch, Christian

    2016-06-01

    The link between solar radiation and melanoma is still elusive. Although infrared radiation (IR) accounts for over 50% of terrestrial solar energy, its influence on human skin is not well explored. There is increasing evidence that IR influences the expression patterns of several molecules independently of heat. A previous in vivo study revealed that pretreatment with IR might promote the development of UVR-induced non-epithelial skin cancer and possibly of melanoma in mice. To expand on this, the aim of the present study was to evaluate the impact of IR on UVR-induced apoptosis and DNA repair in normal human epidermal melanocytes. The balance between these two effects is a key factor of malignant transformation. Human melanocytes were exposed to physiologic doses of IR and UVR. Compared to cells irradiated with UVR only, simultaneous exposure to IR significantly reduced the apoptotic rate. However, IR did not influence the repair of UVR-induced DNA damage. IR partly reversed the pro-apoptotic effects of UVR via modification of the expression and activity of proteins mainly of the extrinsic apoptotic pathway. In conclusion, IR enhances the survival of melanocytes carrying UVR-induced DNA damage and thereby might contribute to melanomagenesis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Giant Congenital Melanocytic Nevus

    DEFF Research Database (Denmark)

    Rasmussen, Bo Sonnich; Henriksen, Trine Foged; Kølle, Stig-Frederik Trojahn

    2015-01-01

    Giant congenital melanocytic nevi (GCMN) occur in 1:20,000 livebirths and are associated with increased risk of malignant transformation. The treatment of GCMN from 1981 to 2010 in a tertiary referral center was reviewed evaluating the modalities used, cosmetic results, associated complications...

  8. Effect of friction on vibrotactile sensation of normal and dehydrated skin.

    Science.gov (United States)

    Chen, S; Ge, S; Tang, W; Zhang, J

    2016-02-01

    Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. The effects of Sophora angustifolia and other natural plant extracts on melanogenesis and melanin transfer in human skin cells.

    Science.gov (United States)

    Singh, Suman K; Baker, Richard; Wibawa, Judata I D; Bell, Mike; Tobin, Desmond J

    2013-01-01

    Skin pigmentation is a multistep process of melanin synthesis by melanocytes, its transfer to recipient keratinocytes and its degradation. As dyspigmentation is a prominent marker of skin ageing, novel effective agents that modulate pigmentation safely are being sought for both clinical and cosmetic use. Here, a number of plant extracts were examined for their effect on melanogenesis (by melanin assay and Western blotting) and melanin transfer (by confocal immunomicroscopy of gp100-positive melanin granules in cocultures and by SEM analysis of filopodia), in human melanocytes and in cocultures with phototype-matched normal adult epidermal keratinocytes. Mulberry, Kiwi and Sophora extracts were assessed against isobutylmethylxanthine, hydroquinone, vitamin C and niacinamide. Compared with unstimulated control, all extracts significantly reduced melanogenesis in human melanoma cells and normal adult epidermal melanocytes. These extracts also reduced melanin transfer and reduced filopodia expression on melanocytes, similar to hydroquinone and niacinamide, indicating their effectiveness as multimode pigmentation actives. © 2013 John Wiley & Sons A/S.

  10. Worldwide cutaneous malignant melanoma incidences analyzed by sex, age, and skin type over time (1955–2007): Is HPV infection of androgenic hair follicular melanocytes a risk factor for developing melanoma exclusively in people of European-ancestry?

    Science.gov (United States)

    Merrill, Stephen J.; Subramanian, Madhan; Godar, Dianne E.

    2016-01-01

    ABSTRACT The cutaneous malignant melanoma (CMM) incidence has been increasing in an exponential manner in certain populations around the world for over 7 decades. To help illuminate the etiology, we performed worldwide temporal (1955–2007) CMM incidence analysis by sex, age (0–14, 15–29, 30–49, 50–69, 70–85+), and skin type on 6 continents using data from the International Agency for Research on Cancer. We observe an exponential increase in the CMM incidence over time and an increase of about 2 orders of magnitude between age groups 0–14 and 15–29 exclusively in European-ancestry populations around the world independent of skin type (I–III or III–IV). Other populations like the Chinese (III-IV) had much lower CMM incidences that either remained stable or temporally decreased but did not display a dramatic increase between the youngest age groups. The dramatic increase in the incidence between the youngest age groups found only in European-ancestry populations suggests one of the most important risk factors for CMM may be developing androgenic hair, the occurrence of which appears to correlate with the distribution of CMM over male and female body sites. Besides that potential new risk factor, the increasing CMM incidence with increasing age, known not to be from cumulative UV doses, may be associated with age-related changes to skin, i.e., thinning epidermis causing lower vitamin D3 levels, and hair, i.e., whitening from higher reactive oxygen species. The temporal exponential increasing CMM incidence in European-ancestry populations may be due to Human Papilloma Virus infection of follicular hair melanocytes, found in CMM biopsies. PMID:27588159

  11. Population-Based Analysis of Histologically Confirmed Melanocytic Proliferations Using Natural Language Processing.

    Science.gov (United States)

    Lott, Jason P; Boudreau, Denise M; Barnhill, Ray L; Weinstock, Martin A; Knopp, Eleanor; Piepkorn, Michael W; Elder, David E; Knezevich, Steven R; Baer, Andrew; Tosteson, Anna N A; Elmore, Joann G

    2018-01-01

    Population-based information on the distribution of histologic diagnoses associated with skin biopsies is unknown. Electronic medical records (EMRs) enable automated extraction of pathology report data to improve our epidemiologic understanding of skin biopsy outcomes, specifically those of melanocytic origin. To determine population-based frequencies and distribution of histologically confirmed melanocytic lesions. A natural language processing (NLP)-based analysis of EMR pathology reports of adult patients who underwent skin biopsies at a large integrated health care delivery system in the US Pacific Northwest from January 1, 2007, through December 31, 2012. Skin biopsy procedure. The primary outcome was histopathologic diagnosis, obtained using an NLP-based system to process EMR pathology reports. We determined the percentage of diagnoses classified as melanocytic vs nonmelanocytic lesions. Diagnoses classified as melanocytic were further subclassified using the Melanocytic Pathology Assessment Tool and Hierarchy for Diagnosis (MPATH-Dx) reporting schema into the following categories: class I (nevi and other benign proliferations such as mildly dysplastic lesions typically requiring no further treatment), class II (moderately dysplastic and other low-risk lesions that may merit narrow reexcision with skin biopsies, performed on 47 529 patients, were examined. Nearly 1 in 4 skin biopsies were of melanocytic lesions (23%; n = 18 715), which were distributed according to MPATH-Dx categories as follows: class I, 83.1% (n = 15 558); class II, 8.3% (n = 1548); class III, 4.5% (n = 842); class IV, 2.2% (n = 405); and class V, 1.9% (n = 362). Approximately one-quarter of skin biopsies resulted in diagnoses of melanocytic proliferations. These data provide the first population-based estimates across the spectrum of melanocytic lesions ranging from benign through dysplastic to malignant. These results may serve as a foundation for future

  12. Immunohistochemical expression of tenascin in melanocytic tumours of dogs.

    Science.gov (United States)

    Sevastre, B; van Ederen, A M; Terlou, M; Gruys, E; Nederbragt, H

    2007-01-01

    The aim of this study was to investigate tenascin-C (TN) immunolabelling and labelling for endothelium by von Willebrand Factor (vWF) in melanocytic tumours of dogs as compared with normal tissues, to evaluate the TN distribution in these types of tumours and to investigate whether a relation could be established between TN and angiogenesis in different types of tumour. Samples of normal dog skin (n=8), benign skin melanocytomas (n=10), malignant oral melanomas (n=9) and malignant toe melanomas (n=5) were studied. The percentages of TN and vWF immunolabelling per total microscopical area were analysed by morphometric methods. In normal skin, TN was found at dermo-epidermal junctions, around hair follicles, in the smooth muscles of hair follicles, and in the walls of blood vessels. TN immunolabelling (distribution and intensity) in melanocytomas was comparable with that found in normal skin. In melanomas, TN expression was considerably increased, its intensity in toe melanomas being twice that observed in oral melanomas. The degree of TN immunolabelling was not related to the histological malignancy of the melanomas. In melanomas, TN was found in the connective tissue surrounding the tumour cell nests and in narrow stromal strands inside the tumour. Regions infiltrated with lymphocytes were devoid of TN. The presence of TN around capillaries in melanocytomas and melanomas was investigated by double-immunolabelling (for TN and vWF). The intensity of vWF and TN immunolabelling was higher in melanomas than in melanocytomas, and higher in toe melanomas than in oral melanomas; however, no clear relation between TN expression and immunolabelling for vWF was found.

  13. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  14. Premalignant quiescent melanocytic nevi do not express the MHC class I chain-related protein A

    Directory of Open Access Journals (Sweden)

    Mercedes B. Fuertes

    2011-08-01

    Full Text Available The MHC class I chain-related protein A (MICA is an inducible molecule almost not expressed by normal cells but strongly up-regulated in tumor cells. MICA-expressing cells are recognized by natural killer (NK cells, CD8+ aßTCR and ?dTCR T lymphocytes through the NKG2D receptor. Engagement of NKG2D by MICA triggers IFN-? secretion and cytotoxicity against malignant cells. Although most solid tumors express MICA and this molecule is a target during immune surveillance against tumors, it has been observed that high grade tumors from different histotypes express low amounts of cell surface MICA due to a metalloprotease- induced shedding. Also, melanomas develop after a complex process of neotransformation of normal melanocytes. However, the expression of MICA in premalignant stages (primary human quiescent melanocytic nevi remains unknown. Here, we assessed expression of MICA by flow cytometry using cell suspensions from 15 primary nevi isolated from 11 patients. When collected material was abundant, cell lysates were prepared and MICA expression was also analyzed by Western blot. We observed that MICA was undetectable in the 15 primary nevi (intradermic, junction, mixed, lentigo and congenital samples as well as in normal skin, benign lesions (seborrheic keratosis, premalignant lesions (actinic keratosis and benign basocellular cancer. Conversely, a primary recently diagnosed melanoma showed intense cell surface MICA. We conclude that the onset of MICA expression is a tightly regulated process that occurs after melanocytes trespass the stage of malignant transformation. Thus, analysis of MICA expression in tissue sections of skin samples may constitute a useful marker to differentiate between benign and malignant nevi.

  15. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  16. Multidirectional Vector Excision Leads to Better Outcomes than Traditional Elliptical Excision of Facial Congenital Melanocytic Nevus

    Directory of Open Access Journals (Sweden)

    Seung Il Oh

    2013-09-01

    Full Text Available Background The elliptical excision is the standard method of removing benign skin lesions,such as congenital melanocytic nevi. This technique allows for primary closure, with little to nodog-ear deformity, but may sacrifice normal tissue adjacent to the lesion, resulting in scarswhich are unnecessarily long. This study was designed to compare the predicted results ofelliptical excision with those resulting from our excision technique.Methods Eighty-two patients with congenital melanocytic nevus on the face were prospectivelystudied. Each lesion was examined and an optimal ellipse was designed and marked onthe skin. After an incision on one side of the nevus margin, subcutaneous undermining wasperformed in the appropriate direction. The skin flap was pulled up and approximated alongseveral vectors to minimize the occurrence of dog-ear deformity.Results Overall, the final wound length was 21.1% shorter than that achieved by ellipticalexcision. Only 8.5% of the patients required dog-ear repair. There was no significant distortionof critical facial structures. All of the scars were deemed aesthetically acceptable based ontheir Patient and Observer Scar Assessment Scale scores.Conclusions When compared to elliptical excision, our technique appears to minimize dogeardeformity and decrease the final wound length. This technique should be considered analternative method for excision of facial nevi.

  17. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  18. Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

    International Nuclear Information System (INIS)

    Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

    1982-01-01

    Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

  19. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  20. Melanogenesis in dermal melanocytes of Japanese Silky chicken embryos.

    Science.gov (United States)

    Ortolani-Machado, C F; Freitas, P F; Faraco, C D

    2009-08-01

    The Japanese Silky chicken (SK) shows dermal and visceral hyperpigmentation. This study characterizes ultrastructurally the melanin granules developing in dermal melanocytes of the dorsal skin of SK, in an attempt to better understand the processes of melanogenesis in these permanently ectopic cells. The steps of melanogenesis are similar to those described for epidermal melanocytes, with melanosomes going from stage I to IV but, in SK, the maturation occurs in the cell body, as well as in the cytoplasmic processes. At stage III, the deposition of melanin is cumulative and can aggregate in rounded structures, which combine to turn into the mature granule. The final destiny of mature melanosomes is still unclear, although it was observed that dermal macrophages can accumulate melanin granules in their phagosomes. Even with the close proximity between melanocytes and other dermal cells, the transference of melanosomes was not observed. Our findings indicate that melanogenesis in dermal melanocytes in SK has the same morphological characteristics found in epidermal melanocytes, but the functional aspect still remains to be elucidated.

  1. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Gledhill, Karl; Guo, Zongyou; Umegaki-Arao, Noriko; Higgins, Claire A; Itoh, Munenari; Christiano, Angela M

    2015-01-01

    The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs) present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  2. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Directory of Open Access Journals (Sweden)

    Karl Gledhill

    Full Text Available The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  3. Methylquercetins stimulate melanin biosynthesis in a three-dimensional skin model.

    Science.gov (United States)

    Yamauchi, Kosei; Mitsunaga, Tohru

    2018-03-01

    In a previous study, we found that both synthetic 3-O-methylquercetin (3MQ) and 3,4',7-O-trimethylquercetin (34'7TMQ) increased extracellular melanin content. 34'7TMQ increased the activity of melanogenic enzymes by stimulating the p38 pathway and the expression of microphthalmia-associated transcription factor (MITF). In contrast, 3MQ increased the activity of melanogenic enzymes without the involvement of MITF, which suggests that 3MQ inhibits the degradation of melanogenic enzymes. In the present study, we investigated the effects of 3MQ and 34'7TMQ on melanogenesis in normal human melanocytes and using a commercial three-dimensional (3D) skin model system. Both 3MQ and 34'7TMQ elongated the dendrites of normal human melanocytes from a Caucasian donor, but did not stimulate melanogenesis in the melanocytes. In the 3D skin model, which included melanocytes from an Asian donor, 3MQ and 34'7TMQ increased and elongated the melanocytes and showed a tendency to stimulate melanogenesis. These results suggest that 3MQ and 34'7TMQ could be put to practical use in skin care products and agents aimed at preventing hair graying.

  4. Melanocytic nevi and non-neoplastic hyperpigmentations.

    Science.gov (United States)

    Clemente, C

    2017-06-01

    This is the first of three chapters that will be progressively published on Pathologica as updating activity of the Italian Study Group of Dermatopathology (GISD), Italian Society of Pathology and Cytology (SIAPeC IAP). The first chapter concerns non-neoplastic hyperpigmented skin lesions and nevi, the second will address the topics of dysplastic nevus, borderline and low malignant potential melanocytic proliferations and the third melanoma in its variants and differential diagnoses with a supplement on the immunohistochemistry and molecular support to diagnostic and prognostic definition of nevi and melanomas. Although we believe that great advances were made in the application of ancillary genetic, immunohistochemical and molecular techniques, for the diagnosis and biological characterization of melanocytic tumors the morphology still remains the gold standard. These chapters are not intended as substitutes or even claim to be compared to the numerous and valuable texts that are also recently published, but they want to present, concisely and quickly available, all of those traits that we believe essential to the histopathological evaluation of a melanocytic lesion. No morphological parameter is exclusive and individually sufficient to make the correct diagnosis of nevus or melanoma but to reach a final conclusive and appropriate interpretation a set of morphological characters must be evaluated and compared. I was lucky enough to be able to examine several thousand cases and to draw lessons from each of these increasing my diagnostic experience. I had a great lesson by my teacher and good friend Prof. Martin C. Mihm Jr of Boston, dermato-pathologist with undisputed international reputation, who, with great passion, patience and friendship, transferred me much of his experience and knowledge and for which I always thank him. Special thanks I would like to address Dr. Agostino Crupi, dermatologist, skin-oncologist and brilliant dermatoscopist who taught me how the

  5. UVA phototransduction drives early melanin synthesis in human melanocytes.

    Science.gov (United States)

    Wicks, Nadine L; Chan, Jason W; Najera, Julia A; Ciriello, Jonathan M; Oancea, Elena

    2011-11-22

    Exposure of human skin to solar ultraviolet radiation (UVR), a powerful carcinogen [1] comprising ~95% ultraviolet A (UVA) and ~5% ultraviolet B (UVB) at the Earth's surface, promotes melanin synthesis in epidermal melanocytes [2, 3], which protects skin from DNA damage [4, 5]. UVB causes DNA lesions [6] that lead to transcriptional activation of melanin-producing enzymes, resulting in delayed skin pigmentation within days [7]. In contrast, UVA causes primarily oxidative damage [8] and leads to immediate pigment darkening (IPD) within minutes, via an unknown mechanism [9, 10]. No receptor protein directly mediating phototransduction in skin has been identified. Here we demonstrate that exposure of primary human epidermal melanocytes (HEMs) to UVA causes calcium mobilization and early melanin synthesis. Calcium responses were abolished by treatment with G protein or phospholipase C (PLC) inhibitors or by depletion of intracellular calcium stores. We show that the visual photopigment rhodopsin [11] is expressed in HEMs and contributes to UVR phototransduction. Upon UVR exposure, significant melanin production was measured within one hour; cellular melanin continued to increase in a retinal- and calcium-dependent manner up to 5-fold after 24 hr. Our findings identify a novel UVA-sensitive signaling pathway in melanocytes that leads to calcium mobilization and melanin synthesis and may underlie the mechanism of IPD in human skin. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  7. The slaty mutation affects the morphology and maturation of melanosomes in the mouse melanocytes.

    Science.gov (United States)

    Hirobe, Tomohisa; Abe, Hiroyuki

    2006-10-01

    The slaty (Dct(slt)) mutation is known to reduce the activity of dopachrome tautomerase in melanocytes and to reduce the melanin content in skin, hairs and eyes. Although the melanosomes in slaty melanocytes are reported to be eumelanosome-like, detailed melanosome biogenesis is not well studied. To address this point, melanosomes in neonatal epidermal melanocytes from wild-type (Dct+/Dct+) mice at the slaty locus as well as its congenic mouse mutant (Dct(slt)/Dct(slt)) in serum-free primary culture were observed under the electron microscope. Wild-type melanocytes possessed exclusively elliptical melanosomes with internal longitudinal structures, whereas in mutant melanocytes, numerous spherical melanosomes with globular depositions of pigment and elliptical melanosomes as well as mixed type of the two melanosomes were observed. Mature stage IV melanosomes were greatly decreased in mutant melanocytes, whereas immature stage III melanosomes were more numerous than in wild-type melanocytes. These results suggest that the slaty mutation affects the morphology and maturation of melanosomes in mouse melanocytes.

  8. The relationship between Na+/H+ exchanger expression and tyrosinase activity in human melanocytes

    International Nuclear Information System (INIS)

    Smith, Dustin R.; Spaulding, Deborah T.; Glenn, Hayden M.; Fuller, Bryan B.

    2004-01-01

    The activity of melanosome-associated tyrosinase in human melanocytes differs based on racial skin type. In melanocytes from Black skin, tyrosinase activity is high while in White melanocytes the activity of the enzyme is low. Recent studies suggest that low tyrosinase activity in White melanocytes may be due to an acidic pH environment within the melanosome. Because sodium/hydrogen (Na + /H + ) exchangers (NHEs) are known to regulate intracellular pH, melanocytes were treated with NHE inhibitors to determine what effect this inhibition might have on tyrosinase activity. Treatment of Black melanocytes with ethyl-isopropyl amiloride (EIPA) caused a rapid dose-dependent inhibition of tyrosinase activity. This inhibition was not due to either direct enzyme inhibition or to a decrease in tyrosinase abundance. In contrast, treatment of White melanocytes with EIPA, cimetidine, or clonidine resulted in little inhibition of tyrosinase activity. Reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blot analysis showed that both Black and White melanocytes expressed mRNA and protein for NHE-1, NHE-3, NHE-5, NHE-6, and NHE-7. Immunohistochemical analysis showed that NHE-7 and NHE-3 co-localized with the melanosomal protein, Tyrosinase Related Protein-1 (TRP-1). In addition, the vesicular proton pump, vesicular ATPase (V-ATPase), was found to be present in both White and Black melanosomes, indicating that organelles from both racial skin types are capable of being acidified. The results suggest that one or more NHEs may help regulate melanosome pH and tyrosinase activity in human melanocytes

  9. PREFERENTIAL SECRETION OF INDUCIBLE HSP70 BY VITILIGO MELANOCYTES UNDER STRESS

    Science.gov (United States)

    Mosenson, Jeffrey A.; Flood, Kelsey; Klarquist, Jared; Eby, Jonathan M.; Koshoffer, Amy; Boissy, Raymond E.; Overbeck, Andreas; C.Tung, Rebecca; Poole, I. Caroline Le

    2014-01-01

    SUMMARY Inducible HSP70 (HSP70i) chaperones peptides from stressed cells, protecting them from apoptosis. Upon extracellular release, HSP70i serves an adjuvant function, enhancing immune responses to bound peptides. We questioned whether HSP70i differentially protects control and vitiligo melanocytes from stress and subsequent immune responses. We compared expression of HSP70i in skin samples, evaluated the viability of primary vitiligo and control melanocytes exposed to bleaching phenols, and measured secreted HSP70i. We determined whether HSP70i traffics to melanosomes to contact immunogenic proteins by cell fractionation, western blotting, electron microscopy and confocal microscopy. Viability of vitiligo and control melanocytes was equally affected under stress. However, vitiligo melanocytes secreted increased amounts of HSP70i in response to MBEH, corroborating with aberrant HSP70i expression in patient skin. Intracellular HSP70i colocalized with melanosomes, and more so in response to MBEH in vitiligo melanocytes. Thus whereas either agent is cytotoxic to melanocytes, MBEH preferentially induces immune responses to melanocytes. PMID:24354861

  10. Isolation and culture of melanocytes from the arctic fox (Alopex lagopus

    Directory of Open Access Journals (Sweden)

    Jiarong Bao

    2015-09-01

    Full Text Available Coat colour is a phenotypic marker of fur animal species, which was determined by the pigment generated from melanocytes. In this study, we developed and validated a method for isolation, purification and passage culture of melanocytes from the arctic fox (Alopex lagopus. Skin biopsies were harvested from the dorsal region of adult foxes and enzyme digestion by Dispase II. The primary culture of melanocytes from arctic fox skin was obtained by using keratinocyte serum-free medium supplemented with epidermal growth factor and bovine pituitary extract with/without phorbol- 12-myristate-13-acetate, and by carrying out a medium change strategy. After serial passages, it yielded pure population of melanocytes, which become efficient tools for investigating the function of colour genes and unraveling the process of melanin synthesis.

  11. Coat-sleeve type giant congenital melanocytic nevus with intraoral blue nevus: A rare case report

    Directory of Open Access Journals (Sweden)

    Lata M Kale

    2017-01-01

    Full Text Available Congenital melanocytic nevi (CMN are visible hyperpigmented (melanocytic, benign, tumor like proliferations in the skin resulting from faulty development of pigment cell precursors in the embryo, and are composed of an abnormal mixture of skin elements. Giant congenital melanocytic nevus (GCMN is usually defined as a melanocytic lesion present at birth that will reach a larger size in adulthood. GCMN is a rare variety of CMN which is characterized by its size (diameter ≥20 cm and the potential for malignant transformation. It is infrequently associated with other findings, which makes the clinical picture complex. In this case, we report a rare association of GCMN with intraoral blue nevus in a 24-year-old male patient.

  12. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

    Science.gov (United States)

    Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

    2013-12-15

    The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

  13. Automatic Classification of Specific Melanocytic Lesions Using Artificial Intelligence

    Directory of Open Access Journals (Sweden)

    Joanna Jaworek-Korjakowska

    2016-01-01

    Full Text Available Background. Given its propensity to metastasize, and lack of effective therapies for most patients with advanced disease, early detection of melanoma is a clinical imperative. Different computer-aided diagnosis (CAD systems have been proposed to increase the specificity and sensitivity of melanoma detection. Although such computer programs are developed for different diagnostic algorithms, to the best of our knowledge, a system to classify different melanocytic lesions has not been proposed yet. Method. In this research we present a new approach to the classification of melanocytic lesions. This work is focused not only on categorization of skin lesions as benign or malignant but also on specifying the exact type of a skin lesion including melanoma, Clark nevus, Spitz/Reed nevus, and blue nevus. The proposed automatic algorithm contains the following steps: image enhancement, lesion segmentation, feature extraction, and selection as well as classification. Results. The algorithm has been tested on 300 dermoscopic images and achieved accuracy of 92% indicating that the proposed approach classified most of the melanocytic lesions correctly. Conclusions. A proposed system can not only help to precisely diagnose the type of the skin mole but also decrease the amount of biopsies and reduce the morbidity related to skin lesion excision.

  14. Automatic Classification of Specific Melanocytic Lesions Using Artificial Intelligence.

    Science.gov (United States)

    Jaworek-Korjakowska, Joanna; Kłeczek, Paweł

    2016-01-01

    Given its propensity to metastasize, and lack of effective therapies for most patients with advanced disease, early detection of melanoma is a clinical imperative. Different computer-aided diagnosis (CAD) systems have been proposed to increase the specificity and sensitivity of melanoma detection. Although such computer programs are developed for different diagnostic algorithms, to the best of our knowledge, a system to classify different melanocytic lesions has not been proposed yet. In this research we present a new approach to the classification of melanocytic lesions. This work is focused not only on categorization of skin lesions as benign or malignant but also on specifying the exact type of a skin lesion including melanoma, Clark nevus, Spitz/Reed nevus, and blue nevus. The proposed automatic algorithm contains the following steps: image enhancement, lesion segmentation, feature extraction, and selection as well as classification. The algorithm has been tested on 300 dermoscopic images and achieved accuracy of 92% indicating that the proposed approach classified most of the melanocytic lesions correctly. A proposed system can not only help to precisely diagnose the type of the skin mole but also decrease the amount of biopsies and reduce the morbidity related to skin lesion excision.

  15. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  16. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  17. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  18. Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

    Science.gov (United States)

    Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

    2012-10-01

    An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

  19. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  20. Childhood malignant blue nevus of the ear associated with two intracranial melanocytic tumors-metastases or neurocutaneous melanosis?

    Science.gov (United States)

    Popović, Mara; Dolenc-Strazar, Zvezdana; Anzic, Jozica; Luzar, Bostjan

    2004-10-01

    Blue nevus is an uncommon pigmented tumor of dermal melanocytes that has traditionally been classified into common and cellular variant. It is usually a skin tumor in adults but can become apparent in early childhood or even be present at birth. Malignant blue nevus is a rare melanocytic tumor of the skin arising from a preexisting cellular blue nevus. We report a multinodular blue nevus of the left ear in an 11-year-old girl who also had 2 intracranial melanocytic lesions. Differential diagnosis between metastases from malignant blue nevus and neurocutaneous melanosis is discussed.

  1. Bilateral diffuse uveal melanocytic proliferation

    DEFF Research Database (Denmark)

    Klemp, Kristian; Kiilgaard, Jens Folke; Heegaard, Steffen

    2017-01-01

    cataract formation and uveal melanocytic tumours. The awareness and documentation of BDUMP has increased during the past decade, and the increasing amount of data collected demonstrates the effect of treatment with plasmapheresis and the value of diagnostic tools in BDUMP such as genetic and immunologic...

  2. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  3. Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)

    2011-06-15

    We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.

  4. Melanocyte pigmentation inversely correlates with MCP-1 production and angiogenesis-inducing potential.

    Science.gov (United States)

    Adini, Irit; Adini, Avner; Bazinet, Lauren; Watnick, Randolph S; Bielenberg, Diane R; D'Amato, Robert J

    2015-02-01

    The incidence of certain angiogenesis-dependent diseases is higher in Caucasians than in African Americans. Angiogenesis is amplified in wound healing and cornea models in albino C57 mice compared with black C57 mice. Moreover, mouse and human melanocytes with low pigmentation stimulate endothelial cell (EC) proliferation and migration in vitro more than melanocytes with high pigmentation. This effect is due, in part, to the secretion of an angiogenic protein called fibromodulin (FMOD) from lowly pigmented melanocytes. Herein, we expand upon the mechanism contributing to increased angiogenesis in lighter skin and report that monocyte chemotactic protein-1 (MCP-1) is secreted by nonpigmented mouse melanocytes by 5- to 10-fold more than pigmented melanocytes. MCP-1 protein stimulates EC proliferation and migration in vitro and angiogenesis in vivo. Mechanistic studies determine that FMOD is upstream of MCP-1 and promotes its secretion from both melanocytes and activated ECs via stimulation of NF-κB activity. Mice injected with FMOD-neutralizing antibodies show 2.3-fold decreased levels of circulating MCP-1. Human studies confirmed that, on average, Caucasians have 2-fold higher serum levels of MCP-1 than African Americans. Taken together, this study implicates the FMOD/MCP-1 pathway in the regulation of angiogenesis by local melanocytes and suggests that melanogenic activity may protect against aberrant angiogenic diseases. © FASEB.

  5. The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

    Science.gov (United States)

    Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

    2017-07-01

    Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  7. Altered expression of versican and hyaluronan in melanocytic tumors of dogs.

    Science.gov (United States)

    Docampo, María-José; Rabanal, Rosa M; Miquel-Serra, Laia; Hernández, Daniel; Domenzain, Clelia; Bassols, Anna

    2007-12-01

    To analyze the expression of versican and hyaluronan in melanocytomas and malignant melanomas of dogs, to correlate their expression with expression of the hyaluronan receptor CD44, and to identify enzymes responsible for the synthesis and degradation of hyaluronan in canine dermal fibroblasts and canine melanoma cell lines. 35 biopsy specimens from melanocytic tumors of dogs, canine primary dermal fibroblasts, and 3 canine melanoma cell lines. Versican, hyaluronan, and CD44 were detected in tumor samples by use of histochemical or immunohistochemical methods. Expression of hyaluronan-metabolizing enzymes was analyzed with a reverse transcriptase-PCR assay. Versican was found only in some hair follicles and around some blood vessels in normal canine skin, whereas hyaluronan was primarily found within the dermis. Hyaluronan was found in connective tissue of the oral mucosa. Versican and, to a lesser extent, hyaluronan were significantly overexpressed in malignant melanomas, compared with expression in melanocytomas. No significant difference was found between malignant tumors from oral or cutaneous origin. The expression of both molecules was correlated, but hyaluronan had a more extensive distribution than versican. Versican and hyaluronan were mainly associated with tumor stroma. Canine fibroblasts and melanoma cell lines expressed hyaluronan synthase 2 and 3 (but not 1) and hyaluronidase 1 and 2. Versican may be useful as a diagnostic marker for melanocytic tumors in dogs. Knowledge of the enzymes involved in hyaluronan metabolism could reveal new potential therapeutic targets.

  8. Increased expression of enhancer of Zeste Homolog 2 (EZH2) differentiates squamous cell carcinoma from normal skin and actinic keratosis.

    Science.gov (United States)

    Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi

    2014-01-01

    Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.

  9. Grafting Of Autologous Non-Cultured Melanocytes For The Treatment Of Vitiligo : A Pilot Study

    Directory of Open Access Journals (Sweden)

    kumar Sudhir

    2003-01-01

    Full Text Available Vitiligo is a common, often heritable, acquired disorder. Although vitiligo does not cause any physical problem but it surely is a psychosocial disaster. Depigmented patches resistant to medical treatment need to be managed surgically. Surgically. Surgical procedures usually performed lead to unsatisfactory results and that too at the cost of scarring of normal donor site. Here we describe our experience with grafting of non-cultured autologous melanocytes, which is not associated with any scarring. We tried this method in 16 lesions in 8 patients of stable vitiligo. Due to its advantages, like no scarring at recipient sites, ability to re-pigment large area with small piece of skin graft, simplicity and feasibility in Indian conditions, this is a good alternative in the treatment of vitiligo.

  10. Giant melanocytic nevus with malignant melanoma: a rare disorder in a black African child.

    Science.gov (United States)

    Katibi, Oludolapo Sherifat; Ogunbiyi, Adebola; Brown, Biobele Jotham; Adeyemi, Oyedeji Oladele

    2014-10-01

    Giant congenital melanocytic nevus (GCMN) is rare in babies of African descent. Unfortunately, it has an increased potential for malignant transformation. A 3-year-old female child presented with a 6-month history of multiple nodules on an existing giant congenital melanocytic nevus and swelling in the right axilla of four weeks duration. Skin biopsy of the nodular skin lesions was in keeping with a metastatic malignant melanoma (Clark stage 4). She completed a full course of chemotherapy but subsequently died four months after presentation. Patients with large GCMN should be counseled and followed up appropriately to improve and prolong life. © 2014 The International Society of Dermatology.

  11. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  12. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

    2011-01-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  13. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  14. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  15. Ocular Albinism Type 1 Regulates Melanogenesis in Mouse Melanocytes

    Directory of Open Access Journals (Sweden)

    Tianzhi Chen

    2016-09-01

    Full Text Available To investigate whether ocular albinism type 1 (OA1 is differentially expressed in the skin of mice with different coat colors and to determine its correlation with coat color establishment in mouse, the expression patterns and tissue distribution characterization of OA1 in the skin of mice with different coat colors were qualitatively and quantitatively analyzed by real-time quantitative PCR (qRT-PCR, immunofluorescence staining and Western blot. The qRT-PCR analysis revealed that OA1 mRNA was expressed in all mice skin samples tested, with the highest expression level in brown skin, a moderate expression level in black skin and the lowest expression level in gray skin. Positive OA1 protein bands were also detected in all skin samples by Western blot analysis. The relative expression levels of OA1 protein in both black and brown skin were significantly higher than that in gray skin, but there was no significant difference between black and brown mice. Immunofluorescence assays revealed that OA1 was mainly expressed in the hair follicle matrix, the inner and outer root sheath in the skin tissues with different coat colors. To get further insight into the important role of OA1 in the melanocytes’ pigmentation, we transfected the OA1 into mouse melanocytes and then detected the relative expression levels of pigmentation-related gene. Simultaneously, we tested the melanin content of melanocytes. As a result, the overexpression of OA1 significantly increased the expression levels of microphthalmia-associated transcription factor (MITF, tyrosinase (TYR, tyrosinase-related protein 1 (TRP1 and premelanosome protein (PMEL. However, the tyrosinase-related protein 2 (TRP2 level was attenuated. By contrast, the level of glycoprotein non-metastatic melanoma protein b (GPNMB was unaffected by OA1 overexpression. Furthermore, we observed a significant increase in melanin content in mouse melanocyte transfected OA1. Therefore, we propose that OA1 may

  16. High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

    Science.gov (United States)

    Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

    2016-09-01

    Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Determination of the optical properties of melanin-pigmented human skin equivalents using terahertz time-domain spectroscopy

    Science.gov (United States)

    Lipscomb, Dawn; Echchgadda, Ibtissam; Peralta, Xomalin G.; Wilmink, Gerald J.

    2013-02-01

    Terahertz time-domain spectroscopy (THz-TDS) methods have been utilized in previous studies in order to characterize the optical properties of skin and its primary constituents (i.e., water, collagen, and keratin). However, similar experiments have not yet been performed to investigate whether melanocytes and the melanin pigment that they synthesize contribute to skin's optical properties. In this study, we used THz-TDS methods operating in transmission geometry to measure the optical properties of in vitro human skin equivalents with or without normal human melanocytes. Skin equivalents were cultured for three weeks to promote gradual melanogenesis, and THz time domain data were collected at various time intervals. Frequency-domain analysis techniques were performed to determine the index of refraction (n) and absorption coefficient (μa) for each skin sample over the frequency range of 0.1-2.0 THz. We found that for all samples as frequency increased, n decreased exponentially and the μa increased linearly. Additionally, we observed that skin samples with higher levels of melanin exhibited greater n and μa values than the non-pigmented samples. Our results indicate that melanocytes and the degree of melanin pigmentation contribute in an appreciable manner to the skin's optical properties. Future studies will be performed to examine whether these contributions are observed in human skin in vivo.

  18. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  19. Tranexamic acid suppresses ultraviolet B eye irradiation-induced melanocyte activation by decreasing the levels of prohormone convertase 2 and alpha-melanocyte-stimulating hormone.

    Science.gov (United States)

    Hiramoto, Keiichi; Yamate, Yurika; Sugiyama, Daijiro; Takahashi, Yumi; Mafune, Eiichi

    2014-12-01

    Tranexamic acid (trans-4-aminomethylcyclohexanecarboxylic acid) is a medicinal amino acid used in skin whitening care. This study examined the effects of tranexamic acid on the melanocyte activation of the skin induced by an ultraviolet (UV) B eye irradiation. The eye or ear was locally exposed to UVB at a dose of 1.0 kJ/m(2) using a 20SE sunlamp after covering the remaining body surface with aluminum foil. UVB eye irradiation induced melanocyte activation of the skin, similar to that observed following UVB ear irradiation, which was suppressed by the administration of tranexamic acid treatment. The plasma α-melanocyte-stimulating hormone (α-MSH) content was increased by UVB irradiation of the eye; however, the increase in α-MSH was suppressed by tranexamic acid treatment. In addition, UVB eye irradiation induced the up-regulation of prohormone convertase (PC) 2 in the pituitary gland. Meanwhile, the increase in PC2 induced by UVB eye irradiation was suppressed by tranexamic acid treatment. These results clearly indicate that tranexamic acid decreases the expression of PC2, which cleavages from proopiomelanocortin to α-MSH in the pituitary gland, thereby suppressing melanocyte activation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  1. Melanoma and melanocytic nevi in decorative tattoos: three case reports.

    Science.gov (United States)

    Varga, Erika; Korom, Irma; Varga, János; Kohán, József; Kemény, Lajos; Oláh, Judit

    2011-12-01

    In response to the demands of style and fashion, the number of decorative tattoos has been increasing worldwide. This has been paralleled by a rising incidence of melanocytic proliferations, including melanoma. The coincidence of various dermatological diseases and skin tumors with tattoos has been documented with some frequency, but reports of melanoma associated with tattoos are exceedingly rare. To date, only 13 cases have been documented in the English language literature. The possibility of an association between melanocytic proliferations and tattoos remains an area for further study. This report presents two cases of melanocytic nevi and one of melanoma occurring in association with a decorative tattoos. At present, the pathogenesis of melanoma developing in a tattoo is unknown. Mere coincidence cannot be ruled out. However, trauma, ultraviolet light exposure, a photoallergic effect, or an inflammatory reaction may promote malignant transformation. Clinicians and histopathologists should be aware of the clinical and pathological features if they are to make a correct diagnosis. Copyright © 2011 John Wiley & Sons A/S.

  2. Influence of low-energy laser radiation on normal skin and certain tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Pletnev, S.D.; Karpenko, O.M.

    For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

  3. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  4. A reporter mouse model for in vivo tracing and in vitro molecular studies of melanocytic lineage cells and their diseases.

    Science.gov (United States)

    Crawford, Melissa; Leclerc, Valerie; Dagnino, Lina

    2017-08-15

    Alterations in melanocytic lineage cells give rise to a plethora of distinct human diseases, including neurocristopathies, cutaneous pigmentation disorders, loss of vision and hearing, and melanoma. Understanding the ontogeny and biology of melanocytic cells, as well as how they interact with their surrounding environment, are key steps in the development of therapies for diseases that involve this cell lineage. Efforts to culture and characterize primary melanocytes from normal or genetically engineered mouse models have at times yielded contrasting observations. This is due, in part, to differences in the conditions used to isolate, purify and culture these cells in individual studies. By breeding ROSA mT/mG and Tyr::CreER T2 mice, we generated animals in which melanocytic lineage cells are identified through expression of green fluorescent protein. We also used defined conditions to systematically investigate the proliferation and migration responses of primary melanocytes on various extracellular matrix (ECM) substrates. Under our culture conditions, mouse melanocytes exhibit doubling times in the range of 10 days, and retain exponential proliferative capacity for 50-60 days. In culture, these melanocytes showed distinct responses to different ECM substrates. Specifically, laminin-332 promoted cell spreading, formation of dendrites, random motility and directional migration. In contrast, low or intermediate concentrations of collagen I promoted adhesion and acquisition of a bipolar morphology, and interfered with melanocyte forward movements. Our systematic evaluation of primary melanocyte responses emphasizes the importance of clearly defining culture conditions for these cells. This, in turn, is essential for the interpretation of melanocyte responses to extracellular cues and to understand the molecular basis of disorders involving the melanocytic cell lineage. © 2017. Published by The Company of Biologists Ltd.

  5. A reporter mouse model for in vivo tracing and in vitro molecular studies of melanocytic lineage cells and their diseases

    Directory of Open Access Journals (Sweden)

    Melissa Crawford

    2017-08-01

    Full Text Available Alterations in melanocytic lineage cells give rise to a plethora of distinct human diseases, including neurocristopathies, cutaneous pigmentation disorders, loss of vision and hearing, and melanoma. Understanding the ontogeny and biology of melanocytic cells, as well as how they interact with their surrounding environment, are key steps in the development of therapies for diseases that involve this cell lineage. Efforts to culture and characterize primary melanocytes from normal or genetically engineered mouse models have at times yielded contrasting observations. This is due, in part, to differences in the conditions used to isolate, purify and culture these cells in individual studies. By breeding ROSAmT/mG and Tyr::CreERT2 mice, we generated animals in which melanocytic lineage cells are identified through expression of green fluorescent protein. We also used defined conditions to systematically investigate the proliferation and migration responses of primary melanocytes on various extracellular matrix (ECM substrates. Under our culture conditions, mouse melanocytes exhibit doubling times in the range of 10 days, and retain exponential proliferative capacity for 50-60 days. In culture, these melanocytes showed distinct responses to different ECM substrates. Specifically, laminin-332 promoted cell spreading, formation of dendrites, random motility and directional migration. In contrast, low or intermediate concentrations of collagen I promoted adhesion and acquisition of a bipolar morphology, and interfered with melanocyte forward movements. Our systematic evaluation of primary melanocyte responses emphasizes the importance of clearly defining culture conditions for these cells. This, in turn, is essential for the interpretation of melanocyte responses to extracellular cues and to understand the molecular basis of disorders involving the melanocytic cell lineage.

  6. Ultraviolet radiation directly induces pigment production by cultured human melanocytes

    International Nuclear Information System (INIS)

    Friedmann, P.S.; Gilchrest, B.A.

    1987-01-01

    In humans the major stimulus for cutaneous pigmentation is ultraviolet radiation (UVR). Little is known about the mechanism underlying this response, in part because of the complexity of interactions in whole epidermis. Using a recently developed culture system, human melanocytes were exposed daily to a physiologic range of UVR doses from a solar simulator. Responses were determined 24 hours after the last exposure. There was a dose-related increase in melanin content per cell and uptake of 14 C-DOPA, accompanied by growth inhibition. Cells from donors of different racial origin gave proportionately similar increases in melanin, although there were approximately tenfold differences in basal values. Light and electron microscopy revealed UVR-stimulated increases in dendricity as well as melanosome number and degree of melanization, analogous to the well-recognized melanocyte changes following sun exposure of intact skin. Similar responses were seen with Cloudman S91 melanoma cells, although this murine cell line required lower UVR dosages and fewer exposures for maximal stimulation. These data establish that UVR is capable of directly stimulating melanogenesis. Because cyclic AMP elevation has been associated in some settings with increased pigment production by cultured melanocytes, preliminary experiments were conducted to see if the effects of UVR were mediated by cAMP. Both alpha-MSH and isobutylmethylxanthine (IBMX), as positive controls, caused a fourfold increase in cAMP level in human melanocytes and/or S91 cells, but following a dose of UVR sufficient to stimulate pigment production there was no change in cAMP level up to 4 hours after exposure. Thus, it appears that the UVR-induced melanogenesis is mediated by cAMP-independent mechanisms

  7. (Pheo)melanin photosensitizes UVA-induced DNA damage in cultured human melanocytes

    NARCIS (Netherlands)

    Wenczl, E.; Schans, G.P. van der; Roza, L.; Kolb, R.M.; Timmerman, A.J.; Smit, N.P.M.; Pavel, S.; Schothorst, A.A.

    1998-01-01

    The question of whether melanins are photoprotecting and/or photosensitizing in human skin cells continues to be debated. To evaluate the role of melanin upon UVA irradiation, DNA single-strand breaks (ssb) were measured in human melanocytes differing only in the amount of pigment produced by

  8. Prehistological evaluation of benign and malignant pigmented skin lesions with optical computed tomography

    Science.gov (United States)

    Kokolakis, Athanasios; Zacharakis, Giannis; Krasagakis, Konstantin; Lasithiotakis, Konstantinos; Favicchio, Rosy; Spiliopoulos, George; Giannikaki, Elpida; Ripoll, Jorge; Tosca, Androniki

    2012-06-01

    Discrimination of benign and malignant melanocytic lesions is a major issue in clinical dermatology. Assessment of the thickness of melanoma is critical for prognosis and treatment selection. We aimed to evaluate a novel optical computed tomography (optical-CT) system as a tool for three-dimensional (3-D) imaging of melanocytic lesions and its ability to discriminate benign from malignant melanocytic lesions while simultaneously determining the thickness of invasive melanoma. Seventeen melanocytic lesions, one hemangioma, and normal skin were assessed immediately after their excision by optical-CT and subsequently underwent histopathological examination. Tomographic reconstructions were performed with a back-propagation algorithm calculating a 3-D map of the total attenuation coefficient (AC). There was a statistically significant difference between melanomas, dysplastic nevi, and non-dysplastic nevi, as indicated by Kruskal-Wallis test. Median AC values were higher for melanomas compared with dysplastic and non-dysplastic nevi. No statistically significant difference was observed when thickness values obtained by optical-CT were compared with histological thickness using a Wilcoxon sighed rank test. Our results suggest that optical-CT can be important for the immediate prehistological evaluation of biopsies, assisting the physician for a rapid assessment of malignancy and of the thickness of a melanocytic lesion.

  9. Demonstration of tyrosinase in the vitiligo skin of human beings by a sensitive fluorometric method as well as by 14C(U)-L-tyrosine incorporation into melanin

    International Nuclear Information System (INIS)

    Husain, I.; Vijayan, E.; Ramaiah, A.; Pasricha, J.S.; Madan, N.C.

    1982-01-01

    Tyrosinase activity (Monophenol, dihydroxyphenylalanine: oxygen oxidoreductase EC 1.14.18.1) in vitiligo and normal epidermal homogenates of skin from human beings was measured by estimating beta 3,4-dihydroxyphenylalanine (dopa) by a highly sensitive fluorometric method described in this paper. The tyrosine activity in the vitiligo skin was about 4 to 37% of corresponding normal skin. The activity of tyrosinase in normal human skin from different individuals and from different regions of the body was in the range of 4 to 140 picomoles of beta 3,4-dihydroxyphenylalanine formed per min/mg protein of epidermal homogenate. The enzyme from vitiligo and normal skin was severely inhibited by substance(s) of low molecular weight. The enzyme exhibits a lag of about 4 hr in the absence of added beta 3,4-dihydroxyphenylalanine and 1 hr in presence of 5 microM dopa. Tyrosinase from the normal and vitiligo skin was inhibited by excess concentration of tyrosine. The homogenates from vitiligo skin could synthesize melanin from C14(U)-L-Tyrosine. The rate of tyrosine incorporation into melanin by the epidermal homogenates is increased by 3,4-dihydroxyphenylalanine (dopa) disproportionate to its effect on tyrosinase activity. Based on the data presented in this paper it is concluded that melanocytes are present in the vitiligo skin. A tentative hypothesis is put forward to explain the lack of melanin synthesis by the vitiligo skin under in vivo conditions, although melanocytes are present

  10. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  11. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  12. Effect of nicotine on melanogenesis and antioxidant status in HEMn-LP melanocytes

    International Nuclear Information System (INIS)

    Delijewski, Marcin; Beberok, Artur; Otręba, Michał; Wrześniok, Dorota; Rok, Jakub; Buszman, Ewa

    2014-01-01

    Nicotine is a natural ingredient of tobacco plants and is responsible for the addictive properties of tobacco. Nowadays nicotine is also commonly used as a form of smoking cessation therapy. It is suggested that nicotine may be accumulated in human tissues containing melanin. This may in turn affect biochemical processes in human cells producing melanin. The aim of this study was to examine the effect of nicotine on melanogenesis and antioxidant status in cultured normal human melanocytes HEMn-LP. Nicotine induced concentration-dependent loss in melanocytes viability. The value of EC 50 was determined to be 7.43 mM. Nicotine inhibited a melanization process in human light pigmented melanocytes and caused alterations of antioxidant defense system. Significant changes in cellular antioxidant enzymes: superoxide dismutase and catalase activities and in hydrogen peroxide content were stated. The obtained results may explain a potential influence of nicotine on biochemical processes in melanocytes in vivo during long term exposition to nicotine. - Graphical abstract: Nicotine inhibits melanogenesis and induces oxidative stress in HEMn-LP melanocytes. - Highlights: • Nicotine induces concentration-dependent loss in melanocytes viability. • Nicotine in non-cytotoxic concentrations inhibits melanogenesis. • Nicotine in higher concentrations induces oxidative stress

  13. Effect of nicotine on melanogenesis and antioxidant status in HEMn-LP melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Delijewski, Marcin; Beberok, Artur; Otręba, Michał; Wrześniok, Dorota; Rok, Jakub; Buszman, Ewa, E-mail: ebuszman@sum.edu.pl

    2014-10-15

    Nicotine is a natural ingredient of tobacco plants and is responsible for the addictive properties of tobacco. Nowadays nicotine is also commonly used as a form of smoking cessation therapy. It is suggested that nicotine may be accumulated in human tissues containing melanin. This may in turn affect biochemical processes in human cells producing melanin. The aim of this study was to examine the effect of nicotine on melanogenesis and antioxidant status in cultured normal human melanocytes HEMn-LP. Nicotine induced concentration-dependent loss in melanocytes viability. The value of EC{sub 50} was determined to be 7.43 mM. Nicotine inhibited a melanization process in human light pigmented melanocytes and caused alterations of antioxidant defense system. Significant changes in cellular antioxidant enzymes: superoxide dismutase and catalase activities and in hydrogen peroxide content were stated. The obtained results may explain a potential influence of nicotine on biochemical processes in melanocytes in vivo during long term exposition to nicotine. - Graphical abstract: Nicotine inhibits melanogenesis and induces oxidative stress in HEMn-LP melanocytes. - Highlights: • Nicotine induces concentration-dependent loss in melanocytes viability. • Nicotine in non-cytotoxic concentrations inhibits melanogenesis. • Nicotine in higher concentrations induces oxidative stress.

  14. Transcriptome Analysis Reveals Markers of Aberrantly Activated Innate Immunity in Vitiligo Lesional and Non-Lesional Skin

    Science.gov (United States)

    Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen

    2012-01-01

    Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting

  15. Giant Congenital Melanocytic Naevi: review of literature

    Directory of Open Access Journals (Sweden)

    A. Marchesi

    2012-04-01

    Full Text Available giant congenital pigmented naevi is a great reconstructive challenge for the pediatric and plastic surgeons. due to the increased risk of malignant transformation in such lesions, many procedures have been used to remove giant congenital naevi like dermoabrasion, laser treatment or surgical excision combined with reconstruction through skin expansion or skin grafting; among these, only a complete excision can offer an efficacious treatment. in our centre we use the “tissue expansion” technique in order to achieve a sufficient quantity of normal skin to perform a both staged and radical excision of these giant lesions.

  16. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

  17. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  18. The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

    Science.gov (United States)

    Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

    2011-04-01

    The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  19. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  20. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  1. Agreement Between Cytology and Histopathology for Regional Lymph Node Metastasis in Dogs With Melanocytic Neoplasms.

    Science.gov (United States)

    Grimes, Janet A; Matz, Brad M; Christopherson, Pete W; Koehler, Jey W; Cappelle, Kelsey K; Hlusko, Katelyn C; Smith, Annette

    2017-07-01

    Melanocytic neoplasms are common in dogs and frequently occur within the oral cavity or in haired skin. The behavior of melanocytic neoplasms is variable and depends on tumor location, size, and histopathologic features. This study compared cytopathology and histopathology of 32 lymph nodes from 27 dogs diagnosed with melanocytic neoplasms. Agreement between the original cytology report, cytology slide review, original histopathology report, and histopathology slide review was determined for each lymph node. A subset of lymph nodes was subjected to immunohistochemistry (Melan-A) and additional histochemical stains/techniques (Prussian blue, bleach) to assist in differentiation of melanocytes and melanophages. Agreement ranged from slight to fair for each of the variables evaluated with weighted kappa (κ w ) or kappa (κ) analysis (original cytology vs cytology review κ w = 0.24; original cytology vs original histopathology κ w = 0.007; original cytology vs histopathology review κ w = 0.23; cytology review vs original histopathology κ w = 0.008; cytology review vs histopathology review κ w = 0.006; and original histopathology vs histopathology review κ = 0.18). The diagnoses (metastatic, equivocal, or negative for metastasis) of the original report and slide review for both cytology and histopathology were not significantly correlated with survival in this population of patients. Overall, agreement between cytology and histopathology was poor even with a single clinical or anatomic pathologist performing slide review. Consensus between routine cytology and histopathology for staging of lymph nodes in patients with melanocytic neoplasms is poor and does not correlate with survival.

  2. Conjunctival Melanocytic Tumors-New Developments

    Directory of Open Access Journals (Sweden)

    Hülya Gökmen Soysal

    2014-09-01

    Full Text Available Melanocytic lesions of the conjunctiva represent a wide spectrum of tumors that include benign, premalignant, and malignant tumors. There are many ongoing arguments about the definition, classification, and therapeutic options of the conjunctival melanocytic tumors with many different suggestions. Conjunctival nevi are the most common melanocytic tumors and their risk of malignant transformation is less than1%. Primary acquired melanosis (PAM histopathologically includes various types of lesions from increased melanin pigmentation without melanocyte proliferation to melanoma in situ and is accepted as a clinical definition, so that a new classification is recommended which is based on more objective criteria than before. Although conjunctival melanoma is seen rarely, it is associated with a high mortality rate. Management of these tumors mainly involves surgery and adjuvant topical chemotherapy, cryotherapy, and radiation therapy that help improving the survival, however, new options are being investigated related to genetic and molecular researches. (Turk J Ophthalmol 2014; 44: Supplement 15-21

  3. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao

    2006-01-01

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  4. A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Abbas Rasi

    2014-01-01

    Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

  5. Molecular effects of 1-naphthyl-methylcarbamate and solar radiation exposures on human melanocytes.

    Science.gov (United States)

    Ferrucio, Bianca; Tiago, Manoela; Fannin, Richard D; Liu, Liwen; Gerrish, Kevin; Maria-Engler, Silvya Stuchi; Paules, Richard S; Barros, Silvia Berlanga de Moraes

    2017-02-01

    Carbaryl (1-naphthyl-methylcarbamate), a broad-spectrum insecticide, has recently been associated with the development of cutaneous melanoma in an epidemiological cohort study with U.S. farm workers also exposed to ultraviolet radiation, the main etiologic factor for skin carcinogenesis. We hypothesized that carbaryl exposure may increase deleterious effects of UV solar radiation on skin melanocytes. This study aimed to characterize human melanocytes after individual or combined exposure to carbaryl (100μM) and solar radiation (375mJ/cm 2 ). In a microarray analysis, carbaryl, but not solar radiation, induced an oxidative stress response, evidenced by the upregulation of antioxidant genes, such as Hemeoxygenase-1 (HMOX1), and downregulation of Microphtalmia-associated Transcription Factor (MITF), the main regulator of melanocytic activity; results were confirmed by qRT-PCR. Carbaryl and solar radiation induced a gene response suggestive of DNA damage and cell cycle alteration. The expression of CDKN1A, BRCA1/2 and MDM2 genes was notably more intense in the combined treatment group, in a synergistic manner. Flow cytometry assays demonstrated S-phase cell cycle arrest, reduced apoptosis levels and faster induction of cyclobutane pyrimidine dimers (CPD) lesions in carbaryl treated groups. Our data suggests that carbaryl is genotoxic to human melanocytes, especially when associated with solar radiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  7. Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

    Science.gov (United States)

    Fullerton, A; Serup, J

    1997-02-01

    To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

  8. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  10. Hepatocyte growth factor/scatter factor-MET signaling in neural crest-derived melanocyte development.

    Science.gov (United States)

    Kos, L; Aronzon, A; Takayama, H; Maina, F; Ponzetto, C; Merlino, G; Pavan, W

    1999-02-01

    The mechanisms governing development of neural crest-derived melanocytes, and how alterations in these pathways lead to hypopigmentation disorders, are not completely understood. Hepatocyte growth factor/scatter factor (HGF/SF) signaling through the tyrosine-kinase receptor, MET, is capable of promoting the proliferation, increasing the motility, and maintaining high tyrosinase activity and melanin synthesis of melanocytes in vitro. In addition, transgenic mice that ubiquitously overexpress HGF/SF demonstrate hyperpigmentation in the skin and leptomenigenes and develop melanomas. To investigate whether HGF/ SF-MET signaling is involved in the development of neural crest-derived melanocytes, transgenic embryos, ubiquitously overexpressing HGF/SF, were analyzed. In HGF/SF transgenic embryos, the distribution of melanoblasts along the characteristic migratory pathway was not affected. However, additional ectopically localized melanoblasts were also observed in the dorsal root ganglia and neural tube, as early as 11.5 days post coitus (p.c.). We utilized an in vitro neural crest culture assay to further explore the role of HGF/SF-MET signaling in neural crest development. HGF/SF added to neural crest cultures increased melanoblast number, permitted differentiation into pigmented melanocytes, promoted melanoblast survival, and could replace mast-cell growth factor/Steel factor (MGF) in explant cultures. To examine whether HGF/SF-MET signaling is required for the proper development of melanocytes, embryos with a targeted Met null mutation (Met-/-) were analysed. In Met-/- embryos, melanoblast number and location were not overtly affected up to 14 days p.c. These results demonstrate that HGF/SF-MET signaling influences, but is not required for, the initial development of neural crest-derived melanocytes in vivo and in vitro.

  11. MC1R and the response of melanocytes to ultraviolet radiation

    International Nuclear Information System (INIS)

    Rouzaud, Francois; Kadekaro, Ana Luisa; Abdel-Malek, Zalfa A.; Hearing, Vincent J.

    2005-01-01

    The constitutive color of our skin plays a dramatic role in our photoprotection from solar ultraviolet radiation (UVR) that reaches the Earth and in minimizing DNA damage that gives rise to skin cancer. More than 120 genes have been identified and shown to regulate pigmentation, one of the key genes being melanocortin 1 receptor (MC1R) that encodes the melanocortin 1 receptor (MC1R), a seven-transmembrane G protein-coupled receptor expressed on the surface of melanocytes. Modulation of MC1R function regulates melanin synthesis by melanocytes qualitatively and quantitatively. The MC1R is regulated by the physiological agonists α-melanocyte-stimulating hormone (αMSH) and adrenocorticotropic hormone (ACTH), and antagonist agouti signaling protein (ASP). Activation of the MC1R by binding of an agonist stimulates the synthesis of eumelanin primarily via activation of adenylate cyclase. The significance of cutaneous pigmentation lies in the photoprotective effect of melanin, particularly eumelanin, against sun-induced carcinogenesis. Epidermal melanocytes and keratinocytes respond to UVR by increasing their expression of αMSH and ACTH, which up-regulate the expression of MC1R, and consequently enhance the response of melanocytes to melanocortins. Constitutive skin pigmentation dramatically affects the incidence of skin cancer. The pigmentary phenotype characterized by red hair, fair complexion, inability to tan and tendency to freckle is an independent risk factor for all skin cancers, including melanoma. The MC1R gene is highly polymorphic in human populations, and allelic variation at this locus accounts, to a large extent, for the variation in pigmentary phenotypes and skin phototypes (SPT) in humans. Several allelic variants of the MC1R gene are associated with the red hair and fair skin (RHC) phenotype, and carrying one of these variants is thought to diminish the ability of the epidermis to respond to DNA damage elicited by UVR. The MC1R gene is considered a

  12. MC1R and the response of melanocytes to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Rouzaud, Francois [Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Building 37, Room 2132, Bethesda, MD 20892 (United States); Kadekaro, Ana Luisa [Department of Dermatology, University of Cincinnati, College of Medicine, Cincinnati, OH 45267 (United States); Abdel-Malek, Zalfa A. [Department of Dermatology, University of Cincinnati, College of Medicine, Cincinnati, OH 45267 (United States); Hearing, Vincent J. [Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Building 37, Room 2132, Bethesda, MD 20892 (United States)]. E-mail: hearingv@nih.gov

    2005-04-01

    The constitutive color of our skin plays a dramatic role in our photoprotection from solar ultraviolet radiation (UVR) that reaches the Earth and in minimizing DNA damage that gives rise to skin cancer. More than 120 genes have been identified and shown to regulate pigmentation, one of the key genes being melanocortin 1 receptor (MC1R) that encodes the melanocortin 1 receptor (MC1R), a seven-transmembrane G protein-coupled receptor expressed on the surface of melanocytes. Modulation of MC1R function regulates melanin synthesis by melanocytes qualitatively and quantitatively. The MC1R is regulated by the physiological agonists {alpha}-melanocyte-stimulating hormone ({alpha}MSH) and adrenocorticotropic hormone (ACTH), and antagonist agouti signaling protein (ASP). Activation of the MC1R by binding of an agonist stimulates the synthesis of eumelanin primarily via activation of adenylate cyclase. The significance of cutaneous pigmentation lies in the photoprotective effect of melanin, particularly eumelanin, against sun-induced carcinogenesis. Epidermal melanocytes and keratinocytes respond to UVR by increasing their expression of {alpha}MSH and ACTH, which up-regulate the expression of MC1R, and consequently enhance the response of melanocytes to melanocortins. Constitutive skin pigmentation dramatically affects the incidence of skin cancer. The pigmentary phenotype characterized by red hair, fair complexion, inability to tan and tendency to freckle is an independent risk factor for all skin cancers, including melanoma. The MC1R gene is highly polymorphic in human populations, and allelic variation at this locus accounts, to a large extent, for the variation in pigmentary phenotypes and skin phototypes (SPT) in humans. Several allelic variants of the MC1R gene are associated with the red hair and fair skin (RHC) phenotype, and carrying one of these variants is thought to diminish the ability of the epidermis to respond to DNA damage elicited by UVR. The MC1R gene is

  13. [Alpha-melanocyte-stimulating hormone. From bench to bedside].

    Science.gov (United States)

    Böhm, M; Luger, T A

    2010-06-01

    Alpha-melanocyte-stimulating hormone (alpha-MSH) is a tridecapeptide that is produced by the skin itself from the precursor proopiomelanocortin. It crucially mediates ultraviolet light-induced tanning after binding to melanocortin-1 receptors (MC-1R) expressed on the surface of epidermal melanocytes. The potent pigment-inducing and also cytoprotective actions of alpha-MSH are the rationale for the performance of first phase II clinical trials with Nle4-D-Phe7-alpha-MSH (NDP-alpha-MSH), a subcutaneously administered synthetic and superpotent alpha-MSH analogue, in patients with photodermatoses such as erythropoietic protoporphyria. Since alpha-MSH has shown promising anti-inflammatory and antifibrotic properties in numerous preclinical studies, it will be most interesting to evaluate these effects in further clinical pilot studies with NDP-alpha-MSH. In addition to alpha-MSH analogues, truncated tripeptides such as KDPT which do not bind to MC-1R but have sustained anti-inflammatory properties are currently emerging as another novel therapeutic strategy in dermatology.

  14. Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

    Science.gov (United States)

    Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

    2018-04-06

    The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

  15. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  16. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

  17. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  18. Melanin offers protection against induction of cyclobutane pyrimidine dimers and 6-4 photoproducts by UVB in cultured human melanocytes

    NARCIS (Netherlands)

    Smit, N.P.M.; Vink, A.A.; Kolb, R.M.; Steenwinkel, M.J.S.T.; Berg, P.T.M. van den; Nieuwpoort, F. van; Roza, L.; Pavel, S.

    2001-01-01

    The goal of this investigation was to correlate the melanin content in human pigmentary cells with the generation of UVB-induced photoproducts and to examine the relationship between the melanin content and the removal of the photoproducts. Cultured melanocytes from light-skinned individuals

  19. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  20. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  1. A combination of high dose rate (10X FFF/2400 MU/min/10 MV X-rays) and total low dose (0.5 Gy) induces a higher rate of apoptosis in melanoma cells in vitro and superior preservation of normal melanocytes.

    Science.gov (United States)

    Sarojini, Sreeja; Pecora, Andrew; Milinovikj, Natasha; Barbiere, Joseph; Gupta, Saakshi; Hussain, Zeenathual M; Tuna, Mehmet; Jiang, Jennifer; Adrianzen, Laura; Jun, Jaewook; Catello, Laurice; Sanchez, Diana; Agarwal, Neha; Jeong, Stephanie; Jin, Youngjin; Remache, Yvonne; Goy, Andre; Ndlovu, Alois; Ingenito, Anthony; Suh, K Stephen

    2015-10-01

    The aim of this study was to determine the apoptotic effects, toxicity, and radiosensitization of total low dose irradiation delivered at a high dose rate in vitro to melanoma cells, normal human epidermal melanocytes (HEM), or normal human dermal fibroblasts (HDF) and to study the effect of mitochondrial inhibition in combination with radiation to enhance apoptosis in melanoma cells. Cells irradiated using 10X flattening filter-free (FFF) 10 MV X-rays at a dose rate of 400 or 2400 MU/min and a total dose of 0.25-8 Gy were analyzed by cell/colony counting, MitoTracker, MTT, and DNA-damage assays, as well as by quantitative real-time reverse transcriptase PCR in the presence or absence of mitochondrial respiration inhibitors. A dose rate of 2400 MU/min killed on average five-fold more melanoma cells than a dose rate 400 MU/min at a total dose of 0.5 Gy and preserved 80% survival of HEM and 90% survival of HDF. Increased apoptosis at the 2400 MU/min dose rate is mediated by greater DNA damage, reduced cell proliferation, upregulation of apoptotic genes, and downregulation of cell cycle genes. HEM and HDF were relatively unharmed at 2400 MU/min. Radiation induced upregulation of mitochondrial respiration in both normal and cancer cells, and blocking the respiration with inhibitors enhanced apoptosis only in melanoma cells. A high dose rate with a low total dose (2400 MU/min, 0.5 Gy/10X FFF 10 MV X-rays) enhances radiosensitivity of melanoma cells while reducing radiotoxicity toward HEM and HDF. Selective cytotoxicity of melanoma cells is increased by blocking mitochondrial respiration.

  2. Progressive Increase in Telomerase Activity From Benign Melanocytic Conditions to Malignant Melanoma

    Directory of Open Access Journals (Sweden)

    Ruben D. Ramirez

    1999-04-01

    Full Text Available The expression of telomerase activity and the in situ localization of the human telomerase RNA component (hTR in melanocytic skin lesions was evaluated in specimens from sixty-three patients. Specimens of melanocytic nevi, primary melanomas and subcutaneous metastases of melanoma were obtained from fifty-eight patients, whereas metastasized lymph nodes were obtained from five patients. Telomerase activity was determined in these specimens by using a Polymerase Chain Reaction—based assay (TRAP. High relative mean telomerase activity levels were detected in metastatic melanoma (subcutaneous metastasess = 54.5, lymph node metastasess = 56.5. Much lower levels were detected in primary melanomas, which increased with advancing levels of tumor cell penetration (Clark II = 0.02, Clark III = 1.1, and Clark IV = 1.9. Twenty-six formalin-fixed, paraffin-embedded melanocytic lesions were sectioned and analyzed for telomerase RNA with a radioactive in situ hybridization assay. In situ hybridization studies with a probe to the template RNA component of telomerase confirmed that expression was almost exclusively confined to tumor cells and not infiltrating lymphocytes. These results indicate that levels of telomerase activity and telomerase RNA in melanocytic lesions correlate well with clinical stage and could potentially assist in the diagnosis of borderline lesions.

  3. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  4. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  5. Giant Congenital Melanocytic Nevus (GCMN - A New Hope for Targeted Therapy?

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2017-07-01

    Full Text Available We present a 6-month-old male patient, who was consulted with dermatologist by his parents, because of a pigmented lesion, present since birth, covering almost the all skin of the back and buttocks.  A sharply bordered, unequally coloured congenital pigmented nevus, measuring approximately 21 cm in diameter was observed in the whole body skin examination. The lesion was affecting the lower 2/3 of the skin of the back and the top half of the gluteus area, extending to the lateral part of the tors, forward the abdomen and the upper lateral part of the hips, composed by multiple darker-pigmented nests and several lighter areas, with single depigmented zones, hairy surface, irregularly infiltrated on palpation. Congenital melanocytic nevi are presented in approximately 1% of newborns, while giant congenital melanocytic nevi (GCMN are the most uncommon subtype of them; with occurrence rate 1 in 50,000 births. They affect 2% of a total body surface or presenting in a diameter larger than 20 cm in older children. Although not common, the possible malignant transformation remains one of the most important considerations related to them, as the related lifetime risk of melanoma is 4% to 10%. Treatment recommendations include non-surgical methods as dermabrasion only within the first two weeks of life, for prevention the possible melanocytic deeper migration, while serial surgical excisions or tissue expanders could be useful treatment tool even in later stages. Nevertheless, cosmetic result is not always satisfactory, and the risk of malignant changes remains, in cases of previous melanocytic migration in deeper layer. Recent article suggests the potential role in the treatment of GCMN with NRAS inhibitor trametinib, approved for treatment of advanced melanoma, associated with underlying NRAS mutations. Although promising, the drug could be useful in paediatric patients, only with associated NRAS gene mutation. It is still unclear whether it could be

  6. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  7. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  8. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  9. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  10. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  11. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  12. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  13. Vitiligo inducing phenols activate the unfolded protein response in melanocytes resulting in upregulation of IL6 and IL8

    Science.gov (United States)

    Toosi, Siavash; Orlow, Seth J.; Manga, Prashiela

    2012-01-01

    Vitiligo is characterized by depigmented skin patches due to loss of epidermal melanocytes. Oxidative stress may play a role in vitiligo onset, while autoimmunity contributes to disease progression. In this study we sought to identify mechanisms that link disease triggers and spreading of lesions. A hallmark of melanocytes at the periphery of vitiligo lesions is dilation of the endoplasmic reticulum (ER). We hypothesized that oxidative stress results in redox disruptions that extend to the ER, causing accumulation of misfolded peptides, which activates the unfolded protein response (UPR). We used 4-tertiary butyl phenol (4-TBP) and monobenzyl ether of hydroquinone (MBEH), known triggers of vitiligo. We show that expression of key UPR components, including the transcription factor X-box binding protein 1 (XBP1), are increased following exposure of melanocytes to phenols. XBP1 activation increases production of immune mediators interleukin-6 (IL6) and IL8. Co-treatment with XBP1 inhibitors reduced IL6 and IL8 production induced by phenols, while over-expression of XBP1 alone increased their expression. Thus, melanocytes themselves produce cytokines associated with activation of an immune response following exposure to chemical triggers of vitiligo. These results expand our understanding of the mechanisms underlying melanocyte loss in vitiligo and pathways linking environmental stressors and autoimmunity. PMID:22696056

  14. Vitiligo-inducing phenols activate the unfolded protein response in melanocytes resulting in upregulation of IL6 and IL8.

    Science.gov (United States)

    Toosi, Siavash; Orlow, Seth J; Manga, Prashiela

    2012-11-01

    Vitiligo is characterized by depigmented skin patches caused by loss of epidermal melanocytes. Oxidative stress may have a role in vitiligo onset, while autoimmunity contributes to disease progression. In this study, we sought to identify mechanisms that link disease triggers and spreading of lesions. A hallmark of melanocytes at the periphery of vitiligo lesions is dilation of the endoplasmic reticulum (ER). We hypothesized that oxidative stress results in redox disruptions that extend to the ER, causing accumulation of misfolded peptides, which activates the unfolded protein response (UPR). We used 4-tertiary butyl phenol and monobenzyl ether of hydroquinone, known triggers of vitiligo. We show that expression of key UPR components, including the transcription factor X-box-binding protein 1 (XBP1), is increased following exposure of melanocytes to phenols. XBP1 activation increases production of immune mediators IL6 and IL8. Co-treatment with XBP1 inhibitors reduced IL6 and IL8 production induced by phenols, while overexpression of XBP1 alone increased their expression. Thus, melanocytes themselves produce cytokines associated with activation of an immune response following exposure to chemical triggers of vitiligo. These results expand our understanding of the mechanisms underlying melanocyte loss in vitiligo and pathways linking environmental stressors and autoimmunity.

  15. Skin manifestations of growth hormone-induced diseases.

    Science.gov (United States)

    Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

    2016-09-01

    The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

  16. Malignant melanoma arising in congenital melanocytic nevi: clinical and dermoscopic challenges

    Directory of Open Access Journals (Sweden)

    Fatma Pelin Cengiz

    2017-01-01

    Full Text Available Congenital melanocytic nevi (CMN are visible pigmented lesions in the skin that are present at birth. CMN are benign malformations resulting from defective development of melanocyte precursors in the embryo. Six MMs from six patients were analyzed by clinical and dermoscopic examination. Of the patients, 33.3% were female (N = 2 and 66.6% were male (N = 4. Of the MMs, four (66.6% were superficial spreading MM and two (33.3 % were in situ MM. A reticular pattern was present in the MMs of three patients (50%, a homogeneous pattern was present in the other patients (50% at the base of the MMs. Superficial spreading melanomas and in situ melanomas with atypical dots and globules and a blue-white veil were the most common dermoscopic features of MMs found in CMN.

  17. Angiogenic effects of cryosurgery with liquid nitrogen on the normal skin of rats, through morphometric study.

    Science.gov (United States)

    Pimentel, Camila Bianco; Moraes, Aparecida Machado de; Cintra, Maria Letícia

    2014-01-01

    Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

  18. alpha-Melanocyte-stimulating-hormone precursors in the pig pituitary

    DEFF Research Database (Denmark)

    Fenger, M

    1986-01-01

    The occurrence of intermediates from the processing of ACTH-(1-39) [adrenocorticotropic hormone-(1-39)] to alpha-melanocyte-stimulating hormone was investigated in normal pig pituitaries by the use of sensitive and specific radioimmunoassays for ACTH-(1-13), ACTH-(1-14), ACTH-(1-13)-NH2 and ACTH-(1......) were detected in lower amounts in both the intermediate lobe and the anterior lobe. ACTH-(1-17), ACTH-(1-13) and their acetylated analogues could not be detected in the anterior lobe or the intermediate lobe. The results suggest that an endopeptidase initially cleaves ACTH-(1-39) at the Lys-16-Arg-17...... bond. ACTH-(1-16) is then processed by a pituitary carboxypeptidase to ACTH-(1-14) and ACTH-(17-39) by the aminopeptidase to ACTH-(18-39)....

  19. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  20. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  1. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  2. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation; Role des melanocytes dans l'unite epidermique de melanisation reconstruite ex-vivo apres une irradiation UV aigue

    Energy Technology Data Exchange (ETDEWEB)

    Cario-Andre, M

    2000-11-15

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  3. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation; Role des melanocytes dans l'unite epidermique de melanisation reconstruite ex-vivo apres une irradiation UV aigue

    Energy Technology Data Exchange (ETDEWEB)

    Cario-Andre, M

    2000-11-15

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  4. Influence of melanocytes in the ex-vivo reconstructed epidermal melanin unit following an acute UV irradiation

    International Nuclear Information System (INIS)

    Cario-Andre, M.

    2000-11-01

    Influence of melanocytes in skin pigmentation is well documented, however its photo-protective role has given rise to controversy. The role of melanocytes have been investigated on reconstructed epidermis with 100 % of keratinocytes or 95 % of keratinocytes and 5 % of melanocytes. In a first time, the effect of an acute UVB dose has been studied on both reconstructed epidermis, next we have investigated UVA and UVA+B effects on these epidermis. Following irradiation, the presence of melanocytes in reconstructed epidermis protects against apoptosis without protecting significantly against DNA damage formation (CPD, 6-4PP) and protects against UV-induced unbalance of the SOD/catalase ratio (antioxidants enzymes). On the contrary, the presence of melanocytes in reconstructed epidermis amplifies lipids and proteins oxidations but seems to protect against DNA oxidations. Melanocytes differ from keratinocytes by their melanin content and their more important concentration in polyunsaturated fatty acids. To evaluate what is the part of melanin and the part of polyunsaturated fatty acids in epidermal UV responses, reconstructed epidermis with keratinocytes have been supplemented with polyunsaturated fatty acid. This study indicates that polyunsaturated fatty acids are responsible for lipids and proteins oxidations and that melanin protect against DNA oxidation induced by lipid peroxidation. All these studies demonstrate that, model of reconstructed epidermis and epidermis in-vivo have the same behaviour following UV irradiation. In the last part, sunscreens and antioxidants have been tested on reconstructed epidermis and have demonstrated that model of reconstructed epidermis is suitable for photo-protective molecules screening. (author)

  5. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  6. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  7. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  8. Spontaneous regression of a congenital melanocytic nevus

    Directory of Open Access Journals (Sweden)

    Amiya Kumar Nath

    2011-01-01

    Full Text Available Congenital melanocytic nevus (CMN may rarely regress which may also be associated with a halo or vitiligo. We describe a 10-year-old girl who presented with CMN on the left leg since birth, which recently started to regress spontaneously with associated depigmentation in the lesion and at a distant site. Dermoscopy performed at different sites of the regressing lesion demonstrated loss of epidermal pigments first followed by loss of dermal pigments. Histopathology and Masson-Fontana stain demonstrated lymphocytic infiltration and loss of pigment production in the regressing area. Immunohistochemistry staining (S100 and HMB-45, however, showed that nevus cells were present in the regressing areas.

  9. Neurotized congenital melanocytic nevus resembling a pigmented neurofibroma

    Directory of Open Access Journals (Sweden)

    Nidhi Singh

    2015-01-01

    Full Text Available Neurotized congenital melanocytic nevus and pigmented neurofibroma (PNF are close mimics and pose a clinicopathological challenge. We present a case of pigmented hypertrichotic plaque over lumbosacral region and discuss the differential diagnosis and its clinical, histopathological and immunohistochemistry features which may aid in differentiation. We highlight the difficulties faced in differentiating neurotized congenital melanocytic nevus from pigmented neurofibroma.

  10. Topical application of dimethylbenz[a]anthracene results in the generation of multiple melanocytic nevi in C3H/HeN mice

    International Nuclear Information System (INIS)

    Elmets, Craig A.; Yusuf, Nabiha; Hamza, Sate; Iranikakh, Nasser; Smith, Jeffrey; Volk, Andrea L.; Skelton, Henry; Smith, Kathy

    2004-01-01

    Melanocytic nevi are a common dermatological problem for which there are few in vivo models. It has been postulated that environmental factors contribute to their development. Experiments were therefore conducted to determine whether application of dimethylbenz[a]anthracene (DMBA) to the skin of mice would result in the development of melanocytic nevi. One hundred microliters of a 0.1%, 0.5%, or 1.0% solution of DMBA was applied to the dorsal skin of C3H/HeN mice. The mice were then observed for the appearance of pigmented lesions. Histological examination revealed perifollicular accumulations of nevus cells, which were S-100-protein and HMB-45-positive, confirming their melanocytic origin. Pigmented lesions did not occur in animals treated with vehicle alone. Dose response studies revealed both greater numbers of nevi and lesions with larger diameters as the dose of DMBA was increased from 0.1% to 0.5%. In no instance was an invasive melanoma observed even after 40 weeks. The fact that melanocytic nevi can be produced by topical application of DMBA suggests that xenobiotics may play a previously unrecognized role in the development of this common benign neoplasm. Because this is one of the only animal models for melanocytic nevi, further examination of this model may facilitate identification of the molecular and biochemical mechanisms that lead to the development of pigmented nevi and the factors that promote their evolution into invasive melanomas

  11. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  12. Novel biodegradable porous scaffold applied to skin regeneration.

    Science.gov (United States)

    Wang, Hui-Min; Chou, Yi-Ting; Wen, Zhi-Hong; Wang, Chau-Zen; Wang, Zhao-Ren; Chen, Chun-Hong; Ho, Mei-Ling

    2013-01-01

    Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  13. Novel biodegradable porous scaffold applied to skin regeneration.

    Directory of Open Access Journals (Sweden)

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  14. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  15. Association of giant congenital melanocytic nevus, halo nevus and vitiligo in a 75-year-old patient Associação de nevo melanocítico congênito gigante, nevo halo e vitiligo. Relato de caso em paciente de 75 anos

    Directory of Open Access Journals (Sweden)

    Marina Leite da Silveira

    2012-04-01

    Full Text Available A giant congenital melanocytic nevus represents a rare condition. The halo phenomenon may be seen in congenital or acquired melanocytic nevi. In the literature, association of halo nevus and giant congenital melanocytic nevus is rare and the association of both with vitiligo even more rare. A 75-yearold woman at first consultation complained of a hyperchromic bluish-brown hairy macula on the lower back, buttocks and thighs present since birth and an achromic halo of onset three years ago. The histological features were consistent with congenital melanocytic nevus and halo nevus, respectively. After two years the patient developed achromic areas in normal skin, histologically consistent with vitiligo. The authors emphasize the rarity of this triple combination, the patient's age and the absence of malignant degeneration to date.Nevo melanocitico congênito gigante constitui uma condição rara. O fenômeno halo pode ser observado em nevos melanocíticos congênitos ou adquiridos. Na literatura a associação nevo halo e nevo melanocítico congênito gigante é rara e a associação de ambos com vitiligo ainda mais rara. Mulher de 75 anos que à primeira consulta apresentava mácula hipercrômica castanho-azulada pilosa na região lombar, nádegas e coxas desde o nascimento e halo acrômico de aparecimento há 3 anos. Os histológicos foram compatíveis com nevo melanocítico congênito e nevo halo respectivamente. Após dois anos evoluiu com áreas de acromia à distância, com histológico de vitiligo. Os autores ressaltam a raridade desta tripla associação; a idade da paciente e a ausência de degeneração maligna até o presente momento.

  16. The measurement of skin impedance for the diagnosis of skin cancer

    International Nuclear Information System (INIS)

    Menzies, S.; Crook, B.; McCarthy, W.

    1996-01-01

    Full text: In vivo skin impedance measurements have been reported to be diagnostic in differentiating benign from malignant skin tumours (Kiss G et al. Borgyogy Vener Szle 45: 164,1969; Melczer N. In: Cancer of the Skin. Saunders Co. Philadelphia, 1976, pp293-313). However, in contrast to non-melanoma skin cancer, only, a small sample of malignant melanomas were reported in these previous studies. We performed skin impedance measurements on a larger sample of melanomas in order to assess the potential use of such instrumentation for clinical diagnosis. The diagnostic method described by Kiss and Horvath was reproduced with only minor modifications. Low voltage impedance measurements at 1600 Hz were taken over each lesion and on nearby surrounding normal skin. Filter paper (4mm diameter) soaked in 0.1 M KCl was used at the skin-probe interface. A minimum of 2 skin and 1 lesion measurements were taken. All lesions were taken from relatively hairless sites and were non abraded or ulcerated. With the exception of 6 seborrhoeic keratoses all lesions were excised for histological diagnosis. The lesions tested were 27 invasive melanomas, 3 in situ melanomas, 27 basal cell carcinomas (BCC), 70 benign melanocytic lesions, 19 seborrhoeic keratoses, 5 Bowens disease (in situ SCC), 1 squamous cell carcinoma (SCC) and 25 other benign lesions. Results were interpreted as previously (Melczer) by the quotient of skin impedance / lesion impedance > 1.5 indicating malignancy. Analysis of total melanocytic lesions gave a sensitivity of 44% and specificity of 83% for the diagnosis of invasive melanoma (p < 0.05). Fifty two percent of BCCs were positively diagnosed. Analysis of all benign versus all invasive malignancy gave a sensitivity of 47% and specificity of 77% for the diagnosis of invasive malignancy (p < 0.01). While impedance measurements at 1600 Hz provide a statistically significant differentiation of melanoma versus non-melanoma and invasive malignancy versus benign lesions

  17. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  18. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Early diagnosis and successful treatment of paraneoplastic melanocytic proliferation.

    Science.gov (United States)

    Jansen, Joyce C G; Van Calster, Joachim; Pulido, Jose S; Miles, Sarah L; Vile, Richard G; Van Bergen, Tine; Cassiman, Catherine; Spielberg, Leigh H; Leys, Anita M

    2015-07-01

    Paraneoplastic melanocytic proliferation (bilateral diffuse uveal melanocytic proliferation, BDUMP) is a rare but devastating disease that causes progressive visual loss in patients who usually have an occult malignancy. Visual loss occurs as a result of paraneoplastic changes in the uveal tissue. In a masked fashion, the serum of two patients with BDUMP was evaluated for the presence of cultured melanocyte elongation and proliferation (CMEP) factor using cultured human melanocytes. We evaluated the efficacy of plasmapheresis as a treatment modality early in the disease in conjunction with radiation and chemotherapy. The serum of the first case patient was investigated after plasmapheresis and did not demonstrate proliferation of cultured human melanocytes. The serum of the second case was evaluated prior to treatment with plasmapheresis and did induce this proliferation. These findings are in accordance with the diminution of CMEP factor after plasmapheresis. Treatment with plasmapheresis managed to stabilise the ocular disease progression in both patients. In the past, visual loss due to paraneoplastic melanocytic proliferation was considered progressive and irreversible. We treated two patients successfully with plasmapheresis and demonstrated a relation between CMEP factor in the serum of these patients and proliferation of cultured melanocytes. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...

  1. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  2. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Directory of Open Access Journals (Sweden)

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  3. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  4. Radiosensitivity of fibroblasts obtained from a cafe-au-lait spot and normal-appearing skin of a patient with neurofibromatosis (NF-6)

    International Nuclear Information System (INIS)

    Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.

    1990-01-01

    Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells

  5. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  6. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  7. Immunolocalization of lactoferrin in surgically resected pigmented skin lesions

    Directory of Open Access Journals (Sweden)

    G Tuccari

    2009-06-01

    Full Text Available Lactoferrin (Lf expression was determined immunohistochemically in 57 formalin-fixed paraffin-embedded bioptic samples obtained from an equal number of patients treated by surgery to remove pigmented skin lesions (nevi = 23; melanoma = 12; vulgaris and seborrhoeic warts = 12; basal cell carcinoma = 10; in addition, 10 specimens of normal skin were studied as control. On 3 ?m thick sections, depigmentation and antigen retrieval procedures were performed. The Lf immunoreactivity was revealed by a rabbit anti-human Lf. Quantification of Lf immunoreactivity was performed using an intensity-distribution (ID score. Melanocytic cells, regardless of their benign or malignant nature, were consistently stained, with no significant differences in the Lf IDscore between melanomas or nevi. A different intensity of Lf immunoreactivity was encountered in superficial portions of warts, exclusively inside squamous epithelial cells arranged in sheets or whorls of keratin. On the contrary, basal cell carcinomas were always unstained, while a slight Lf positivity was found in focal keratinized areas present in two tumours showing baso-squamous differentiation. The Lf immunoreactivity was localized in the cytoplasm and only occasionally in the nucleus. The biological meaning of Lf in these cases of human skin specimens remains unexplained, although it cannot be ruled out that Lf might be involved in the defense system against tumours, or alternatively, may be used by cells requiring iron availability for their turnover. Moreover, the immunohistochemical expression of Lf in melanocytic lesions might be also related to a Lf-melanin interaction. Finally, the involvement of Lf in skin squamous non-neoplastic elements could be related to its role as one of the molecules modulating an unspecific inflammatory or anti-oxidant response.

  8. Epidermal hydrogen peroxide is not increased in lesional and non-lesional skin of vitiligo.

    Science.gov (United States)

    Zailaie, Mohammad Z

    2017-01-01

    It is widely believed that the loss of the epidermal melanocytes in vitiligo is basically due to excessive oxidative stress. Previous research work described abnormal elevation of the absolute concentration of the epidermal hydrogen peroxide (H 2 O 2 ) in lesional and non-lesional skin of vitiligo. Based on this finding, our primary research objective was to use this feature as a screening marker in individuals at a great risk of developing vitiligo. Ninety-six patients of non-segmental vitiligo (NSV) of varying durations, skin phototypes, and treatment modalities (psoralen UVA-, narrow band UVB-treated) were recruited for this study. Raman spectroscopic measurements, using an external probehead, of the lesional and non-lesional skin were obtained, and the resulting spectra were analyzed using the Opus software package of the MultiRam spectrometer and the intensity of the peak at 875 cm -1 that represents the absolute concentration of H 2 O 2 was calculated. Contrary to previous reports, in patients of skin phototype IV, the absolute concentrations of H 2 O 2 in non-lesional and lesional NSV of all groups were non-significantly decreased compared to normal control. In patients of NSV of skin phototype V, the decrease in the absolute concentrations of H 2 O 2 was not significant in the untreated group, and a slight non-significant increase in the NBUVB-treated group was noted. However, in the PUVA-treated group, the non-lesional skin demonstrated significant increase in the absolute concentration of H 2 O 2 , whereas the lesional skin showed only a slight non-significant increase compared to normal control. In NSV patients of skin phototype VI who were previously treated with PUVA, the non-lesional skin showed a slight non-significant increase in the absolute concentration of H 2 O 2 ; however, the lesional skin showed a marked significant decrease compared to normal control and the non-lesional skin. Thereof, one can conclude that the epidermal H 2 O 2 is not

  9. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  10. The effect of simultaneous exposure of HEMn-DP and HEMn-LP melanocytes to nicotine and UV-radiation on the cell viability and melanogenesis

    International Nuclear Information System (INIS)

    Delijewski, Marcin; Wrześniok, Dorota; Beberok, Artur; Rok, Jakub; Otręba, Michał; Buszman, Ewa

    2016-01-01

    Nicotine is a main compound of tobacco plants and may affect more than a billion people all over the world that are permanently exposed to nicotine from cigarettes, various forms of smoking cessation therapies, electronic cigarettes or second-hand smoke. It is known that nicotine forms complexes with melanin what may lead to accumulation of this alkaloid in tissues of living organisms containing the pigment. This may affect the viability of cells and process of melanin biosynthesis that takes place in melanocytes. Although UV radiation is known to be a particular inductor of melanin biosynthesis, its simultaneous effect with nicotine on this process as well as the viability of human cells containing melanin have not been assessed so far. The aim of this study was to examine the simultaneous impact of nicotine and UV radiation on viability and melanogenesis in cultured normal human melanocytes dark (HEMn-DP) and light (HEMn-LP) pigmented. Nicotine together with UV radiation induced concentration-dependent loss in melanocytes viability. The higher cell loss was observed in dark pigmented melanocytes in comparison to light pigmented cells. Simultaneous exposure of cells to nicotine and UV radiation also caused changes in melanization process in both tested cell lines. The data suggest that simultaneous exposure of melanocytes to nicotine and UV radiation up-regulates melanogenesis and affects cell viability. Observed processes are more pronounced in dark pigmented cells. - Highlights: • Nicotine and UVA induced concentration-dependent loss in melanocytes viability. • Nicotine and UVA modulated melanization process in melanocytes. • Changes in viability and melanization were more pronounced in dark pigmented cells.

  11. The effect of simultaneous exposure of HEMn-DP and HEMn-LP melanocytes to nicotine and UV-radiation on the cell viability and melanogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Delijewski, Marcin; Wrześniok, Dorota; Beberok, Artur; Rok, Jakub; Otręba, Michał; Buszman, Ewa, E-mail: ebuszman@sum.edu.pl

    2016-11-15

    Nicotine is a main compound of tobacco plants and may affect more than a billion people all over the world that are permanently exposed to nicotine from cigarettes, various forms of smoking cessation therapies, electronic cigarettes or second-hand smoke. It is known that nicotine forms complexes with melanin what may lead to accumulation of this alkaloid in tissues of living organisms containing the pigment. This may affect the viability of cells and process of melanin biosynthesis that takes place in melanocytes. Although UV radiation is known to be a particular inductor of melanin biosynthesis, its simultaneous effect with nicotine on this process as well as the viability of human cells containing melanin have not been assessed so far. The aim of this study was to examine the simultaneous impact of nicotine and UV radiation on viability and melanogenesis in cultured normal human melanocytes dark (HEMn-DP) and light (HEMn-LP) pigmented. Nicotine together with UV radiation induced concentration-dependent loss in melanocytes viability. The higher cell loss was observed in dark pigmented melanocytes in comparison to light pigmented cells. Simultaneous exposure of cells to nicotine and UV radiation also caused changes in melanization process in both tested cell lines. The data suggest that simultaneous exposure of melanocytes to nicotine and UV radiation up-regulates melanogenesis and affects cell viability. Observed processes are more pronounced in dark pigmented cells. - Highlights: • Nicotine and UVA induced concentration-dependent loss in melanocytes viability. • Nicotine and UVA modulated melanization process in melanocytes. • Changes in viability and melanization were more pronounced in dark pigmented cells.

  12. Skin Cancer (Including Melanoma)—Health Professional Version

    Science.gov (United States)

    Basal cell carcinoma and squamous cell carcinoma are referred to as nonmelanoma skin cancers. Melanoma is a malignant tumor of melanocytes, which make the melanin. Find evidence-based information on skin cancer treatment, causes and prevention, screening, research, genetics, and statistics.

  13. Forehead Skin Blood Flow in Normal Neonates during Active and Quiet Sleep, Measured with a Diode Laser Doppler Instrument

    NARCIS (Netherlands)

    Suichies, H.E.; Aarnoudse, J.G.; Okken, A.; Jentink, H.W.; de Mul, F.F.M.; Greve, Jan

    1988-01-01

    Changes in forehead skin blood flow during active and quiet sleep were determined in 16 healthy neonates using a recently developed semi-conductor laser Doppler flow meter without light conducting fibres. Measurements were carried out at a postnatal age varying from 5 hours to 7 days. The two sleep

  14. Melanocytes from patients affected by Ullrich congenital muscular dystrophy and Bethlem myopathy have dysfunctional mitochondria that can be rescued with cyclophilin inhibitors

    Directory of Open Access Journals (Sweden)

    Alessandra eZulian

    2014-11-01

    Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.

  15. Does Melanoma Begin in a Melanocyte Stem Cell

    International Nuclear Information System (INIS)

    Hoerter, J. D.; Bradley, P.; Casillas, A.; Chambers, D.; Weiswasser, B.; Clements, L.; Gilbert, S.; Jiao, A.

    2012-01-01

    What is the cellular origin of melanoma? What role do melanocyte stem cells (MSC) and other melanocyte precursors play in the development of melanoma? Are MSCs and other latent melanocyte precursors more susceptible to solar radiation? These and many other questions can be very effectively addressed using the zebra fish model. Zebra fish have a robust regenerative capability, permitting the study of how MSCs are regulated and recruited at specific times and places to generate the pigment pattern following fin amputation or melanocyte ablation. They can be used to determine the effects of environmental radiation on the proliferation, survival, repair, and differentiation of MSCs. Our lab is using zebra fish to investigate how UVA- (320-400nm) and UVB- (290-320nm) induced damage to MSCs may contribute to the development of melanoma. A review is given of MSCs in zebrafish as well as experimental techniques and drugs for manipulating MSC populations. These techniques can be used to design experiments to help answer many questions regarding the role of MSCs or melanocyte precursors in the formation of melanoma stem cells and tumors following exposure to UVA/UVB radiation.

  16. Molecular cytogenetics of cutaneous melanocytic lesions - diagnostic, prognostic and therapeutic aspects.

    NARCIS (Netherlands)

    Blokx, W.A.M.; Dijk, M.C.R.F. van; Ruiter, D.J.

    2010-01-01

    This review intends to update current knowledge regarding molecular cytogenetics in melanocytic tumours with a focus on cutaneous melanocytic lesions. Advantages and limitations of diverse, already established methods, such as (fluorescence) in situ hybridization and mutation analysis, to detect

  17. Molecular cytogenetics of cutaneous melanocytic lesions - diagnostic, prognostic and therapeutic aspects

    NARCIS (Netherlands)

    Blokx, Willeke Am M.; van Dijk, Marcory C. R. F.; Ruiter, Dirk J.

    This review intends to update current knowledge regarding molecular cytogenetics in melanocytic tumours with a focus on cutaneous melanocytic lesions. Advantages and limitations of diverse, already established methods, such as (fluorescence) in situ hybridization and mutation analysis, to detect

  18. An oral TRPV1 antagonist attenuates laser radiant-heat-evoked potentials and pain ratings from UV(B)-inflamed and normal skin.

    Science.gov (United States)

    Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram

    2013-02-01

    Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  19. Investigation of the predictive validity of laser-EPs in normal, UVB-inflamed and capsaicin-irritated skin with four analgesic compounds in healthy volunteers.

    Science.gov (United States)

    Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim

    2017-07-01

    The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical

  20. Optical Coherence Tomography Angiography Characteristics of Iris Melanocytic Tumors

    Science.gov (United States)

    Skalet, Alison H.; Li, Yan; Lu, Chen D.; Jia, Yali; Lee, ByungKun; Husvogt, Lennart; Maier, Andreas; Fujimoto, James G.; Thomas, Charles R.; Huang, David

    2016-01-01

    Objective To evaluate tumor vasculature with optical coherence tomography (OCT) angiography (OCTA) in malignant iris melanomas and benign iris lesions. Design Cross-sectional observational clinical study. Participants Patients with iris lesions and healthy volunteers. Methods Eyes were imaged using OCTA systems operating at 1050 and 840 nm wavelengths. Three-dimensional OCTA scans were acquired. Iris melanomas patients treated with radiation therapy were imaged again after I-125 plaque brachytherapy at 6 and 18 months. Main Outcome Measures OCT and OCTA images, qualitative evaluation of iris and tumor vasculature and quantitative vessel density. Results One eye each of eight normal volunteers and nine patients with iris melanomas or benign iris lesions including freckles, nevi, and an iris pigment epithelial (IPE) cyst were imaged. The normal iris has radially-oriented vessels within the stroma on OCTA. Penetration of flow signal in normal iris depended on iris color, with best penetration seen in light to moderately pigmented irides. Iris melanomas demonstrated tortuous and disorganized intratumoral vasculature. In two eyes with nevi there was no increased vascularity; in another, fine vascular loops were noted near an area of ectropion uveae. Iris freckles and the IPE cyst did not have intrinsic vascularity. The vessel density was significantly higher within iris melanomas (34.5%±9.8%, piris nevi (8.0%±1.4%) or normal irides (8.0%±1.2%). Tumor regression after radiation therapy for melanomas was associated with decreased vessel density. OCTA at 1050 nm provided better visualization of tumor vasculature and penetration through thicker tumors than at 840 nm. But in very thick tumors and highly pigmented lesions even 1050 nm OCTA could not visualize their full thickness. Interpretable OCTA images were obtained in 82% participants in whom imaging was attempted. Conclusions This is the first demonstration of OCTA in iris tumors. OCTA may provide a dye-free, no

  1. Organelle-specific injury to melanin-containing cells in human skin by pulsed laser irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, G.F.; Shepard, R.S.; Paul, B.S.; Menkes, A.; Anderson, R.R.; Parrish, J.A.

    1983-12-01

    Physical models predict that ultraviolet laser radiation of appropriately brief pulses can selectively alter melanin-containing cellular targets in human skin. Skin of normal human volunteers was exposed to brief (20 nanosecond) 351-nm wave length pulses from a XeF excimer laser, predicting that those cells containing the greatest quantities of melanized melanosomes (lower half of the epidermis) would be selectively damaged. Transmission electron microscopy revealed the earliest cellular alteration to be immediate disruption of melanosomes, both within melanocytes and basal keratinocytes. This disruption was dose dependent and culminated in striking degenerative changes in these cells. Superficial keratinocytes and Langerhans cells were not affected. It was concluded that the XeF excimer laser is capable of organelle-specific injury to melanosomes. These findings may have important clinical implications in the treatment of both benign and malignant pigmented lesions by laser radiations of defined wave lengths and pulse durations.

  2. High-definition optical coherence tomography imaging of melanocytic lesions

    DEFF Research Database (Denmark)

    Boone, Marc A L M; Norrenberg, Sarah; Jemec, Gregor B E

    2014-01-01

    and cytologic features of melanocytic lesions. All lesions were examined by one observer clinically and using dermoscopy. Cross-sectional HD-OCT images were compared with histopathology. En face HD-OCT images were compared with reflectance confocal microscopy (RCM). Twenty-six melanocytic lesions of 26 patients...... with sufficient resolution and penetration depth to discriminate architectural patterns and cytologic features of pigmented cells in epidermis and dermis. The method appears to offer the possibility of additional three-dimensional structural information complementary to that of RCM, albeit at a slightly lower...

  3. The epidermal melanocyte system in individuals of Scandinavian origin, determined by DOPA-staining and TEM

    DEFF Research Database (Denmark)

    Drzewiecki, K T; Piltz-Drzewiecka, J

    1979-01-01

    The quantitative evaluation of DOPA-positive epidermal melanocytes in 16 patients of Scandinavian origin showed both individual and regional differences in the melanocyte count. Our data is in agreement with other published studies. The distribution in the number of melanocytes varies significant...

  4. Recent Updates in Melanocyte Function: The Use of Promising Bioactive Compounds for the Treatment of Hypopigmentary Disorders.

    Science.gov (United States)

    Ali, Sharique A; Naaz, Ishrat; Zaidi, Kamal Uddin; Ali, Ayesha S

    2017-01-01

    Skin pigmentation is a broadly appearing phenomenon in nature which plays an important task of determining the appearance and biology of all vertebrates including human beings. Skin color is a crucial attribute, determined by the synthesis of melanin pigment within melanocytes by the process of melanogenesis and is regulated by many extrinsic as well as intrinsic factors. Tyrosinase catalyzes the key step of melanogenesis, dysfunction of tyrosinase leads to reduce melanin production which results in severe clinical and aesthetical problems of hypopigmentation. Therefore, the regulation of melanin production is an important strategy in the treatment of abnormal skin pigmentation for cosmetic and medicinal purpose. The present review covers the various aspects of mammalian melanocyte biology which will help in the identification of key regulators of melanogenesis from pharmaceutical and pharmacological point of view. Further sections of the review focus on the dysfunctions of melanogenic pathways, which result in severe clinical and aesthetical problems of hypopigmentation. We have also attempted to highlight the ability of available scientifically validated plant extracts to naturally enhance melanin synthesis in order to cure hypopigmentation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  5. Analytical validation of a melanoma diagnostic gene signature using formalin-fixed paraffin-embedded melanocytic lesions.

    Science.gov (United States)

    Warf, M Bryan; Flake, Darl D; Adams, Doug; Gutin, Alexander; Kolquist, Kathryn A; Wenstrup, Richard J; Roa, Benjamin B

    2015-01-01

    These studies were to validate the analytical performance of a gene expression signature that differentiates melanoma and nevi, using RNA expression from 14 signature genes and nine normalization genes that generates a melanoma diagnostic score (MDS). Formalin-fixed paraffin-embedded melanocytic lesions were evaluated in these studies. The overall SD of the assay was determined to be 0.69 MDS units. Individual amplicons within the signature had an average amplification efficiency of 92% and a SD less than 0.5 CT. The MDS was reproducible across a 2000-fold dilution range of input RNA. Melanin, an inhibitor of PCR, does not interfere with the signature. These studies indicate this signature is robust and reproducible and is analytically validated on formalin-fixed paraffin-embedded melanocytic lesions.

  6. Towards a "free radical theory of graying": melanocyte apoptosis in the aging human hair follicle is an indicator of oxidative stress induced tissue damage.

    Science.gov (United States)

    Arck, Petra Clara; Overall, Rupert; Spatz, Katharina; Liezman, Christiane; Handjiski, Bori; Klapp, Burghard F; Birch-Machin, Mark A; Peters, Eva Milena Johanne

    2006-07-01

    Oxidative stress is generated by a multitude of environmental and endogenous challenges such as radiation, inflammation, or psychoemotional stress. It also speeds the aging process. Graying is a prominent but little understood feature of aging. Intriguingly, the continuous melanin synthesis in the growing (anagen) hair follicle generates high oxidative stress. We therefore hypothesize that hair bulb melanocytes are especially susceptible to free radical-induced aging. To test this hypothesis, we subjected human scalp skin anagen hair follicles from graying individuals to macroscopic and immunohistomorphometric analysis and organ culture. We found evidence of melanocyte apoptosis and increased oxidative stress in the pigmentary unit of graying hair follicles. The "common" deletion, a marker mitochondrial DNA-deletion for accumulating oxidative stress damage, occurred most prominently in graying hair follicles. Cultured unpigmented hair follicles grew better than pigmented follicles of the same donors. Finally, cultured pigmented hair follicles exposed to exogenous oxidative stress (hydroquinone) showed increased melanocyte apoptosis in the hair bulb. We conclude that oxidative stress is high in hair follicle melanocytes and leads to their selective premature aging and apoptosis. The graying hair follicle, therefore, offers a unique model system to study oxidative stress and aging and to test antiaging therapeutics in their ability to slow down or even stop this process.

  7. Effects of Extremely Low Frequency Electromagnetic Fields on Melanogenesis through p-ERK and p-SAPK/JNK Pathways in Human Melanocytes

    Directory of Open Access Journals (Sweden)

    Yu-Mi Kim

    2017-10-01

    Full Text Available This study evaluated frequency-dependent effects of extremely low frequency electromagnetic fields (ELF-EMFs on melanogenesis by melanocytes in vitro. Melanocytes were exposed to 2 mT EMFs at 30–75 Hz for 3 days before melanogenesis was examined. Exposure to ELF-EMFs at 50 and 60 Hz induced melanogenic maturation without cell damage, without changing cell proliferation and mitochondrial activity. Melanin content and tyrosinase activity of cells exposed to 50 Hz were higher than in controls, and mRNA expression of tyrosinase-related protein-2 was elevated relative to controls at 50 Hz. Phosphorylated cyclic adenosine monophosphate response element-binding protein (p-CREB levels were higher than controls in cells exposed to ELF-EMFs at 50–75 Hz. Immunohistochemical staining showed that melanocyte-specific markers (HMB45, Melan-A were strongly expressed in cells exposed to EMFs at 50 and 60 Hz compared to controls. Thus, exposure to ELF-EMFs at 50 Hz could stimulate melanogenesis in melanocytes, through activation of p-CREB and p-p38 and inhibition of phosphorylated extracellular signal-regulated protein kinase and phosphorylated stress-activated protein kinase/c-Jun N-terminal kinase. The results may form the basis of an appropriate anti-gray hair treatment or be applied in a therapeutic device for inducing repigmentation in the skin of vitiligo patients.

  8. Structural studies of α-melanocyte-stimulating hormone and a novel β-melanocyte-stimulating hormone from the neurointermediate lobe of the pituitary of the dogfish Squalus acanthias

    Science.gov (United States)

    Bennett, Hugh P. J.; Lowry, Philip J.; McMartin, Colin; Scott, Alexander P.

    1974-01-01

    A melanocyte-stimulating hormone (MSH) has been isolated from extracts of the neurointermediate lobe of the pituitary of the dogfish Squalus acanthias by gel-filtration and ion-exchange chromatography. It had approximately 1% of the potency of mammalian α-MSH on bioassays in vitro on frog skin and dogfish skin. Sequence analysis revealed it to be a hexadecapeptide with the following primary structure: Asp-Gly-Asp-Asp-Tyr-Lys-Phe-Gly-His-Phe-Arg-Trp-Ser-Val-Pro-Leu. It appears to be related to the β-MSH species of mammalian species but has only the sequence -His-Phe-Arg-Trp- in common with the heptapeptide core -Met-Glu-His-Phe-Arg-Trp-Gly- which is characteristic not only of the MSH peptides but also of the adrenocorticotrophins and lipotrophins studied so far. An α-MSH was also isolated, 50% of which was amidated at the C-terminus group. Sequence data from this study taken in conjunction with those from a previous study (Lowry & Chadwick, 1970b) revealed it to be a tridecapeptide which is identical with the N-terminal sequence of dogfish adrenocorticotrophin. PMID:4375978

  9. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  10. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-01-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  11. FISH analysis for diagnostic evaluation of challenging melanocytic lesions.

    Science.gov (United States)

    Zimmermann, A K; Hirschmann, A; Pfeiffer, D; Paredes, B E; Diebold, J

    2010-09-01

    The differential diagnosis of malignant melanomas and atypical melanocytic nevi is still a diagnostic challenge. The currently accepted morphologic criteria show substantial interobserver variability, likewise immunohistochemical studies are often not able to discriminate these lesions reliably. Techniques that support diagnostic accuracy are of the greatest importance considering the growing incidence of malignant melanomas and their increase in younger patients. In this study we analyzed the feasibility of fluorescence in situ hybridization (FISH) analysis for the discrimination of malignant and benign melanocytic tumors. A panel of DNA probes was used to detect chromosomal aberrations of chromosomes 6 and 11. On a series of 5 clearly malignant and benign melanocytic tumors we confirmed the applicability of the test. Then we focused on examination of ambiguous melanocytic lesions, where atypical cells are often difficult to relocalize in the 4',6-Diamidino-2-phenylindol (DAPI)-fluorescence stain. FISH analyses were conducted on destained H&E-stained slides. By comparison of the DAPI-image with photos taken from the H&E stain, unambiguous assignment of the FISH results to the conspicuous groups of cells was possible. The results of FISH analysis were consistent with the conventional diagnosis in 11 of 14 small ambiguous lesions. Of the remaining 3 cases, 2 showed FISH-results close to the cut-off level. Comparison of FISH results on thin and thick sections revealed that the cut-off values have to be adapted for 2 microm destained sections. In conclusion, FISH analysis is a useful and applicable tool for assessment of even smallest melanocytic neoplasms, although there will remain unclear cases that cannot be solved even after additional FISH evaluation.

  12. Aberrant expression of HMB-45 in traumatized melanocytic nevi.

    Science.gov (United States)

    Leleux, Todd M; Prieto, Victor G; Diwan, A Hafeez

    2012-09-01

    Assessment of histologic and immunohistochemical maturation (with HMB-45 and anti-Ki-67) may be helpful in differentiating benign melanocytic nevi (BMN) from malignant melanoma. Recently, we reported loss of maturation and aberrant immunohistochemical findings in melanocytic nevi after liquid nitrogen cryotherapy (Adeniran et al, J Am Acad Dermatol 2009;61:341-5). Herein we report a similar phenomenon identified in traumatized melanocytic nevi (TMN). We sought to evaluate the histologic and immunohistochemical findings in early and late stages of traumatized nevi. Twenty-four cases of TMN were retrieved from the pathology archives. These were then assessed by two pathologists (T.L. and A.H.D.) using HMB-45 and MIB-1 (for Ki-67) antibodies. TMN showed some of the following findings: epidermal changes (parakeratosis, ulceration, serum crust, flattening of the epidermis) and dermal changes including fibrosis and the presence of melanophages. In some cases, there was architectural disorder of the overlying melanocytes, with crowding in the basal layer, but without significant pagetoid spread. Occasionally, the dermal scar contained larger, more epithelioid-appearing melanocytes than those beneath the scar. Fifty-four percent of TMN lacked obvious immunohistochemical maturation with HMB-45, since nevus cells within the scar or directly beneath it were strongly labeled. None of the TMN showed appreciable labeling for Ki-67. The exact clinical duration between trauma and biopsy could not be determined. Loss of maturation with HMB-45 in TMN can be a diagnostic pitfall in challenging cases. Concurrent evaluation of MIB-1 expression, along with the characteristic histologic features of trauma, should allow the correct diagnosis to be reached. Copyright © 2011 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  13. Melanin-concentrating hormone and its receptor are expressed and functional in human skin.

    Science.gov (United States)

    Hoogduijn, Martin J; Ancans, Janis; Suzuki, Itaru; Estdale, Siân; Thody, Anthony J

    2002-08-23

    In this study, we have demonstrated the presence of melanin-concentrating hormone (MCH) and melanin-concentrating hormone receptor (MCHR1) transcripts in human skin. Sequence analysis confirmed that the transcripts of both genes were identical to those previously found in human brain. In culture, endothelial cells showed pro-MCH expression whereas no signal was found in keratinocytes, melanocytes, and fibroblasts. MCHR1 expression was restricted to melanocytes and melanoma cells. Stimulation of cultured human melanocytes with MCH reduced the alpha-MSH-induced increase in cAMP production. Furthermore, the melanogenic actions of alpha-MSH were inhibited by MCH. We propose that the MCH/MCHR1 signalling system is present in human skin and may have a role with the melanocortins in regulating the melanocyte.

  14. Refractometry of melanocyte cell nuclei using optical scatter images recorded by digital Fourier microscopy.

    Science.gov (United States)

    Seet, Katrina Y T; Nieminen, Timo A; Zvyagin, Andrei V

    2009-01-01

    The cell nucleus is the dominant optical scatterer in the cell. Neoplastic cells are characterized by cell nucleus polymorphism and polychromism-i.e., the nuclei exhibits an increase in the distribution of both size and refractive index. The relative size parameter, and its distribution, is proportional to the product of the nucleus size and its relative refractive index and is a useful discriminant between normal and abnormal (cancerous) cells. We demonstrate a recently introduced holographic technique, digital Fourier microscopy (DFM), to provide a sensitive measure of this relative size parameter. Fourier holograms were recorded and optical scatter of individual scatterers were extracted and modeled with Mie theory to determine the relative size parameter. The relative size parameter of individual melanocyte cell nuclei were found to be 16.5+/-0.2, which gives a cell nucleus refractive index of 1.38+/-0.01 and is in good agreement with previously reported data. The relative size parameters of individual malignant melanocyte cell nuclei are expected to be greater than 16.5.

  15. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  16. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  17. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    OpenAIRE

    Sobanska, Anna W.; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present ...

  18. Melanocytic Nevi Prevalence and the Relationship with Sun Exposure Among School Children

    Directory of Open Access Journals (Sweden)

    Neslihan Şendur

    2009-12-01

    Full Text Available Background and Design: Melanocytic nevi (MN count is known as the strongest risk factor for melanoma development. So it is important to know the MN count in public. We aimed to determine the MN prevalence in schoolchildren and also clarify the possible relation between MN counts, constitutional variables and sun exposure. Material and Method: In this randomized, cross-sectional study, a questionnaire asking skin phenotypes and sun exposure in previous summer was prepared for primary-school children. Nine hundred and sixty questionnaires distributed to the parents. Children who were given permission by parents for examination were examined for whole body MN. Results: Questionnaires were answered by parents of 939 children and 622 children (316 boys and 306 girls were examined. Mean age of children was 8.8±1.5 (6-12. Mean MN count was 19.6±16.6 and this count was increasing with age (p<0.001. MN count was significantly related with sex, skin phototype and skin colour. More MN were found in boys (p<0.001, children with sun sensitive phototypes (p=0.03 and light skin colour (p<0.001. Time spent outside on midday in previous summer was not related with the MN count (p=0.35. Sunburns experienced in previous summer were not related with MN count (p=0.11. MN were most densely located on the face, and then on upper extremity, trunk and lower extremity in decreasing order. There were more MN on the more sun exposed sites of the arms, hands and feet. Conclusion: It was found that previous summer sun exposure had no effect on MN count in schoolchildren. However, relation between MN count and skin phenotype and distribution of the MN on the body suggest that sun exposure could affect MN count and this effect could be seen in a long period of time.

  19. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.

    1981-01-01

    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  20. Aqueous humor tyrosinase activity is indicative of iris melanocyte toxicity.

    Science.gov (United States)

    Mahanty, Sarmistha; Kawali, Ankush A; Dakappa, Shruthi Shirur; Mahendradas, Padmamalini; Kurian, Mathew; Kharbanda, Varun; Shetty, Rohit; Setty, Subba Rao Gangi

    2017-09-01

    Antibiotics such as fluoroquinolones (FQLs) are commonly used to treat ocular infections but are also known to cause dermal melanocyte toxicity. The release of dispersed pigments from the iris into the aqueous humor has been considered a possible ocular side effect of the systemic administration of FQLs such as Moxifloxacin, and this condition is known as bilateral acute iris transillumination (BAIT). Bilateral acute depigmentation of iris (BADI) is a similar condition, with iris pigment released into the aqueous, but it has not been reported as a side effect of FQL. Iris pigments are synthesized by the melanogenic enzyme tyrosinase (TYR) and can be detected but not quantified by using slit-lamp biomicroscopy. The correlation between dispersed pigments in the aqueous and the extent of melanocyte toxicity due to topical antibiotics in vivo is not well studied. Here, we aimed to study the effect of topical FQLs on iris tissue, the pigment release in the aqueous humor and the development of clinically evident iris atrophic changes. We evaluated this process by measuring the activity of TYR in the aqueous humor of 82 healthy eyes undergoing cataract surgery following topical application of FQLs such as Moxifloxacin (27 eyes, preservative-free) or Ciprofloxacin (29 eyes, with preservative) or the application of non-FQL Tobramycin (26 eyes, with preservative) as a control. In addition, the patients were questioned and examined for ocular side effects in pre- and post-operative periods. Our data showed a significantly higher mean TYR activity in the aqueous humor of Ciprofloxacin-treated eyes compared to Moxifloxacin- (preservative free, p iris melanocytes. However, the reduced TYR activity in the aqueous of Moxifloxacin-treated eyes was possibly due to the presence of a higher drug concentration, which inhibits TYR activity. Consistently, immunoblotting analysis of the aqueous humor from both Ciprofloxacin- and Moxifloxacin-treated eyes showed the presence of soluble

  1. Effect of treatment in fractionated schedules with the combination of x-irradiation and six cytotoxic drugs on the RIF-1 tumor and normal mouse skin

    International Nuclear Information System (INIS)

    Lelieveld, P.; Scoles, M.A.; Brown, J.M.; Phil, D.; Kallman, R.F.

    1985-01-01

    RIF-1 tumors, implanted syngeneically in the gastrocnemius muscles of the right hind legs of C3H/Km mice, were treated either with X ray alone, drug alone, or drug and X ray combined. The drugs tested were bleomycin, BCNU, cis-diamminedichloro platinum, adriamycin, cyclophosphamide, and actinomycin-D. All drugs were administered either in the maximum tolerated dose or a dose that causes minimal tumor growth delay. Both drugs and X rays were administered either as a single dose or in five daily fractions. In addition to the single modality controls, seven different schedules of combined modalities were tested. Tumors were measured periodically after treatment in order that the day at which each tumor reached 4 times its initial cross-sectional area, i.e., its size at the time of treatment, could be determined. The effect of treatment on tumors was based upon excess growth delay (GD), i.e., T400% (treated)-T400% (untreated control). Treatment effects for the same combined modality schedules were also determined for normal skin, using the early skin reaction as an endpoint. Dose effect factors (DEF) were computed for all combined modality schedules and were based upon calculated radiation dose equivalents. We also calculated supra-additivity ratios, SR/sub I/ and SR/sub II/, therapeutic gain factors and adjusted therapeutic gain factors. The only drugs to produce significant supra-additivity with X rays were cis-Pt and cyclo

  2. Targeting PI3K-AKT-mTOR by LY3023414 inhibits human skin squamous cell carcinoma cell growth in vitro and in vivo.

    Science.gov (United States)

    Zou, Ying; Ge, Minggai; Wang, Xuemin

    2017-08-19

    Abnormal activation of PI3K-AKT-mTOR signaling is detected in human skin squamous cell carcinoma (SCC). LY3023414 is a novel, potent, and orally bio-available PI3K-AKT-mTOR inhibitor. Its activity against human skin SCC cells was tested. We demonstrated that LY3023414 was cytotoxic when added to established (A431 line) and primary (patient-derived) human skin SCC cells. LY3023414 induced G0/1-S arrest and inhibited proliferation of skin SCC cells. Moreover, LY3023414 induced activation of caspase-3/-9 and apoptosis in skin SCC cells. Intriguingly, LY3023414 was yet non-cytotoxic nor pro-apoptotic to normal human skin cells (melanocytes, keratinocytes and fibroblasts). At the molecular level, LY3023414 blocked PI3K-AKT-mTOR activation in skin SCC cells, as it dephosphorylated PI3K-AKT-mTOR substrates: P85, AKT and S6K1. In vivo studies showed that oral administration of LY3023414 at well-tolerated doses inhibited A431 xenograft tumor growth in severe combined immunodeficiency (SCID) mice. AKT-mTOR activation in LY3023414-treated tumors was also largely inhibited. Together, these results suggest that targeting PI3K-AKT-mTOR by LY3023414 inhibits human skin SCC cell growth in vitro and in vivo, establishing the rationale for further clinical testing. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  4. Quantification of sunscreen ethylhexyl triazone in topical skin-care products by normal-phase TLC/densitometry.

    Science.gov (United States)

    Sobanska, Anna W; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot(-1). Both methods were validated.

  5. Ultrastructural demonstration of chemical modification of melanogenesis in hairless mouse skin

    International Nuclear Information System (INIS)

    Nishimura, M.; Gellin, G.A.; Hoshino, S.; Epstein, J.H.; Epstein, W.L.; Fukuyama, K.

    1982-01-01

    We investigated chemical and physical modifications of the genetically determined ultrastructure of melanosomes. The flank skin of hairless mice was treated with ultraviolet energy (UV) shorter than 320 nm or with a combination of a photosensitizer and UV (PUVA treatment). All melanosomes in the induced melanocytes and those in resident melanocytes in the ear skin showed eumelanogenesis, although the degree of melanin deposition differed considerably according to the induction process. Eumelanogenesis was most advanced in the resident melanocytes while PUVA-induced melanocytes showed more immature premelanosomes. We then topically applied 4-tertiary butyl catechol on the skin. The depigmenting agent caused an appearance of pheomelanosomes. The alteration in melanogenesis was seen most distinctly in premelanosomes of the PUVA-induced cells. Altered ultrastructure was also observed in matured melanosomes; this change was most apparent in the resident melanocytes. These findings indicate that cells with eumelanogenesis may undergo pheomelanogenesis. The present study demonstrated effects of chemicals on genetically determined function of melanocytes by quantitative analysis of melanosome ultrastructure

  6. Premalignant quiescent melanocytic nevi do not express the MHC class I chain-related protein A Los nevos melanocíticos premalignos quiescentes no expresan la molécula MHC class I chain-related protein A

    Directory of Open Access Journals (Sweden)

    Mercedes B. Fuertes

    2011-08-01

    Full Text Available The MHC class I chain-related protein A (MICA is an inducible molecule almost not expressed by normal cells but strongly up-regulated in tumor cells. MICA-expressing cells are recognized by natural killer (NK cells, CD8+ aßTCR and ?dTCR T lymphocytes through the NKG2D receptor. Engagement of NKG2D by MICA triggers IFN-? secretion and cytotoxicity against malignant cells. Although most solid tumors express MICA and this molecule is a target during immune surveillance against tumors, it has been observed that high grade tumors from different histotypes express low amounts of cell surface MICA due to a metalloprotease- induced shedding. Also, melanomas develop after a complex process of neotransformation of normal melanocytes. However, the expression of MICA in premalignant stages (primary human quiescent melanocytic nevi remains unknown. Here, we assessed expression of MICA by flow cytometry using cell suspensions from 15 primary nevi isolated from 11 patients. When collected material was abundant, cell lysates were prepared and MICA expression was also analyzed by Western blot. We observed that MICA was undetectable in the 15 primary nevi (intradermic, junction, mixed, lentigo and congenital samples as well as in normal skin, benign lesions (seborrheic keratosis, premalignant lesions (actinic keratosis and benign basocellular cancer. Conversely, a primary recently diagnosed melanoma showed intense cell surface MICA. We conclude that the onset of MICA expression is a tightly regulated process that occurs after melanocytes trespass the stage of malignant transformation. Thus, analysis of MICA expression in tissue sections of skin samples may constitute a useful marker to differentiate between benign and malignant nevi.MHC class I chain-related protein A (MICA es una molécula casi ausente en células normales pero sobre-expresada por células tumorales, que promueve el reconocimiento por células citotóxicas naturales (natural killer o NK y por

  7. Asymmetry and irregularity border as discrimination factor between melanocytic lesions

    Science.gov (United States)

    Sbrissa, David; Pratavieira, Sebastião.; Salvio, Ana Gabriela; Kurachi, Cristina; Bagnato, Vanderlei Salvadori; Costa, Luciano Da Fontoura; Travieso, Gonzalo

    2015-06-01

    Image processing tools have been widely used in systems supporting medical diagnosis. The use of mobile devices for the diagnosis of melanoma can assist doctors and improve their diagnosis of a melanocytic lesion. This study proposes a method of image analysis for melanoma discrimination from other types of melanocytic lesions, such as regular and atypical nevi. The process is based on extracting features related with asymmetry and border irregularity. It were collected 104 images, from medical database of two years. The images were obtained with standard digital cameras without lighting and scale control. Metrics relating to the characteristics of shape, asymmetry and curvature of the contour were extracted from segmented images. Linear Discriminant Analysis was performed for dimensionality reduction and data visualization. Segmentation results showed good efficiency in the process, with approximately 88:5% accuracy. Validation results presents sensibility and specificity 85% and 70% for melanoma detection, respectively.

  8. [Effect of Tribulus terrestris extract on melanocyte-stimulating hormone expression in mouse hair follicles].

    Science.gov (United States)

    Yang, Liu; Lu, Jian-wei; An, Jing; Jiang, Xuan

    2006-12-01

    To observe the effect of Tribulus terrestris extract on melanocyte stimulating hormone (MSH) expression in C57BL/6J mouse hair follicles, and investigate the role of Tribulus terrestris extract in activation, proliferation, epidermal migration of dormant hair follicle melanocytes. The aqueous extract of Tribulus terrestris was administered orally in specific pathogen-free C57BL/6J mouse at the daily dose equivalent to 1 g/1 kg in adult human, and the expression and distribution of MSH in the mouse hair follicles was observed with immunohistochemistry. The positivity rate of MSH expression in the hair follicle melanocytes was 75% in mice treated with the extract, significantly higher than the rate of only 18.75% in the control group (PTribulus terrestris can significantly increase MSH expression in the hair follicle melanocytes by activating tyrosinase activity and promoting melanocyte proliferation, melanine synthesis, and epidermal migration of dormant melanocytes.

  9. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...

  10. Influence of variation in melanin content on absorbance spectra of liquid skin phantoms

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2010-09-01

    Full Text Available content on absorbance spectra of liquid skin phantoms JE Smit, AE Karsten, AF Grobler, RW Sparrow Presented by JE Smit Date: 25 September 2010 circle6 Background circle6 Why study melanin? circle6 Skin pigments, melanocytes, melanosomes, melanin...

  11. Double optical fibre-probe device for the diagnosis of melanocytic lesions

    Science.gov (United States)

    Cicchi, Riccardo; Cosci, Alessandro; Rossari, Susanna; De Giorgi, Vincenzo; Kapsokalyvas, Dimitrios; Massi, Daniela; Pavone, Francesco S.

    2012-06-01

    We have designed and developed an optical fiber-probe for spectroscopic measurements on human tissues. The experimental setup combines fluorescence spectroscopy and Raman spectroscopy in a multidimensional approach. Concerning fluorescence spectroscopy, the excitation is provided by two laser diodes, one emitting in the UV (378 nm) and the other emitting in the visible (445 nm). These two lasers are used to selectively excite fluorescence from NADH and FAD, which are among the brightest endogenous fluorophores in human tissues. For Raman and NIR spectroscopy, the excitation is provided by a third laser diode with 785 nm excitation wavelength. Laser light is delivered to the tissue through the central optical fiber of a fiber bundle. The surrounding 48 fibers of the bundle are used for collecting fluorescence and Raman and for delivering light to the spectrograph. Fluorescence and Raman spectra are acquired on a cooled CCD camera. The instrument has been tested on fresh human skin biopsies clinically diagnosed as malignant melanoma, melanocytic nevus, or healthy skin, finding an optimal correlation with the subsequent histological exam. In some cases our examination was not in agreement with the clinical observation, but it was with the histological exam, demonstrating that the system can potentially contribute to improve clinical diagnostic capabilities and hence reduce the number of unnecessary biopsies.

  12. Essential role of RAB27A in determining constitutive human skin color.

    Directory of Open Access Journals (Sweden)

    Yasuko Yoshida-Amano

    Full Text Available Human skin color is predominantly determined by melanin produced in melanosomes within melanocytes and subsequently distributed to keratinocytes. There are many studies that have proposed mechanisms underlying ethnic skin color variations, whereas the processes involved from melanin synthesis in melanocytes to the transfer of melanosomes to keratinocytes are common among humans. Apart from the activities in the melanogenic rate-limiting enzyme, tyrosinase, in melanocytes and the amounts and distribution patterns of melanosomes in keratinocytes, the abilities of the actin-associated factors in charge of melanosome transport within melanocytes also regulate pigmentation. Mutations in genes encoding melanosome transport-related molecules, such as MYO5A, RAB27A and SLAC-2A, have been reported to cause a human pigmentary disease known as Griscelli syndrome, which is associated with diluted skin and hair color. Thus we hypothesized that process might play a role in modulating skin color variations. To address that hypothesis, the correlations of expression of RAB27A and its specific effector, SLAC2-A, to melanogenic ability were evaluated in comparison with tyrosinase, using human melanocytes derived from 19 individuals of varying skin types. Following the finding of the highest correlation in RAB27A expression to the melanogenic ability, darkly-pigmented melanocytes with significantly higher RAB27A expression were found to transfer significantly more melanosomes to keratinocytes than lightly-pigmented melanocytes in co-culture and in human skin substitutes (HSSs in vivo, resulting in darker skin color in concert with the difference observed in African-descent and Caucasian skins. Additionally, RAB27A knockdown by a lentivirus-derived shRNA in melanocytes concomitantly demonstrated a significantly reduced number of transferred melanosomes to keratinocytes in co-culture and a significantly diminished epidermal melanin content skin color intensity (

  13. NEAR-INFRARED AUTOFLUORESCENCE IN BILATERAL DIFFUSE UVEAL MELANOCYTIC PROLIFERATION ASSOCIATED WITH ESOPHAGEAL CARCINOMA AND CHOROIDAL METASTASIS.

    Science.gov (United States)

    Golshahi, Azadeh; Bornfeld, Norbert; Weinitz, Silke; Kellner, Ulrich

    2016-01-01

    To investigate the advantage of near-infrared autofluorescence (787 nm) for the detection of melanocytic lesions in a patient with bilateral diffuse uveal melanocytic proliferation in association with esophageal carcinoma complicated by most likely unilateral choroidal metastasis. In this retrospective case report, a 55-year-old woman referred for the evaluation of sudden visual loss underwent normal ophthalmological evaluation and, in addition, was examined with near-infrared reflectance, near-infrared autofluorescence, fundus autofluorescence (Heidelberg Retina Angiograph II [HRA2; Heidelberg Engineering]), spectral domain optical coherence tomography (Spectralis OCT; Heidelberg Engineering), and multifocal electroretinography (RetiScan; Roland Consult). The patient had been diagnosed with esophageal carcinoma 3 months before the onset of visual symptoms. The visual acuity was 20/40 in the right eye and 20/20 in the left eye. Bilateral patchy melanocytic proliferation was detected on ophthalmoscopy. The extent of lesions was best detected with near-infrared reflectance and near-infrared autofluorescence, whereas fundus autofluorescence and spectral domain optical coherence tomography did not reveal alterations of the outer retina or retinal pigment epithelium in this early stage of bilateral diffuse uveal melanocytic proliferation. The right eye showed in addition to the findings on the left eye choroidal folds in the fovea and an elevated lesion inferotemporal of the fovea suspicious of a choroidal metastasis. In the B-scan ultrasonography, a homogenous lesion was seen. Spectral domain optical coherence tomography demonstrated a mild accumulation of subretinal fluid adjacent to and over the choroidal metastasis. Transretinal biopsy of this elevated lesion revealed a low differentiated carcinoma of squamous epithelium, compatible with choroidal metastasis of the esophageal carcinoma. The choroidal metastasis increased within 3 months after the first visit. The

  14. Skin graft - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

  15. Proteomic Mass Spectrometry Imaging for Skin Cancer Diagnosis.

    Science.gov (United States)

    Lazova, Rossitza; Seeley, Erin H

    2017-10-01

    Mass spectrometry imaging can be successfully used for skin cancer diagnosis, particularly for the diagnosis of challenging melanocytic lesions. This method analyzes proteins within benign and malignant melanocytic tumor cells and, based on their differences, which constitute a unique molecular signature of 5 to 20 proteins, can render a diagnosis of benign nevus versus malignant melanoma. Mass spectrometry imaging may assist in the differentiation between metastases and nevi as well as between proliferative nodules in nevi and melanoma arising in a nevus. In the difficult area of atypical Spitzoid neoplasms, mass spectrometry diagnosis can predict clinical outcome better than histopathology. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  17. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Science.gov (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

    2015-01-01

    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  18. A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, M A L M; Suppa, M; Marneffe, A

    2016-01-01

    properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....

  19. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    International Nuclear Information System (INIS)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E.

    1991-01-01

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  20. Proteomics reveals novel oxidative and glycolytic mechanisms in type 1 diabetic patients' skin which are normalized by kidney-pancreas transplantation.

    Directory of Open Access Journals (Sweden)

    Franco Folli

    2010-03-01

    Full Text Available In type 1 diabetes (T1D vascular complications such as accelerated atherosclerosis and diffused macro-/microangiopathy are linked to chronic hyperglycemia with a mechanism that is not yet well understood. End-stage renal disease (ESRD worsens most diabetic complications, particularly, the risk of morbidity and mortality from cardiovascular disease is increased several fold.We evaluated protein regulation and expression in skin biopsies obtained from T1D patients with and without ESRD, to identify pathways of persistent cellular changes linked to diabetic vascular disease. We therefore examined pathways that may be normalized by restoration of normoglycemia with kidney-pancreas (KP transplantation. Using proteomic and ultrastructural approaches, multiple alterations in the expression of proteins involved in oxidative stress (catalase, superoxide dismutase 1, Hsp27, Hsp60, ATP synthase delta chain, and flavin reductase, aerobic and anaerobic glycolysis (ACBP, pyruvate kinase muscle isozyme, and phosphoglycerate kinase 1, and intracellular signaling (stratifin-14-3-3, S100-calcyclin, cathepsin, and PPI rotamase as well as endothelial vascular abnormalities were identified in T1D and T1D+ESRD patients. These abnormalities were reversed after KP transplant. Increased plasma levels of malondialdehyde were observed in T1D and T1D+ESRD patients, confirming increased oxidative stress which was normalized after KP transplant.Our data suggests persistent cellular changes of anti-oxidative machinery and of aerobic/anaerobic glycolysis are present in T1D and T1D+ESRD patients, and these abnormalities may play a key role in the pathogenesis of hyperglycemia-related vascular complications. Restoration of normoglycemia and removal of uremia with KP transplant can correct these abnormalities. Some of these identified pathways may become potential therapeutic targets for a new generation of drugs.

  1. Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1987-01-01

    We have analyzed the pattern of protein synthesis in solar near ultraviolet (334 nm, 365 nm) and near visible (405 nm) irradiated normal human skin fibroblasts. Two hours after irradiation we find that one major stress protein of approximately 32 kDa is induced in irradiated cells. This protein is not induced by ultraviolet radiation at wavelengths shorter than 334 nm and is not inducible by heat shock treatment of these cells. Although sodium arsenite, diamide, and menadione all induced a 32-kDa protein, they also induced the major heat shock proteins. In contrast, the oxidizing agent, hydrogen peroxide, induced the low molecular weight stress protein without causing induction of the major heat shock proteins. A comparison of the 32-kDa proteins induced by sodium arsenite, H 2 O 2 , and solar near ultraviolet radiation using chemical peptide mapping shows that they are closely related. These results imply that the pathways for induction of the heat shock response and the 32-kDa protein are not identical and suggest that, at least in the case of radiation and treatment with H 2 O 2 , the 32-kDa protein might be induced in response to cellular oxidative stress. This conclusion is supported by the observation that depletion of endogenous cellular glutathione prior to solar near ultraviolet irradiation lowers the fluence threshold for induction of the 32-kDa stress protein

  2. A rare case of unilateral diffuse melanocytic proliferation

    Directory of Open Access Journals (Sweden)

    Guruprasad Ayachit

    2018-01-01

    Full Text Available A 67-year-old woman presented with metamorphopsia in the right eye. Leopard mottling was seen temporal to the fovea oculus dexter with corresponding hyper- and hypo-autofluorescent lesions on fundus autofluorescence. Spectral domain-optical coherence tomography revealed hyperreflective dots in the retinal pigment epithelium and choroid with subretinal fluid (SRF. Intravitreal bevacizumab was administered with which SRF resolved, albeit with increase in the areas of mottling. The patient was diagnosed to have metastatic ductal carcinoma of the right breast. It is important to bear in mind that the well-known entity of bilateral diffuse uveal melanocytic proliferation can rarely present unilaterally.

  3. Pharmacological induction of skin pigmentation unveils the neuroendocrine circuit regulated by light.

    Science.gov (United States)

    Bertolesi, Gabriel E; Vazhappilly, Sherene T; Hehr, Carrie L; McFarlane, Sarah

    2016-03-01

    Light-regulated skin colour change is an important physiological process in invertebrates and lower vertebrates, and includes daily circadian variation and camouflage (i.e. background adaptation). The photoactivation of melanopsin-expressing retinal ganglion cells (mRGCs) in the eye initiates an uncharacterized neuroendocrine circuit that regulates melanin dispersion/aggregation through the secretion of alpha-melanocyte-stimulating hormone (α-MSH). We developed experimental models of normal or enucleated Xenopus embryos, as well as in situ cultures of skin of isolated dorsal head and tails, to analyse pharmacological induction of skin pigmentation and α-MSH synthesis. Both processes are triggered by a melanopsin inhibitor, AA92593, as well as chloride channel modulators. The AA9253 effect is eye-dependent, while functional data in vivo point to GABAA receptors expressed on pituitary melanotrope cells as the chloride channel blocker target. Based on the pharmacological data, we suggest a neuroendocrine circuit linking mRGCs with α-MSH secretion, which is used normally during background adaptation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Oral melanocytic nevi: Report of two cases with immunohistochemical elaboration of their probable origin and maturation

    Directory of Open Access Journals (Sweden)

    Dipti Dutta

    2015-01-01

    Full Text Available Oral melanocytic nevi are localized developmental tissue malformations of nevus cells in the oral mucosa. Relatively rare in occurrence compared to their dermal counterparts, considerable debate exists in the literature related to their origin, development and maturation, and their relationship to oral melanocytes.We report two cases of oral melanocytic nevi with classical clinical presentation. The histopathology was consistent with the known patterns of oral melanocytic nevi. Special stains such as Masson Fontana, further substantiated the observation. S-100 and HMB-45 were applied to immunohistochemically elaborate the cell population. Interestingly two distinct cell populations were detected in the lesions. "Type A" cells in the center of the lesion were S-100 positive, indicating a neural origin and immaturity in development, while peripheral "type B" cells stained positive with HMB-45, indicating melanocytic origin and mature development.

  5. Differences in MITF gene expression and histology between albino and normal sea cucumbers ( Apostichopus japonicus Selenka)

    Science.gov (United States)

    Zhao, Heling; Yang, Hongsheng; Zhao, Huan; Liu, Shilin; Wang, Tianming

    2012-01-01

    Albino Apostichopus japonicus occur both in the wild and in captivity. The offspring of albino A. japonicus also suffer from albinism. The formation of melanin in the melanocytes is dependant on microphthalmia-associated transcription factor (MITF). To investigate the role of MITF in controlling albinism, we cloned the full-length MITF cDNA from A. japonicus and compared MITF mRNA expression in albino and normal A. japonicus. In addition, we used light and electron microscopy to compare histological samples of normal and albino A. japonicus. The body wall of albino adults was characterized by significantly lower levels of MITF expression and lower numbers of epidermal melanocytes, which also contained less melanin. In albino juvenile offspring, MITF expression levels were significantly lower 32 d after fertilization and there were fewer, and less developed, epidermal melanocytes. Thus, we conclude that albino A. japonicus have fewer melanocytes and a reduced ability to synthesize melanin, likely because of lower expression of MITF.

  6. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    International Nuclear Information System (INIS)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  7. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  8. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  9. Inhibition of systemic inflammation by central action of the neuropeptide alpha-melanocyte- stimulating hormone.

    Science.gov (United States)

    Delgado Hernàndez, R; Demitri, M T; Carlin, A; Meazza, C; Villa, P; Ghezzi, P; Lipton, J M; Catania, A

    1999-01-01

    The neuropeptide alpha-melanocyte stimulating hormone (alpha-MSH) reduces fever and acute inflammation in the skin when administered centrally. The aim of the present research was to determine whether central alpha-MSH can also reduce signs of systemic inflammation in mice with endotoxemia. Increases in serum tumor necrosis factor-alpha and nitric oxide, induced by intraperitoneal administration of endotoxin, were modulated by central injection of a small concentration of alpha-MSH. Inducible nitric oxide synthase (iNOS) activity and iNOS mRNA in lungs and liver were likewise modulated by central alpha-MSH. Lung myeloperoxidase activity, a marker of neutrophil infiltration, was increased in endotoxemic mice; the increase was significantly less in lungs of mice treated with central alpha-MSH. Intraperitoneal administration of the small dose of alpha-MSH that was effective centrally did not alter any of the markers of inflammation. In experiments using immunoneutralization of central alpha-MSH, we tested the idea that endogenous peptide induced within the brain during systemic inflammation modulates host responses to endotoxic challenge in peripheral tissues. The data showed that proinflammatory agents induced by endotoxin in the circulation, lungs, and liver were significantly greater after blockade of central alpha-MSH. The results suggest that anti-inflammatory influences of neural origin that are triggered by alpha-MSH could be used to treat systemic inflammation.

  10. Knowledge and perception of melanocytic nevi and sunburn in young children.

    Science.gov (United States)

    Richtig, Erika; Jung, Erika; Asbäck, Katharina; Trapp, Michael; Hofmann-Wellenhof, Rainer

    2009-01-01

    Understanding the public's perception of nevi and sunburn is crucial to melanoma prevention efforts. We investigated the knowledge and perception of melanocytic nevi and sunburns in 77 children 6 to 10 years old (mean 8.2) in two elementary schools in Styria, Austria. The children were interviewed by specially trained psychologists about the number of their moles and how they felt having them. Additionally questions about sunburn history and sunburn perception were asked. The spontaneous answers of the children were recorded, there were no pregiven answers. Afterwards the children were examined by dermatologists clinically and with dermatoscopes. The 96% of the children could describe a nevus (the term "mole" was translated to "nevus") and 91% did not feel bothered about theirs. Only 26% had noted the appearance of new nevi within the last year. The 67% of all children had at least one sunburn and remembered the clinical features. The 20% of the children knew that sunburns could provoke skin cancer. All children felt comfortable during the clinical and dermatoscopic examination. Children aged from 6 to 10 years know exactly why they had suffered from sunburn, can describe the sunburn and how to avoid it. They do not feel bothered by their nevi and are alert to the appearance of new nevi.

  11. Dermoscopic patterns of melanocytic nevi in children and adolescents: a cross-sectional study*

    Science.gov (United States)

    Piazza, Christiane Donato; Yamada, Sergio; Marcassi, Aline P; Maciel, Marina G; Seize, Maria P; Cestari, Silmara C P

    2017-01-01

    Background Childhood is a dynamic period regarding nevogenesis. Dermoscopy is a noninvasive technique, recommended for the evaluation of pigmented cutaneous lesions. Objectives The purpose of this study was to describe the structures and dermoscopic patterns of melanocytic nevi observed in children and adolescents. Methods Dermoscopy with photographic documentation was used for nevi located on the face, trunk, and extremities of 38 patients aged from one to 16 years examined at the Pediatric Dermatology Outpatient Clinic of the Federal University of São Paulo. Results The study included 201 skin lesions that were diagnosed as nevi during clinic examination. Upon evaluation of the global dermoscopic pattern of the lesions, the most frequently observed nevi were reticular (39.0%), followed by homogeneous (23.9%) and globular nevi (16.4%). During evaluation of the dermoscopic structures, according to the body site, the pigment network was the most observed in the extremities. Study limitations A limitation to be considered is that the inclusion of small or new lesions may hinder the differentiation between dots and globules. Conclusions In our study, the most observed pattern was reticular. There was a difference in the predominance of structures dependent on the anatomical location. PMID:29186245

  12. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  13. YY1 regulates melanocyte development and function by cooperating with MITF.

    Directory of Open Access Journals (Sweden)

    Juying Li

    Full Text Available Studies of coat color mutants have greatly contributed to the discovery of genes that regulate melanocyte development and function. Here, we generated Yy1 conditional knockout mice in the melanocyte-lineage and observed profound melanocyte deficiency and premature gray hair, similar to the loss of melanocytes in human piebaldism and Waardenburg syndrome. Although YY1 is a ubiquitous transcription factor, YY1 interacts with M-MITF, the Waardenburg Syndrome IIA gene and a master transcriptional regulator of melanocytes. YY1 cooperates with M-MITF in regulating the expression of piebaldism gene KIT and multiple additional pigmentation genes. Moreover, ChIP-seq identified genome-wide YY1 targets in the melanocyte lineage. These studies mechanistically link genes implicated in human conditions of melanocyte deficiency and reveal how a ubiquitous factor (YY1 gains lineage-specific functions by co-regulating gene expression with a lineage-restricted factor (M-MITF-a general mechanism which may confer tissue-specific gene expression in multiple lineages.

  14. Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

    Science.gov (United States)

    Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

    2000-11-01

    When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

  15. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    International Nuclear Information System (INIS)

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-01-01

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure

  16. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chantarawong, Wipa [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Inter Departmental Multidisciplinary Graduate Program in Bioscience, Faculty of Science, Kasetsart University, Bangkok (Thailand); Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Pradermwong, Kantimanee [Department of Zoology, Faculty of Science, Kasetsart University, Bangkok (Thailand); Shibahara, Shigeki, E-mail: shibahar@med.tohoku.ac.jp [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan)

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  17. Expression of cytosolic NADP(+)-dependent isocitrate dehydrogenase in melanocytes and its role as an antioxidant.

    Science.gov (United States)

    Kim, Ji Young; Shin, Jae Yong; Kim, Miri; Hann, Seung-Kyung; Oh, Sang Ho

    2012-02-01

    Cytosolic NADP(+)-dependent ICDH (IDPc) has an antioxidant effect as a supplier of NADPH to the cytosol, which is needed for the production of glutathione. To evaluate the expression of IDPc in melanocytes and to elucidate its role as an antioxidant. The knock-down of IDPc expression in immortalized mouse melanocyte cell lines (melan-a) was performed using the short interfering RNA (siRNA)-targeted gene silencing method. After confirming the silencing of IDPc expression with mRNA and protein levels, viability, apoptosis and necrosis, as well as ROS production in IDPc-silenced melanocytes were monitored under conditions of oxidative stress and non-stress. Also, the ratio of oxidized glutathione to total glutathione was examined, and whether the addition of glutathione recovered cell viability, decreased by oxidant stress, was checked. The expression of IDPc in both primary human melanocytes and melan-a cells was confirmed by Western blot and RT-PCR. The silencing of IDPc expression by transfecting IDPc siRNA in melan-a cells was observed by Western blotting and real-time RT-PCR. IDPc knock-down cells showed significantly decreased cell viability and an increased number of cells under apoptosis and necrosis. IDPc siRNA-treated melanocytes demonstrated a higher intensity of DCFDA after the addition of H(2)O(2) compared with scrambled siRNA-treated melanocytes, and a lower ratio of reduced glutathione to oxidized glutathione were observed in IDPc siRNA transfected melanocytes. In addition, the addition of glutathione recovered cell viability, which was previously decreased after incubation with H(2)O(2). This study suggests that decreased IDPc expression renders melanocytes more vulnerable to oxidative stress, and IDPc plays an important antioxidant function in melanocytes. Copyright © 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  18. Association between melanocytic neoplasms and seborrheic keratosis: more than a coincidental collision?

    Science.gov (United States)

    DeFazio, Jennifer; Zalaudek, Iris; Busam, Klaus J.; Cota, Carlo; Marghoob, Ashfaq

    2012-01-01

    Clinical observations and an expanding knowledge of cell-to-cell communication have led us to speculate that the finding of a melanocytic nevus in conjunction with a seborrheic keratosis is more than a coincidental collision of two lesions. Here we present five cases demonstrating dermoscopic features of both melanocytic lesions and seborrheic keratoses with corresponding histology. Four cases demonstrate dermoscopic features of a melanocytic nevus and seborrheic keratosis, and the final case a melanoma arising in association with a seborrheic keratosis. PMID:23785597

  19. Isolation, Culture, and Motility Measurements of Epidermal Melanocytes from GFP-Expressing Reporter Mice.

    Science.gov (United States)

    Dagnino, Lina; Crawford, Melissa

    2018-03-27

    In this article, we provide a method to isolate primary epidermal melanocytes from reporter mice, which also allow targeted gene inactivation. The mice from which these cells are isolated are bred into a Rosa26 mT/mG reporter background, which results in GFP expression in the targeted melanocytic cell population. These cells are isolated and cultured to >95% purity. The cells can be used for gene expression studies, clonogenic experiments, and biological assays, such as capacity for migration. Melanocytes are slow moving cells, and we also provide a method to measure motility using individual cell tracking and data analysis.

  20. Effect of Novel Marine Nutraceuticals on IL-1α-Mediated TNF-α Release from UVB-Irradiated Human Melanocyte-Derived Cells

    Directory of Open Access Journals (Sweden)

    Visalini Muthusamy

    2011-01-01

    Full Text Available UV-induced inflammation and reactive oxygen species formation are involved in the development of melanoma. Natural products like 5β-scymnol and CO2-supercritical fluid extract (CO2-SFE of mussel oil contain anti-inflammatory and antioxidant properties that may aid in reducing the deleterious effects of UV radiation. Therefore, their effect on the release of the proinflammatory cytokine, tumour necrosis factor-α (TNF-α, from UVB-irradiated human melanocytic cells was examined. Human epidermal melanocytes (HEM and MM96L melanoma cells were exposed to UVB radiation and IL-1α. Cell viability and TNF-α levels were determined 24 hours after-irradiation while p38 mitogen-activated protein kinase (MAPK activation was observed at 15 min after-irradiation. When α-tocopherol, CO2-SFE mussel oil, and 5β-scymnol were added to the UVB-irradiated HEM cells treated with IL-1α, TNF-α levels fell by 53%, 65%, and 76%, respectively, while no inhibition was evident in MM96L cells. This effect was not due to inhibition of the intracellular p38 MAPK signalling pathway. These compounds may be useful in preventing inflammation-induced damage to normal melanocytes.

  1. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  2. Study of skin and nail Candida species as a normal flora based on age groups in healthy persons in Tehran-Iran.

    Science.gov (United States)

    Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F

    2017-12-01

    The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.

  3. Ecto-mesenchymal stem cells from dental pulp are committed to differentiate into active melanocytes

    Directory of Open Access Journals (Sweden)

    F Paino

    2010-10-01

    Full Text Available Dental pulp stem cells (DPSCs are multipotent stem cells derived from neural crest and mesenchyme and have the capacity to differentiate into multiple cell lineages. It has already been demonstrated that DPSCs differentiate into melanocyte-like cells but only when cultivated in a specific melanocyte differentiating medium. In this study we have shown, for the first time, that DPSCs are capable of spontaneously differentiating into mature melanocytes, which display molecular and ultrastructural features of full development, including the expression of melanocyte specific markers and the presence of melanosomes up to the terminal stage of maturation. We have also compared the differentiating features of DPSCs grown in different culture conditions, following the timing of differentiation at molecular and cytochemical levels and found that in all culture conditions full development of these cells was obtained, although at different times. The spontaneous differentiating potential of these cells strongly suggests their possible applications in regenerative medicine.

  4. Blood Supply--Susceptible Formation of Melanin Pigment in Hair Bulb Melanocytes of Mice

    Directory of Open Access Journals (Sweden)

    Shogo Maeda, MD

    2015-03-01

    Conclusions: Melanin pigment formation in the hair bulb melanocytes appeared to be susceptible to the blood supply, and melanocytosis was promoted in the follicles and in the epidermis of Kitl-Tg C57BL/6 mice.

  5. Blood flow in skin, subcutaneous adipose tissue and skeletal muscle in the forearm of normal man during an oral glucose load

    DEFF Research Database (Denmark)

    Bülow, J; Astrup, A; Christensen, N J

    1987-01-01

    Blood flow to the forearm, and the subcutaneous tissue and skin in the forearm were measured by strain gauge plethysmography, 133Xe-elimination and Laser Doppler flowmetry during an oral glucose load (I g glucose kg-1 lean body mass) and during control conditions. The forearm blood flow remained...... constant during both experiments. Glucose induced a two-fold vasodilatation in subcutaneous tissue. In skin, glucose induced a relative vasodilatation and later a relative vasoconstriction compared with control experiments. When estimated from forearm blood flow and subcutaneous and skin blood flows......, muscle blood flow decreased about 20-30% during both experiments. Proximal nervous blockade did not abolish the glucose-induced vasodilatation in subcutaneous tissue. In the glucose experiment, arterial glucose concentration increased to 7.8 +/- 1.17 mmol l-1 30 min after the load was given...

  6. Comparative cytogenetic characterization of primary canine melanocytic lesions using array CGH and fluorescence in situ hybridization

    OpenAIRE

    Poorman, Kelsey; Borst, Luke; Moroff, Scott; Roy, Siddharth; Labelle, Philippe; Motsinger-Reif, Alison; Breen, Matthew

    2014-01-01

    Melanocytic lesions originating from the oral mucosa or cutaneous epithelium are common in the general dog population, with up to 100,000 diagnoses each year in the USA. Oral melanoma is the most frequent canine neoplasm of the oral cavity, exhibiting a highly aggressive course. Cutaneous melanocytomas occur frequently, but rarely develop into a malignant form. Despite the differential prognosis, it has been assumed that subtypes of melanocytic lesions represent the same disease. To address t...

  7. High resolution skin colorimetry, strain mapping and mechanobiology.

    Science.gov (United States)

    Devillers, C; Piérard-Franchimont, C; Schreder, A; Docquier, V; Piérard, G E

    2010-08-01

    Skin colours are notoriously different between individuals. They are governed by ethnicities and phototypes, and further influenced by a variety of factors including photoexposures and sustained mechanical stress. Indeed, mechanobiology is a feature affecting the epidermal melanization. High-resolution epiluminescence colorimetry helps in deciphering the effects of forces generated by Langer's lines or relaxed skin tension lines on the melanocyte activity. The same procedure shows a prominent laddering pattern of melanization in striae distensae contrasting with the regular honeycomb pattern in the surrounding skin.

  8. (2)Maintaining Beauty Through Skin Care(Well-aging-Present State of Rejuvenation Medicine, The 73rd General Meeting of the Society of Tokyo Women's Medical University)

    OpenAIRE

    川島, 眞; Makoto, KAWASHIMA

    2008-01-01

    Dry skin, senile freckles and wrinkles are major symptoms of aged skin. Dry skin is caused by the decrease of skin surface lipids, natural moisturizing factors and intercellular lipids of the stratum corneum. Senile freckles are the deposition of melanin pigments on the basal layer of the epidermis which is brought about by the activation of melanocytes through UV exposure and the delay in the turnover rate of epidermal cells due to aging. Wrinkles are caused by UV-induced damage to collagen ...

  9. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.

    2011-01-01

    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  10. Substantial Effect of Melanin Influencing Factors on Melanogenesis in Muzzle Melanocytes of Differently Colored Hanwoo

    Directory of Open Access Journals (Sweden)

    Touseef Amna

    2012-07-01

    Full Text Available The present study was designed to investigate the effect of α-melanocyte-stimulating hormone (α-MSH, nitric oxide (NO and L-cysteine on melanin production and expression of related genes MC1R, Tyr, Tyrp-1 and Tyrp-2 in muzzle melanocytes of differently colored three native Hanwoo cattle. Muzzle samples were taken from black, brindle and brown Hanwoo and purified melanocytes were cultured with α-MSH, nitric oxide and L-cysteine at 100 nM, 50 µM and 0.07 mg/ml of media respectively. The amounts of total melanin, eumelanin and mRNA expression at Tyr, Tyrp-1, Tyrp-2 and MC1R levels were quantified. α-MSH and nitric oxide significantly increased (p<0.05 the amount of total melanin in black and brindle whereas eumelanin production in brown Hanwoo muzzle melanocytes. On the contrary, L-cysteine greatly (p<0.05 depressed the eumelanin production in black color but increased in brown. Simultaneously, up regulation of Tyr by nitric oxide and α-MSH and down regulation of Tyr, Tyrp-2 and MC1R genes by L-cysteine were observed in muzzle melanocytes of all three phenotypes. The results of this study revealed nitric oxide and α-MSH contribute hyper-pigmentation by enhancing eumelanogenesis whereas L-cysteine contributes to pheomelanin production in different colored Hanwoo muzzle melanocytes.

  11. PPARalpha/gamma expression and activity in mouse and human melanocytes and melanoma cells.

    Science.gov (United States)

    Eastham, Linda L; Mills, Caroline N; Niles, Richard M

    2008-06-01

    We examined the expression of PPARs and the effects of PPARalpha and PPARgamma agonists on growth of mouse and human melanocytes and melanoma cells. PPARalpha,beta, and PPARgamma mRNA qualitative expression in melan-a mouse melanocytes, B16 mouse melanoma, human melanocytes, and A375 and SK-mel28 human melanoma cells was determined by RT-PCR, while quantitative PPARalpha mRNA levels were determined by QuantiGene assay. PPARalpha and PPARgamma protein was assessed by Western blotting. The effect of natural and synthetic PPAR ligands on cell growth was determined by either hemocytometer counting or crystal violet assay. PPAR transcriptional activity was determined by a PPRE-reporter gene assay, while knockdown of PPARalpha expression was achieved by transient transfection of siRNA. Both mouse and human melanoma cells produced more PPARalpha and PPARgamma protein compared to melanocytes. PPARalpha mRNA levels were elevated in human melanoma cells, but not in mouse melanoma cells relative to melanocytes. Silencing of PPARalpha in human melanoma cells did not alter cell proliferation or morphology. PPARgamma-selective agonists inhibited the growth of both mouse and human melanoma cells, while PPARalpha-selective agonists had limited effects. Increased expression of PPARalpha in melanoma relative to melanocytes may be a common occurrence, however its biologic significance remains to be determined. PPARgamma agonists may be useful for arresting the growth of some melanomas.

  12. Oncogenic mutations in melanomas and benign melanocytic nevi of the female genital tract.

    Science.gov (United States)

    Tseng, Diane; Kim, Julie; Warrick, Andrea; Nelson, Dylan; Pukay, Marina; Beadling, Carol; Heinrich, Michael; Selim, Maria Angelica; Corless, Christopher L; Nelson, Kelly

    2014-08-01

    The genetic heterogeneity of melanomas and melanocytic nevi of the female genital tract is poorly understood. We aim to characterize the frequency of mutations of the following genes: BRAF, NRAS, KIT, GNA11, and GNAQ in female genital tract melanomas. We also characterize the frequency of BRAF mutations in female genital tract melanomas compared with melanocytic nevi. Mutational screening was performed on the following female genital tract melanocytic neoplasms: 25 melanomas, 7 benign melanocytic nevi, and 4 atypical melanocytic nevi. Of the 25 female genital tract melanoma specimens queried, KIT mutations were detected in 4 (16.0%), NRAS mutations in 4 (16.0%), and BRAF mutations in 2 (8.0%) samples. Two of the tumors with KIT mutations harbored double mutations in the same exon. No GNAQ or GNA11 mutations were identified among 11 melanomas screened. BRAF V600E mutations were detected in 7 of 7 benign melanocytic genital nevi (100%) and 3 of 4 atypical genital nevi (75%). Our study is limited by the small sample size of this rare subset of melanomas. KIT, NRAS, and BRAF mutations are found in a subset of female genital tract melanomas. Screening for oncogenic mutations is important for developing and applying clinical therapies for melanomas of the female genital tract. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  13. Noncultured keratinocyte/melanocyte cosuspension: effect on reepithelialization and repigmentation--a randomized, placebo-controlled study.

    Science.gov (United States)

    Back, Christopher; Dearman, Bronwyn; Li, Amy; Neild, Tim; Greenwood, John E

    2009-01-01

    Randomized controlled trials in the literature investigating the efficacy of noncultured keratinocyte/melanocyte suspensions are scarce; however, the advocates of such techniques press the value of their application based largely on case studies and anecdote. Caucasian patients with burn hypopigmentation seldom request cosmetic revision making worthwhile clinical trials difficult so that informal case treatments with new therapies generate anecdotal results. A randomized, placebo-controlled trial was carried out to evaluate whether cosuspensions of noncultured skin cells are capable of (1) decreasing the time to reepithelialization and (2) reestablishing pigmentation in vitiligo leukoderma following epidermal/superficial dermal ablation (in the knowledge that a positive result would make the technique likely to be successful in burn hypopigmentation). Vitiligo is common and is socially more debilitating such that suitable trial subjects for new therapies from this pool are more forthcoming. This study demonstrated that suspensions of noncultured keratinocytes and melanocytes do not decrease the time to epithelialization of superficial partial thickness wounds compared with controls. It also suggested that the achievement, quality, and duration of any pigmentation were unpredictable and largely disappointing. Some pigmentation was recorded in placebo-treated areas indicating an effect of the method of epidermal ablation in these patients. These findings have mandated a complete review of the use of these techniques in burn care at the Royal Adelaide Hospital; they have been omitted from surgical protocols where the aim of use was to speed reepithelialization. Their infrequent use in burns hypopigmentation will continue contingent on the successful repigmentation of a test patch.

  14. Development of the springbok skin — colour pattern, hair slope and ...

    African Journals Online (AJOL)

    In the foetal springbok skin, identifiable melanocytes are present before colour patterns are established. These pigment cells fail to appear in the pouch and belly areas, indicating that these zones are piebald and not albinotic. Areas of regional colour differences are sharply separated. Their distinctiveness is caused by a ...

  15. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  16. Effect of Exercise-induced Sweating on facial sebum, stratum corneum hydration, and skin surface pH in normal population.

    Science.gov (United States)

    Wang, Siyu; Zhang, Guirong; Meng, Huimin; Li, Li

    2013-02-01

    Evidence demonstrated that sweat was an important factor affecting skin physiological properties. We intended to assess the effects of exercise-induced sweating on the sebum, stratum corneum (SC) hydration and skin surface pH of facial skin. 102 subjects (aged 5-60, divided into five groups) were enrolled to be measured by a combination device called 'Derma Unit SSC3' in their frontal and zygomatic regions when they were in a resting state (RS), at the beginning of sweating (BS), during excessive sweating (ES) and an hour after sweating (AS), respectively. Compared to the RS, SC hydration in both regions increased at the BS or during ES, and sebum increased at the BS but lower during ES. Compared to during ES, Sebum increased in AS but lower than RS. Compared to the RS, pH decreased in both regions at the BS in the majority of groups, and increased in frontal region during ES and in zygomatic region in the AS. There was an increase in pH in both regions during ES in the majority of groups compared to the BS, but a decrease in the AS compared to during ES. The study implies that even in summer, after we sweat excessively, lipid products should be applied locally in order to maintain stability of the barrier function of the SC. The study suggests that after a short term(1 h or less) of self adjustment, excessive sweat from moderate exercise will not impair the primary acidic surface pH of the facial skin. Exercise-induced sweating significantly affected the skin physiological properties of facial region. © 2012 John Wiley & Sons A/S.

  17. A modified fluorimetric host cell reactivation assay to determine the repair capacity of primary keratinocytes, melanocytes and fibroblasts

    Directory of Open Access Journals (Sweden)

    Gebhard Daniel

    2010-06-01

    Full Text Available Abstract Background The Host Cell Reactivation Assay (HCRA is widely used to identify circumstances and substances affecting the repair capacity of cells, however, it is restricted by the transfection procedure used and the sensitivity of the detection method. Primary skin cells are particularly difficult to transfect, and therefore sensitive methods are needed to detect any variations due to the cell-type or inter-individual differences or changes induced by diverse substances. A sensitive and repeatable method to detect the repair capacity of skin cells would be useful in two different aspects: On the one hand, to identify substances influencing the repair capacity in a positive manner (these substances could be promising ingredients for cosmetic products and on the other hand, to exclude the negative effects of substances on the repair capacity (this could serve as one step further towards replacing or at least reducing animal testing. Results In this paper, we present a rapid and sensitive assay to determine the repair capacity of primary keratinocytes, melanocytes and fibroblasts based on two wave-length Green Fluorescent Protein (GFP and DsRed reporter technology in order to test different substances and their potential to influence the DNA repair capacity. For the detection of plasmid restoration, we used FACS technology, which, in comparison to luminometer technology, is highly sensitive and allows single cell based analysis. The usefulness of this assay and studying the repair capacity is demonstrated by the evidence that DNA repair is repressed by Cyclosporin A in fibroblasts. Conclusions The methodology described in this paper determines the DNA repair capacity in different types of human skin cells. The described transfection protocol is suitable for the transfection of melanocytes, keratinocytes and fibroblasts, reaching efficacies suitable for the detection of the restored plasmids by FACS technology. Therefore the repair capacity

  18. Combined fluorescence-Raman spectroscopy measurements with an optical fiber probe for the diagnosis of melanocytic lesions

    Science.gov (United States)

    Cosci, Alessandro; Cicchi, Riccardo; Rossari, Susanna; De Giorgi, Vincenzo; Massi, Daniela; Pavone, Francesco S.

    2012-02-01

    We have designed and developed an optical fiber-probe for spectroscopic measurements on human tissues. The experimental setup combines fluorescence spectroscopy and Raman spectroscopy in a multidimensional approach. Concerning fluorescence spectroscopy, the excitation is provided by two laser diodes, one emitting in the UV (378 nm) and the other emitting in the visible (445 nm). These two lasers are used to selectively excite fluorescence from NADH and FAD, which are among the brightest endogenous fluorophores in human tissues. For Raman and NIR spectroscopy, the excitation is provided by a third laser diode with 785 nm excitation wavelength. Laser light is delivered to the tissue through the central optical fiber of a fiber bundle. The surrounding 48 fibers of the bundle are used for collecting fluorescence and Raman and for delivering light to the spectrograph. Fluorescence and Raman spectra are acquired on a cooled CCD camera. The instrument has been tested on fresh human skin biopsies clinically diagnosed as malignant melanoma, melanocytic nevus, or healthy skin, finding an optimal correlation with the subsequent histological exam. In some cases our examination was not in agreement with the clinical observation, but it was with the histological exam, demonstrating that the system can potentially contribute to improve clinical diagnostic capabilities and hence reduce the number of unnecessary biopsies.

  19. Proof-of-concept: 3D bioprinting of pigmented human skin constructs.

    Science.gov (United States)

    Ng, Wei Long; Qi, Jovina Tan Zhi; Yeong, Wai Yee; Naing, May Win

    2018-01-23

    Three-dimensional (3D) pigmented human skin constructs have been fabricated using a 3D bioprinting approach. The 3D pigmented human skin constructs are obtained from using three different types of skin cells (keratinocytes, melanocytes and fibroblasts from three different skin donors) and they exhibit similar constitutive pigmentation (pale pigmentation) as the skin donors. A two-step drop-on-demand bioprinting strategy facilitates the deposition of cell droplets to emulate the epidermal melanin units (pre-defined patterning of keratinocytes and melanocytes at the desired positions) and manipulation of the microenvironment to fabricate 3D biomimetic hierarchical porous structures found in native skin tissue. The 3D bioprinted pigmented skin constructs are compared to the pigmented skin constructs fabricated by conventional a manual-casting approach; in-depth characterization of both the 3D pigmented skin constructs has indicated that the 3D bioprinted skin constructs have a higher degree of resemblance to native skin tissue in term of the presence of well-developed stratified epidermal layers and the presence of a continuous layer of basement membrane proteins as compared to the manually-cast samples. The 3D bioprinting approach facilitates the development of 3D in vitro pigmented human skin constructs for potential toxicology testing and fundamental cell biology research.

  20. Skin β-Endorphin Mediates Addiction to UV Light

    OpenAIRE

    Fell, Gillian L.; Robinson, Kathleen C.; Mao, Jianren; Woolf, Clifford J.; Fisher, David E.

    2014-01-01

    Ultraviolet light is an established carcinogen yet evidence suggests that UV-seeking behavior has addictive features. Following UV exposure, epidermal keratinocytes synthesize Proopiomelanocortin that is processed to Melanocyte Stimulating Hormone, inducing tanning. We show that in rodents another POMC-derived peptide, β-endorphin, is coordinately synthesized in skin, elevating plasma levels after low-dose UV. Increases in pain-related thresholds are observed, and reversed by pharmacologic op...

  1. Efficacy of keishibukuryogan, a traditional Japanese herbal medicine, in treating cold sensation and numbness after stroke: clinical improvement and skin temperature normalization in 22 stroke patients.

    Science.gov (United States)

    Fujita, Keishi; Yamamoto, Tetsuya; Kamezaki, Takao; Matsumura, Akira

    2010-01-01

    Cold sensation and numbness have been reported as post-stroke sensory sequelae attributable to distal axonopathy, which is caused by chronic ischemia of diseased limbs resulting from dysfunction of vasomotor regulatory systems. Keishibukuryogan is a traditional herbal medicine used to treat symptoms of peripheral ischemia such as cold extremities. This study investigated clinical improvement and skin temperature in peripheral ischemia patients to determine the efficacy of keishibukuryogan in alleviating post-stroke cold sensation and numbness. Twenty-two stroke patients with cold sensation and/or numbness were enrolled in this study. Subjective cold sensation and numbness, evaluated using the visual analogue scale, were found in 21 and 31 limbs, respectively. The skin temperature of diseased and healthy limbs was recorded. We observed all patients for 4 weeks and 17 patients for 8 weeks after administration of keishibukuryogan. The skin temperature of diseased limbs was significantly higher than baseline at 4 weeks and 8 weeks, whereas that of healthy limbs did not change significantly. Cold sensation and numbness were significantly improved at 4 weeks and 8 weeks compared to baseline. Keishibukuryogan administration resulted in warming of diseased limbs and improved cold sensation and numbness, probably by increasing peripheral blood flow.

  2. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  3. A subpopulation of smooth muscle cells, derived from melanocyte-competent precursors, prevents patent ductus arteriosus.

    Directory of Open Access Journals (Sweden)

    Ichiro Yajima

    Full Text Available BACKGROUND: Patent ductus arteriosus is a life-threatening condition frequent in premature newborns but also present in some term infants. Current mouse models of this malformation generally lead to perinatal death, not reproducing the full phenotypic spectrum in humans, in whom genetic inheritance appears complex. The ductus arteriosus (DA, a temporary fetal vessel that bypasses the lungs by shunting the aortic arch to the pulmonary artery, is constituted by smooth muscle cells of distinct origins (SMC1 and SMC2 and many fewer melanocytes. To understand novel mechanisms preventing DA closure at birth, we evaluated the importance of cell fate specification in SMC that form the DA during embryonic development. Upon specific Tyr::Cre-driven activation of Wnt/β-catenin signaling at the time of cell fate specification, melanocytes replaced the SMC2 population of the DA, suggesting that SMC2 and melanocytes have a common precursor. The number of SMC1 in the DA remained similar to that in controls, but insufficient to allow full DA closure at birth. Thus, there was no cellular compensation by SMC1 for the loss of SMC2. Mice in which only melanocytes were genetically ablated after specification from their potential common precursor with SMC2, demonstrated that differentiated melanocytes themselves do not affect DA closure. Loss of the SMC2 population, independent of the presence of melanocytes, is therefore a cause of patent ductus arteriosus and premature death in the first months of life. Our results indicate that patent ductus arteriosus can result from the insufficient differentiation, proliferation, or contractility of a specific smooth muscle subpopulation that shares a common neural crest precursor with cardiovascular melanocytes.

  4. A Subpopulation of Smooth Muscle Cells, Derived from Melanocyte-Competent Precursors, Prevents Patent Ductus Arteriosus

    Science.gov (United States)

    Puig, Isabel; Champeval, Delphine; Kumasaka, Mayuko; Belloir, Elodie; Bonaventure, Jacky; Mark, Manuel; Yamamoto, Hiroaki; Taketo, Mark M.; Choquet, Philippe; Etchevers, Heather C.; Beermann, Friedrich; Delmas, Véronique; Monassier, Laurent; Larue, Lionel

    2013-01-01

    Background Patent ductus arteriosus is a life-threatening condition frequent in premature newborns but also present in some term infants. Current mouse models of this malformation generally lead to perinatal death, not reproducing the full phenotypic spectrum in humans, in whom genetic inheritance appears complex. The ductus arteriosus (DA), a temporary fetal vessel that bypasses the lungs by shunting the aortic arch to the pulmonary artery, is constituted by smooth muscle cells of distinct origins (SMC1 and SMC2) and many fewer melanocytes. To understand novel mechanisms preventing DA closure at birth, we evaluated the importance of cell fate specification in SMC that form the DA during embryonic development. Upon specific Tyr::Cre-driven activation of Wnt/β-catenin signaling at the time of cell fate specification, melanocytes replaced the SMC2 population of the DA, suggesting that SMC2 and melanocytes have a common precursor. The number of SMC1 in the DA remained similar to that in controls, but insufficient to allow full DA closure at birth. Thus, there was no cellular compensation by SMC1 for the loss of SMC2. Mice in which only melanocytes were genetically ablated after specification from their potential common precursor with SMC2, demonstrated that differentiated melanocytes themselves do not affect DA closure. Loss of the SMC2 population, independent of the presence of melanocytes, is therefore a cause of patent ductus arteriosus and premature death in the first months of life. Our results indicate that patent ductus arteriosus can result from the insufficient differentiation, proliferation, or contractility of a specific smooth muscle subpopulation that shares a common neural crest precursor with cardiovascular melanocytes. PMID:23382837

  5. Examining the Impact of Skin Lighteners In Vitro

    Directory of Open Access Journals (Sweden)

    James V. Gruber

    2013-01-01

    Full Text Available Three cosmetically important skin lightening agents, hydroquinone (HQ, kojic acid (KA, and niacinamide (NA, consume the bulk of successful skin lightening ingredients in cosmetic applications. However, the mechanisms by which these ingredients work are still unclear. In this study, melanocytes and keratinocytes were treated with high, nontoxic doses of HQ, KA, and NA and the cells were examined by human microarrays and protein assays for several important targets including cytotoxicity, melanin expression, tyrosinase gene (TYR and protein expression, melanocortin-1 receptor (MC1R gene and protein expression, cytochrome c oxidase-1 (COX1 gene and protein expression, and ferritin (FTH1 gene and protein expression. It was found that all the skin lighteners examined showed marked increases in TYR, COX1, and FTH1 gene and protein expression, but not in MC1R expression in melanocytes. Upregulation of COX1 and FTH1 genes and proteins was common across both cell lines, melanocytes and keratinocytes. The results of the tyrosinase expression were somewhat unexpected. The role of iron in the expression of melanin is somewhat unexplored, but common and strong upregulation of ferritin protein in both types of cells due to the treatments suggests that iron plays a more pivotal role in melanin synthesis than previously anticipated.

  6. Differential susceptibility of primary cultured human skin cells to hypericin PDT in an in vitro model.

    Science.gov (United States)

    Popovic, A; Wiggins, T; Davids, L M

    2015-08-01

    Skin cancer is the most common cancer worldwide, and its incidence rate in South Africa is increasing. Photodynamic therapy (PDT) has been shown to be an effective treatment modality, through topical administration, for treatment of non-melanoma skin cancers. Our group investigates hypericin-induced PDT (HYP-PDT) for the treatment of both non-melanoma and melanoma skin cancers. However, a prerequisite for effective cancer treatments is efficient and selective targeting of the tumoral cells with minimal collateral damage to the surrounding normal cells, as it is well established that cancer therapies have bystander effects on normal cells in the body, often causing undesirable side effects. The aim of this study was to investigate the cellular and molecular effects of HYP-PDT on normal primary human keratinocytes (Kc), melanocytes (Mc) and fibroblasts (Fb) in an in vitro tissue culture model which represented both the epidermal and dermal cellular compartments of human skin. Cell viability analysis revealed a differential cytotoxic response to a range of HYP-PDT doses in all the human skin cell types, showing that Fb (LD50=1.75μM) were the most susceptible to HYP-PDT, followed by Mc (LD50=3.5μM) and Kc (LD50>4μM HYP-PDT) These results correlated with the morphological analysis which displayed distinct morphological changes in Fb and Mc, 24h post treatment with non-lethal (1μM) and lethal (3μM) doses of HYP-PDT, but the highest HYP-PDT doses had no effect on Kc morphology. Fluorescent microscopy displayed cytoplasmic localization of HYP in all the 3 skin cell types and additionally, HYP was excluded from the nuclei in all the cell types. Intracellular ROS levels measured in Fb at 3μM HYP-PDT, displayed a significant 3.8 fold (phuman skin cells thus highlighting the efficacy and indeed, the potential bystander effect of if administered in vivo. This study contributes toward our knowledge of the cellular response of the epidermis to photodynamic therapies and

  7. Dermoscopic features of melanocytic skin lesions in Greek children and adolescents and their association with environmental factors and skin types.

    Science.gov (United States)

    Papakonstantinou, A; Ioannides, D; Vakirlis, E; Savvoulidis, C; Lallas, A; Apalla, Z; Sotiriou, E; Lazaridou, E

    2018-04-06

    Acquired naevi often present in childhood and increase in number and size during early and middle life. As naevi represent potential mimickers of melanoma, the knowledge of their epidemiologic and morphologic characteristics is essential. In this study, we intend to determine the prevalence of dermoscopic patterns of naevi, as well their association with environmental and constitutional factors. Cross-sectional data derived from a population-based cohort of children and adolescents aged 6-18 years, from 12 different schools in Thessaloniki, Greece. For each participant, a consent form and a questionnaire were completed, which included data on age, sex, phototype, sun sensitivity, sun exposure, sunscreen use and previous sunburn history. All naevi, their body distribution, and their dermoscopic patterns were recorded. Two thousand and five hundred and five (2505) subjects were enrolled into the study (47.8% males and 52.2% females). The mean number of MN counted in a single person was 29.11 (SD = ±23.863). TNC increased continuously with higher age. Males were found to have a significantly increased number on the trunk (11.7 ± 11.2 and 10.0 ± 8.7, respectively, P < 0.001) and face and neck (6.2 ± 5.3 and 5.1 ± 4.3, respectively, P < 0.001) while females on the upper (10.3 ± 10.1 and 9.3 ± 9.4, respectively, P = 0.008) and lower extremities (2.8 ± 3.4 and 2.5 ± 3.2, respectively, P = 0.008). Globular pattern was the most frequent dominant pattern in lower age groups, and its percentage fell as age increased. On the contrary, the reticular pattern was more often documented in individuals in adolescence. This first study of MN in our young population aims to be the basis of further investigation for the MM preventive policy of our state. © 2018 European Academy of Dermatology and Venereology.

  8. Oxidative stress-induced overexpression of miR-25: the mechanism underlying the degeneration of melanocytes in vitiligo

    Science.gov (United States)

    Shi, Q; Zhang, W; Guo, S; Jian, Z; Li, S; Li, K; Ge, R; Dai, W; Wang, G; Gao, T; Li, C

    2016-01-01

    Oxidative stress has a critical role in the pathogenesis of vitiligo. However, the specific molecular mechanism involved in oxidative stress-induced melanocyte death is not well characterized. Given the powerful role of microRNAs (miRNAs) in the regulation of cell survival as well as the fact that the generation of miRNAs can be affected by oxidative stress, we hypothesized that miRNAs may participate in vitiligo pathogenesis by modulating the expression of vital genes in melanocytes. In the present study, we initially found that miR-25 was increased in both serum and lesion samples from vitiligo patients, and its serum level was correlated with the activity of vitiligo. Moreover, restoration of miR-25 promoted the H2O2-induced melanocyte destruction and led to the dysfunction of melanocytes. Further experiments proved that MITF, a master regulator in melanocyte survival and function, accounted for the miR-25-caused damaging impact on melanocytes. Notably, other than the direct role on melanocytes, we observed that miR-25 inhibited the production and secretion of SCF and bFGF from keratinocytes, thus impairing their paracrine protective effect on the survival of melanocytes under oxidative stress. At last, we verified that oxidative stress could induce the overexpression of miR-25 in both melanocytes and keratinocytes possibly by demethylating the promoter region of miR-25. Taken together, our study demonstrates that oxidative stress-induced overexpression of miR-25 in vitiligo has a crucial role in promoting the degeneration of melanocytes by not only suppressing MITF in melanocytes but also impairing the paracrine protective effect of keratinocytes. Therefore, it is worthy to investigate the possibility of miR-25 as a potential drug target for anti-oxidative therapy in vitiligo. PMID:26315342

  9. The treatment of hypopigmentation after skin resurfacing.

    Science.gov (United States)

    Fulton, James E; Rahimi, A David; Mansoor, Sohail; Helton, Peter; Shitabata, Paul

    2004-01-01

    Hypopigmentation has plagued all methods of skin resurfacing. Whether the physician uses chemical peels, dermabrasion or laser resurfacing hypopigmentation can develop. To examine the pathogenesis and treatment of hypopigmentation after resurfacing. Areas of hypopigmentation after skin resurfacing were blended in with laser-assisted chemabrasion (LACA). The process begins with preconditioning of the skin with vitamin A/glycolic skin conditioning lotions. Then the area is resurfaced with the LACA. This resurfacing usually requires three to four freeze-sand cycles to remove the areas of hypopigmentation associated with dermal fibrosis. The resurfaced skin is then occluded with a combination of polyethylene/silicone sheeting during the acute phase of wound healing. Ultraviolet photography and histologic examination were used to demonstrate the improvement in dermal fibrosis and hypopigmentation. The LACA improved areas of hypopigmentation in the 22 cases studied. Under occlusive wound dressings, the melanocytes migrated into the areas of hypopigmentation, and the wounds healed without extensive fibrosis. This produced a blending of skin color. It is possible with skin preconditioning, LACA, and occlusive wound healing to provide for a wound healing environment that blends in areas of hypopigmentation that have developed after previous skin resurfacing.

  10. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi; Kotani, Eiji; Hirano, Tomoko; Nakajima, Yumiko; Matsumoto, Goichi; Mori, Hajime

    2014-01-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  11. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  12. Comparative potency of formulations of mometasone furoate in terms of inhibition of ′PIRHR′ in the forearm skin of normal human subjects measured with laser doppler velocimetry

    Directory of Open Access Journals (Sweden)

    Kulhalli Prabhakar

    2005-01-01

    Full Text Available BACKGROUND AND AIMS: Topical glucocorticoid formulations are widely used for effective treatment and control of a variety of dermatoses. Mometasone furoate is a newer corticoid that has high potency but low systemic toxicity. Pharmaceutical factors are known to significantly influence potency and systemic absorption of topically applied glucocorticoids. We studied the potency of "Elocon", a topical formulation of mometasone furoate, compared with two other branded formulations of the same corticoid. METHODS: Corticoid potency was measured by employing a pharmacodynamic parameter of an inhibitory effect of the corticoid on post-ischemic-reactive-hyperemic-response (PIRHR in human forearm skin under occlusive dressing. The PIRHR was expressed in terms of % increase in the skin blood flow (SBF as measured with laser doppler velocimetry (LDV. RESULTS : All three active branded formulations of mometasone furoate produced significant inhibition of PIRHR. The AUC(0-2min of PIRHR was ( Mean ± SEM , Control = 213.52 ± 11.80, Placebo = 209.77 ± 19.31, Formulation A = 119.83 ± 13.71, Formulation C = 53.67 ± 4.85 and Formulation D = 111.46 ± 22.87. Formulation "C" exhibited significantly higher topical anti-inflammatory potency than formulations "A" or "D". CONCLUSIONS: Thus, branded formulations of the same glucocorticoid, mometasone furoate significantly differed in their topical anti-inflammatory potency. "Elocon" was significantly more potent than the two other branded formulations studied.

  13. An alternative method for facial resurfacing: supraclavicular skin prefabrication by perforator fascia flap.

    Science.gov (United States)

    Hocaoğlu, Emre

    2014-01-01

    Prefabrication of supraclavicular skin provides a useful source for flaps congruent with the face skin. Among various vascular sources that have been used for this purpose, anterolateral thigh fascia seems to represent a greater value because of having a long and strong vascular pedicle and negligible donor-site morbidity. In this regard, we present a technical report on using the lateral circumflex femoral artery perforator flap harvest technique in preparing an anterolateral thigh fascia flap for the prefabrication of the supraclavicular skin. The technique proved successful in resurfacing the facial skin of a young female patient with a giant congenital melanocytic hairy nevus on the left side of her face.

  14. Immunohistochemical analysis of regulatory T cell markers FOXP3 and GITR on CD4(+) CD25(+) T cells in normal skin and inflammatory dermatoses

    NARCIS (Netherlands)

    de Boer, Onno J.; van der Loos, Chris M.; Teeling, Peter; van der Wal, Allard C.; Teunissen, Marcel B. M.

    2007-01-01

    Regulatory T cells (Treg) are a subset of T lymphocytes that play a central role in immunologic tolerance and in the termination of immune responses. The identification of these cells in normal and inflammatory conditions may contribute to a better understanding of underlying pathology. We

  15. Immunopolarization of CD4(+) and CD8(+) T cells to type-1-like is associated with melanocyte loss in human vitiligo

    NARCIS (Netherlands)

    Wańkowicz-Kalińska, Anna; van den Wijngaard, René M. J. G. J.; Tigges, Bert J.; Westerhof, Wiete; Ogg, Graham S.; Cerundolo, Vincenzo; Storkus, Walter J.; Das, Pranab K.

    2003-01-01

    Vitiligo is an autoimmune condition characterized by loss of epidermal melanocytes. High frequencies of melanocyte-reactive cytotoxic T cells in the peripheral blood of vitiligo patients and the observed correlation between perilesional T-cell infiltration and melanocyte loss in situ suggest the

  16. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  17. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  18. Long-term follow-up of patients undergoing autologous noncultured melanocyte-keratinocyte transplantation for vitiligo and other leukodermas.

    Science.gov (United States)

    Silpa-Archa, Narumol; Griffith, James L; Huggins, Richard H; Henderson, Marsha D; Kerr, Holly A; Jacobsen, Gordon; Mulekar, Sanjeev V; Lim, Henry W; Hamzavi, Iltefat H

    2017-08-01

    Persistence of pigmentation after a melanocyte-keratinocyte transplantation procedure (MKTP) is an important consideration for efficacy. We sought to determine long-term repigmentation of MKTP in vitiligo and other leukodermas. A retrospective review of electronic medical records was conducted for all MKTPs performed at Henry Ford Hospital between January 2009 and April 2014. Repigmentation was assessed by a 5-point grading scale (poor to excellent) and Vitiligo Area Scoring Index (VASI). One hundred patients had MKTP performed at 236 anatomically-based lesions (ABLs); 63 patients with 157 ABLs had long-term data available (12-72 months; median, 24 months). Segmental vitiligo, nonsegmental vitiligo, and physical leukoderma demonstrated improvement in VASI scores: -75.6 ± 24.6%, -59.2 ± 36.6%, and -32.4 ± 33.5%, respectively. In vitiligo, at 24, 48, and 72 months after MKTP, 53%, 64%, and 53% of ABLs, respectively, maintained >75% repigmentation. Skin phototype, age, and anatomic location of ABLs had no significant effect on the outcome of treatment. Limitations of the study include the retrospective design with uncontrolled, postoperative adjuvant treatments and inconsistent compliance to scheduled follow-up evaluations. MKTP provides satisfactory long-term repigmentation in the majority of appropriately selected patients with leukoderma. MKTP can maintain repigmentation for at least 72 months. Copyright © 2017. Published by Elsevier Inc.

  19. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  20. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...

  1. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Markus Böhm

    2016-05-01

    Full Text Available Alpha-melanocyte-stimulating hormone (alpha-MSH increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation.

  2. Shining Light on Skin Pigmentation: The Darker and the Brighter Side of Effects of UV Radiation†

    Science.gov (United States)

    Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi

    2012-01-01

    The term barrier function as applied to human skin often connotes the physical properties of this organ that provide protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on a) the mechanisms of involved in selective effects of subcomponents of UV radiation on human skin pigmentation and b) the interactive influences between keratinocytes and melanocytes, acting as ‘epidermal melanin unit’, that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the non-ionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. PMID:22404235

  3. Shining light on skin pigmentation: the darker and the brighter side of effects of UV radiation.

    Science.gov (United States)

    Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi

    2012-01-01

    The term barrier function as applied to human skin often connotes the physical properties of this organ that provides protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing in the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on (1) the mechanisms involved in selective effects of subcomponents of UV radiation on human skin pigmentation and (2) the interactive influences between keratinocytes and melanocytes, acting as "epidermal melanin unit," that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the nonionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.

  4. Melanocortin 1 receptor genotype: an important determinant of the damage response of melanocytes to ultraviolet radiation

    Science.gov (United States)

    Kadekaro, Ana Luisa; Leachman, Sancy; Kavanagh, Renny J.; Swope, Viki; Cassidy, Pamela; Supp, Dorothy; Sartor, Maureen; Schwemberger, Sandy; Babcock, George; Wakamatsu, Kazumasa; Ito, Shosuke; Koshoffer, Amy; Boissy, Raymond E.; Manga, Prashiela; Sturm, Richard A.; Abdel-Malek, Zalfa A.

    2010-01-01

    The melanocortin 1 receptor gene is a main determinant of human pigmentation, and a melanoma susceptibility gene, because its variants that are strongly associated with red hair color increase melanoma risk. To test experimentally the association between melanocortin 1 receptor genotype and melanoma susceptibility, we compared the responses of primary human melanocyte cultures naturally expressing different melanocortin 1 receptor variants to α-melanocortin and ultraviolet radiation. We found that expression of 2 red hair variants abolished the response to α-melanocortin and its photoprotective effects, evidenced by lack of functional coupling of the receptor, and absence of reduction in ultraviolet radiation-induced hydrogen peroxide generation or enhancement of repair of DNA photoproducts, respectively. These variants had different heterozygous effects on receptor function. Microarray data confirmed the observed differences in responses of melanocytes with functional vs. nonfunctional receptor to α-melanocortin and ultraviolet radiation, and identified DNA repair and antioxidant genes that are modulated by α-melanocortin. Our findings highlight the molecular mechanisms by which the melanocortin 1 receptor genotype controls genomic stability of and the mutagenic effect of ultraviolet radiation on human melanocytes.—Kadekaro, A. L., Leachman, S., Kavanagh, R. J., Swope, V., Cassidy, P., Supp, D., Sartor, M., Schwemberger, S., Babcock, G., Wakamatsu, K., Ito, S., Koshoffer, A., Boissy, R. E., Manga, P., Sturm, R. A., Abdel-Malek, Z. A. Melanocortin 1 receptor genotype: an important determinant of the damage response of melanocytes to ultraviolet radiation. PMID:20519635

  5. Mutations in c10orf11, a melanocyte-differentiation gene, cause autosomal-recessive albinism

    DEFF Research Database (Denmark)

    Grønskov, Karen; Dooley, Christopher M; Østergaard, Elsebet

    2013-01-01

    in an individual originating from Lithuania. Immunohistochemistry showed localization of C10orf11 in melanoblasts and melanocytes in human fetal tissue, but no localization was seen in retinal pigment epithelial cells. Knockdown of the zebrafish (Danio rerio) homolog with the use of morpholinos resulted...

  6. Stimulation of cyclic GMP efflux in human melanocytes by hypergravity generated by centrifugal acceleration

    NARCIS (Netherlands)

    Ivanova, Krassimira; Zadeh, Nahid Hamidi; Block, Ingrid; Das, Pranab K.; Gerzer, Rupert

    2004-01-01

    Gravity alteration (micro- and hypergravity) is known to influence cell functions. As guanosine 3',5'-cyclic monophosphate (cGMP) plays an important role in human melanocyte functions and different guanylyl cyclase isoforms are responsible for cGMP synthesis in human non-metastatic and metastatic

  7. Overexpression of hepatoma-derived growth factor in melanocytes does not lead to oncogenic transformation

    International Nuclear Information System (INIS)

    Sedlmaier, Angela; Wernert, Nicolas; Gallitzendörfer, Rainer; Abouzied, Mekky M; Gieselmann, Volkmar; Franken, Sebastian

    2011-01-01

    HDGF is a growth factor which is overexpressed in a wide range of tumors. Importantly, expression levels were identified as a prognostic marker in some types of cancer such as melanoma. To investigate the presumed oncogenic/transforming capacity of HDGF, we generated transgenic mice overexpressing HDGF in melanocytes. These mice were bred with mice heterozygous for a defective copy of the Ink4a tumor suppressor gene and were exposed to UV light to increase the risk for tumor development both genetically and physiochemically. Mice were analyzed by immunohistochemistry and Western blotting. Furthermore, primary melanocytes were isolated from different strains created. Transgenic animals overexpressed HDGF in hair follicle melanocytes. Interestingly, primary melanocytes isolated from transgenic animals were not able to differentiate in vitro whereas cells isolated from wild type and HDGF-deficient animals were. Although, HDGF -/- /Ink4a +/- mice displayed an increased number of epidermoid cysts after exposure to UV light, no melanomas or premelanocytic alterations could be detected in this mouse model. The results therefore provide no evidence that HDGF has a transforming capacity in tumor development. Our results in combination with previous findings point to a possible role in cell differentiation and suggest that HDGF promotes tumor progression after secondary upregulation and may represent another protein fitting into the concept of non-oncogene addiction of tumor tissue

  8. Clinical and histological responses of congenital melanocytic nevi after single treatment with Q-switched lasers

    NARCIS (Netherlands)

    Grevelink, JM; vanLeeuwen, RL; Anderson, RR; Byers, HR

    Background: Laser irradiation of congenital melanocytic nevi is a controversial treatment. Recurrence of lesions after laser treatment appears to be the rule, and the effects of laser irradiation on cellular biological behavior and the possible mutagenic responses of nevomelanocytes that have

  9. G2 accumulation and melanin overproduction in malignant melanocytes treated with a new nitrosourea.

    Science.gov (United States)

    Buchdahl, C; Papon, J; Communal, Y; Bourges, M; Madelmont, J C

    1998-12-01

    Cystemustine (N'-(2-chloroethyl)-N-(2-(methylsulphonyl)ethyl)-N'-nitrosourea), a new anticancer chloroethylnitrosourea (CENU) is being tested in a phase II clinical trial of disseminated melanoma. The antitumour effect of this drug is mainly due to DNA damage in malignant melanocytes. Recently, we have shown that this damage can induce apoptosis in some melanoma cell lines. In others, apoptosis is not clearly observed, although there is a strong cytostatic effect. In this paper, we have characterized the cytological effect of cystemustine on murine malignant melanocytes (B16 cell line) which are resistant to apoptosis induced by this CENU. The results show that 3 days after cystemustine treatment, these melanocytes had accumulated in phase G2 of the cell cycle. There was then a strong morphological modification during a long cytostatic phase up to 30 days after treatment. During this cytostatic phase, there was uncontrolled DNA synthesis and marked swelling. Also, tyrosinase activity, melanin content and the number of mature melanosomes were greatly increased. These results suggest that when malignant melanocytes are not able to undergo apoptosis after treatment with CENU, they accumulate in G2 and this is followed by enhancement of melanogenesis.

  10. Behandling og håndtering af kongenitte melanocytære naevi

    DEFF Research Database (Denmark)

    Bahn, Kamille-Amalie; Hædersdal, Merete; Schmidt, Grethe

    2016-01-01

    Congenital melanocytic naevi (CMN) appear in approximately 2.6% of Caucasians. There is a major demand for treatment but no vital indication. Laser therapy, curettage and excision are available treatment modalities, but there is no ideal treatment with documented long-term effect and without side...

  11. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  12. The unfolded protein response in melanocytes: activation in response to chemical stressors of the endoplasmic reticulum and tyrosinase misfolding.

    Science.gov (United States)

    Manga, Prashiela; Bis, Sabina; Knoll, Kristen; Perez, Beremis; Orlow, Seth J

    2010-10-01

    Accumulation of proteins in the endoplasmic reticulum (ER) triggers the unfolded protein response (UPR), comprising three signaling pathways initiated by Ire1, Perk and Atf6 respectively. Unfolded protein response activation was compared in chemically stressed murine wildtype melanocytes and mutant melanocytes that retain tyrosinase in the ER. Thapsigargin, an ER stressor, activated all pathways in wildtype melanocytes, triggering Caspase 12-mediated apoptosis at toxic doses. Albino melanocytes expressing mutant tyrosinase showed evidence of ER stress with increased Ire1 expression, but the downstream effector, Xbp1, was not activated even following thapsigargin treatment. Attenuation of Ire1 signaling was recapitulated in wildtype melanocytes treated with thapsigargin for 8 days, with diminished Xbp1 activation observed after 4 days. Atf6 was also activated in albino melanocytes, with no response to thapsigargin, while the Perk pathway was not activated and thapsigargin treatment elicited robust expression of the downstream effector CCAAT-enhancer-binding protein homologous protein. Thus, melanocytes adapt to ER stress by attenuating two UPR pathways.

  13. Plasma concentrations of alpha-melanocyte-stimulating hormone are elevated in patients on chronic haemodialysis.

    Science.gov (United States)

    Airaghi, L; Garofalo, L; Cutuli, M G; Delgado, R; Carlin, A; Demitri, M T; Badalamenti, S; Graziani, G; Lipton, J M; Catania, A

    2000-08-01

    Clinical and/or laboratory signs of systemic inflammation occur frequently in patients undergoing long-term haemodialysis. It is likely, therefore, that a compensatory release of endogenous anti-inflammatory molecules occurs to limit host reactions. The aim of the present research was to determine if the potent anti-inflammatory peptide alpha-melanocyte-stimulating hormone (alpha-MSH), a pro-opiomelanocortin derivative, is increased in plasma of haemodialysis patients. Because endotoxin and cytokines induce alpha-MSH in vivo and in vitro, we also measured plasma concentrations of endotoxin, interleukin-6 (IL-6), and tumour necrosis factor alpha (TNF-alpha), and the two circulating products of activated monocytes, nitric oxide (NO) and neopterin. Thirty-five chronic haemodialysis patients, 20 patients with chronic renal failure not yet on dialysis, and 35 normal controls were included in the study. In the haemodialysis group, blood samples were obtained before and at the end of a dialysis session. Plasma alpha-MSH was measured using a double antibody radioimmunoassay, and IL-6, TNF-alpha, and neopterin using specific enzyme-linked immunosorbent assays. Plasma nitrites were determined by a colorimetric method, and endotoxin with the quantitative chromogenic LAL (limulus amoebocyte lysate) method. Mean plasma alpha-MSH was higher in haemodialysis patients than in control subjects, with the peptide concentrations being particularly elevated in dialysed patients with detectable endotoxin. High alpha-MSH concentrations were observed in the pre-dialysis samples, with no substantial change at the end of the dialysis session. Plasma concentrations of IL-6, TNF-alpha, neopterin, and NO were generally elevated in chronic haemodialysis patients and there was a negative correlation between circulating alpha-MSH and IL-6. In patients with renal failure not yet on dialysis, mean plasma alpha-MSH was similar to that of normal subjects. alpha-MSH is increased in the circulation of

  14. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Diagnosis and staging of female genital tract melanocytic lesions using pump-probe microscopy (Conference Presentation)

    Science.gov (United States)

    Robles, Francisco E.; Selim, Maria A.; Warren, Warren S.

    2016-02-01

    Melanoma of the vulva is the second most common type of malignancy afflicting that organ. This disease caries poor prognosis, and shows tendencies to recur locally and develop distant metastases through hematogenous dissemination. Further, there exists significant clinical overlap between early-stage melanomas and melanotic macules, benign lesions that are believed to develop in about 10% of the general female population. In this work we apply a novel nonlinear optical method, pump-probe microscopy, to quantitatively analyze female genitalia tract melanocytic lesions. Pump-probe microscopy provides chemical information of endogenous pigments by probing their electronic excited state dynamics, with subcellular resolution. Using unstained biopsy sections from 31 patients, we find significant differences between melanin type and structure in tissue regions with invasive melanoma, melanoma in-situ and non-malignant melanocytic proliferations (e.g., nevi, melanocytic macules). The molecular images of non-malignant lesion have a well-organized structure, with relatively homogenous pigment chemistry, most often consistent with that of eumelanin with large aggregate size or void of metals, such as iron. On the other hand, pigment type and structure observed in melanomas in-situ and invasive melanomas is typically much more heterogeneous, with larger contributions from pheomelanin, melanins with larger metal content, and/or melanins with smaller aggregate size. Of most significance, clear differences can be observed between melanocytic macules and vulvar melanoma in-situ, which, as discussed above, can be difficult to clinically distinguish. This initial study demonstrates pump-probe microscopy's potential as an adjuvant diagnostic tool by revealing systematic chemical and morphological differences in melanin pigmentation among invasive melanoma, melanoma in-situ and non-malignant melanocytic lesions.

  16. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  17. Y-type congenital urethral duplication with normal dorsal urethra and small ventral fistula to perineal skin – 28th reported case

    Directory of Open Access Journals (Sweden)

    Donald E. Meier

    2016-05-01

    Full Text Available There are numerous types of urethral duplication previously described in the literature including a Type IIA2Y where a large ventral channel branches from the hypoplastic, dorsal, orthotopic urethra. There have been 27 previously reported cases of a similar defect, called “congenital posterior urethrocutaneous fistula” (CUPF with the only difference being that the ventral urethra is hypoplastic and the dorsal, orthotopic one normal. The difference in treatment for these 2 entities is markedly different, and preoperative identification of the appropriate abnormality is essential. Treatment of CUPF requires only safe excision of the ventral segment, but treatment for a Type IIA2Y duplication requires resection of the hypoplastic, orthotopic urethra and transposition of the larger ventral segment into the dorsal orthotopic position. The outcome for treatment of CUPF is much better than for treatment of Type IIA2Y entities. We herein present the 28th case of CUPF in the English literature with discussion of the anatomy, appropriate diagnostic criteria, and safe method of treatment for these entities.

  18. Hydrogen water intake via tube-feeding for patients with pressure ulcer and its reconstructive effects on normal human skin cells in vitro

    Science.gov (United States)

    2013-01-01

    Background Pressure ulcer (PU) is common in immobile elderly patients, and there are some research works to investigate a preventive and curative method, but not to find sufficient effectiveness. The aim of this study is to clarify the clinical effectiveness on wound healing in patients with PU by hydrogen-dissolved water (HW) intake via tube-feeding (TF). Furthermore, normal human dermal fibroblasts OUMS-36 and normal human epidermis-derived cell line HaCaT keratinocytes were examined in vitro to explore the mechanisms relating to whether hydrogen plays a role in wound-healing at the cellular level. Methods Twenty-two severely hospitalized elderly Japanese patients with PU were recruited in the present study, and their ages ranged from 71.0 to 101.0 (86.7 ± 8.2) years old, 12 male and 10 female patients, all suffering from eating disorder and bedridden syndrome as the secondary results of various underlying diseases. All patients received routine care treatments for PU in combination with HW intake via TF for 600 mL per day, in place of partial moisture replenishment. On the other hand, HW was prepared with a hydrogen-bubbling apparatus which produces HW with 0.8-1.3 ppm of dissolved hydrogen concentration (DH) and −602 mV to −583 mV of oxidation-reduction potential (ORP), in contrast to reversed osmotic ultra-pure water (RW), as the reference, with DH of < 0.018 ppm and ORP of +184 mV for use in the in vitro experimental research. In in vitro experiments, OUMS-36 fibroblasts and HaCaT keratinocytes were respectively cultured in medium prepared with HW and/or RW. Immunostain was used for detecting type-I collagen reconstruction in OUMS-36 cells. And intracellular reactive oxygen species (ROS) were quantified by NBT assay, and cell viability of HaCaT cells was examined by WST-1 assay, respectively. Results Twenty-two patients were retrospectively divided into an effective group (EG, n = 12) and a less effective group (LG, n = 10) according to

  19. Melanoma Therapy with Rhenium-Cyclized Alpha Melanocyte Stimulating Hormone Peptide Analogs

    Energy Technology Data Exchange (ETDEWEB)

    Thomas P Quinn

    2005-11-22

    Malignant melanoma is the 6th most commonly diagnosed cancer with increasing incidence in the United States. It is estimated that 54,200 cases of malignant melanoma will be newly diagnosed and 7,600 cases of death will occur in the United States in the year 2003 (1). At the present time, more than 1.3% of Americans will develop malignant melanoma during their lifetime (2). The average survival for patients with metastatic melanoma is about 6-9 months (3). Moreover, metastatic melanoma deposits are resistant to conventional chemotherapy and external beam radiation therapy (3). Systematic chemotherapy is the primary therapeutic approach to treat patients with metastatic melanoma. Dacarbazine is the only single chemotherapy agent approved by FDA for metastatic melanoma treatment (5). However, the response rate to Dacarbazine is only approximately 20% (6). Therefore, there is a great need to develop novel treatment approaches for metastatic melanoma. The global goal of this research program is the rational design, characterization and validation of melanoma imaging and therapeutic radiopharmaceuticals. Significant progress has been made in the design and characterization of metal-cyclized radiolabeled alpha-melanocyte stimulating hormone peptides. Therapy studies with {sup 188}Re-CCMSH demonstrated the therapeutic efficacy of the receptor-targeted treatment in murine and human melanoma bearing mice (previous progress report). Dosimetry calculations, based on biodistribution data, indicated that a significant dose was delivered to the tumor. However, {sup 188}Re is a very energetic beta-particle emitter. The longer-range beta-particles theoretically would be better for larger tumors. In the treatment of melanoma, the larger primary tumor is usually surgically removed leaving metastatic disease as the focus of targeted radiotherapy. Isotopes with lower beta-energies and/or shorter particle lengths should be better suited for targeting metastases. The {sup 177}Lu

  20. Melanome Therapy with Rhenium Cyclized Alpha Melanocyte Stimulating Hormone Peptide Analogs. Final report

    International Nuclear Information System (INIS)

    Quinn, Thomas P.

    2005-01-01

    Malignant melanoma is the 6th most commonly diagnosed cancer with increasing incidence in the United States. It is estimated that 54,200 cases of malignant melanoma will be newly diagnosed and 7,600 cases of death will occur in the United States in the year 2003 (1). At the present time, more than 1.3% of Americans will develop malignant melanoma during their lifetime (2). The average survival for patients with metastatic melanoma is about 6-9 months (3). Moreover, metastatic melanoma deposits are resistant to conventional chemotherapy and external beam radiation therapy (3). Systematic chemotherapy is the primary therapeutic approach to treat patients with metastatic melanoma. Dacarbazine is the only single chemotherapy agent approved by FDA for metastatic melanoma treatment (5). However, the response rate to Dacarbazine is only approximately 20% (6). Therefore, there is a great need to develop novel treatment approaches for metastatic melanoma. The global goal of this research program is the rational design, characterization and validation of melanoma imaging and therapeutic radiopharmaceuticals. Significant progress has been made in the design and characterization of metal-cyclized radiolabeled alpha-melanocyte stimulating hormone peptides. Therapy studies with 188 Re-CCMSH demonstrated the therapeutic efficacy of the receptor-targeted treatment in murine and human melanoma bearing mice (previous progress report). Dosimetry calculations, based on biodistribution data, indicated that a significant dose was delivered to the tumor. However, 188 Re is a very energetic beta-particle emitter. The longer-range beta-particles theoretically would be better for larger tumors. In the treatment of melanoma, the larger primary tumor is usually surgically removed leaving metastatic disease as the focus of targeted radiotherapy. Isotopes with lower beta-energies and/or shorter particle lengths should be better suited for targeting metastases. The 177 Lu-DOTA-Re(Arg11)CCMSH and

  1. In vivo skin fluorescence imaging in young Caucasian adults with early malignant melanomas

    Directory of Open Access Journals (Sweden)

    Piérard GE

    2014-08-01

    Full Text Available Gérald E Piérard,1 Trinh Hermanns-Lê,2 Sébastien L Piérard,3 Lucas Dewalque,4 Corinne Charlier,4 Claudine Piérard-Franchimont,2 Philippe Delvenne2 1Laboratory of Skin Bioengineering and Imaging (LABIC, Department of Clinical Sciences, Liège University, 2Department of Dermatopathology, Unilab Lg, University Hospital of Liège, 3INTELSIG Laboratory, Montefiore Institute, University of Liège, 4Department of Clinical, Forensic and Environmental Toxicology, University Hospital of Liège, Liège, Belgium Background: Human cutaneous malignant melanoma (CMM is an aggressive cancer showing a dramatic worldwide increase in incidence over the past few decades. The most prominent relative epidemiological increase has been disclosed in young women. The aim of the study was to assess the effects of chronic sun exposures in order to rate the extend of melanocytic stimulations in the vicinity of CMM. Methods: The study was designed to evaluate the melanin distribution and density using ultraviolet light illumination. The present study was performed on surgical excision specimens of thin CMM lesion removed from the upper limbs of 55 Caucasian adults (37 women and 18 men. Two control groups comprised 23 men and 21 women of similar ages who had medium-size congenital melanocytic nevi, also present on the upper limbs. The peritumoral skin was scrutinized using a Visioscan® VC98 device, revealing the faint mosaic melanoderma (FMM pattern that grossly indicates early signs of chronic photodamage in epidermal melanin units. Results: The median extent of relative FMM was significantly higher in the CMM male group. By contrast, the CMM female group showed a reverse bimodal distribution in FMM size. Only 12/37 (32.5% of the CMM female group had an increased FMM size, whereas 25/37 (67.5% of females with CMM had a global FMM extent in the normal range, relative to the controls. Conclusion: Thin CMM supervening in young women appear unrelated to repeat

  2. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  3. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  4. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  5. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  6. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  7. The gender differences in the inhibitory action of UVB-induced melanocyte activation by the administration of tranexamic acid.

    Science.gov (United States)

    Hiramoto, Keiichi; Yamate, Yurika; Sugiyama, Daijiro; Takahashi, Yumi; Mafune, Eiichi

    2016-05-01

    Tranexamic acid has an inhibitory action on ultraviolet (UV) B-induced melanocyte activation. This study examined the sex differences in the inhibitory action of tranexamic acid on UVB-induced melanocyte activation. We irradiated the eye and ear of male and female mice with UVB at a dose of 1.0 kJ/m(2) using a 20SE sunlamp. We orally administered tranexamic acid (750 mg/kg/day) at 30 min before UVB exposure. Tranexamic acid inhibited the UVB-induced epidermal melanocyte activation, and the effect was more remarkable under UVB eye irradiation than under UVB ear irradiation. Furthermore, the melanocyte activity suppression effect was stronger in female mice than in male mice. Following the administration of tranexamic acid, the female displayed increased blood levels of β-endorphin and μ-opioid receptor and estradiol receptor β expression in comparison with the male. Furthermore, the effect of melanocyte activity suppression in the female mice was decreased by the administration of tamoxifen (antagonist of estrogen receptor) or naltrexone (antagonist of μ-opioid receptor). These results suggest that the suppression by tranexamic acid of the UVB-induced melanocyte activation (UVB sensitivity) is stronger in female mice than in male mice and that female hormones and β-endorphin play an important role in this sex difference. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Substantial Effect of Melanin Influencing Factors on In vitro Melanogenesis in Muzzle Melanocytes of Differently Colored Hanwoo.

    Science.gov (United States)

    Amna, Touseef; Park, Kyoung Mi; Cho, In-Kyung; Choi, Tae Jeong; Lee, Seung Soo; Seo, Kang-Seok; Hwang, Inho

    2012-07-01

    The present study was designed to investigate the effect of α-melanocyte-stimulating hormone (α-MSH), nitric oxide (NO) and L-cysteine on melanin production and expression of related genes MC1R, Tyr, Tyrp-1 and Tyrp-2 in muzzle melanocytes of differently colored three native Hanwoo cattle. Muzzle samples were taken from black, brindle and brown Hanwoo and purified melanocytes were cultured with α-MSH, nitric oxide and L-cysteine at 100 nM, 50 µM and 0.07 mg/ml of media respectively. The amounts of total melanin, eumelanin and mRNA expression at Tyr, Tyrp-1, Tyrp-2 and MC1R levels were quantified. α-MSH and nitric oxide significantly increased (pmuzzle melanocytes. On the contrary, L-cysteine greatly (pmuzzle melanocytes of all three phenotypes. The results of this study revealed nitric oxide and α-MSH contribute hyper-pigmentation by enhancing eumelanogenesis whereas L-cysteine contributes to pheomelanin production in different colored Hanwoo muzzle melanocytes.

  9. Histomorphologic spectrum of BAP1 negative melanocytic neoplasms in a family with BAP1-associated cancer susceptibility syndrome.

    Science.gov (United States)

    Marušić, Zlatko; Buljan, Marija; Busam, Klaus J

    2015-06-01

    Multiple BAP1 negative melanocytic neoplasms are a hallmark of familial cancer susceptibility syndrome caused by BAP1 germline mutation. The syndrome is characterized by increased incidence of renal cell carcinoma, mesothelioma, cholangiocarcinoma, cutaneous and uveal melanoma and some other neoplasms. We report histomorphologic characteristics of six cutaneous melanocytic neoplasms with loss of BAP1 expression in two members of a family with BAP1-associated cancer susceptibility syndrome. The neoplasms were dermal melanocytic nevi characterized by a proliferation of large epithelioid (spitzoid) melanocytes, and adipocytic metaplasia. Nuclear pseudoinclusions and multinucleated melanocytes were present in most neoplasms. In two of the cases, a nodular melanoma was found associated with a dermal nevus. None of the melanomas recurred or metastasized after 6 and 3 years of follow up. We report two new cases of melanoma arising in a BAP1-deficient melanocytic nevus in the setting of familial tumor predisposition syndrome. Adipocytic metaplasia and nuclear pseudoinclusions may be additional morphologic clues to a BAP1-deficient nevus. It remains to be seen whether these features are more common in familial than sporadic lesions. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Pseudomelanocytic nests mimicking atypical melanocytic proliferations: first reported cases in the oral cavity.

    Science.gov (United States)

    Boros, Audrey L; Handlers, Janice P; Melrose, Raymond J

    2014-10-01

    The concept of pseudomelanocytic nests has been recently described in the dermatology literature. To our knowledge, this entity has yet to be published in the oral pathology literature. We report 2 cases with features of pseudomelanocytic nests. In both instances, nests of cells suspicious for melanocytes were observed. Interpretation of melan-A was negative. Both cases showed strong and diffuse immunoreactivity of the nested cells to CD68. This immunohistochemical staining pattern is most consistent with a melanophage identity. Pseudomelanocytic nests are a recently described entity that represents a potential diagnostic pitfall. Distinguishing pseudomelanocytic nests from an authentic atypical melanocytic proliferation can be challenging and is important for appropriate patient management. Clinicopathologic correlation with cautious interpretation of immunohistochemistry may be necessary to arrive at the correct diagnosis. These cases represent the first reports of pseudomelanocytic nests in the oral pathology literature. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. A case of melanocytic cervical adenosquamous carcinoma complicated with Cushing's syndrome.

    Science.gov (United States)

    Chen, Y; Zhang, Y; Wang, L; Yang, X

    2017-01-01

    To date, cervical carcinoma complicated with Cushing's syndrome were all diagnosed as small cell carcinoma histo- logically, but not adenosquamous carcinoma. Here the authors present the diagnosis, management, and prognosis of a case of melanocytic cervical adenosquamous carcinoma complicated with Cushing's syndrome. A 28-year-old woman was admitted with the chief complaint of post-coital bleeding for one month. Gynecological examination revealed a nodular yellowish-pigmented vegetation (6x5 cm) on the cervix. Laboratory findings proved the diagnosis of Cushing's syndrome. Histopathological diagnosis showed the adenosquamous carcinoma with melanoma differentiation. Immunohistochemical stainings for melanoma A and anti- adrenocorticotropic hormone (ACTH) were positive in the majority of the tumor cells, which indicated that this melanocytic cervical carcinoma lesion was the source of ectopic ACTH production resulting in Cushing's syndrome. This is a unique case of a rare type of cervical carcinoma.

  12. Fluorine-18-labeled [Nle4,D-Phe7]-α-MSH, an α-melanocyte stimulating hormone analogue

    International Nuclear Information System (INIS)

    Vaidyanathan, Ganesan; Zalutsky, Michael R.

    1997-01-01

    The α-melanocyte stimulating hormone (α-MSH) analogue [N1e 4 ,D-Phe 7 ]-α-MSH was labeled with 18 F using N-succinimidyl 4-[ 18 F]fluorobenzoate ([ 18 F]SFB) in >80% radiochemical yield. The IC 50 values of [N1e 4 ,D-Phe 7 ]-α-MSH and para-fluorobenzoyl-[N1e 4 ,D-Phe 7 ]-α-MSH ([N1e 4 ,D-Phe 7 ,Lys 11 -( 18 F)PFB]-α-MSH) for inhibiting the binding of meta-[ 131 I]iodobenzoyl-[N1e 4 ,D-Phe 7 ]-α-MSH ([N1e 4 ,D-Phe 7 ,Lys 11 -( 131 I)MIB]-α-MSH) to B16-F1 murine melanoma cells were 89 ± 9 pM and 112 ± 22 pM, respectively, suggesting that addition of 4-fluorobenzoate did not compromise α-MSH receptor binding affinity. Binding of [N1e 4 ,D-Phe 7 ,Lys 11 -( 18 F)PFB]-α-MSH was influenced by the specific activity of the preparation (400-1000 Ci/mmol). The normal tissue clearance of [N1e 4 ,D-Phe 7 ,Lys 11 -( 18 F)PFB]-α-MSH in mice was quite rapid, with little evidence for defluorination

  13. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  14. Anti-oxidant defence mechanism in vitiliginous skin increases with skin type

    NARCIS (Netherlands)

    Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.

    2012-01-01

    Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing

  15. Intracranial melanocytic meningeal tumours and melanosis oculi: case report and literature review

    International Nuclear Information System (INIS)

    Doglietto, Francesco; Colosimo, Cesare; Lauriola, Libero; Balducci, Mario; De Bonis, Pasquale; Montano, Nicola; Zadeh, Gelareh; Maira, Giulio; Pallini, Roberto

    2012-01-01

    Melanocytic meningeal tumours are rare extra-axial neoplasms of the nervous system, with only three reported cases in the cavernous sinus. Herein we describe for the first time the association of ocular melanosis and multiple intracranial melanocytic meningeal tumours, with the presenting lesion being in the cavernous sinus. The importance of this association is discussed together with the diagnostic and therapeutic challenges of the case. A 20-year-old man presented with a left sixth cranial nerve deficit; general examination documented only congenital melanosis of the homolateral eye. MRI examination showed a space occupying lesion in the left cavernous sinus, which was followed conservatively for 2 years, until a new space occupying lesion was evident at the level of the right frontal convexity: both lesions presented with neuroradiological characteristics suggestive of melanin content. The frontal convexity lesion was removed: intraoperatively the dura was markedly and diffusely melanotic. Histological examination documented a melanocytic meningeal tumour, with a proliferative index of 3 %. The patient underwent 3D-Conformal Radiation Therapy on the lesion of the cavernous sinus (total dose 5040 cGy), with initial tumour reduction. Three years later, due to a symptomatic growth, he underwent partial removal of the lesion in the cavernous sinus. Histological examination was unchanged. He then received adjuvant Temozolomide with Low Dose Fractionated Radiation Therapy (LD-FRT). Due to further disease progression cisplatin plus fotemustine were administered, concomitant with LD-FRT: after two cycles MRI documented significant disease regression. After a period of apparent disease control, the patient presented with persistent cough and evidence of multiple thoracic metastases, which lead to his death, seven years after presentation. Intracranial melanocytic meningeal tumours are challenging lesions, both from a diagnostic and therapeutic point of view; though rare

  16. Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.

    Science.gov (United States)

    Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H

    2007-07-01

    Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.

  17. Resolution of vitiligo following excision of halo congenital melanocytic nevus: a rare case report.

    Science.gov (United States)

    Wang, Kai; Wang, Zhi; Huang, Weiqing

    2016-05-01

    Halo congenital melanocytic nevus (CMN) associated with vitiligo is rare, especially with regard to CMN excision. Only two reports of excision of halo CMN following repigmentation of vitiligo are found in the literature. We present a case of a girl with halo CMN and periorbital vitiligo. The halo CMN was excised and followed by spontaneous improvement of vitiligo. The result suggests excision of the inciting lesion may be a promising way to control vitiligo. © 2015 Wiley Periodicals, Inc.

  18. DMEM enhances tyrosinase activity in B16 mouse melanoma cells and human melanocytes

    Directory of Open Access Journals (Sweden)

    Panpen Diawpanich

    2008-07-01

    Full Text Available Media components may affect the activities of cultured cells. In this study, tyrosinase activity was evaluated by using B16-F10 mouse melanoma cell lines (B16-F10 and primary human melanocytes cultured in different media. An optical density measurement and a L-dopa reaction assay were used as the determination of the tyrosinase activity. The study of B16-F10 found the optical density to be 2010, 2246 and 2961 in cells cultured in RPMI Medium 1640 (RPMI1640,Minimum Essential Medium (MEM and Dulbecco’s Modified Eagle Medium (DMEM, respectively. Moreover, compared to RPMI 1640 and MEM, DMEM showed the darkest color of melanin formation in culture media and in cells after the L-dopa reaction assay. Addition of kojic acid showed a significant inhibitory effect on tyrosinase activity in all media.Whereas MCDB153 showed no significant effect on human melanocytes, DMEM caused a dramatic increase in tyrosinase activity after 4 days of cultivation. Addition of kojic acid showed a significant tyrosinase inhibitory effect in DMEM only. Furthermore, an active ingredient in green tea, epigallocathechin gallate (EGCG could inhibit tyrosinase activity in both B16-F10 and human melanocytes cultured in DMEM. In summary, these results suggest that DMEM is a suitable medium that provides high detection sensitivity in a tyrosinase inhibition assay.

  19. Loss of 5-hydroxymethylcytosine correlates with increasing morphologic dysplasia in melanocytic tumors.

    Science.gov (United States)

    Larson, Allison R; Dresser, Karen A; Zhan, Qian; Lezcano, Cecilia; Woda, Bruce A; Yosufi, Benafsha; Thompson, John F; Scolyer, Richard A; Mihm, Martin C; Shi, Yujiang G; Murphy, George F; Lian, Christine Guo

    2014-07-01

    DNA methylation is the most well-studied epigenetic modification in cancer biology. 5-hydroxymethylcytosine is an epigenetic mark that can be converted from 5-methylcytosine by the ten-eleven translocation gene family. We recently reported the loss of 5-hydroxymethylcytosine in melanoma compared with benign nevi and suggested that loss of this epigenetic marker is correlated with tumor virulence based on its association with a worse prognosis. In this study, we further characterize the immunoreactivity patterns of 5-hydroxymethylcytosine in the full spectrum of melanocytic lesions to further validate the potential practical application of this epigenetic marker. One hundred and seventy-five cases were evaluated: 18 benign nevi, 20 dysplastic nevi (10 low-grade and 10 high-grade lesions), 10 atypical Spitz nevi, 20 borderline tumors, 5 melanomas arising within nevi, and 102 primary melanomas. Progressive loss of 5-hydroxymethylcytosine from benign dermal nevi to high-grade dysplastic nevi to borderline melanocytic neoplasms to melanoma was observed. In addition, an analysis of the relationship of nuclear diameter with 5-hydroxymethylcytosine staining intensity within lesional cells revealed a significant correlation between larger nuclear diameter and decreased levels of 5-hydroxymethylcytosine. Furthermore, borderline lesions uniquely exhibited a diverse spectrum of staining of each individual case. This study further substantiates the association of 5-hydroxymethylcytosine loss with dysplastic cytomorphologic features and tumor progression and supports the classification of borderline lesions as a biologically distinct category of melanocytic lesions.

  20. An ultra-sensitive biophysical risk assessment of light effect on skin cells.

    Science.gov (United States)

    Bennet, Devasier; Viswanath, Buddolla; Kim, Sanghyo; An, Jeong Ho

    2017-07-18

    The aim of this study was to analyze photo-dynamic and photo-pathology changes of different color light radiations on human adult skin cells. We used a real-time biophysical and biomechanics monitoring system for light-induced cellular changes in an in vitro model to find mechanisms of the initial and continuous degenerative process. Cells were exposed to intermittent, mild and intense (1-180 min) light with On/Off cycles, using blue, green, red and white light. Cellular ultra-structural changes, damages, and ECM impair function were evaluated by up/down-regulation of biophysical, biomechanical and biochemical properties. All cells exposed to different color light radiation showed significant changes in a time-dependent manner. Particularly, cell growth, stiffness, roughness, cytoskeletal integrity and ECM proteins of the human dermal fibroblasts-adult (HDF-a) cells showed highest alteration, followed by human epidermal keratinocytes-adult (HEK-a) cells and human epidermal melanocytes-adult (HEM-a) cells. Such changes might impede the normal cellular functions. Overall, the obtained results identify a new insight that may contribute to premature aging, and causes it to look aged in younger people. Moreover, these results advance our understanding of the different color light-induced degenerative process and help the development of new therapeutic strategies.

  1. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  2. ICRP-26 and skin contamination

    International Nuclear Information System (INIS)

    Finnigan, T.; Huda, W.; Newbery, G.R.

    1979-01-01

    The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)

  3. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  4. Clinicohistopathological correlations in juvenile localized scleroderma: studies on a subset of children with hypopigmented juvenile localized scleroderma due to loss of epidermal melanocytes.

    Science.gov (United States)

    Sung, Joanne J; Chen, Tina S; Gilliam, Anita C; McCalmont, Timothy H; Gilliam, Amy E

    2011-08-01

    Localized scleroderma or morphea is a connective tissue disorder characterized by fibrosis of the skin and subcutaneous tissue. Excessive accumulation of collagen underlies the fibrosis, yet the pathogenesis is unknown. A subset of localized scleroderma/morphea, juvenile localized scleroderma (JLS), affects children and adolescents. The clinical and microscopic features of JLS have not been fully characterized. The goal is to better characterize the microscopic features of JLS. We collected a distinctive data set of 35 children with JLS, 19 (54%) of whom presented with hypopigmented lesions, and performed a retrospective chart and pathology review. We had adequate tissue for immunostaining studies on 8 of these individuals. We found that: (1) CD34 and factor XIIIa immunostaining, reported previously in adult morphea and scleroderma, when used with clinical information, is valuable for confirming a diagnosis of JLS; and (2) presence of hypopigmented lesions in JLS correlates with immunostaining studies. Decreased numbers of MelanA(+) melanocytes were present at the dermoepidermal junction in lesional skin in two of 3 children with hypopigmented JLS and in two of 4 children with nonhypopigmented JLS. The number of cases is small, a function of the small number of children who have biopsy specimens with material sufficient for multiple immunostaining procedures. These results provide a useful immunostaining method for confirmation of the diagnosis of JLS. They suggest a complex autoimmune phenotype in some children with JLS. Copyright © 2010 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  5. Characterization of oily mature skin by biophysical and skin imaging techniques.

    Science.gov (United States)

    de Melo, M O; Maia Campos, P M B G

    2018-02-13

    The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

    Science.gov (United States)

    Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

    2017-05-01

    Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

  7. Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.

    Science.gov (United States)

    Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara

    2018-04-01

    Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.

  8. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  9. Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin.

    Directory of Open Access Journals (Sweden)

    Charles W Higdon

    Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.

  10. The effect of ultraviolet on direct current potentials of the human skin

    Directory of Open Access Journals (Sweden)

    A. O. Lazarev

    2017-01-01

    Full Text Available Aim of the study. investigation of the suntan on the level of omnipresent electrical potential of skin in frames of development of the hypothesis about the melanocyte participation in skin electrical activity formation. Material and methods. 11 men and 11 women on summer holyday took part in investigation. The relationship between the levels of skin omnipresent electrical potential and the reflection factor were investigated. The omnipresent electrical potentials were registered as the potential differences between the two areas on skin using the Orion 261S pH meter and the liquid Ag/AgCl electrodes of the same company. The reflecting factor was estimated with the help of the spectroradiometer LI-1800 (“LI-COR” using the included intgrational sphere 1800-12 coated with barium sulfate. Hole size was 1,45 cm. The reflection factor was estimated at the wave band 375-800 nanometers with the scanning pitch 1 nm. Main results. There is a mathematical relation between the magnitudes of potential differences and the reflection factors of the areas of sunburnt skin and the areas of the skin not affected with sun at wave light 620-729 nm. The relationship could be approximated in linear equation. Spearman correlation factor between these two parameters was -0,43 (p = 0,045, between the differences in levels of skin omnipresent electrical potential and the reflection factors of the sunburnt skin was r = -0,52 (p = 0,01, between the differences of the electrical potentials of sunburnt skin and the skin not affected with sun was r = -0,28 (p = 0,2. The presented results of investigation and the data from literature allow to conclude that there is a positive correlation between the level of omnipresent electrical potential of skin and the quantity of melanosomes filled with melanin. Conclusion. It is suggested that melanocytes take part in formation of the skin electrical activity via melanosomes filled with melanin. At the same time the melanocyte

  11. Skin graft viability test

    International Nuclear Information System (INIS)

    Wahner, H.W.; Robertson, J.S.

    1983-01-01

    With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter

  12. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  13. On the possible origin of bulk third harmonic generation in skin cells

    Science.gov (United States)

    Su, Tung-Yu; Liao, Chien-Sheng; Yang, Chih-Yuan; Zhuo, Guan-Yu; Chen, Szu-Yu; Chu, Shi-Wei

    2011-09-01

    We studied third harmonic generation (THG) of melanin solution with concentrations similar to melanocytes in human skin. In contrast to conventional observation of THG at interface, bulk THG was detected inside the solution due to the formation of melanin hydrocolloids. A linear relationship between melanin concentration and THG intensity was found, suggesting THG originated from high-order hyper-Rayleigh scattering. By fitting this linear relationship, third-order hyperpolarizability of melanin hydrocolloids was determined to be three orders larger than that of water. Our result will be useful for interpretation of THG signals in skin and other tissues containing colloidal particles.

  14. Mutations in c10orf11, a melanocyte-differentiation gene, cause autosomal-recessive albinism.

    Science.gov (United States)

    Grønskov, Karen; Dooley, Christopher M; Østergaard, Elsebet; Kelsh, Robert N; Hansen, Lars; Levesque, Mitchell P; Vilhelmsen, Kaj; Møllgård, Kjeld; Stemple, Derek L; Rosenberg, Thomas

    2013-03-07

    Autosomal-recessive albinism is a hypopigmentation disorder with a broad phenotypic range. A substantial fraction of individuals with albinism remain genetically unresolved, and it has been hypothesized that more genes are to be identified. By using homozygosity mapping of an inbred Faroese family, we identified a 3.5 Mb homozygous region (10q22.2-q22.3) on chromosome 10. The region contains five protein-coding genes, and sequencing of one of these, C10orf11, revealed a nonsense mutation that segregated with the disease and showed a recessive inheritance pattern. Investigation of additional albinism-affected individuals from the Faroe Islands revealed that five out of eight unrelated affected persons had the nonsense mutation in C10orf11. Screening of a cohort of autosomal-recessive-albinism-affected individuals residing in Denmark showed a homozygous 1 bp duplication in C10orf11 in an individual originating from Lithuania. Immunohistochemistry showed localization of C10orf11 in melanoblasts and melanocytes in human fetal tissue, but no localization was seen in retinal pigment epithelial cells. Knockdown of the zebrafish (Danio rerio) homolog with the use of morpholinos resulted in substantially decreased pigmentation and a reduction of the apparent number of pigmented melanocytes. The morphant phenotype was rescued by wild-type C10orf11, but not by mutant C10orf11. In conclusion, we have identified a melanocyte-differentiation gene, C10orf11, which when mutated causes autosomal-recessive albinism in humans. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  15. Comparative cytogenetic characterization of primary canine melanocytic lesions using array CGH and fluorescence in situ hybridization.

    Science.gov (United States)

    Poorman, Kelsey; Borst, Luke; Moroff, Scott; Roy, Siddharth; Labelle, Philippe; Motsinger-Reif, Alison; Breen, Matthew

    2015-06-01

    Melanocytic lesions originating from the oral mucosa or cutaneous epithelium are common in the general dog population, with up to 100,000 diagnoses each year in the USA. Oral melanoma is the most frequent canine neoplasm of the oral cavity, exhibiting a highly aggressive course. Cutaneous melanocytomas occur frequently, but rarely develop into a malignant form. Despite the differential prognosis, it has been assumed that subtypes of melanocytic lesions represent the same disease. To address the relative paucity of information about their genomic status, molecular cytogenetic analysis was performed on the three recognized subtypes of canine melanocytic lesions. Using array comparative genomic hybridization (aCGH) analysis, highly aberrant distinct copy number status across the tumor genome for both of the malignant melanoma subtypes was revealed. The most frequent aberrations included gain of dog chromosome (CFA) 13 and 17 and loss of CFA 22. Melanocytomas possessed fewer genome wide aberrations, yet showed a recurrent gain of CFA 20q15.3-17. A distinctive copy number profile, evident only in oral melanomas, displayed a sigmoidal pattern of copy number loss followed immediately by a gain, around CFA 30q14. Moreover, when assessed by fluorescence in situ hybridization (FISH), copy number aberrations of targeted genes, such as gain of c-MYC (80 % of cases) and loss of CDKN2A (68 % of cases), were observed. This study suggests that in concordance with what is known for human melanomas, canine melanomas of the oral mucosa and cutaneous epithelium are discrete and initiated by different molecular pathways.

  16. Relative contributions of decay accelerating factor (DAF), membrane cofactor protein (MCP) and CD59 in the protection of melanocytes from homologous complement

    NARCIS (Netherlands)

    Venneker, G. T.; Vodegel, R. M.; Okada, N.; Westerhof, W.; Bos, J. D.; Asghar, S. S.

    1998-01-01

    Complement regulatory molecules, membrane cofactor protein (MCP), decay accelerating factor (DAF) and CD59, protect body cells from autologous complement. They have wide tissue distribution but nothing is known about the expression of these molecules on human melanocytes. Since melanocytes are lysed

  17. MicroRNA expression in melanocytic nevi: the usefulness of formalin-fixed, paraffin-embedded material for miRNA microarray profiling

    DEFF Research Database (Denmark)

    Glud, M.; Klausen, M.; Gniadecki, R.

    2009-01-01

    surgical specimens are formalin fixed and paraffin embedded (FFPE). To explore whether FFPE material would be suitable for miRNA profiling in melanocytic lesions, we compared miRNA expression patterns in FFPE versus fresh frozen samples, obtained from 15 human melanocytic nevi. Out of microarray data, we...

  18. Significance of the Melanocortin 1 and Endothelin B Receptors in Melanocyte Homeostasis and Prevention of Sun-Induced Genotoxicity

    Directory of Open Access Journals (Sweden)

    Zalfa A. Abdel-Malek

    2016-08-01

    Full Text Available The membrane bound melanocortin 1 receptor (MC1R, and the endothelin B receptor (ENDBR are two G-protein coupled receptors that play important roles in constitutive regulation of melanocytes and their response to ultraviolet radiation (UVR, the main etiological factor for melanoma. The human MC1R is a Gs protein-coupled receptor, which is activated by its agonists α-melanocyte stimulating hormone (α-melanocortin; α-MSH and adrenocorticotropic hormone (ACTH. The ENDBR is a Gq coupled-receptor, which is activated by Endothelin (ET-3 during embryonic development, and ET-1 postnatally. Pigmentation and the DNA repair capacity are two major factors that determine the risk for melanoma. Activation of the MC1R by its agonists stimulates the synthesis of eumelanin, the dark brown photoprotective pigment. In vitro studies showed that α-MSH and ET-1 interact synergistically in the presence of basic fibroblast growth factor (bFGF to stimulate human melanocyte proliferation and melanogenesis, and to inhibit UVR-induced apoptosis. An important function of the MC1R is reduction of oxidative stress and activation of DNA repair pathways. The human MC1R is highly polymorphic, and MC1R variants, particularly those that cause loss of function of the expressed receptor, are associated with increased melanoma risk independently of pigmentation. These variants compromise the DNA repair and antioxidant capacities of human melanocytes. Recently, activation of ENDBR by ET-1 was reported to reduce the induction and enhance the repair of UVR-induced DNA photoproducts. We conclude that α-MSH and ET-1 and their cognate receptors MC1R and ENDBR reduce the risk for melanoma by maintaining genomic stability of melanocytes via modulating the DNA damage response to solar UVR. Elucidating the response of melanocytes to UVR should improve our understanding of the process of melanomagenesis, and lead to effective melanoma chemoprevention, as well as therapeutic strategies.

  19. Different Levels of Skin Whitening Activity among 3,6-Anhydro-l-galactose, Agarooligosaccharides, and Neoagarooligosaccharides

    Directory of Open Access Journals (Sweden)

    Ji Hye Kim

    2017-10-01

    Full Text Available 3,6-Anhydro-l-galactose (AHG, a major monomeric constituent of red macroalgae (Rhodophyta, was recently reported to possess skin whitening activity. Moreover, AHG-containing oligosaccharides, such as agarooligosaccharides (AOSs and neoagarooligosaccharides (NAOSs, have various physiological activities, including anti-inflammatory, antioxidant, and skin moisturizing effects. In this study, AHG and NAOSs were produced from agarose by enzymatic reactions catalyzed by an endo-type β-agarase, an exo-type β-agarase, and a neoagarobiose hydrolase. In a cell proliferation assay, AHG, AOSs, and NAOSs at 12.5, 25, and 50 μg/mL concentrations did not exhibit cytotoxicity toward murine B16 melanoma cells or human epidermal melanocytes. In an in vitro skin whitening activity assay of AHG, AOSs, and NAOSs at 50 μg/mL, AHG showed the highest skin whitening activity in both murine B16 melanoma cells and human epidermal melanocytes; this activity was mediated by the inhibition of melanogenesis. Neoagarotetraose and neoagarohexaose also exhibited in vitro skin whitening activity, whereas neoagarobiose and AOSs with degrees of polymerization of 3 (agarotriose, 5 (agaropentaose, and 7 (agaroheptaose did not. Therefore, AHG is responsible for the skin whitening activity of agar-derived sugars, and the structural differences among the AHG-containing oligosaccharides may be responsible for their different skin whitening activities.

  20. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  1. Abundance of the benign melanocytic universe: Dermoscopic-histopathological correlation in nevi.

    Science.gov (United States)

    Woltsche, Nora; Schmid-Zalaudek, Karin; Deinlein, Teresa; Rammel, Katrin; Hofmann-Wellenhof, Rainer; Zalaudek, Iris

    2017-05-01

    The broad universe of "melanocytic nevi" includes a variety of different subtypes, which can be classified either due to their morphology, epidemiology, genetic alterations or risk for developing melanoma. Regarding morphology, on the one hand macroscopic/clinical and on the other hand histopathological appearance were used to subdivide in the past, often resulting in confusion and poor interobserver agreement, while nowadays dermoscopy presents the clinician's precious bridge between naked-eye examination and histopathological diagnostics, allowing prediction of the lesions' histopathology, follow up and monitoring over time without need of excision. The non-invasive dermoscopic examination relies on the assessment of colors, patterns and the distribution of both within a cutaneous lesion. Until today, the correspondence of certain dermoscopic colors and patterns to certain histopathological correlates has been reported for a huge amount of different cutaneous lesions. Moreover, the correspondence of certain dermoscopic features to certain body sites, age groups and pigmentary traits, but also to specific genetic alterations in lesions, has been broadly investigated. Dermoscopy has led us to a new understanding of melanocytic nevi's biology and evolution and, last but not least, to a new classification system, which we want to present herein. © 2017 Japanese Dermatological Association.

  2. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  3. Hyperelastic skin

    Science.gov (United States)

    ... is most often seen in people who have Ehlers-Danlos syndrome. People with this disorder have very elastic skin. ... any member of your family been diagnosed with Ehlers-Danlos syndrome? What other symptoms are present? Genetic counseling may ...

  4. Skin Cancer

    Science.gov (United States)

    ... sunlamps. There are 2 types of UV rays: UVA rays (long-wave) – UVA rays penetrate clouds and glass. They penetrate the ... to cancer. But studies have shown that both UVA and UVB damage the skin and can cause ...

  5. Human phenylalanine hydroxylase is activated by H2O2: a novel mechanism for increasing the L-tyrosine supply for melanogenesis in melanocytes

    International Nuclear Information System (INIS)

    Schallreuter, Karin U.; Wazir, Umar; Kothari, Sonal; Gibbons, Nicholas C.J.; Moore, Jeremy; Wood, John M.

    2004-01-01

    Epidermal phenylalanine hydroxylase (PAH) produces L-tyrosine from the essential amino acid L-phenylalanine supporting melanogenesis in human melanocytes. Those PAH activities increase linearly in the different skin phototypes I-VI (Fitzpatrick classification) and also increase up to 24 h after UVB light with only one minimal erythemal dose. Since UVB generates also H 2 O 2 , we here asked the question whether this reactive oxygen species could influence the activity of pure recombinant human PAH. Under saturating conditions with the substrate L-phenylalanine (1 x 10 -3 M), the V max for enzyme activity increased 4-fold by H 2 O 2 (>2.0 x 10 -3 M). Lineweaver-Burk analysis identified a mixed activation mechanism involving both the regulatory and catalytic domains of PAH. Hyperchem molecular modelling and Deep View analysis support oxidation of the single Trp 120 residue to 5-OH-Trp 120 by H 2 O 2 causing a conformational change in the regulatory domain. PAH was still activated by H 2 O 2 in the presence of the electron donor/cofactor 6(R)-L-erythro-5,6,7,8-tetrahydrobiopterin despite slow oxidation of this cofactor. In vivo FT-Raman spectroscopy confirmed decreased epidermal phenylalanine in association with increased tyrosine after UVB exposure. Hence, generation of H 2 O 2 by UVB can activate epidermal PAH leading to an increased L-tyrosine pool for melanogenesis

  6. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  7. UVB 311 nm tolerance of vitiligo skin increases with skin photo type

    NARCIS (Netherlands)

    Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete

    2005-01-01

    It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we

  8. Loci associated with skin pigmentation identified in African populations

    Science.gov (United States)

    Crawford, Nicholas G.; Kelly, Derek E.; Hansen, Matthew E. B.; Beltrame, Marcia H.; Fan, Shaohua; Bowman, Shanna L.; Jewett, Ethan; Ranciaro, Alessia; Thompson, Simon; Lo, Yancy; Pfeifer, Susanne P.; Jensen, Jeffrey D.; Campbell, Michael C.; Beggs, William; Hormozdiari, Farhad; Mpoloka, Sununguko Wata; Mokone, Gaonyadiwe George; Nyambo, Thomas; Meskel, Dawit Wolde; Belay, Gurja; Haut, Jake; Rothschild, Harriet; Zon, Leonard; Zhou, Yi; Kovacs, Michael A.; Xu, Mai; Zhang, Tongwu; Bishop, Kevin; Sinclair, Jason; Rivas, Cecilia; Elliot, Eugene; Choi, Jiyeon; Li, Shengchao A.; Hicks, Belynda; Burgess, Shawn; Abnet, Christian; Watkins-Chow, Dawn E.; Oceana, Elena; Song, Yun S.; Eskin, Eleazar; Brown, Kevin M.; Marks, Michael S.; Loftus, Stacie K.; Pavan, William J.; Yeager, Meredith; Chanock, Stephen; Tishkoff, Sarah

    2017-01-01

    Despite the wide range of skin pigmentation in humans, little is known about its genetic basis in global populations. Examining ethnically diverse African genomes, we identify variants in or near SLC24A5, MFSD12, DDB1, TMEM138, OCA2 and HERC2 that are significantly associated with skin pigmentation. Genetic evidence indicates that the light pigmentation variant at SLC24A5 was introduced into East Africa by gene flow from non-Africans. At all other loci, variants associated with dark pigmentation in Africans are identical by descent in southern Asian and Australo-Melanesian populations. Functional analyses indicate that MFSD12 encodes a lysosomal protein that affects melanogenesis in zebrafish and mice, and that mutations in melanocyte-specific regulatory regions near DDB1/TMEM138 correlate with expression of UV response genes under selection in Eurasians. PMID:29025994

  9. An Adhesive Patch-Based Skin Biopsy Device for Molecular Diagnostics and Skin Microbiome Studies.

    Science.gov (United States)

    Yao, Zuxu; Moy, Ronald; Allen, Talisha; Jansen, Burkhard

    2017-10-01

    , melanocytes, and other skin cells involved in the pathology of various skin conditions and conditions where the skin can serve as a surrogate target organ. J Drugs Dermatol. 2017;16(10):979-986..

  10. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....

  11. Loss of Oca2 disrupts the unfolded protein response and increases resistance to endoplasmic reticulum stress in melanocytes.

    Science.gov (United States)

    Cheng, Tsing; Orlow, Seth J; Manga, Prashiela

    2013-11-01

    Accumulation of proteins in the endoplasmic reticulum (ER) typically induces stress and initiates the unfolded protein response (UPR) to facilitate recovery. If homeostasis is not restored, apoptosis is induced. However, adaptation to chronic UPR activation can increase resistance to subsequent acute ER stress. We therefore investigated adaptive mechanisms in Oculocutaneous albinism type 2 (Oca2)-null melanocytes where UPR signaling is arrested despite continued tyrosinase accumulation leading to resistance to the chemical ER stressor thapsigargin. Although thapsigargin triggers UPR activation, instead of Perk-mediated phosphorylation of eIF2α, in Oca2-null melanocytes, eIF2α was rapidly dephosphorylated upon treatment. Dephosphorylation was mediated by the Gadd34-PP1α phosphatase complex. Gadd34-complex inhibition blocked eIF2α dephosphorylation and significantly increased Oca2-null melanocyte sensitivity to thapsigargin. Thus, Oca2-null melanocytes adapt to acute ER stress by disruption of pro-apoptotic Perk signaling, which promotes cell survival. This is the first study to demonstrate rapid eIF2α dephosphorylation as an adaptive mechanism to ER stress. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Label-Free Imaging of Female Genital Tract Melanocytic Lesions With Pump-Probe Microscopy: A Promising Diagnostic Tool.

    Science.gov (United States)

    Robles, Francisco E; Deb, Sanghamitra; Fischer, Martin C; Warren, Warren S; Selim, Maria Angelica

    2017-04-01

    Melanomas of the female genital tract present a unique clinical challenge. Not only are these lesions in an anatomically sensitive area, but also they tend to be multifocal and have high recurrence rates. Furthermore, several benign melanocytic proliferations resemble early-stage melanoma clinically and/or histopathologically. Thus, there is a significant need for additional tools that can help correctly diagnose and stage these lesions. Here, we quantitatively and nondestructively analyze the chemical composition of melanin in excised pigmented lesions of the female genital tract using pump-probe microscopy, a high-resolution optical imaging technique that is sensitive to many biochemical properties of melanin. Thirty-one thin (~5 μm) tissue sections previously excised from female genital tract melanocytic lesions were imaged with pump-probe microscopy and analyzed. We find significant quantitative differences in melanin type and structure between melanoma and nonmalignant melanocytic proliferations. Our analysis also suggests a link between the molecular signatures of melanins and lesion-specific genetic mutations. Finally, significant differences are found between metastatic and nonmetastatic melanomas. The limitations of this work include the fact that molecular information is restricted to melanin pigment and the sample size is relatively small. Pump-probe microscopy provides unique information regarding the biochemical composition of genital tract melanocytic lesions, which can be used to improve the diagnosis and staging of vulvar melanomas.

  13. Systemic photoprotection in solar urticaria with α-melanocyte-stimulating hormone analogue [Nle4-D-Phe7]-α-MSH.

    Science.gov (United States)

    Haylett, A K; Nie, Z; Brownrigg, M; Taylor, R; Rhodes, L E

    2011-02-01

    Solar urticaria is a rare photosensitivity disorder demonstrating a range of action spectra, which can inflict a very large impact on life quality despite available treatments. Melanin broadly reduces skin penetration by ultraviolet-visible wavelengths, thus increased melanization may protect in solar urticaria. To examine quantitatively for impact of the potent α-melanocyte stimulating hormone analogue afamelanotide ([Nle(4)-D-Phe(7)]-α-MSH, Scenesse(®); Clinuvel Pharmaceuticals Ltd, Melbourne, Vic., Australia) on the solar urticaria response and skin melanization. Five patients with solar urticaria received a single dose of 16 mg subcutaneous afamelanotide implant in winter time. Melanin density was assessed spectrophotometrically from day 0 to day 60. Detailed monochromated light testing to geometric dose series (increment ) of wavelengths 300-600 nm was performed at 0, 30 and 60 days, with assessment of weal and flare area and minimum urticarial dose (MUD). Data were analysed by repeated-measures anova. Mean melanin density increased by day 7, peaked at day 15 and remained elevated at day 60 (P=0·03, 0·01, 0·02 vs. baseline, respectively). Baseline phototesting revealed action spectra of 320-400 (n=1), 320-500 (n=2), 300-600 (n=1) and 370-500 nm (n=1), and on afamelanotide mean rises in MUD of 1-12 and 1-3 dose increments were seen at the individual wavelengths tested, at 30 and 60 days, respectively. A significant fall in weal area occurred across responding wavelengths from 300 to 600 nm at 60 days postimplant (P=0·049 vs. baseline), accompanied by greater than twofold overall increase in MUD (P=0·058 vs. baseline). Melanization following afamelanotide is accompanied by reduction in solar urticaria response across a broad spectrum of wavelengths. Further study is warranted to assess clinical benefit under ambient conditions in summer. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  14. Skin decontamination

    International Nuclear Information System (INIS)

    Moehrle, G.

    1975-01-01

    A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream

  15. Polarization-Sensitive Hyperspectral Imaging in vivo: A Multimode Dermoscope for Skin Analysis

    Science.gov (United States)

    Vasefi, Fartash; MacKinnon, Nicholas; Saager, Rolf B.; Durkin, Anthony J.; Chave, Robert; Lindsley, Erik H.; Farkas, Daniel L.

    2014-05-01

    Attempts to understand the changes in the structure and physiology of human skin abnormalities by non-invasive optical imaging are aided by spectroscopic methods that quantify, at the molecular level, variations in tissue oxygenation and melanin distribution. However, current commercial and research systems to map hemoglobin and melanin do not correlate well with pathology for pigmented lesions or darker skin. We developed a multimode dermoscope that combines polarization and hyperspectral imaging with an efficient analytical model to map the distribution of specific skin bio-molecules. This corrects for the melanin-hemoglobin misestimation common to other systems, without resorting to complex and computationally intensive tissue optical models. For this system's proof of concept, human skin measurements on melanocytic nevus, vitiligo, and venous occlusion conditions were performed in volunteers. The resulting molecular distribution maps matched physiological and anatomical expectations, confirming a technologic approach that can be applied to next generation dermoscopes and having biological plausibility that is likely to appeal to dermatologists.

  16. Aspirin reduces serum anti-melanocyte antibodies and soluble interleukin-2 receptors in vitiligo patients

    International Nuclear Information System (INIS)

    Zailaie, Mohamad Z.

    2005-01-01

    Increased serum levels of certain immunologic markers including immunoglobulin G (IgG) anti-melanocyte/ vitiligo antibodies (V-IgG) and soluble interleukin-2 receptors (sIL-2R) are associated with augmented humoral and cellular immunity involved in melanocyte cytotoxicity during the active phase of non-segmental vitiligo. Recent reports have shown that, aspirin possesses a wide range of immunomodulatory and antioxidant properties. Therefore, the aim of the present study is to investigate the effect of long-term treatment of vitiligo patients with low-dose oral aspirin on serum V-IgG activity and sIL-2R concentration. The present study was carried out at the Vitiligo Unit, King Abdul-Aziz University Medical Center, Jeddah, Kingdom of Saudi Arabia between March and October 2003. Eighteen female and 14 male patients with a recent onset of non-segmental vitiligo were divided into 2 equal groups. One group received a daily single dose of oral aspirin (300 mg) and the second group received only placebo for a period of 12 weeks. Serum V-IgG activity and sIL-2R concentration were determined before and at the end of treatment period. The V-IgG activity was measured using cellular enzyme-linked immunosorbent assay (ELISA) following incubation of IgG antibodies with an adult cultured melanocytes. Serum sIL-2R concentration was measured using the highly sensitive quantitative sandwich ELISA utilizing a commercially available kit. As expected, the serum V-IgG activity and sIL-2R concentration of the active vitiligo patients (0.81 +/- 0.23 optical density (O.D.), 1428 +/- 510 pg/ml) were significantly increased compared with that of controls (0.27 +/- 0.1 O.D., 846 +/- 312 pg/ml; p<0.05, p<0.01). Aspirin-treated vitiligo patients showed significant decrease in serum V-IgG activity and sIL-2R concentration (0.32 +/- 0.08 O.D., 756 +/- 216 pg/ml) compared with that of placebo-treated patients (0.83 +/- 0.19 O.D., 1327 +/- 392 pg/ml; p<0.01). Low-dose oral aspirin treatment of

  17. Alpha-amidated peptides derived from pro-opiomelanocortin in normal human pituitary

    DEFF Research Database (Denmark)

    Fenger, M; Johnsen, A H

    1988-01-01

    Normal human pituitaries were extracted in boiling water and acetic acid, and the alpha-amidated peptide products of pro-opiomelanocortin (POMC), alpha-melanocyte-stimulating hormone (alpha MSH), gamma-melanocyte-stimulating hormone (gamma 1MSH), and amidated hinge peptide (HP-N), as well...... (ACTH)-(1-39), ACTH-(1-14) and alpha MSH immunoreactivity]. alpha MSH and ACTH-(1-14) were only present in non- or mono-acetylated forms. Only large forms of gamma 1MSH and gamma 2MSH were present in partly glycosylated states. The hinge peptides were amidated to an extent two to three orders...... amidated POMC-related peptides are present in normal human pituitary. It also shows that cleavage in vivo at all dibasic amino acids but one, takes place at the N-terminal POMC region; the exception is at the POMC-(49-50) N-terminal of the gamma MSH sequence. The pattern of peptides produced suggests...

  18. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  19. 'Fish matters': the relevance of fish skin biology to investigative dermatology.

    Science.gov (United States)

    Rakers, Sebastian; Gebert, Marina; Uppalapati, Sai; Meyer, Wilfried; Maderson, Paul; Sell, Anne F; Kruse, Charli; Paus, Ralf

    2010-04-01

    Fish skin is a multi-purpose tissue that serves numerous vital functions including chemical and physical protection, sensory activity, behavioural purposes or hormone metabolism. Further, it is an important first-line defense system against pathogens, as fish are continuously exposed to multiple microbial challenges in their aquatic habitat. Fish skin excels in highly developed antimicrobial features, many of which have been preserved throughout evolution, and infection defense principles employed by piscine skin are still operative in human skin. This review argues that it is both rewarding and important for investigative dermatologists to revive their interest in fish skin biology, as it provides insights into numerous fundamental issues that are of major relevance to mammalian skin. The basic molecular insights provided by zebrafish in vivo-genomics for genetic, regeneration and melanoma research, the complex antimicrobial defense systems of fish skin and the molecular controls of melanocyte stem cells are just some of the fascinating examples that illustrate the multiple potential uses of fish skin models in investigative dermatology. We synthesize the essentials of fish skin biology and highlight selected aspects that are of particular comparative interest to basic and clinically applied human skin research.

  20. Keratinocyte-Melanocyte graft technique followed by PUVA therapy for stable vitiligo

    Directory of Open Access Journals (Sweden)

    Kachhawa Dilip

    2008-01-01

    Full Text Available Background: Various surgical procedures for correcting stable vitiligo exist but these have their own limitations. Autologous, non-cultured, non-trypsinized, melanocyte plus keratinocyte grafting is a new and simple method of vitiligo surgery. Objective: The study aimed to evaluate efficacy of a new grafting technique in vitiligo patches. Methods: Eighteen vitiligo patches underwent this procedure. The upper layer of epidermis was removed by superficial dermabrasion using a dermabrader micromotor until the epidermis appeared wet and shiny. Then, antibiotic ointment was applied and dermabrasion was continued up to the whitish area of the upper dermis. The paste-like material (ointment with entangled epidermal particles was collected and spread over the dermabraded recipient site. Results: Pigmentation usually started at 4-6 weeks. Complete uniform pigmentation took 16-20 weeks. Conclusion: For smaller vitiligo patches this method gives cosmetically acceptable results. It is easy to perform and does not require specific laboratory setup.

  1. Small Dysplastic Congenital Melanocytic Nevi in Childhood as Possible Melanoma Imitators

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2018-01-01

    Full Text Available Small pigmented lesions in children can represent a significant diagnostic challenge. If the diagnostic features and therapeutic approach are relatively well established in large and giant nevi, there is still much controversy regarding small and intermediate-sized congenital pigmented lesions that can lead to significant diagnostic challenges, both clinically and dermoscopically, and consequently to difficulty in defining the optimal approach in such cases. Although dermoscopy can be useful in the diagnosis of pigmented lesions, the diversity of clinical and dermoscopic features of pigmented nevi in children usually hinder the differentiation between them and melanoma. Histological findings after resection often show surprising results that do not correspond either to the clinical nor the dermoscopic features. With the present case, we want to emphasise the variable natural behaviour of melanocytic lesions in children, which sometimes leads to unnecessary surgical excisions, which should be avoided in pediatric patients.

  2. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  3. Effectiveness of an employee skin cancer screening program for secondary prevention.

    Science.gov (United States)

    Uslu, Ugur; Hees, Felix; Winnik, Eva; Uter, Wolfgang; Sticherling, Michael

    2016-08-01

    Incidences of UV-induced skin cancer are continuously increasing. For this reason, early diagnosis is becoming more important. In this study, 783 employees of a technical company participated in an employee skin cancer screening program, which consisted of a physical examination for benign and malignant skin lesions and premalignant conditions. To ensure the quality of the examinations, screening was only performed by 5 trained dermatologists. Participants also were asked to complete a standardized questionnaire prior to examination. A total of 661 skin lesions were diagnosed among 48% of participants; 12.8% of participants exhibited 50 or more melanocytic nevi and the risk for developing skin cancer was categorized as at least moderate for 64.9%. Additionally, 84.4% of participants with at least 1 skin lesion were advised to have a checkup within 1 year. The high rate of suspicious nevi detected in this study suggested that employee skin cancer screening programs are effective and also should be recommended at companies where employees are not at increased risk for developing skin cancer due to the nature of their work (eg, those who work outdoors). Despite the comparatively selective and young study population, these examinations provide evidence of the importance of skin cancer screening for the wider population.

  4. Use of multiphoton tomography and fluorescence lifetime imaging to investigate skin pigmentation in vivo

    Science.gov (United States)

    Dancik, Yuri; Favre, Amandine; Loy, Chong Jin; Zvyagin, Andrei V.; Roberts, Michael S.

    2013-02-01

    There is a growing body of literature showing the usefulness of multiphoton tomography (MPT) and fluorescence lifetime imaging for in situ characterization of skin constituents and the ensuing development of noninvasive diagnostic tools against skin diseases. Melanin and pigmentation-associated skin cancers constitute some of the major applications. We show that MPT and fluorescence lifetime imaging can be used to measure changes in cutaneous melanin concentration and that these can be related to the visible skin color. Melanin in the skin of African, Indian, Caucasian, and Asian volunteers is detected on the basis of its emission wavelength and fluorescence lifetimes in solution and in a melanocyte-keratinocyte cell culture. Fluorescence intensity is used to characterize the melanin content and distribution as a function of skin type and depth into the skin (stratum granulosum and stratum basale). The measured fluorescence intensities in given skin types agree with melanin amounts reported by others using biopsies. Our results suggest that spatial distribution of melanin in skin can be studied using MPT and fluorescence lifetime imaging, but further studies are needed to ascertain that the method can resolve melanin amount in smaller depth intervals.

  5. Platelet lysate as a serum replacement for skin cell culture on biomimetic PCL nanofibers.

    Science.gov (United States)

    Sovkova, Vera; Vocetkova, Karolina; Rampichova, Michala; Mickova, Andrea; Buzgo, Matej; Lukasova, Vera; Dankova, Jana; Filova, Eva; Necas, Alois; Amler, Evzen

    2018-06-01

    Platelets are a popular source of native growth factors for tissue engineering applications. The aim of the study was to verify the use of platelet lysate as a fetal bovine serum (FBS) replacement for skin cell culture. The cytokine content of the platelet lysate was characterized using the Bio-Plex system. The cells (fibroblasts, melanocytes, and keratinocytes) were cultured on PCL nanofibrous scaffolds to mimic their natural microenvironment. The cytokine content of the platelet lysate was determined, and to the cells, a medium containing platelet lysate or platelet lysate in combination with FBS was added. The results showed that 7% (v/v) platelet lysate was sufficient to supplement 10% (v/v) FBS in the culture of fibroblasts and keratinocytes. The combination of platelet lysate and FBS had a rather inhibitory effect on fibroblasts, in contrary to keratinocytes, where the effect was synergic. Platelet lysate did not sufficiently promote proliferation in melanocytes; however, the combination of FBS and platelet lysate yielded a better outcome and resulted in bipolar morphology of the cultured melanocytes. The data indicated that platelet lysate improved cell proliferation and metabolic activity and may be used as an additive to the cell culture media.

  6. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  7. Gallium-67-labeled lactam bridge-cyclized alpha-melanocyte stimulating hormone peptide for primary and metastatic melanoma imaging.

    Science.gov (United States)

    Guo, Haixun; Yang, Jianquan; Shenoy, Nalini; Miao, Yubin

    2009-12-01

    The purpose of this study was to examine the melanoma imaging properties of a novel 67Ga-labeled lactam bridge-cyclized alpha-melanocyte stimulating hormone (alpha-MSH) peptide. A lactam bridge-cyclized alpha-MSH peptide, DOTA-GlyGlu-CycMSH {DOTA-Gly-Glu-c[Lys-Nle-Glu-His-DPhe-Arg-Trp-Gly-Arg-Pro-Val-Asp]}, was synthesized and radiolabeled with 67Ga. The melanoma targeting and pharmacokinetic properties of 67Ga-DOTA-GlyGlu-CycMSH were determined in B16/F1 flank primary melanoma-bearing and B16/F10 pulmonary metastatic melanoma-bearing C57 mice. Flank primary melanoma and pulmonary metastatic melanoma imaging were performed by small animal single photon emission computed tomography (SPECT)/CT using 67Ga-DOTA-GlyGlu-CycMSH as an imaging probe. 67Ga-DOTA-GlyGlu-CycMSH was readily prepared with greater than 95% radiolabeling yield. 67Ga-DOTA-GlyGlu-CycMSH exhibited substantial tumor uptake (12.93 +/- 1.63%ID/g at 2 h postinjection) and prolonged tumor retention (5.02 +/- 1.35%ID/g at 24 h postinjection) in B16/F1 melanoma-bearing C57 mice. The uptake values for nontarget organs were generally low (<0.30%ID/g) except for the kidneys at 2, 4, and 24 h postinjection. 67Ga-DOTA-GlyGlu-CycMSH exhibited significantly (p < 0.05) higher uptakes (1.44 +/- 0.75%ID/g at 2 h postinjection and 1.49 +/- 0.69%ID/g at 4 h postinjection) in metastatic melanoma-bearing lung than those in normal lung (0.15 +/- 0.10%ID/g and 0.17 +/- 0.11%ID/g at 2 and 4 h postinjection, respectively). Both flank primary B16/F1 melanoma and B16/F10 pulmonary melanoma metastases were clearly visualized by SPECT/CT using 67Ga-DOTA-GlyGlu-CycMSH as an imaging probe 2 h postinjection. 67Ga-DOTA-GlyGlu-CycMSH exhibited favorable melanoma targeting and imaging properties, highlighting its potential as an effective imaging probe for early detection of primary and metastatic melanoma.

  8. Reducing renal uptake of 9Y- and 177Lu-labeled alpha-melanocyte stimulating hormone peptide analogues

    International Nuclear Information System (INIS)

    Miao Yubin; Fisher, Darrell R.; Quinn, Thomas P.

    2006-01-01

    Objective: The purpose of this study was to improve the tumor-to-kidney uptake ratios of 9 Y- and 177 Lu-[1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid-Re-Cys 3,4,1 , D-Phe 7 , Arg 11 ]α-melanocyte stimulating hormone 3-13 {DOTA-Re(Arg 11 )CCMSH} through coupling a negatively charged glutamic acid (Glu) to the peptide sequence. Methods: A new peptide of DOTA-Re(Glu 2 , Arg 11 )CCMSH was designed, synthesized and labeled with 9 Y and 177 Lu. Pharmacokinetics of 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH was determined in B16/F1 murine melanoma-bearing C57 mice. Results: 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH exhibited significantly (P 9 Y- and 177 Lu-DOTA-Re(Arg 11 )CCMSH at 30 min and at 2, 4 and 24 h after dose administration. The renal uptake values of 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH were 28.16% and 28.81% of those of 9 Y- and 177 Lu-DOTA-Re(Arg 11 )CCMSH, respectively, at 4 h postinjection. 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH displayed higher tumor-to-kidney uptake ratios than 9 Y- and 177 Lu-DOTA-Re(Arg 11 )CCMSH at 30 min and at 2, 4 and 24 h after dose administration. The tumor-to-kidney uptake ratio of 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH was 2.28 and 1.69 times of 9 Y- and 177 Lu-DOTA-Re(Arg 11 )CCMSH, respectively, at 4 h postinjection. The 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH activity accumulation was low in normal organs except for kidney. Conclusions: Coupling a negatively charged amino acid (Glu) to the CCMSH peptide sequence dramatically reduced the renal uptake values and increased the tumor-to-kidney uptake ratios of 9 Y- and 177 Lu-DOTA-Re(Glu 2 , Arg 11 )CCMSH, facilitating their potential applications as radiopharmaceuticals for targeted radionuclide therapy of melanoma

  9. Matching the skin barrier to the skin type.

    Science.gov (United States)

    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  10. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  11. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures ...

  12. Skin Cancer Treatment

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  13. Stages of Skin Cancer

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  14. Bacterial skin flora of diabetic patients in the Jos University Teaching ...

    African Journals Online (AJOL)

    Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...

  15. Cooperation of endothelin-1 signaling with melanosomes plays a role in developing and/or maintaining human skin hyperpigmentation

    Directory of Open Access Journals (Sweden)

    Daiki Murase

    2015-10-01

    Full Text Available Skin hyperpigmentation is characterized by increased melanin synthesis and deposition that can cause significant psychosocial and psychological distress. Although several cytokine-receptor signaling cascades contribute to the formation of ultraviolet B-induced cutaneous hyperpigmentation, their possible involvement in other types of skin hyperpigmentation has never been clearly addressed. Since our continuous studies using skin specimens from more than 30 subjects with ethnic skin diversity emphasized a consistent augmentation in the expression of endothelin-1 (ET-1 and its receptor (Endothelin B receptor, ET-B in hyperpigmented lesions, including senile lentigos (SLs, the precise function of ET-1 signaling was investigated in the present study. In line with previous studies, ET-1 significantly induced melanogenesis followed by increases in melanosome transport in melanocytes and in its transfer to keratinocytes while inhibition of ET-B function substantially depressed melanogenic ability in tissue-cultured SLs. Additionally, in agreement with a previous report that the formation of autophagosomes rather than melanosomes is stimulated according to starvation or defective melanosome production, ET-1 was found to remarkably augment the expression of components necessary for early melanosome formation, indicating its counteraction against autophagy-targeting melanosome degradation in melanocytes. Despite the lack of substantial impact of ET-1 on keratinocyte melanogenic functions, the expression of ET-1 was enhanced following melanosome uptake by keratinocytes. Taken together, our data suggest that ET-1 plays a substantial role in the development and/or maintenance of skin hyperpigmentation in reciprocal cooperation with increased melanosome incorporation.

  16. Melan-A/Mart-1- or HMB-45-positive melanocytes are not present in calcifying cystic odontogenic tumors (calcifying odontogenic cysts): a study in 13 Caucasian patients.

    Science.gov (United States)

    Tosios, Konstantinos I; Prountzos, Nikolaos; Katsoulas, Nikolaos; Koutlas, Ioannis G; Sklavounou-Andrikopoulou, Alexandra

    2012-03-01

    Melanin pigment and melanocytes may be found in odontogenic cysts and tumors, particularly calcifying cystic odontogenic tumor (CCOT). In the present study we investigated the immunohistochemical expression of the Melan-A/Mart-1 and HMB-45 antigens in 13 Caucasians patients with CCOT. Melan-A/Mart-1- and HMB-45-positive melanocytes were not seen in any of the cases. Our findings are in agreement with the assumption that pigmentation in odontogenic lesions may be a racial phenomenon.

  17. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  18. Evaluation of the Melanocytic Pathology Assessment Tool and Hierarchy for Diagnosis (MPATH-Dx) classification scheme for diagnosis of cutaneous melanocytic neoplasms: Results from the International Melanoma Pathology Study Group.

    Science.gov (United States)

    Lott, Jason P; Elmore, Joann G; Zhao, Ge A; Knezevich, Stevan R; Frederick, Paul D; Reisch, Lisa M; Chu, Emily Y; Cook, Martin G; Duncan, Lyn M; Elenitsas, Rosalie; Gerami, Pedram; Landman, Gilles; Lowe, Lori; Messina, Jane L; Mihm, Martin C; van den Oord, Joost J; Rabkin, Michael S; Schmidt, Birgitta; Shea, Christopher R; Yun, Sook Jung; Xu, George X; Piepkorn, Michael W; Elder, David E; Barnhill, Raymond L

    2016-08-01

    Pathologists use diverse terminology when interpreting melanocytic neoplasms, potentially compromising quality of care. We sought to evaluate the Melanocytic Pathology Assessment Tool and Hierarchy for Diagnosis (MPATH-Dx) scheme, a 5-category classification system for melanocytic lesions. Participants (n = 16) of the 2013 International Melanoma Pathology Study Group Workshop provided independent case-level diagnoses and treatment suggestions for 48 melanocytic lesions. Individual diagnoses (including, when necessary, least and most severe diagnoses) were mapped to corresponding MPATH-Dx classes. Interrater agreement and correlation between MPATH-Dx categorization and treatment suggestions were evaluated. Most participants were board-certified dermatopathologists (n = 15), age 50 years or older (n = 12), male (n = 9), based in the United States (n = 11), and primary academic faculty (n = 14). Overall, participants generated 634 case-level diagnoses with treatment suggestions. Mean weighted kappa coefficients for diagnostic agreement after MPATH-Dx mapping (assuming least and most severe diagnoses, when necessary) were 0.70 (95% confidence interval 0.68-0.71) and 0.72 (95% confidence interval 0.71-0.73), respectively, whereas correlation between MPATH-Dx categorization and treatment suggestions was 0.91. This was a small sample size of experienced pathologists in a testing situation. Varying diagnostic nomenclature can be classified into a concise hierarchy using the MPATH-Dx scheme. Further research is needed to determine whether this classification system can facilitate diagnostic concordance in general pathology practice and improve patient care. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  19. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  20. Next generation human skin constructs as advanced tools for drug development.

    Science.gov (United States)

    Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela

    2017-11-01

    Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various

  1. [Skin hydration and hydrating products].

    Science.gov (United States)

    Duplan, H; Nocera, T

    2018-05-01

    One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

  2. Integrated genomic classification of melanocytic tumors of the central nervous system using mutation analysis, copy number alterations and DNA methylation profiling.

    Science.gov (United States)

    Griewank, Klaus; Koelsche, Christian; van de Nes, Johannes A P; Schrimpf, Daniel; Gessi, Marco; Möller, Inga; Sucker, Antje; Scolyer, Richard A; Buckland, Michael E; Murali, Rajmohan; Pietsch, Torsten; von Deimling, Andreas; Schadendorf, Dirk

    2018-06-11

    In the central nervous system, distinguishing primary leptomeningeal melanocytic tumors from melanoma metastases and predicting their biological behavior solely using histopathologic criteria can be challenging. We aimed to assess the diagnostic and prognostic value of integrated molecular analysis. Targeted next-generation-sequencing, array-based genome-wide methylation analysis and BAP1 immunohistochemistry was performed on the largest cohort of central nervous system melanocytic tumors analyzed to date, incl. 47 primary tumors of the central nervous system, 16 uveal melanomas. 13 cutaneous melanoma metastasis and 2 blue nevus-like melanomas. Gene mutation, DNA-methylation and copy-number profiles were correlated with clinicopathological features. Combining mutation, copy-number and DNA-methylation profiles clearly distinguished cutaneous melanoma metastases from other melanocytic tumors. Primary leptomeningeal melanocytic tumors, uveal melanomas and blue nevus-like melanoma showed common DNA-methylation, copy-number alteration and gene mutation signatures. Notably, tumors demonstrating chromosome 3 monosomy and BAP1 alterations formed a homogeneous subset within this group. Integrated molecular profiling aids in distinguishing primary from metastatic melanocytic tumors of the central nervous system. Primary leptomeningeal melanocytic tumors, uveal melanoma and blue nevus-like melanoma share molecular similarity with chromosome 3 and BAP1 alterations markers of poor prognosis. Copyright ©2018, American Association for Cancer Research.

  3. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  4. Usefulness of confocal microscopy in distinguishing between basal cell carcinoma and intradermal melanocytic nevus on the face.

    Science.gov (United States)

    Gamo, R; Floristan, U; Pampín, A; Caro, D; Pinedo, F; López-Estebaranz, J L

    2015-10-01

    The clinical distinction between basal cell carcinoma (BCC) and intradermal melanocytic nevus lesions on the face can be difficult, particularly in young patients or patients with multiple nevi. Dermoscopy is a useful tool for analyzing characteristic dermoscopic features of BCC, such as cartwheel structures, maple leaf-like areas, blue-gray nests and dots, and ulceration. It also reveals arborizing telangiectatic vessels and prominent curved vessels, which are typical of BCC, and comma vessels, which are typical of intradermal melanocytic nevi. It is, however, not always easy to distinguish between these 2 conditions, even when dermoscopy is used. We describe 2 facial lesions that posed a clinical and dermoscopic challenge in two 38-year-old patients; confocal microscopy showed separation between tumor nests and stroma and polarized nuclei, which are confocal microscopy features of basal cell carcinoma. Copyright © 2014 Elsevier España, S.L.U. y AEDV. All rights reserved.

  5. The Melanocyte Fate in Neural Crest is Triggered by Myb Proteins through Activation of c-kit

    Czech Academy of Sciences Publication Activity Database

    Karafiát, Vít; Dvořáková, Marta; Pajer, Petr; Čermák, Vladimír; Dvořák, Michal

    2007-01-01

    Roč. 64, č. 21 (2007), s. 2975-2984 ISSN 1420-682X R&D Projects: GA MŠk(CZ) LC06061; GA ČR GA204/06/1728 Institutional research plan: CEZ:AV0Z50520514 Keywords : c-myb proto-oncogene * v-mybAMV oncogene * neural crest * cell fate determination * melanocytes * c-kit signal Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.239, year: 2007

  6. UVB-Stimulated TNFα Release from Human Melanocyte and Melanoma Cells Is Mediated by p38 MAPK

    Directory of Open Access Journals (Sweden)

    Visalini Muthusamy

    2013-08-01

    Full Text Available Ultraviolet (UV radiation activates cell signaling pathways in melanocytes. As a result of altered signaling pathways and UV-induced cellular damage, melanocytes can undergo oncogenesis and develop into melanomas. In this study, we investigated the effect of UV-radiation on p38 MAPK (mitogen-activated protein kinase, JNK and NFκB pathways to determine which plays a major role in stimulating TNFα secretion in human HEM (melanocytes and MM96L (melanoma cells. MM96L cells exhibited 3.5-fold higher p38 activity than HEM cells at 5 min following UVA + B radiation and 1.6-fold higher JNK activity at 15–30 min following UVB+A radiation, while NFκB was minimally activated in both cells. Irradiated HEM cells had the greatest fold of TNFα secretion (UVB: 109-fold, UVA + B: 103-fold & UVB+A: 130-fold when co-exposed to IL1α. The p38 inhibitor, SB202190, inhibited TNFα release by 93% from UVB-irradiated HEM cells. In the UVB-irradiated MM96L cells, both SB202190 and sulfasalazine (NFκB inhibitor inhibited TNFα release by 52%. Although, anisomycin was a p38 MAPK activator, it inhibited TNFα release in UV-irradiated cells. This suggests that UV-mediated TNFα release may occur via different p38 pathway intermediates compared to those stimulated by anisomycin. As such, further studies into the functional role p38 MAPK plays in regulating TNFα release in UV-irradiated melanocyte-derived cells are warranted.

  7. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  8. Construction of a Three-Dimensional in vitro skin model on polycaprolactone fibers.

    Science.gov (United States)

    Liu, Qi; Zhang, Ru-Zhi; Xu, Bin

    2017-05-16

    To observe the morphological characteristics and the biological properties of human epidermal cells when cultured at an air-liquid interface in polycaprolactone (PCL) fibers as a three-dimensional scaffold for tissue engineering. In this study, the melanocytes and keratinocytes were obtained from human scalp skin, seeded onto a PCL film, and cocultured for 2 weeks to construct a three-dimensional (3D) skin model. The cells were then characterized by hematoxylin and eosin (H&E) staining, by immunohistochemical staining with antibodies to cytokeratin 15 (CK15), Ki-67, CD34, CD200 and HMB45 and by transmission electron microscopy. Keratinocytes and melanocytes grew well in the co-culture system. Hematoxylin and eosin staining revealed that the cells adhered to the PCLfiber scaffold well, the keratinocyte layer became a multilayered concentric structure and the surface became distinctly keratinized at the air-liquid interface. Immunohistochemical analyses exhibited a scattered distribution of cells expressing CK15, CD34, CD200, Ki-67 and/or HMB45. Transmission electron microscopy revealed that the keratinocytes contained a number of keratin fibrils and membrane-coated granules. The PCL scaffold has excellent adhesiveness and biocompatibility with human epidermal cells, and is suitable for constructing 3D skin models for tissue engineering in the future.

  9. Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes.

    Science.gov (United States)

    Kenyon, Amy; Gavriouchkina, Daria; Zorman, Jernej; Chong-Morrison, Vanessa; Napolitani, Giorgio; Cerundolo, Vincenzo; Sauka-Spengler, Tatjana

    2018-04-06

    A complex network of inflammatory genes is closely linked to somatic cell transformation and malignant disease. Immune cells and their associated molecules are responsible for detecting and eliminating cancer cells as they establish themselves as the precursors of a tumour. By the time a patient has a detectable solid tumour, cancer cells have escaped the initial immune response mechanisms. Here, we describe the development of a double binary zebrafish model that enables regulatory programming of the myeloid cells as they respond to oncogene-activated melanocytes to be explored, focussing on the initial phase when cells become the precursors of cancer. A hormone-inducible binary system allows for temporal control of expression of different Ras oncogenes ( NRas Q61K , HRas G12V and KRas G12V ) in melanocytes, leading to proliferation and changes in morphology of the melanocytes. This model was coupled to binary cell-specific biotagging models allowing in vivo biotinylation and subsequent isolation of macrophage or neutrophil nuclei for regulatory profiling of their active transcriptomes. Nuclear transcriptional profiling of neutrophils, performed as they respond to the earliest precursors of melanoma in vivo , revealed an intricate landscape of regulatory factors that may promote progression to melanoma, including Serpinb1l4, Fgf1, Fgf6, Cathepsin H, Galectin 1 and Galectin 3. The model presented here provides a powerful platform to study the myeloid response to the earliest precursors of melanoma. © 2018. Published by The Company of Biologists Ltd.

  10. Silencing of GPNMB by siRNA Inhibits the Formation of Melanosomes in Melanocytes in a MITF-Independent Fashion

    Science.gov (United States)

    Zhu, Cansheng; Yuan, Xiaoying; Li, Dongguang; Gu, Weijie; Ma, Huimin; Xie, Xin; Gao, Tianwen

    2012-01-01

    Background Melanosomes are specialized membrane-surrounded organelles, which are involved in the synthesis, storage and transport of melanin. Glycoprotein (transmembrane) non-metastatic melanoma protein b (GPNMB), a melanosome-specific structural protein, shares significant amino acid sequence homology with Pmel-17. Proteomic analysis demonstrated that GPNMB is present in all stages (I-IV) of melanosomes. However, little is known about the role of GPNMB in melanosomes. Methodology/Principal Findings Using real-time quantitative PCR, Western blotting and immunofluorescence analysis, we demonstrated that the expression of GPNMB in PIG1 melanocytes was up-regulated by ultraviolet B (UVB) radiation. Transmission electron microscopy analysis showed that the total number of melanosomes in PIG1 melanocytes was sharply reduced by GPNMB-siRNA transfection. Simultaneously, the expression levels of tyrosinase (Tyr), tyrosinase related protein 1 (Trp1), Pmel17/gp100 and ocular albinism type 1 protein (OA1) were all significantly attenuated. But the expression of microphthalmia-associated transcription factor (MITF) was up-regulated. Intriguingly, in GPNMB silenced PIG1 melanocytes, UVB radiation sharply reduced MITF expression. Conclusion Our present work revealed that the GPNMB was critical for the formation of melanosomes. And GPNMB expression down-regulation attenuated melanosome formation in a MITF-independent fashion. PMID:22912767

  11. Diagnosis of Malignant Melanoma of Skin Cancer Types

    Directory of Open Access Journals (Sweden)

    Abbas Hassin Alasadi

    2017-08-01

    Full Text Available Malignant melanoma is a kind of skin cancer that begins in melanocytes. It can influence on the skin only, or it may expand to the bones and organs. It is less common, but more serious and aggressive than other types of skin cancer. Malignant Melanoma can happen anywhere on the skin, but it is widespread in certain locations such as the legs in women, the back and chest in men, the face, the neck, mouth, eyes, and genitals. In this paper, a proposed algorithm is designed for diagnosing malignant melanoma types by using digital image processing techniques. The algorithm consists of four steps: preprocessing, separation, features extraction, and diagnosis. A neural network (NN used to diagnosis malignant melanoma types. The total accuracy of the neural network was 100% for training and 93% for testing. The evaluation of the algorithm is done by using sensitivity, specificity, and accuracy. The sensitivity of NN in diagnosing malignant melanoma types was 95.6%, while the specificity was 92.2% and the accuracy was 93.9%. The experimental results are acceptable.

  12. RASopathic skin eruptions during vemurafenib therapy.

    Directory of Open Access Journals (Sweden)

    Jeannine D Rinderknecht

    Full Text Available Vemurafenib is a potent inhibitor of V600 mutant BRAF with significant impact on progression-free and overall survival in advanced melanoma. Cutaneous side effects are frequent. This single-center observational study investigates clinical and histological features of these class-specific cutaneous adverse reactions.Patients were all treated with Vemurafenib 960 mg b.i.d. within local ethic committees approved clinical trials. All skin reactions were collected and documented prospectively. Cutaneous reactions were classified by reaction pattern as phototoxic and inflammatory, hair and nail changes, keratinocytic proliferations and melanocytic disorders.Vemurafenib was well tolerated, only in two patients the dose had to be reduced to 720 mg due to arthralgia. 26/28 patients (93% experienced cutaneous side effects. Observed side effects included UVA dependent photosensitivity (n = 16, maculopapular exanthema (n = 14, pruritus (n = 8, folliculitis (n = 5, burning feet (n = 3, hair thinning (mild alopecia (n = 8, curly hair (n = 2 and nail changes (n = 2. Keratosis pilaris and acanthopapilloma were common skin reactions (n = 12/n = 13, as well as plantar hyperkeratosis (n = 4, keratoacanthoma (n = 5 and invasive squamous cell carcinoma (n = 4. One patient developed a second primary melanoma after more than 4 months of therapy (BRAF and RAS wild type.Vemurafenib has a broad and peculiar cutaneous side effect profile involving epidermis and adnexa overlapping with the cutaneous manifestations of genetic diseases characterized by activating germ line mutations of RAS (RASopathy. They must be distinguished from allergic drug reaction. Regular skin examination and management by experienced dermatologists as well as continuous prophylactic photo protection including an UVA optimized sun screen is mandatory.

  13. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  14. The Alpha-Melanocyte Stimulating Hormone Induces Conversion of Effector T Cells into Treg Cells

    Directory of Open Access Journals (Sweden)

    Andrew W. Taylor

    2011-01-01

    Full Text Available The neuropeptide alpha-melanocyte stimulating hormone (α-MSH has an important role in modulating immunity and homeostasis. The production of IFN-γ by effector T cells is suppressed by α-MSH, while TGF-β production is promoted in the same cells. Such α-MSH-treated T cells have immune regulatory activity and suppress hypersensitivity, autoimmune diseases, and graft rejection. Previous characterizations of the α-MSH-induced Treg cells showed that the cells are CD4+ T cells expressing the same levels of CD25 as effector T cells. Therefore, we further analyzed the α-MSH-induced Treg cells for expression of effector and regulatory T-cell markers. Also, we examined the potential for α-MSH-induced Treg cells to be from the effector T-cell population. We found that the α-MSH-induced Treg cells are CD25+  CD4+ T cells that share similar surface markers as effector T cells, except that they express on their surface LAP. Also, the α-MSH treatment augments FoxP3 message in the effector T cells, and α-MSH induction of regulatory activity was limited to the effector CD25+ T-cell population. Therefore, α-MSH converts effector T cells into Treg cells, which suppress immunity targeting specific antigens and tissues.

  15. Oral delivery of Bifidobacterium longum expressing α-melanocyte-stimulating hormone to combat ulcerative colitis.

    Science.gov (United States)

    Wei, Pijin; Yang, Yan; Ding, Qing; Li, Xiuying; Sun, Hanxiao; Liu, Zhaobing; Huang, Junli; Gong, Yahui

    2016-02-01

    α-Melanocyte-stimulating hormone (α-MSH) is a tridecapeptide derived from pro-opiomelanocortin that exhibits potent anti-inflammatory properties by regulating the production of inflammatory mediators. This peptide has been well established in several inflammatory models, including inflammatory bowel disease (IBD). However, its extremely short duration in vivo limits its clinical application. To address this limitation, Bifidobacterium was used here as a carrier to deliver α-MSH. We utilized α-MSH-engineered Bifidobacterium against IBD, which is closely linked to immune and intestinal microbiota dysfunction. First, we constructed a Bifidobacterium longum secreting α-MSH (B. longum-α-MSH). We then tested the recombinant α-MSH expression and determined its bioactivity in HT-29 cells. To assess its effectiveness, B. longum-α-MSH was used against an ulcerative colitis (UC) model in rats induced by dextran sulfate sodium. The data showed that α-MSH expression in B. longum-α-MSH was effective, and its biological activity was similar to the synthesized one. This UC model experiment indicated that B. longum-α-MSH successfully colonized the intestinal gut, expressed bioactive α-MSH and had a significant anti-inflammatory effect. The results demonstrate the feasibility of preventing IBD by using B. longum-α-MSH.

  16. A Case of Iris Melanocytoma Demonstrating Diffuse Melanocytic Proliferation with Uncontrolled Intraocular Pressure

    Directory of Open Access Journals (Sweden)

    Mami Kusunose

    2017-03-01

    Full Text Available We report a rare case with histologically proven melanocytoma of the iris that demonstrated diffuse melanocytic proliferation with uncontrolled secondary glaucoma and investigate the etiology of the intraocular pressure elevation. The patient was a 78-year-old man with a history of darkened iris of his left eye. The intraocular pressure was 39 mm Hg. A slit-lamp examination showed a diffuse darkened iris, and a gonioscopic examination revealed open angle with circumferential heavy pigmentation. There was no pigment dispersion of the anterior chamber and no pigment deposition of the cornea. We suspected malignant ring melanoma in the left eye and enucleated it. The globe was examined with light and electron microscopy. Light microscopy revealed the presence of heavily pigmented tumor cells in the iris, ciliary body, trabecular meshwork, and Schlemm’s canal. A bleached preparation showed large tumor cells with central and paracentral nuclei without mitosis. Electron microscopy of the trabecular meshwork revealed melanin-bearing tumor cells invading the intertrabecular spaces, and the melanin granules were not phagocytosed in the trabecular cells. The mechanical obstruction of the aqueous flow by the tumor cells may be a major cause of secondary glaucoma in eyes with iris melanocytoma presenting diffuse proliferation.

  17. L-tyrosine and L-DOPA as hormone-like regulators of melanocytes functions

    Science.gov (United States)

    Slominski, Andrzej; Zmijewski, Michal; Pawelek, John

    2011-01-01

    Summary Evidence reveals that L-tyrosine and L-DOPA, besides serving as substrates and intermediates of melanogenesis, are also bioregulatory agents acting not only as inducers and positive regulators of melanogenesis but also as regulators of other cellular functions. These can be mediated through action on specific receptors or through non-receptor mediated mechanisms. The substrate induced (L-tyrosine and/or L-DOPA) melanogenic pathway would autoregulate itself as well as it would regulate the melanocyte functions through activity of its structural or regulatory proteins and through intermediates of melanogenesis and melanin itself. Dissection of regulatory and autoregulatory elements of this process may elucidate how substrate induced autoregulatory pathways have evolved from prokaryotic or simple eukaryotic organisms to complex systems in vertebrates. This could substantiate older theory proposing that receptors for amino-acid derived hormones arose from the receptors for those amino acids, and that nuclear receptors evolved from primitive intracellular receptors binding nutritional factors or metabolic intermediates. PMID:21834848

  18. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can ... rarely, younger children can develop skin cancer. How can people with dark skin get skin cancer? Although ...

  19. Role of the Ubiquitin Proteasome System in Regulating Skin Pigmentation

    Directory of Open Access Journals (Sweden)

    Hideya Ando

    2009-10-01

    Full Text Available Pigmentation of the skin, hair and eyes is regulated by tyrosinase, the critical rate-limiting enzyme in melanin synthesis by melanocytes. Tyrosinase is degraded endogenously, at least in part, by the ubiquitin proteasome system (UPS. Several types of inherited hypopigmentary diseases, such as oculocutaneous albinism and Hermansky-Pudlak syndrome, involve the aberrant processing and/or trafficking of tyrosinase and its subsequent degradation which can occur due to the quality-control machinery. Studies on carbohydrate modifications have revealed that tyrosinase in the endoplasmic reticulum (ER is proteolyzed via ER-associated protein degradation and that tyrosinase degradation can also occur following its complete maturation in the Golgi. Among intrinsic factors that regulate the UPS, fatty acids have been shown to modulate tyrosinase degradation in contrasting manners through increased or decreased amounts of ubiquitinated tyrosinase that leads to its accelerated or decelerated degradation by proteasomes.

  20. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  1. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  2. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  3. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  4. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  5. Histoplasma skin test

    Science.gov (United States)

    Histoplasmosis skin test ... health care provider cleans an area of your skin, usually the forearm. An allergen is injected just below the cleaned skin surface. An allergen is a substance that causes ...

  6. Skin Condition Finder

    Science.gov (United States)

    ... SKIN CONDITIONS HEALTH TOPICS FOR PROFESSIONALS Rash and Skin Condition Finder 1 Select Age Group Infant Child ... Toe Toe Webspace Toe Nail CLOSE About the Skin Condition Finder Have a health question or concern? ...

  7. Skin Complications of IBD

    Science.gov (United States)

    ... Home > Resources > Skin Complications of IBD Go Back Skin Complications of IBD Email Print + Share After arthritis, ... about 5% of people with inflammatory bowel disease. SKIN DISORDERS COMMONLY SEEN IN IBD ERHTHEMA NODOSUM The ...

  8. Skin Peeling Syndrome

    Directory of Open Access Journals (Sweden)

    Sharma Rajeev

    2000-01-01

    Full Text Available Peeling of the skin is an uncommonly encountered disorder. Occurrence of vesicles and bullae in peeling skin syndrome is very rare. We report a case of idiopathic peeling skin syndrome with vesicular lesions.

  9. Pigmentation and Pregnancy: Knowing What Is Normal.

    Science.gov (United States)

    Bieber, Amy Kalowitz; Martires, Kathryn J; Stein, Jennifer A; Grant-Kels, Jane M; Driscoll, Marcia S; Pomeranz, Miriam Keltz

    2017-01-01

    Changes in melanocytic nevi during pregnancy are frequently attributed to the new hormonal milieu and are dismissed without concern for malignancy. Recent studies suggest that pregnancy itself does not induce significant change in nevi, and delays in the assessment of changing moles may contribute to the often more advanced nature of melanomas diagnosed during or soon after pregnancy. Nevi on the breasts and abdomen can grow as a result of skin expansion, but studies have found no significant changes in nevi located in more stable areas such as the back or lower extremities. There is also insufficient evidence to support the notion that nevi darken during pregnancy. As such, any changing nevus that would raise concern for malignancy in a nonpregnant patient should do so in a pregnant patient as well. Pregnancy can, however, induce physiologic pigmentary changes that are often worrisome to both patients and physicians. These benign changes include melasma, pigmentary demarcation lines, secondary areola, and linea nigra as well as other less common findings. It is important for physicians to recognize these changes as physiologic to provide adequate reassurance to their patients and avoid unnecessary stress.

  10. Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration

    Science.gov (United States)

    2012-03-01

    6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less

  11. Aplicación de terapia de vacío en el tratamiento de nevus pigmentario gigante en la infancia Negative pressure therapy in the treatment of a giant melanocytic nevus in chilhood

    Directory of Open Access Journals (Sweden)

    J. Fregenal

    2011-12-01

    Full Text Available Los nevus melanocíticos gigantes congénitos son muy infrecuentes. Su incidencia de malignización varía según las series clínicas entre el 2 y el 45%. Este riesgo de malignización y los problemas de adaptación psicosocial que suelen acarrear hacen recomendable el inicio del tratamiento quirúrgico de este tipo de lesiones antes de la edad escolar. Presentamos el caso de un niño de 7 años de edad con nevus melanocítico congénito gigante que afectaba a la espalda y al flanco derecho, de 30 x 19 cm de diámetro. Desarrollamos un protocolo terapéutico mediante programación de intervenciones quirúrgicas seriadas de mínima morbilidad, con postoperatorio simple y poco doloroso. En un primer tiempo realizamos extirpación de la lesión con bisturí ultrasónico y cobertura temporal del defecto creado con dermis artificial. En un segundo tiempo intentamos cobertura definitiva con piel cultivada autóloga, siendo necesario un tercer tiempo de cobertura con autoinjerto de espesor ultrafino. En este caso, el sistema de terapia de presión negativa VAC® mostró su eficacia para inmovilizar los apósitos de forma segura, indolora y en régimen ambulatorio.Giant congenital melanocytic nevi are very uncommon. Malignization incidence varies according to clinical series between 2 and 45%. This risk of malignization and psychosocial adaptation problems make necessary to begin the surgical treatment before school age. We present a 7-year-old child with a giant melanocytic nevus in the back and right flank, 30 x 19 cm in size. A therapeutic protocol using serial surgical interventions with minimal morbidity and an easy and painless postoperative care were developed. In the first surgery we removed the nevus with ultrasonic scalpel and used artificial dermis as a temporary coverage. In the second time we tried to complete the definitive coverage with autologous cultured skin, but we needed a third time to apply definitive ultrathin skin autograft. In

  12. Endothelial network formed with human dermal microvascular endothelial cells in autologous multicellular skin substitutes.

    Science.gov (United States)

    Ponec, Maria; El Ghalbzouri, Abdoelwaheb; Dijkman, Remco; Kempenaar, Johanna; van der Pluijm, Gabri; Koolwijk, Pieter

    2004-01-01

    A human skin equivalent from a single skin biopsy harboring keratinocytes and melanocytes in the epidermal compartment, and fibroblasts and microvascular dermal endothelial cells in the dermal compartment was developed. The results of the study revealed that the nature of the extracellular matrix of the dermal compartments plays an important role in establishment of endothelial network in vitro. With rat-tail type I collagen matrices only lateral but not vertical expansion of endothelial networks was observed. In contrast, the presence of extracellular matrix of entirely human origin facilitated proper spatial organization of the endothelial network. Namely, when human dermal fibroblasts and microvascular endothelial cells were seeded on the bottom of an inert filter and subsequently epidermal cells were seeded on top of it, fibroblasts produced extracellular matrix throughout which numerous branched tubes were spreading three-dimensionally. Fibroblasts also facilitated the formation of basement membrane at the epidermal/matrix interface. Under all culture conditions, fully differentiated epidermis was formed with numerous melanocytes present in the basal epidermal cell layer. The results of the competitive RT-PCR revealed that both keratinocytes and fibroblasts expressed VEGF-A, -B, -C, aFGF and bFGF mRNA, whereas fibroblasts also expressed VEGF-D mRNA. At protein level, keratinocytes produced 10 times higher amounts of VEGF-A than fibroblasts did. The generation of multicellular skin equivalent from a single human skin biopsy will stimulate further developments for its application in the treatment of full-thickness skin defects. The potential development of biodegradable, biocompatible material suitable for these purposes is a great challenge for future research.

  13. Implementation and analysis of relief patterns of the surface of benign and malignant lesions of the skin by microtopography

    International Nuclear Information System (INIS)

    Lopez Pacheco, Maria del Carmen Lopez; Martins-Costa, Manuel Filipe Pereira da Cunha; Zapata, Aura Judith Perez; Cherit, Judith DomInguez; Gallegos, Eva Ramon

    2005-01-01

    The objective of this study was to be able to distinguish between healthy skin tissue and malignant ones, furthermore determining a unique pattern of roughness for each skin lesion by microtopographic analysis of the skin surface of Mexican patients during the period from April to October 2002. The standard technique used in this study for the diagnosis of skin cancer and the comparison of the results was the haematoxylin-eosin histopathological technique. Latex impressions were taken from skin lesions as well as from the healthy skin of each patient to serve as control samples. These impressions were analysed by the MICROTOP.03.MFC microtopographic system inspection. It was observed that when the tumour becomes rougher, more malign will be the lesion. On average, the melanoma present an increase of roughness of 67% compared to healthy skin, obtaining a roughness relation of 1:2.54. The percentage decreases to 49% (49%, 1:60) in the case of basal cell carcinoma and to 40% in pre-malignant lesions such as melanocytic nevus (40%, 1:150). In benign lesions such as the seborrhoea keratosis only a small increase in roughness was noted (4%, 1:0.72). Microtopographic inspection of the skin surface can be considered as a complementary diagnostic technique for skin cancer

  14. Implementation and analysis of relief patterns of the surface of benign and malignant lesions of the skin by microtopography

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Pacheco, Maria del Carmen Lopez [Laboratorio de CitopatologIa Ambiental, Departamento de MorfologIa, ENCB-IPN, UP Lazaro Cardenas, Casco de Santo Tomas, 11340 (Mexico); Martins-Costa, Manuel Filipe Pereira da Cunha [Departamento de Fisica, Universidad do Minho, Escola de Ciencias Campus de Gualtar-PT-4710-057 Braga (Portugal); Zapata, Aura Judith Perez [Laboratorio de CitopatologIa Ambiental, Departamento de MorfologIa, ENCB-IPN, UP Lazaro Cardenas, Casco de Santo Tomas, 11340 (Mexico); Cherit, Judith DomInguez [Departamento de DermatologIa, Hospital General Dr Manuel Gea Gonzalez, Calzada de Tlalpan No 4800, 14000 (Mexico); Gallegos, Eva Ramon [Laboratorio de CitopatologIa Ambiental, Departamento de MorfologIa, ENCB-IPN, UP Lazaro Cardenas, Casco de Santo Tomas, 11340 (Mexico)

    2005-12-07

    The objective of this study was to be able to distinguish between healthy skin tissue and malignant ones, furthermore determining a unique pattern of roughness for each skin lesion by microtopographic analysis of the skin surface of Mexican patients during the period from April to October 2002. The standard technique used in this study for the diagnosis of skin cancer and the comparison of the results was the haematoxylin-eosin histopathological technique. Latex impressions were taken from skin lesions as well as from the healthy skin of each patient to serve as control samples. These impressions were analysed by the MICROTOP.03.MFC microtopographic system inspection. It was observed that when the tumour becomes rougher, more malign will be the lesion. On average, the melanoma present an increase of roughness of 67% compared to healthy skin, obtaining a roughness relation of 1:2.54. The percentage decreases to 49% (49%, 1:60) in the case of basal cell carcinoma and to 40% in pre-malignant lesions such as melanocytic nevus (40%, 1:150). In benign lesions such as the seborrhoea keratosis only a small increase in roughness was noted (4%, 1:0.72). Microtopographic inspection of the skin surface can be considered as a complementary diagnostic technique for skin cancer.

  15. Ultraviolet stimulated melanogenesis by human melanocytes is augmented by di-acyl glycerol but not TPA

    International Nuclear Information System (INIS)

    Friedmann, P.S.; Wren, F.E.; Matthews, J.N.

    1990-01-01

    Epidermal melanocytes (MC) synthesize melanin in response to ultraviolet radiation (UVR). The mechanisms mediating the UV-induced activation of melanogenesis are unknown but since UVR induces turnover of membrane phospholipids generating prostaglandins (PGs) and other products, it is possible that one of these might provide the activating signal. We have examined the effects of prostaglandins (PGs) E1, E2, D2, F2 alpha, and di-acyl glycerol upon the UV-induced responses of cultured human MC and the Cloudman S91 melanoma cell line. The PGs had little effect on unirradiated cells and did not alter the response to UVR in either human MC or S91 melanoma cells. However, a synthetic analogue of di-acyl glycerol, 1-oleyl 2-acetyl glycerol (OAG), caused a significant (P less than 0.0001), dose-related augmentation of melanin content both in human MC (seven-fold) and S91 cells (three-fold). UVR caused a significant augmentation of the OAG-induced melanogenesis of both human MC and S91 cells. Since OAG is known to activate protein kinase C, it was possible that the observed modulation of the UVR signal could be via that pathway. Di-octanoyl glycerol, another di-acyl glycerol, which activates kinase C, caused a small (70%) increase in melanogenesis in MC which was not altered by UVR. However, 12-0 tetradecanoyl phorbol 13-acetate (TPA), a potent activator of protein kinase C, had no significant effect on either basal or UV-induced melanin synthesis in either cell type. These data suggest that the UV-induced signal activating melanogenesis could be mediated by di-acyl glycerol. Furthermore, they imply that the signal is transduced via an alternative, pathway that might be independent of protein kinase C

  16. The significance of crystalline/chrysalis structures in the diagnosis of melanocytic and nonmelanocytic lesions.

    Science.gov (United States)

    Balagula, Yevgeniy; Braun, Ralph P; Rabinovitz, Harold S; Dusza, Stephen W; Scope, Alon; Liebman, Tracey N; Mordente, Ines; Siamas, Katherine; Marghoob, Ashfaq A

    2012-08-01

    Crystalline/chrysalis structures (CS) are white shiny streaks that can only be seen with polarized dermatoscopy. We sought to estimate the prevalence and assess the clinical significance of CS in melanocytic and nonmelanocytic lesions. This was a prospective observational study in which dermatoscopic assessment of lesions was recorded in consecutive patients examined during a 6-month period. In addition, a data set of biopsy-proven melanomas was retrospectively analyzed. In all, 11,225 lesions in 881 patients were prospectively examined. Retrospectively, 229 melanomas imaged with polarized dermatoscopy were analyzed. In the prospective data set, a median of 12.7 lesions (range, 1-54) were evaluated per patient. None of clinically diagnosed Clark nevi (n = 9750, 86.8%) demonstrated CS. Overall, CS were observed in 206 (1.8%) lesions, most commonly dermatofibromas and scars among nonbiopsied lesions. A total of 265 (2.4%) lesions were biopsied, including 20 melanomas and 36 nevi. Among biopsied malignant lesions, CS were most commonly observed in basal cell carcinoma (47.6%) and invasive melanomas (84.6%). Melanomas were more likely to have CS than biopsied nevi (odds ratio = 9.7, 95% confidence interval 2.7-34.1). In the retrospective data set, CS were more commonly observed among invasive melanomas (41%) compared with in situ melanomas (17%) (odds ratio = 3.4, 95% confidence interval 1.9-6.3, P < .001). The prevalence of CS correlated with increased melanoma thickness (P = .001). Biopsied lesions represent a small percentage of the total number of lesions evaluated. Among biopsied malignant lesions, CS are most commonly observed in basal cell carcinoma and invasive melanomas and rarely seen in nevi. In melanoma, CS may reflect increased tumor thickness and progression. Copyright © 2011 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  17. p63 in skin development and ectodermal dysplasias

    Science.gov (United States)

    Koster, Maranke I.

    2010-01-01

    The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549

  18. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  19. A Fast-Track Referral System for Skin Lesions Suspicious of Melanoma: Population-Based Cross-Sectional Study from a Plastic Surgery Center

    Directory of Open Access Journals (Sweden)

    Reem Dina Jarjis

    2016-01-01

    Full Text Available Introduction. To minimize delay between presentation, diagnosis, and treatment of cutaneous melanoma (CM, a national fast-track referral system (FTRS was implemented in Denmark. The aim of this study was to analyze the referral patterns to our department of skin lesions suspicious of melanoma in the FTRS. Methods. Patients referred to the Department of Plastic Surgery and Breast Surgery in Zealand University Hospital were registered prospectively over a 1-year period in 2014. A cross-sectional study was performed analyzing referral patterns, including patient and tumor characteristics. Results. A total of 556 patients were registered as referred to the center in the FTRS for skin lesions suspicious of melanoma. Among these, a total of 312 patients (56.1% were diagnosed with CM. Additionally, 41 (7.4% of the referred patients were diagnosed with in situ melanoma. Conclusion. In total, 353 (63.5% patients had a malignant or premalignant melanocytic skin lesion. When only considering patients who where referred without a biopsy, the diagnostic accuracy for GPs and dermatologists was 29% and 45%, respectively. We suggest that efforts of adequate training for the referring physicians in diagnosing melanocytic skin lesions will increase diagnostic accuracy, leading to larger capacity in secondary care for the required treatment of malignant skin lesions.

  20. A Simple Device For Measuring Skin Friction

    Directory of Open Access Journals (Sweden)

    Gupta A.B

    1995-01-01

    Full Text Available A simple device for measuring skin friction in vivo is described. The frictional coefficient of normal Indian skin and the effect of hydration and application of talc and glycerol on the frictional coefficient and also the friction of ichthyotic skin have been determined with its help. The average value of friction of friction of normal India skin at forearm is found to be 0.41 +- 0.08, the hydration raises the value to 0.71 +- 0.11 and the effect of glycerol is also to school it up to 0.70+- 0.05, almost equal to that of water. The effect of talc however is opposite and its application lowers the friction to 0.21+-0.07. The mean coeff of friction for ichthyotic skin is found to be 0.21+- 0.0.5, which closely agrees with talc-treated normal skin. A good positive correlation (p<0.01 between friction and sebum level at skin site, with r = 0.64, has been observed.

  1. Clinical scoring and instrumental analysis to evaluate skin types.

    Science.gov (United States)

    Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G

    2013-04-01

    The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.

  2. Unveiling skin macrophage dynamics explains both tattoo persistence and strenuous removal.

    Science.gov (United States)

    Baranska, Anna; Shawket, Alaa; Jouve, Mabel; Baratin, Myriam; Malosse, Camille; Voluzan, Odessa; Vu Manh, Thien-Phong; Fiore, Frédéric; Bajénoff, Marc; Benaroch, Philippe; Dalod, Marc; Malissen, Marie; Henri, Sandrine; Malissen, Bernard

    2018-04-02

    Here we describe a new mouse model that exploits the pattern of expression of the high-affinity IgG receptor (CD64) and allows diphtheria toxin (DT)-mediated ablation of tissue-resident macrophages and monocyte-derived cells. We found that the myeloid cells of the ear skin dermis are dominated by DT-sensitive, melanin-laden cells that have been missed in previous studies and correspond to macrophages that have ingested melanosomes from neighboring melanocytes. Those cells have been referred to as melanophages in humans. We also identified melanophages in melanocytic melanoma. Benefiting of our knowledge on melanophage dynamics, we determined the identity, origin, and dynamics of the skin myeloid cells that capture and retain tattoo pigment particles. We showed that they are exclusively made of dermal macrophages. Using the possibility to delete them, we further demonstrated that tattoo pigment particles can undergo successive cycles of capture-release-recapture without any tattoo vanishing. Therefore, congruent with dermal macrophage dynamics, long-term tattoo persistence likely relies on macrophage renewal rather than on macrophage longevity. © 2018 Baranska et al.

  3. The impact of pediatric skin disease on self-esteem.

    Science.gov (United States)

    Vivar, K L; Kruse, L

    2018-03-01

    Pediatric skin disorders can affect children's self-esteem, relationships with caregivers and peers, and performance in school and activities. This review describes common pediatric congenital and acquired dermatologic disorders and the impact that these disorders can have on children's self-esteem. A review of current, English-language literature was conducted with use of the PubMed database. Search terms included atopic dermatitis, acne, infantile hemangiomas, port wine stains, congenital melanocytic nevi, hidradenitis suppurativa, and self-esteem. During infancy and toddlerhood, skin disorders such as infantile hemangiomas primarily affect the attachment between child and caregiver. School-aged children with port wine stains and atopic dermatitis report increased bullying, teasing, and social isolation. Acne and hidradenitis typically affect older children and teens and these conditions are associated with increased risks of depression and suicidal ideation. Effective management of these conditions has been shown to increase patients' self-esteem. Pediatric dermatologic disorders impact self-esteem throughout childhood. In addition to the surgical and medical management of these disorders, clinicians can also take an active role in the assessment and improvement of the psychosocial impact of these skin disorders.

  4. Comparative human cellular radiosensitivity: I. The effect of SV40 transformation and immortalisation on the gamma-irradiation survival of skin derived fibroblasts from normal individuals and from ataxia-telangiectasia patients and heterozygotes.

    Science.gov (United States)

    Arlett, C F; Green, M H; Priestley, A; Harcourt, S A; Mayne, L V

    1988-12-01

    We have compared cell killing following 60Co gamma irradiation in 22 primary human fibroblast strains, nine SV40-immortalized human fibroblast lines and seven SV40-transformed pre-crisis human fibroblast cultures. We have examined material from normal individuals, from ataxia-telangiectasia (A-T) patients and from A-T heterozygotes. We have confirmed the greater sensitivity of A-T derived cells to gamma radiation. The distinction between A-T and normal cells is maintained in cells immortalized by SV40 virus but the immortal cells are more gamma radiation resistant than the corresponding primary fibroblasts. Cells transformed by plasmids (pSV3gpt and pSV3neo) expressing SV40 T-antigen, both pre- and post-crisis, show this increased resistance, indicating that it is expression of SV40 T-antigen, rather than immortalization per se which is responsible for the change. We use D0, obtained from a straight line fit, and D, estimated from a multitarget curve, as parameters to compare radiosensitivity. We suggest that both have their advantages; D0 is perhaps more reproducible, but D is more realistic when comparing shouldered and non-shouldered data.

  5. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard

    2001-01-01

    with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared......Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  6. Alpha-Melanocyte-Stimulating Hormone and Agouti-Related Protein: Do They Play a Role in Appetite Regulation in Childhood Obesity?

    Science.gov (United States)

    Vehapoğlu, Aysel; Türkmen, Serdar; Terzioğlu, Şule

    2016-03-05

    The hypothalamus plays a crucial role in the regulation of feeding behavior. The anorexigenic neuropeptide alpha-melanocyte-stimulating hormone (α-MSH) and the orexigenic neuropeptide agouti-related protein (AgRP) are among the major peptides produced in the hypothalamus. This study investigated the plasma concentrations of α-MSH and AgRP in underweight and obese children and their healthy peers. The associations between α-MSH and AgRP levels and anthropometric and nutritional markers of malnutrition and obesity were also assessed. Healthy sex-matched subjects aged 2 to 12 years were divided into 3 groups, as underweight (n=57), obese (n=61), and of normal weight (n=57). Plasma fasting concentrations of α-MSH and AgRP were measured by enzyme-linked immunosorbent assay. The differences between the three groups as to the relationships between plasma concentrations of α-MSH and AgRP and anthropometric data, serum biochemical parameters and homeostatic model assessment of insulin resistance were evaluated. Obese children had significantly lower α-MSH levels than underweight (1194±865 vs. 1904±1312 ng/mL, p=0.006) and normal weight (1194±865 vs. 1762±1463 ng/mL, p=0.036) children; there were no significant differences in the α-MSH levels between the underweight and normal weight children (p=0.811). Also, no significant differences were observed between the underweight and obese children regarding the AgRP levels (742±352 vs. 828±417 ng/mL, p=0.125). We found a significant positive correlation between plasma α-MSH and AgRP levels across the entire sample. This study is the first to demonstrate body weight-related differences in α-MSH and AgRP levels in children. Circulating plasma α-MSH levels in obese children were markedly lower than those of underweight and normal-weight children. This suggests that α-MSH could play a role in appetite regulation.

  7. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  8. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  9. Biological Rhythms in the Skin

    Directory of Open Access Journals (Sweden)

    Mary S. Matsui

    2016-05-01

    Full Text Available Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN of the hypothalamus, which directs an organism’s rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional–translational autoregulatory loops. This master clock, following environmental cues, regulates an organism’s sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.

  10. Volumetric Visualization of Human Skin

    Science.gov (United States)

    Kawai, Toshiyuki; Kurioka, Yoshihiro

    We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.

  11. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  12. Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo.

    Science.gov (United States)

    Ingram, D A; Yang, F C; Travers, J B; Wenning, M J; Hiatt, K; New, S; Hood, A; Shannon, K; Williams, D A; Clapp, D W

    2000-01-03

    Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's "two hit" model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1-/- murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W(41) mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras-mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W(41)) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types.

  13. Skin, Hair, and Nails

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Skin, Hair, and Nails KidsHealth / For Parents / Skin, Hair, and ... piel, el cabello y las uñas About Skin, Hair and Nails Skin is our largest organ. If ...

  14. Preliminary experiments on quantification of skin condition

    Science.gov (United States)

    Kitajima, Kenzo; Iyatomi, Hitoshi

    2014-03-01

    In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.

  15. Urostomy - stoma and skin care

    Science.gov (United States)

    ... it well before you attach the pouch. Avoid skin care products that contain alcohol. These can make your skin ... the pouch to your skin. Use fewer special skin care products. This will make problems with your skin less ...

  16. Risks of Skin Cancer Screening

    Science.gov (United States)

    ... factors increase or decrease the risk of skin cancer. Skin cancer is a disease in which malignant (cancer) ... following PDQ summaries for more information about skin cancer: Skin Cancer Prevention Skin Cancer Treatment Melanoma Treatment Genetics ...

  17. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    International Nuclear Information System (INIS)

    Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael

    2002-01-01

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  18. Minimally invasive and targeted therapeutic cell delivery to the skin using microneedle devices.

    Science.gov (United States)

    Gualeni, B; Coulman, S A; Shah, D; Eng, P F; Ashraf, H; Vescovo, P; Blayney, G J; Piveteau, L-D; Guy, O J; Birchall, J C

    2018-03-01

    Translation of cell therapies to the clinic is accompanied by numerous challenges, including controlled and targeted delivery of the cells to their site of action, without compromising cell viability and functionality. To explore the use of hollow microneedle devices (to date only used for the delivery of drugs and vaccines into the skin and for the extraction of biological fluids) to deliver cells into skin in a minimally invasive, user-friendly and targeted fashion. Melanocyte, keratinocyte and mixed epidermal cell suspensions were passed through various types of microneedles and subsequently delivered into the skin. Cell viability and functionality are maintained after injection through hollow microneedles with a bore size ≥ 75 μm. Healthy cells are delivered into the skin at clinically relevant depths. Hollow microneedles provide an innovative and minimally invasive method for delivering functional cells into the skin. Microneedle cell delivery represents a potential new treatment option for cell therapy approaches including skin repigmentation, wound repair, scar and burn remodelling, immune therapies and cancer vaccines. © 2017 British Association of Dermatologists.

  19. High resolution in-vivo imaging of skin with full field optical coherence tomography

    Science.gov (United States)

    Dalimier, E.; Bruhat, Alexis; Grieve, K.; Harms, F.; Martins, F.; Boccara, C.

    2014-03-01

    Full-field OCT (FFOCT) has the ability to provide en-face images with a very good axial sectioning as well as a very high transverse resolution (about 1 microns in all directions). Therefore it offers the possibility to visualize biological tissues with very high resolution both on the axial native view, and on vertical reconstructed sections. Here we investigated the potential dermatological applications of in-vivo skin imaging with FFOCT. A commercial FFOCT device was adapted for the in-vivo acquisition of stacks of images on the arm, hand and finger. Several subjects of different benign and pathological skin conditions were tested. The images allowed measurement of the stratum corneum and epidermis thicknesses, measurement of the stratum corneum refractive index, size measurement and count of the keratinocytes, visualization of the dermal-epidermal junction, and visualization of the melanin granules and of the melanocytes. Skins with different pigmentations could be discriminated and skin pathologies such as eczema could be identified. The very high resolution offered by FFOCT both on axial native images and vertical reconstructed sections allows for the visualization and measurement of a set of parameters useful for cosmetology and dermatology. In particular, FFOCT is a potential tool for the understanding and monitoring of skin hydration and pigmentation, as well as skin inflammation.

  20. Coordination by Cdc42 of Actin, Contractility, and Adhesion for Melanoblast Movement in Mouse Skin

    DEFF Research Database (Denmark)

    Woodham, Emma F; Paul, Nikki R; Tyrrell, Benjamin

    2017-01-01

    traverse the dermis to reach the epidermis of the skin and hair follicles. We previously established that Rac1 signals via Scar/WAVE and Arp2/3 to effect pseudopod extension and migration of melanoblasts in skin. Here we show that RhoA is redundant in the melanocyte lineage but that Cdc42 coordinates...... multiple motility systems independent of Rac1. Similar to Rac1 knockouts, Cdc42 null mice displayed a severe loss of pigmentation, and melanoblasts showed cell-cycle progression, migration, and cytokinesis defects. However, unlike Rac1 knockouts, Cdc42 null melanoblasts were elongated and displayed large...... null cells lacked the ability to polarize their Golgi and coordinate motility systems for efficient movement. Loss of Cdc42 de-coupled three main systems: actin assembly via the formin FMNL2 and Arp2/3, active myosin-II localization, and integrin-based adhesion dynamics....

  1. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)......Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...

  2. Genetic Background of Iris Melanomas and Iris Melanocytic Tumors of Uncertain Malignant Potential.

    Science.gov (United States)

    van Poppelen, Natasha M; Vaarwater, Jolanda; Mudhar, Hardeep S; Sisley, Karen; Rennie, Ian G; Rundle, Paul; Brands, Tom; van den Bosch, Quincy C C; Mensink, Hanneke W; de Klein, Annelies; Kiliç, Emine; Verdijk, Robert M

    2018-01-19

    BAP1 expression as seen in choroidal melanoma. Consequently, iris melanoma is a distinct molecular subgroup of UM. Histologic borderline malignant iris nevi can harbor BAP1 mutations and may be designated iris melanocytic tumors of uncertain malignant potential. Copyright © 2017 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  3. Melanoma transition is frequently accompanied by a loss of cytoglobin expression in melanocytes: a novel expression site of cytoglobin.

    Directory of Open Access Journals (Sweden)

    Yoshihiko Fujita

    Full Text Available The tissue distribution and function of hemoglobin or myoglobin are well known; however, a newly found cytoglobin (CYGB, which also belongs to the globin family, remains to be characterized. To assess its expression in human malignancies, we sought to screen a number of cell lines originated from many tissues using northern blotting and real time PCR techniques. Unexpectedly, we found that several, but not all, melanoma cell lines expressed CYGB mRNA and protein at much higher levels than cells of other origins. Melanocytes, the primary origin of melanoma, also expressed CYGB at a high level. To verify these observations, immunostaining and immunoblotting using anti-CYGB antibody were also performed. Bisulfite-modified genomic sequencing revealed that several melanoma cell lines that abrogated CYGB expression were found to be epigenetically regulated by hypermethylation in the promoter region of CYGB gene. The RNA interference-mediated knockdown of the CYGB transcript in CYGB expression-positive melanoma cell lines resulted in increased proliferation in vitro and in vivo. Flow cytometric analysis using 2'-, 7'-dichlorofluorescein diacetate (DCFH-DA, an indicator of reactive oxygen species (ROS, revealed that the cellular ROS level may be involved in the proliferative effect of CYGB. Thus, CYGB appears to play a tumor suppressive role as a ROS regulator, and its epigenetic silencing, as observed in CYGB expression-negative melanoma cell lines, might function as an alternative pathway in the melanocyte-to-melanoma transition.

  4. Melanocytic Nevi and Sun Exposure in a Cohort of Colorado Children: Anatomic Distribution and Site-Specific Sunburn

    Science.gov (United States)

    Dodd, Athena T.; Morelli, Joseph; Mokrohisky, Stefan T.; Asdigian, Nancy; Byers, Tim E.; Crane, Lori A.

    2010-01-01

    Sun exposure and high prevalence of melanocytic nevi are major risk factors for melanoma, but the relationship between them is not well understood. This study examines the relationship between sun exposure (detailed by anatomic location and history of site-specific sunburns) and the presence of melanocytic nevi on 743 White children in Denver, Colorado. Parental reports of site-specific sunburns were collected annually for 2 years starting at ages 5 to 6 years. In the third year, nevi were counted and mapped by anatomic location. Nevus density was higher for boys (36.0 nevi/m2) than for girls (31.0 nevi/m2; P = 0.04). Nevus density was highest on the face, neck, and lateral forearms and was significantly higher in chronically versus intermittently sun-exposed areas (P sunburn. The face, shoulders, and back were the most frequently sunburned areas of the body. When adjusted for host factors, total number of sunburns was significantly associated with higher total nevus prevalence (P = 0.01 for one burn). Site-specific sunburns were significantly associated with nevus prevalence on the back (P = 0.03 for three or more sunburns), but not on the face, arms, or legs. In this high-risk population, there is evidence for two pathways to nevus accumulation: by chronic sun exposure and by intermittent exposure related to sunburns. PMID:17932362

  5. Evaluation of treatment response to autologous transplantation of noncultured melanocyte/keratinocyte cell suspension in patients with stable vitiligo.

    Science.gov (United States)

    Ramos, Mariana Gontijo; Ramos, Daniel Gontijo; Ramos, Camila Gontijo

    2017-01-01

    Vitiligo is a chronic disease characterized by the appearance of achromic macules caused by melanocyte destruction. Surgical treatments with melanocyte transplantation can be used for stable vitiligo cases. To evaluate treatment response to the autologous transplantation of noncultured epidermal cell suspension in patients with stable vitiligo. Case series study in patients with stable vitiligo submitted to noncultured epidermal cell suspension transplantation and evaluated at least once, between 3 and 6 months after the procedure, to observe repigmentation and possible adverse effects. The maximum follow-up period for some patients was 24 months. Of the 20 patients who underwent 24 procedures, 25% showed an excellent rate of repigmentation, 50% good repigmentation, 15% regular, and 10% poor response. The best results were observed in face and neck lesions, while the worst in extremity lesions (88% and 33% of satisfactory responses, respectively). Patients with segmental vitiligo had a better response (84%) compared to non-segmental ones (63%). As side effects were observed hyperpigmentation of the treated area and the appearance of Koebner phenomenon in the donor area. Some limitations of the study included the small number of patients, a subjective evaluation, and the lack of long-term follow-up on the results. CONCLUSION: Noncultured epidermal cell suspension transplantation is efficient and well tolerated for stable vitiligo treatment, especially for segmental vitiligo on the face and neck.

  6. Synthetic Peptide Drugs for Targeting Skin Cancer: Malignant Melanoma and Melanotic Lesions.

    Science.gov (United States)

    Eberle, Alex N; Rout, Bhimsen; Qi, Mei Bigliardi; Bigliardi, Paul L

    2017-01-01

    Peptides play decisive roles in the skin, ranging from host defense responses to various forms of neuroendocrine regulation of cell and organelle function. Synthetic peptides conjugated to radionuclides or photosensitizers may serve to identify and treat skin tumors and their metastatic forms in other organs of the body. In the introductory part of this review, the role and interplay of the different peptides in the skin are briefly summarized, including their potential application for the management of frequently occurring skin cancers. Special emphasis is given to different targeting options for the treatment of melanoma and melanotic lesions. Radionuclide Targeting: α-Melanocyte-stimulating hormone (α-MSH) is the most prominent peptide for targeting of melanoma tumors via the G protein-coupled melanocortin-1 receptor that is (over-)expressed by melanoma cells and melanocytes. More than 100 different linear and cyclic analogs of α-MSH containing chelators for 111In, 67/68Ga, 64Cu, 90Y, 212Pb, 99mTc, 188Re were synthesized and examined with experimental animals and in a few clinical studies. Linear Ac-Nle-Asp-His-D-Phe-Arg-Trp-Gly-Lys-NH2 (NAP-amide) and Re-cyclized Cys- Cys-Glu-His-D-Phe-Arg-Trp-Cys-Arg-Pro-Val-NH2 (Re[Arg11]CCMSH) containing different chelators at the N- or C-terminus served as lead compounds for peptide drugs with further optimized characteristics. Alternatively, melanoma may be targeted with radiopeptides that bind to melanin granules occurring extracellularly in these tumors. Photosensitizer targeting: A more recent approach is the application of photosensitizers attached to the MSH molecule for targeted photodynamic therapy using LED or coherent laser light that specifically activates the photosensitizer. Experimental studies have demonstrated the feasibility of this approach as a more gentle and convenient alternative compared to radionuclides. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. Effects of irradiation of skin flaps

    International Nuclear Information System (INIS)

    Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.

    1984-01-01

    The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage

  8. Lymphatic albumin clearance from psoriatic skin

    International Nuclear Information System (INIS)

    Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.

    1983-01-01

    In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return

  9. Oily skin: an overview.

    Science.gov (United States)

    Sakuma, Thais H; Maibach, Howard I

    2012-01-01

    Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

  10. Nevus melanocítico intradérmico congénito gigante. "El niño tortuga (testudines": Caso clínico Giant congenital melanocytic nevus. "Turtle boy": Case report

    Directory of Open Access Journals (Sweden)

    J.F. Arango Ospina

    2009-09-01

    Full Text Available Presentamos el caso de un paciente de 2 años de edad, conocido en su pueblo, como "el niño tortuga (testudines" debido a la gran similitud con dicho reptil. Desde su nacimiento presentó nevus melanocítico gigante localizado en región torácica posterior, región lumbosacra y lesiones satélites en extremidades y abdomen, de 50 por 40cm de diámetro y color café oscuro; la piel en las zonas afectadas es gruesa con grandes surcos de aspecto corrugado (cerebriforme. El nombre dado al niño se basa en la similitud de sus lesiones con la morfología de una tortuga, ya que el caparazón cubre la zona superior, inferior y lateral del cuerpo de este animal, de la misma forma que el nevus gigante lo hacía en el caso de nuestro paciente. Este caparazón está formado por placas óseas revestidas de placas corneas, que se asemejan a los surcos de aspecto corrugado que conforman el nevus melanocítico gigante. Los estudios clínicos practicados revelaron compromiso cardiovascular, hepático y esplénico, así como una desfavorable evolución y pronostico del cuadro clínico, por lo que esta patología, específicamente para este niño y de acuerdo a la junta Médico-Quirúrgica y valoraciones, fue considerada inoperable.We present the case of a 2 years-old patient, known in his town as "turtle boy"(testudines due to his great simility with this reptile because of his giant congenital melanocytic nevus, located in the posterior and lateral aspect of the chest and in smaller proportion in abdomen and extremities, of 50 by 40cm and dark brown colour. The skin in this zone is thick with great furrows and corrugated aspect. He was called "turtle boy" based on the morphology of the turtle, its shell covers the superior, inferior and lateral zone like in our patient's case. It is formed by bone layers covered by cornea layers, which resemble the furrows and corrugated aspect of the giant congenital melanocytic nevus. Medical investigation reveals

  11. MicroRNA expression in melanocytic nevi: the usefulness of formalin-fixed, paraffin-embedded material for miRNA microarray profiling.

    Science.gov (United States)

    Glud, Martin; Klausen, Mikkel; Gniadecki, Robert; Rossing, Maria; Hastrup, Nina; Nielsen, Finn C; Drzewiecki, Krzysztof T

    2009-05-01

    MicroRNAs (miRNAs) are small, noncoding RNA molecules that regulate cellular differentiation, proliferation, and apoptosis. MiRNAs are expressed in a developmentally regulated and tissue-specific manner. Aberrant expression may contribute to pathological processes such as cancer, and miRNA may therefore serve as biomarkers that may be useful in a clinical environment for diagnosis of various diseases. Most miRNA profiling studies have used fresh tissue samples. However, in some types of cancer, including malignant melanoma, fresh material is difficult to obtain from primary tumors, and most surgical specimens are formalin fixed and paraffin embedded (FFPE). To explore whether FFPE material would be suitable for miRNA profiling in melanocytic lesions, we compared miRNA expression patterns in FFPE versus fresh frozen samples, obtained from 15 human melanocytic nevi. Out of microarray data, we identified 84 miRNAs that were expressed in both types of samples and represented an miRNA profile of melanocytic nevi. Our results showed a high correlation in miRNA expression (Spearman r-value of 0.80) between paired FFPE and fresh frozen material. The data were further validated by quantitative RT-PCR. In conclusion, FFPE specimens of melanocytic lesions are suitable as a source for miRNA microarray profiling.

  12. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  13. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was