WorldWideScience

Sample records for normal skin fibroblasts

  1. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  2. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  3. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  4. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  5. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  6. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  7. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  8. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  9. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  10. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Radiosensitivity of fibroblasts obtained from a cafe-au-lait spot and normal-appearing skin of a patient with neurofibromatosis (NF-6)

    International Nuclear Information System (INIS)

    Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.

    1990-01-01

    Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells

  12. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  13. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-01-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  14. Adaptive response to ionizing radiation in normal human skin fibroblasts. Enhancement of DNA repair rate and modulation of gene expression

    International Nuclear Information System (INIS)

    Toledo, S.M. de; Mitchel, R.E.J.; Azzam, E.; Ottawa Univ., ON; Raaphorst, G.P.

    1994-01-01

    Low doses and dose rates of ionizing radiation enhance the rate of DNA repair in human fibroblasts and protect the cells against radiation-induced micronucleus formation. Chronic exposures reduce the mRNA levels of the genes topoisomerase II and FACC-1 (Fanconi's anemia, group C). (authors). 11 refs., 1 tab., 2 figs

  15. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.

    1981-01-01

    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  16. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    International Nuclear Information System (INIS)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E.

    1991-01-01

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  17. Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1987-01-01

    We have analyzed the pattern of protein synthesis in solar near ultraviolet (334 nm, 365 nm) and near visible (405 nm) irradiated normal human skin fibroblasts. Two hours after irradiation we find that one major stress protein of approximately 32 kDa is induced in irradiated cells. This protein is not induced by ultraviolet radiation at wavelengths shorter than 334 nm and is not inducible by heat shock treatment of these cells. Although sodium arsenite, diamide, and menadione all induced a 32-kDa protein, they also induced the major heat shock proteins. In contrast, the oxidizing agent, hydrogen peroxide, induced the low molecular weight stress protein without causing induction of the major heat shock proteins. A comparison of the 32-kDa proteins induced by sodium arsenite, H 2 O 2 , and solar near ultraviolet radiation using chemical peptide mapping shows that they are closely related. These results imply that the pathways for induction of the heat shock response and the 32-kDa protein are not identical and suggest that, at least in the case of radiation and treatment with H 2 O 2 , the 32-kDa protein might be induced in response to cellular oxidative stress. This conclusion is supported by the observation that depletion of endogenous cellular glutathione prior to solar near ultraviolet irradiation lowers the fluence threshold for induction of the 32-kDa stress protein

  18. Alzheimer skin fibroblasts show increased susceptibility to free radicals.

    Science.gov (United States)

    Tesco, G; Latorraca, S; Piersanti, P; Piacentini, S; Amaducci, L; Sorbi, S

    1992-11-01

    We have studied the response to toxic oxygen metabolites of fibroblasts derived from skin biopsies of 5 patients with familial (FAD) and 4 with sporadic (AD) Alzheimer's disease compared with those derived from 4 normal controls. Fibroblasts were damaged by the generation of oxygen metabolites during the enzymatic oxidation of acetaldehyde by 50 munits of xanthine-oxidase (Xo). To quantify cell damage we measured lactate dehydrogenase (LDH) activity in the culture medium and cell viability in fibroblast cultures. We found a significant increase in LDH activity in the FAD vs. controls and also in the AD vs. controls.

  19. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  20. Constituents from the roots of Taraxacum platycarpum and their effect on proliferation of human skin fibroblasts.

    Science.gov (United States)

    Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio

    2012-01-01

    A MeOH extract from the roots of Taraxacum platycarpum has shown significant effects on the proliferation of normal human skin fibroblasts. Chemical analysis of the extract resulted in the isolation of 26 compounds, including eight new triterpenes, one new sesquiterpene glycoside, and seventeen known compounds. The structure of each new compound was established using NMR spectroscopy. Some triterpenes had a significant effect on the proliferation of normal human skin fibroblasts.

  1. Degradation of type IV collagen by neoplastic human skin fibroblasts

    International Nuclear Information System (INIS)

    Sheela, S.; Barrett, J.C.

    1985-01-01

    An assay for the degradation of type IV (basement membrane) collagen was developed as a biochemical marker for neoplastic cells from chemically transformed human skin fibroblasts. Type IV collagen was isolated from basement membrane of Syrian hamster lung and type I collagen was isolated from rat tails; the collagens were radioactively labelled by reductive alkylation. The abilities of normal (KD) and chemically transformed (Hut-11A) human skin fibroblasts to degrade the collagens were studied. A cell-associated assay was performed by growing either normal or transformed cells in the presence of radioactively labelled type IV collagen and measuring the released soluble peptides in the medium. This assay also demonstrated that KD cells failed to synthesize an activity capable of degrading type IV collagen whereas Hut-11A cells degraded type IV collagen in a linear manner for up to 4 h. Human serum at very low concentrations, EDTA and L-cysteine inhibited the enzyme activity, whereas protease inhibitors like phenylmethyl sulfonyl fluoride, N-ethyl maleimide or soybean trypsin inhibitor did not inhibit the enzyme from Hut-11A cells. These results suggest that the ability to degrade specifically type IV collagen may be an important marker for neoplastic human fibroblasts and supports a role for this collagenase in tumor cell invasion

  2. Deficiency of gamma-ray excision repair in skin fibroblasts from patients with Fanconi's anemia

    International Nuclear Information System (INIS)

    Remsen, J.F.; Cerutti, P.A.

    1976-01-01

    The capacity of preparations of skin fibroblasts from normal individuals and patients with Fanconi's anemia to excise gamma-ray products of the 5,6-dihydroxydihydrothymine type from exogenous DNA was investigated. The excision capacity of whole-cell homogenates of fibroblasts from two of four patients with Fanconi's anemia was substantially below normal. This repair deficiency was further pronounced in nuclear preparations from cells of the same two patients

  3. The effect of keratinocytes on the biomechanical characteristics and pore microstructure of tissue engineered skin using deep dermal fibroblasts.

    Science.gov (United States)

    Varkey, Mathew; Ding, Jie; Tredget, Edward E

    2014-12-01

    Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Induction of growth stimulation in skin fibroblasts from retinoblastoma donors after ionizing radiation

    International Nuclear Information System (INIS)

    Diatloff-Zito, C.; Macieira-Coelho, A.; Turleau, C.; Cabanis, M.O.; Grouchy, J. de

    1983-01-01

    Skin fibroblasts from normal children and two children with a 13q14 deletion retinoblastoma (Rb) were submitted to fractionated doses of γ radiations. Irradiation reduced the population doublings in normal fibroblasts and the decline was inversely related to the dose. An increase in population doublings was obtained with one of the Rb cell lines. Foci appeared in the irradiated culture of the other Rb donor. It is suggested that fibroblasts from patients with Rb are able to express some phenotypical properties of transformed cells, perhaps related to factors rendering them more susceptible to carcinogens [fr

  5. DNA repair in Bloom's syndrome skin fibroblasts after ultraviolet light irradiation

    International Nuclear Information System (INIS)

    Kurihara, Takayuki; Inoue, Masao; Kawashima, Hiroko; Yagi, Takashi; Takebe, Hiraku.

    1981-01-01

    Skin fibroblasts from a patient with Bloom's syndrome (86NoKi) were assayed for various DNA repair activities after ultraviolet light (UV) irradiation. Cultured fibroblasts as well as lymphocytes obtained from this patient showed a high frequency of spontaneous sister chromatid exchanges (SCEs). There was no significant difference between 86NoKi fibroblasts and skin fibroblasts from normal donors in the sensitivity to UV as measured by inactivation of colony forming activity, the capacity of host-cell reactivation (HCR) of UV-irradiated virus, and the amount of unscheduled DNA synthesis (UDS) after UV irradiation. However, the yield of UV-induced SCEs in 86NoKi cells was significantly higher than that in normal cells. (author)

  6. Fibroblast-matrix interplay: Nintedanib and pirfenidone modulate the effect of IPF fibroblast-conditioned matrix on normal fibroblast phenotype.

    Science.gov (United States)

    Epstein Shochet, Gali; Wollin, Lutz; Shitrit, David

    2018-03-12

    Idiopathic pulmonary fibrosis (IPF) is a progressive lung disease with poor prognosis. Activated fibroblasts are the key effector cells in fibrosis, producing excessive amounts of collagen and extracellular matrix (ECM) proteins. Whether the ECM conditioned by IPF fibroblasts determines the phenotype of naïve fibroblasts is difficult to explore. IPF-derived primary fibroblasts were cultured on Matrigel and then cleared using ammonium hydroxide, creating an IPF-conditioned matrix (CM). Normal fibroblast CM served as control. Normal fibroblasts were cultured on both types of CM, and cell count, cell distribution and markers of myofibroblast differentiation; transforming growth factor beta (TGFβ) signalling; and ECM expression were assessed. The effects of the anti-fibrotic drugs nintedanib and pirfenidone at physiologically relevant concentrations were also explored. Normal fibroblasts cultured on IPF-CM arranged in large aggregates as a result of increased proliferation and migration. Moreover, increased levels of pSmad3, pSTAT3 (phospho signal transducer and activator of transcription 3), alpha smooth muscle actin (αSMA) and Collagen1a were found, suggesting a differentiation towards a myofibroblast-like phenotype. SB505124 (10 μmol/L) partially reversed these alterations, suggesting a TGFβ contribution. Furthermore, nintedanib at 100 nmol/L and, to a lesser extent, pirfenidone at 100 μmol/L prevented the IPF-CM-induced fibroblast phenotype alterations, suggesting an attenuation of the ECM-fibroblast interplay. IPF fibroblasts alter the ECM, thus creating a CM that further propagates an IPF-like phenotype in normal fibroblasts. This assay demonstrated differences in drug activities for approved IPF drugs at clinically relevant concentrations. Thus, the matrix-fibroblast phenotype interplay might be a relevant assay to explore drug candidates for IPF treatment. © 2018 Asian Pacific Society of Respirology.

  7. Testosterone metabolism of fibroblasts grown from prostatic carcinoma, benign prostatic hyperplasia and skin fibroblasts

    International Nuclear Information System (INIS)

    Schweikert, H.U.; Hein, H.J.; Romijn, J.C.; Schroeder, F.H.

    1982-01-01

    The metabolism of [1,2,6,7-3H]testosterone was assessed in fibroblast monolayers derived from tissue of 5 prostates with benign hyperplasia (BPH), 4 prostates with carcinoma (PC), and 3 biopsy samples of skin, 2 nongenital skin (NG) and 1 genital skin. The following metabolites could be identified: androstanedione androstenedione, dihydrotestosterone, androsterone, epiandrosterone, androstane-3 alpha, 17 beta-diol and androstane-3 beta, 17 beta-diol. Testosterone was metabolized much more rapidly in fibroblasts originating from prostatic tissue than in fibroblasts derived from NG. A significantly higher formation of 5 alpha-androstanes and 3 alpha-hydroxysteroids could be observed in fibroblasts from BPH as compared to PC. 17-ketosteroid formation exceeded 5 alpha-androstane formation in BPH, whereas 5 alpha-reduction was the predominant pathway in fibroblasts grown from PC and NG. Since testosterone metabolism in fibroblasts of prostatic origin therefore resembles in many aspects that in whole prostatic tissue, fibroblasts grown from prostatic tissues might be a valuable tool for further investigation of the pathogenesis of human BPH and PC

  8. Sialylation regulates myofibroblast differentiation of human skin fibroblasts.

    Science.gov (United States)

    Sasaki, Norihiko; Itakura, Yoko; Toyoda, Masashi

    2017-04-18

    Fibroblasts are key players in maintaining skin homeostasis and in orchestrating physiological tissue repair and skin regeneration. Dysfunctions in fibroblasts that occur with aging and the senescent process lead to the delayed healing observed in elderly people. The molecular mechanisms leading to fibroblast dysfunction during aging and the senescent process have not yet been clarified. Previously, changes in patterns of glycosylation were observed in fibroblasts in aging and the senescent process, but the effect of these changes on the function of fibroblasts has not been well documented. Here, we investigated whether changes in glycosylation during the process to senescence may have functional effects on fibroblasts. The changes in cell surface glycans on skin fibroblasts during the process to senescence were examined in early-passage (EP) and late-passage (LP) skin fibroblasts by fluorescence-activated cell sorting analysis using lectins. The contributors to the changes in cell surface glycans were examined by real-time polymerase chain reaction or Western blot analysis. The effects of changes in glycosylation on proliferation, migration, induction of cellular senescence, and myofibroblast differentiation induced by transforming growth factor (TGF)-β1 stimulation were examined in EP fibroblasts. The changes in glycosylation were performed by GalNAc-α-O-benzyl or sialidase treatment. A decrease in sialylation of glycoproteins and an increase in sialidase NEU1 were observed in LP fibroblasts. The reduction of sialylation did not have any effect on proliferation, migration, or induction of cellular senescence. On the other hand, myofibroblast differentiation was inhibited by the reduction of sialylation, indicating that sialylation is important for myofibroblast differentiation. The localization of CD44 in lipid rafts, which is required for myofibroblast differentiation, was inhibited by the reduction of sialylation. Furthermore, reduced myofibroblast

  9. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    Science.gov (United States)

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  10. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  11. Comparative human cellular radiosensitivity: I. The effect of SV40 transformation and immortalisation on the gamma-irradiation survival of skin derived fibroblasts from normal individuals and from ataxia-telangiectasia patients and heterozygotes.

    Science.gov (United States)

    Arlett, C F; Green, M H; Priestley, A; Harcourt, S A; Mayne, L V

    1988-12-01

    We have compared cell killing following 60Co gamma irradiation in 22 primary human fibroblast strains, nine SV40-immortalized human fibroblast lines and seven SV40-transformed pre-crisis human fibroblast cultures. We have examined material from normal individuals, from ataxia-telangiectasia (A-T) patients and from A-T heterozygotes. We have confirmed the greater sensitivity of A-T derived cells to gamma radiation. The distinction between A-T and normal cells is maintained in cells immortalized by SV40 virus but the immortal cells are more gamma radiation resistant than the corresponding primary fibroblasts. Cells transformed by plasmids (pSV3gpt and pSV3neo) expressing SV40 T-antigen, both pre- and post-crisis, show this increased resistance, indicating that it is expression of SV40 T-antigen, rather than immortalization per se which is responsible for the change. We use D0, obtained from a straight line fit, and D, estimated from a multitarget curve, as parameters to compare radiosensitivity. We suggest that both have their advantages; D0 is perhaps more reproducible, but D is more realistic when comparing shouldered and non-shouldered data.

  12. Primary skin fibroblasts as a model of Parkinson's disease

    NARCIS (Netherlands)

    Auburger, G.; Klinkenberg, M.; Droste, J.A.H.; Marcus, K.; Morales-Gordo, B.; Kunz, W.S.; Brandt, U.; Broccoli, V.; Reichmann, H.; Gispert, S.; Jendrach, M.

    2012-01-01

    Parkinson's disease is the second most frequent neurodegenerative disorder. While most cases occur sporadic mutations in a growing number of genes including Parkin (PARK2) and PINK1 (PARK6) have been associated with the disease. Different animal models and cell models like patient skin fibroblasts

  13. Transfection of Primary Human Skin Fibroblasts for Peroxisomal Studies

    NARCIS (Netherlands)

    Koster, Janet; Waterham, Hans R.

    2017-01-01

    Functional studies with primary human skin fibroblasts from patients with a peroxisomal disorder often require efficient transfection with plasmids to correct the genetic defect or to express heterologous reporter proteins. Here, we describe a protocol we commonly use for efficient nonviral

  14. Free radical injury in skin cultured fibroblasts from Alzheimer's disease patients.

    Science.gov (United States)

    Tesco, G; Latorraca, S; Piersanti, P; Sorbi, S; Piacentini, S; Amaducci, L

    1992-12-26

    Oxygen radical production is postulated to be a major cause of cell damage in aging. We have studied the response to toxic oxygen metabolites of fibroblast cell lines derived from skin biopsies of patients with familial and sporadic Alzheimer's disease compared with those derived from normal controls. Fibroblasts were damaged by the generation of oxygen metabolites during the enzymatic oxidation of acetaldehyde by 50 mU of xanthine-oxidase. To quantify cell damage we measured lactate dehydrogenase activity in the culture medium and cell viability in fibroblast cultures from four normal subjects, five FAD, and four AD patients after 2 hours of Xo incubation. We found a significant increase of LDH activity in FAD vs. controls and also in AD vs. controls, suggesting that AD cells are more susceptible to oxygen radical damage than are normal controls.

  15. Studies of the in vivo radiosensitivity of human skin fibroblasts

    International Nuclear Information System (INIS)

    Hill, Richard P.; Kaspler, Pavel; Griffin, Anthony M.; O'Sullivan, Brian; Catton, Charles; Alasti, Hamideh; Abbas, Ahmar; Heydarian, Moustafa; Ferguson, Peter; Wunder, Jay S.; Bell, Robert S.

    2007-01-01

    Background and purpose: To examine the radiosensitivity of skin cells obtained directly from the irradiated skin of patients undergoing fractionated radiation treatment prior to surgery for treatment of soft tissue sarcoma (STS) and to determine if there was a relationship with the development of wound healing complications associated with the surgery post-radiotherapy. Methods: Micronucleus (MN) formation was measured in cells (primarily dermal fibroblasts) obtained from human skin at their first division after being removed from STS patients during post-radiotherapy surgery (2-9 weeks after the end of the radiotherapy). At the time of radiotherapy (planned tumor dose - 50 Gy in 25 daily fractions) measurements were made of surface skin dose at predetermined marked sites. Skin from these sites was obtained at surgery and cell suspensions were prepared directly for the cytokinesis-blocked MN assay. Cultured strains of the fibroblasts were also established from skin nominally outside the edge of the radiation beam and DNA damage (MN formation) was examined following irradiation in vitro for comparison with the results from the in situ irradiations. Results: Extensive DNA damage (MN) was detectable in fibroblasts from human skin at extended periods after irradiation (2-9 weeks after the end of the 5-week fractionated radiotherapy). Analysis of skin receiving a range of doses demonstrated that the level of damage observed was dose dependent. There was no clear correlation between the level of damage observed after irradiation in situ and irradiation of cell strains in culture. Similarly, there was no correlation between the extent of MN formation following in situ irradiation and the propensity for the patient to develop wound healing complications post-surgery. Conclusions: Despite the presence of DNA damage in dermal fibroblasts weeks after the end of the radiation treatment, there was no relationship between this damage and wound healing complications following

  16. Recovery from UV-induced potentially lethal damage in systemic lupus erythematosus skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Zamansky, G B

    1986-08-01

    The repair of ultraviolet light-induced potentially lethal damage was investigated in density-inhibited skin fibroblast cell strains derived from patients with systemic lupus erythematosus. The effect of exposure to polychromatic ultraviolet light composed of environmentally relevant wavelengths or to the more commonly studied, short wavelength (254 nm) ultraviolet light was studied. Systemic lupus erythematosus cells, which are hypersensitive to ultraviolet light under growth promoting conditions, were able to repair potentially lethal damage as well as normal cells.

  17. Recovery from UV-induced potentially lethal damage in systemic lupus erythematosus skin fibroblasts

    International Nuclear Information System (INIS)

    Zamansky, G.B.

    1986-01-01

    The repair of ultraviolet light-induced potentially lethal damage was investigated in density-inhibited skin fibroblast cell strains derived from patients with systemic lupus erythematosus. The effect of exposure to polychromatic ultraviolet light composed of environmentally relevant wavelengths or to the more commonly studied, short wavelength (254 nm) ultraviolet light was studied. Systemic lupus erythematosus cells, which are hypersensitive to ultraviolet light under growth promoting conditions, were able to repair potentially lethal damage as well as normal cells. (author)

  18. Development of human skin equivalents mimicking skin aging : contrast between papillary and reticular fibroblasts as a lead

    NARCIS (Netherlands)

    Janson, D.

    2017-01-01

    This thesis describes the development of human skin equivalents that show characteristics of skin aging. The type of skin equivalent used was a fibroblast derived matrix equivalent, in which the dermal compartment is generated by fibroblasts and thus is fully of human origin. Two strategies are

  19. Elastin hydrolysate derived from fish enhances proliferation of human skin fibroblasts and elastin synthesis in human skin fibroblasts and improves the skin conditions.

    Science.gov (United States)

    Shiratsuchi, Eri; Nakaba, Misako; Yamada, Michio

    2016-03-30

    Recent studies have shown that certain peptides significantly improve skin conditions, such as skin elasticity and the moisture content of the skin of healthy woman. This study aimed to investigate the effects of elastin hydrolysate on human skin. Proliferation and elastin synthesis were evaluated in human skin fibroblasts exposed to elastin hydrolysate and proryl-glycine (Pro-Gly), which is present in human blood after elastin hydrolysate ingestion. We also performed an ingestion test with elastin hydrolysate in humans and evaluated skin condition. Elastin hydrolysate and Pro-Gly enhanced the proliferation of fibroblasts and elastin synthesis. Maximal proliferation response was observed at 25 ng mL(-1) Pro-Gly. Ingestion of elastin hydrolysate improved skin condition, such as elasticity, number of wrinkles, and blood flow. Elasticity improved by 4% in the elastin hydrolysate group compared with 2% in the placebo group. Therefore, elastin hydrolysate activates human skin fibroblasts and has beneficial effects on skin conditions. © 2015 Society of Chemical Industry.

  20. Treatment of Skin Avulsion Injuries with Basic Fibroblast Growth Factor

    Directory of Open Access Journals (Sweden)

    Hajime Matsumine, MD, PhD

    2015-04-01

    Full Text Available Summary: This report describes favorable outcomes in 9 patients with skin avulsion injuries of the extremities who underwent full-thickness skin grafting and basic fibroblast growth factor (bFGF application. Following removal of contaminated subcutaneous fat tissue on the inside of skin, the avulsed skin was processed into a full-thickness skin graft, with as much of the skin used as possible irrespective of damage. Several drainage holes (5–10 mm in diameter were made on the graft for drainage from the graft bed and to prevent seroma and hematoma formation. Genetically recombinant human bFGF was sprayed at a dose of 1 μg/cm2 onto the graft bed, which was then covered with the graft and sutured. Pressure immobilization with ointment gauzes and elastic bandages was administered for 1 week postoperatively, and the surface of the skin grafts that did not take was scraped away, preserving the revascularized dermal component on the debrided raw surface as much as possible. bFGF was sprayed again onto the debrided surface to promote epithelialization. Wound closure was achieved in all cases with conservative therapy. The surgical procedure was effective in preventing postoperative ulcer formation and scar contracture and resulted in wound healing with the formation of good-quality, flexible scars.

  1. Wound healing properties of ethyl acetate fraction of Moringa oleifera in normal human dermal fibroblasts

    Directory of Open Access Journals (Sweden)

    Sivapragasam Gothai

    2016-03-01

    Full Text Available Background/Aim: Wounds are the outcome of injuries to the skin that interrupt the soft tissue. Healing of a wound is a complex and long-drawn-out process of tissue repair and remodeling in response to injury. A large number of plants are used by folklore traditions for treatment of cuts, wounds and burns. Moringa oleifera is an herb used as traditional folk medicine for the treatment of various skin wounds and associated diseases. The underlying mechanisms of wound healing activity of ethyl acetate fraction of M. oleifera leaves extract are completely unknown. Methods: In the current study, ethyl acetate fraction of Moringa oleifera leaves was investigated for its efficacy on cell viability, proliferation and migration (wound closure rate in human normal dermal fibroblast cells. Results: Results revealed that lower concentration (12.5 µg/ml, 25 µg/ml, and 50 µg/ml of ethyl acetate fraction of M. oleifera leaves showed remarkable proliferative and migratory effect on normal human dermal fibroblasts. Conclusion: The present study suggested that ethyl acetate fraction of M. oleifera leaves might be a potential therapeutic agent for skin wound healing by promoting fibroblast proliferation and migration through increasing the wound closure rate corroborating its traditional use. [J Complement Med Res 2016; 5(1.000: 1-6

  2. The effect of tranilast on fibroblast activation protein α (FAP-α expression in normal and keloid fibroblasts in vitro

    Directory of Open Access Journals (Sweden)

    Paweł P. Antończak

    2017-07-01

    Full Text Available Introduction . Tranilast (N-(3’,4’-demethoxycinnamoyl-anthranilic acid is an anti-allergic drug. Its mechanism of action is based on the inhibition of antigen-induced release of chemical mediators from mast cells and basophils. It also reveals antifibroproliferative activities. These properties of tranilast are used in the treatment of hypertrophic scars and keloids. Keloids are characterized by incorrect extracellular matrix components turnover. Fibroblasts derived from keloids reveal overproduction of collagen type I and decreased degradation of extracellular matrix in comparison with normal fibroblasts. Fibroblast activation protein α (FAP-α may play an important role in remodeling of extracellular matrix and the invasive properties of keloids. Objective . In the present study, the effect of tranilast on expression of FAP-α gene and its protein was evaluated in normal human dermal fibroblasts and fibroblasts derived from keloids cultured in vitro . Materials and methods. In the first stage of the study, the influence of tranilast on cell viability was estimated. The second stage of the study included the quantitative evaluation of FAP-α mRNA expression in normal and keloid fibroblasts treated with tranilast. The third stage of the study comprised fibroblast activation protein α expression analysis in the examined cells treated with tranilast. Results and conclusions . The expression of FAP-α gene and fibroblast activation protein α is higher in keloid fibroblasts. Tranilast at concentrations of 3 μM and 30 μM up-regulated mRNA FAP-α expression in normal fibroblasts but did not influence keloid fibroblasts. The drug, at concentrations of 30 μM and 300 μM up-regulated fibroblast activation protein α expression in normal fibroblasts and did not influence keloid fibroblasts. Tranilast antiproliferative effect is not associated with FAP-α expression in keloid fibroblasts.

  3. Resistance to 1,25-dihydroxyvitamin D. Association with heterogeneous defects in cultured skin fibroblasts

    International Nuclear Information System (INIS)

    Liberman, U.A.; Eil, C.; Marx, S.J.

    1983-01-01

    We evaluated the interaction of [ 3 H]1,25(OH) 2 D 3 with skin fibroblasts cultured from normal subjects or from affected members of six kindreds with rickets and resistance to 1-alpha, 25(OH) 2 D [1,25(OH) 2 D]. We analyzed two aspects of the radioligand interaction; nuclear uptake with dispersed, intact cells at 37 degrees C and binding at 0 degrees C with soluble extract (cytosol) prepared from cells disrupted in buffer containing 300 mM KCl and 10 mM sodium molybdate. With normal fibroblasts the affinity and capacity of nuclear uptake of [ 3 H]1,25(OH) 2 D 3 were 0.5 nM and 10,300 sites per cell, respectively; for binding with cytosol these were 0.13 nM and 8,900 sites per cell, respectively. In all cases where the radioligand bound with high affinity in nucleus or cytosol, the nucleus- or cytosol-associated radioligand exhibited normal sedimentation velocity on sucrose density gradients. When two kindreds exhibited similar patterns (i.e. pattern a or c) with the analyses of cultured fibroblasts, clinical features in affected members suggested that the underlying genetic defects were not identical. In conclusion: (a) Fibroblasts cultured from human skin manifest nuclear uptake and cytosol binding of [ 3 H]1,25(OH) 2 D 3 that is an expression of the genes determining these processes in target tissues. (b) Based upon data from clinical evaluations and from analyses of cultured fibroblasts, severe resistance to 1,25(OH) 2 D resulted from five or six distinct genetic mutations in six kindreds

  4. Resistance to 1,25-dihydroxyvitamin D. Association with heterogeneous defects in cultured skin fibroblasts

    International Nuclear Information System (INIS)

    Liberman, U.A.; Eil, C.; Marx, S.J.

    1983-01-01

    The authors evaluated the interaction of [ 3 H]1,25(OH) 2 D3 with skin fibroblasts cultured from normal subjects or from affected members of six kindreds with rickets and resistance to 1-alpha, 25(OH) 2 D [1,25(OH) 2 D]. They analyzed two aspects of the radioligand interaction; nuclear uptake with dispersed, intact cells at 37 degrees C and binding at 0 degrees C with soluble extract (cytosol) prepared from cells disrupted in buffer. With normal fibroblasts the affinity and capacity of nuclear uptake of [ 3 H]1,25(OH) 2 D3 were 0.5 nM and 10,300 sites per cell, respectively; for binding with cytosol these were 0.13 nM and 8,900 sites per cell, respectively. The following four patterns of interaction with [ 3 H]1,25(OH) 2 D3 were observed with cells cultured from affected patients. In all cases where the radioligand bound with high affinity in nucleus or cytosol, the nucleus- or cytosol-associated radioligand exhibited normal sedimentation velocity on sucrose density gradients. When two kindreds exhibited similar patterns (i.e. pattern a or c) with the analyses of cultured fibroblasts, clinical features in affected members suggested that the underlying genetic defects were not identical. In conclusion: (a) Fibroblasts cultured from human skin manifest nuclear uptake and cytosol binding of [ 3 H]1,25(OH) 2 D3 that is an expression of the genes determining these processes in target tissues. (b) Based upon data from clinical evaluations and from analyses of cultured fibroblasts, severe resistance to 1,25(OH) 2 D resulted from five or six distinct genetic mutations in six kindreds

  5. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  6. Microporous dermal-mimetic electrospun scaffolds pre-seeded with fibroblasts promote tissue regeneration in full-thickness skin wounds.

    Directory of Open Access Journals (Sweden)

    Paul P Bonvallet

    Full Text Available Electrospun scaffolds serve as promising substrates for tissue repair due to their nanofibrous architecture and amenability to tailoring of chemical composition. In this study, the regenerative potential of a microporous electrospun scaffold pre-seeded with dermal fibroblasts was evaluated. Previously we reported that a 70% collagen I and 30% poly(Ɛ-caprolactone electrospun scaffold (70:30 col/PCL containing 160 μm diameter pores had favorable mechanical properties, supported fibroblast infiltration and subsequent cell-mediated deposition of extracellular matrix (ECM, and promoted more rapid and effective in vivo skin regeneration when compared to scaffolds lacking micropores. In the current study we tested the hypothesis that the efficacy of the 70:30 col/PCL microporous scaffolds could be further enhanced by seeding scaffolds with dermal fibroblasts prior to implantation into skin wounds. To address this hypothesis, a Fischer 344 (F344 rat syngeneic model was employed. In vitro studies showed that dermal fibroblasts isolated from F344 rat skin were able to adhere and proliferate on 70:30 col/PCL microporous scaffolds, and the cells also filled the 160 μm pores with native ECM proteins such as collagen I and fibronectin. Additionally, scaffolds seeded with F344 fibroblasts exhibited a low rate of contraction (~14% over a 21 day time frame. To assess regenerative potential, scaffolds with or without seeded F344 dermal fibroblasts were implanted into full thickness, critical size defects created in F344 hosts. Specifically, we compared: microporous scaffolds containing fibroblasts seeded for 4 days; scaffolds containing fibroblasts seeded for only 1 day; acellular microporous scaffolds; and a sham wound (no scaffold. Scaffolds containing fibroblasts seeded for 4 days had the best response of all treatment groups with respect to accelerated wound healing, a more normal-appearing dermal matrix structure, and hair follicle regeneration

  7. Tattoo ink nanoparticles in skin tissue and fibroblasts.

    Science.gov (United States)

    Grant, Colin A; Twigg, Peter C; Baker, Richard; Tobin, Desmond J

    2015-01-01

    Tattooing has long been practised in various societies all around the world and is becoming increasingly common and widespread in the West. Tattoo ink suspensions unquestionably contain pigments composed of nanoparticles, i.e., particles of sub-100 nm dimensions. It is widely acknowledged that nanoparticles have higher levels of chemical activity than their larger particle equivalents. However, assessment of the toxicity of tattoo inks has been the subject of little research and ink manufacturers are not obliged to disclose the exact composition of their products. This study examines tattoo ink particles in two fundamental skin components at the nanometre level. We use atomic force microscopy and light microscopy to examine cryosections of tattooed skin, exploring the collagen fibril networks in the dermis that contain ink nanoparticles. Further, we culture fibroblasts in diluted tattoo ink to explore both the immediate impact of ink pigment on cell viability and also to observe the interaction between particles and the cells.

  8. Tattoo ink nanoparticles in skin tissue and fibroblasts

    Directory of Open Access Journals (Sweden)

    Colin A. Grant

    2015-05-01

    Full Text Available Tattooing has long been practised in various societies all around the world and is becoming increasingly common and widespread in the West. Tattoo ink suspensions unquestionably contain pigments composed of nanoparticles, i.e., particles of sub-100 nm dimensions. It is widely acknowledged that nanoparticles have higher levels of chemical activity than their larger particle equivalents. However, assessment of the toxicity of tattoo inks has been the subject of little research and ink manufacturers are not obliged to disclose the exact composition of their products. This study examines tattoo ink particles in two fundamental skin components at the nanometre level. We use atomic force microscopy and light microscopy to examine cryosections of tattooed skin, exploring the collagen fibril networks in the dermis that contain ink nanoparticles. Further, we culture fibroblasts in diluted tattoo ink to explore both the immediate impact of ink pigment on cell viability and also to observe the interaction between particles and the cells.

  9. Abnormal phenotype of cultured fibroblasts in human skin with chronic radiotherapy damage

    International Nuclear Information System (INIS)

    Delanian, S.; Martin, M.; Lefaix, J.-L.; Bravard, A.; Luccioni, C.

    1998-01-01

    Purpose: The pathophysiological aspects of radiation-induced fibrosis (RIF) have not been well characterized. We therefore cultured human fibroblasts from samples of skin with RIF to investigate the long-term effects of therapeutic irradiation. Materials and methods: Biopsies of normal and RIF skin were obtained from patients previously irradiated for cancer, without recurrence. Cells were extracted from dermis samples by the outgrowth technique, seeded as monolayers and cultured at confluence. Enzyme activities and proteins were assayed, RNA was isolated and Northern blot analysis was performed on surviving cells between passages 2 and 5. Results: RIF cell cultures displayed heterogeneous fibroblasts populations. The initial outgrowth consisted of one-third small cells that floated rapidly, one-third spindle-shaped cells migrating far from the explant to form islets and one-third large pleiomorphic cells. In subsequent subcultures, surviving cells exhibited either myofibroblastic characteristics with a normal proliferative capacity or senescent morphology with a reduced proliferative capacity. These RIF cells had a brief finite lifespan, with dramatically reduced growth rate during their initial outgrowth and the following passages. Study of the antioxidant metabolism showed that Mn superoxide dismutase and catalase activities were significantly weaker in surviving RIF cells than healthy fibroblasts. These exhausted RIF cells exhibited no overexpression of transforming growth factor β or tissue inhibitor of metalloproteinase. Conclusion: Irradiation may lead to apparently contradictory effects such as fibrosis and necrosis in clinical practice. In cell culture, we observed two main cellular phenotypes which may be related to both processes, i.e. myofibroblast-like cells and fibrocyte-like cells. These two phenotypes may represent two steps in the differentiation induced as a long-term effect of therapeutic irradiation of the skin. Cell culture probably

  10. Fibroblast-mediated contraction in actinically exposed and actinically protected aging skin

    International Nuclear Information System (INIS)

    Marks, M.W.; Morykwas, M.J.; Wheatley, M.J.

    1990-01-01

    The changes in skin morphology over time are a consequence of both chronologic aging and the accumulation of environmental exposure. Through observation, we know that actinic radiation intensifies the apparent aging of skin. We have investigated the effects of aging and actinic radiation on the ability of fibroblasts to contract collagen-fibroblast lattices. Preauricular and postauricular skin samples were obtained from eight patients aged 49 to 74 undergoing rhytidectomy. The samples were kept separate, and the fibroblasts were grown in culture. Lattices constructed with preauricular fibroblasts consistently contracted more than lattices containing postauricular fibroblasts. The difference in amount of contraction in 7 days between sites was greatest for the younger patients and decreased linearly as donor age increased (r = -0.96). This difference may be due to preauricular fibroblasts losing their ability to contract a lattice as aging skin is exposed to more actinic radiation

  11. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Emond Mary

    2007-09-01

    Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

  12. Radiation-induced chromosome aberrations and cell killing in normal human fibroblasts and ataxia telangiectasia fibroblasts

    International Nuclear Information System (INIS)

    Kawata, T.; Saito, M.; Uno, T.; Ito, H.; Shigematsu, N.

    2003-01-01

    Full text: When cells are held in a non-dividing state (G0) after irradiation, an enhanced survival can be observed compared to that of immediate plating. A change of survival depending on post irradiation condition is known to be repair of potentially lethal damage (RPLD). The effects of confluent holding recovery (24-h incubation following irradiation) on chromosome aberrations in normal human fibroblasts (AG1522) and ataxia telangiectasia fibroblasts (GM02052C) were examined. A chemical-induced premature chromosome condensation (PCC) technique with fluorescent in situ hybridization (FISH) was applied to study chromosome aberrations in G2 and M-phase. Results from cell survival showed that the capacity for potentially lethal damage repair was normal in AG1522 cells but very little in GM02052C cells. The frequency of chromosome aberrations in AG1522 cells decreased when cells were allowed to repair for 24-h. Especially complex type exchanges were found to decrease markedly at high doses (4Gy and 6Gy). However, the frequency of chromosome aberrations including complex type exchanges showed little decrease in GM02052C cells. Confluent holding can effectively reduce chromosome aberrations, especially complex type exchanges in normal cells

  13. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  14. Differential Gene Expression of Fibroblasts: Keloid versus Normal

    Directory of Open Access Journals (Sweden)

    Michael F. Angel

    2002-11-01

    Full Text Available Abstract: This study investigated gene regulation and unique gene products in both keloid (KDF and normal (NDF dermal fibroblasts in established cell lines. For gene regulation, NDF versus KDF were compared using Clontech's Atlas™ Human cDNA Expression Array while unique gene products were studied using RNA Fingerprinting Kit. RNA from each sample was converted to cDNA using oligo-dT primers. Down-regulated genes using Atlas Array in KDF were 1 60 S ribosomal protein, 2 Thioredoxin dependent peroxidase, 3 Nuclease sensitive element DNA binding protein, 4 c-myc purine-binding transcription factor, 5 c-AMP dependent protein kinase, and, 6 Heat Shock Protein 90 kDa. Genes that are up regulated in KDF were 1 Tubulin and 2 Heat Shock Protein 27 kDa. With the differential display, we found 17 bands unique to both KDF and NDF. The specific gene and the manner in which they were differentially regulated have direct implications to understanding keloid fibroblast proliferation.

  15. The small Rho GTPase Rac1 controls normal human dermal fibroblasts proliferation with phosphorylation of the oncoprotein c-myc

    International Nuclear Information System (INIS)

    Nikolova, Ekaterina; Mitev, Vanio; Zhelev, Nikolai; Deroanne, Christophe F.; Poumay, Yves

    2007-01-01

    Proliferation of dermal fibroblasts is crucial for the maintenance of skin. The small Rho GTPase, Rac1, has been identified as a key transducer of proliferative signals in various cell types, but in normal human dermal fibroblasts its significance to cell growth control has not been studied. In this study, we applied the method of RNA interference to suppress endogenous Rac1 expression and examined the consequences on human skin fibroblasts. Rac1 knock-down resulted in inhibition of DNA synthesis. This effect was not mediated by inhibition of the central transducer of proliferative stimuli, ERK1/2 or by activation of the pro-apoptotic p38. Rather, as a consequence of the suppressed Rac1 expression we observed a significant decrease in phosphorylation of c-myc, revealing for the first time that in human fibroblasts Rac1 exerts control on proliferation through c-myc phosphorylation. Thus Rac1 activates proliferation of normal fibroblasts through stimulation of c-myc phosphorylation without affecting ERK1/2 activity

  16. Bioactive reagents used in mesotherapy for skin rejuvenation in vivo induce diverse physiological processes in human skin fibroblasts in vitro- a pilot study.

    Science.gov (United States)

    Jäger, Claudia; Brenner, Christiane; Habicht, Jüri; Wallich, Reinhard

    2012-01-01

    The promise of mesotherapy is maintenance and/or recovery of a youthful skin with a firm, bright and moisturized texture. Currently applied medications employ microinjections of hyaluronic acid, vitamins, minerals and amino acids into the superficial layer of the skin. However, the molecular and cellular processes underlying mesotherapy are still elusive. Here we analysed the effect of five distinct medication formulas on pivotal parameters involved in skin ageing, that is collagen expression, cell proliferation and morphological changes using normal human skin fibroblast cultures in vitro. Whereas in the presence of hyaluronic acid, NCTF135(®) and NCTF135HA(®) , cell proliferation was comparable to control cultures; however, with higher expression of collagen type-1, matrix metalloproteinase-1 and tissue inhibitor of matrix metalloproteinase-1, addition of Soluvit(®) N and Meso-BK led to apoptosis and/or necrosis of human fibroblasts. The data indicate that bioactive reagents currently applied for skin rejuvenation elicit strikingly divergent physiological processes in human skin fibroblast in vitro. © 2011 John Wiley & Sons A/S.

  17. Differentiation state of skin fibroblast cultures versus risk of subcutaneous fibrosis after radiotherapy

    International Nuclear Information System (INIS)

    Herskind, C.; Bamberg, M.; Rodemann, H.P.; Bentzen, S.M.; Overgaard, J.; Overgaard, M.

    1998-01-01

    Background and purpose: There is increasing evidence for patient-to-patient variation in the response of normal tissue to radiotherapy. Recently, it has been suggested that accumulation of functional fibrocytes may be a key step in the development of radiation-induced fibrosis. Therefore, we have examined a possible relationship between the differentiation state of untreated fibroblasts and the risk of radiation-induced subcutaneous fibrosis in individual patients. Materials and methods: We used skin fibroblast cultures isolated from eight postmastectomy radiotherapy patients whose individual clinical radiosensitivity was assessed by the mean excess risk of fibrosis. Different types of potentially mitotic progenitor fibroblasts (MF) and postmitotic functional fibrocytes (PMF) in the terminal differentiation lineage (MFI approaches MFII approaches MFIII approaches PMF) were scored morphologically in clonal culture. Progression of differentiation was quantified by the ratio L/E of colony-forming late (MFIII and late MFII) and early (MFI and early MFII) progenitors. Results: We observed a correlation between the ratio L/E and the mean risk of fibrosis (r S =0.743, P=0.03), indicating an approximately 10-fold increase in L/E with an increasing risk of fibrosis. This was paralleled by a decreasing trend in the absolute numbers of early progenitor types. By contrast, there was no significant correlation between the plating efficiency and the risk of fibrosis. Conclusions: The data suggest that the risk of fibrosis increases with the progression of the differentiation of untreated progenitor fibroblasts, indicating that the progression of fibroblast differentiation may be a co-factor in the development of radiation-induced fibrosis. If this hypothesis is validated, it provides a rationale for a novel predictive test to identify patients with an increased risk of subcutaneous fibrosis. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  18. Possible role of ginsenoside Rb1 in skin wound healing via regulating senescent skin dermal fibroblast.

    Science.gov (United States)

    Hou, Jingang; Kim, Sunchang

    2018-05-05

    Cellular senescence suppresses cancer by inducing irreversible cell growth arrest. Nevertheless, senescent cells is proposed as causal link with aging and aging-related pathologies. The physiological beneficial functions of senescent cells are still of paucity. Here we show that senescent human dermal fibroblast accelerates keratinocytes scratch wound healing and stimulates differentiation of fibroblast. Using oxidative stress (100 μM H 2 O 2 exposure for 1 h) induction, we successfully triggered fibroblast senescence and developed senescence associated secretory phenotype (SASP). The induction of SASP was regulated by p38MAPK/MSK2/NF-κB pathway. Interestingly, inhibition of p38MAPK activation only partially suppressed SASP. However, SASP was significantly inhibited by SB747651A, a specific MSK inhibitor. Additionally, we demonstrate that SASP stimulates migration of keratinocytes and myofibroblast transition of fibroblast, through fold-increased secretion of growth factors, platelet-derived growth factor AA (PDGF-AA) and AB (PDGF-AB), transforming growth factor beta 1 (TGF-β1) and beta 2 (TGF-β2), vascular endothelial growth factor A (VEGF-A) and D (VEGF-D), vascular endothelial growth factor receptor 2 (VEGFR2) and 3 (VEGFR3). Importantly, we also confirmed ginsenoside Rb1 promoted SASP-mediated healing process via p38MAPK/MSK2/NF-κB pathway. The results pointed to senescent fibroblast as a potential mechanism of wound healing control in human skin. Further, it provided a candidate targeted for wound therapy. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Resveratrol Modulation of Protein Expression in parkin-Mutant Human Skin Fibroblasts: A Proteomic Approach

    Directory of Open Access Journals (Sweden)

    Daniele Vergara

    2017-01-01

    Full Text Available In this study, we investigated by two-dimensional gel electrophoresis (2-DE and mass spectrometry (MS analysis the effects of resveratrol treatment on skin primary fibroblasts from a healthy subject and from a parkin-mutant early onset Parkinson’s disease patient. Parkin, an E3 ubiquitin ligase, is the most frequently mutated gene in hereditary Parkinson’s disease. Functional alteration of parkin leads to impairment of the ubiquitin-proteasome system, resulting in the accumulation of misfolded or aggregated proteins accountable for the neurodegenerative process. The identification of proteins differentially expressed revealed that resveratrol treatment can act on deregulated specific biological process and molecular function such as cellular redox balance and protein homeostasis. In particular, resveratrol was highly effective at restoring the heat-shock protein network and the protein degradation systems. Moreover, resveratrol treatment led to a significant increase in GSH level, reduction of GSSG/GSH ratio, and decrease of reduced free thiol content in patient cells compared to normal fibroblasts. Thus, our findings provide an experimental evidence of the beneficial effects by which resveratrol could contribute to preserve the cellular homeostasis in parkin-mutant fibroblasts.

  20. Resveratrol Modulation of Protein Expression in parkin-Mutant Human Skin Fibroblasts: A Proteomic Approach

    Science.gov (United States)

    Gaballo, Antonio; Signorile, Anna; Tanzarella, Paola; Pacelli, Consiglia; Di Paola, Marco

    2017-01-01

    In this study, we investigated by two-dimensional gel electrophoresis (2-DE) and mass spectrometry (MS) analysis the effects of resveratrol treatment on skin primary fibroblasts from a healthy subject and from a parkin-mutant early onset Parkinson's disease patient. Parkin, an E3 ubiquitin ligase, is the most frequently mutated gene in hereditary Parkinson's disease. Functional alteration of parkin leads to impairment of the ubiquitin-proteasome system, resulting in the accumulation of misfolded or aggregated proteins accountable for the neurodegenerative process. The identification of proteins differentially expressed revealed that resveratrol treatment can act on deregulated specific biological process and molecular function such as cellular redox balance and protein homeostasis. In particular, resveratrol was highly effective at restoring the heat-shock protein network and the protein degradation systems. Moreover, resveratrol treatment led to a significant increase in GSH level, reduction of GSSG/GSH ratio, and decrease of reduced free thiol content in patient cells compared to normal fibroblasts. Thus, our findings provide an experimental evidence of the beneficial effects by which resveratrol could contribute to preserve the cellular homeostasis in parkin-mutant fibroblasts. PMID:29138676

  1. Repair replication in cultured normal and transformed human fibroblasts

    International Nuclear Information System (INIS)

    Smith, C.A.; Hanawalt, P.C.

    1976-01-01

    Repair replication in response to ultraviolet irradiation has been studied in normal human diploid fibroblast cultures, W138, and an SV40 transformant, VA13. Quantitative comparisons have been made using the combined isotopic and density labelling method for assaying repair replication. No significant difference was found in the amount of repair replication performed, its dose response, or the time course between growing and confluent W138 cells, early passage and senescent cells, or normal W138 cells and the transformed VA13 cells. When [ 3 H]dThd was employed as the isotopic label in the presence of a 30-200 fold excess of unlabelled BrdUrd apparent differences in repair replication were seen between W138 cells shortly after subcultivation and cells which had been allowed to reach confluence. These differences were the same over a wide dose range and regardless of the passage number of the cells, but could be influenced by using different serum lots. The differences were not seen, however, when [ 3 H]BrdUrd provided the isotopic label; thus they reflect either impurities in the [ 3 H]dThd or a slight discrimination by some cellular process

  2. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Lei [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Xiao, Yongsheng [Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States); Wang, Yinsheng, E-mail: yinsheng.wang@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States)

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

  3. Colony size distributions according to in vitro aging in human skin fibroblasts

    International Nuclear Information System (INIS)

    Kim, Jun Sang; Kim, Jae Sung; Cho, Moon June; Park, Jeong Kyu; Paik, Tae Hyun

    1999-01-01

    To investigate the percentage of colonies with 16 or more cells distribution of human skin fibroblast according to in vitro aging, and to evaluate the relationship between percentage of colonies with 16 or more cells and in vivo donor age in human skin fibroblast culture. C1, C2, C3a, and C3b human skin fibroblast samples from three breast cancer patients were used as subjects. The C1, C2, and C3a donor were 44, 54, and 55 years old, respectively. C3a and C3b cells were isolated from the same person. Single cell suspension of skin fibroblasts was prepared with primary explant technique. One hundred cells are plated into 100ml tissue culture flask and cultured for two weeks. The colony size was defined as colonies with 16 or more cells. The cultured cell was stained with crystal violet, and number of cells in each colony was determined with stereo microscope at x 10 magnification. Passage number of C1, C2, C3a and C3b skin fibroblast were 12th, 17th, and 14th, respectively. Percentage of colonies with 16 or more cells of skin fibroblast samples decreased with increasing in vitro passage number. In contrast, cumulative population doublings of skin fibroblast sample increased with increasing in vitro passage number. Percentage of colonies with 16 or more cells also decreased with increasing population doublings in human skin fibroblast culture. There was strong correlation with percentage of colonised with 16 or more cells and population doublings in C3a skin fibroblast sample. At the same point of population doublings, the percentage of colonies with 16 or more cells of the young C1 donor was higher level than the old C3a donor. The population doublings increased with increasing in vitro passage number but percentage of colonies with 16 or more cells decreased. The results of this study imply that percentage of colonies with 16 or more cells is useful as a indicator of in vitro human skin fibroblast aging and may estimate the in vivo donor age

  4. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  5. Blackcurrant Anthocyanins Increase the Levels of Collagen, Elastin, and Hyaluronic Acid in Human Skin Fibroblasts and Ovariectomized Rats

    Directory of Open Access Journals (Sweden)

    Naoki Nanashima

    2018-04-01

    Full Text Available Blackcurrants (Ribes nigrum L. contain high levels of anthocyanin polyphenols, which have beneficial effects on health, owing to their antioxidant and anticarcinogenic properties. Phytoestrogens are plant-derived substances with estrogenic activity, which could have beneficial effects on the skin. Estradiol secretion decreases during menopause, reducing extracellular matrix (ECM component production by skin fibroblasts. Using a normal human female skin fibroblast cell line (TIG113 and ovariectomized rats, the present study investigated whether an anthocyanin-rich blackcurrant extract (BCE and four blackcurrant anthocyanins have novel phytoestrogenic activities that could benefit the skin in menopausal women. In TIG113 cells, a microarray and the Ingenuity® Pathway Analysis showed that 1.0 μg/mL of BCE upregulated the expression of many estrogen signaling-related genes. A quantitative RT-PCR analysis confirmed that BCE (1.0 or 10.0 μg/mL and four types of anthocyanins (10 μM altered the mRNA expression of ECM proteins and enzymes involved in ECM turnover. Immunofluorescence staining indicated that the anthocyanins stimulated the expression of ECM proteins, such as collagen (types I and III and elastin. Dietary administration of 3% BCE to ovariectomized rats for 3 months increased skin levels of collagen, elastin, and hyaluronic acid. This is the first study to show that blackcurrant phytoestrogens have beneficial effects on skin experimental models.

  6. Membrane associated ion transport enzymes in normal and transformed fibroblasts and epithelial cells

    International Nuclear Information System (INIS)

    Borek, C.

    1982-01-01

    In an effort to evaluate membrane changes associated with neoplastic transformation of fibroblasts and epithelial cells by radiation and chemicals, alterations in membrane-associated (Na + + K + )-ATPase and 5'-nucleotidase activities were investigated. Cell cultures consisted of normal and radiation transformed hamster embryo fibroblasts (HE) and mouse C3H 10T 1/2 fibroblasts, normal and chemically transformed adult rat liver epithelial cells (ARL), as well as hepatocarcinoma cells induced by the liver transformants. Transformed fibroblasts demonstrated a 1-2 fold increase in (Na + + K + )-ATPase activity over the normal, while the transformed liver epithelial cells and carcinoma cells showed a 60% and 40% decrease in activity compared to the normal values, respectively. The 5'-nucleotidase activity was 2 to 3 times higher in the transformed fibroblasts

  7. Effect of low-dose-rate irradiation on the division potential of cells in vitro. V. Human skin fibroblasts from donors with a high risk of cancer

    International Nuclear Information System (INIS)

    Diatloff, C.; Macieira-Coelho, A.

    1979-01-01

    Skin fibroblasts from normal donors, donors with ataxia-telanglectasia or Fanconi's anemia, and from 1 cancer patient were treated with repeated γ radiation at about 16 rads per hour. The remaining division potential of all fibroblasts, except for the Fanconi's anemia cells, was reduced to different extents by radiation. The growth potential of Fanconl's anemia cells was increased in all the irradiated cultures. The increase was 54% in the group that survived the longest. These results were identical to those obtained with fibroblasts from certain species that have a high probability of transformation

  8. Senescent phenotypes of skin fibroblasts from patients with Tangier disease

    International Nuclear Information System (INIS)

    Matsuura, Fumihiko; Hirano, Ken-ichi; Ikegami, Chiaki; Sandoval, Jose C.; Oku, Hiroyuki; Yuasa-Kawase, Miyako; Tsubakio-Yamamoto, Kazumi; Koseki, Masahiro; Masuda, Daisaku; Tsujii, Ken-ichi; Ishigami, Masato; Nishida, Makoto; Shimomura, Iichiro; Hori, Masatsugu; Yamashita, Shizuya

    2007-01-01

    Tangier disease (TD) is characterized by a deficiency of high density lipoprotein (HDL) in plasma and patients with TD have an increased risk for coronary artery disease (CAD). Recently, we reported that fibroblasts from TD exhibited large and flattened morphology, which is often observed in senescent cells. On the other hand, data have accumulated to show the relationship between cellular senescence and development of atherosclerotic CAD. The aim of the present study was to investigate whether TD fibroblasts exhibited cellular senescence. The proliferation of TD fibroblasts was gradually decreased at population doubling level (PDL) ∼10 compared with control cells. TD cells practically ceased proliferation at PDL ∼30. DNA synthesis was markedly decreased in TD fibroblasts. TD cells exhibited a higher positive rate for senescence-associated β-galactosidase (SA-β-gal), which is one of the biomarkers of cellular senescence in vitro. These data showed that TD cells reached cellular senescence at an earlier PDL compared with controls. Although, there was no difference in the telomere length of fibroblasts between TD and controls at the earlier passage (PDL 6), the telomere length of TD cells was shorter than that of controls at the late passage (PDL 25). Taken together, the current study demonstrates that the late-passaged TD fibroblasts showed senescent phenotype in vitro, which might be related to the increased cardiovascular manifestations in TD patients

  9. In vitro culture of skin fibroblast cells for potential cloning by nuclear transfer

    International Nuclear Information System (INIS)

    Gupta, S.C.; Gupta, N.; Ahlawat, S.P.S.; Kumar, A.; Taneja, R.; Sharma, R.; Sunder, S.; Tantia, M.S.

    2005-01-01

    Donor cell lines were developed from skin tissue for the conservation of the endangered Jaiselmeri camel breed of India. Average cell proliferation rates varied from 0.82 to 0.69 in different passages, and population doubling time from 29.3 h to 34.8 h. Around 15 population doublings were accomplished during this culturing. Cell viability was 97 to 99% in different passages. Growth curves of cells from the JC-5 cell line reached a plateau on day 7, while the slower-growing cultures of JC-3 showed elevation even on day 10, possibly due to donor age differences. Cell proliferation rates by both cell count and MTT absorbance showed similar patterns, with a correlation coefficient of 0.79. MTT assay, a colorimetric method, can handle large samples in somatic cell cultures. Diploid chromosomal counts in passages 1, 3 and 5 were normal (2N=74, XY) in 97% of the cells. Occasional metaphase plates showed polyploidy. The present baseline data on standard growth curve, linear relationship in colorimetric assay for estimation of cell proliferation rate, and normal ploidy and karyological levels in camel skin fibroblast cells in multiplication could be useful in developing competent donor somatic cell lines for conservation now and revival of this camel breed by cloning in the future. (author)

  10. Human fibroblast strain with normal survival but abnormal postreplication repair after ultraviolet light irradiation

    International Nuclear Information System (INIS)

    Doniger, J.; Barrett, S.F.; Robbins, J.H.

    1980-01-01

    Postreplication repair has been studied in ultraviolet light (UV-irradiated) fibroblast strains derived from eight apparently normal control donors and seven xeroderma pigmentosum patients. One control donor strain had an intermediate defect in postreplication repair similar to that in excision-deficient xeroderma pigmentosum fibroblasts. However, unlike the xeroderma pigmentosum strains, this control donor strain had normal UV-induced unscheduled DNA synthesis and normal survival after irradiation with UV. This unique fibroblast strain should be useful in studies designed to elucidate the possible role of postreplication repair in UV-induced carcinogenesis and mutagenesis

  11. Dermal fibroblasts from patients with Parkinson’s disease have normal GCase activity and autophagy compared to patients with PD and GBA mutations [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Lucy M Collins

    2018-02-01

    Full Text Available Background: Recently, the development of Parkinson’s disease (PD has been linked to a number of genetic risk factors, of which the most common is glucocerebrosidase (GBA mutations. Methods: We investigated PD and Gaucher Disease (GD patient derived skin fibroblasts using biochemistry assays. Results: PD patient derived skin fibroblasts have normal glucocerebrosidase (GCase activity, whilst patients with PD and GBA mutations have a selective deficit in GCase enzyme activity and impaired autophagic flux. Conclusions: This data suggests that only PD patients with a GBA mutation have altered GCase activity and autophagy, which may explain their more rapid clinical progression.

  12. 8,12;8,20-diepoxy-8,14-secopregnane glycosides from roots of Asclepias tuberosa and their effect on proliferation of human skin fibroblasts.

    Science.gov (United States)

    Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio; Noro, Tadataka

    2011-10-01

    A pregnane glycoside fraction from the roots of Asclepias tuberosa L. caused normal human skin fibroblasts to proliferate. This fraction contained 21 pregnane glycosides whose structures were established using NMR spectroscopic analysis and chemical evidence. The aglycones of most of these compounds were identified as 8,12;8,20-diepoxy-8,14-secopregnanes, such as tuberogenin or 5,6-didehydrotuberogenin, the same aglycones as constituents of the aerial parts of this plant. Some of these compounds also caused proliferation of skin fibroblasts. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. Cancer associated fibroblasts (CAFs) are activated in cutaneous basal cell carcinoma and in the peritumoural skin

    DEFF Research Database (Denmark)

    Omland, Silje Haukali; Wettergren, Erika Elgstrand; Mollerup, Sarah

    2017-01-01

    of chemokines involved in tumour progression and immunosuppression (CXCL12, CCL17). Fibroblasts from chronically sun-exposed skin near tumours show gene expression patterns resembling that of CAFs, indicating that stromal fibroblasts in cancer-free surgical BCC margins exhibit a tumour promoting phenotype.......BACKGROUND: Cutaneous basal cell carcinoma (BCC) is the commonest cancer worldwide. BCC is locally invasive and the surrounding stromal microenvironment is pivotal for tumourigenesis. Cancer associated fibroblasts (CAFs) in the microenvironment are essential for tumour growth in a variety...... of neoplasms but their role in BCC is poorly understood. METHODS: Material included facial BCC and control skin from the peritumoural area and from the buttocks. With next-generation sequencing (NGS) we compared mRNA expression between BCC and peritumoural skin. qRT-PCR, immunohistochemical...

  14. Cancer associated fibroblasts (CAFs) are activated in cutaneous basal cell carcinoma and in the peritumoural skin

    DEFF Research Database (Denmark)

    Omland, Silje Haukali; Wettergren, Erika Elgstrand; Mourier, Tobias

    2017-01-01

    of chemokines involved in tumour progression and immunosuppression (CXCL12, CCL17). Fibroblasts from chronically sun-exposed skin near tumours show gene expression patterns resembling that of CAFs, indicating that stromal fibroblasts in cancer-free surgical BCC margins exhibit a tumour promoting phenotype.......Background: Cutaneous basal cell carcinoma (BCC) is the commonest cancer worldwide. BCC is locally invasive and the surrounding stromal microenvironment is pivotal for tumourigenesis. Cancer associated fibroblasts (CAFs) in the microenvironment are essential for tumour growth in a variety...... of neoplasms but their role in BCC is poorly understood. Methods: Material included facial BCC and control skin from the peritumoural area and from the buttocks. With next-generation sequencing (NGS) we compared mRNA expression between BCC and peritumoural skin. qRT-PCR, immunohistochemical...

  15. Generation of hiPSTZ16 (ISMMSi003-A cell line from normal human foreskin fibroblasts

    Directory of Open Access Journals (Sweden)

    Marion Dejosez

    2018-01-01

    Full Text Available Human foreskin fibroblasts from a commercial source were reprogrammed into induced pluripotent stem cells to establish a clonal stem cell line, hiPSTZ16 (ISMMSi003-A. These cells show a normal karyotype and full differentiation potential in teratoma assays. The described cells provide a useful resource in combination with other iPS cell lines generated from normal human foreskin fibroblasts to study source- and reprogramming method-independent effects in downstream applications.

  16. The protective effects of fucosterol against skin damage in UVB-irradiated human dermal fibroblasts.

    Science.gov (United States)

    Hwang, Eunson; Park, Sang-Yong; Sun, Zheng-wang; Shin, Heon-Sub; Lee, Don-Gil; Yi, Tae Hoo

    2014-06-01

    Exposure to ultraviolet (UV) light causes matrix metalloproteinase (MMP) overexpression and extracellular matrix depletion, leading to skin photoaging. The activation of MMP is related to increased interlukin-6 (IL-6) and type I procollagen production, which is regulated by transforming growth factor-β1 (TGF-β1). Activator protein-1 (AP-1) activation induces MMP-1 production and reduces type I procollagen secretion. Fucosterol, which is extracted and purified from the brown algae Hizikia fusiformis, is a phytosterol. We assessed the effects of fucosterol on photodamage and investigated its molecular mechanism of action in UVB-irradiated normal human dermal fibroblasts by using enzyme-linked immunosorbent assay, Western blot analysis, and reverse transcription-polymerase chain reaction. Our results showed that fucosterol significantly decreased the UVB-induced expression of MMP-1, IL-6, p-c-Jun, and p-c-Fos. Additionally, fucosterol markedly increased the UVB-induced production of type I procollagen and TGF-β1. Our results indicate that fucosterol regulates MMP-1 and type I procollagen expression by modulating AP-1 and TGF-β1 signaling and that MMP-1 activation is correlated with IL-6. These data suggest that fucosterol is a promising botanical agent to protect against skin photodamage.

  17. Differences in motility pattern between human buccal fibroblasts and periodontal and skin fibroblasts

    DEFF Research Database (Denmark)

    Lepekhin, Eugene; Grøn, Birgitte; Berezin, Vladimir

    2002-01-01

    at these sites can be explained by differences in the motile behavior of their respective fibroblast populations. The migratory characteristics were studied in a two-dimensional culture system. The migration of single cells was time-lapse video recorded at intervals of 15 min for a period of 6 h using a computer...

  18. Adaptive response to ionizing radiation in normal human skin fibroblasts. Enhancement of DNA repair rate and modulation of gene expression. Reponse adaptative au rayonnement ionisant des fibroblastes de peau humaine. Augmentation de la vitesse de reparation de l'ADN et variation de l'expression des genes

    Energy Technology Data Exchange (ETDEWEB)

    Toledo, S.M. de; Mitchel, R.E.J. (Atomic Energy of Canada Ltd., Chalk River, ON (Canada). Chalk River Nuclear Labs.); Azzam, E. (Atomic Energy of Canada Ltd., Chalk River, ON (Canada). Chalk River Nuclear Labs. Ottawa Univ., ON (Canada). Dept. of Biology); Raaphorst, G.P. (Ottawa Univ., ON (Canada). Dept. of Biology)

    Low doses and dose rates of ionizing radiation enhance the rate of DNA repair in human fibroblasts and protect the cells against radiation-induced micronucleus formation. Chronic exposures reduce the mRNA levels of the genes topoisomerase II and FACC-1 (Fanconi's anemia, group C). (authors). 11 refs., 1 tab., 2 figs.

  19. Molecular alterations of tropoelastin and proteoglycans induced by tobacco smoke extracts and ultraviolet A in cultured skin fibroblasts

    International Nuclear Information System (INIS)

    Yin, Lei; Morita, Akimichi; Tsuji, Takuo

    2002-01-01

    Functional integrity of normal skin is dependent on the balance between the biosynthesis and degradation of extracellular matrix, primarily composed of collagen, elastin and proteoglycans. In our previous studies, we found that tobacco smoke extracts decreased expressions of type I and III procollagen and induced matrix metalloproteinase-1 (MMP-1) and MMP-3 in the cultured skin fibroblasts. We here further investigated the effects of tobacco smoke extracts or ultraviolet A (UVA) treatments on the expression of tropoelastin (soluble elastin protein), and versican and decorin (proteoglycans) in cultured skin fibroblasts. The mRNA of tropoelastin increased by tobacco smoke extracts or UVA irradiation. Versican was markedly shown to decrease after these treatments by using western blotting and the mRNA of versican V0 also significantly decreased. UVA treatment did not show remarkable change in decorin protein, but resulted in marked decrease of decorin D1 mRNA. In contrast to UVA irradiation, the treatments of tobacco smoke extracts resulted in significant increase in decorin, while mRNA of decorin D1 decreased as compared to the control. MMP-7 increased after the treatment of tobacco smoke extracts or UVA. These results indicated that common molecular features might underlie the skin premature aging induced by tobacco smoke extracts and UVA, including abnormal regulation of extracellular matrix deposition through elevated MMPs, reduced collagen production, abnormal tropoelastin accumulation, and altered proteoglycans. (author)

  20. Molecular alterations of tropoelastin and proteoglycans induced by tobacco smoke extracts and ultraviolet A in cultured skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Lei; Morita, Akimichi; Tsuji, Takuo [Nagoya City Univ. (Japan). Medical School

    2002-02-01

    Functional integrity of normal skin is dependent on the balance between the biosynthesis and degradation of extracellular matrix, primarily composed of collagen, elastin and proteoglycans. In our previous studies, we found that tobacco smoke extracts decreased expressions of type I and III procollagen and induced matrix metalloproteinase-1 (MMP-1) and MMP-3 in the cultured skin fibroblasts. We here further investigated the effects of tobacco smoke extracts or ultraviolet A (UVA) treatments on the expression of tropoelastin (soluble elastin protein), and versican and decorin (proteoglycans) in cultured skin fibroblasts. The mRNA of tropoelastin increased by tobacco smoke extracts or UVA irradiation. Versican was markedly shown to decrease after these treatments by using western blotting and the mRNA of versican V0 also significantly decreased. UVA treatment did not show remarkable change in decorin protein, but resulted in marked decrease of decorin D1 mRNA. In contrast to UVA irradiation, the treatments of tobacco smoke extracts resulted in significant increase in decorin, while mRNA of decorin D1 decreased as compared to the control. MMP-7 increased after the treatment of tobacco smoke extracts or UVA. These results indicated that common molecular features might underlie the skin premature aging induced by tobacco smoke extracts and UVA, including abnormal regulation of extracellular matrix deposition through elevated MMPs, reduced collagen production, abnormal tropoelastin accumulation, and altered proteoglycans. (author)

  1. Royal jelly protects against ultraviolet B-induced photoaging in human skin fibroblasts via enhancing collagen production.

    Science.gov (United States)

    Park, Hye Min; Hwang, Eunson; Lee, Kwang Gill; Han, Sang-Mi; Cho, Yunhi; Kim, Sun Yeou

    2011-09-01

    Royal jelly (RJ) is a honeybee product containing proteins, carbohydrates, fats, free amino acids, vitamins, and minerals. As its principal unsaturated fatty acid, RJ contains 10-hydroxy-2-decenoic acid (10-HDA), which may have antitumor and antibacterial activity and a capacity to stimulate collagen production. RJ has attracted interest in various parts of the world for its pharmacological properties. However, the effects of RJ on ultraviolet (UV)-induced photoaging of the skin have not been reported. In this study we measured the 10-HDA content of RJ by high-performance liquid chromatography and tested the effects of RJ on UVB-induced skin photoaging in normal human dermal fibroblasts. The effects of RJ and 10-HDA on UVB-induced photoaging were tested by measuring procollagen type I, transforming growth factor (TGF)-β1, and matrix metalloproteinase (MMP)-1 after UVB irradiation. The RJ contained about 0.211% 10-HDA. The UVB-irradiated human skin fibroblasts treated with RJ and 10-HDA had increased procollagen type I and TGF-β1 productions, but the level of MMP-1 was not changed. Thus RJ may potentially protect the skin from UVB-induced photoaging by enhancing collagen production.

  2. DNA-repair after UV-irradiation in skin fibroblasts from patients with actinic keratosis

    International Nuclear Information System (INIS)

    Sbano, E.; Andreassi, L.; Fimiani, M.; Valentino, A.; Baiocchi, R.

    1978-01-01

    Autoradiographic counting technique was utilized to measure the ultraviolet-induced unscheduled DNA synthesis of skin fibroblasts from 12 patients with chronic actinic keratosis and from 12 healthy donors of about the same age. In order to reveal a possible regional difference of DNA repair between the parts of the body ordinarily exposed and those parts unexposed to sunlight, two cell strains were used for each examined subject; one developed from the forehead skin and the other from the abdominal or axillary skin. Unscheduled DNA synthesis appeared depressed in actinic keratosis patients, as compared with controls. In all examined subjects, however, cell strains from exposed skin showed a DNA repair more active than cell strains from unexposed skin. These findings show that skin cancer may be promoted in actinic keratosis patients by a defect of DNA repair. The exalted DNA repair of chronically sun exposed skin is probably the consequence of a defensive process caused by enzymatic induction. (orig.) [de

  3. PAI1 mediates fibroblast-mast cell interactions in skin fibrosis.

    Science.gov (United States)

    Pincha, Neha; Hajam, Edries Yousaf; Badarinath, Krithika; Batta, Surya Prakash Rao; Masudi, Tafheem; Dey, Rakesh; Andreasen, Peter; Kawakami, Toshiaki; Samuel, Rekha; George, Renu; Danda, Debashish; Jacob, Paul Mazhuvanchary; Jamora, Colin

    2018-05-01

    Fibrosis is a prevalent pathological condition arising from the chronic activation of fibroblasts. This activation results from the extensive intercellular crosstalk mediated by both soluble factors and direct cell-cell connections. Prominent among these are the interactions of fibroblasts with immune cells, in which the fibroblast-mast cell connection, although acknowledged, is relatively unexplored. We have used a Tg mouse model of skin fibrosis, based on expression of the transcription factor Snail in the epidermis, to probe the mechanisms regulating mast cell activity and the contribution of these cells to this pathology. We have discovered that Snail-expressing keratinocytes secrete plasminogen activator inhibitor type 1 (PAI1), which functions as a chemotactic factor to increase mast cell infiltration into the skin. Moreover, we have determined that PAI1 upregulates intercellular adhesion molecule type 1 (ICAM1) expression on dermal fibroblasts, rendering them competent to bind to mast cells. This heterotypic cell-cell adhesion, also observed in the skin fibrotic disorder scleroderma, culminates in the reciprocal activation of both mast cells and fibroblasts, leading to the cascade of events that promote fibrogenesis. Thus, we have identified roles for PAI1 in the multifactorial program of fibrogenesis that expand its functional repertoire beyond its canonical role in plasmin-dependent processes.

  4. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  5. Diffuse colonies of human skin fibroblasts in relation to cellular senescence and proliferation.

    Science.gov (United States)

    Zorin, Vadim; Zorina, Alla; Smetanina, Nadezhda; Kopnin, Pavel; Ozerov, Ivan V; Leonov, Sergey; Isaev, Artur; Klokov, Dmitry; Osipov, Andreyan N

    2017-05-16

    Development of personalized skin treatment in medicine and skin care may benefit from simple and accurate evaluation of the fraction of senescent skin fibroblasts that lost their proliferative capacity. We examined whether enriched analysis of colonies formed by primary human skin fibroblasts, a simple and widely available cellular assay, could reveal correlations with the fraction of senescent cells in heterogenic cell population. We measured fractions of senescence associated β-galactosidase (SA-βgal) positive cells in either mass cultures or colonies of various morphological types (dense, mixed and diffuse) formed by skin fibroblasts from 10 human donors. Although the donors were chosen to be within the same age group (33-54 years), the colony forming efficiency of their fibroblasts (ECO-f) and the percentage of dense, mixed and diffuse colonies varied greatly among the donors. We showed, for the first time, that the SA-βgal positive fraction was the largest in diffuse colonies, confirming that they originated from cells with the least proliferative capacity. The percentage of diffuse colonies was also found to correlate with the SA-βgal positive cells in mass culture. Using Ki67 as a cell proliferation marker, we further demonstrated a strong inverse correlation (r=-0.85, p=0.02) between the percentage of diffuse colonies and the fraction of Ki67+ cells. Moreover, a significant inverse correlation (r=-0.94, p=0.0001) between the percentage of diffuse colonies and ECO-f was found. Our data indicate that quantification of a fraction of diffuse colonies may provide a simple and useful method to evaluate the extent of cellular senescence in human skin fibroblasts.

  6. Effect of low-power red light laser irradiation on the viability of human skin fibroblast

    Energy Technology Data Exchange (ETDEWEB)

    Bednarska, K.; Rozga, B.; Leyko, W.; Bryszewska, M. [Institute of Biophysics, University of Lodz (Poland); Kolodziejczyk, K.; Szosland, D. [Diabetological Clinic, Medical Academy of Lodz (Poland)

    1998-10-01

    Human skin fibroblast monolayers (S-126 cell line) were exposed to laser radiation (wavelength 670 nm, power density 40 mW/cm{sup 2}). The energy densities were 2 J/cm{sup 2} and 12 J/cm{sup 2}, respectively, and the irradiation was carried out at a temperature of 22 C. For fibroblast viability evaluation, the colorimetric assay (conversion of thiazolyl blue to formazan) was used. The experiments were carried out at 37 C, in the presence of 5% CO{sub 2}, and at different time periods of incubation after irradiation (2, 4, 8 h and 1, 2, 3, 4, 5 days). The results indicated that there was a certain stimulating effect on the long-term proliferation of skin fibroblasts and that the stimulation proceeded in two stages, the first one 2 h and the second one 3 days post-irradiation. (orig.) With 4 figs., 2 tabs., 13 refs.

  7. Effect of mixed-sulfonated aluminium phthalocyanine on human skin fibroblasts for photodynamic therapy

    CSIR Research Space (South Africa)

    Ndhundhuma, IM

    2008-08-01

    Full Text Available of the study was to evaluate the effect of mixed-sulfonated aluminium phthalocyanine (AlPcSmix) used as photosensitizers for PDT, determined by changes in cell morphology and cell viability of human skin fibroblasts (WS1). Methods. Cells incubated with 5, 10...

  8. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  9. Isolation and culture of primary adult skin fibroblasts from the Asian elephant (Elephas maximus

    Directory of Open Access Journals (Sweden)

    Puntita Siengdee

    2018-01-01

    Full Text Available Background Primary cultures from Asian elephants (Elephas maximus allow scientists to obtain representative cells that have conserved most of their original characteristics, function, physiology and biochemistry. This technique has thus gained significant importance as a foundation for further cellular, cell biology and molecular research. Therefore, the aim of this study was to describe conditions for the successful establishment of primary adult fibroblasts from Asian elephant carcasses. Methods Ear tissue sample collection from Asian elephant carcasses and our recommendations are given. We describe here a simple modified protocol for successful isolation and maintenance of primary adult fibroblasts from elephant ear skin. Ear samples from each individual (five 3 × 3 cm2 pieces were brought to the laboratory within 3 h after collection, kept in transportation medium at 0–4 °C. The ear tissues were prepared by a combination of 10% collagenase type II digestion procedure together with a simple explant procedure. Primary fibroblasts were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM with 20% fetal calf serum (FCS in a humidified atmosphere containing 5% CO2. After the third passage, fibroblasts were routinely trypsinized with 0.25% trypsin/EDTA and cultured in DMEM with 10% FCS at 37 °C and 5% CO2. Traditional cell counting method was used to measure cell viability and growth curve. Long-term storage of cells used freezing medium consisting of 40% FCS (v/v. Results We explored the most suitable conditions during sample collection (post-mortem storage time and sample storage temperature, which is the most important step in determining primary outgrowth. Our study successfully established and cultured primary adult skin fibroblasts obtained from post-mortem E. maximus ear skin tissues from six carcasses, with a success rate of around 83.3%. Outgrowth could be seen 4–12 days after explantation, and epithelial

  10. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  11. Epilobium angustifolium extract demonstrates multiple effects on dermal fibroblasts in vitro and skin photo-protection in vivo.

    Science.gov (United States)

    Ruszová, Ema; Cheel, José; Pávek, Stanislav; Moravcová, Martina; Hermannová, Martina; Matějková, Ilona; Spilková, Jiřina; Velebný, Vladimír; Kubala, Lukáš

    2013-09-01

    Stress-induced fibroblast senescence is thought to contribute to skin aging. Ultraviolet light (UV) radiation is the most potent environmental risk factor in these processes. An Epilobium angustifolium (EA) extract was evaluated for its capacity to reverse the senescent response of normal human dermal fibroblasts (NHDF) in vitro and to exhibit skin photo-protection in vivo. The HPLC-UV-MS analysis of the EA preparation identified three major polyphenol groups: tannins (oenothein B), phenolic acids (gallic and chlorogenic acids) and flavonoids. EA extract increased the cell viability of senescent NHDF induced by serum deprivation. It diminished connective tissue growth factor and fibronectin gene expressions in senescent NHDF. Down-regulation of the UV-induced release of both matrix metalloproteinase-1 and -3 and the tissue inhibitor of matrix metalloproteinases-1 and -2, and also down-regulation of the gene expression of hyaluronidase 2 were observed in repeatedly UV-irradiated NHDF after EA extract treatment. Interestingly, EA extract diminished the down-regulation of sirtuin 1 dampened by UV-irradiation. The application of EA extract using a sub-irritating dose protected skin against UV-induced erythema formation in vivo. In summary, EA extract diminished stress-induced effects on NHDF, particularly on connective tissue growth factor, fibronectin and matrix metalloproteinases. These results collectively suggest that EA extract may possess anti-aging properties and that the EA polyphenols might account for these benefits.

  12. Fibroblastic rheumatism

    Directory of Open Access Journals (Sweden)

    Jyoti Ranjan Parida

    2017-01-01

    Full Text Available Fibroblastic rheumatism (FR is a rare dermoarthopathy reported from different parts of the world since 1980. Although the exact cause is unknown, few reports implicate infection may be a triggering event. Patients usually present with multiple skin nodules and polyarthropathy with progressive skin contractures. Laboratory parameters including acute phase reactants are usually normal. The confirmatory diagnosis is based on histopathologic study of skin nodules, which demonstrate fibroblastic proliferation, thickened collagen fibers, dermal fibrosis, and decreased number of elastic fibers. Immunoreactivity for b-catenin, smooth muscle actin, and the monoclonal antibody HHF35 show myofibroblastic differentiation. Treatments with oral prednisolone and other disease-modifying drugs such as methotrexate, infliximab, and interferon have been tried with variable success. In general, skin lesions respond more aptly than joint symptoms indicating that skin fibroblast is more amenable to treatment than synovial fibroblasts. Awareness regarding this orphan disease among clinicians and pathologists will help in more reporting of such cases and finding out optimal treatment regimen.

  13. Heterogeneous response to X-ray and ultraviolet light irradiations of cultured skin fibroblasts in two families with Gardner's Syndrome

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Little, J.B.; Nove, J.; Weichselbaum, R.R.; Li, F.P.; Meyer, R.J.; Marchetto, D.J.; Patterson, W.B.

    1982-01-01

    A heterogeneous response to X-ray and far UV (254 nm) light irradiations was found in cultured skin fibroblast lines from 2 separate families with Gardner's syndrome. When compared to 2 normal control cultures and cultures from 2 patients with nonfamilial colon cancer, cultures from 4 clinically affected members of family 1 showed increased sensitivity to the lethal effects of both X-ray and UV light irradiations. These cells also showed a delayed pattern of X-ray potentially lethal damage repair (PLDR) and absent UV PLDR. In contrast, cultures from 3 members of family 2 (2 of whom were clinically affected) showed a normal response of survival and PLDR to both X-ray and UV light irradiations. Thus increased sensitivity of cultured skin fibroblasts to X-ray and UV light irradiations was not a consistent in vitro finding in patients with Gardner's syndrome. However, in families with Gardner's syndrome who demonstrate in vitro radiosensitivity, additional studies are needed to assess the usefulness of these techniques in detecting affected individuals prior to the development of colon carcinoma and other manifestations

  14. Selective enrichment and biochemical characterization of seven human skin fibroblasts cell types in vitro

    International Nuclear Information System (INIS)

    Rodemann, H.P.; Bayreuther, K.; Francz, P.I.; Dittmann, K.; Albiez, M.

    1989-01-01

    The mitotic and postmitotic populations of the human skin fibroblast cell line HH-8 are heterogeneous when studied in vitro. There are reproducible changes in the frequencies of the mitotic fibroblasts (MF), MF I, MF II, MF III, and the postmitotic fibroblasts (PMF), PMF IV, PMF V, PMF VI, and PMF VII. For biochemical characterization, methods for selective enrichment of homogeneous populations of these seven fibroblast cell types have been established. Clonal populations with 95% purity for the mitotic fibroblasts MF I, MF II, and MF III can be raised in uniform clone types of fibroblasts (CTF) CTF I, CTF II, and CTF III. Pure clonal subpopulations of MF I type cells are present in mass populations in the range of 1-20 cumulative population doublings (CPD). Populations of mitotic fibroblasts represent nearly homogeneous populations of MF II (75-85% purity) in the range of 28-34 CPD and MF III (73-86% purity) in the range of 48-53 CPD. These populations can be easily expanded to up to 10(7)-10(8) cells. The spontaneous transition of MF III to PMF VI takes 140-180 days. In order to shorten this period and increase the proportion of distinct postmitotic types, mitotic fibroblast mass populations (CPD 30-32, MF II: 75-85% purity) have been induced by uv-irradiation to differentiate to nearly homogeneous populations of PMF IV, PMF V, PMF VI, and PMF VII within 4 to 36 days of culture. Using this method, 10(7) cells of one differentiation stage can be obtained. Spontaneously arising and experimentally selected or induced homogeneous clonal and mass populations of MF I, MF II, MF III, PMF IV, PMF V, PMF VI, and PMF VII express an identical differentiation-dependent and cell-type-specific [35S]methionine-labeled polypeptide pattern

  15. Differences in [14C]glycerol utilization in normal and familial hypercholesterolemic fibroblasts

    International Nuclear Information System (INIS)

    Shireman, R.B.; Durieux, J.

    1991-01-01

    It is known that cultured fibroblasts from familial hypercholesterolemia (FH) patients lack the normal cell receptor for low density lipoprotein (LDL) and that the absence of receptor-mediated transport of LDL cholesterol into these cells results in increased cellular synthesis of cholesterol. After 20 h perincubation in lipid-free medium, cultured FH fibroblasts incorporated significantly greater amounts of [ 14 C]glycerol into cellular lipids than did normal fibroblasts. Relative to the control medium which contained only bovine serum albumin (BSA), preincubation with 5% fetal bovine serum or 50 micrograms LDL/ml decreased [ 14 C]glycerol incorporation by both cell types. FH cells utilized more [ 14 C]glycerol for phospholipid synthesis and less for triglyceride synthesis than normal cells. This study indicates that LDL may be important in the transport of glycerides, as well as cholesterol, to cells

  16. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  17. Telomere erosion varies during in vitro aging of normal human fibroblasts from young and adult donors.

    Science.gov (United States)

    Figueroa, R; Lindenmaier, H; Hergenhahn, M; Nielsen, K V; Boukamp, P

    2000-06-01

    The life span of normal fibroblasts in vitro (Hayflick limit) depends on donor age, and telomere shortening has been proposed as a potential mechanism. By quantitative fluorescence in situ hybridization and Southern blot analysis, we show progressive telomere loss to about 5 kb mean telomere restriction fragment length in fibroblasts from two adult donors within 40 population doublings, whereas in fibroblasts from two infant donors, telomere erosion is reduced, leaving a mean telomere restriction fragment length of approximately 7 kb at senescence (after approximately 60 population doublings). Aging of fibroblasts from both infant and adult donors was not accompanied by chromosomal abnormalities but was correlated with increased telomere repeat-binding factor 2 expression at both the protein and transcriptional level.

  18. Normal rejoining of DNA strand breaks in ataxia telangiectasia fibroblast lines after low x-ray exposure

    International Nuclear Information System (INIS)

    Hariharan, P.V.; Eleczko, S.; Smith, B.P.; Paterson, M.C.

    1981-01-01

    The alkaline elution method was used to measure the enzymatic repair of x-ray-induced DNA strand breaks in skin fibroblasts derived from human subjects afflicted with ataxia telangiectasia (AT). Monolayer cultures of normal control and AT cell lines were exposed acutely to moderately lethal (250-rad) and highly lethal (1250-rad) doses of 250-kV x rays under aerobic conditions. Upon receiving 250 rad, the control fibroblasts from a clinically normal donor rejoined all detectable single-strand breaks (plus alkali-labile bonds) within 30 to 60 min of incubation. When challenged with 1250 rad the kinetics of strand rejoining by the normal control cells were biphasic. For both exposures, no significant difference in either the rate or the extent of strand rejoining was detected between the normal cell line (GM38) and three mutant cell lines (AT2BE, AT3BI, AT4BI) belonging to the three known genetic complementation groups in AT. It would thus appear that the enhanced radiosensitivity of cultured AT cells does not stem from faulty rejoining of radiogenic DNA strand breaks

  19. Central Role for Dermal Fibroblasts in Skin Model Protection against Candida albicans.

    Science.gov (United States)

    Kühbacher, Andreas; Henkel, Helena; Stevens, Philip; Grumaz, Christian; Finkelmeier, Doris; Burger-Kentischer, Anke; Sohn, Kai; Rupp, Steffen

    2017-06-01

    The fungal pathogen Candida albicans colonizes basically all human epithelial surfaces, including the skin. Under certain conditions, such as immunosuppression, invasion of the epithelia occurs. Not much is known about defense mechanisms against C. albicans in subepithelial layers such as the dermis. Using immune cell-supplemented 3D skin models we defined a new role for fibroblasts in the dermis and identified a minimal set of cell types for skin protection against C. albicans invasion. Dual RNA sequencing of individual host cell populations and C. albicans revealed that dermal invasion is directly impeded by dermal fibroblasts. They are able to integrate signals from the pathogen and CD4+ T cells and shift toward an antimicrobial phenotype with broad specificity that is dependent on Toll-like receptor 2 and interleukin 1β. These results highlight a central function of dermal fibroblasts for skin protection, opening new possibilities for treatment of infectious diseases. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  20. TGF-beta-induced early gene-1 overexpression promotes oxidative stress protection and actin cytoskeleton rearrangement in human skin fibroblasts.

    Science.gov (United States)

    Leduc, Chloe; Sobilo, Lauren; Toumi, Hechmi; Mondon, Philippe; Lespessailles, Eric; Ossant, Fédéric; Kurfurst, Robin; Pichon, Chantal

    2016-06-01

    Transforming growth factor beta inducible early gene-1 (TIEG-1), a member of the Krüppel-like factor, was identified as a primary response gene for TGF-β. The role of TIEG-1 in skin repair has been mainly addressed in vivo on TIEG-1 null mice model and the mechanism remains unexplored. We investigated the modulation of TIEG-1 expression in normal human skin fibroblasts by either down-expressing or overexpressing the gene. We evaluated reactive oxygen species production and the cell viability of treated cells. The effect of TIEG-1 overexpression was monitored by wound healing assay and immunofluorescence staining of actin fibers organization and alpha-smooth muscle actin (α-SMA). Western blots were carried out to identify the level of expression or phosphorylation of key proteins such as cofilin, Rho GTPases, and p38 mitogen-activated protein kinase (p38 MAPK). TIEG-1 down-regulation had a deleterious effect on the cell viability. It was significantly reduced (65±5%) and exposure to ultraviolet further increased this effect (47±3%). By contrast, cells overexpressing TIEG-1 had a reduced reactive oxygen species production (75%) compared to control and mock-transfected cells. This overexpression also resulted in formation of actin stress fibers and increased α-SMA expression and an enhanced wound healing feature. RhoB GTPase was upregulated and phosphorylation of cofilin and p38 MAPK was observed. TIEG-1 overexpression in normal human skin fibroblasts results in improved resistance to oxidative stress, myofibroblast-like conversion that involved RhoB signaling pathway with cofilin and p38 MAPK proteins activation. This study enlightens the role of TIEG-1 role in skin biology. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Cancer associated fibroblasts (CAFs) are activated in cutaneous basal cell carcinoma and in the peritumoural skin.

    Science.gov (United States)

    Omland, Silje Haukali; Wettergren, Erika Elgstrand; Mollerup, Sarah; Asplund, Maria; Mourier, Tobias; Hansen, Anders Johannes; Gniadecki, Robert

    2017-10-07

    Cutaneous basal cell carcinoma (BCC) is the commonest cancer worldwide. BCC is locally invasive and the surrounding stromal microenvironment is pivotal for tumourigenesis. Cancer associated fibroblasts (CAFs) in the microenvironment are essential for tumour growth in a variety of neoplasms but their role in BCC is poorly understood. Material included facial BCC and control skin from the peritumoural area and from the buttocks. With next-generation sequencing (NGS) we compared mRNA expression between BCC and peritumoural skin. qRT-PCR, immunohistochemical and immunofluorescent staining were performed to validate the NGS results and to investigate CAF-related cyto-and chemokines. NGS revealed upregulation of 65 genes in BCC coding for extracellular matrix components pointing at CAF-related matrix remodeling. qRT-PCR showed increased mRNA expression of CAF markers FAP-α, PDGFR-β and prolyl-4-hydroxylase in BCC. Peritumoural skin (but not buttock skin) also exhibited high expression of PDGFR-β and prolyl-4-hydroxylase but not FAP-α. We found a similar pattern for the CAF-associated chemokines CCL17, CCL18, CCL22, CCL25, CXCL12 and IL6 with high expression in BCC and peritumoural skin but absence in buttock skin. Immunofluorescence revealed correlation between FAP-α and PDGFR-β and CXCL12 and CCL17. Matrix remodeling is the most prominent molecular feature of BCC. CAFs are present within BCC stroma and associated with increased expression of chemokines involved in tumour progression and immunosuppression (CXCL12, CCL17). Fibroblasts from chronically sun-exposed skin near tumours show gene expression patterns resembling that of CAFs, indicating that stromal fibroblasts in cancer-free surgical BCC margins exhibit a tumour promoting phenotype.

  2. Development and validation of a skin fibroblast biomarker profile for schizophrenic patients

    Directory of Open Access Journals (Sweden)

    Marianthi Logotheti

    2016-12-01

    Full Text Available Gene expression profiles of non-neural tissues through microarray technology could be used in schizophrenia studies, adding more information to the results from similar studies on postmortem brain tissue. The ultimate goal of such studies is to develop accessible biomarkers. Supervised machine learning methodologies were used, in order to examine if the gene expression from skin fibroblast cells could be exploited for the classification of schizophrenic subjects. A dataset of skin fibroblasts gene expression of schizophrenia patients was obtained from Gene Expression Omnibus database. After applying statistical criteria, we concluded to genes that present a differential expression between the schizophrenic patients and the healthy controls. Based on those genes, functional profiling was performed with the BioInfoMiner web tool. After the statistical analysis, 63 genes were identified as differentially expressed. The functional profiling revealed interesting terms and pathways, such as mitogen activated protein kinase and cyclic adenosine monophosphate signaling pathways, as well as immune-related mechanisms. A subset of 16 differentially expressed genes from fibroblast gene expression profiling that occurred after Support Vector Machines Recursive Feature Elimination could efficiently separate schizophrenic from healthy controls subjects. These findings suggest that through the analysis of fibroblast based gene expression signature and with the application of machine learning methodologies we might conclude to a diagnostic classification model in schizophrenia.

  3. Assembly of fibronectin into the extracellular matrix of early and late passage human skin fibroblasts

    International Nuclear Information System (INIS)

    Mann, D.M.

    1987-01-01

    The specific binding of soluble 125 I-human plasma fibronectin ( 125 I-HFN-P) to confluent cultures of early and late passage human skin fibroblasts was investigated. Previous studies HFN-P bound to fibroblast cell layers indicated that HNF-P was present in the cultures in two separate pools, distinguishable on the basis of their solubility in 1% deoxycholate. Examination of the kinetics of 125 I-HFN-P binding to Pool I of early and late passage cultures revealed that both cultures required 2-4 h to approach steady-state conditions. Other kinetic studies showed that the rates of low of 125 I-HFN-P from either Pool I or Pool II were similar for both cultures. Further, Scatchard analysis revealed a single class of Pool I binding sites with apparent dissociation constants (K/sub d/) of 5.3 x 10 -8 M (early passage) and 4.2 x 10 -8 M (late passage). These results indicate that early and late passage cultures of human fibroblasts exhibit differences in the number of cell surface biding sites for soluble fibronectin, and in the extent to which they incorporate soluble fibronectin into the extracellular matrix. Parameters which affect the fibronectin matrix assembly system of human skin fibroblasts were also examined. In addition, several monoclonal anti-fibronectin antibodies were characterized and developed as experimental probes for fibronectin structure and function

  4. Phenotypic differences between oral and skin fibroblasts in wound contraction and growth factor expression.

    Science.gov (United States)

    Shannon, Diane B; McKeown, Scott T W; Lundy, Fionnuala T; Irwin, Chris R

    2006-01-01

    Wounds of the oral mucosa heal in an accelerated fashion with reduced scarring compared with cutaneous wounds. The differences in healing outcome between oral mucosa and skin could be because of phenotypic differences between the respective fibroblast populations. This study compared paired mucosal and dermal fibroblasts in terms of collagen gel contraction, alpha-smooth muscle actin expression (alpha-SMA), and production of the epithelial growth factors: keratinocyte growth factor (KGF) and hepatocyte growth factor/scatter factor (HGF). The effects of transforming growth factor -beta1 and -beta3 on each parameter were also determined. Gel contraction in floating collagen lattices was determined over a 7-day period. alpha-SMA expression by fibroblasts was determined by Western blotting. KGF and HGF expression were determined by an enzyme-linked immunosorbent assay. Oral fibroblasts induced accelerated collagen gel contraction, yet surprisingly expressed lower levels of alpha-SMA. Oral cells also produced significantly greater levels of both KGF and HGF than their dermal counterparts. Transforming growth factor-beta1 and -beta3, over the concentration range of 0.1-10 ng/mL, had similar effects on cell function, stimulating both gel contraction and alpha-SMA production, but inhibiting KGF and HGF production by both cell types. These data indicate phenotypic differences between oral and dermal fibroblasts that may well contribute to the differences in healing outcome between these two tissues.

  5. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  6. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  7. Wound healing morbidity in STS patients treated with preoperative radiotherapy in relation to in vitro skin fibroblast radiosensitivity, proliferative capacity and TGF-β activity

    International Nuclear Information System (INIS)

    Akudugu, John M.; Bell, Robert S.; Catton, Charles; Davis, Aileen M.; Griffin, Anthony M.; O'Sullivan, Brian; Waldron, John N.; Ferguson, Peter C.; Wunder, Jay S.; Hill, Richard P.

    2006-01-01

    Background and purpose: In a recent study, we demonstrated that the ability of dermal fibroblasts, obtained from soft tissue sarcoma (STS) patients, to undergo initial division in vitro following radiation exposure correlated with the development of wound healing morbidity in the patients following their treatment with preoperative radiotherapy. Transforming growth factor beta (TGF-β) is thought to play an important role in fibroblast proliferation and radiosensitivity both of which may impact on wound healing. Thus, in this study we examined the interrelationship between TGF-β activity, radiosensitivity and proliferation of cultured fibroblasts and the wound healing response of STS patients after preoperative radiotherapy to provide a validation cohort for our previous study and to investigate mechanisms. Patients and methods: Skin fibroblasts were established from skin biopsies of 46 STS patients. The treatment group consisted of 28 patients who received preoperative radiotherapy. Eighteen patients constituted a control group who were either irradiated postoperatively or did not receive radiation treatment. Fibroblast cultures were subjected to the colony forming and cytokinesis-blocked binucleation assays (low dose rate: ∼0.02 Gy/min) and TGF-β assays (high dose-rate: ∼1.06 Gy/min) following γ-irradiation. Fibroblast radiosensitivity and initial proliferative ability were represented by the surviving fraction at 2.4 Gy (SF 2.4 ) and binucleation index (BNI), respectively. Active and total TGF-β levels in fibroblast cultures were determined using a biological assay. Wound healing complication (WHC), defined as the requirement for further surgery or prolonged deep wound packing, was the clinical endpoint examined. Results: Of the 28 patients treated with preoperative radiotherapy, 8 (29%) had wound healing difficulties. Fibroblasts from patients who developed WHC showed a trend to retain a significantly higher initial proliferative ability after

  8. X ray sensitivity of diploid skin fibroblasts from patients with Fanconi's anemia

    Science.gov (United States)

    Kale, Ranjini

    1989-01-01

    Experiments were performed on Fanconi's anemia and normal human fibroblast cell lines growing in culture in an attempt to correlate cell cycle kinetics with genomic damage and determine their bearing on the mechanism of chromosome aberration induction. FA fibroblasts showed a significantly increased susceptibility to chromosomal breakage by x rays in the G2 phase of the cell cycle. No such response was observed in fibroblasts irradiated in the G0 phase. The observed increases in achromatic lesions and in chromatid deletions in FA cells as compared with normal cells appear to indicate that FA cells are deficient in strand break repair and also possibly in base damage excision repair. Experiments are now in progress to further elucidate the mechanisms involved.

  9. The Impact of Environmental and Endogenous Damage on Somatic Mutation Load in Human Skin Fibroblasts.

    Directory of Open Access Journals (Sweden)

    Natalie Saini

    2016-10-01

    Full Text Available Accumulation of somatic changes, due to environmental and endogenous lesions, in the human genome is associated with aging and cancer. Understanding the impacts of these processes on mutagenesis is fundamental to understanding the etiology, and improving the prognosis and prevention of cancers and other genetic diseases. Previous methods relying on either the generation of induced pluripotent stem cells, or sequencing of single-cell genomes were inherently error-prone and did not allow independent validation of the mutations. In the current study we eliminated these potential sources of error by high coverage genome sequencing of single-cell derived clonal fibroblast lineages, obtained after minimal propagation in culture, prepared from skin biopsies of two healthy adult humans. We report here accurate measurement of genome-wide magnitude and spectra of mutations accrued in skin fibroblasts of healthy adult humans. We found that every cell contains at least one chromosomal rearrangement and 600–13,000 base substitutions. The spectra and correlation of base substitutions with epigenomic features resemble many cancers. Moreover, because biopsies were taken from body parts differing by sun exposure, we can delineate the precise contributions of environmental and endogenous factors to the accrual of genetic changes within the same individual. We show here that UV-induced and endogenous DNA damage can have a comparable impact on the somatic mutation loads in skin fibroblasts. Trial Registration: ClinicalTrials.gov NCT01087307.

  10. Radioprotective effect of c-ski on rat skin fibroblast in vitro

    International Nuclear Information System (INIS)

    Liu Xia; Li Ping; Zhang En; Liu Ping; Zhou Ping; Zhou Yuanguo

    2006-01-01

    Objective: To examine radioprotective effect of c-ski on rat skin fibroblast in vitro and explore its possible mechanism. Methods: The effect of soft X-ray irradiation at dose varied from 2 to 8 Gy on cell apoptosis in rat skin fibroblast were determined by flow cytometry with Annexin-V-FITC-PI labelling. The effect of c-ski gene transfection on cell apoptosis was evaluated after soft X-ray irradiation of 4 Gy. The protein expressions of Bax and Bcl-2 after c-ski gene transfection were measured with the Western blot method. Results: Soft X-ray irradiation increases cell apoptosis, and the increase is proportional to the irradiation dose. Apoptosis ratio increases with time since the irradiation, and reaches its peak at 36h after the irradiation, c-ski gene was observed to markedly decrease apoptosis index at 24 h after soft X-ray irradiation of 4 Gy compared to the control group, significant increase of the protein expression of Bcl-2 was observed. C-ski gene was found no significant effect on the protein expression of Bax. Conclusion: c-ski gene can decrease radiation sensitivity of skin fibroblast, promoting Bcl-2 protein expression is one of its possible mechanism for this radioprotective effects. (authors)

  11. Inhibition of hydrogen peroxide induced injuring on human skin fibroblast by Ulva prolifera polysaccharide.

    Science.gov (United States)

    Cai, Chuner; Guo, Ziye; Yang, Yayun; Geng, Zhonglei; Tang, Langlang; Zhao, Minglin; Qiu, Yuyan; Chen, Yifan; He, Peimin

    2016-10-01

    Ulva prolifera can protect human skin fibroblast from being injured by hydrogen peroxide. This work studied the composition of Ulva prolifera polysaccharide and identified its physicochemical properties. The results showed that the cell proliferation of 0.5mg/mL crude polysaccharide was 154.4% of that in negative control group. Moreover, ROS detection indices, including DCFH-DA, GSH-PX, MDA and CAT, indicated that crude polysaccharide could improve cellular ability to scavenge free radical and decrease the injury on human skin fibroblast by hydrogen peroxide. In purified polysaccharide, the activity of fraction P1-1 was the highest, with 174.6% of that in negative control group. The average molecular weight of P1-1 was 137kD with 18.0% of sulfate content. This work showed the inhibition of hydrogen peroxide induced injuries on human skin fibroblast by Ulva prolifera polysaccharide, which may further evaluate the application of U. prolifera on cosmetics. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Transformation of human mesenchymal cells and skin fibroblasts into hematopoietic cells.

    Directory of Open Access Journals (Sweden)

    David M Harris

    Full Text Available Patients with prolonged myelosuppression require frequent platelet and occasional granulocyte transfusions. Multi-donor transfusions induce alloimmunization, thereby increasing morbidity and mortality. Therefore, an autologous or HLA-matched allogeneic source of platelets and granulocytes is needed. To determine whether nonhematopoietic cells can be reprogrammed into hematopoietic cells, human mesenchymal stromal cells (MSCs and skin fibroblasts were incubated with the demethylating agent 5-azacytidine (Aza and the growth factors (GF granulocyte-macrophage colony-stimulating factor and stem cell factor. This treatment transformed MSCs to round, non-adherent cells expressing T-, B-, myeloid-, or stem/progenitor-cell markers. The transformed cells engrafted as hematopoietic cells in bone marrow of immunodeficient mice. DNA methylation and mRNA array analysis suggested that Aza and GF treatment demethylated and activated HOXB genes. Indeed, transfection of MSCs or skin fibroblasts with HOXB4, HOXB5, and HOXB2 genes transformed them into hematopoietic cells. Further studies are needed to determine whether transformed MSCs or skin fibroblasts are suitable for therapy.

  13. Chromosomal radiosensitivity during the G2 cell-cycle period of skin fibroblasts from individuals with familial cancer

    International Nuclear Information System (INIS)

    Parshad, R.; Sanford, K.K.; Jones, G.M.

    1985-01-01

    The authors reported previously that human cells after neoplastic transformation in culture had acquired an increased susceptibility to chromatid damage induced by x-irradiation during the G2 phase of the cell cycle. Evidence suggested that this results from deficient DNA repair during G2 phase. Cells derived from human tumors also showed enhanced G2-phase chromosomal radiosensitivity. Furthermore, skin fibroblasts from individuals with genetic diseases predisposing to a high risk of cancer, including ataxia-telangiectasia, Bloom syndrome, Fanconi anemia, and xeroderma pigmentosum exhibited enhanced G2-phase chromosomal radiosensitivity. The present study shows that apparently normal skin fibroblasts from individuals with familial cancer--i.e., from families with a history of neoplastic disease--also exhibit enhanced G2-phase chromosomal radiosensitivity. This radiosensitivity appears, therefore, to be associated with both a genetic predisposition to cancer and a malignant neoplastic state. Furthermore, enhanced G2-phase chromosomal radiosensitivity may provide the basis for an assay to detect genetic susceptibility to cancer

  14. Protective influence of hyaluronic acid on focal adhesion kinase activity in human skin fibroblasts exposed to ethanol.

    Science.gov (United States)

    Donejko, Magdalena; Rysiak, Edyta; Galicka, Elżbieta; Terlikowski, Robert; Głażewska, Edyta Katarzyna; Przylipiak, Andrzej

    2017-01-01

    The aim of this study was to evaluate the effect of ethanol and hyaluronic acid (HA) on cell survival and apoptosis in cultured human skin fibroblasts. Regarding the mechanism of ethanol action on human skin fibroblasts, we investigated cell viability and apoptosis, expression of focal adhesion kinase (FAK), and the influence of HA on those processes. Studies were conducted in confluent human skin fibroblast cultures that were treated with 25 mM, 50 mM, and 100 mM ethanol or with ethanol and 500 µg/mL HA. Cell viability was examined using methyl thiazolyl tetrazolium (MTT) assay and NC-300 Nucleo-Counter. Imaging of the cells using a fluorescence microscope Pathway 855 was performed to measure FAK expression. Depending on the dosage, ethanol decreased cell viability and activated the process of apoptosis in human skin fibroblasts. HA prevented the negative influence of ethanol on cell viability and prevented apoptosis. The analysis of fluorescence imaging using BD Pathway 855 High-Content Bioimager showed the inhibition of FAK migration to the cell nucleus, depending on the increasing concentration of ethanol. This study proves that downregulation of signaling pathway of FAK is involved in ethanol-induced apoptosis in human skin fibroblasts. The work also indicates a protective influence of HA on FAK activity in human skin fibroblasts exposed to ethanol.

  15. Cell survival of human tumor cells compared with normal fibroblasts following 60Co gamma irradiation

    International Nuclear Information System (INIS)

    Lloyd, E.L.; Henning, C.B.; Reynolds, S.D.; Holmblad, G.L.; Trier, J.E.

    1982-01-01

    Three tumor cell lines, two of which were shown to be HeLa cells, were irradiated with 60 Co gamma irradiation, together with two cell cultures of normal human diploid fibroblasts. Cell survival was studied in three different experiments over a dose range of 2 to 14 gray. All the tumor cell lines showed a very wide shoulder in the dose response curves in contrast to the extremely narrow shoulder of the normal fibroblasts. In addition, the D/sub o/ values for the tumor cell lines were somewhat greater. These two characteristics of the dose response curves resulted in up to 2 orders of magnitude less sensitivity for cell inactivation of HeLa cells when compared with normal cells at high doses (10 gray). Because of these large differences, the extrapolation of results from the irradiation of HeLa cells concerning the mechanisms of normal cell killing should be interpreted with great caution

  16. Mosaic trisomy 8 detected by fibroblasts cultured of skin

    Science.gov (United States)

    Gómez, Ana M; Mora, Lina; Suarez-Obando, Fernando; Moreno, Olga

    2016-01-01

    Introduction: Mosaic trisomy 8 or "Warkany's Syndrome" is a chromosomopathy with an estimated prevalance of 1:25,000 to 1:50,000, whose clinical presentation has a wide phenotypic variability. Case Description: Patient aged 14 years old with antecedents of global retardation of development, moderate cognitive deficit and hypothyroidism of possible congenital origin. Clinical Findings: Physical examination revealed palpebral ptosis, small corneas and corectopia, hypoplasia of the upper maxilla and prognathism, dental crowding, high-arched palate, anomalies of the extremities such as digitalization of the thumbs, clinodactyly and bilateral shortening of the fifth finger, shortening of the right femur, columnar deviation and linear brown blotches that followed Blaschko's lines. Cerebral nuclear magnetic resonance revealed type 1 Chiari's malformation and ventriculomegaly. Although the karyotype was normal in peripheral blood (46,XY), based on the finding of cutaneous mosaicism the lesions were biopsied and cytogenetic analysis demonstrated mosaic trisomy 8: mos 47,XY,+8[7]/46,XY[93]. Clinical Relevance: Trisomy 8 is clinically presented as a mosaic, universal cases being unfailingly lethal. In this particular case, cutaneous lesions identified the mosaic in tissue, although the karyotype was normal in peripheral blood. The cutaneous mosaicism represented by brown linear blotches which follow Blaschko's lines is a clinical finding that has not previously been described in Warkany's syndrome. PMID:27546932

  17. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  18. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  19. In vitro study of RRS HA injectable mesotherapy/biorevitalization product on human skin fibroblasts and its clinical utilization.

    Science.gov (United States)

    Deglesne, Pierre-Antoine; Arroyo, Rodrigo; Ranneva, Evgeniya; Deprez, Philippe

    2016-01-01

    Mesotherapy/biorevitalization with hyaluronic acid (HA) is a treatment approach currently used for skin rejuvenation. Various products with a wide range of polycomponent formulations are available on the market. Most of these formulations contain noncross-linked HA in combination with a biorevitalization cocktail, formed by various amounts of vitamins, minerals, amino acids, nucleotides, coenzymes, and antioxidants. Although ingredients are very similar among the different products, in vitro and clinical effects may vary substantially. There is a real need for better characterization of these products in terms of their action on human skin or in vitro skin models. In this study, we analyzed the effect of the RRS(®) (Repairs, Refills, Stimulates) HA injectable medical device on human skin fibroblasts in vitro. Skin fibroblast viability and its capacity to induce the production of key extracellular matrix were evaluated in the presence of different concentrations of RRS HA injectable. Viability was evaluated through colorimetric MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assay, and key extracellular matrix genes, type I collagen and elastin, were quantified by quantitative polymerase chain reaction. Results demonstrated that RRS HA injectable could promote human skin fibroblast viability (+15%) and increase fibroblast gene expression of type I collagen and elastin by 9.7-fold and 14-fold in vitro, respectively. These results demonstrate that mesotherapy/biorevitalization products can, at least in vitro, effectively modulate human skin fibroblasts.

  20. Mutagenesis and lethality following S phase irradiation of xeroderma pigmentosum and normal human diploid fibroblasts with ultraviolet light

    International Nuclear Information System (INIS)

    Grosovsky, A.J.; Little, J.B.

    1983-01-01

    The mutagenic and lethal effects of u.v. light exposure in the DNA synthetic phase of the cell cycle were determined in xeroderma pigmentosum complementation group A (XP-A), hereditary adenomatosis of the colon and rectum (ACR), and a normal, foreskin derived cell strain (AG1522). For AG1522, an increased sensitivity to the cytotoxic effects of u.v. light was observed as compared to previous findings for confluent, non-proliferating cultures. XP-A fibroblasts were markedly hypersensitive and ACR fibroblasts exhibited an intermediate response. The mutagenic response of ACR fibroblasts, however, was similar to normal fibroblasts. A threshold of 1.5-2 J/m 2 was observed for u.v. induced mutagenesis in normal and ACR fibroblasts. XP fibroblasts, on the other hand, were strikingly hypermutable and demonstrated little or no threshold. When S phase mutagenesis was considered as a function of survival level rather than u.v. light dose, XP fibroblasts remained significantly hypermutable as compared with normal fibroblasts at all survival levels. Previous mutagenesis results with confluent, non-proliferating cultures of XP and normal fibroblasts were reanalyzed as a function of cytotoxicity; XP hypermutability at all survival levels was also observed. (author)

  1. Skin fibroblasts from a D-deletion type retinoblastoma patient are abnormally X-ray sensitive

    International Nuclear Information System (INIS)

    Weichselbaum, R.R.; Nove, J.; Little, J.B.

    1977-01-01

    Retinoblastoma is a rare malignant eye tumour that appears either spontaneously or in genetically predisposed persons. The latter group is composed of persons who inherit the tumour with a dominant mode of transmission (the familial type) and those who have a deletion in the long arm of chromosome 13 referred to as the D-deletion type. When this deletion is present it is observed in many somatic cells and is often associated with structural defects. Survivors of the genetic forms of retinoblastoma have an increased risk of the development of cancers at other sites. A single genetic locus is unlikely to predispose many somatic cells to tumour formation unless a fundamental molecular defect, possibly related to DNA repair, is present. In order to investigate this hypothesis a study was made of the in vitro X-ray sensitivity of skin fibroblasts derived from three retinoblastoma patients, comprising a pair of twins with the familial type accompanied by no gross chromosome abnormalities, and a patient with the D-deletion type. It was found that fibroblasts derived from the D-deletion patient were significantly more radiosensitive than those from the other two patients. X-ray survival curves are shown. It is concluded that skin fibroblasts derived from a patient with the D-deletion variant of retinoblastoma are abnormally radiosensitive. Future investigations may indicate a specific defect in molecular repair of DNA that will explain the predisposition of these patients to the development of other tumours. (U.K.)

  2. Aluminum is More Cytotoxic than Lunar Dust in Human Skin and Lung Fibroblasts

    Science.gov (United States)

    Hammond, D.; Shehata, T.; Hammond, D.; Shehata, T.; Wise, J.P.; Martino, J; Wise, J.P.; Wise, J.P.

    2009-01-01

    NASA plans to build a permanent space station on the moon to explore its surface. The surface of the moon is covered in lunar dust, which consists of fine particles that contain silicon, aluminum and titanium, among others. Because this will be a manned base, the potential toxicity of this dust has to be studied. Also, toxicity standards for potential exposure have to be set. To properly address the potential toxicity of lunar dust we need to understand the toxicity of its individual components, as well as their combined effects. In order to study this we compared NASA simulant JSC-1AVF (volcanic ash particles), that simulates the dust found on the moon, to aluminum, the 3rd most abundant component in lunar dust. We tested the cytotoxicity of both compounds on human lung and skin fibroblasts (WTHBF-6 and BJhTERT cell lines, respectively). Aluminum oxide was more cytotoxic than lunar dust to both cell lines. In human lung fibroblasts 5, 10 and 50 g/sq cm of aluminum oxide induced 85%, 61% and 30% relative survival, respectively. For human skin fibroblasts the same concentrations induced 58%, 41% and 58% relative survival. Lunar dust was also cytotoxic to both cell lines, but its effects were seen at higher concentrations: 50, 100, 200 and 400 g/sq cm of lunar dust induced a 69%, 46%, 35% and 30% relative survival in the skin cells and 53%, 16%, 8% and 2% on the lung cells. Overall, for both compounds, lung cells were more sensitive than skin cells. This work was supported by a NASA EPSCoR grant through the Maine Space Grant Consortium (JPW), the Maine Center for Toxicology and Environmental Health., a Fulbright Grant (JM) and a Delta Kappa Gamma Society International World Fellowship (JM).

  3. Fibroblast-mediated in vivo and in vitro growth promotion of tumorigenic rat thyroid carcinoma cells but not normal Fisher rat thyroid follicular cells.

    Science.gov (United States)

    Saitoh, Ohki; Mitsutake, Norisato; Nakayama, Toshiyuki; Nagayama, Yuji

    2009-07-01

    It is known that genetic abnormalities in oncogenes and/or tumor suppressor genes promote carcinogenesis. Numerous recent articles, however, have demonstrated that epithelial-stromal interaction also plays a critical role for initiation and progression of carcinoma cells. Furthermore, ionizing radiation induces alterations in the tissue microenvironments that promote carcinogenesis. There is little or no information on epithelial-stromal interaction in thyroid carcinoma cells. The objective of this study was to determine if epithelial-stromal interaction influenced the growth of thyroid carcinoma cells in vivo and in vitro and to determine if radiation had added or interacting effects. Normal Fisher rat thyroid follicular cells (FRTL5 cells) and tumorigenic rat thyroid carcinoma cells (FRTL-Tc cells) derived from FRTL5 cells were employed. The cells were injected into thyroids or subcutaneously into left flanks of rats alone or in combination with skin-derived fibroblasts. In groups of rats, fibroblasts were irradiated with 0.1 or 4 Gy x-ray 3 days before inoculation. In vitro growth of FRTL-Tc and FRTL-5 cells were evaluated using the fibroblast-conditioned medium and in a co-culture system with fibroblasts. The in vivo experiments demonstrated that FRTL-Tc cells injected intrathyroidally grew faster than those injected subcutaneously, and that admixed fibroblasts enhanced growth of subcutaneous FRTL-Tc tumors, indicating that the intrathyroidal milieu, particularly in the presence of fibroblasts, confer growth-promoting advantage to thyroid carcinoma cells. This in vivo growth-promoting effect of fibroblasts on FRTL-Tc cells was duplicated in the in vitro experiments using the fibroblast-conditioned medium. Thus, our data demonstrate that this effect is mediated by soluble factor(s), is reversible, and is comparable to that of 10% fetal bovine serum. However, normal FRTL5 cells did not respond to the fibroblast-conditioned medium. Furthermore, high- and low

  4. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena

    2015-05-12

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways that control cell proliferation, oxidative phosphorylation, cellular respiration, and other redox reactions were activated in the immortalized cells. Here we report that, upon overexpression of S18-2 protein, primary rat skin fibroblasts underwent cell transformation. Cells passed more than 300 population doublings, and two out of three tested clones gave rise to tumors in experimental animals. Transformed cells showed anchorage-independent growth and loss of contact inhibition; they expressed epithelial markers, such as E-cadherin and β-catenin. Transformed cells showed increased telomerase activity, disturbance of the cell cycle, and chromosomal instability. Taken together, our data suggest that S18-2 is a newly identified oncoprotein that may be involved in cancerogenesis.

  5. Growth properties of familial Alzheimer skin fibroblasts during in vitro aging.

    Science.gov (United States)

    Tesco, G; Vergelli, M; Amaducci, L; Sorbi, S

    1993-01-01

    Human diploid fibroblasts undergo replicative senescence in vitro, which is strongly correlated with biological aging in vivo. In order to examine whether features compatible with a systemic premature aging are present in familial Alzheimer's disease (FAD) patients, we investigated the growth characteristics of three skin fibroblast lines from FAD patients and from three sex/age-matched controls at different passages until senescence was reached. A kinetic study of the replicative capacity was performed at different culture times by [3H]-thymidine incorporation and crystal violet staining. Data showed no significant difference between the two groups at any studied passage. The life span of the two types of cultures was also comparable. These results suggest that in familial Alzheimer patients there are not systemic signs of accelerated aging.

  6. DNA damage in cultured human skin fibroblasts exposed to excimer laser radiation

    Energy Technology Data Exchange (ETDEWEB)

    Rimoldi, D.; Miller, A.C.; Freeman, S.E.; Samid, D. (Department of Pathology, Uniformed Services University of the Health Sciences, Bethesda, MD (USA))

    1991-06-01

    Ultraviolet excimer lasers are being considered for use in a variety of refractive and therapeutic procedures, the long-term biologic consequences of which are unknown. The effect of sublethal doses of 193-nm laser radiation on cellular DNA was examined in cultured human skin fibroblasts. In contrast to 248 nm, treatments with the 193-nm laser radiation below 70 J/m2 did not cause significant pyrimidine dimer formation in the skin cells. This was indicated by the lack of excision repair activities (unscheduled DNA synthesis assay), and further demonstrated by direct analysis of pyrimidine dimers in DNA from irradiated cells. However, a low level of unscheduled DNA synthesis could be detected following irradiation at 193 nm with 70 J/m2. Both the 193-nm and 248-nm radiation were able to induce chromosomal aberrations, as indicated by a micronucleus assay. A dose-dependent increase in micronuclei frequency was observed 48 and 72 h after laser irradiation. These results indicate that exposure of actively replicating human skin fibroblasts to sublethal doses of either 193- or 248-nm laser radiation can result in genotoxicity.

  7. Membrane damage induced in cultured human skin fibroblasts by UVA irradiation

    International Nuclear Information System (INIS)

    Gaboriau, F.; Morliere, P.; Marquis, I.; Moysan, A.; Geze, M.; Dubertret, L.

    1993-01-01

    Irradiation of cultured human skin fibroblasts with ultraviolet light from 320 to 400 nm (UVA) leads to a decrease in the membrane fluidity exemplified by an enhanced fluorescence anisotropy of the lipophilic fluorescent probe 1-[4-trimethylamino)-phenyl]-6-phenylhexa-1,3,5-triene. This UVA-induced decrease in fluidity is associated with lactate dehydrogenase leakage in the supernatant. Vitamin E, an inhibitor of lipid peroxidation, exerts a protective effect on both phenomena. Therefore, this UVA-induced damage in membrane properties may be related to lipid peroxidation processes. Moreover, exponentially growing cells are more sensitive to these UVA-induced alterations than confluent cells. (Author)

  8. Minoxidil specifically decreases the expression of lysine hydroxylase in cultured human skin fibroblasts.

    Science.gov (United States)

    Hautala, T; Heikkinen, J; Kivirikko, K I; Myllylä, R

    1992-01-01

    The levels of lysine hydroxylase protein and the levels of the mRNAs for lysine hydroxylase and the alpha- and beta-subunits of proline 4-hydroxylase were measured in cultured human skin fibroblasts treated with 1 mM-minoxidil. The data demonstrate that minoxidil decreases the amount of lysine hydroxylase protein, this being due to a decrease in the level of lysine hydroxylase mRNA. The effect of minoxidil appears to be highly specific, as no changes were observed in the amounts of mRNAs for the alpha- and beta-subunits of proline 4-hydroxylase. Images Fig. 1. Fig. 2. Fig. 3. PMID:1314568

  9. GABA promotes elastin synthesis and elastin fiber formation in normal human dermal fibroblasts (HDFs).

    Science.gov (United States)

    Uehara, Eriko; Hokazono, Hideki; Hida, Mariko; Sasaki, Takako; Yoshioka, Hidekatsu; Matsuo, Noritaka

    2017-06-01

    The multiple physiological effects of γ-aminobutyric acid (GABA) as a functional food component have been recently reported. We previously reported that GABA upregulated the expression of type I collagen in human dermal fibroblasts (HDFs), and that oral administration of GABA significantly increased skin elasticity. However, details of the regulatory mechanism still remain unknown. In this study, we further examined the effects of GABA on elastin synthesis and elastin fiber formation in HDFs. Real-time PCR indicated that GABA significantly increased the expression of tropoelastin transcript in a dose-dependent manner. Additionally, the expression of fibrillin-1, fibrillin-2, and fibulin-5/DANCE, but not lysyl oxidase and latent transforming factor-β-binding protein 4, were also significantly increased in HDFs. Finally, immunohistochemical analysis confirmed that treatment with GABA dramatically increased the formation of elastic fibers in HDFs. Taken together, our results showed that GABA improves skin elasticity in HDFs by upregulating elastin synthesis and elastin fiber formation.

  10. Cyclobutane-type pyrimidine photodimer formation and induction of ornithine decarboxylase in human skin fibroblasts after UV irradiation

    International Nuclear Information System (INIS)

    Niggli, H.J.; Roethlisberger, R.

    1988-01-01

    Cyclobutane-type pyrimidine photodimers as well as the induction of ornithine decarboxylase (ODC) may serve as biochemical markers of the mutagenic and carcinogenic effects of ultraviolet light (UV). For this reason, it is important to compare the formation of pyrimidine dimers with the induction of ODC in human skin fibroblasts after irradiation with UVC (200-290 nm) and UVB (290-320 nm). In our studies we determined cytosine-thymine (C-T) as well as thymine-thymine dimer yields (T-T) by high-pressure liquid chromatography in cultures of neonatal normal human foreskin-derived fibroblasts after irradiation with UVC and UVB light. It was found that the yield of dimerization and the ratio of T-T/C-T decreased from the UVC to the UVB region. Time-course studies of ODC-induction in the same cells indicated that the maximal activity after UVB irradiation was retarded compared to UVC exposure. For the UV-induced ODC-levels, however, no significant difference in maximal induction could be measured after UVC and UVB irradiation at fluences where comparable yields of thymine dimerization are produced. Similar ODC-maxima were obtained with strains from children, while cells from adults showed significantly less pronounced ODC induction, indicating that ODC-response decreases with age and may therefore be used as a marker of aging

  11. Near-ultraviolet radiation-induced lipid peroxidation and membrane effects in Escherichia coli and human skin fibroblasts

    International Nuclear Information System (INIS)

    Chamberlain, J.

    1987-01-01

    The first part of this thesis examines the response of an unsaturated fatty acid auxotroph, Escherichia coli K1060 to broad-band near-UV radiation. Sensitivity, lipid peroxidation and leakage of rubidium from irradiated cells were found to increase with increasing unsaturation of membrane fatty acids. The involvement of singlet oxygen was implicated by an increase in sensitivity, lipid peroxidation and leakage of rubidium following irradiation in deuterium oxide. Some factors influencing survival following irradiation were investigated, where lower growth rates were shown to enhance survival. In the second part, the study was extended to human fibroblasts where a normal human skin fibroblast strain, GM730 and a strain derived from an actinic reticuloid patient, AR6LO, are compared. Lipid peroxidation was measured in both cell lines following broad-band near-UV irradiation. Membrane activity, as assessed by the pinocytic uptake of 14 C-sucrose and its subsequent release from the cell, was measured. Near-UV irradiation was found to increase such activity in both strains. Vitamin E and Trolox-C were found to decrease this response in AR6LO but not GM730 cells. The final part consists of preliminary investigations into the near-UV induced peroxidation of fatty acids and liposomes, and the subsequent increase in the level of hydroperoxides in the hours following irradiation. (author)

  12. Amelogenin is phagocytized and induces changes in integrin configuration, gene expression and proliferation of cultured normal human dermal fibroblasts

    DEFF Research Database (Denmark)

    Almqvist, Sofia; Werthén, Maria; Johansson, Anna

    2010-01-01

    Fibroblasts are central in wound healing by expressing important mediators and producing and remodelling extracellular matrix (ECM) components. This study aimed at elucidating possible mechanisms of action of the ECM protein amelogenin on normal human dermal fibroblasts (NHDF). Amelogenin at 100...

  13. L-Lactate Protects Skin Fibroblasts against Aging-Associated Mitochondrial Dysfunction via Mitohormesis

    Directory of Open Access Journals (Sweden)

    Jaroslav Zelenka

    2015-01-01

    Full Text Available A moderate elevation of reactive oxygen species (ROS production and a mild inhibition of mitochondrial respiratory chain have been associated with a health promotion and a lifespan extension in several animal models of aging. Here, we tested whether this phenomenon called mitohormesis could be mediated by L-lactate. The treatment with 5 mM L-lactate significantly increased H2O2 production and slightly inhibited the respiration in cultured skin fibroblasts and in isolated mitochondria. The L-lactate exposure was associated with oxidation of intracellular glutathione, phosphorylation of 5′AMP-activated protein kinase (AMPK, and induction of peroxisome proliferator-activated receptor gamma coactivator 1α (PGC1α transcription. A replicative aging of fibroblasts (L0 with a constant (LC, or intermittent 5 mM L-lactate (LI in media showed that the high-passage LI fibroblasts have higher respiration, lower H2O2 release, and lower secretion of L-lactate compared to L0 and LC. This protection against mitochondrial dysfunction in LI cells was associated with lower activity of mechanistic target of rapamycin complex 1 (mTORC1, less signs of cellular senescence, and increased autophagy compared to L0 and LC. In conclusion, we demonstrated that intermittent but not constant exposure to L-lactate triggers mitohormesis, prevents aging-associated mitochondrial dysfunction, and improves other markers of aging.

  14. Generation of human-induced pluripotent stem cells from burn patient-derived skin fibroblasts using a non-integrative method.

    Science.gov (United States)

    Fu, Shangfeng; Ding, Jianwu; Liu, Dewu; Huang, Heping; Li, Min; Liu, Yang; Tu, Longxiang; Liu, Deming

    2018-01-01

    Patient specific induced pluripotent stem cells (iPSCs) have been recognized as a possible source of cells for skin tissue engineering. They have the potential to greatly benefit patients with large areas of burned skin or skin defects. However, the integration virus-based reprogramming method is associated with a high risk of genetic mutation and mouse embryonic fibroblast feeder-cells may be a pollutant. In the present study, human skin fibroblasts (HSFs) were successfully harvested from patients with burns and patient-specific iPSCs were generated using a non-integration method with a feeder-free approach. The octamer-binding transcription factor 4 (OCT4), sex-determining region Y box 2 (SOX2) and NANOG transcription factors were delivered using Sendai virus vectors. iPSCs exhibited representative human embryonic stem cell-like morphology and proliferation characteristics. They also expressed pluripotent markers, including OCT4, NANOG, SOX2, TRA181, stage-specific embryonic antigen 4 and TRA-160, and exhibited a normal karyotype. Teratoma and embryoid body formation revealed that iPSCs were able to differentiate into cells of all three germ layers in vitro and in vivo. The results of the present study demonstrate that HSFs derived from patients with burns, may be reprogrammed into stem cells with pluripotency, which provides a basis for cell‑based skin tissue engineering in the future.

  15. Recombinant Human Acidic Fibroblast Growth Factor (aFGF) Expressed in Nicotiana benthamiana Potentially Inhibits Skin Photoaging.

    Science.gov (United States)

    Ha, Jang-Ho; Kim, Ha-Neul; Moon, Ki-Beom; Jeon, Jae-Heung; Jung, Dai-Hyun; Kim, Su-Jung; Mason, Hugh S; Shin, Seo-Yeon; Kim, Hyun-Soon; Park, Kyung-Mok

    2017-07-01

    Responding to the need for recombinant acidic fibroblast growth factor in the pharmaceutical and cosmetic industries, we established a scalable expression system for recombinant human aFGF using transient and a DNA replicon vector expression in Nicotiana benthamiana . Recombinant human-acidic fibroblast growth factor was recovered following Agrobacterium infiltration of N. benthamiana . The optimal time point at which to harvest recombinant human acidic fibroblast growth factor expressing leaves was found to be 4 days post-infiltration, before necrosis was evident. Commassie-stained SDS-PAGE gels of His-tag column eluates, concentrated using a 10 000 molecular weight cut-off column, showed an intense band at the expected molecular weight for recombinant human acidic fibroblast growth factor. An immunoblot confirmed that this band was recombinant human acidic fibroblast growth factor. Up to 10 µg recombinant human-acidic fibroblast growth factor/g of fresh leaves were achieved by a simple affinity purification protocol using protein extract from the leaves of agroinfiltrated N. benthamiana . The purified recombinant human acidic fibroblast growth factor improved the survival rate of UVB-irradiated HaCaT and CCD-986sk cells approximately 89 and 81 %, respectively. N. benthamiana -derived recombinant human acidic fibroblast growth factor showed similar effects on skin cell proliferation and UVB protection compared to those of Escherichia coli -derived recombinant human acidic fibroblast growth factor. Additionally, N. benthamiana- derived recombinant human acidic fibroblast growth factor increased type 1 procollagen synthesis up to 30 % as well as reduced UVB-induced intracellular reactive oxygen species generation in fibroblast (CCD-986sk) cells.UVB is a well-known factor that causes various types of skin damage and premature aging. Therefore, the present study demonstrated that N. benthamiana -derived recombinant human acidic fibroblast growth factor

  16. Protein, RNA, and DNA synthesis in cultures of skin fibroblasts from healthy subjects and patients with rheumatic diseases

    International Nuclear Information System (INIS)

    Abakumova, O.Y.; Kutsenko, N.G.; Panasyuk, A.F.

    1985-01-01

    To study the mechanism of the lasting disturbance of fibroblast function, protein, RNA and DNA synthesis was investigated in skin fibroblasts from patients with rheumatoid arthritis (RA) and systemic scleroderma (SS). The labeled precursors used to analyze synthesis of protein, RNA, and DNA were 14 C-protein hydrolysate, ( 14 C)uridine, and ( 14 C) thymidine. Stimulation was determined by measuring incorporation of ( 14 C)proline into fibroblast proteins. During analysis of stability of fast-labeled RNA tests were carried out to discover whether all measurable radioactivity belonged to RNA molecules

  17. Abnormal sensitivity of skin fibroblasts from familial polyposis patients to DNA alkylating agents

    International Nuclear Information System (INIS)

    Barfknecht, T.R.; Little, J.B.

    1982-01-01

    Fibroblast cell strains derived from different patients all afflicted with genetic predisposing to the development of intestinal polyposis and cancer were tested for their sensitivity to the lethal effects of the DNA alkylating agents methylmethanesulfonate (MMS), ethyl methanesulfonate, N-methyl-N'-nitro-N-nitrosoguanidine, and 4-nitroquinoline 1-oxide. The genetic syndromes studied were: (a) adenomatosis of the colon and rectum only, an autosomal dominant trait; (b) Turcot's syndrome, a rare autosomal recessive polyposis syndrome also characterized by central nervous system tumors; and (c) Gardner's syndrome, an autosomal dominant syndrome which, in addition to intestinal polyposis, is also clinically characterized by osteomas and soft tissue tumors. Fibroblasts from a patient with Turcot's syndrome were hypersensitive to MMS, having a D0 value of 0.24 mM (p less than 0.01) versus the normal average D0 of 0.36 mM and a D10 value of 0.95 mM (p less than 0.01) compared with the normal average value of 1.3 mM. Fibroblasts from the Gardner's syndrome proband were moderately sensitive to MMS, ethyl methanesulfonate, and N-methyl-N'-nitro-N-nitrosoguanidine due to significant differences of D10 values of 0.60 mM (p less than 0.01), 15 mM (p less than 0.01), and 4.8 microM (p less than 0.025), respectively, versus the normal average values of 1.3 mM, 28 mM, and 9.4 microM. Fibroblasts from the clinically affected Gardner's syndrome daughter of the proband were significantly more sensitive to MMS treatment, D0 of 0.22 mM (p less than 0.01) versus the normal average D0 of 0.36 mM and a D10 of 0.97 mM (p less than 0.01) versus the normal average. This differential sensitivity to the several DNA alkylating agents suggests that different mechanisms of hypersensitivity to these chemicals may be associated with fibroblasts from the various forms of familial polyposis

  18. Resveratrol Prevents High Fluence Red Light-Emitting Diode Reactive Oxygen Species-Mediated Photoinhibition of Human Skin Fibroblast Migration.

    Directory of Open Access Journals (Sweden)

    Andrew Mamalis

    Full Text Available Skin fibrosis is a significant medical problem that leads to a functional, aesthetic, and psychosocial impact on quality-of-life. Light-emitting diode-generated 633-nm red light (LED-RL is part of the visible light spectrum that is not known to cause DNA damage and is considered a safe, non-invasive, inexpensive, and portable potential alternative to ultraviolet phototherapy that may change the treatment paradigm of fibrotic skin disease.The goal of our study was to investigate the how reactive oxygen species (ROS free radicals generated by high fluence LED-RL inhibit the migration of skin fibroblasts, the main cell type involved in skin fibrosis. Fibroblast migration speed is increased in skin fibrosis, and we studied cellular migration speed of cultured human skin fibroblasts as a surrogate measure of high fluence LED-RL effect on fibroblast function. To ascertain the inhibitory role of LED-RL generated ROS on migration speed, we hypothesized that resveratrol, a potent antioxidant, could prevent the photoinhibitory effects of high fluence LED-RL on fibroblast migration speed.High fluence LED-RL generated ROS were measured by flow cytometry analysis using dihydrorhodamine (DHR. For purposes of comparison, we assessed the effects of ROS generated by hydrogen peroxide (H2O2 on fibroblast migration speed and the ability of resveratrol, a well known antioxidant, to prevent LED-RL and H2O2 generated ROS-associated changes in fibroblast migration speed. To determine whether resveratrol could prevent the high fluence LED-RL ROS-mediated photoinhibition of human skin fibroblast migration, treated cells were incubated with resveratrol at concentrations of 0.0001% and 0.001% for 24 hours, irradiated with high fluences LED-RL of 480, 640, and 800 J/cm2.High fluence LED-RL increases intracellular fibroblast ROS and decreases fibroblast migration speed. LED-RL at 480, 640 and 800 J/cm2 increased ROS levels to 132.8%, 151.0%, and 158.4% relative to matched

  19. Mechanisms of inhibition of DNA replication by ultraviolet light in normal human and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Kaufmann, W.K.; Cleaver, J.E.

    1981-01-01

    The inhibition of DNA replication in ultraviolet-irradiated human fibroblasts was characterized by quantitative analysis of radiation-induced alterations in the steady-state distribution of sizes of pulse-labeled, nascent DNA. Low, noncytotoxic fluences rapidly produced an inhibition of DNA synthesis in half-replicon-size replication intermediates. With time, the inhibition produced by low fluences spread progressively to include multi-replicon-size intermediates. The results indicate that ultraviolet radiation inhibits the initiation of DNA synthesis in replicons. Higher cytotoxic fluences inhibited DNA synthesis in operating replicons. Xeroderma pigmentosum fibroblasts with deficiencies in DNA excision repair exhibited an inhibition of replicon initiation after low radiation fluences, indicating the effect was not solely dependent upon operation of the nucleotidyl excision repair pathway. Owing to their inability to remove pyrimidine dimers ahead of DNA growing points, the repair-deficient cells also were more sensitive than normal cells to the ultraviolet-induced inhibition of chain elongation. Xeroderma pigmentosum cells belonging to the variant class were even more sensitive to inhibition of chain elongation despite their ability to remove pyrimidine dimers. The analysis suggested that normal and repair-deficient human fibroblasts either are able to rapidly bypass certain dimers or these dimers are not recognized by the chain elongation machinery. (author)

  20. In vitro study of RRS HA injectable mesotherapy/biorevitalization product on human skin fibroblasts and its clinical utilization

    Directory of Open Access Journals (Sweden)

    Deglesne PA

    2016-02-01

    Full Text Available Pierre-Antoine Deglesne,* Rodrigo Arroyo,* Evgeniya Ranneva, Philippe Deprez Research and Development, SKIN TECH PHARMA GROUP, Castelló d'Empúries, Spain  *These authors contributed equally to this work Abstract: Mesotherapy/biorevitalization with hyaluronic acid (HA is a treatment approach currently used for skin rejuvenation. Various products with a wide range of polycomponent formulations are available on the market. Most of these formulations contain noncross-linked HA in combination with a biorevitalization cocktail, formed by various amounts of vitamins, minerals, amino acids, nucleotides, coenzymes, and antioxidants. Although ingredients are very similar among the different products, in vitro and clinical effects may vary substantially. There is a real need for better characterization of these products in terms of their action on human skin or in vitro skin models. In this study, we analyzed the effect of the RRS® (Repairs, Refills, Stimulates HA injectable medical device on human skin fibroblasts in vitro. Skin fibroblast viability and its capacity to induce the production of key extracellular matrix were evaluated in the presence of different concentrations of RRS HA injectable. Viability was evaluated through colorimetric MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide assay, and key extracellular matrix genes, type I collagen and elastin, were quantified by quantitative polymerase chain reaction. Results demonstrated that RRS HA injectable could promote human skin fibroblast viability (+15% and increase fibroblast gene expression of type I collagen and elastin by 9.7-fold and 14-fold in vitro, respectively. These results demonstrate that mesotherapy/biorevitalization products can, at least in vitro, effectively modulate human skin fibroblasts.Keywords: mesotherapy, medical device, RRS, collagen, elastin, extracellular matrix

  1. L-Carnosine reduces telomere damage and shortening rate in cultured normal fibroblasts

    International Nuclear Information System (INIS)

    Shao Lan; Li Qinghuan; Tan Zheng

    2004-01-01

    Telomere is the repetitive DNA sequence at the end of chromosomes, which shortens progressively with cell division and limits the replicative potential of normal human somatic cells. L-Carnosine, a naturally occurring dipeptide, has been reported to delay the replicative senescence, and extend the lifespan of cultured human diploid fibroblasts. In this work, we studied the effect of carnosine on the telomeric DNA of cultured human fetal lung fibroblast cells. Cells continuously grown in 20 mM carnosine exhibited a slower telomere shortening rate and extended lifespan in population doublings. When kept in a long-term nonproliferating state, they accumulated much less damages in the telomeric DNA when cultured in the presence of carnosine. We suggest that the reduction in telomere shortening rate and damages in telomeric DNA made an important contribution to the life-extension effect of carnosine

  2. Protective role of microRNA-29a in denatured dermis and skin fibroblast cells after thermal injury

    Directory of Open Access Journals (Sweden)

    Jie Zhou

    2016-03-01

    Full Text Available Our previous study has suggested that downregulated microRNA (miR-29a in denatured dermis might be involved in burn wound healing. However, the exact role of miR-29a in healing of burn injury still remains unclear. Here, we found that expression of miR-29a was notably upregulated in denatured dermis tissues and skin fibroblast cells after thermal injury, and thereafter gradually downregulated compared with control group. By contrast, the expression of collagen, type I, alpha 2 (COL1A2 and vascular endothelial growth factor (VEGF-A were first reduced and subsequently upregulated in denatured dermis tissues and skin fibroblast cells after thermal injury. We further identified COL1A2 as a novel target of miR-29a, which is involved in type I collagen synthesis, and showed that miR-29a negatively regulated the expression level of COL1A2 in skin fibroblast cells. In addition, VEGF-A, another target gene of miR-29a, was also negatively mediated by miR-29a in skin fibroblast cells. Inhibition of miR-29a expression significantly promoted the proliferation and migration of skin fibroblast cells after thermal injury, and knockdown of COL1A2 and VEGF-A reversed the effects of miR-29a on the proliferation and migration of skin fibroblast cells. Furthermore, we found that Notch2/Jagged2 signaling was involved in miR-29a response to burn wound healing. Our findings suggest that downregulated miR-29a in denatured dermis may help burn wound healing in the later phase, probably via upregulation of COL1A2 and VEGF-A expression, which can further enhance type I collagen synthesis and angiogenesis.

  3. Establishment and cryopreservation of a skin fibroblast cell line derived from Yunnan semi-fine wool sheep in the presence of synthetic ice blocker.

    Science.gov (United States)

    Wu, Shuai Shuai; Li, Dong Jiang; Lv, Chun Rong; Yang, Hong Yuan; Zhu, Lan; Li, Wei Juan; Quan, Guo Bo; Hong, Qiong Hua

    2013-01-01

    In this study, the fibroblasts cell line derived from ear marginal tissue of Yunnan semi-fine wool sheep was successfully established using the primary explants technique and cryopreservation technology. Additionally, the protective effect of synthetic ice blocker (SIB) including 1, 3-cyclohexanediol (1, 3-CHD) and 1, 4-cyclohexanediol (1, 4-CHD) on frozen fibroblast cells was also assessed and compared. Propidium iodide (PI) was used to stain the dead cells following cryopreservation and thawing. The results showed that compared with Medium 199 (M199) and Dulbecco's modified Eagle's medium : Nutrient Mixture F-12 (1 : 1) Mixture (DMEM/F12), Dulbecco's modified Eagle's medium (DMEM) may be more suitable for the primary culture of fibroblast cells of Yunnan semi-fine wool sheep. The growth curve of cells is a typical "S" type. After subculture for four days, the cells entered the plateau phase and began to degenerate. Biological analysis showed that the population doubling time (PDT) for subculturing fibroblast cells was approximately 26h. The Karyotyping data indicated that the percentage of fibroblast cells with normal chromosome number 2n = 54 was over 90% following subculture for 10 passages. Moreover, the tests for bacteria, fungi, viruses and mycoplasma were negative. After serial subculture for 5 generations, the fibroblast cells were cryopreserved in the presence or absence of 1, 3-CHD or 1, 4-CHD. The data indicated that with increase of the synthetic ice blocker concentrations, the viability of frozen-thawed fibroblast cells was firstly increased and then decreased. When the concentration of 1, 3-CHD or 1, 4-CHD was 50 mM, the viable percentage of frozen-thawed fibroblast cells was 91.93% +/- 2.24% and 94.13% +/- 0.55% respectively and significantly higher than that of the cells frozen in the absence of synthetic ice blockers (88.10% +/- 1.49%, P skin fibroblast cell line of Yunnan semi-fine wool sheep was firstly established in this study. Additionally

  4. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  5. Anti-Inflammatory Effect of ETAS®50 by Inhibiting Nuclear Factor-κB p65 Nuclear Import in Ultraviolet-B-Irradiated Normal Human Dermal Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ken Shirato

    2018-01-01

    Full Text Available Ultraviolet (UV irradiation induces proinflammatory responses in skin cells, including dermal fibroblasts, accelerating premature skin aging (photoaging. ETAS 50, a standardized extract from the Asparagus officinalis stem, is a novel and unique functional food that suppresses proinflammatory responses of hydrogen peroxide-stimulated skin fibroblasts and interleukin- (IL- 1β-stimulated hepatocytes. To elucidate its antiphotoaging potencies, we examined whether ETAS 50 treatment after UV-B irradiation attenuates proinflammatory responses of normal human dermal fibroblasts (NHDFs. UV-B-irradiated NHDFs showed reduced levels of the cytosolic inhibitor of nuclear factor-κB α (IκBα protein and increased levels of nuclear p65 protein. The nuclear factor-κB nuclear translocation inhibitor JSH-23 abolished UV-B irradiation-induced IL-1β mRNA expression, indicating that p65 regulates transcriptional induction. ETAS 50 also markedly suppressed UV-B irradiation-induced increases in IL-1β mRNA levels. Immunofluorescence analysis revealed that ETAS 50 retained p65 in the cytosol after UV-B irradiation. Western blotting also showed that ETAS 50 suppressed the UV-B irradiation-induced increases in nuclear p65 protein. Moreover, ETAS 50 clearly suppressed UV-B irradiation-induced distribution of importin-α protein levels in the nucleus without recovering cytosolic IκBα protein levels. These results suggest that ETAS 50 exerts anti-inflammatory effects on UV-B-irradiated NHDFs by suppressing the nuclear import machinery of p65. Therefore, ETAS 50 may prevent photoaging by suppressing UV irradiation-induced proinflammatory responses of dermal fibroblasts.

  6. Human uracil DNA N-glycosidase: studies in normal and repair defective cultured fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Kuhnlein, U; Lee, B; Linn, S

    1978-01-01

    Uracil DNA N-glycosidase, an enzyme which participates in the excision of uracil from DNA, was measured in extracts from fibroblast lines cultured from normal subjects, from several subjects with the genetic disease xeroderma pigmentosum, and from a subject with ataxia telangiectasia. The cell lines representative of complementation groups A and D of xeroderma pigmentosum and of ataxia telangiectasia had roughly the same level of activity as did the normal cells. On the other hand, cells from two xeroderma pigmentosum variants (XP4BE and XP13BE) had roughly half the normal level of activity, and cells from the heterozygous mother of XP4BE had an intermediate level of activity. In spite of these quantitative differences, no systematic alterations in reaction characteristics, apparent K/sub m/ for substrate, or purification characteristics were noted for enzyme from any of the lines. Thus a causal relationship, if any, between levels of activity and the disease symptoms is equivocal.

  7. Effects of bosentan on collagen type I synthesis on in vitro culture of scleroderma skin fibroblasts

    Directory of Open Access Journals (Sweden)

    S. Soldano

    2011-01-01

    Full Text Available The present study evaluated the effects of a non-selective endothelin (ETA/B receptors antagonist, on collagen type I (COLI synthesis on in vitro culture of scleroderma (SSc skin fibroblasts (Fb. Fb were obtained from skin biopsies of 6 female SSc patients (mean age 64. 1±6 years, after informed consent and Ethical Committee Approval. Cells were treated with endothelin-I [ET-I, 100nM] for 24 and 48 hrs, pre-treated for I hr with ETA/B receptors antagonist [10nM] alone or followed by ET-I for 24 and 48 hrs. Untreated Fb were used as controls. Immunocytochemistry and western blot analysis were performed to evaluate COLI synthesis. ET-I increased COLI synthesis both at 24 and 48 hrs when compared to controls. ETA/B receptor antagonost blocks the increased COLI synthesis ET-I-mediated both at 24 and 48 hrs vs. ET-I. Results showed that ET-I receptors blockage by ETA/B receptors antagonist might prevent the excessive synthesis of COLI, supporting its positive action in the management of skin fibrosis.

  8. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: An in vitro study of fibroblast and keratinocyte scratch assays

    International Nuclear Information System (INIS)

    Walter, M.N.M.; Wright, K.T.; Fuller, H.R.; MacNeil, S.; Johnson, W.E.B.

    2010-01-01

    We have used in vitro scratch assays to examine the relative contribution of dermal fibroblasts and keratinocytes in the wound repair process and to test the influence of mesenchymal stem cell (MSC) secreted factors on both skin cell types. Scratch assays were established using single cell and co-cultures of L929 fibroblasts and HaCaT keratinocytes, with wound closure monitored via time-lapse microscopy. Both in serum supplemented and serum free conditions, wound closure was faster in L929 fibroblast than HaCaT keratinocyte scratch assays, and in co-culture the L929 fibroblasts lead the way in closing the scratches. MSC-CM generated under serum free conditions significantly enhanced the wound closure rate of both skin cell types separately and in co-culture, whereas conditioned medium from L929 or HaCaT cultures had no significant effect. This enhancement of wound closure in the presence of MSC-CM was due to accelerated cell migration rather than increased cell proliferation. A number of wound healing mediators were identified in MSC-CM, including TGF-β1, the chemokines IL-6, IL-8, MCP-1 and RANTES, and collagen type I, fibronectin, SPARC and IGFBP-7. This study suggests that the trophic activity of MSC may play a role in skin wound closure by affecting both dermal fibroblast and keratinocyte migration, along with a contribution to the formation of extracellular matrix.

  9. Abnormal sensitivity of diploid skin fibroblasts from a family with Gardner's syndrome to the lethal effects of X-irradiation, ultraviolet light and mitomycin-C

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Weichselbaum, R.R.

    1980-01-01

    Skin fibroblasts isolated from two members of the same family with the cancer-prone disease Gardner's Syndrome (intestinal polyposis, colon cancer, bone and soft tissue tumors) showed enhanced sensitivity to the lethal effects of X-irradiation, ultraviolet light and mitomycin-C. These cells showed no liquid-holding type recovery following UV-irradiation of confluent cultures, but were normal in their capacity for UV-induced unscheduled DNA synthesis. UV survival was not influenced by post-irradiation incubation with caffeine. (orig.)

  10. Regulation and inhibition of collagenase expression by long-wavelength ultraviolet radiation in cultured human skin fibroblasts

    International Nuclear Information System (INIS)

    Petersen, Marta; Hamilton, Tiffani; Haili Li

    1995-01-01

    The cellular mechanisms responsible for the connective tissue changes produced by chronic exposure to UV light are poorly understood. collagenase, a metalloproteinase, initiates degradation of types I and III collagen and thus plays a key role in the remodeling of dermal collagen. Collagenase synthesis by fibroblasts and keratinocytes involves the protein kinase C (PKC) second messenger system, and corticosteroids have been shown to suppress its synthesis at the level of gene transcription. Long-wavelength UV light (UVA, 320-400 nm) stimulates the synthesis of interstitial collagenase, as well as increasing PKC activity, in human skin fibroblasts in vitro. This study explores the regulation of collagenase expression by UVA in cultured human skin fibroblasts. Specifically, the time course, the effect of actinomycin D, an inhibitor of RNA synthesis, as well as the effect of PKC inhibitors and dexamethansone on expression of collagenase following UVA irradiation were examined. (Author)

  11. Insulin binding and stimulation of hexose and amino acid transport by normal and receptor-defective human fibroblasts

    International Nuclear Information System (INIS)

    Longo, N.; Nagata, N.; Danner, D.; Priest, J.; Elsas, L.

    1986-01-01

    The authors analyzed insulin receptors in cells cultured from a sibship of related parents who had two offspring with severe insulin resistance (Leprechaunism). 124 I-Insulin (1 ng/ml) binding to skin fibroblasts from the proband, mother, and father was 9, 60 and 62% of control cells, respectively, at equilibrium, Non-linear regression analysis, utilizing a two receptors model, of curvilinear Scatchard plots indicated a reduced number of high-affinity binding sites in both parents. Influx of L-Proline (System A), L-Serine (ASC) and L-Leucine (L) was similar in control and mutant cells. Similarly, during the depletion of intracellular amino acid pools, there was a release from transinhibition for System A and a decrease of transstimulation of Systems ASC and L in both cell lines. Surprisingly, insulin augmented, normally, A system influx with an ED 50 = 70 ng/ml at 24 0 C and 7 ng/ml at 37 0 C. By contrast insulin failed to simulated 3-0-methyl-D-glucose influx into the proband's cells, while normal cells were stimulated 30% with an ED 50 of 6 ng/ml. These results indicate that defective high-affinity insulin binding is inherited as an autosomal recessive trait; that general membrane functions are intact; that insulin regulates A system amino acid and hexose transport by two different mechanisms; and, that the latter mechanism is impaired by this family's receptor mutation

  12. Cytogenetic study of skin fibroblasts in a case of accidental acute irradiation

    International Nuclear Information System (INIS)

    Mouthuy, M.; Dutrillaux, B.

    1982-01-01

    The cytogenetic study of skin fibroblasts from a young boy, heavily irradiated by handling of an iridium-192 source of 25 curies is reported. About half of the cells examined had chromosomal abnormalities. The same clone, with multiple chromosome rearrangement, was observed in cultures from biopsies obtained 25 and 35 months after the accident. Several other clones were detected in vitro. The results obtained from cultures of biopsies from different locations show that no direct relationships were found between the absorbed dose and the frequency of stable chromosomal rearrangements. The comparison of the intrachromosomal rearrangements, mostly inversions, observed in this study with those detected in human pathology, in irradiation experiments in vitro, and in various species of primates indicates that these rearrangements do not occur at random. (orig.)

  13. Quantitative assessment of changes in the dermal fibroblast population of pig skin after single doses of X-rays

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W.

    1988-10-01

    Changes in the density of fibroblast nuclei in reticular dermis of pigs was studied from 6 to 104 weeks after a single dose of 15.4 Gy of X-rays. The largest decrease in fibroblasts occurred between 12 and 26 weeks after irradiation; after this there was only a slight fall in fibroblast number until 104 weeks when observations ceased. At 26 weeks and later times after irradiation reduction in the density of fibroblast nuclei in the reticular dermis was dose-dependent for single doses in the range 8.0-20.7 Gy. The dose-response curve had an initial shoulder, after which the fall in the fibroblast nuclear density was linearly related to dose. Data obtained between 26 weeks and 104 weeks after irradiation, could be fitted by the same dose-response curve. The fall in the counts of fibroblast nuclei was compared with earlier studies. The loss of fibroblasts occurred after an initial reduction in blood flow in the pig skin but was concomitant with general reduction in dermal thickness.

  14. A quantitative assessment of changes in the dermal fibroblast population of pig skin after single doses of X-rays

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1988-01-01

    Changes in the density of fibroblast nuclei in reticular dermis of pigs was studied from 6 to 104 weeks after a single dose of 15.4 Gy of X-rays. The largest decrease in fibroblasts occurred between 12 and 26 weeks after irradiation; after this there was only a slight fall in fibroblast number until 104 weeks when observations ceased. At 26 weeks and later times after irradiation reduction in the density of fibroblast nuclei in the reticular dermis was dose-dependent for single doses in the range 8.0-20.7 Gy. The dose-response curve had an initial shoulder, after which the fall in the fibroblast nuclear density was linearly related to dose. Data obtained between 26 weeks and 104 weeks after irradiation, could be fitted by the same dose-response curve. The fall in the counts of fibroblast nuclei was compared with earlier studies. The loss of fibroblasts occurred after an initial reduction in blood flow in the pig skin but was concomitant with general reduction in dermal thickness. (author)

  15. Establishment of human induced pluripotent stem cell lines from normal fibroblast TIG-1.

    Science.gov (United States)

    Kumazaki, Tsutomu; Kurata, Sayaka; Matsuo, Taira; Mitsui, Youji; Takahashi, Tomoko

    2011-06-01

    Normal human cells have a replicative life span and therefore senesce. Usually, normal human cell strains are differentiated cells and reach a terminally differentiated state after a number of cell divisions. At present, definitive differences are not known between replicative senescence and terminal differentiation. TIG-1 is a human fibroblast strain established from fetal lung and has been used extensively in studies of cellular senescence, and numerous data were accumulated at the molecular level. Recently, a method for generating induced pluripotent stem cells (iPSCs) was developed. Using the method, we introduced four reprogramming genes to TIG-1 fibroblasts and succeeded in isolating colonies that had embryonic stem cell (ESC)-like morphologies. They showed alkaline phosphatase activity and expressed ESC markers, as shown by immunostaining of OCT4, SOX2, SSEA4, and TRA-1-81 as well as reverse-transcription polymerase chain reaction (RT-PCR) for OCT4 and NANOG transcripts. Thus, we succeeded in establishing iPSC clones from TIG-1. The iPSC clones could differentiate to cells originated from all three germ-cell layers, as shown by RT-PCR, for messenger RNA (mRNA) expression of α-fetoprotein (endoderm), MSX1 (mesoderm) and microtubule-associated protein 2 (ectoderm), and by immunostaining for α-fetoprotein (endoderm), α-smooth muscle actin (mesoderm), and β-III-tubulin (ectoderm). The iPSCs formed teratoma containing the structures developed from all three germ-cell layers in severe combined immune-deficiency mice. Thus, by comparing the aging process of parental TIG-1 cells and the differentiation process of iPSC-derived fibrocytes to fibroblasts, we can reveal the exact differences in processes between senescence and terminal differentiation.

  16. Establishment, characterization and immortalization of a fibroblast cell line from the Chinese red belly toad Bombina maxima skin.

    Science.gov (United States)

    Xiang, Yang; Gao, Qian; Su, Weiting; Zeng, Lin; Wang, Jinhuan; Hu, Yi; Nie, Wenhui; Ma, Xutong; Zhang, Yong; Lee, Wenhui; Zhang, Yun

    2012-01-01

    The skin of the amphibian Bombina maxima is rich in biologically active proteins and peptides, most of which have mammalian analogues. The physiological functions of most of the mammalian analogues are still unknown. Thus, Bombina maxima skin may be a promising model to reveal the physiological role of these proteins and peptides because of their large capacity for secretion. To investigate the physiological role of these proteins and peptides in vitro, a fibroblast cell line was successfully established from Bombina maxima tadpole skin. The cell line grew to form a monolayer with cells of a uniform shape and abundant rough endoplasmic reticulum, which are typical characteristics of fibroblasts. Further identification at a molecular level revealed that they strongly expressed the fibroblast marker protein vimentin. The chromosome number of these cells is 2n = 28, and most of them were diploid. Growth property analysis showed that they grew well for 14 passages. However, cells showed decreased proliferative ability after passage 15. Thus, we tried to immortalize the cells through the overexpression of SV40 T antigen. After selecting by G418, cells stably expressed SV40 large T antigen and showed enhanced proliferative ability and increased telomerase activity. Signal transduction analysis revealed functional p42 mitogen-activated protein (MAP) kinase in immortalized Bombina maxima dermal fibroblasts. Primary fibroblast cells and the immortalized fibroblast cells from Bombina maxima cultured in the present study can be used to investigate the physiological role of Bombina maxima skin-secreted proteins and peptides. In addition, the methods for primary cell culturing and cell immortalization will be useful for culturing and immortalizing cells from other types of amphibians.

  17. Persistent Amplification of DNA Damage Signal Involved in Replicative Senescence of Normal Human Diploid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Masatoshi Suzuki

    2012-01-01

    Full Text Available Foci of phosphorylated histone H2AX and ATM are the surrogate markers of DNA double strand breaks. We previously reported that the residual foci increased their size after irradiation, which amplifies DNA damage signals. Here, we addressed whether amplification of DNA damage signal is involved in replicative senescence of normal human diploid fibroblasts. Large phosphorylated H2AX foci (>1.5 μm diameter were specifically detected in presenescent cells. The frequency of cells with large foci was well correlated with that of cells positive for senescence-associated β-galactosidase staining. Hypoxic cell culture condition extended replicative life span of normal human fibroblast, and we found that the formation of large foci delayed in those cells. Our immuno-FISH analysis revealed that large foci partially localized at telomeres in senescent cells. Importantly, large foci of phosphorylated H2AX were always colocalized with phosphorylated ATM foci. Furthermore, Ser15-phosphorylated p53 showed colocalization with the large foci. Since the treatment of senescent cells with phosphoinositide 3-kinase inhibitor, wortmannin, suppressed p53 phosphorylation, it is suggested that amplification of DNA damage signaling sustains persistent activation of ATM-p53 pathway, which is essential for replicative senescence.

  18. Establishment of ultra long-lived cell lines by transfection of TERT into normal human fibroblast TIG-1 and their characterization.

    Science.gov (United States)

    Kamada, Mizuna; Kumazaki, Tsutomu; Matsuo, Taira; Mitsui, Youji; Takahashi, Tomoko

    2012-06-01

    To establish useful human normal cell lines, TERT (telomerase reverse transcriptase) cDNA was transfected into normal female lung fibroblast, TIG-1. After long-term-sub-cultivation of 74 individual clones selected for resistance to G418, we obtained 55 cultures with normal range of life span [75 PDL (population doubling level)], 16 cultures with extended life span (75-140 PDL). In addition, 3 immortal cell strains and unexpectedly, one ultra long-lived cell line (ULT-1) with life span of 166 PDL were established. IMT-1, one of the immortal cell strains was confirmed to maintain long telomere length, high telomerase activity and an extremely low level of p16INK4A. They also showed moderate p53 and p21CIP1 expression, keeping vigorous growth rate even at 450 PDL. High level of fibronectin and collagen 1α expression confirmed IMT-1 as normal fibroblasts, although one X chromosome had been lost. ULT-1, however, kept a near normal karyotypes and had shortening of telomere length, high expression of p16INK4A, moderate levels of senescence associated-β-galactosidase positive cells and decreased growth rate only after 150 PDs (population doublings), and finally reached senescence at 166 PDL with morphology of normal senescent fibroblasts. As resources of standard normal human cell, abundant vials of early and middle passages of ULT-1 have been stocked. The use of the cell line is discussed, focusing on isograft of artificial skin and screening of anti-aging or safe chemical agents.

  19. Survival of human osteosarcoma cells and normal human fibroblasts following alpha particle irradiation

    International Nuclear Information System (INIS)

    Lloyd, E.L.; Gemmell, M.A.

    1981-01-01

    Cell survival of human osteosarcoma cells in culture following alpha particle irradiation is reported here for the first time. The osteosarcoma cell line (TE-85) is found to be less sensitive to inactivation by 5.6 MeV alpha particles (LET 86 keV/μm) than normal diploid human fibroblasts (NFS). Values for the mean lethal doses were estimated to be 103 rads for the TE-85 cells compared with 68 rads for the NFS cultures irradiated under identical conditions. It is postulated that the aneuploidy of the tumor cells with increased DNA chromosomal material may confer a selective advantage for the survival of tumor cells relative to normal cells with diploid chromosomes

  20. Biochemical mechanisms of skin radiation burns inhibition and healing by the volumetric autotransplantation of fibroblasts and of keratinocytes with fibroblasts composition

    Directory of Open Access Journals (Sweden)

    L. V. Altukhova

    2015-09-01

    Full Text Available Mechanisms of influence of volumetric autotransplantation of fibroblasts and of the mixture of fibroblasts and keratinocytes on the development of the local 3rd degree X-ray burn and the radiation skin ulcer in guinea pigs were investigated. We used deepadministration into the irradiation zone on its perimeter of 6 doses, which contained (150–160×103 fibroblasts and (130–140×103 keratinocytes in 100 µl. It is shown that this autotransplantation carried out 1 hour after the irradiation, and then every 24 hours, reduces the area of burn on the 35th day, compared to the control by 63%. Radiation ulcer appears on the 10th day after irradiation and is completely healed on the 25th day. With the same regimen of administration of only fibroblasts containing (200–210×103 cells in 100 µl, these parameters of treatment were equal to 31% on 4th and 35th day, respectively. It is shown that as a result of radiation in the area of burn the level of gene expression of collagen types I and III, elastin, fibronectin, vinculin, decorin, hyaluronansynthases 1, 2, 3, matrix metalloproteinases 1, 2, 3, 7, 9 and hyaluronidase is reduced. Besides, in the burn area the level of gene expression of transforming growth factor α, fibroblast growth factors 1, 2, 8 and anti-inflammatory cytokines – interleukin 10 and transforming growth factor-β1 – is reduced, while the level of gene expression of proinflammatory cytokine (interleykin1β increases. Both types of autotransplantation cause the growth of the expression level of all the structural genes and regulatory proteins of biopolymers and decrease in the expression level of interleukin 1β, which leads to activation of tissue regeneration and healing of the burn wound. Reasonsfor the higher efficiency of autotransplantation using the mixture of fibroblasts and keratinocytes compared to autotransplantation by fibroblasts only are both the larger total number of live cells regularly replacing dead cells in

  1. Pathways of sphingomyelin metabolism in cultured fibroblasts from normal and sphingomyelin lipidosis subjects.

    Science.gov (United States)

    Spence, M W; Clarke, J T; Cook, H W

    1983-07-25

    The metabolism of endogenous sphingomyelin labeled with 32P or [methyl-3H]choline and of exogenous [choline-methyl-3H], [32P]-, or [N-acyl-1-14C]sphingomyelin was studied in normal and Niemann-Pick Type A (NP-A) cultured fibroblasts. Despite a greater than 96% decrease in lysosomal sphingomyelinase activity in the NP-A cells, they were able to degrade endogenously produced [32P]- or [methyl-3H]sphingomyelin at normal or near normal rates. Exogenous [methyl-3H]-, [methyl-3H, 32P]-, and [methyl-3H, N-acyl-1-14C] sphingomyelin was taken up intact by normal and NP-A cells, with NP-A cells accumulating 4-8 times more lipid. By 20 h, 50% of the control cell-associated 3H and 32P was recovered in lecithin, and the ratio of activities (3H/32P) indicated most of the phosphorylcholine derived from sphingomyelin had been transferred intact. By comparison in NP-A cells, after a 40-h incubation only 20% of the labeled phosphorylcholine derived from sphingomyelin was recovered in lecithin. With both cell lines, 20 to 50 times more sphingomyelin was hydrolyzed than was taken up by the cells; the reaction products in the medium were ceramide and a mixture of water-soluble compounds such as phosphorylcholine and choline. These results indicate that there are at least two metabolic pathways for sphingomyelin modification in cultured fibroblasts in addition to degradation by the lysosomal acid sphingomyelinase. One route is hydrolysis by a cellular sphingomyelinase. The second is the hydrolysis and/or transfer of phosphorylcholine from sphingomyelin and results in the synthesis of lecithin.

  2. In vitro sensitivity of normal and hereditary retinoblastoma fibroblasts to DNA-damaging agents

    International Nuclear Information System (INIS)

    Woods, W.G.; Byrne, T.D.

    1986-01-01

    We investigated the ability of nine fibroblast cell strains from patients with the hereditary form of retinoblastoma (RB) to handle various types of DNA-damaging agents and compared the results with those obtained in nine normal strains. Cell strains were exposed to gamma-radiation, which causes DNA scission; actinomycin D, a DNA-intercalating agent; and mitomycin C, a bifunctional alkylating agent leading to DNA-DNA cross-linking. Cell strains were studied for their ability to survive in a cytotoxicity assay. Nine normal strains exhibited a mean D0 (inverse of the slope of the straight line portion of the survival curve) of 134-178 cGy after radiation exposure, compared to a range of 119-186 cGy in the nine RB strains (P = 0.33). Similarly, exposure to actinomycin D led to D0 values of 0.024-0.069 microgram/ml in the nine normal strains and D0 values of 0.016-0.067 microgram/ml in the RB strains (P = 0.64). The nine RB strains did exhibit a small overall increase in sensitivity after exposure to mitomycin C, with D0 values ranging from 0.14-0.32 microgram/ml versus 0.19-0.66 microgram/ml in the nine normal strains (P = 0.002); however, when the two most resistant normal strains were excluded from analysis, results were similar. Three RB cell strains derived from individuals who had either developed second cancers or who had a family history of additional sarcomas consistently exhibited increases in sensitivity to all three DNA-damaging agents studied compared with other hereditary RB cell strains as well as normal strains. The results suggest that normal human fibroblast cell strains exhibit a wide response to DNA-damaging agents, especially chemical agents. Most hereditary RB strains exhibit sensitivity well within the normal range; however, strains from RB patients predisposed to second cancers exhibit increases in sensitivity to DNA-damaging agents

  3. Calmodulin and calmodulin-binding proteins in cystic fibrosis and normal human fibroblasts

    International Nuclear Information System (INIS)

    Tallant, E.A.; Wallace, R.W.

    1986-01-01

    The authors have investigated the possibility that a lesion in a calmodulin (CaM)-dependent regulatory mechanism may be involved in cystic fibrosis (CF). The level of CaM, CaM-binding proteins (CaM-BP) and a CaM-dependent phosphatase (CaM-Ptase) have been compared in cultured fibroblasts from CF patients versus age- and sex-matched control subjects. The CaM concentration, measured by radioimmunoassay, ranged from 0.20 to 0.76 μg/mg protein (n=8); there was no significant difference in the average CaM concentration from CF patients vs controls. Using Western blotting techniques with 125 I-CaM, they detected at least ten distinct CaM-BPs in fibroblasts with molecular weights ranging from 230K to 37K; the only consistent difference between control and CF cell lines was in a 46.5K CaM-BP, which was depressed in all three CF samples. The 46.5 K CaM-BP was found only in the particulate fraction. A 59K CaM-BP was identified as a CaM-Ptase by its crossreactivity with an antibody against a brain CaM-Ptase. There was no significant difference in CaM-Ptase activity or in the amount of the phosphatase as determined by radioimmunoassay in CF vs. normal samples (n=8). Thus, the level of CaM as well as its various enzymes and proteins do not appear to be altered in CF fibroblasts except for a CaM-BP of 46.5K, the identity of which is currently being investigated

  4. Immortalization of normal human fibroblasts by treatment with 4-nitroquinoline 1-oxide.

    Science.gov (United States)

    Bai, L; Mihara, K; Kondo, Y; Honma, M; Namba, M

    1993-02-01

    Normal human fibroblasts (the OUMS-24 strain), derived from a 6-week-old human embryo, were transformed (into the OUMS-24F line) and immortalized by repeated treatments (59 times) with 4-nitroquinoline 1-oxide (4NQO). Treatment began during primary culture and ended at the 51st population doubling level (PDL). At the 57th PDL (146 days after the last treatment), morphologically altered, epithelial-type cells appeared, began to grow and became immortal (now past the 100th PDL). However, the control fibroblasts, which were not treated with 4NQO, senesced at the 62nd PDL. The finding that extensive, repeated treatments with 4NQO are required for the immortalization of normal human cells, indicates that multiple mutational events are involved in the immortalization of human cells in general. In other words, immortalization itself seems to be a multi-step process. Karyotypic analysis showed that many cells were hypodiploid before immortalization, but that afterwards chromosomes were distributed broadly in the diploid to tetraploid regions. The immortalized cells showed amplification and enhanced expression of c-myc. Two-dimensional electrophoretic analysis showed that the number of disappearing cellular proteins was greater than the number of the newly appearing ones after the cells became immortalized. Since the immortalized cells showed neither anchorage-independent growth nor tumorigenicity, they are useful for studying factors that can contribute to multi-step carcinogenesis in human cells. In addition, genetically matched normal (OUMS-24) and immortalized (OUMS-24F) cells will be useful for analyzing the genes related to cellular mortality and immortalization.

  5. Studies of DNA and chromosome damage in skin fibroblasts and blood lymphocytes from psoriasis patients treated with 8-methoxypsoralen and UVA irradiation

    International Nuclear Information System (INIS)

    Bredberg, A.; Lambert, B.; Lindblad, A.; Swanbeck, G.; Wennersten, G.

    1983-01-01

    Exposure of human lymphocytes and skin fibroblasts in vitro to a single, clinically used dose of PUVA, i.e., 0.1 micrograms/ml of 8-methoxypsoralen (8-MOP) plus 0.9-4 J/cm2 of longwave ultraviolet radiation (UVA), lead to the formation of DNA damage as determined by alkaline elution, and to chromosome aberrations and sister chromatid exchanges (SCE). When lymphocyte-enriched plasma was obtained from psoriasis patients 2 h after oral intake of 8-MOP and then UVA irradiated (1.8-3.6 J/cm2) in vitro, an increased frequency of chromosome aberrations and SCE was observed. Normal levels of chromosome aberrations and SCE were found in lymphocytes of psoriasis patients after 3-30 weeks of PUVA treatment in vivo. A small but statistically significant increase in the SCE frequency was observed in the lymphocytes of psoriasis patients treated for 1-6 years with PUVA (mean 18.0 SCE/cell) as compared with before PUVA (mean 15.8, p less than 0.05). Skin fibroblasts of psoriasis patients analyzed 5 years after the start of PUVA treatment showed a normal number of SCE but a high fraction of filter-retained DNA in the alkaline elution assay, suggesting the presence of cross-linked DNA

  6. Effects of hyperthermia and ionizing radiation in normal and ataxia telangiectasia human fibroblast lines

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Chan, A.; Smith, B.P.; Child, S.D.; Paterson, M.C.

    1984-01-01

    The effects of 45 0 C hyperthermia and γ radiation have been studied in three normal human fibroblast lines (GM38, GM730, WI38) and compared to the effects in two lines derived from patients with the hereditary disease ataxia telangiectasia (AR3BI, AT5BI). All lines, both normal and γ-sensitive AT, showed a similar resistance to killing by heat alone, suggesting that the defect responsible for the increased radiation sensitivity in AT lines does not confer increased heat sensitivity. Shouldered survival curves were obtained in each case indicating the ability to accumulate sublethal heat damage. All normal and AT cell lines exhibited increased resistance to the lethal effects of heat in response to a thermal stress, indicating that the defect that causes radiosensitivity in AT cell lines does not prevent the induction of thermotolerance. It was hypothesized that in normal cells, this heat treatment inactivates the process which is already defective in AT lines, and that this process may be required for the proper rejoining of double-strand breaks produced during the repair of other radiation-induced lesions

  7. In vitro radiation response studies on bone marrow fibroblasts (CFU-F) obtained from normal and chronically irradiated dogs

    International Nuclear Information System (INIS)

    Klein, A.K.; Stitzel, K.A.; Greenberg, B.; Woo, L.

    1984-01-01

    The radiation resistance of bone marrow fibroblasts as measured by their proliferative potential was evaluated in chronically irradiated dogs. Bone marrows were obtained from eight dogs that had been chronically irradiated beginning at 21 days of gestation or after birth and eight age-matched controls. Of these irradiated dogs, four were either preleukemic or exhibited frank acute nonlymphocytic leukemia. The other four were clinically normal but demonstrated abnormalities in their marrow that could be attributed to radiation effects and/or other pathologic changes. Fibroblasts from six of the irradiated dogs were significantly more radioresistant than those of their controls. Five of these six dogs subsequently succumbed to hematopathologic disease, while the two irradiated dogs with normal fibroblasts remained clinically normal, suggesting that this observed radioresistance may be linked to the disease process. (author)

  8. Bryostatin and its synthetic analog, picolog rescue dermal fibroblasts from prolonged stress and contribute to survival and rejuvenation of human skin equivalents.

    Science.gov (United States)

    Khan, Tapan K; Wender, Paul A; Alkon, Daniel L

    2018-02-01

    Skin health is associated with the day-to-day activity of fibroblasts. The primary function of fibroblasts is to synthesize structural proteins, such as collagen, extracellular matrix proteins, and other proteins that support the structural integrity of the skin and are associated with younger, firmer, and more elastic skin that is better able to resist and recover from injury. At sub-nanomolar concentrations (0.03-0.3 nM), bryostatin-1 and its synthetic analog, picolog (0.1-10 nM) sustained the survival and activation of human dermal fibroblasts cultured under the stressful condition of prolonged serum deprivation. Bryostatin-1 treatment stabilized human skin equivalents (HSEs), a bioengineered combination of primary human skin cells (keratinocytes and dermal fibroblasts) on an extracellular matrix composed of mainly collagen. Fibroblasts activated by bryostatin-1 protected the structural integrity of HSEs. Bryostatin-1 and picolog prolonged activation of Erk in fibroblasts to promote cell survival. Chronic stress promotes the progression of apoptosis. Dermal fibroblasts constitutively express all components of Fas associated apoptosis, including caspase-8, an initiator enzyme of apoptosis. Prolong bryostatin-1 treatment reduced apoptosis by decreasing caspase-8 and protected dermal fibroblasts. Our data suggest that bryostatin-1 and picolog could be useful in anti-aging skincare, and could have applications in tissue engineering and regenerative medicine. © 2017 Wiley Periodicals, Inc.

  9. Fluorescent-light-induced lethality and DNA repair in normal and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Ritter, M.A.; Williams, J.R.

    1981-01-01

    Cell survival and induction of endonuclease-sensitive sites in DNA were measured in human fibroblast cells exposed to fluorescent light or germicidal ultraviolet light. Cells from a xeroderma pigmentosum patient were hypersensitive to cell killing by fluorescent light, although less so than for germicidal ultraviolet light. Xeroderma pigmentosum cells were deficient in the removal of fluorescent light-induced endonuclease sites that are probably pyrimidine dimers, and both the xeroderma pigmentosum and normal cells removed these sites with kinetics indistinguishable from those for ultraviolet light-induced sites. A comparison of fluorescent with ultraviolet light data demonstrates that there are markedly fewer pyrimidine dimers per lethal event for fluorescent than for ultraviolet light, suggesting a major role for non-dimer damage in fluorescent lethality. (Auth.)

  10. Energetic heavy ions accelerate differentiation in the descendants of irradiated normal human diploid fibroblasts

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Hara, Takamitsu; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced genomic instability has been demonstrated in a variety of endpoints such as delayed reproductive death, chromosome instability and mutations, which occurs in the progeny of survivors many generations after the initial insult. Dependence of these effects on the linear energy transfer (LET) of the radiation is incompletely characterized; however, our previous work has shown that delayed reductions in clonogenicity can be most pronounced at LET of 108 keV/μm. To gain insight into potential cellular mechanisms involved in LET-dependent delayed loss of clonogenicity, we investigated morphological changes in colonies arising from normal human diploid fibroblasts exposed to γ-rays or energetic carbon ions (108 keV/μm). Exposure of confluent cultures to carbon ions was 4-fold more effective at inactivating cellular clonogenic potential and produced more abortive colonies containing reduced number of cells per colony than γ-rays. Second, colonies were assessed for clonal morphotypic heterogeneity. The yield of differentiated cells was elevated in a dose- and LET-dependent fashion in clonogenic colonies, whereas differentiated cells predominated to a comparable extent irrespective of radiation type or dose in abortive colonies. The incidence of giant or multinucleated cells was also increased but much less frequent than that of differentiated cells. Collectively, our results indicate that carbon ions facilitate differentiation more effectively than γ-rays as a major response in the progeny of irradiated fibroblasts. Accelerated differentiation may account, at least in part, for dose- and LET-dependent delayed loss of clonogenicity in normal human diploid cells, and could be a defensive mechanism that minimizes further expansion of aberrant cells

  11. Influence of low-energy laser radiation on normal skin and certain tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Pletnev, S.D.; Karpenko, O.M.

    For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

  12. Full-thickness skin wound healing using autologous keratinocytes and dermal fibroblasts with fibrin: bilayered versus single-layered substitute.

    Science.gov (United States)

    Idrus, Ruszymah Bt Hj; Rameli, Mohd Adha bin P; Low, Kiat Cheong; Law, Jia Xian; Chua, Kien Hui; Latiff, Mazlyzam Bin Abdul; Saim, Aminuddin Bin

    2014-04-01

    Split-skin grafting (SSG) is the gold standard treatment for full-thickness skin defects. For certain patients, however, an extensive skin lesion resulted in inadequacies of the donor site. Tissue engineering offers an alternative approach by using a very small portion of an individual's skin to harvest cells for propagation and biomaterials to support the cells for implantation. The objective of this study was to determine the effectiveness of autologous bilayered tissue-engineered skin (BTES) and single-layer tissue-engineered skin composed of only keratinocytes (SLTES-K) or fibroblasts (SLTES-F) as alternatives for full-thickness wound healing in a sheep model. Full-thickness skin biopsies were harvested from adult sheep. Isolated fibroblasts were cultured using medium Ham's F12: Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, whereas the keratinocytes were cultured using Define Keratinocytes Serum Free Medium. The BTES, SLTES-K, and SLTES-F were constructed using autologous fibrin as a biomaterial. Eight full-thickness wounds were created on the dorsum of the body of the sheep. On 4 wounds, polyvinyl chloride rings were used as chambers to prevent cell migration at the edge. The wounds were observed at days 7, 14, and 21. After 3 weeks of implantation, the sheep were euthanized and the skins were harvested. The excised tissues were fixed in formalin for histological examination via hematoxylin-eosin, Masson trichrome, and elastin van Gieson staining. The results showed that BTES, SLTES-K, and SLTES-F promote wound healing in nonchambered and chambered wounds, and BTES demonstrated the best healing potential. In conclusion, BTES proved to be an effective tissue-engineered construct that can promote the healing of full-thickness skin lesions. With the support of further clinical trials, this procedure could be an alternative to SSG for patients with partial- and full-thickness burns.

  13. Double trisomy mosaic (47,XXX/48,XXX,+13) confirmed by FISH and skin fibroblast culture

    Energy Technology Data Exchange (ETDEWEB)

    Lieber, E.; Grady, V.; Dosik, H. [Interfaith Medical Center, Brooklyn, NY (United States)] [and others

    1994-09-01

    A 4 lb 8 oz female was born to a 49-year-old woman (P1200G12) at 40 weeks. The baby had tetralogy of Fallot, polydactyly, microcephaly, low set simple ears, posterior cleft of the soft palate and overlapping flexion deformities of both hands. The eyes were deep set. The clinical impression was trisomy 13. The baby is not doing well and needs a gastrotomy tube for feeding. Sucking is allright but swallowing is impeded. An MRI showed an anomaly of the corpus callosum. The ophthalmological examination showed no abnormalities. A chromosome study on a 2-day peripheral blood sample resulted in poor growth and poor morphology; however, 20 Giemsa-banded cells revealed a 47,XXX karyotype. A second specimen was obtained to search for mosaicism and a blood smear revealed nuclear projections on the neutrophils. FISH analysis using whole chromosome painting probe (Life Technologies) first identified the extra chromosome number 13, the final results showing five of sixty metaphase cells (8.3%) with trisomy 13. Cytogenetic analysis using Giemsa-banding technique revealed four cells in fifty examined (8.0%) with a 48,XXX,+13 karyotype. In order to further evaluate the mosaicism, cytogenetic analysis of a skin fibroblast culture was performed. Twenty one of twenty three cells examined (91.3%) showed the 48,XXX,+13 karyotype. FISH analysis of the skin biopsy revealed eighteen of twenty cells (90.9%) with the trisomy 13. The FISH technique is an important enhancement to routine cytogenetic studies when they do not immediately correlate with clinical impressions.

  14. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...... modulated the oxidative stress response transcription factor Nrf-2 and its downstream effector haem-oxygenase (HO-1), possibly through the amelioration of the environmental stress induced by the plastic surface of the culturing flasks. Therefore, it is important to consider the role of ECM in modulating...

  15. Radiosensitivity of skin fibroblasts from atomic bomb survivors with and without breast cancer

    International Nuclear Information System (INIS)

    Ban, Sadayuki; Setlow, R.B.; Bender, M.A.

    1990-11-01

    Fibroblasts were established in vitro from skin biopsies obtained from 55 women and one man with or without breast cancer and with or without exposure to radiation from the atomic bomb explosion in Hiroshima. The radiosensitivity of these cells was evaluated by clonogenic assays after exposure to X rays or to fission neutrons from a 252 Cf source. Data were fitted to a multitarget model, S/S 0 = A[1-(1-e kD ) N ], for both X-ray and neutron dose-survival curves. A single-hit model, S/S 0 = Ae kD , fits the neutron dose-survival responses as well. These was no difference in the means or variances of radiosensitivity between exposed and nonexposed groups, or between patients with or without breast cancer. Hence, although the sample is not large, it provides no support for the hypothesis that A-bomb radiation preferentially induces breast cancer in women whose cells in vitro are sensitive to cell killing by radiation. (author)

  16. Surface modification of Polycaprolactone (PCL) microcarrier for performance improvement of human skin fibroblast cell culture

    Science.gov (United States)

    Samsudin, N.; Hashim, Y. Z. H.; Arifin, M. A.; Mel, M.; Salleh, H. Mohd; Sopyan, I.; Hamid, M. Abdul

    2018-01-01

    Polycaprolactone (PCL) has many advantages for use in biomedical engineering field. In the present work PCL microcarriers of 150-200 μm were fabricated using oil-in-water (o/w) emulsification coupled with solvent evaporation method. The surface charge of PCL microcarrier was then been improved by using ultraviolet/ozone treatment to introduce oxygen functional group. Immobilisation of gelatin onto PCL microspheres using zero-length crosslinker provides a stable protein-support complex, with no diffusional barrier which is ideal for mass processing. The optimum concentration of carboxyl group (COOH) absorbed on the surface was 1495.9 nmol/g and the amount of gelatin immobilized was 1797.3 μg/g on UV/O3 treated microcarriers as compared to the untreated (320 μg/g) microcarriers. The absorption of functional oxygen groups on the surface and the immobilized gelatin was confirmed with Fourier Transformed Infrared spectroscopy and the enhancement of hydrophilicity of the surface was confirmed using water contact angle measurement which decreased (86.93° - 49.34°) after UV/O3 treatment and subsequently after immobilisation of gelatin. The attachment and growth kinetics for human skin fibroblast cell (HSFC) showed that adhesion occurred much more rapidly for gelatin immobilised surface as compared to untreated PCL and UV/O3 PCL microcarrier.

  17. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes.

    Science.gov (United States)

    El Ghalbzouri, Abdoelwaheb; Jonkman, Marcel F; Dijkman, Remco; Ponec, Maria

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence of serum and exogenous growth factors. The expression of various BM components was analyzed on the protein and mRNA level. Irrespective of the presence or absence of fibroblasts, keratin 14, hemidesmosomal proteins plectin, BP230 and BP180, and integrins alpha1beta1, alpha2beta1, alpha3beta1, and alpha6beta4 were expressed but laminin 1 was absent. Only in the presence of fibroblasts or of various growth factors, laminin 5 and laminin 10/11, nidogen, uncein, type IV and type VII collagen were decorating the dermal/epidermal junction. These findings indicate that the attachment of basal keratinocytes to the dermal matrix is most likely mediated by integrins alpha1beta1 and alpha2beta1, and not by laminins that bind to integrin alpha6beta4 and that the epithelial-mesenchymal cross-talk plays an important role in synthesis and deposition of various BM components.

  18. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  19. Studies on the formation of lactate and pyruvate from glucose in cultured skin fibroblasts: implications for detection of respiratory chain defects

    NARCIS (Netherlands)

    Wijburg, F. A.; Feller, N.; Scholte, H. R.; Przyrembel, H.; Wanders, R. J.

    1989-01-01

    We investigated the time course of the formation of lactate and pyruvate from glucose in cultured skin fibroblasts from controls, from a patient with a cytochrome c oxidase deficiency and from controls treated with inhibitors of the individual respiratory chain complexes. Fibroblasts from the

  20. A new, simple assay for long-chain acyl-CoA dehydrogenase in cultured skin fibroblasts using stable isotopes and GC-MS

    NARCIS (Netherlands)

    Niezen-Koning, K. E.; Wanders, R. J.; Nagel, G. T.; IJlst, L.; Heymans, H. S.

    1992-01-01

    In this paper, we present a new method for measurement of long-chain acyl-CoA dehydrogenase (LCAD) activities in cultured skin fibroblasts. The method is based upon gas chromatographic/mass spectrometric determination of 3-OH-hexadecanoic acid formed during incubation of fibroblasts in a medium

  1. Enhanced reactivation and mutagenesis of UV-irradiated adenovirus in normal human fibroblasts

    International Nuclear Information System (INIS)

    Bennett, C.B.; Rainbow, A.J.

    1988-01-01

    UV-enhanced reactivation (UVER) and UV-enhanced mutagenesis (UVEM) for two adenovirus temperature-sensitive mutants were examined following the infection of normal human fibroblasts. UV-irradiation of the virus alone resulted in dose-dependent increase in the UV-induced reversion frequency (RF) of viral progeny and a dose-dependent exponential decrease in progeny survival, when infecting non-irradiated cells. Analysis of the slopes of the UV-induced reversion curves suggested that 2.5 ± 0.3 and 2.4 ± 0.5 'hits' were required to produce a targeted reversion event among the viral progeny of Ad5ts36 and Ad5ts125 respectively. UV-irradiation of cells 24 h prior to infection resulted in a significant increase in progeny survival for UV-irradiated virus (UVER factor = 3.4 ± 0.8) concomitant with a significant increase in RF for UV-irradiated virus (targeted increase = 1.9 ± 0.3). The UV-induced RF per lethal hit to the virus was also significantly greater in UV-irradiated compared with non-irradiated cells. These results are consistent with the existence of a UV-inducible error-prone DNA repair mechanism in normal human cells. (author)

  2. Frequent induction of chromosomal aberrations in in vivo skin fibroblasts after allogeneic stem cell transplantation: hints to chromosomal instability after irradiation

    International Nuclear Information System (INIS)

    Massenkeil, G.; Zschieschang, P.; Thiel, G.; Hemmati, P. G.; Budach, V.; Dörken, B.; Pross, J.; Arnold, R.

    2015-01-01

    Total body irradiation (TBI) has been part of standard conditioning regimens before allogeneic stem cell transplantation for many years. Its effect on normal tissue in these patients has not been studied extensively. We studied the in vivo cytogenetic effects of TBI and high-dose chemotherapy on skin fibroblasts from 35 allogeneic stem cell transplantation (SCT) patients. Biopsies were obtained prospectively (n = 18 patients) before, 3 and 12 months after allogeneic SCT and retrospectively (n = 17 patients) 23–65 months after SCT for G-banded chromosome analysis. Chromosomal aberrations were detected in 2/18 patients (11 %) before allogeneic SCT, in 12/13 patients (92 %) after 3 months, in all patients after 12 months and in all patients in the retrospective group after allogeneic SCT. The percentage of aberrant cells was significantly higher at all times after allogeneic SCT compared to baseline analysis. Reciprocal translocations were the most common aberrations, but all other types of stable, structural chromosomal aberrations were also observed. Clonal aberrations were observed, but only in three cases they were detected in independently cultured flasks. A tendency to non-random clustering throughout the genome was observed. The percentage of aberrant cells was not different between patients with and without secondary malignancies in this study group. High-dose chemotherapy and TBI leads to severe chromosomal damage in skin fibroblasts of patients after SCT. Our long-term data suggest that this damage increases with time, possibly due to in vivo radiation-induced chromosomal instability

  3. The Possible Pre- and Post-UVA Radiation Protective Effect of Amaranth Oil on Human Skin Fibroblast Cells.

    Science.gov (United States)

    Wolosik, Katarzyna; Zareba, Ilona; Surazynski, Arkadiusz; Markowska, Agnieszka

    2017-07-01

    The health effects of Amaranth Oil (AO) are attributed to its specific chemical composition. That makes it an outstanding natural product for the prevention and treatment of ultraviolet (UV) irradiation-related pathologies such as sunburn, photoaging, photoimmunosuppression, and photocarcinogenesis. Most of the studies are taken on animal model, and there is a lack of research on the endogenous effect of AO on fibroblast level, where UVA takes it harmful place. The aim of this study was evaluation if AO can protect or abolish UVA exposure effect on human skin fibroblast. The 0.1% AO, 0.25% AO, and 0.5% AO concentration and irradiation for 15 min under UVA-emitting lamp were studied in various condition. In all experiments, the mean values for six assays ± standard deviations were calculated. Pretreatment with various concentrations of AO was tested. The highest concentration of AO where cell survival was observed was 0.5%. Cytotoxicity assays provided evidence for pre- and post-UVA protective effect of 0.1% AO among three tested concentrations. The results also provide evidence that UVA has inhibitory effect on collagen biosynthesis in confluent skin fibroblast, but presence of 0.1% AO abolishes pre- and post-UVA effect comparing to other used AO concentration. The assessment results on DNA biosynthesis show the significant abolished post-UVA effect when 0.1% and 0.5% of AO were added. AO gives pre- and post-UVA protection in low concentration. This provides the evidence for using it not as a main protective factor against UV but as one of the combined components in cosmetic formulation. The recommended Amaranth Oil (AO) concentration in cosmetic formulation is between 0.1 and 5%Pretreatment with various concentrations of AO suggests to use the highest 0.5% concentration of AO in human skin fibroblast culturesThe 0.1% of AO in fibroblast cultures, protects and abolishes effect of ultraviolet A (UVA) exposureUVA has inhibitory effect on collagen biosynthesis in

  4. PKCδ inhibition normalizes the wound-healing capacity of diabetic human fibroblasts.

    Science.gov (United States)

    Khamaisi, Mogher; Katagiri, Sayaka; Keenan, Hillary; Park, Kyoungmin; Maeda, Yasutaka; Li, Qian; Qi, Weier; Thomou, Thomas; Eschuk, Danielle; Tellechea, Ana; Veves, Aris; Huang, Chenyu; Orgill, Dennis Paul; Wagers, Amy; King, George L

    2016-03-01

    Abnormal fibroblast function underlies poor wound healing in patients with diabetes; however, the mechanisms that impair wound healing are poorly defined. Here, we evaluated fibroblasts from individuals who had type 1 diabetes (T1D) for 50 years or more (Medalists, n = 26) and from age-matched controls (n = 7). Compared with those from controls, Medalist fibroblasts demonstrated a reduced migration response to insulin, lower VEGF expression, and less phosphorylated AKT (p-AKT), but not p-ERK, activation. Medalist fibroblasts were also functionally less effective at wound closure in nude mice. Activation of the δ isoform of protein kinase C (PKCδ) was increased in postmortem fibroblasts from Medalists, fibroblasts from living T1D subjects, biopsies of active wounds of living T1D subjects, and granulation tissues from mice with streptozotocin-induced diabetes. Diabetes-induced PKCD mRNA expression was related to a 2-fold increase in the mRNA half-life. Pharmacologic inhibition and siRNA-mediated knockdown of PKCδ or expression of a dominant-negative isoform restored insulin signaling of p-AKT and VEGF expression in vitro and improved wound healing in vivo. Additionally, increasing PKCδ expression in control fibroblasts produced the same abnormalities as those seen in Medalist fibroblasts. Our results indicate that persistent PKCδ elevation in fibroblasts from diabetic patients inhibits insulin signaling and function to impair wound healing and suggest PKCδ inhibition as a potential therapy to improve wound healing in diabetic patients.

  5. Growth properties and growth factor responsiveness in skin fibroblasts from centenarians.

    Science.gov (United States)

    Tesco, G; Vergelli, M; Grassilli, E; Salomoni, P; Bellesia, E; Sikora, E; Radziszewska, E; Barbieri, D; Latorraca, S; Fagiolo, U; Santacaterina, S; Amaducci, L; Tiozzo, R; Franceschi, C; Sorbi, S

    1998-03-27

    Human fibroblast cultures, which have a finite replicative lifespan in vitro, are the most widely used model for the study of senescence at the cellular level. An inverse relationship between replicative capability and donor age has been reported in human fibroblast strains. We studied the growth capacity of fibroblast primary cultures derived from people whose lifespan was as closer as possible to the expected maximum human lifespan, i.e. people over one hundred. Our data suggest that outgrowth of fibroblasts from biopsies, growth kinetics at different population doubling levels, capability to respond to a classical mitogenic stimulus (such as 20% serum) and a variety of growth factors, were remarkably similar in fibroblasts from centenarians and young controls. On the whole, our data challenge the tenet of a simple and strict relationship between in vivo aging and in vitro proliferative capability of human fibroblasts, at least at the individual level.

  6. Skin equivalent tissue-engineered construct: co-cultured fibroblasts/ keratinocytes on 3D matrices of sericin hope cocoons.

    Directory of Open Access Journals (Sweden)

    Sunita Nayak

    Full Text Available The development of effective and alternative tissue-engineered skin replacements to autografts, allografts and xenografts has became a clinical requirement due to the problems related to source of donor tissue and the perceived risk of disease transmission. In the present study 3D tissue engineered construct of sericin is developed using co-culture of keratinocytes on the upper surface of the fabricated matrices and with fibroblasts on lower surface. Sericin is obtained from "Sericin Hope" silkworm of Bombyx mori mutant and is extracted from cocoons by autoclave. Porous sericin matrices are prepared by freeze dried method using genipin as crosslinker. The matrices are characterized biochemically and biophysically. The cell proliferation and viability of co-cultured fibroblasts and keratinocytes on matrices for at least 28 days are observed by live/dead assay, Alamar blue assay, and by dual fluorescent staining. The growth of the fibroblasts and keratinocytes in co-culture is correlated with the expression level of TGF-β, b-FGF and IL-8 in the cultured supernatants by enzyme-linked immunosorbent assay. The histological analysis further demonstrates a multi-layered stratified epidermal layer of uninhibited keratinocytes in co-cultured constructs. Presence of involucrin, collagen IV and the fibroblast surface protein in immuno-histochemical stained sections of co-cultured matrices indicates the significance of paracrine signaling between keratinocytes and fibroblasts in the expression of extracellular matrix protein for dermal repair. No significant amount of pro inflammatory cytokines (TNF-α, IL-1β and nitric oxide production are evidenced when macrophages grown on the sericin matrices. The results all together depict the potentiality of sericin 3D matrices as skin equivalent tissue engineered construct in wound repair.

  7. Comparison of the transcriptomes of mouse skin derived precursors (SKPs and SKP-derived fibroblasts (SFBs by RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Yujie Mao

    Full Text Available Skin-derived precursors (SKPs from dermis possess the capacities of self-renewal and multipotency. In vitro and in vivo studies demonstrated that they can differentiate into fibroblasts. However, little is known about the molecular mechanism of the differentiation of SKPs into fibroblasts. Here we compare the transcriptomes of mouse SKPs and SKP-derived fibroblasts (SFBs by RNA-Seq analysis, trying to find differences in gene expression between the two kinds of cells and then elucidate the candidate genes that may play important roles in the differentiation of SKPs into fibroblasts. A total of 1971 differentially expressed genes (DEGs were identified by RNA-Seq, which provided abundant data for further analysis. Gene Ontology enrichment analysis revealed that genes related to cell differentiation, cell proliferation, protein binding, transporter activity and membrane were significantly enriched. The most significantly up-regulated genes Wnt4, Wisp2 and Tsp-1 and down-regulated genes Slitrk1, Klk6, Agtr2, Ivl, Msx1, IL15, Atp6v0d2, Kcne1l and Thbs4 may play important roles in the differentiation of SKPs into fibroblasts. KEGG analysis showed that DEGs were significantly enriched in the TGF-β signaling pathway, Wnt signaling pathway and Notch signaling pathway, which have been previously proven to regulate the differentiation and self-renewal of various stem cells. These identified DEGs and pathways could facilitate further investigations of the detailed molecular mechanisms, making it possible to take advantage of the potential therapeutic applications of SKPs in skin regeneration in the future.

  8. Charged-particle mutagenesis 2. Mutagenic effects of high energy charged particles in normal human fibroblasts

    Science.gov (United States)

    Chen, D. J.; Tsuboi, K.; Nguyen, T.; Yang, T. C.

    1994-01-01

    The biological effects of high Linear Energy Transfer (LET) charged particles are a subject of great concern with regard to the prediction of radiation risk in space. In this report, mutagenic effects of high LET charged particles are quantitatively measured using primary cultures of human skin fibroblasts, and the spectrum of induced mutations are analyzed. The LET of the charged particles ranged from 25 KeV/micrometer to 975 KeV/micrometer with particle energy (on the cells) between 94-603 MeV/u. The X-chromosome linked hypoxanthine guanine phosphoribosyl transferase (hprt) locus was used as the target gene. Exposure to these high LET charged particles resulted in exponential survival curves; whereas, mutation induction was fitted by a linear model. The Relative Biological Effect (RBE) for cell-killing ranged from 3.73 to 1.25, while that for mutant induction ranged from 5.74 to 0.48. Maximum RBE values were obtained at the LET of 150 keV/micrometer. The inactivation cross-section (alpha i) and the action cross-section for mutant induction (alpha m) ranged from 2.2 to 92.0 sq micrometer and 0.09 to 5.56 x 10(exp -3) sq micrometer respectively. The maximum values were obtained by Fe-56 with an LET of 200 keV/micrometer. The mutagenicity (alpha m/alpha i) ranged from 2.05 to 7.99 x 10(exp -5) with the maximum value at 150 keV/micrometer. Furthermore, molecular analysis of mutants induced by charged particles indicates that higher LET beams are more likely to cause larger deletions in the hprt locus.

  9. Charged-particle mutagenesis II. Mutagenic effects of high energy charged particles in normal human fibroblasts

    Science.gov (United States)

    Chen, D. J.; Tsuboi, K.; Nguyen, T.; Yang, T. C.

    1994-01-01

    The biological effects of high LET charged particles are a subject of great concern with regard to the prediction of radiation risk in space. In this report, mutagenic effects of high LET charged particles are quantitatively measured using primary cultures of human skin fibroblasts, and the spectrum of induced mutations are analyzed. The LET of the charged particles ranged from 25 KeV/micrometer to 975 KeV/micrometer with particle energy (on the cells) between 94-603 MeV/u. The X-chromosome linked hypoxanthine guanine phosphoribosyl transferase (hprt) locus was used as the target gene. Exposure to these high LET charged particles resulted in exponential survival curves; whereas, mutation induction was fitted by a linear model. The Relative Biological Effect (RBE) for cell-killing ranged from 3.73 to 1.25, while that for mutant induction ranged from 5.74 to 0.48. Maximum RBE values were obtained at the LET of 150 keV/micrometer. The inactivation cross-section (alpha i) and the action cross-section for mutant induction (alpha m) ranged from 2.2 to 92.0 micrometer2 and 0.09 to 5.56 x 10(-3) micrometer2, respectively. The maximum values were obtained by 56Fe with an LET of 200 keV/micrometer. The mutagenicity (alpha m/alpha i) ranged from 2.05 to 7.99 x 10(-5) with the maximum value at 150 keV/micrometer. Furthermore, molecular analysis of mutants induced by charged particles indicates that higher LET beams are more likely to cause larger deletions in the hprt locus.

  10. The fate of radiation induced giant-nucleated cells of human skin fibroblasts

    Science.gov (United States)

    Almahwasi, A. A.; Jeynes, J. C.; Bradley, D. A.; Regan, P. H.

    2017-11-01

    Radiation-induced giant-nucleated cells (GCs) have been observed to occur within survivors of irradiated cancerous and within healthy cells, both in vivo and in vitro. The expression of such morphological alterations is associated with genomic instability. This study was designed to investigate the fate of GCs induced in a normal human fibroblast cell line (AG1522) after exposure to 0.2, 1 or 2 Gy of X-ray or proton irradiation. The total of 79 individual AG1522 GCs present at 7, 14 or 21 days after each dose point were analysed from fluorescence microscopy images captured over approximately 120 h. The GCs were identified at the beginning of the observation period for each time point post-irradiation and the area of the cell nucleus was measured (μm2) using a cell-recognition MATLAB code. The results demonstrate that the majority of GCs had undergone a prolonged mitotic arrest, which might be an indication of the survival strategy. The live cell microscopy confirms that a giant-nucleated cell formed 14 days after exposure to 0.2 Gy of proton irradiation was divided into two asymmetrical normal-sized cells. These results suggest that a small fraction of GCs can proliferate and form progeny. Some of GCs had disappeared from the microscopy fields. The rate of their loss was decreased as the dose increased but there remains the potential for them to have progeny that could continue to proliferate, ultimately contributing to development of cancer risk. This important method to access delayed effects in normal tissues could act as a potential radioprotective assay for a dose-limiting parameter when applying radiotherapy. These results might have important implications in evaluating risk estimates for patients during radiation therapy treatment.

  11. Estimation of low-dose radiation-responsive proteins in the absence of genomic instability in normal human fibroblast cells.

    Science.gov (United States)

    Yim, Ji-Hye; Yun, Jung Mi; Kim, Ji Young; Nam, Seon Young; Kim, Cha Soon

    2017-11-01

    Low-dose radiation has various biological effects such as adaptive responses, low-dose hypersensitivity, as well as beneficial effects. However, little is known about the particular proteins involved in these effects. Here, we sought to identify low-dose radiation-responsive phosphoproteins in normal fibroblast cells. We assessed genomic instability and proliferation of fibroblast cells after γ-irradiation by γ-H2AX foci and micronucleus formation analyses and BrdU incorporation assay, respectively. We screened fibroblast cells 8 h after low-dose (0.05 Gy) γ-irradiation using Phospho Explorer Antibody Microarray and validated two differentially expressed phosphoproteins using Western blotting. Cell proliferation proceeded normally in the absence of genomic instability after low-dose γ-irradiation. Phospho antibody microarray analysis and Western blotting revealed increased expression of two phosphoproteins, phospho-NFκB (Ser536) and phospho-P70S6K (Ser418), 8 h after low-dose radiation. Our findings suggest that low-dose radiation of normal fibroblast cells activates the expression of phospho-NFκB (Ser536) and phospho-P70S6K (Ser418) in the absence of genomic instability. Therefore, these proteins may be involved in DNA damage repair processes.

  12. Multistep carcinogenesis of normal human fibroblasts. Human fibroblasts immortalized by repeated treatment with Co-60 gamma rays were transformed into tumorigenic cells with Ha-ras oncogenes.

    Science.gov (United States)

    Namba, M; Nishitani, K; Fukushima, F; Kimoto, T

    1988-01-01

    Two normal mortal human fibroblast cell strains were transformed into immortal cell lines, SUSM-1 and KMST-6, by treatment with 4-nitroquinoline 1-oxide (4NQO) and Co-60 gamma rays, respectively. These immortalized cell lines showed morphological changes of cells and remarkable chromosome aberrations, but neither of them grew in soft agar or formed tumors in nude mice. The immortal cell line, KMST-6, was then converted into neoplastic cells by treatment with Harvey murine sarcoma virus (Ha-MSV) or the c-Ha-ras oncogene derived from a human lung carcinoma. These neoplastically transformed cells acquired anchorage-independent growth potential and developed tumors when transplanted into nude mice. All the tumors grew progressively without regression until the animals died of tumors. In addition, the tumors were transplantable into other nude mice. Normal human fibroblasts, on the other hand, were not transformed into either immortal or tumorigenic cells by treatment with Ha-MSV or c-Ha-ras alone. Our present data indicate that (1) the chemical carcinogen, 4NQO, or gamma rays worked as an initiator of carcinogenesis in normal human cells, giving rise to immortality, and (2) the ras gene played a role in the progression of the immortally transformed cells to more malignant cells showing anchorage-independent growth and tumorigenicity. In other words, the immortalization process of human cells seems to be a pivotal or rate-limiting step in the carcinogenesis of human cells.

  13. Cytotoxic and mutagenic effects of high let charged particles on human skin fibroblasts

    International Nuclear Information System (INIS)

    Tsuboi, Koji.; Park, M.S.; Chen, D.J.; Yang, T.C.

    1992-01-01

    Cytotoxic and mutagenic effects of high LET charged particles were quantitatively measured using primary cultures of human skin fibroblasts. The span of LETs selected were from 25 keV/μm(330 MeV/u) to 920 keV/μm (600 MeV/u). Mutations were scored at the hypoxanthine-guanine phosphoribosyl transferase (HPRT) locus using 6-thioguanine (6-TG) for selection. Exposure to these high LET charged particles resulted in exponential survival curves whereas mutant induction was fitted by a linear model. The Relative Biological Effect (RBE) for cell-killing ranged from 3.73 to 1.25, while that for mutant induction ranged from 5.74 to 0.48. Maximum RBE values were obtained at the LET of 150 keV/μm. The inactivation cross-section (σ i ) and the action cross-section for mutant induction (σ m ) ranged from 2.2 to 92.0 μm 2 and 0.09 to 5.56 x 10 -3 μm 2 respectively, the maximum values were obtained by 56 Fe with an LET of 200 keV/μm. The mutagenicity (σ m /σ i ) ranged from 2.05 to 7.99 x 10 -5 with the maximum value at 150 keV/μm. Furthermore, the results of multiplex polymerase chain reaction (PCR) of some of the mutants induced by charged particles indicate that higher LET beams are more likely to cause larger deletions in the hprt locus. (author)

  14. Bone marrow stromal elements in murine leukemia; Decreased CSF-producing fibroblasts and normal IL-1 expression by macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Ishay, Z [Laboratory of Experimental Hematology, Department of Anatomy and Embryology, Hebrew University-Hadassah Medical School (Israel); Barak, V [Laboratory of Immunology, Department of Oncology, Hadassah University Hospital (Israel); Shoshan, S [Faculty of Dental Medicine, Connective Tissue Research Laboratory, Hebrew University, Jerusalem (Israel); Prindull, G [Department of Pediatrics, University of Gottingen, Gottingen (Germany, F.R.)

    1990-01-01

    A study of bone marrow stromal elements in murine acute myeloid leukemia (AML) was carried out. Our previous studies had indicated marrow stromal deficiency in murine AML. In the current investigation, separate stromal cells were cultured and the results obtained have shown that, while marrow stromal macrophages are normal in leukemia and express adequate amounts of IL-1, the fibroblasts are markedly reduced. However, if sufficient fibroblasts are pooled in vitro, they produce adequate amounts of CSF. Test of TNF{alpha} in leukemic cells CM, as possible cause of marrow stromal inhibition in leukemia, had not disclosed this cytokine. Further, it was observed that total body lethal irradiation of leukemic mice aggravates the stromal deficiency, confirming results of our previous investigations. It is concluded that bone marrow stromal deficiency in murine AML is due to decreased fibroblasts and, implicity, reduced CSF production. (author).

  15. Post-UV colony-forming ability of normal fibroblast strains and of the xeroderma pigmentosum group G strain

    International Nuclear Information System (INIS)

    Barrett, S.F.; Tarone, R.E.; Moshell, A.N.; Ganges, M.B.; Robbins, J.H.

    1981-01-01

    In xeroderma pigmentosum, an inherited disorder of defective DNA repair, post-uv colony-forming ability of fibroblasts from patients in complementation groups A through F correlates with the patients' neurological status. The first xeroderma pigmentosum patient assigned to the recently discovered group G had the neurological abnormalities of XP. Researchers have determined the post-uv colony-forming ability of cultured fibroblasts from this patient and from 5 more control donors. Log-phase fibroblasts were irradiated with 254 nm uv light from a germicidal lamp, trypsinized, and replated at known densities. After 2 to 4 weeks' incubation the cells were fixed, stained and scored for colony formation. The strains' post-uv colony-forming ability curves were obtained by plotting the log of the percent remaining post-uv colony-forming ability as a function of the uv dose. The post-uv colony-forming ability of 2 of the 5 new normal strains was in the previously defined control donor zone, but that of the other 3 extended down to the level of the most resistant xeroderma pigmentosum strain. The post-uv colony-forming ability curve of the group G fibroblasts was not significantly different from the curves of the group D fibroblast strains from patients with clinical histories similar to that of the group G patient

  16. Molecular mechanisms of UVB-induced senescence of dermal fibroblasts and its relevance for photoaging of the human skin.

    Science.gov (United States)

    Cavinato, Maria; Jansen-Dürr, Pidder

    2017-08-01

    Due to its ability to cross the epidermis and reach the upper dermis where it causes cumulative DNA damage and increased oxidative stress, UVB is considered the most harmful component of sunlight to the skin. The consequences of chronic exposition to UVB are related to photoaging and photocarcinogenesis. There are limitations to the study of human skin aging and for this reason the use of models is required. Human dermal fibroblasts submitted to mild and repeated doses of UVB are considered a versatile model to study UVB effects in the process of skin photoaging, which depends on the accumulation of senescent cells, in particular in the dermis. Here we provide updated information about the current model of UVB-induced senescence with special emphasis on the process of protein quality control. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Endogenous glutathione protects human skin fibroblasts against the cytotoxic action of UVB, UVA and near-visible radiations

    International Nuclear Information System (INIS)

    Tyrell, R.M.; Pidoux, Mireille

    1986-01-01

    Both the UVB (290-320 nm) and UVA (320-380 nm) regions of sunlight damage human skin cells but, particularly at the longer wavelengths, information is scant concerning the mechanism(s) of damage induction and the roles of cellular defense mechanisms. Following extensive glutathione depletion of cultured human skin fibroblasts, the cells become strongly sensitized to the cytotoxic action of near-visible (405 nm), UVA (334 nm, 365 nm) and UVB (313 nm) but not UVC (254 nm) radiations. In the critical UVB region, the magnitude of the protection afforded by endogenous glutathione approaches that of the protection provided by excision repair. The results suggest that a significant fraction of even UVB damage can be mediated by free radical attack and that a major role of glutathione in human skin cells is to protect them from the cytotoxic action of sunlight. (author)

  18. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  19. Effect of Fe3O4 Nanoparticles on Skin Tumor Cells and Dermal Fibroblasts

    Directory of Open Access Journals (Sweden)

    Lirija Alili

    2015-01-01

    Full Text Available Iron oxide (Fe3O4 nanoparticles have been used in many biomedical approaches. The toxicity of Fe3O4 nanoparticles on mammalian cells was published recently. Though, little is known about the viability of human cells after treatment with Fe3O4 nanoparticles. Herein, we examined the toxicity, production of reactive oxygen species, and invasive capacity after treatment of human dermal fibroblasts (HDF and cells of the squamous tumor cell line (SCL-1 with Fe3O4 nanoparticles. These nanoparticles had an average size of 65 nm. Fe3O4 nanoparticles induced oxidative stress via generation of reactive oxygen species (ROS and subsequent initiation of lipid peroxidation. Furthermore, the question was addressed of whether Fe3O4 nanoparticles affect myofibroblast formation, known to be involved in tumor invasion. Herein, Fe3O4 nanoparticles prevent the expression alpha-smooth muscle actin and therefore decrease the number of myofibroblastic cells. Moreover, our data show in vitro that concentrations of Fe3O4 nanoparticles, which are nontoxic for normal cells, partially reveal a ROS-triggered cytotoxic but also a pro-invasive effect on the fraction of squamous cancer cells surviving the treatment with Fe3O4 nanoparticles. The data herein show that the Fe3O4 nanoparticles appear not to be adequate for use in therapeutic approaches against cancer cells, in contrast to recently published data with cerium oxide nanoparticles.

  20. The effect of caffeine on X-ray-induced mitotic delay in normal human and ataxia-telangiectasia fibroblasts

    International Nuclear Information System (INIS)

    Zampetti-Bosseler, F.; Scott, D.

    1985-01-01

    The authors previously showed that radiation-sensitive fibroblasts from ataxia-telangiectasia (A-T) patients sustain less G 2 delay after X-irradiation than normal fibroblasts. Caffeine is known to reduce the amount of X-ray-induced delay in various mammalian cell types. It is proposed that A-T cells have an altered chromatin structure, similar to that of caffeine-treated normal cells and that this results in a failure of A-T cells to delay their progression through the cell cycle to allow time for DNA repair. The authors now show that caffeine treatment after X-irradiation reduces G 2 delay in both A-T and normal cells. The authors confirm the results previously obtained on lymphocytes that caffeine potentiates the chromosome-damaging effects of X-rays in both A-T and normal fibroblasts. These and other data suggest that the radiation responses of A-T cells and of caffeine-treated normal cells are caused by different mechanisms. (Auth.)

  1. Ionizing radiation-induced phosphorylation of RPA p34 is deficient in ataxia telangiectasia and reduced in aged normal fibroblasts

    International Nuclear Information System (INIS)

    Xinbo Cheng; Nge Cheong; Ya Wang; Iliakis, George

    1996-01-01

    Replication protein A (RPA, also called human single stranded DNA binding protein, hSSB) is a trimeric, multifunctional protein complex involved in DNA replication, DNA repair and recombination. Phosphorylation of RPA p34 subunit is observed after exposure of cells to radiation and other DNA damaging agents, which implicates the protein not only in repair but also in the regulation of replication on damaged DNA template. Here, we show that the phosphorylation observed in RPA p34 after exposure to ionizing radiation, X- or γ-rays, is reduced and occurs later in primary fibroblasts from patients suffering from ataxia telangiectasia (AT), as compared to normal fibroblasts. We also show that in primary normal human fibroblasts, radiation-induced phosphorylation of RPA p34 is 'age'-dependent and decreases significantly as cultures senesce. Radiation-induced phosphorylation of RPA p34 is nearly absent in non-cycling cells, while the expression of p21 cip1/waf1/sdi1 remains inducible. The results demonstrate a growth-stage and culture-age dependency in radiation-induced RPA p34 phosphorylation, and suggest the operation of a signal transduction pathway that is inactivated in senescing or quiescent fibroblasts and defective in AT cells

  2. Acute leukemia after radiotherapy in a patient with Turcot's syndrome. Impaired colony formation in skin fibroblast cultures after irradiation

    International Nuclear Information System (INIS)

    Li, F.P.; Little, J.B.; Bech-Hansen, N.T.; Paterson, M.C.; Arlett, C.; Garnick, M.B.; Mayer, R.J.

    1983-01-01

    Colonic polyposis and carcinoma developed in a woman with Turcot's syndrome at the age of 31 years; astrocytoma developed when she was 37. Her brother and sister had died of astrocytoma at the ages of 18 and 33 years, respectively. Progressive neutropenia developed in the patient three months after radiotherapy for her brain tumor and acute myelomonocytic leukemia 19 months after treatment. Three laboratories independently evaluated cultures of her skin fibroblasts for in vitro sensitivity to cell killing (loss of colony-forming ability) by x-rays. Survival assays consistently revealed slight but significant radiosensitivity in an early-passage (six to 10 doublings) fibroblast subculture. A later subculture (21 to 29 doublings) showed no abnormality, a possible effect of selective in vitro loss of radiosensitive cells

  3. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  4. Pharmaceutical studies for gene therapy: expression of human Cu, Zn-superoxide dismutase gene transfected by lipofection in rat skin fibroblasts.

    Science.gov (United States)

    Nishiguchi, K; Ishida, K; Nakajima, M; Maeda, T; Komada, F; Iwakawa, S; Tanigawara, Y; Okumura, K

    1996-08-01

    To evaluate whether lipofection using Lipofectin is suitable for delivering foreign genes into skin fibroblasts as target cells, we performed experiments using human superoxide dismutase (hSOD) and neomycin-resistance (Neo) genes as models in rat skin fibroblasts (FR and primary cells) in vitro. The amounts of DNA used in the lipofection procedure significantly affected the transfection efficiencies, and the optimal amounts were determined for all cells used. However, the efficiencies in rat skin fibroblasts were about 20-fold higher than that in rat lung epithelial-like cells (L2 cells). The differences in plasmid vectors (pRc/RSV-SOD and pRc/CMV-SOD) hardly affected the transfection efficiencies. The amounts of Lipofectin significantly affected the transfection efficiencies, and the optimal amounts were determined for both types of skin fibroblasts. However, cytotoxic effects in both skin fibroblasts were observed with high doses of Lipofectin. On the other hand, with optimal amounts of DNA and Lipofectin, the reporter gene (NeoT) introduced into cells was mainly integrated into the host cell chromosome. Western blot analysis showed the continuous expression of hSOD protein for at least 45 d in skin fibroblasts transfected with the expression plasmid for hSOD by Lipofectin under the optimal conditions, and the cellular SOD activity fluctuated in parallel with the expression of hSOD protein. Differences in the type of cells also affected the expression of hSOD. These results indicate that it is necessary to set up optimal conditions for transfection using Lipofectin for each cell type, and that transfection with Lipofectin under optimal conditions may be an efficient method for introduction of foreign genes into skin fibroblasts for use as a clinical delivery system of therapeutic protein.

  5. Fabrication of a nanofibrous scaffold with improved bioactivity for culture of human dermal fibroblasts for skin regeneration

    International Nuclear Information System (INIS)

    Chandrasekaran, Arun Richard; Venugopal, J; Sundarrajan, S; Ramakrishna, S

    2011-01-01

    Engineering dermal substitutes with electrospun nanofibres have lately been of prime importance for skin tissue regeneration. Simple electrospinning technology served to produce nanofibrous scaffolds morphologically and structurally similar to the extracellular matrix of native tissues. The nanofibrous scaffolds of poly(l-lactic acid)-co-poly(ε-caprolactone) (PLACL) and PLACL/gelatin complexes were fabricated by the electrospinning process. These nanofibres were characterized for fibre morphology, membrane porosity, wettability and chemical properties by FTIR analysis to culture human foreskin fibroblasts for skin tissue engineering. The nanofibre diameter was obtained between 282 and 761 nm for PLACL and PLACL/gelatin scaffolds; expressions of amino and carboxyl groups and porosity up to 87% were obtained for these fibres, while they also exhibited improved hydrophilic properties after plasma treatment. The results showed that fibroblasts proliferation, morphology, CMFDA dye expression and secretion of collagen were significantly increased in plasma-treated PLACL/gelatin scaffolds compared to PLACL nanofibrous scaffolds. The obtained results prove that the plasma-treated PLACL/gelatin nanofibrous scaffold is a potential biocomposite material for skin tissue regeneration.

  6. Fabrication of a nanofibrous scaffold with improved bioactivity for culture of human dermal fibroblasts for skin regeneration

    Energy Technology Data Exchange (ETDEWEB)

    Chandrasekaran, Arun Richard; Venugopal, J; Sundarrajan, S; Ramakrishna, S, E-mail: nnijrv@nus.edu.s [Healthcare and Energy Materials Laboratory, Nanoscience and Nanotechnology Initiative, Faculty of Engineering, National University of Singapore (Singapore)

    2011-02-15

    Engineering dermal substitutes with electrospun nanofibres have lately been of prime importance for skin tissue regeneration. Simple electrospinning technology served to produce nanofibrous scaffolds morphologically and structurally similar to the extracellular matrix of native tissues. The nanofibrous scaffolds of poly(l-lactic acid)-co-poly({epsilon}-caprolactone) (PLACL) and PLACL/gelatin complexes were fabricated by the electrospinning process. These nanofibres were characterized for fibre morphology, membrane porosity, wettability and chemical properties by FTIR analysis to culture human foreskin fibroblasts for skin tissue engineering. The nanofibre diameter was obtained between 282 and 761 nm for PLACL and PLACL/gelatin scaffolds; expressions of amino and carboxyl groups and porosity up to 87% were obtained for these fibres, while they also exhibited improved hydrophilic properties after plasma treatment. The results showed that fibroblasts proliferation, morphology, CMFDA dye expression and secretion of collagen were significantly increased in plasma-treated PLACL/gelatin scaffolds compared to PLACL nanofibrous scaffolds. The obtained results prove that the plasma-treated PLACL/gelatin nanofibrous scaffold is a potential biocomposite material for skin tissue regeneration.

  7. Comparative study of human-induced pluripotent stem cells derived from bone marrow cells, hair keratinocytes, and skin fibroblasts.

    Science.gov (United States)

    Streckfuss-Bömeke, Katrin; Wolf, Frieder; Azizian, Azadeh; Stauske, Michael; Tiburcy, Malte; Wagner, Stefan; Hübscher, Daniela; Dressel, Ralf; Chen, Simin; Jende, Jörg; Wulf, Gerald; Lorenz, Verena; Schön, Michael P; Maier, Lars S; Zimmermann, Wolfram H; Hasenfuss, Gerd; Guan, Kaomei

    2013-09-01

    Induced pluripotent stem cells (iPSCs) provide a unique opportunity for the generation of patient-specific cells for use in disease modelling, drug screening, and regenerative medicine. The aim of this study was to compare human-induced pluripotent stem cells (hiPSCs) derived from different somatic cell sources regarding their generation efficiency and cardiac differentiation potential, and functionalities of cardiomyocytes. We generated hiPSCs from hair keratinocytes, bone marrow mesenchymal stem cells (MSCs), and skin fibroblasts by using two different virus systems. We show that MSCs and fibroblasts are more easily reprogrammed than keratinocytes. This corresponds to higher methylation levels of minimal promoter regions of the OCT4 and NANOG genes in keratinocytes than in MSCs and fibroblasts. The success rate and reprogramming efficiency was significantly higher by using the STEMCCA system than the OSNL system. All analysed hiPSCs are pluripotent and show phenotypical characteristics similar to human embryonic stem cells. We studied the cardiac differentiation efficiency of generated hiPSC lines (n = 24) and found that MSC-derived hiPSCs exhibited a significantly higher efficiency to spontaneously differentiate into beating cardiomyocytes when compared with keratinocyte-, and fibroblast-derived hiPSCs. There was no significant difference in the functionalities of the cardiomyocytes derived from hiPSCs with different origins, showing the presence of pacemaker-, atrial-, ventricular- and Purkinje-like cardiomyocytes, and exhibiting rhythmic Ca2+ transients and Ca2+ sparks in hiPSC-derived cardiomyocytes. Furthermore, spontaneously and synchronously beating and force-developing engineered heart tissues were generated. Human-induced pluripotent stem cells can be reprogrammed from all three somatic cell types, but with different efficiency. All analysed iPSCs can differentiate into cardiomyocytes, and the functionalities of cardiomyocytes derived from different cell

  8. Effect of glutathione on arecanut treated normal human buccal fibroblast culture.

    Directory of Open Access Journals (Sweden)

    Saraswathi T

    2006-01-01

    Full Text Available BACKGROUND: Experimental studies have shown arecanut to be a cytotoxic substance with mutagenic and carcinogenic potential. OBJECTIVE: The present study was undertaken to evaluate the effect of glutathione on arecanut treated human buccal fibroblast culture and its potential as a chemopreventive agent. MATERIALS AND METHODS: Fibroblast culture was done in Dulbecco′s Modified Eagle′s Medium MEM supplemented with 10% Fetal Calf Serum (FCS and antibiotic at 370C degrees in an atmosphere of 5% carbon di-oxide and 95% air. The fibroblast cells were subjected to different concentrations of aqueous extracts of raw and boiled arecanut. Fibroblasts were plated in two 24-well culture plates and in each plate, cells were dividt,ednto 2 groups; 600gg microml of reduced glutathione was added to the first group of cells; subsequently, aqueous extracts of raw and boiled arecanut at least and highest concentrations i.e., 20j. microml and 100lg microml were added to the first group of cells in the respective plates whereas the second group served as a control. The morphological alterations and cell survival were assayed at 24, 48, 72, and 96 hours. Results Morphologically, the initial (10 hours attached fibroblast cells were converted from spheroidal shape towards hexagonal and finally to a fully extended spindle shaped configuration. The three morphological types of fibroblasts at 48 hours were F-I, F-II and F-III. Aqueous extract of raw arecanut exhibited significant cytotoxicity (p < .0 001 at all time periods studied, when compared against the control values of untreated fibroblasts. Addition of reduced glutathione to cultures showed a significant (p < 0. 001 reduction in cytotoxicity, as indicated by higher optical density values and morphological reversion to the spindle-shaped configuration. CoCONCLUSION:Addition of glutathione reduced the cytotoxic and morphological alterations of the fibroblasts treated with aqueous extracts of both raw and boiled

  9. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  10. Differential production of proteolytic enzymes by normal human fibroblasts and their counterparts transformed by treatment with 60Co gamma rays

    International Nuclear Information System (INIS)

    Nishitani, Koji; Namba, Masayoshi; Ohkubo, Shigeki; Kimoto, Tetsuo

    1985-01-01

    Production of proteolytic enzymes by human fibroblasts in the process of transformation was investigated. The cells used were normal human fibroblasts (KSM-6) and their in vitro counterparts transformed by treatment with 60 Co gamma rays (KMST-6). Cells seeded by treatment with EDTA were cultured in a serum free medium. Proteolytic enzymes in the culture medium of cells were assayed using a synthetic substrate, N-α-(p-tosyl)-L-arginine ( 3 H) methyl ester hydrochloride. The transformed cells (KMST-6) produced a larger amount of enzymes than normal cells (KMS-6). The enzyme production in both cell lines was high in the exponential growth stage and then decreased as the cells reached confluency. The proteolytic enzymes produced by these cells were trypsin- and thrombin-like enzymes. Cell growth of KMST-6 or KMS-6 was not inhibited by the addition of protease inhibitors to the culture medium. (author)

  11. Human skin-derived fibroblasts used as a 'Trojan horse' for drug delivery.

    Science.gov (United States)

    Coccè, V; Vitale, A; Colombo, S; Bonomi, A; Sisto, F; Ciusani, E; Alessandri, G; Parati, E; Brambilla, P; Brambilla, M; La Porta, C A; Pessina, A

    2016-06-01

    Drug toxicity currently represents the main challenge of tumour chemotherapy. Our group recently developed a new method for drug delivery inspired by the 'Trojan Horse' concept. Human mesenchymal stem cells (hMSCs) have been shown to play the role of new 'horses' in delivering anti-tumour agents, without involving any genetic manipulation. As human stromal dermal fibroblasts (hSDFs) represent an interesting alternative to hMSCs, being easy to isolate, they could be an ideal candidate for this kind of procedure. To investigate whether hSDFs can take up and deliver paclitaxel (PTX) in sufficient concentrations to inhibit a very aggressive melanoma tumour (IgR39) in vitro. hSDFs were primed with high doses of PTX, and then the effect of drug delivery on IgR39 melanoma proliferation in vitro was evaluated using several assays (antiproliferation, transwell cocultures, rosette assays and colony growth assays). Furthermore, the cell cycle and PTX uptake/release mechanism of hSDFs were studied both under both normal and hypoxic conditions. hSDFs incorporated PTX and then released it with unaffected pharmacological activity, inhibiting human IgR39 melanoma growth in vitro. The hypoxic conditions did not induce changes in cell cycle pattern and the uptake-release mechanism with PTX was not affected. hSDFs can be used as a Trojan horse, as the released drug was functionally active. These results indicated that these cells could be used for clinical treatment as the drug was released into the cellular environment and the primed cells underwent apoptosis. © 2016 British Association of Dermatologists.

  12. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  13. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  14. Ultrastructural changes following electron irradiation in three-dimensional culture of normal human dermal fibroblasts

    International Nuclear Information System (INIS)

    Han, Chunmao; Ishikura, Naotaka; Tsukada, Sadao

    1994-01-01

    The present study was designed to examine the effect of electron irradiation on fibroblasts and extracellular matrices electron-microscopically. The three-dimensional dermal fibroblast culture was exposed to one, 4 or 10 Gy of electron beams. One day after irradiation, fibroblasts were vacuolated in all irradiated groups and intercellular spaces were increased in a dose-dependent manner. Seven days later, intercellular spaces became dense in both one and 4 Gy groups, although they were still extremely increased in the 10 Gy group. The remaining fibroblasts were still activated in all groups. Thirty days after irradiation, myofibroblastic cells were scarcely observed, but extracellular fine fibrils and collagen fibrils were observed in all irradiated groups. The other ultrastructural findings were similar to those in the control group. In conclusion, electron beams damaged not only cells but also extracellular matrix. The extracellular matrix may be repaired by activated residual fibroblasts, resulting in the mixture of new and old collagen fibrils having different diamters. (N.K.)

  15. Mycophenolic acid suppresses human pterygium and normal tenon fibroblast proliferation in vitro.

    Science.gov (United States)

    Amer, Radgonde; Rabinowich, Liane; Maftsir, Genia; Puxeddu, Ilaria; Levi-Schaffer, Francesca; Solomon, Abraham

    2010-10-01

    To investigate whether mycophenolic acid (MPA) exerts antifibrotic effects on pterygium fibroblasts (PFB) with and without stimulation with fibrogenic cytokines, and to compare the efficacy of MPA with mitomycin (MMC) and dexamethasone (DXM) on PFB and tenon fibroblasts (TFB). TFB and PFB were obtained from tissue explants during strabismus or pterygium surgery. Proliferation of subconfluent fibroblasts ± basic fibroblast growth factor (bFGF) (10 ng/ml) was assessed by using the (3H) thymidine-incorporation assay. Cell cultures were incubated with MPA, MMC or DXM. Apoptosis was evaluated by quantifying Annexin V and propidium iodide positive cells with flow cytometry. MPA showed a concentration-dependent inhibition of proliferation of PFB ± bFGF as well as TFB ± bFGF. The antiproliferative effect of MPA was comparable with that of MMC and DXM. Short exposure of PFB to MPA under profibrogenic conditions was significantly inhibitory. No apoptotic effect was found on TFB. MPA suppressed tenon and pterygium fibroblast proliferation in vitro under basal and profibrogenic conditions. It was comparable with MMC under long-term exposure, but MMC was more suppressive under short-term exposure. MPA may be safer than MMC due to a more specific mechanism of action and lack of cytotoxicity. Further investigation is warranted regarding MPA concentrations that will lead to a potent antiproliferative effect in vivo.

  16. Repair of chromosome damage induced by X-irradiation during G2 phase in a line of normal human fibroblasts and its malignant derivative

    International Nuclear Information System (INIS)

    Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.

    1982-01-01

    A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. The gaps may represent single-strand breaks. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or beta-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives

  17. Repair of chromosome damage induced by X-irradiation during G2 phase in a line of normal human fibroblasts and its malignant derivative

    International Nuclear Information System (INIS)

    Parshad, R.; Gantt, R.; Sanford, K.K.; Jones, G.M.; Tarone, R.E.

    1982-01-01

    A line of normal human skin fibroblasts (KD) differed from its malignant derivative (HUT-14) in the extent of cytogenetic damage induced by X-irradiation during G 2 phase. Malignant cells had significantly more chromatid breaks and gaps after exposure to 25, 50, or 100 rad. Results from alkaline elution of cellular DNA immediately after irradiation showed that the normal and malignant cells in asynchronous population were equally sensitive to DNA single-strand breakage by X-irradiation. Caffeine or #betta#-cytosine arabinoside (ara-C), inhibitors of DNA repair, when added directly following G 2 phase exposure, significantly increased the incidence of radiation-induced chromatid damage in the normal cells. In contrast, similar treatment of the malignant cells had little influence. Ara-C differed from caffeine in its effects; whereas both agents increased the frequency of chromatid breaks and gaps, only ara-C increased the frequency of gaps to the level observed in the irradiated malignant cells. Addition of catalase, which destroys H 2 O 2 , or mannitol, a scavenger of the derivative free hydroxyl radical (.OH), to the cultures of malignant cells before, during, and following irradiation significantly reduced the chromatid damage; and catalase prevented formation of chromatid gaps. The DNA damage induced by X-ray during G 2 phase in the normal KD cells was apparently repaired by a caffeine- and ara-C-sensitive mechanism(s) that was deficient or absent in their malignant derivatives

  18. Transcriptome comparison of human neurons generated using induced pluripotent stem cells derived from dental pulp and skin fibroblasts.

    Science.gov (United States)

    Chen, Jian; Lin, Mingyan; Foxe, John J; Pedrosa, Erika; Hrabovsky, Anastasia; Carroll, Reed; Zheng, Deyou; Lachman, Herbert M

    2013-01-01

    Induced pluripotent stem cell (iPSC) technology is providing an opportunity to study neuropsychiatric disorders through the capacity to grow patient-specific neurons in vitro. Skin fibroblasts obtained by biopsy have been the most reliable source of cells for reprogramming. However, using other somatic cells obtained by less invasive means would be ideal, especially in children with autism spectrum disorders (ASD) and other neurodevelopmental conditions. In addition to fibroblasts, iPSCs have been developed from cord blood, lymphocytes, hair keratinocytes, and dental pulp from deciduous teeth. Of these, dental pulp would be a good source for neurodevelopmental disorders in children because obtaining material is non-invasive. We investigated its suitability for disease modeling by carrying out gene expression profiling, using RNA-seq, on differentiated neurons derived from iPSCs made from dental pulp extracted from deciduous teeth (T-iPSCs) and fibroblasts (F-iPSCs). This is the first RNA-seq analysis comparing gene expression profiles in neurons derived from iPSCs made from different somatic cells. For the most part, gene expression profiles were quite similar with only 329 genes showing differential expression at a nominally significant p-value (pdisease-modeling neuropsychiatric disorder and may have some advantages over those derived from F-iPSCs.

  19. Plasma Rich in Growth Factors Inhibits Ultraviolet B Induced Photoageing of the Skin in Human Dermal Fibroblast Culture.

    Science.gov (United States)

    Anitua, Eduardo; Pino, Ander; Orive, Gorka

    Ultraviolet irradiation is able to deeply penetrate into the dermis and alter fibroblast structure and function, leading to a degradation of the dermal extracellular matrix. The regenerative effect of plasma rich in growth factors (PRGF) on skin ageing was investigated using UVB photo-stressed human dermal fibroblasts as an in vitro culture model. PRGF was assessed over the main indicative features of ultraviolet B irradiation, including ROS formation, cell viability and death detection, apoptosis/ necrosis analysis and biosynthetic activity measurement. Four different UV irradiation protocols were tested in order to analyze the beneficial effects of PRGF. Ultraviolet irradiation exhibited a dose dependent cytotoxicity and dose of 400mJ/cm2 was selected for subsequent experiments. PRGF increased the cell viability and decreased the cell death comparing to the non-treated group. The apoptosis and necrosis were significantly lower in PRGF treated fibroblasts. ROS production after UV irradiation was significantly reduced in the presence of PRGF. Procollagen type I, hyaluronic acid and TIMP-1 levels were higher in the when treated with PRGF. This preliminary in vitro study suggests that PRGF is able to prevent UVB derived photooxidative stress and to diminish the cell damage caused by ultraviolet irradiation.

  20. Effect of friction on vibrotactile sensation of normal and dehydrated skin.

    Science.gov (United States)

    Chen, S; Ge, S; Tang, W; Zhang, J

    2016-02-01

    Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. The inhibition of DNA repair by aphidicolin or cytosine arabinoside in X-irradiated normal and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Waters, R.; Crocombe, K.; Mirzayans, R.

    1981-01-01

    Normal and excision-deficient xeroderma pigmentosum fibroblasts were X-irradiated and the influence on DNA repair of either the repair inhibitor cytosine arabinoside or the specific inhibitor of DNA polymerase α, aphidicolin, investigated. The data indicated that the repair of a certain fraction of X-ray-induced lesions can be inhibited in both cell lines by both compounds. Thus, as aphidicolin blocks the operation of polymerase α, this enzyme must be involved in an excision repair pathway operating in both normal and excision-deficient xeroderma pigmentosum cells. (orig.)

  2. A spectroscopic study on the effect of ultra-violet solar radiation in Antarctica on the human skin fibroblast cells

    Directory of Open Access Journals (Sweden)

    Tatsuyuki Yamamoto

    2013-11-01

    Full Text Available A study on the effect of the solar ultra-violet radiation on the human skin fibroblast cells revealed that the production of matrix metalloproteinase-2 was inhibited by the radiation. A CO2 incubator connected by optical fibers to a reflector telescope for collecting the solar light was built at Syowa station by the 49th Japanese Antarctica Research Expedition. The direction of the telescope was continuously controlled by a sun-tracker to follow the movement of the Sun automatically. The intensity of the collected light was monitored by a portable spectrophotometer housed inside. The human skin fibroblast cells were incubated in the CO2 chamber to investigate the effect of the solar radiation at Syowa station and were compared with those reference experiments at a laboratory in Japan. The results showed cell damage by strong UV radiation. The production of matrix metalloproteinase-2 was prompted by the moderate UV-B, but was inhibited by the strong UV-B radiation, as studied under laboratory conditions in Japan. The effect of strong solar radiation at Syowa station involving the radiation of UV-B region was estimated to be of the same extent of the radiation caused by an artificial UV-B light with the intensity more than 50 mJ/cm2.

  3. Effects of CO2 laser irradiation on the wettability and human skin fibroblast cell response of magnesia partially stabilised zirconia

    International Nuclear Information System (INIS)

    Hao, L.; Lawrence, J.

    2003-01-01

    Human skin fibroblast cells in vitro responses on the surface of a bioinert zirconia ceramic partially stabilised with magnesia partially stabilised zirconia (MgO-PSZ) bioinert ceramic before and after CO 2 laser treatment were investigated to find the interrelationship between the cell adhesion, wettability and laser parameters. Contact angle, θ, measurements of a set of test liquids were a clear indication that surface treatment of the MgO-PSZ with a CO 2 laser brought about a reduction in θ, indicating that the wettability of the MgO-PSZ had been enhanced. A relationship was found between the wettability and the microstructure of the MgO-PSZ surface and laser processing parameters. It was subsequently deduced that the factors active in causing the observed modification in the wettability of the MgO-PSZ were the increases in the surface O 2 content and the polar component of the surface energy, γ sv p , the latter resulting from surface melting and resolidification. Moreover, the investigation into the human skin fibroblast cell response revealed that the CO 2 laser treatment of the MgO-PSZ had resulted in a surface favourable for cell adhesion, as the extent of cell attachment and adhesion on the MgO-PSZ surface was enhanced depending on laser parameters. Such an improvement in cell adhesion, which could be greatly beneficial to developing enhanced bonding at the tissue and implant interface, was influenced by the surface properties of the modified MgO-PSZ, particular wettability

  4. Dose-dependent micronuclei formation in normal human fibroblasts exposed to proton radiation

    Czech Academy of Sciences Publication Activity Database

    Litvinchuk, Alexandra; Vachelová, Jana; Michaelidesová, Anna; Wagner, Richard; Davídková, Marie

    2015-01-01

    Roč. 54, č. 3 (2015), s. 327-334 ISSN 0301-634X R&D Projects: GA ČR(CZ) GBP108/12/G108; GA MŠk LM2011019 Institutional support: RVO:61389005 Keywords : human fibroblasts * proton radiation * micronuclei assay * biodosimetry Subject RIV: BO - Biophysics Impact factor: 1.923, year: 2015

  5. Microprobe analysis of human fibroblasts

    International Nuclear Information System (INIS)

    Allan, G.L.; Zhu, J.; Legge, G.J.F.

    1985-01-01

    The Melbourne Proton Microprobe has been used to study the copper content in human skin fibroblast cells derived from patients with the genetic disease Menkes Syndrome. Both normal and diseased cells have been studied to investigate any elemental differences occurring between the two cell types. This paper details the preparatory techniques necessary for individual cell analysis and presents the elemental information with a new three dimensional contour mapping technique. These maps are used to highlight elemental differences between normal and mutant fibroblasts. The work also confirms the expected copper excess found in the Menkes cell and indicates that the microprobe can be used for rapid identification of a Menkes carrier

  6. L-Lactate Protects Skin Fibroblasts against Aging-Associated Mitochondrial Dysfunction via Mitohormesis

    Czech Academy of Sciences Publication Activity Database

    Zelenka, Jaroslav; Dvořák, Aleš; Alán, Lukáš

    2015-01-01

    Roč. 2015, č. 2015 (2015), ID351698 ISSN 1942-0900 R&D Projects: GA ČR(CZ) GPP305/12/P388 Institutional support: RVO:67985823 Keywords : mitochondria * reactive oxygen species * lactate * fibroblasts Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.492, year: 2015

  7. Anti-aging effects of Piper cambodianum P. Fourn. extract on normal human dermal fibroblast cells and a wound-healing model in mice

    Directory of Open Access Journals (Sweden)

    Lee H

    2016-07-01

    Full Text Available Hyunji Lee,1 Youngeun Hong,1 So Hee Kwon,2 Jongsun Park,1 Jisoo Park1 1Department of Pharmacology and Medical Science, Metabolic Diseases and Cell Signaling Laboratory, Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon, 2Department of Pharmacy, College of Pharmacy, Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Incheon, South Korea Background: Aging of skin is associated with environmental factors such as ultraviolet rays, air pollution, gravity, and genetic factors, all of which can lead to wrinkling of skin. Previous reports suggest that the wound repair is impaired by the aging process and strategies to manipulate the age-related wound healing are necessary in order to stimulate repair.Objective: Several traditional plant extracts are well-known for their properties of skin protection and care. Piper cambodianum P. Fourn. (PPF, a member of Piperacecae, is a plant found in Vietnam that might have therapeutic properties. Therefore, the effects of PPF stem and leaf extract on aging process were investigated in vitro and in vivo.Methods: PPF extract dissolved in methanol was investigated using Western blotting, real-time quantitative reverse transcription-polymerase chain reaction, flow cytometry, and cell wound-healing assays. We assessed the anti-aging effect of PPF in mouse using the wound-healing assay. The results were analyzed by Student’s unpaired t-test; *P<0.05 and **P<0.01 were considered to indicate significant and highly significant values, respectively, compared with corresponding controls.Results: PPF treatment demonstrated in vitro and in vivo anti-aging activity. Western blot analysis of PPF-treated normal human dermal fibroblast cells showed a dose-dependent increase in the expression of extracellular matrix genes such as collagen and elastin, but decreased expression of the aging gene matrix metalloproteinase-3. Quantitative polymerase chain reaction showed

  8. Multistep process of neoplastic transformation of normal human fibroblasts by 60Co gamma rays and Harvey sarcoma viruses

    Energy Technology Data Exchange (ETDEWEB)

    Namba, M.; Nishitani, K.; Fukushima, F.; Kimoto, T.; Nose, K.

    1986-03-15

    As reported previously (Namba et al., 1985), normal human fibroblasts were transformed by 60Co gamma-ray irradiation into immortal cells with abnormal karyotypes. These transformed cells (KMST-6), however, showed a low cloning efficiency in soft agar and no transplantability. However, upon treatment with Harvey murine sarcoma virus (Ha-MSV), the cells acquired elevated clonability in soft agar and transplantability in nude mice. Ha-MSV alone, however, did not convert normal human fibroblasts into either immortal or tumorigenic cells. The Ha-MSV-transformed KMST-6 cells showed an enhanced expression of the ras oncogene, but normal and 60Co gamma-ray-transformed cells did not. Our current data suggest that gamma rays worked against normal human cells as an initiator, giving rise to chromosome aberrations and immortality, and that Ha-MSV, probably through its ras oncogene, played a role in the progression of the malignant cell population to a more malignant one showing enhanced colony formation in soft agar and tumorigenicity in nude mice.

  9. Transcriptome-Wide Expression Profiling in Skin Fibroblasts of Patients with Joint Hypermobility Syndrome/Ehlers-Danlos Syndrome Hypermobility Type.

    Science.gov (United States)

    Chiarelli, Nicola; Carini, Giulia; Zoppi, Nicoletta; Dordoni, Chiara; Ritelli, Marco; Venturini, Marina; Castori, Marco; Colombi, Marina

    2016-01-01

    Joint hypermobility syndrome/Ehlers-Danlos syndrome hypermobility type (JHS/EDS-HT), is likely the most common systemic heritable connective tissue disorder, and is mostly recognized by generalized joint hypermobility, joint instability complications, minor skin changes and a wide range of satellite features. JHS/EDS-HT is considered an autosomal dominant trait but is still without a defined molecular basis. The absence of (a) causative gene(s) for JHS/EDS-HT is likely attributable to marked genetic heterogeneity and/or interaction of multiple loci. In order to help in deciphering such a complex molecular background, we carried out a comprehensive immunofluorescence analysis and gene expression profiling in cultured skin fibroblasts from five women affected with JHS/EDS-HT. Protein study revealed disarray of several matrix structural components such as fibrillins, tenascins, elastin, collagens, fibronectin, and their integrin receptors. Transcriptome analysis indicated perturbation of different signaling cascades that are required for homeostatic regulation either during development or in adult tissues as well as altered expression of several genes involved in maintenance of extracellular matrix architecture and homeostasis (e.g., SPON2, TGM2, MMP16, GPC4, SULF1), cell-cell adhesion (e.g., CDH2, CHD10, PCDH9, CLDN11, FLG, DSP), immune/inflammatory/pain responses (e.g., CFD, AQP9, COLEC12, KCNQ5, PRLR), and essential for redox balance (e.g., ADH1C, AKR1C2, AKR1C3, MAOB, GSTM5). Our findings provide a picture of the gene expression profile and dysregulated pathways in JHS/EDS-HT skin fibroblasts that correlate well with the systemic phenotype of the patients.

  10. Head and neck squamous cancer stromal fibroblasts produce growth factors influencing phenotype of normal human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Strnad, Hynek; Lacina, L.; Kolář, Michal; Čada, Z.; Vlček, Čestmír; Dvořánková, B.; Betka, J.; Plzák, J.; Chovanec, M.; Šáchová, Jana; Valach, Jaroslav; Urbanová, Markéta; Smetana, K. Jr.

    2010-01-01

    Roč. 133, č. 2 (2010), s. 201-211 ISSN 0948-6143 R&D Projects: GA MŠk 2B06106 Grant - others:GA ČR(CZ) GP304/08/P175 Institutional research plan: CEZ:AV0Z50520514 Keywords : Cancer microenvironment * Epithelial–mesenchymal interaction * Cancer-associated fibroblasts Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.727, year: 2010

  11. The Role of Fibroblast Growth Factor Binding Protein 1 in Skin Carcinogenesis and Inflammation

    DEFF Research Database (Denmark)

    Schmidt, Marcel Oliver; Garman, Khalid Ammar; Lee, Yong Gu

    2018-01-01

    , and is upregulated in various cancers. Here we evaluated the contribution of endogenous FGFBP1 to development and homeostasis as well as to skin pathologies utilizing Fgfbp1-knockout (KO) mice. Relative to wild-type (WT) littermates KO mice showed no gross pathologies. Still, in KO mice a significant thickening...... of the epidermis associated with a decreased transepidermal water loss and increased pro-inflammatory gene expression in the skin was detected. Also, skin carcinogen challenge by DMBA/TPA resulted in delayed and reduced papillomatosis in KO mice. This was paralleled by delayed healing of skin wounds and reduced...... angiogenic sprouting in subcutaneous matrigel plugs. Heterozygous GFP-knock-in mice revealed rapid induction of gene expression during papilloma induction and during wound healing. Examination of WT skin grafted onto Fgfbp1 GFP knockin reporter hosts and bone marrow transplants from the GFP reporter model...

  12. Blocking negative effects of senescence in human skin fibroblasts with a plant extract.

    Science.gov (United States)

    Lämmermann, Ingo; Terlecki-Zaniewicz, Lucia; Weinmüllner, Regina; Schosserer, Markus; Dellago, Hanna; de Matos Branco, André Dargen; Autheried, Dominik; Sevcnikar, Benjamin; Kleissl, Lisa; Berlin, Irina; Morizot, Frédérique; Lejeune, Francois; Fuzzati, Nicola; Forestier, Sandra; Toribio, Alix; Tromeur, Anaïs; Weinberg, Lionel; Higareda Almaraz, Juan Carlos; Scheideler, Marcel; Rietveld, Marion; El Ghalbzouri, Abdoel; Tschachler, Erwin; Gruber, Florian; Grillari, Johannes

    2018-01-01

    There is increasing evidence that senescent cells are a driving force behind many age-related pathologies and that their selective elimination increases the life- and healthspan of mice. Senescent cells negatively affect their surrounding tissue by losing their cell specific functionality and by secreting a pro-tumorigenic and pro-inflammatory mixture of growth hormones, chemokines, cytokines and proteases, termed the senescence-associated secretory phenotype (SASP). Here we identified an extract from the plant Solidago virgaurea subsp. alpestris , which exhibited weak senolytic activity, delayed the acquisition of a senescent phenotype and induced a papillary phenotype with improved functionality in human dermal fibroblasts. When administered to stress-induced premature senescent fibroblasts, this extract changed their global mRNA expression profile and particularly reduced the expression of various SASP components, thereby ameliorating the negative influence on nearby cells. Thus, the investigated plant extract represents a promising possibility to block age-related loss of tissue functionality.

  13. c-fos/c-jun expression and AP-1 activation in skin fibroblasts from centenarians.

    Science.gov (United States)

    Grassilli, E; Bellesia, E; Salomoni, P; Croce, M A; Sikora, E; Radziszewska, E; Tesco, G; Vergelli, M; Latorraca, S; Barbieri, D; Fagiolo, U; Santacaterina, S; Amaducci, L; Tiozzo, R; Sorbi, S; Franceschi, C

    1996-09-13

    In vitro replicative senescence is characterized by an irreversible growth arrest due to the inability of the cell to induce some key regulators of cell cycle progression, such as c-fos and AP-1, in response to mitogenic stimuli. In vitro replicative senescence and in vivo aging have been assumed to be two related phenomena, likely controlled by overlapping or interacting genes. As a corollary, fibroblasts from centenarians, which have undergone a long process of senescence in vivo should have very limited proliferative capability. On the contrary, in a previous work we found that fibroblasts from centenarians exhibited the same capacity to respond to different mitogenic stimuli as fibroblasts from young donors. Here we provide evidences that the well preserved proliferative response is likely due to the fact that some pivotal regulators- c-fos, c-jun and AP-1-are still fully inducible, despite a long process of in vivo senescence. Our data therefore suggest that in vivo and in vitro aging are separate phenomena whose possible relationships, if any, have to be ascertained very carefully.

  14. Transfection of normal human and Chinese hamster DNA corrects diepoxybutane-induced chromosomal hypersensitivity of Fanconi anemia fibroblasts

    International Nuclear Information System (INIS)

    Shaham, M.; Adler, B.; Ganguly, S.; Chaganti, R.S.K.

    1987-01-01

    Cultured cells from individuals affected with Fanconi anemia (FA) exhibit spontaneous chromosome breakage and hypersensitivity to the cell killing and clastogenic effects of the difunctional alkylating agent diepoxybutane (DEB). The authors report here the correction of both of these DEB-hypersensitivity phenotypes of FA cells achieved by cotransfection of normal placental of Chinese hamster lung cell DNA and the plasmid pSV2-neo-SVgpt. Transfectants were selected for clonogenic survival after treatment with DEB at a dose of 5 μgml. At this dose of DEB, the clonogenicity of normal fibroblasts was reduced to 50% and that of FA fibroblasts was reduced to zero. DEB-resistant (DEB/sup r/) colonies selected in this system exhibited a normal response to DEB-induced chromosome breakage and resistance to repeated DEB treatment. The neo and gpt sequences were detected by Southern blot analysis of DNA from one of four DEB/sup r/ colonies independently derived from transfection of human DNA and one of three DEB/sup r/ colonies independently derived from transfection of Chinese hamster DNA. The results demonstrate that DNA sequences that complement the two hallmark cellular phenotypes (cellular and chromosomal hypersensitivity to alkylating agents) of FA are present in human as well as Chinese hamster DNA. The cloning of these genes using transfection strategies can be expected to enable molecular characterization of FA

  15. Inhibition of collagen production in scleroderma fibroblast cultures by a connective tissue glycoprotein extracted from normal dermis

    International Nuclear Information System (INIS)

    Maquart, F.X.; Bellon, G.; Cornillet-Stoupy, J.; Randoux, A.; Triller, R.; Kalis, B.; Borel, J.P.

    1985-01-01

    It was shown in a previous paper that a connective tissue glycoprotein (CTGP) extracted from normal rabbit dermis was able to inhibit total protein and collagen syntheses by normal dermis fibroblast cultures. In the present study, the effects of CTGP on scleroderma fibroblasts were investigated. [ 14 C]Proline incorporation into total proteins of the supernatant was not significantly different from that found in controls. By contrast, the amount of collagen, expressed as percentage of total secreted protein, was far higher in scleroderma cultures than in normal ones (14.4% +/- 6.0% vs 4.6% +/- 0.9%). Addition of CTGP to the medium induced a concentration-dependent inhibition of [ 14 C]proline incorporation into proteins from both control and scleroderma cells. In control cultures, no significant decrease of the percentage of collagen was observed, but over 60 micrograms/ml, both cytotoxic effects and inhibition of protein synthesis occurred. In scleroderma cultures, the inhibition was twice as effective on collagen as on noncollagen protein synthesis. The inhibition of collagen secretion was not related either to changes in collagen hydroxylation or to the intracellular catabolism of newly synthesized procollagen

  16. Tissue engineering of ligaments: a comparison of bone marrow stromal cells, anterior cruciate ligament, and skin fibroblasts as cell source.

    Science.gov (United States)

    Van Eijk, F; Saris, D B F; Riesle, J; Willems, W J; Van Blitterswijk, C A; Verbout, A J; Dhert, W J A

    2004-01-01

    Anterior cruciate ligament (ACL) reconstruction surgery still has important problems to overcome, such as "donor site morbidity" and the limited choice of grafts in revision surgery. Tissue engineering of ligaments may provide a solution for these problems. Little is known about the optimal cell source for tissue engineering of ligaments. The aim of this study is to determine the optimal cell source for tissue engineering of the anterior cruciate ligament. Bone marrow stromal cells (BMSCs), ACL, and skin fibroblasts were seeded onto a resorbable suture material [poly(L-lactide/glycolide) multifilaments] at five different seeding densities, and cultured for up to 12 days. All cell types tested attached to the suture material, proliferated, and synthesized extracellular matrix rich in collagen type I. On day 12 the scaffolds seeded with BMSCs showed the highest DNA content (p engineered ligament.

  17. ANALYSIS OF DNA DAMAGE AND REPAIR IN SKIN FIBROBLASTS OF INFANT AND OLDER CHILDREN USING THE IN VITRO ALKALINE COMET ASSAY

    Science.gov (United States)

    ANALYSIS OF DNA DAMAGE AND REPAIR IN SKIN FIBROBLASTS OF INFANT AND OLDER CHILDREN USING THE IN VITRO ALKALINE COMET ASSAY, Alan H. Tennant1, Geremy W. Knapp1 and Andrew D. Kligerman1, 1Environmental Carcinogenesis Division, National Health and Environmental Effects Research Lab...

  18. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  19. Characterization of ultraviolet light-induced diphtheria toxin-resistant mutations in normal and Xeroderma pigmentosum human fibroblasts

    International Nuclear Information System (INIS)

    Glover, T.W.

    1979-01-01

    Quantitative mutagenesis studies in human cells have been severely limited by the lack of reliable genetic markers. Experiments were therefore performed to develop and characterize a better quantitative mutation assay for human cells. The uv-induction of diphtheria toxin resistant (DT/sup r/) mutations in normal and excision repair defective xeroderma pigmentosum (XP) fibroblasts has been quantitatively characterized. A concentration of diphtheria toxin to use in the selection of resistant mutants was determined whereby DT/sup r/ cells are cross-resistant to Pseudomonas aeurginosa exotoxin A, indicating mutants have altered elongation factor-2 (EF-2) which is not susceptible to ADP-ribosylation by either toxin. Results of this study indicate that XP fibroblasts have higher uv-induced mutation frequencies per unit uv-dose but similar frequencies per unit survival compared to normal cells as measured using a new genetic marker for quantitative mutagenesis. Furthermore, these results support a prediction of the mutation theory of cancer, namely, that cells from individuals with certain human syndromes that predispose the individual to cancer will have higher induced mutation frequencies than cells from non-susceptible individuals. This newly characterized genetic marker should be useful in quantitative mutagenesis studies in human cells

  20. Factors modifying 3-aminobenzamide cytotoxicity in normal and repair-deficient human fibroblasts

    International Nuclear Information System (INIS)

    Boorstein, R.J.; Pardee, A.B.

    1984-01-01

    3-Aminobenzamide (3-AB), an inhibitor of poly(ADP-ribosylation), is lethal to human fibroblasts with damaged DNA. Its cytotoxicity was determined relative to a number of factors including the types of lesions, the kinetics of repair, and the availability of alternative repair systems. A variety of alkylating agent, UV or gamma irradiation, or antimetabolites were used to create DNA lesions. 3-AB enhanced lethality with monofunctional alkylating agents only. Within this class of compounds, methylmethanesulfonate (MMS) treatments made cells more sensitive to 3-AB than did treatment with methylnitrosourea (MNU) or methylnitronitrosoguanidine (MNNG). 3-AB interfered with a dynamic repair process lasting several days, since human fibroblasts remained sensitive to 3-AB for 36-48 hours following MMS treatment. During this same interval 3-AB caused these cells to arrest in G 2 phase. Alkaline elution analysis also revealed that this slow repair was delayed further by 3-AB. Human mutant cell defective in DNA repair differed in their responses to 3-AB. Greater lethality with 3-AB could be dependent on inability of the mutant cells to repair damage by other processes

  1. Human lung fibroblast-derived matrix facilitates vascular morphogenesis in 3D environment and enhances skin wound healing.

    Science.gov (United States)

    Du, Ping; Suhaeri, Muhammad; Ha, Sang Su; Oh, Seung Ja; Kim, Sang-Heon; Park, Kwideok

    2017-05-01

    Extracellular matrix (ECM) is crucial to many aspects of vascular morphogenesis and maintenance of vasculature function. Currently the recapitulation of angiogenic ECM microenvironment is still challenging, due mainly to its diverse components and complex organization. Here we investigate the angiogenic potential of human lung fibroblast-derived matrix (hFDM) in creating a three-dimensional (3D) vascular construct. hFDM was obtained via decellularization of in vitro cultured human lung fibroblasts and analyzed via immunofluorescence staining and ELISA, which detect multiple ECM macromolecules and angiogenic growth factors (GFs). Human umbilical vein endothelial cells (HUVECs) morphology was more elongated and better proliferative on hFDM than on gelatin-coated substrate. To prepare 3D construct, hFDM is collected, quantitatively analyzed, and incorporated in collagen hydrogel (Col) with HUVECs. Capillary-like structure (CLS) formation at 7day was significantly better with the groups containing higher doses of hFDM compared to the Col group (control). Moreover, the group (Col/hFDM/GFs) with both hFDM and angiogenic GFs (VEGF, bFGF, SDF-1) showed the synergistic activity on CLS formation and found much larger capillary lumen diameters with time. Further analysis of hFDM via angiogenesis antibody array kit reveals abundant biochemical cues, such as angiogenesis-related cytokines, GFs, and proteolytic enzymes. Significantly up-regulated expression of VE-cadherin and ECM-specific integrin subunits was also noticed in Col/hFDM/GFs. In addition, transplantation of Col/hFMD/GFs with HUVECs in skin wound model presents more effective re-epithelialization, many regenerated hair follicles, better transplanted cells viability, and advanced neovascularization. We believe that current system is a very promising platform for 3D vasculature construction in vitro and for cell delivery toward therapeutic applications in vivo. Functional 3D vasculature construction in vitro is still

  2. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  3. Overexpression of LncRNA AC067945.2 Down-Regulates Collagen Expression in Skin Fibroblasts and Possibly Correlates with the VEGF and Wnt Signalling Pathways.

    Science.gov (United States)

    Chen, Ling; Li, Jingyun; Li, Qian; Li, Xue; Gao, Yanli; Hua, Xiangdong; Zhou, Bei; Li, Jun

    2018-01-01

    Long non-coding RNAs (lncRNAs) are thought to play crucial roles in human diseases. However, the function of lncRNAs in hypertrophic scar formation remains poorly understood. Utilizing qRT-PCR, we explored the expression changes of AC067945.2. Overexpression of AC067945.2 in normal skin fibroblasts was performed by transient plasmid transfection. Western blot was used to check the proteins' expression changes. Cell Counting Kit-8 (CCK-8) assay and Annexin V/7-AAD staining were used to examine cell proliferation and apoptosis, respectively. mRNA-seq was applied to dissect the differentially expressed mRNAs in AC067945.2 overexpressed cells. We also performed ELISA to detect the VEGF secretion. AC067945.2 was down-regulated in hypertrophic scar tissues. Overexpression of AC067945.2 did not affect cell proliferation, but it mildly promoted early apoptosis in normal skin fibroblasts. Furthermore, AC067945.2 overexpression inhibited the expression of COL1A1, COL1A2, COL3A1 and α-SMA proteins. Transforming growth factor-β1 (TGF-β1) could inhibit the expression of AC067945.2. Based on mRNA-seq data, compared with mRNAs in the control group, 138 mRNAs were differentially expressed, including 14 up-regulated and 124 down-regulated transcripts, in the AC067945.2 overexpression group. Gene ontology and pathway analyses revealed that AC067945.2 overexpression was correlated with developmental processes, binding, extracellular region, and the vascular endothelial cell growth factor (VEGF) and Wnt signalling pathways. ELISA confirmed that AC067945.2 overexpression could repress VEGF secretion. Taken together, our data uncovered the functions of a novel lncRNA AC067945.2, which might help us understand the mechanisms regulated by AC067945.2 in the pathogenesis of hypertrophic scar formation. © 2018 The Author(s). Published by S. Karger AG, Basel.

  4. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  5. Fibroblasts of skin fragments as a tool for the investigation of genetic diseases: technical recommendations

    Directory of Open Access Journals (Sweden)

    Coelho Janice Carneiro

    2000-01-01

    Full Text Available Skin biopsies are frequently indicated for investigation and/or confirmation of genetic disorders. Although relatively simple and noninvasive, these procedures require care in order to increase probability of success and to avoid patient discomfort and unnecessary repeated analyses and associated laboratory fees. The present report highlights the importance of skin biopsies in genetic disorder diagnosis and presents general rules for collecting, storing, transporting and processing samples. We recommend its reading to professionals intending to use this important and sometimes fundamental diagnostic tool.

  6. NOD2 and TLR2 ligands trigger the activation of basophils and eosinophils by interacting with dermal fibroblasts in atopic dermatitis-like skin inflammation

    Science.gov (United States)

    Jiao, Delong; Wong, Chun-Kwok; Qiu, Huai-Na; Dong, Jie; Cai, Zhe; Chu, Man; Hon, Kam-Lun; Tsang, Miranda Sin-Man; Lam, Christopher Wai-Kei

    2016-01-01

    The skin of patients with atopic dermatitis (AD) has a unique predisposition for colonization by Staphylococcus aureus (S. aureus), which contributes to the inflammation and grim prognosis of AD. Although the mechanism underlying the S. aureus-induced exacerbation of AD remains unclear, recent studies have found a pivotal role for pattern recognition receptors in regulating the inflammatory responses in S. aureus infection. In the present study, we used a typical mouse model of AD-like skin inflammation and found that S. aureus-associated nucleotide-binding oligomerization domain-containing protein 2 (NOD2) and toll-like receptor 2 (TLR2) ligands exacerbated AD-like symptoms, which were further deteriorated by the in vivo expansion of basophils and eosinophils. Subsequent histological analyses revealed that dermal fibroblasts were pervasive in the AD-like skin lesions. Co-culture of human dermal fibroblasts with basophils and eosinophils resulted in a vigorous cytokine/chemokine response to the NOD2/TLR2 ligands and the enhanced expression of intercellular adhesion molecule-1 on the dermal fibroblasts. Basophils and eosinophils were primarily responsible for the AD-related cytokine/chemokine expression in the co-cultures. Direct intercellular contact was necessary for the crosstalk between basophils and dermal fibroblasts, while soluble mediators were sufficient to mediate the eosinophil–fibroblast interactions. Moreover, the intracellular p38 mitogen-activated protein kinase, extracellular signal-regulated kinase, and nuclear factor-kappa B signaling pathways were essential for NOD2/TLR2 ligand-mediated activation of basophils, eosinophils, and dermal fibroblasts in AD-related inflammation. This study provides the evidence of NOD2/TLR2-mediated exacerbation of AD through activation of innate immune cells and therefore sheds light on a novel mechanistic pathway by which S. aureus contributes to the pathophysiology of AD. PMID:26388234

  7. Fibroblast cultures in duchenne muscular dystrophy

    International Nuclear Information System (INIS)

    Ionasescu, V.; Lara-Braud, C.; Zellweger, H.; Ionasescu, R.; Burmeister, L.

    1977-01-01

    Primary skin fibroblast cultures were grown from forearm pinch skin biopsies obtained from 24 patients with Duchenne muscular dystrophy (DMD) and ten normal controls matched for sex and age. The first subcultures were grown for 7 days and incubated with L-( 3 H)-proline for 24 hours. Intracellular collagen incoption was significantly decreased (2.2 X) and extracellular collagen incorporation significantly increased (1.8 X) in fibroblast cultures from patients with DMD by both collagenase assay and polyacrylamide gel electrophoresis. The synthesis of noncollagen proteins showed low values from the DMD fibroblast cultures. The alterations in synthesis and secretion of collagen and noncollagen proteins were characteristic only for the log phase of DMD fibroblasts. (author)

  8. Cell cycle synchronization and analysis of apoptosis-related gene in skin fibroblasts from domestic cat (Felis silvestris catus) and kodkod (Leopardus guigna).

    Science.gov (United States)

    Veraguas, D; Gallegos, P F; Castro, F O; Rodriguez-Alvarez, L

    2017-10-01

    The kodkod population is in constant decrease and the somatic cell nuclear transfer (SCNT) might help to preserve the genetic pool of this species. The cell cycle synchronization of donor cells plays a crucial role in SCNT. The objective of this research was to evaluate two different methods for quiescence induction, serum starvation (SS) and contact inhibition (CI), both for 1, 3 and 5 days, on skin fibroblast from domestic cat and kodkod. Flow cytometry analysis revealed that in domestic cat, SS and CI, both at 3 and 5 days, increased the percentage of fibroblasts in G0/G1 compared to growing cells (GC) (p kodkod, only SS for 3 and 5 days and CI for 1 and 3 days increased the percentage of fibroblasts in G0/G1 compared to GC (p kodkod (p kodkod fibroblasts, BAX/BCL2 ratio was increased in CI at 3 and 5 days compared to SS at 3 and 5 days (p kodkod fibroblasts SS for 5 days and CI after 3 days might have a negative impact on cellular viability. According to these results, we suggest SS for 3 days for cell cycle synchronization in kodkod fibroblasts. © 2017 Blackwell Verlag GmbH.

  9. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    Science.gov (United States)

    2009-06-01

    the accordance in the structure and growth of animals and plants . London: The Syden- ham Society, 1–268 Sessa L, Breiling A, Lavorgna G, Silvestri L...targets. Heredity 97:88–96 Wolpert L (1969) Positional information and the spatial pattern of cellular differentiation. J Theor Biol 25:1–47 Yamaguchi Y

  10. Scaffold-Free Coculture Spheroids of Human Colonic Adenocarcinoma Cells and Normal Colonic Fibroblasts Promote Tumorigenicity in Nude Mice

    Directory of Open Access Journals (Sweden)

    Jong-il Park

    2016-02-01

    Full Text Available The aim of this study was to form a scaffold-free coculture spheroid model of colonic adenocarcinoma cells (CACs and normal colonic fibroblasts (NCFs and to use the spheroids to investigate the role of NCFs in the tumorigenicity of CACs in nude mice. We analysed three-dimensional (3D scaffold-free coculture spheroids of CACs and NCFs. CAC Matrigel invasion assays and tumorigenicity assays in nude mice were performed to examine the effect of NCFs on CAC invasive behaviour and tumorigenicity in 3D spheroids. We investigated the expression pattern of fibroblast activation protein-α (FAP-α by immunohistochemical staining. CAC monocultures did not form densely-packed 3D spheroids, whereas cocultured CACs and NCFs formed 3D spheroids. The 3D coculture spheroids seeded on a Matrigel extracellular matrix showed higher CAC invasiveness compared to CACs alone or CACs and NCFs in suspension. 3D spheroids injected into nude mice generated more and faster-growing tumors compared to CACs alone or mixed suspensions consisting of CACs and NCFs. FAP-α was expressed in NCFs-CACs cocultures and xenograft tumors, whereas monocultures of NCFs or CACs were negative for FAP-α expression. Our findings provide evidence that the interaction between CACs and NCFs is essential for the tumorigenicity of cancer cells as well as for tumor propagation.

  11. Resistance of plateau-phase human normal and xeroderma pigmentosum fibroblasts to the cytotoxic effect of ultraviolet light

    International Nuclear Information System (INIS)

    Chan, G.L.; Little, J.B.

    1979-01-01

    Clonogenic survival response to 254-nm ultraviolet light was measured in 2 strains of repair-proficient normal human fibroblasts and 4 strains of xeroderma pigmentosum (XP) fibroblasts belonging to complementation groups A, C, D and variant. In all strains except XPA, cells irradiated in plateau phase and subcultured immediately were much more resistant to the lethal effect of UV than cells irradiated in the exponential phase of growth. Typically, 10-20% of plateau-phase cells were extremely resistant. When the cultures were held in plateau phase for 24 h after irradiation and before subculture, there was a further enhancement of survival. By use of a UV-specific endonuclease assay, no difference was found in the number of DNA lesions induced in exponentially growing and plateau cultures by the same dose of UV light. Thus plateau-phase cells appear to be more efficient in their DNA-repair capability than cells in exponential growth. XP group A cells were uniquely found to be deficient in the processes which lead to plateau-phase resistance. Since plateau-phase repair was not lacking in XP groups C, D and variant, it may be related to a DNA-repair process different from that which is responsible for the overall UV sensitivity of these cells. (orig.)

  12. In normal human fibroblasts variation in DSB repair capacity cannot be ascribed to radiation-induced changes in the localisation, expression or activity of major NHEJ proteins

    DEFF Research Database (Denmark)

    Kasten-Pisula, Ulla; Vronskaja, Svetlana; Overgaard, Jens

    2008-01-01

    in the activity of the DNA-PK complex induced upon irradiation. CONCLUSIONS: For normal human fibroblasts, the level or activity of NHEJ proteins measured prior to or after irradiation cannot be used to predict the DSB repair capacity or cellular radiosensitivity. Udgivelsesdato: 2008-Mar......BACKGROUND AND PURPOSE: The aim of the present study was to test whether for normal human fibroblasts the variation in double-strand break (DSB) repair capacity results from radiation-induced differences in localisation, expression or activity of major non-homologous end-joining (NHEJ) proteins....... MATERIALS AND METHODS: Experiments were performed with 11 normal human fibroblast strains AF01-11. NHEJ proteins were determined by Western blot and DNA-PK activity by pulldown-assay. RESULTS: The four NHEJ proteins tested (Ku70, Ku80, XRCC4 and DNA-PKcs) were found to be localised almost exclusively...

  13. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  14. Inflammatory microenvironment and tumor necrosis factor alpha as modulators of periostin and CCN2 expression in human non-healing skin wounds and dermal fibroblasts.

    Science.gov (United States)

    Elliott, Christopher G; Forbes, Thomas L; Leask, Andrew; Hamilton, Douglas W

    2015-04-01

    Non-healing skin wounds remain a significant clinical burden, and in recent years, the regulatory role of matricellular proteins in skin healing has received significant attention. Periostin and CCN2 are both upregulated at day 3 post-wounding in murine skin, where they regulate aspects of the proliferative phase of repair including mesenchymal cell infiltration and myofibroblast differentiation. In this study, we examined 1) the wound phenotype and expression patterns of periostin and CCN2 in non-healing skin wounds in humans and 2) the regulation of their expression in wound fibroblasts by tumor necrosis factor α (TNFα) and transforming growth factor-β1 (TGF-β1). Chronic skin wounds had a pro-inflammatory phenotype, characterized by macrophage infiltration, TNFα immunoreactivity, and neutrophil infiltration. Periostin, but not CCN2, was significantly suppressed in non-healing wound edge tissue at the mRNA and protein level compared with non-involved skin. In vitro, human wound edge fibroblasts populations were still able to proliferate and contract collagen gels. Compared to cells from non-involved skin, periostin and α-SMA mRNA levels increased significantly in the presence of TGF-β1 in wound cells and were significantly decreased by TNFα, but not those of Col1A2 or CCN2. In the presence of both TGF-β1 and TNFα, periostin and α-SMA mRNA levels were significantly reduced compared to TGF-β1 treated wound cells. Effects of TGF-β1 and TNFα on gene expression were also more pronounced in wound edge cells compared to non-involved fibroblasts. We conclude that variations in the expression of periostin and CCN2, are related to an inflammatory microenvironment and the presence of TNFα in human chronic wounds. Copyright © 2015. Published by Elsevier B.V.

  15. Leukaemia virus infection promotes fibroblast transformation by normal BALB/c mouse DNA

    NARCIS (Netherlands)

    Krump-Konvalinkova, V.; Berg, K.J. van den

    1980-01-01

    All normal cells are thought to carry genetic information for oncogenic transformation, which, on activation to continuous expression. might make the cell cancerous. The presently known transforming retroviruses contain transforming genes which were probably derived by recombination of a slow

  16. Structural and metabolic studies of O-linked fucose-containing proteins of normal and virally-transformed rat fibroblasts

    International Nuclear Information System (INIS)

    Morton, P.A.

    1985-01-01

    Previous studies in this laboratory have demonstrated that cultured human and rodent cells contain a series of low molecular weight glycosylated amino acids of unusual structure, designated amino acid fucosides. The incorporation of radiolabelled-fucose into one of these components, designated FL4a (glucosylfucosylthreonine), is markedly-reduced in transformed epithelial and fibroblastic cells. The authors have examined fucose-labelled normal and virally-transformed rat fibroblast cell lines for glycoproteins which might be precursors to amino acid fucosides. Using milk alkaline/borohydride treatment (the beta-elimination reaction) to release O-linked oligosaccharides from proteins, they have isolated and partially characterized two low M/sub r/ reaction products (designated DS-ol and TS-ol) released from macromolecular cell material. The identity of one of these components (DS-ol, glucosylfucitol) suggested the existence in these cells of a direct protein precursor to FL4a. They examined fucose-labelled macromolecular cell material for proteins which release DS-ol (DS-proteins.). Using gel filtration chromatography and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with subsequent autoradiography, they have observed DS-proteins which appear to exhibit a broad molecular weight size range, and are also present in culture medium from normal and transformed cells. The findings suggest that mammalian cells contain DS-proteins and TS-proteins with a novel carbohydrate-peptide linkage wherein L-fucose is O-linked to a polypeptide backbone. Metabolic studies were undertaken to examine both the relationship between DS-protein and FL4a and the biochemical basis for the decreased level of FL4a and the biochemical basis for the decreased level of FL4a observed in transformed cells

  17. Withaferin A Induces Cell Death Selectively in Androgen-Independent Prostate Cancer Cells but Not in Normal Fibroblast Cells.

    Directory of Open Access Journals (Sweden)

    Yukihiro Nishikawa

    Full Text Available Withaferin A (WA, a major bioactive component of the Indian herb Withania somnifera, induces cell death (apoptosis/necrosis in multiple types of tumor cells, but the molecular mechanism underlying this cytotoxicity remains elusive. We report here that 2 μM WA induced cell death selectively in androgen-insensitive PC-3 and DU-145 prostate adenocarcinoma cells, whereas its toxicity was less severe in androgen-sensitive LNCaP prostate adenocarcinoma cells and normal human fibroblasts (TIG-1 and KD. WA also killed PC-3 cells in spheroid-forming medium. DNA microarray analysis revealed that WA significantly increased mRNA levels of c-Fos and 11 heat-shock proteins (HSPs in PC-3 and DU-145, but not in LNCaP and TIG-1. Western analysis revealed increased expression of c-Fos and reduced expression of the anti-apoptotic protein c-FLIP(L. Expression of HSPs such as HSPA6 and Hsp70 was conspicuously elevated; however, because siRNA-mediated depletion of HSF-1, an HSP-inducing transcription factor, reduced PC-3 cell viability, it is likely that these heat-shock genes were involved in protecting against cell death. Moreover, WA induced generation of reactive oxygen species (ROS in PC-3 and DU-145, but not in normal fibroblasts. Immunocytochemistry and immuno-electron microscopy revealed that WA disrupted the vimentin cytoskeleton, possibly inducing the ROS generation, c-Fos expression and c-FLIP(L suppression. These observations suggest that multiple events followed by disruption of the vimentin cytoskeleton play pivotal roles in WA-mediated cell death.

  18. A branching process model for the analysis of abortive colony size distributions in carbon ion-irradiated normal human fibroblasts

    International Nuclear Information System (INIS)

    Sakashita, Tetsuya; Kobayashi, Yasuhiko; Hamada, Nobuyuki; Kawaguchi, Isao; Hara, Takamitsu; Saito, Kimiaki

    2014-01-01

    A single cell can form a colony, and ionizing irradiation has long been known to reduce such a cellular clonogenic potential. Analysis of abortive colonies unable to continue to grow should provide important information on the reproductive cell death (RCD) following irradiation. Our previous analysis with a branching process model showed that the RCD in normal human fibroblasts can persist over 16 generations following irradiation with low linear energy transfer (LET) γ-rays. Here we further set out to evaluate the RCD persistency in abortive colonies arising from normal human fibroblasts exposed to high-LET carbon ions (18.3 MeV/u, 108 keV/μm). We found that the abortive colony size distribution determined by biological experiments follows a linear relationship on the log–log plot, and that the Monte Carlo simulation using the RCD probability estimated from such a linear relationship well simulates the experimentally determined surviving fraction and the relative biological effectiveness (RBE). We identified the short-term phase and long-term phase for the persistent RCD following carbon-ion irradiation, which were similar to those previously identified following γ-irradiation. Taken together, our results suggest that subsequent secondary or tertiary colony formation would be invaluable for understanding the long-lasting RCD. All together, our framework for analysis with a branching process model and a colony formation assay is applicable to determination of cellular responses to low- and high-LET radiation, and suggests that the long-lasting RCD is a pivotal determinant of the surviving fraction and the RBE. (author)

  19. Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

    International Nuclear Information System (INIS)

    Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

    1982-01-01

    Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

  20. Expression profiles are different in carbon ion-irradiated normal human fibroblasts and their bystander cells

    International Nuclear Information System (INIS)

    Iwakawa, Mayumi; Hamada, Nobuyuki; Imadome, Kaori; Funayama, Tomoo; Sakashita, Testuya; Kobayashi, Yasuhiko; Imai, Takashi

    2008-01-01

    Evidence has accumulated that ionizing radiation induces biological effects in non-irradiated bystander cells having received signals from directly irradiated cells; however, energetic heavy ion-induced bystander response is incompletely characterized. Here we performed microarray analysis of irradiated and bystander fibroblasts in confluent cultures. To see the effects in bystander cells, each of 1, 5 and 25 sites was targeted with 10 particles of carbon ions (18.3 MeV/u, 103 keV/μm) using microbeams, where particles traversed 0.00026, 0.0013 and 0.0066% of cells, respectively. diated cells, cultures were exposed to 10% survival dose (D), 0.1D and 0.01D of corresponding broadbeams (108 keV/μm). Irrespective of the target numbers (1, 5 or 25 sites) and the time (2 or 6 h postirradiation), similar expression changes were observed in bystander cells. Among 874 probes that showed more than 1.5-fold changes in bystander cells, 25% were upregulated and the remainder downregulated. These included genes related to cell communication (PIK3C2A, GNA13, FN1, ANXA1 and IL1RAP), stress response (RAD23B, ATF4 and EIF2AK4) and cell cycle (MYCN, RBBP4 and NEUROG1). Pathway analysis revealed serial bystander activation of G protein/PI-3 kinase pathways. Instead, genes related to cell cycle or death (CDKN1A, GADD45A, NOTCH1 and BCL2L1), and cell communication (IL1B, TCF7 and ID1) were upregulated in irradiated cells, but not in bystander cells. Our results indicate different expression profiles in irradiated and bystander cells, and imply that intercellular signaling between irradiated and bystander cells activate intracellular signaling, leading to the transcriptional stress response in bystander cells

  1. Temporally distinct response of irradiated normal human fibroblasts and their bystander cells to energetic heavy ions

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Ni, Meinan; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced bystander effects have been documented for a multitude of endpoints such as mutations, chromosome aberrations and cell death, which arise in nonirradiated bystander cells having received signals from directly irradiated cells; however, energetic heavy ion-induced bystander response is incompletely characterized. To address this, we employed precise microbeams of carbon and neon ions for targeting only a very small fraction of cells in confluent fibroblast cultures. Conventional broadfield irradiation was conducted in parallel to see the effects in irradiated cells. Exposure of 0.00026% of cells led to nearly 10% reductions in the clonogenic survival and twofold rises in the apoptotic incidence regardless of ion species. Whilst apoptotic frequency increased with time up to 72 h postirradiation in irradiated cells, its frequency escalated up to 24 h postirradiation but declined at 48 h postirradiation in bystander cells, indicating that bystander cells exhibit transient commitment to apoptosis. Carbon- and neon-ion microbeam irradiation similarly caused almost twofold increments in the levels of serine 15-phosphorylated p53 proteins, irrespective of whether 0.00026, 0.0013 or 0.0066% of cells were targeted. Whereas the levels of phosphorylated p53 were elevated and remained unchanged at 2 h and 6 h postirradiation in irradiated cells, its levels rose at 6 h postirradiation but not at 2 h postirradiation in bystander cells, suggesting that bystander cells manifest delayed p53 phosphorylation. Collectively, our results indicate that heavy ions inactivate clonogenic potential of bystander cells, and that the time course of the response to heavy ions differs between irradiated and bystander cells. These induced bystander responses could be a defensive mechanism that minimizes further expansion of aberrant cells

  2. Fibroblast growth factor receptor signaling is essential for normal mammary gland development and stem cell function.

    Science.gov (United States)

    Pond, Adam C; Bin, Xue; Batts, Torey; Roarty, Kevin; Hilsenbeck, Susan; Rosen, Jeffrey M

    2013-01-01

    Fibroblast growth factor (FGF) signaling plays an important role in embryonic stem cells and adult tissue homeostasis, but the function of FGFs in mammary gland stem cells is less well defined. Both FGFR1 and FGFR2 are expressed in basal and luminal mammary epithelial cells (MECs), suggesting that together they might play a role in mammary gland development and stem cell dynamics. Previous studies have demonstrated that the deletion of FGFR2 resulted only in transient developmental defects in branching morphogenesis. Using a conditional deletion strategy, we investigated the consequences of FGFR1 deletion alone and then the simultaneous deletion of both FGFR1 and FGFR2 in the mammary epithelium. FGFR1 deletion using a keratin 14 promoter-driven Cre-recombinase resulted in an early, yet transient delay in development. However, no reduction in functional outgrowth potential was observed following limiting dilution transplantation analysis. In contrast, a significant reduction in outgrowth potential was observed upon the deletion of both FGFR1 and FGFR2 in MECs using adenovirus-Cre. Additionally, using a fluorescent reporter mouse model to monitor Cre-mediated recombination, we observed a competitive disadvantage following transplantation of both FGFR1/R2-null MECs, most prominently in the basal epithelial cells. This correlated with the complete loss of the mammary stem cell repopulating population in the FGFR1/R2-attenuated epithelium. FGFR1/R2-null MECs were partially rescued in chimeric outgrowths containing wild-type MECs, suggesting the potential importance of paracrine mechanisms involved in the maintenance of the basal epithelial stem cells. These studies document the requirement for functional FGFR signaling in mammary stem cells during development. Copyright © 2012 AlphaMed Press.

  3. Poly(I:C) induces expressions of MMP-1, -2, and -3 through various signaling pathways including IRF3 in human skin fibroblasts.

    Science.gov (United States)

    Yao, Cheng; Lee, Dong Hun; Oh, Jang-Hee; Kim, Min-Kyoung; Kim, Kyu Han; Park, Chi-Hyun; Chung, Jin Ho

    2015-10-01

    Ultraviolet (UV) irradiation can result in premature skin aging (photoaging) which is characterized by decreased expression of collagen and increased expression of matrix metalloproteinases (MMPs). Double-stranded RNAs (dsRNAs) can be generated at various conditions including virally infected cells or UV-damaged skin cells. Recent studies have shown that a synthetic dsRNA, polyinosinic-polycytidylic acid (poly(I:C)), can reduce procollagen expression in human skin fibroblasts. However, little is known about the effect of poly(I:C) on the expression of MMPs in skin fibroblasts and its underlying mechanisms. We examined the effect of poly(I:C) on MMP-1, -2, and -3 expressions in human skin fibroblasts. Then, we further explored the underlying signaling pathways involved in the processes. Human skin fibroblasts were treated with poly(I:C) for the indicated times in the presence or the absence of various chemical inhibitors or small interfering RNAs (siRNAs) at the indicated concentrations. Protein and mRNA levels of various target molecules were examined by Western blotting and quantitative real-time PCR, respectively. Poly(I:C) induced MMP-1, -2, and -3 expressions, which were dependent on TLR3. Poly(I:C) also induced activations of the mitogen-activated protein kinases (MAPKs), the nuclear factor-kappaB (NF-κB) and the interferon regulatory factor 3 (IRF3) pathways. By using specific inhibitors, we found that poly(I:C)-induced expressions of MMP-1, -2, and -3 were differentially regulated by these signaling pathways. In particular, we found that the inhibition of IRF3 signaling pathways attenuated poly(I:C)-induced expressions of all the three MMPs. Our data show that the expressions of MMP-1, -2, and -3 are induced by poly(I:C) through various signaling pathways in human skin fibroblasts and suggest that TLR3 and/or IRF3 may be good targets for regulating the expressions of MMP-1, -2, and -3 induced by dsRNAs. Copyright © 2015 Elsevier Ireland Ltd. All rights

  4. Photobiomodulation of distinct lineages of human dermal fibroblasts: a rational approach towards the selection of effective light parameters for skin rejuvenation and wound healing

    Science.gov (United States)

    Mignon, Charles; Uzunbajakava, Natallia E.; Raafs, Bianca; Moolenaar, Mitchel; Botchkareva, Natalia V.; Tobin, Desmond J.

    2016-03-01

    Distinct lineages of human dermal fibroblasts play complementary roles in skin rejuvenation and wound healing, which makes them a target of phototherapy. However, knowledge about differential responses of specific cell lineages to different light parameters and moreover the actual molecular targets remain to be unravelled. The goal of this study was to investigate the impact of a range of parameters of light on the metabolic activity, collagen production, and cell migration of distinct lineages of human dermal fibroblasts. A rational approach was used to identify parameters with high therapeutic potential. Fibroblasts exhibited both inhibitory and cytotoxic change when exposed to a high dose of blue and cyan light in tissue culture medium containing photo-reactive species, but were stimulated by high dose red and near infrared light. Cytotoxic effects were eliminated by refreshing the medium after light exposure by removing potential ROS formed by extracellular photo-reactive species. Importantly, distinct lineages of fibroblasts demonstrated opposite responses to low dose blue light treatment when refreshing the medium after exposure. Low dose blue light treatment also significantly increased collagen production by papillary fibroblasts; high dose significantly retarded closure of the scratch wound without signs of cytotoxicity, and this is likely to have involved effects on both cell migration and proliferation. We recommend careful selection of fibroblast subpopulations and their culture conditions, a systematic approach in choosing and translating treatment parameters, and pursuit of fundamental research on identification of photoreceptors and triggered molecular pathways, while seeking effective parameters to address different stages of skin rejuvenation and wound healing.

  5. Loss of a putative tumor suppressor locus after gamma-ray-induced neoplastic transformation of HeLa x Skin fibroblast human cell hybrids

    International Nuclear Information System (INIS)

    Mendonca, M.S.; Redpath, J.L.; Fasching, C.L.

    1995-01-01

    The nontumorigenic HeLa x skin fibroblast hybrid cell line, CGL1, can be induced to re-express HeLa tumor-associated cell surface antigen, p75-IAP (intestinal alkaline phosphatase), with resulting neoplastic transformation, by exposure to γ radiation. This has allowed the human hybrid system to be developed into a quantitative in vitro model for radiation-induced neoplastic transformation of human cells. Recently, several γ-ray-induced IAP-expression mutants (GIMs) of the nontumorigenic HeLa x skin fibroblast hybrid CGL1 were isolated and all were tumorigenic when injected subcutaneously into nude mice. Control cell lines which were negative for p75-IAP (CONs) were also isolated from irradiated populations, and none were found to be tumorigenic. We have now begun to investigate the molecular basis of radiation-induced neoplastic transformation in this system by studying the potential genetic linkage between p75/IAP expression, tumorigenicity and damage to a putative tumor suppressor locus on fibroblast chromosome 11. Previous analysis of rare spontaneous segregants has indicated that this locus is involved in the regulation of tumorigenicity and in the expression of the HeLa tumor-associated cell surface marker intestinal alkaline phosphatase (p75-IAP) in this system. Therefore, analysis by restriction fragment length polymorphism and chromosome painting have been performed for chromosome 11, and for chromosome 13 as a control, for the p75/IAP-positive GIM and p75/IAP-negative CON cell lines. We report that in five of eight of the GIMs large-scale damage to the fibroblast chromosome 11's is evident (four GIMs have lost one complete copy of a fibroblast chromosome 11 heavily damaged). None of the CONs, however (0/5), have lost a complete copy of either fibroblast chromosome 11. No large-scale damage to the control chromosome 13's was detected in the GIMs or CONs. 49 refs., 3 figs., 2 tabs

  6. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  7. [Clinical application of artificial dermis combined with basic fibroblast growth factor in the treatment of cicatrix and deep skin wounds].

    Science.gov (United States)

    Liu, Yang; Zhang, Yilan; Huang, Yalan; Luo, Gaoxing; Peng, Yizhi; Yan, Hong; Luo, Qizhi; Zhang, Jiaping; Wu, Jun; Peng, Daizhi

    2016-04-01

    To observe the effects of artificial dermis combined with basic fibroblast growth factor (bFGF) on the treatment of cicatrix and deep skin wounds. The clinical data of 72 patients with wounds repaired with artificial dermis, hospitalized in our unit from October 2010 to April 2015, conforming to the study criteria, were retrospectively analyzed. The types of wounds were wounds after resection of cicatrices, deep burn wounds without exposure of tendon or bone, and wounds with exposure of small area of tendon or bone, in a total number of 102. Wounds were divided into artificial dermis group (A, n=60) and artificial dermis+ bFGF group (B, n=42) according to whether or not artificial dermis combined with bFGF. In group A, after release and resection of cicatrices or thorough debridement of deep skin wounds, artificial dermis was directly grafted to wounds in the first stage operation. After complete vascularization of artificial dermis, wounds were repaired with autologous split-thickness skin grafts in the second stage operation. In group B, all the procedures were exactly the same as those in group A except that artificial dermis had been soaked in bFGF for 30 min before grafting. Operation area, complete vascularization time of artificial dermis, survival of skin grafts, and the follow-up condition of wounds in the two groups were recorded. Data were processed with t test and Fisher's exact test. (1) Operation areas of wounds after resection of cicatrices, deep burn wounds without exposure of tendon or bone, and wounds with exposure of small area of tendon or bone in the two groups were about the same (with t values from -1.853 to -0.200, P values above 0.05). Complete vascularization time of artificial dermis in wounds after resection of cicatrices, deep burn wounds without exposure of tendon or bone, and wounds with exposure of small area of tendon or bone in group B were respectively (15.6 ± 2.9), (14.7 ± 2.7), and (20.3 ± 4.4) d, and they were shorter by an

  8. The effect of Centella asiatica, vitamins, glycolic acid and their mixtures preparations in stimulating collagen and fibronectin synthesis in cultured human skin fibroblast.

    Science.gov (United States)

    Hashim, Puziah

    2014-03-01

    Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.

  9. Heme oxygenase is the major 32-kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1989-01-01

    We have shown that UVA (320-380 nm) radiation, hydrogen peroxide, and sodium arsenite induce a stress protein of approximately 32 kDa in human skin fibroblasts. The synthesis and cloning of cDNA from arsenite-induced mRNA populations have now allowed us to unequivocally identify the 32-kDa protein as heme oxygenase. By mRNA analysis we have shown that the heme oxygenase gene is also induced in cultured human skin fibroblasts by UVA radiation, hydrogen peroxide, cadmium chloride, iodoacetamide, and menadione. The known antioxidant properties of heme catabolites taken together with the observation of a high level of induction of the enzyme in cells from an organ not involved in hemoglobin breakdown strongly supports the proposal that the induction of heme oxygenase may be a general response to oxidant stress and constitutes an important cellular defense mechanism against oxidative damage

  10. Senescence-associated microRNAs target cell cycle regulatory genes in normal human lung fibroblasts.

    Science.gov (United States)

    Markopoulos, Georgios S; Roupakia, Eugenia; Tokamani, Maria; Vartholomatos, George; Tzavaras, Theodore; Hatziapostolou, Maria; Fackelmayer, Frank O; Sandaltzopoulos, Raphael; Polytarchou, Christos; Kolettas, Evangelos

    2017-10-01

    Senescence recapitulates the ageing process at the cell level. A senescent cell stops dividing and exits the cell cycle. MicroRNAs (miRNAs) acting as master regulators of transcription, have been implicated in senescence. In the current study we investigated and compared the expression of miRNAs in young versus senescent human fibroblasts (HDFs), and analysed the role of mRNAs expressed in replicative senescent HFL-1 HDFs. Cell cycle analysis confirmed that HDFs accumulated in G 1 /S cell cycle phase. Nanostring analysis of isolated miRNAs from young and senescent HFL-1 showed that a distinct set of 15 miRNAs were significantly up-regulated in senescent cells including hsa-let-7d-5p, hsa-let-7e-5p, hsa-miR-23a-3p, hsa-miR-34a-5p, hsa-miR-122-5p, hsa-miR-125a-3p, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-181a-5p, hsa-miR-221-3p, hsa-miR-222-3p, hsa-miR-503-5p, hsa-miR-574-3p, hsa-miR-574-5p and hsa-miR-4454. Importantly, pathway analysis of miRNA target genes down-regulated during replicative senescence in a public RNA-seq data set revealed a significant high number of genes regulating cell cycle progression, both G 1 /S and G 2 /M cell cycle phase transitions and telomere maintenance. The reduced expression of selected miRNA targets, upon replicative and oxidative-stress induced senescence, such as the cell cycle effectors E2F1, CcnE, Cdc6, CcnB1 and Cdc25C was verified at the protein and/or RNA levels. Induction of G1/S cell cycle phase arrest and down-regulation of cell cycle effectors correlated with the up-regulation of miR-221 upon both replicative and oxidative stress-induced senescence. Transient expression of miR-221/222 in HDFs promoted the accumulation of HDFs in G1/S cell cycle phase. We propose that miRNAs up-regulated during replicative senescence may act in concert to induce cell cycle phase arrest and telomere erosion, establishing a senescent phenotype. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Injury induces in vivo expression of platelet-derived growth factor (PDGF) and PDGF receptor mRNAs in skin epithelial cells and PDGF mRNA in connective tissue fibroblasts

    International Nuclear Information System (INIS)

    Antoniades, H.N.; Galanopoulos, T.; Neville-Golden, J.; Kiritsy, C.P.; Lynch, S.E.

    1991-01-01

    Platelet-derived growth factor (PDGF) stimulates many of the processes important in tissue repair, including proliferation of fibroblasts and synthesis of extracellular matrices. In this study, the authors have demonstrated with in situ hydridization and immunocytochemistry the reversible expression of 3-sis/PDGF-2 and PDGF receptor (PDGF-R) b mRNAs and their respective protein products in epithelial cells and fibroblasts following cutaneous injury in pigs. Epithelial cells in control, unwounded skin did not express c-sis and PDGF-R mRNAs, and fibroblasts expressed only PDGF-R mRNA. The expression levels in the injured site were correlated with the stage of tissue repair, being highest during the initial stages of the repair process and declining at the time of complete re-epithelialization and tissue remodeling. These studies provide a mulecular basis for understanding the mechanisms contributing to normal tissue repair. They suggest the possibility that a defect in these mechanisms may be associated with defective wound healing. It is also conceivable that chronic injury may induce irreversible gene expression leading to pathologic, unregulated cell growth

  12. Effects of the Nd:YAG laser on DNA synthesis and collagen production in human skin fibroblast cultures

    Energy Technology Data Exchange (ETDEWEB)

    Castro, D.J.; Abergel, R.P.; Meeker, C.; Dwyer, R.M.; Lesavoy, M.A.; Uitto, J.

    1983-09-01

    Human skin fibroblasts were subjected to treatment with a Neodymium:YAG laser at 1060 nm with varying levels of energy determined by a reproducible method of dosimetry. DNA synthesis in the cells was measured by the incorporation of (3H)thymidine, and collagen production was monitored by the synthesis of nondialyzable (3H)hydroxyproline after incubation of cells with (3H)proline. Using energy levels equal to 1.7 X 10(3) J/cm2, a significant reduction in DNA synthesis was noted, while the cells remained viable as tested by the trypan blue exclusion test. With energy levels higher or equal to 2.3 X 10(3) J/cm2, the suppression of DNA synthesis was accompanied by cell nonviability. The collagen production, when measured immediately following the treatment with 1.7 X 10(3) J/cm2, was markedly reduced, and similar effects were observed with higher energy levels. However, when the cells were tested for collagen production at 20 hours following laser treatment, there was a significant decrease in collagen production at energy levels as low as 1.1 X 10(3) J/cm2, a dose that did not affect DNA synthesis or cell viability. Thus, the results indicate that the Nd:YAG laser can selectively suppress collagen production without affecting cell proliferation. These observations suggest that laser treatment could potentially be used to reduce collagen deposition in conditions such as keloids and hypertrophic scars.

  13. Altered binding of 125I-labeled calmodulin to a 46.5-kilodalton protein in skin fibroblasts cultured from patients with cystic fibrosis

    International Nuclear Information System (INIS)

    Tallant, E.A.; Wallace, R.W.

    1987-01-01

    The levels of calmodulin and calmodulin-binding proteins have been determined in cultured skin fibroblasts from patients with cystic fibrosis (CF) and age- and sex-matched controls. Calmodulin ranged from 0.20 to 0.76 microgram/mg protein; there was no difference between calmodulin concentration in fibroblasts from CF patients and controls. Calmodulin-binding proteins of 230, 212, 204, 164, 139, 70, 59, 46.5, and 41 kD were identified. A protein with a mobility identical to the 59-kD calmodulin-binding protein was labeled by antiserum against calmodulin-dependent phosphatase. Although Ca 2+ /calmodulin-dependent phosphatase activity was detected, there was no different in activity between control and CF fibroblasts or in the level of phosphatase protein as determined by radioimmunoassay. Lower amounts of 125 I-calmodulin were bound to the 46.5-kD calmodulin-binding protein in CF fibroblasts as compared with controls. The 46.5-kD calmodulin-binding protein may be reduced in CF fibroblasts or its structure may be altered resulting in a reduced binding capacity and/or affinity for calmodulin and perhaps reflecting, either directly or indirectly, the genetic defect responsible for cystic fibrosis

  14. Acyl CoA Binding Domain Containing 3 (ACBD3) Protein in Huntington’s Disease 
Human Skin Fibroblasts

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, H.; Rodinová, M.; Sládková, J.; Klempíř, J.; Lišková, Irena; Motlík, Jan; Zeman, J.; Hansíková, H.; Tesařová, M.

    2015-01-01

    Roč. 78, Suppl. 2 (2015), s. 34-38 ISSN 1210-7859. [Conference on Animal Models for neurodegenerative Diseases /3./. Liblice, 08.11.2015-10.11.2015] R&D Projects: GA MŠk ED2.1.00/03.0124 Institutional support: RVO:67985904 Keywords : Huntington’s disease * Acyl-CoA binding domain containing 3 protein * human skin fibroblasts Subject RIV: FH - Neurology Impact factor: 0.209, year: 2015

  15. Parapoxvirus orf virus infection induces an increase in interleukin-8, tumour necrosis factor-α, and decorin in goat skin fibroblast cells

    Directory of Open Access Journals (Sweden)

    Wang Lingling

    2016-09-01

    Full Text Available Introduction: Orf virus (ORFV is a prototype Parapoxvirus species in the Poxviridae family that causes serious zoonotic infectious disease. Goat skin fibroblast (GSF cells are the major host targets of ORFV. Interleukin 8 (IL-8 and tumour necrosis factor (TNF-α are known to play a vital role in immune response during viral infections. However, the manner of variation over time of their level of expression in GSF cells remains unclear.

  16. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  17. Decreased expression of lysyl hydroxylase 2 (LH2) in skin fibroblasts from three Ehlers-Danlos patients does not result from mutations in either the coding or proximal promoter region of the LH2 gene.

    Science.gov (United States)

    Walker, L C; Teebi, A S; Marini, J C; De Paepe, A; Malfait, F; Atsawasuwan, P; Yamauchi, M; Yeowell, H N

    2004-12-01

    The Ehlers-Danlos syndromes (EDS) are a heterogeneous group of inherited connective tissue disorders characterized by tissue fragility, hyperelasticity of the skin and joint hypermobility. This phenotype, accompanied by kyphoscoliosis and/or ocular fragility, is present in patients with the autosomal recessive type VI form of EDS. These patients have significantly decreased levels of lysyl hydroxylase (LH) activity, due to mutations in the LH1 gene. LH hydroxylates specific lysine residues in the collagen molecule that are precursors for the formation of cross-links which provide collagen with its tensile strength. No disorder has been directly linked to decreased expression of LH2 and LH3, two other isoforms of LH. This study describes 3 patients with mixed phenotypes of EDS, who have significantly decreased mRNAs for LH2, but normal levels of LH1 and LH3 mRNAs, in their skin fibroblasts. In contrast to the effect of LH1 deficiency in EDS VI patients, the decreased expression of LH2 does not affect LH activity, bifunctional collagen cross-links (measured after reduction as dihydroxylysinonorleucine (DHLNL) and hydroxylysinonorleucine (HLNL)), or helical lysine hydroxylation in these cell lines. Sequence analysis of full length LH2 cDNAs and 1kb of the promoter region of LH2 does not show mutations that could explain the decreased expression of LH2. These results suggest that the deficiency of LH2 in these fibroblasts may be caused by changes in other factors required for the expression of LH2.

  18. Low-Dose Hyper-Radiosensitivity Is Not a Common Effect in Normal Asynchronous and G2-Phase Fibroblasts of Cancer Patients

    International Nuclear Information System (INIS)

    Słonina, Dorota; Biesaga, Beata; Janecka, Anna; Kabat, Damian; Bukowska-Strakova, Karolina; Gasińska, Anna

    2014-01-01

    Purpose: In our previous study, using the micronucleus assay, a low-dose hyper-radiosensitivity (HRS)-like phenomenon was observed for normal fibroblasts of 2 of the 40 cancer patients investigated. In this article we report, for the first time, the survival response of primary fibroblasts from 25 of these patients to low-dose irradiation and answer the question regarding the effect of G2-phase enrichment on HRS elicitation. Methods and Materials: The clonogenic survival of asynchronous as well as G2-phase enriched fibroblast populations was measured. Separation of G2-phase cells and precise cell counting was performed using a fluorescence-activated cell sorter. Sorted and plated cells were irradiated with single doses (0.1-4 Gy) of 6-MV x-rays. For each patient, at least 4 independent experiments were performed, and the induced-repair model was fitted over the whole data set to confirm the presence of HRS effect. Results: The HRS response was demonstrated for the asynchronous and G2-phase enriched cell populations of 4 patients. For the rest of patients, HRS was not defined in either of the 2 fibroblast populations. Thus, G2-phase enrichment had no effect on HRS elicitation. Conclusions: The fact that low-dose hyper-radiosensitivity is not a common effect in normal human fibroblasts implies that HRS may be of little consequence in late-responding connective tissues with regard to radiation fibrosis

  19. The small-molecule Bcl-2 inhibitor HA14-1 sensitizes cervical cancer cells, but not normal fibroblasts, to heavy-ion radiation

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Kataoka, Keiko; Sora, Sakura; Hara, Takamitsu; Omura-Minamisawa, Motoko; Funayama, Tomoo; Sakashita, Tetsuya; Nakano, Takashi; Kobayashi, Yasuhiko

    2008-01-01

    This is the first study to demonstrate that the small-molecule Bcl-2 inhibitor HA14-1 renders human cervical cancer cells and their Bcl-2 overexpressing radioresistant counterparts, but not normal fibroblasts, more susceptible to heavy ions. Thus, Bcl-2 may be an attractive target for improving the efficacy of heavy-ion therapy

  20. Epidermal growth factor receptor-induced activato protein 1 activity controls density-dependent growht inhibition in normal rat kidney fibroblasts.

    NARCIS (Netherlands)

    Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.

    2006-01-01

    Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these

  1. Effects of plant sterols derived from Aloe vera gel on human dermal fibroblasts in vitro and on skin condition in Japanese women

    Directory of Open Access Journals (Sweden)

    Tanaka M

    2015-02-01

    Full Text Available Miyuki Tanaka,1 Eriko Misawa,1 Koji Yamauchi,1 Fumiaki Abe,1 Chiaki Ishizaki2 1Functional Food Research Department, Food Science and Technology Institute, Morinaga Milk Industry Co, Ltd, Zama, Kanagawa, 2Ebisu Skin Research Center, Inforward, Inc., Tokyo, Japan Background: Aloe is known for its topical use for treating wounds and burns. Many previous studies reported the healing effects of Aloe vera. However, there are few clinical studies on the effect of orally administered A. vera gel on the skin. Aloe sterols are a type of plant sterols that have the capability to regulate the metabolism of glucose and lipids. In a recent study, we confirmed that ingested Aloe sterols reached the peripheral tissues through the bloodstream. However, their influence on dermal fibroblasts has not been investigated. Methods: First, we investigated the capability of Aloe sterols (cycloartenol and lophenol to stimulate human dermal fibroblasts in vitro. Then, we investigated the effect of intake of Aloe vera gel powder (AVGP containing 40 µg Aloe sterols on the skin conditions in Japanese women with dry skin in a randomized, double-blind, placebo-controlled trial. Results: After cocultivation with Aloe sterols, the production of collagen and hyaluronic acid increased by approximately two-fold and 1.5-fold, and gene expression levels of these enzymes responsible for their synthesis were also observed in human dermal fibroblasts. An increase in arm skin hydration was observed at 8 weeks in the AVGP group, whereas a slight decrease in arm skin hydration was noted in the placebo group. However, there was no statistical difference between AVGP and placebo groups in skin moisture. In subgroup analysis, the change in the mean wrinkle depth was significantly lower in the AVGP group than in the control group. In addition, percent body fat after 8 weeks was significantly lower in the AVGP group. No AVGP intake-dependent harmful phenomenon was observed during the intake

  2. Evaluating the Toxicity of the Analgesic Glutaminase Inhibitor 6-Diazo-5-Oxo-L-Norleucine in vitro and on Rat Dermal Skin Fibroblasts

    Science.gov (United States)

    Crosby, Heith A; Ihnat, Michael; Miller, Kenneth E

    2018-01-01

    6-diazo-5-oxo-l-norleucine (DON) is a glutamine antagonist produced naturally by Streptomyces. It inhibits several glutamine-dependent enzyme pathways. Of particular note is its inhibitory effect on the mitochondrial enzyme, glutaminase (GLS), the primary producer of neuronal glutamate. Glutamate is an excitatory neurotransmitter released by primary sensory peripheral nerve terminals and spinal synaptic terminals during pain signaling. Previous work using the tail incision and inflammatory models of pain has demonstrated that a single application of the glutaminase inhibitor, DON, into a surgical incision or the paw of arthritic animals results in pain relief. Even though this compound shows promise as a therapeutic agent, limited data exist regarding its dermal toxicity. As a first approach, we evaluated the effect of several concentrations of DON, on the viability, mitochondrial oxidative capacity and proliferation of rat skin fibroblasts, and then examined the effect of DON after incubation with human liver microsomes on proliferation. Finally, we evaluated DON treated rat skin (tail and hind paw) for cellular necrosis, inflammation and mitotic bodies. No significant effects (p > 0.05) of DON were noted on apoptosis, necrosis, and mitochondrial activity in experiments with cultured rat skin fibroblasts. Flow cytometry revealed the absence of apoptosis in cells treated at the IC50 of 232.5 μM. Enhanced toxicity post-exposure to human microsomes was not observed when compared to DON alone. The H&E staining of the rat skin revealed no obvious pathology in the DON treatment group (10 mM). DON has no/minimal cellular toxicity in vitro on dermal fibroblasts at concentrations that effectively provide analgesia. The local application of concentrations greater than the in vitro IC50 for DON revealed no in vivo skin toxicity. These data provide results indicating zero-to-minimal cellular toxicity with DON and support the further investigation of DON as an analgesic. PMID

  3. Maternal nutrient restriction in baboon programs later-life cellular growth and respiration of cultured skin fibroblasts: a potential model for the study of aging-programming interactions.

    Science.gov (United States)

    Salmon, Adam B; Dorigatti, Jonathan; Huber, Hillary F; Li, Cun; Nathanielsz, Peter W

    2018-05-25

    Compelling data exist for programming of chronic later-life diseases and longevity by perinatal developmental programming challenges. Understanding mechanisms by which life course health trajectory and longevity are set is fundamental to understanding aging. Appropriate approaches are needed to determine programming effects on cellular function. We have developed a baboon model in which control mothers eat ad libitum while a second group eat 70% of the global diet fed controls, leading to male and female offspring intrauterine growth restriction (IUGR). We have shown that IUGR suffer from acceleration of several age-related physiological declines. Here, we report on a skin-derived fibroblast model with potential relevance for mechanistic studies on how IUGR impacts aging. Fibroblasts were cultured from the skin biopsies taken from adult baboons from control and IUGR cohorts. IUGR-derived fibroblasts grew in culture less well than controls and those derived from male, but not female, IUGR baboons had a significant reduction in maximum respiration rate compared to control-derived fibroblasts. We also show that relative levels of several mitochondrial protein subunits, including NDUFB8 and cytochrome c oxidase subunit IV, were reduced in IUGR-derived fibroblasts even after serial passaging in culture. The lower levels of electron transport system components provide potential mechanisms for accelerated life course aging in the setting of programmed IUGR. This observation fits with the greater sensitivity of males compared with females to many, but not all, outcomes in response to programming challenges. These approaches will be powerful in the determination of programming-aging interactions.

  4. Skin Aging-Dependent Activation of the PI3K Signaling Pathway via Downregulation of PTEN Increases Intracellular ROS in Human Dermal Fibroblasts

    Directory of Open Access Journals (Sweden)

    Eun-Mi Noh

    2016-01-01

    Full Text Available Reactive oxygen species (ROS play a major role in both chronological aging and photoaging. ROS induce skin aging through their damaging effect on cellular constituents. However, the origins of ROS have not been fully elucidated. We investigated that ROS generation of replicative senescent fibroblasts is generated by the modulation of phosphatidylinositol 3,4,5-triphosphate (PIP3 metabolism. Reduction of the PTEN protein, which dephosphorylates PIP3, was responsible for maintaining a high level of PIP3 in replicative cells and consequently mediated the activation of the phosphatidylinositol-3-OH kinase (PI3K/Akt pathway. Increased ROS production was blocked by inhibition of PI3K or protein kinase C (PKC or by NADPH oxidase activating in replicative senescent cells. These data indicate that the signal pathway to ROS generation in replicative aged skin cells can be stimulated by reduced PTEN level. Our results provide new insights into skin aging-associated modification of the PI3K/NADPH oxidase signaling pathway and its relationship with a skin aging-dependent increase of ROS in human dermal fibroblasts.

  5. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

    Science.gov (United States)

    Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

    2013-12-15

    The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

  6. Reduction in life span on normal human fibroblasts exposed to low-dose radiation in heavy-ion radiation field

    International Nuclear Information System (INIS)

    Suzuki, Masao; Yamaguchi, Chizuru; Yasuda, Hiroshi; Uchihori, Yukio; Fujitaka, Kazunobu

    2003-01-01

    We studied the effect of in vitro life span in normal human fibroblasts exposed to chronically low-dose radiation in heavy-ion radiation field. Cells were cultured in a CO 2 incubator, which was set in the irradiation room for biological study of heavy ions in the Heavy Ion Medical Accelerator in Chiba (HIMAC) at National Institute of Radiological Sciences (NIRS), and exposed to scattered radiations produced with heavy-ion beams throughout the life span of the cell population. Absorbed dose, which was measured using a thermoluminescence dosimeter(TLD) and a Si-semiconductor detector, was to be 1.4 mGy per day when operating the HIMAC machine for biological experiments. The total population doubling number of the exposed cells reduced to 79-93% of non-exposed control cells in the three independent experiments. There is evidence that the exposure of chronically low-dose radiation in heavy-ion radiation field promotes the life-span reduction in cellular level. (author)

  7. Dependence of the bystander effect for micronucleus formation on dose of heavy-ion radiation in normal human fibroblasts

    International Nuclear Information System (INIS)

    Matsumoto, Yoshitaka; Hamada, Nobuyuki; Aoki-Nakano, Mizuho; Furusawa, Yoshiya; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko; Wada, Seiichi; Kakizaki, Takehiko

    2015-01-01

    Ionising radiation-induced bystander effects are well recognised, but its dependence on dose or linear energy transfer (LET) is still a matter of debate. To test this, 49 sites in confluent cultures of AG01522D normal human fibroblasts were targeted with microbeams of carbon (103 keV μm -1 ), neon (375 keV μm -1 ) and argon ions (1260 keV μm -1 ) and evaluated for the bystander-induced formation of micronucleus that is a kind of a chromosome aberration. Targeted exposure to neon and argon ions significantly increased the micronucleus frequency in bystander cells to the similar extent irrespective of the particle numbers per site of 1- 6. In contrast, the bystander micronucleus frequency increased with increasing the number of carbon-ion particles in a range between 1 and 3 particles per site and was similar in a range between 3 and 8 particles per site. These results suggest that the bystander effect of heavy ions for micronucleus formation depends on dose. (authors)

  8. A framework for analysis of abortive colony size distributions using a model of branching processes in irradiated normal human fibroblasts.

    Science.gov (United States)

    Sakashita, Tetsuya; Hamada, Nobuyuki; Kawaguchi, Isao; Ouchi, Noriyuki B; Hara, Takamitsu; Kobayashi, Yasuhiko; Saito, Kimiaki

    2013-01-01

    Clonogenicity gives important information about the cellular reproductive potential following ionizing irradiation, but an abortive colony that fails to continue to grow remains poorly characterized. It was recently reported that the fraction of abortive colonies increases with increasing dose. Thus, we set out to investigate the production kinetics of abortive colonies using a model of branching processes. We firstly plotted the experimentally determined colony size distribution of abortive colonies in irradiated normal human fibroblasts, and found the linear relationship on the log-linear or log-log plot. By applying the simple model of branching processes to the linear relationship, we found the persistent reproductive cell death (RCD) over several generations following irradiation. To verify the estimated probability of RCD, abortive colony size distribution (≤ 15 cells) and the surviving fraction were simulated by the Monte Carlo computational approach for colony expansion. Parameters estimated from the log-log fit demonstrated the good performance in both simulations than those from the log-linear fit. Radiation-induced RCD, i.e. excess probability, lasted over 16 generations and mainly consisted of two components in the early (probability over 5 generations, whereas abortive colony size distribution was robust against it. These results suggest that, whereas short-term RCD is critical to the abortive colony size distribution, long-lasting RCD is important for the dose response of the surviving fraction. Our present model provides a single framework for understanding the behavior of primary cell colonies in culture following irradiation.

  9. Acrolein-exposed normal human lung fibroblasts in vitro: cellular senescence, enhanced telomere erosion, and degradation of Werner's syndrome protein.

    Science.gov (United States)

    Jang, Jun-Ho; Bruse, Shannon; Huneidi, Salam; Schrader, Ronald M; Monick, Martha M; Lin, Yong; Carter, A Brent; Klingelhutz, Aloysius J; Nyunoya, Toru

    2014-09-01

    Acrolein is a ubiquitous environmental hazard to human health. Acrolein has been reported to activate the DNA damage response and induce apoptosis. However, little is known about the effects of acrolein on cellular senescence. We examined whether acrolein induces cellular senescence in cultured normal human lung fibroblasts (NHLF). We cultured NHLF in the presence or absence of acrolein and determined the effects of acrolein on cell proliferative capacity, senescence-associated β-galactosidase activity, the known senescence-inducing pathways (e.g., p53, p21), and telomere length. We found that acrolein induced cellular senescence by increasing both p53 and p21. The knockdown of p53 mediated by small interfering RNA (siRNA) attenuated acrolein-induced cellular senescence. Acrolein decreased Werner's syndrome protein (WRN), a member of the RecQ helicase family involved in DNA repair and telomere maintenance. Acrolein-induced down-regulation of WRN protein was rescued by p53 knockdown or proteasome inhibition. Finally, we found that acrolein accelerated p53-mediated telomere shortening. These results suggest that acrolein induces p53-mediated cellular senescence accompanied by enhanced telomere attrition and WRN protein down-regulation.

  10. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  11. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  12. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  13. Cytoskeletal proteins from human skin fibroblasts, peripheral blood leukocytes, and a lymphoblastoid cell line compared by two-dimensional gel electrophoresis

    International Nuclear Information System (INIS)

    Giometti, C.S.; Willard, K.E.; Anderson, N.L.

    1982-01-01

    Differences in proteins between cells grown as suspension cultures and those grown as attached cultures were studied by comparing the proteins of detergent-resistant cytoskeletons prepared from peripheral blood leukocytes and a lymphoblastoid cell line (GM607) (both grown as suspension cultures) and those of human skin fibroblasts (grown as attached cultures) by two-dimensional gel electrophoresis. The major cytoskeletal proteins of the leukocytes were also present in the protein pattern of GM607 cytoskeletons. In contrast, the fibroblast cytoskeletal protein pattern contained four groups of proteins that differed from the patterns of the leukocytes and GM607. In addition, surface labeling of GM607 and human fibroblasts with 125 I demonstrated that substantial amounts of vimentin and actin are exposed at the surface of the attached fibroblasts, but there is little evidence of similar exposure at the surface of the suspension-grown GM607. These results demonstrate some differences in cytoskeletal protein composition between different types of cells could be related to their ability or lack of ability to grow as attached cells in tissue culture

  14. Absence of correlations between the radiosensitivity of human T-lymphocytes at G0 and skin fibroblasts at log phase from the same individuals

    International Nuclear Information System (INIS)

    Kushiro, Jun-ichi; Nakamura, Nori; Kyoizumi, Seishi; Nishiki, Masayuki; Dohi, Kiyohiko; Akiyama, Mitoshi.

    1990-01-01

    Matched samples of peripheral T-lymphocytes and skin fibroblasts from a total of 22 patients who underwent various surgical procedures were tested for a dose-survival study using loss of colony-forming ability as the end point. The results showed that the mean D 10 (the dose required to kill 90 % of the cells) ±SD was 3.58 ± 0.21 Gy for T-lymphocytes irradiated at G 0 and 3.19 ± 0.37 Gy for skin fibroblasts irradiated at log phase. The coefficient of variation was found to be 6 % and 11 %, respectively. Contrary to expectation, regression analysis of the D 10 values for the two cell types revealed no significant correlations. The absence of correlation is most probably derived from the fact that the apparent interindividual variability of dose-survival curves is largely caused by random experimental fluctuations, at least for lymphocytes. Possible reasons for the greater variability observed in the fibroblast assay are discussed. (author)

  15. CopA3 Peptide Prevents Ultraviolet-Induced Inhibition of Type-I Procollagen and Induction of Matrix Metalloproteinase-1 in Human Skin Fibroblasts

    Directory of Open Access Journals (Sweden)

    Dong-Hee Kim

    2014-05-01

    Full Text Available Ultraviolet (UV exposure is well-known to induce premature aging, which is mediated by matrix metalloproteinase-1 (MMP-1 activity. A 9-mer peptide, CopA3 (CopA3 was synthesized from a natural peptide, coprisin, which is isolated from the dung beetle Copris tripartitus. As part of our continuing search for novel bioactive natural products, CopA3 was investigated for its in vitro anti-skin photoaging activity. UV-induced inhibition of type-I procollagen and induction of MMP-1 were partially prevented in human skin fibroblasts by CopA3 peptide in a dose-dependent manner. At a concentration of 25 μM, CopA3 nearly completely inhibited MMP-1 expression. These results suggest that CopA3, an insect peptide, is a potential candidate for the prevention and treatment of skin aging.

  16. [Expressiona of c-Jun and collagens I and III in cultured human skin fibroblasts are affected by infrared ray radiation].

    Science.gov (United States)

    Liu, Ping; Yang, Rong-Li; Su, Hui; Li, Lin-Li; Song, Jian-Wen; Lu, Ning; Liu, Yu-Ze

    2016-02-01

    To observe the effect of solar infrared ray (IR) radiation on the expressions of c-Jun and collagens I and III in cultured human skin fibroblasts (HSFs) and explore the molecular mechanism by which IR radiation causes aging of the skin. Primarily cultured HSFs exposed to IR radiation were examined for changes of the cell viability with MTT assay. The mRNA and protein expressions of c-Jun and collagens I and III was detected with real-time quantitative PCR and immunocytochemistry. MTT assay showed that IR irradiation caused inhibition of cell proliferation compared with the control cells. The mRNA and protein expression of collagen I was decreased significantly by IR irradiation with the increase of the irradiation dose (Pradiation to initiate and promote skin photoaging.

  17. 9-AAA inhibits growth and induces apoptosis in human melanoma A375 and rat prostate adenocarcinoma AT-2 and Mat-LyLu cell lines but does not affect the growth and viability of normal fibroblasts.

    Science.gov (United States)

    Korohoda, Włodzimierz; Hapek, Anna; Pietrzak, Monika; Ryszawy, Damian; Madeja, Zbigniew

    2016-11-01

    The present study found that, similarly to 5-fluorouracil, low concentrations (1-10 µM) of 9-aminoacridine (9-AAA) inhibited the growth of the two rat prostate cancer AT-2 and Mat-LyLu cell lines and the human melanoma A375 cell line. However, at the same concentrations, 9-AAA had no effect on the growth and apoptosis of normal human skin fibroblasts (HSFs). The differences between the cellular responses of the AT-2 and Mat-LyLu cell lines, which differ in malignancy, were found to be relatively small compared with the differences between normal HSFs and the cancer cell lines. Visible effects on the cell growth and survival of tumor cell lines were observed after 24-48 h of treatment with 9-AAA, and increased over time. The inhibition of cancer cell growth was found to be due to the gradually increasing number of cells dying by apoptosis, which was observed using two methods, direct counting and FlowSight analysis. Simultaneously, cell motile activity decreased to the same degree in cancer and normal cells within the first 8 h of incubation in the presence of 9-AAA. The results presented in the current study suggest that short-lasting tests for potential anticancer substances can be insufficient; which may result in cell type-dependent differences in the responses of cells to tested compounds that act with a delay being overlooked. The observed differences in responses between normal human fibroblasts and cancer cells to 9-AAA show the requirement for additional studies to be performed simultaneously on differently reacting cancer and normal cells, to determine the molecular mechanisms responsible for these differences.

  18. PMN Leukocytes and Fibroblasts Numbers on Wound Burn Healing on the Skin of White Rat after Administration of Ambonese Plantain Banana

    Directory of Open Access Journals (Sweden)

    Juniarti

    2012-04-01

    Full Text Available A study of ambonese plantain banana (Musa paradisiaca var sapientum Lamb treatment in burn wound healing on the skin of white rats (Rattus novergicus has been conducted. The wound healing of burn injuries was evaluated by counting the number of PMN leukocytes and fibroblasts at the 7th, 14th, and 21st days following the treatment. The study showed that the decrease in number of PMN leukocytes of subjects treated with ambonese plantain banana was relatively more significant compared to both negative and positive control (Bioplacenton ®. In contrast, an increasing number of fibroblasts was significantly demonstrated at the 14th and 21st days after treatment. In conclusion, ambonese plantain banana treatment in burn injuries will provide better results compared to both positive and negative controls.

  19. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  20. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  1. Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

    Science.gov (United States)

    Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

    2012-10-01

    An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

  2. Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

    Science.gov (United States)

    Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

    2000-11-01

    When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

  3. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  4. Effects of macelignan isolated from Myristica fragrans (nutmeg) on expression of matrix metalloproteinase-1 and type I procollagen in UVB-irradiated human skin fibroblasts

    International Nuclear Information System (INIS)

    Lee, Kyung-Eun; Mun, Sukyeong; Pyun, Hee-Bong; Kim, Myung-Suk; Hwang, Jae-Kwan

    2012-01-01

    Exposure to ultraviolet (UV) light causes premature skin aging that is associated with upregulated matrix metalloproteinases (MMPs) and decreased collagen synthesis. Macelignan, a natural lignan compound isolated from Myristica fragrans HOUTT. (nutmeg), has been reported to possess antioxidant and antiinflammatory activities. This study assessed the effects of macelignan on photoaging and investigated its mechanisms of action in UV-irradiated human skin fibroblasts (Hs68) by reverse transcription-polymerase chain reaction, Western blot analysis, 2', 7'-dichlorofluorescein diacetate assay, and enzyme-linked immunosorbent assay. Our results show that macelignan attenuated UV-induced MMP-1 expression by suppressing phosphorylation of mitogen-activated protein kinases (MAPKs) induced by reactive oxygen species. Macelignan also increased type I procollagen expression and secretion through transforming growth factor β (TGF-β)/Smad signaling. These findings indicate that macelignan regulates the expression of MMP-1 and type I procollagen in UV-irradiated human skin fibroblasts by modulating MAPK and TGF-β/Smad signaling, suggesting its potential as an efficacious antiphotoaging agent. (author)

  5. DNA-mediated gene transfer into human diploid fibroblasts derived from normal and ataxia-telangiectasia donors: parameters for DNA transfer and properties of DNA transformants

    International Nuclear Information System (INIS)

    Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.

    1984-01-01

    An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)

  6. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  7. Increased expression of enhancer of Zeste Homolog 2 (EZH2) differentiates squamous cell carcinoma from normal skin and actinic keratosis.

    Science.gov (United States)

    Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi

    2014-01-01

    Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.

  8. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Label-free characterization of ultra violet-radiation-induced changes in skin fibroblasts with Raman spectroscopy and quantitative phase microscopy.

    Science.gov (United States)

    Singh, S P; Kang, Sungsam; Kang, Jeon Woong; So, Peter T C; Dasari, Ramanchandra Rao; Yaqoob, Zahid; Barman, Ishan

    2017-09-07

    Minimizing morbidities and mortalities associated with skin cancers requires sustained research with the goal of obtaining fresh insights into disease onset and progression under specific stimuli, particularly the influence of ultraviolet rays. In the present study, label-free profiling of skin fibroblasts exposed to time-bound ultra-violet radiation has been performed using quantitative phase imaging and Raman spectroscopy. Statistically significant differences in quantifiable biophysical parameters, such as matter density and cell dry mass, were observed with phase imaging. Accurate estimation of changes in the biochemical constituents, notably nucleic acids and proteins, was demonstrated through a combination of Raman spectroscopy and multivariate analysis of spectral patterns. Overall, the findings of this study demonstrate the promise of these non-perturbative optical modalities in accurately identifying cellular phenotypes and responses to external stimuli by combining molecular and biophysical information.

  10. Molecular Insights into SIRT1 Protection Against UVB-Induced Skin Fibroblast Senescence by Suppression of Oxidative Stress and p53 Acetylation.

    Science.gov (United States)

    Chung, Ki Wung; Choi, Yeon Ja; Park, Min Hi; Jang, Eun Ji; Kim, Dae Hyun; Park, Byung Hyun; Yu, Byung Pal; Chung, Hae Young

    2015-08-01

    Stresses, such as exposure to ultraviolet radiation and those associated with aging, are known to cause premature cellular senescence that is characterized by growth arrest and morphological and gene expression changes. This study was designed to investigate the protective effect of Sirtuin1 (SIRT1) on the UVB-induced premature senescence. Under in vitro experimental conditions, exposure to a subcytotoxic dose of UVB enhanced human skin fibroblasts senescence, as characterized by increased β-galactosidase activity and increased levels of senescence-associated proteins. However, adenovirus-mediated SIRT1 overexpression significantly protected fibroblasts from UVB-induced cellular deterioration. Exposure to UVB-induced cell senescence was associated with oxidative stress and p38 mitogen-activated protein kinase activation. Molecular analysis demonstrated that deacetylation of Forkhead box O3α (FOXO3α) by SIRT1 changed the transcriptional activity of FOXO3α and increased resistance to the oxidative stress. In addition, SIRT1 suppressed UVB-induced p53 acetylation and its transcriptional activity, which directly affected the cell cycle arrest induced by UVB. Further study demonstrated that SIRT1 activation inhibited cell senescence in the skin of the HR1 hairless mouse exposed to UVB. The study identifies a new role for SIRT1 in the UVB-induced senescence of skin fibroblats and provides a potential target for skin protection through molecuar insights into the mechanisms responsible for UVB-induced photoaging. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Effects of combination therapy using basic fibroblast growth factor and mature adipocyte-derived dedifferentiated fat (DFAT) cells on skin graft revascularisation.

    Science.gov (United States)

    Asami, Takashi; Soejima, Kazutaka; Kashimura, Tsutomu; Kazama, Tomohiko; Matsumoto, Taro; Morioka, Kosuke; Nakazawa, Hiroaki

    2015-01-01

    Although the benefits of basic fibroblast growth factor (bFGF) for wound healing and angiogenesis are well known, its effects on the process of skin graft revascularisation have not been clarified. It was hypothesised that bFGF would be beneficial to promote taking of skin grafts, but that the effect might be limited in the case of bFGF monotherapy. Therefore, this study investigated the efficacy of combination therapy using bFGF and dedifferentiated fat (DFAT) cells. DFAT cells have multilineage differentiation potential, including into endothelial cells, similar to the case of mesenchymal stem cells (MSC). Commercially available human recombinant bFGF was used. DFAT cells were prepared from SD strain rats as an adipocyte progenitor cell line from mature adipocytes. Full-thickness skin was lifted from the back of SD strain rats and then grafted back to the original wound site. Four groups were established prior to skin grafting: control group (skin graft alone), bFGF group (treated with bFGF), DFAT group (treated with DFAT cells), and combination group (treated with both bFGF and DFAT cells). Tissue specimens for histological examination were harvested 48 hours after grafting. The histological findings for the bFGF group showed vascular augmentation in the grafted dermis compared with the control group. However, the difference in the number of revascularised vessels per unit area did not reach statistical significance against the control group. In contrast, in the combination group, skin graft revascularisation was significantly promoted, especially in the upper dermis. The results suggest that replacement of the existing graft vessels was markedly promoted by the combination therapy using bFGF and DFAT cells, which may facilitate skin graft taking.

  12. Genomic instability in mutation induction on normal human fibroblasts irradiated with chronic low-dose radiations in heavy-ion radiation field

    International Nuclear Information System (INIS)

    Suzuki, M.; Tsuruoka, C.; Uchihori, Y.; Yasuda, H.; Fujitaka, K.

    2003-01-01

    Full text: At a time when manned space exploration is more a reality with the planned the International Space Station (ISS) underway, the potential exposure of crews in a spacecraft to chronic low-dose radiations in the field of low-flux galactic cosmic rays (GCR) and the subsequent biological effects have become one of the major concerns of space science. We have studied both in vitro life span and genomic instability in cellular effects in normal human skin fibroblasts irradiated with chronic low-dose radiations in heavy-ion radiation field. Cells were cultured in a CO2 incubator, which was set in the irradiation room for the biological study of heavy ions in the Heavy Ion Medical Accelerator in Chiba (HIMAC) at National Institute of Radiological Sciences (NIRS), and irradiated with scattered radiations produced from heavy ions. Absorbed dose measured using a thermoluminescence dosimeter (TLD) and a Si-semiconductor detector was to be around 1.4 mGy per day when operating the HIMAC machine for biological experiments. The total population doubling number (tPDN) of low-dose irradiated cells was significantly smaller (79-93%) than that of unirradiated cells. The results indicate that the life span of the cell population shortens by irradiating with low-dose scattered radiations in the heavy-ion irradiation field. Genomic instability in cellular responses was examined to measure either cell killing or mutation induction in low-dose accumulated cells after exposing to X-ray challenging doses. The results showed that there was no enhanced effect on cell killing between low-dose accumulated and unirradiated cells after exposing to defined challenging doses of 200kV X rays. On the contrary, the mutation frequency on hprt locus of low-dose accumulated cells was much higher than that of unirradiated cells. The results suggested that genomic instability was induced in mutagenesis by the chronic low-dose irradiations in heavy-ion radiation field

  13. Radiosensitivity in cultured human fibroblasts

    International Nuclear Information System (INIS)

    Cox, R.; Masson, W.K.

    1980-01-01

    Caution is urged in the use of freshly isolated cultures of human diploid fibroblasts for quantitative studies of radiosensitivity. The distribution of x ray sensitivities of 'normal' human fibroblast cultures of foetal origin (10 subjects, skin or lung biopsy) and post-foetal origin (34 subjects, skin biopsy) are compared with the distribution in 12 patients with ataxia telangiectasia (probability of including any one of these in a normal post-foetal distribution is 0.01%). Cultures from nominally normal subjects showed a broad distribution of D 0 range of 98 +- 160 rad and assuming normal distribution, a mean +- one standard deviation of 122 +- 17 rad. Mean D 0 values for foetal origin cultures were 117 +- 12; values for post-foetal cultures D 0 were 124 +- 18. No systematic variation in D 0 was observed for age of donor, number of cell divisions in culture or for cloning efficiency. For ataxia telangiectasia D 0 values were 46 +- 7 rad. (U.K.)

  14. Fibroblast implantation enhances wound healing as indicated by breaking strength determinations

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, W W; Goepfert, H; Romsdahl, M; Hersen, J; Withers, R H; Jesse, R H

    1978-09-01

    Irradiation of normal tissues at the dose/time factor employed in the treatment of solid tumors impairs the subsequent healing of surgical wounds made in those tissues. Irreversible radiation damage to regional fibroblasts is one cause of impared healing. This study was conducted to determine whether syngeneic guinea pig fibroblasts is one cause of impared healing. This study was conducted to determine whether syngeneic guinea pig fibroblasts, harvested from tissue culture when injected into irradiated guinea pig skin at the time of wound closure, could improve wound healing. Breaking strength determinations indicate that irradiated wounds demonstrate enhanced wound healing if implanted with fibroblasts.

  15. Comparative studies of host-cell reactivation, cellular capacity and enhanced reactivation of herpes simplex virus in normal, xeroderma pigmentosum and Cockayne syndrome fibroblasts

    International Nuclear Information System (INIS)

    Ryan, D.K.G.; Rainbow, A.J.; McMaster Univ., Hamilton, Ontario

    1986-01-01

    Host-cell reactivation (HCR) of UV-irradiated herpes simplex virus type 2 (HSV-2), capacity of UV-irradiated cells to support HSV-2 plaque formation and UV-enhanced reactivation (UVER) of UV-irradiated HSV-2 were examined in fibroblasts from 4 patients with Cockayne syndrome (CS), 5 with xeroderma pigmentosum and 5 normals. The results indicate that delayed capacity for HSV-2 plaque formation is a more sensitive assay than HCR in the detection of cellular DNA-repair deficiency for XP and CS. For the examination of UVER, fibroblasts were irradiated with various UV doses and subsequently infected with either unirradiated or UV-irradiated HSV and scored for plaque formation 2 days later. UVER expression was maximum when the delay between UV-irradiation of the cells and HSV infection was 48 h. (Auth.)

  16. Signaling pathway activation drift during aging: Hutchinson-Gilford Progeria Syndrome fibroblasts are comparable to normal middle-age and old-age cells.

    Science.gov (United States)

    Aliper, Alexander M; Csoka, Antonei Benjamin; Buzdin, Anton; Jetka, Tomasz; Roumiantsev, Sergey; Moskalev, Alexy; Zhavoronkov, Alex

    2015-01-01

    For the past several decades, research in understanding the molecular basis of human aging has progressed significantly with the analysis of premature aging syndromes. Progerin, an altered form of lamin A, has been identified as the cause of premature aging in Hutchinson-Gilford Progeria Syndrome (HGPS), and may be a contributing causative factor in normal aging. However, the question of whether HGPS actually recapitulates the normal aging process at the cellular and organismal level, or simply mimics the aging phenotype is widely debated. In the present study we analyzed publicly available microarray datasets for fibroblasts undergoing cellular aging in culture, as well as fibroblasts derived from young, middle-age, and old-age individuals, and patients with HGPS. Using GeroScope pathway analysis and drug discovery platform we analyzed the activation states of 65 major cellular signaling pathways. Our analysis reveals that signaling pathway activation states in cells derived from chronologically young patients with HGPS strongly resemble cells taken from normal middle-aged and old individuals. This clearly indicates that HGPS may truly represent accelerated aging, rather than being just a simulacrum. Our data also points to potential pathways that could be targeted to develop drugs and drug combinations for both HGPS and normal aging.

  17. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

    2011-01-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  18. Excision of gamma-ray induced thymine lesions by preparations from ataxia telangiectasia fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Remsen, J F; Cerutti, P A [Florida Univ., Gainesville (USA). Inst. of Food and Agricultural Sciences; Florida Univ., Gainesville (USA). Dept. of Biochemistry)

    1977-04-01

    The capacity of whole cell sonicates of skin fibroblasts of normal individuals and patients with the autosomal recessive disease Ataxia telangiectasia (AT) to remove aerobic gamma-ray products of the 5,6-dihydroxydihydrothymine type (tsub(O/sub 2/)sup(..gamma..)) from exogenous DNA substrates was investigated. All four AT strains (AT CRL 1312, AT CRL 1343, AT GM 367, AT 4BI) possessed normal capabilities to excise tsub(O/sub 2/)sup(..gamma..) from irradiated bacteriophage DNA and irradiated chromatin isolated from normal and AT-skin fibroblasts.

  19. High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

    Science.gov (United States)

    Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

    2016-09-01

    Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Plasma Rich in Growth Factors Enhances Wound Healing and Protects from Photo-oxidative Stress in Dermal Fibroblasts and 3D Skin Models.

    Science.gov (United States)

    Anitua, Eduardo; Pino, Ander; Jaen, Pedro; Orive, Gorka

    2016-01-01

    Optimal skin repair has been a desired goal for many researchers. Recently, plasma rich in growth factors (PRGF) has gained importance in dermatology proving it is beneficial effects in wound healing and cutaneous regeneration. The anti-fibrotic, pro-contractile and photo-protective effect of PRGF on dermal fibroblasts and 3D skin models has been evaluated. The effect against TGFβ1 induced myofibroblast differentiation was tested. Cell contractile activity over collagen gel matrices was analyzed and the effect against UV derived photo-oxidative stress was assessed. The effectiveness of PRGF obtained from young aged and middle aged donors was compared. Furthermore, 3D organotypic skin explants were used as human skin models with the aim of analyzing ex vivo cutaneous preventive and regenerative photo-protection after UV exposure. TGFβ1 induced myofibroblast levels decreased significantly after treatment with PRGF while the contractile activity increased compared to the control group. After UV irradiation, cell survival was promoted while apoptotic and ROS levels were noticeably reduced. Photo-exposed 3D explants showed higher levels of metabolic activity and lower levels of necrosis, cell damage, irritation and ROS formation when treated with PRGF. The histological integrity and connective tissue fibers showed lower signals of photodamage among PRGF injected skin models. No significant differences for the assessed biological outcomes were observed when PRGF obtained from young aged and middle aged donors were compared. These findings suggest that this autologous approach might be useful for antifibrotic wound healing and provide an effective protection against sun derived photo-oxidative stress regardless the age of the patient.

  1. Decreased mitochondrial density and ultrastructural changes of mitochondria in cultivated skin fibroblasts of patients with Huntington´s disease

    Czech Academy of Sciences Publication Activity Database

    Rodinová, M.; Marková, M.; Kratochvílová, H.; Kučerová, I.; Tesařová, M.; Lišková, Irena; Klempíř, J.; Roth, J.; Zeman, J.; Hansíková, H.

    2015-01-01

    Roč. 78, Suppl 2 (2015), s. 20-21 ISSN 1210-7859. [Conference on Animal Models for neurodegenerative Diseases /3./. 08.11.2015-10.11.2015, Liblice] R&D Projects: GA MŠk ED2.1.00/03.0124; GA MŠk(CZ) 7F14308 Institutional support: RVO:67985904 Keywords : Huntington ´s disease * fibroblasts * mitochondrial ultrastructure Subject RIV: FH - Neurology

  2. Salubrinal protects human skin fibroblasts against UVB-induced cell death by blocking endoplasmic reticulum (ER) stress and regulating calcium homeostasis.

    Science.gov (United States)

    Ji, Chao; Yang, Bo; Huang, Shu-Ying; Huang, Jin-Wen; Cheng, Bo

    2017-12-02

    The role of UVB in skin photo damages has been widely reported. Overexposure to UVB will induce severe DNA damages in epidermal cells and cause most cytotoxic symptoms. In the present study, we tested the potential activity of salubrinal, a selective inhibitor of Eukaryotic Initiation Factor 2 (eIF2) -alpha phosphatase, against UV-induced skin cell damages. We first exposed human fibroblasts to UVB radiation and evaluated the cytosolic Ca 2+ level as well as the induction of ER stress. We found that UVB radiation induced the depletion of ER Ca 2+ and increased the expression of ER stress marker including phosphorylated PERK, CHOP, and phosphorylated IRE1α. We then determined the effects of salubrinal in skin cell death induced by UVB radiation. We observed that cells pre-treated with salubrinal had a higher survival rate compared to cells treated with UVB alone. Pre-treatment with salubrinal successfully re-established the ER function and Ca 2+ homeostasis. Our results suggest that salubrinal can be a potential therapeutic agents used in preventing photoaging and photo damages. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Molecular analysis by electron microscopy of the removal of psoralen-photoinduced DNA cross-links in normal and Fanconi's anemia fibroblasts

    International Nuclear Information System (INIS)

    Rousset, S.; Nocentini, S.; Revet, B.; Moustacchi, E.

    1990-01-01

    The induction and fate of psoralen-photoinduced DNA interstrand cross-links in the genome of Fanconi's anemia (FA) fibroblasts of complementation groups A and B, and of normal human fibroblasts, were investigated by quantitative analysis of totally denatured DNA fragments visualized by electron microscopy. 8-Methoxypsoralen (5 x 10(-5) M) interstrand cross-links were induced as a function of the near ultraviolet light dose. With time of postexposure incubation, a fraction of interstrand cross-links disappeared in all cell lines. However, 24 h after treatment, this removal was significantly lower in the two FA group A cell lines examined (34-39%) than in the FA group B and normal cell lines (43-53 and 47-57%, respectively). These data indicate that FA cells are at least able to recognize and incise interstrand cross-links, as normal cells do, although group A cells seem somewhat hampered in this process. This is in accord with data obtained on the same cell lines using another biochemical assay. Since the fate of cross-links in FA constituted a controversial matter, it is important to stress that two different methodologies applied to genetically well defined cell lines led to the same conclusions

  4. Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

    International Nuclear Information System (INIS)

    Garver, R.I. Jr.; Chytil, A.; Karlsson, S.

    1987-01-01

    α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

  5. Evidence that novobiocin and nalidixic acid do not inhibit excision repair in u.v.-irradiated human skin fibroblasts at a pre-incision

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1985-01-01

    The effects of novobiocin and nalidixic acid on the specific toxicity of aphidicolin towards u.v. irradiated arrested human skin fibroblasts have been determined. Contrary to the result expected if either drug were causing inhibition of excision repair at a pre-incision step the sector of toxicity due to a combined treatment of 300 μg ml -1 nalidixic acid and 1.0 μg ml -1 aphidicolin is unchanged when compared with that due to treatment with 1.0 μg ml -1 aphidicolin alone, while that for 150 μg ml -1 novobiocin + 1.0 μg ml -1 aphidicolin was slightly increased. In parallel measurements of the inhibition of u.v.-induced DNA repair synthesis in arrested fibroblasts by these drugs, 150 μg ml -1 novobiocin inhibited repair synthesis by approx.60% over the fluence range employed. Nalidixic acid (300 μg ml -1 ) caused no detectable inhibition of repair synthesis. It was concluded that the mode of action of novobiocin in the inhibition of DNA excision repair is not via the inhibition of a pre-incision step and the data do not support the hypothesis that a type II topoisomerase mediated change in DNA supercoiling is an essential early step in excision repair of u.v.-induced damage. (author)

  6. Evidence that novobiocin and nalidixic acid do not inhibit excision repair in u.v.-irradiated human skin fibroblasts at a pre-incision step

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1985-01-01

    The effects of novobiocin and nalidixic acid on the specific toxicity of aphidicolin towards u.v. irradiated arrested (nondividing) human skin fibroblasts have been determined. Contrary to the result expected if either drug were causing inhibition of excision repair at a pre-incision step the sector of toxicity due to a combined treatment of 300 micrograms ml -1 nalidixic acid and 1.0 micrograms ml -1 aphidicolin is unchanged when compared with that due to treatment with 1.0 micrograms ml -1 aphidicolin alone, while that for 150 micrograms ml -1 novobiocin + 1.0 micrograms ml -1 aphidicolin was slightly increased. In parallel measurements of the inhibition of u.v.-induced DNA repair synthesis in arrested fibroblasts by these drugs, 150 micrograms ml -1 novobiocin inhibited repair synthesis by approximately 60% over the fluence range employed. Nalidixic acid at a concentration of 300 micrograms ml -1 caused no detectable inhibition of repair synthesis. The authors conclude that the mode of action of novobiocin in the inhibition of DNA excision repair is not via the inhibition of a pre-incision step and the data do not support the hypothesis that a type II topoisomerase mediated change in DNA supercoiling is an essential early step in excision repair of u.v.-induced damage

  7. Comparative microscopic and biochemical study of the uptake of fluorescent and 125I-labeled lipoproteins by skin fibroblasts, smooth muscle cells, and peritoneal macrophages in culture

    International Nuclear Information System (INIS)

    Reynolds, G.D.; St Clair, R.W.

    1985-01-01

    Uptake of low density lipoprotein (LDL) and of acetyl LDL was compared in skin fibroblasts, smooth muscle cells, and peritoneal macrophages with the use of lipoproteins labeled with either 125 I or the fluorescent probe 3,3'-dioctadecylindocarbocyanine (DiI). The uptake of DiI-labeled lipoproteins was assessed by quantitative spectrofluorometry and by fluorescence microscopy. The DiI was quantitatively retained by the cells, while the 125 I-LDL was degraded and 125 I-labeled degradation products were excreted from the cells. In smooth muscle cells and fibroblasts the uptake of LDL was virtually the same whether measured with the use of the DiI or 125 I-label. The labeling of acetyl LDL with DiI enhanced its uptake in peritoneal macrophages by an average of 18%. With the DiI label, lipoprotein uptake could be determined after as little as 10 minutes of incubation at 37 C. The pattern of uptake of the DiI-labeled lipoproteins was consistent with binding to specific receptors, because no DiI could be detected in mutant cells without LDL receptors, and uptake was competitively inhibited by addition of excess unlabeled lipoprotein. When the DiI-labeled lipoproteins were removed from the medium, there was a 5-15% loss of DiI from all cell types studied over the first 24 hours

  8. Cutis laxa: reduced elastin gene expression in skin fibroblast cultures as determined by hybridizations with a homologous cDNA and an exon 1-specific oligonucleotide

    International Nuclear Information System (INIS)

    Olsen, D.R.; Fazio, M.J.; Shamban, A.T.; Rosenbloom, J.; Uitto, J.

    1988-01-01

    Fibroblast cultures were established from six patients with cutis laxa, and elastin gene expression was analyzed by RNA hybridizations with a 2.5-kilobase human elastin cDNA or an exon 1-specific 35-base oligomer. Northern analyses using either probe detected mRNA transcripts of ∼ 3.5 kilobases, and no qualitative difference between the control and cutis laxa mRNAs was detected. However, quantitation of the elastin mRNA abundance by slot blot hybridizations revealed markedly reduced levels in all cutis laxa cell strains. Assuming equal translational activity of the control and cutix laxa mRNAs, the reduced mRNA levels could result in diminished elastin production, providing an explanation for the paucity of elastic fibers in the skin and other tissues in cutis laxa

  9. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  10. H2O2 treatment or serum deprivation induces autophagy and apoptosis in naked mole-rat skin fibroblasts by inhibiting the PI3K/Akt signaling pathway.

    Science.gov (United States)

    Zhao, Shanmin; Li, Li; Wang, Shiyong; Yu, Chenlin; Xiao, Bang; Lin, Lifang; Cong, Wei; Cheng, Jishuai; Yang, Wenjing; Sun, Wei; Cui, Shufang

    2016-12-20

    Naked mole-rats (NMR; Heterocephalus glaber) display extreme longevity and resistance to cancer. Here, we examined whether autophagy contributes to the longevity of NMRs by assessing the effects of the PI3K/Akt pathway inhibitor LY294002 and the autophagy inhibitor chloroquine (CQ) on autophagy and apoptosis in NMR skin fibroblasts. Serum starvation, H2O2 treatment, and LY294002 treatment all increased the LC3-II/LC3-I ratio and numbers of double-membraned autophagosomes and autophagic vacuoles, and decreased levels of p70S6K, p-AktSer473, and p-AktThr308. By contrast, CQ treatment decreased p70S6K, AktSer473, and AktThr308 levels. The Bax/Bcl-2 ratio increased after 12 h of exposure to LY294002 or CQ. These data show that inhibiting the Akt pathway promotes autophagy and apoptosis in NMR skin fibroblasts. Furthermore, LY294002 or CQ treatment decreased caspase-3, p53, and HIF1-α levels, suggesting that serum starvation or H2O2 treatment increase autophagy and apoptosis in NMR skin fibroblasts by inhibiting the PI3K/Akt pathway. CQ-induced inhibition of late autophagy stages also prevented Akt activation and induced apoptosis. Finally, the HIF-1α and p53 pathways were involved in serum starvation- or H2O2-induced autophagy in NMR skin fibroblasts.

  11. Transcriptome analysis of skin fibroblasts with dominant negative COL3A1 mutations provides molecular insights into the etiopathology of vascular Ehlers-Danlos syndrome.

    Science.gov (United States)

    Chiarelli, Nicola; Carini, Giulia; Zoppi, Nicoletta; Ritelli, Marco; Colombi, Marina

    2018-01-01

    Vascular Ehlers-Danlos syndrome (vEDS) is a dominantly inherited connective tissue disorder caused by mutations in the COL3A1 gene that encodes type III collagen (COLLIII), which is the major expressed collagen in blood vessels and hollow organs. The majority of disease-causing variants in COL3A1 are glycine substitutions and in-frame splice mutations in the triple helix domain that through a dominant negative effect are associated with the severe clinical spectrum potentially lethal of vEDS, characterized by fragility of soft connective tissues with arterial and organ ruptures. To shed lights into molecular mechanisms underlying vEDS, we performed gene expression profiling in cultured skin fibroblasts from three patients with different structural COL3A1 mutations. Transcriptome analysis revealed significant changes in the expression levels of several genes involved in maintenance of cell redox and endoplasmic reticulum (ER) homeostasis, COLLs folding and extracellular matrix (ECM) organization, formation of the proteasome complex, and cell cycle regulation. Protein analyses showed that aberrant COLLIII expression is associated with the disassembly of many structural ECM constituents, such as fibrillins, EMILINs, and elastin, as well as with the reduction of the proteoglycans perlecan, decorin, and versican, all playing an important role in the vascular system. Furthermore, the altered distribution of the ER marker protein disulfide isomerase PDI and the strong reduction of the COLLs-modifying enzyme FKBP22 are consistent with the disturbance of ER-related homeostasis and COLLs biosynthesis and post-translational modifications, indicated by microarray analysis. Our findings add new insights into the pathophysiology of this severe vascular disorder, since they provide a picture of the gene expression changes in vEDS skin fibroblasts and highlight that dominant negative mutations in COL3A1 also affect post-translational modifications and deposition into the ECM of

  12. Transcriptome analysis of skin fibroblasts with dominant negative COL3A1 mutations provides molecular insights into the etiopathology of vascular Ehlers-Danlos syndrome.

    Directory of Open Access Journals (Sweden)

    Nicola Chiarelli

    Full Text Available Vascular Ehlers-Danlos syndrome (vEDS is a dominantly inherited connective tissue disorder caused by mutations in the COL3A1 gene that encodes type III collagen (COLLIII, which is the major expressed collagen in blood vessels and hollow organs. The majority of disease-causing variants in COL3A1 are glycine substitutions and in-frame splice mutations in the triple helix domain that through a dominant negative effect are associated with the severe clinical spectrum potentially lethal of vEDS, characterized by fragility of soft connective tissues with arterial and organ ruptures. To shed lights into molecular mechanisms underlying vEDS, we performed gene expression profiling in cultured skin fibroblasts from three patients with different structural COL3A1 mutations. Transcriptome analysis revealed significant changes in the expression levels of several genes involved in maintenance of cell redox and endoplasmic reticulum (ER homeostasis, COLLs folding and extracellular matrix (ECM organization, formation of the proteasome complex, and cell cycle regulation. Protein analyses showed that aberrant COLLIII expression is associated with the disassembly of many structural ECM constituents, such as fibrillins, EMILINs, and elastin, as well as with the reduction of the proteoglycans perlecan, decorin, and versican, all playing an important role in the vascular system. Furthermore, the altered distribution of the ER marker protein disulfide isomerase PDI and the strong reduction of the COLLs-modifying enzyme FKBP22 are consistent with the disturbance of ER-related homeostasis and COLLs biosynthesis and post-translational modifications, indicated by microarray analysis. Our findings add new insights into the pathophysiology of this severe vascular disorder, since they provide a picture of the gene expression changes in vEDS skin fibroblasts and highlight that dominant negative mutations in COL3A1 also affect post-translational modifications and deposition

  13. Effects of CO{sub 2} laser irradiation on the wettability and human skin fibroblast cell response of magnesia partially stabilised zirconia

    Energy Technology Data Exchange (ETDEWEB)

    Hao, L.; Lawrence, J

    2003-10-15

    Human skin fibroblast cells in vitro responses on the surface of a bioinert zirconia ceramic partially stabilised with magnesia partially stabilised zirconia (MgO-PSZ) bioinert ceramic before and after CO{sub 2} laser treatment were investigated to find the interrelationship between the cell adhesion, wettability and laser parameters. Contact angle, {theta}, measurements of a set of test liquids were a clear indication that surface treatment of the MgO-PSZ with a CO{sub 2} laser brought about a reduction in {theta}, indicating that the wettability of the MgO-PSZ had been enhanced. A relationship was found between the wettability and the microstructure of the MgO-PSZ surface and laser processing parameters. It was subsequently deduced that the factors active in causing the observed modification in the wettability of the MgO-PSZ were the increases in the surface O{sub 2} content and the polar component of the surface energy, {gamma}{sub sv}{sup p}, the latter resulting from surface melting and resolidification. Moreover, the investigation into the human skin fibroblast cell response revealed that the CO{sub 2} laser treatment of the MgO-PSZ had resulted in a surface favourable for cell adhesion, as the extent of cell attachment and adhesion on the MgO-PSZ surface was enhanced depending on laser parameters. Such an improvement in cell adhesion, which could be greatly beneficial to developing enhanced bonding at the tissue and implant interface, was influenced by the surface properties of the modified MgO-PSZ, particular wettability.

  14. Biostimulative effects of Nd:YAG Q-switch dye on normal human fibroblast cultures: study of a new chemosensitizing agent for the Nd:YAG laser

    International Nuclear Information System (INIS)

    Castro, D.J.; Saxton, R.E.; Fetterman, H.R.; Castro, D.J.; Ward, P.H.

    1987-01-01

    Kodak Q-switch II is a new chemical with an absorption maxima at 1051 nm, designed to be used as an Nd:YAG dye laser. The potential for this dye as a new chemosensitizing agent in the treatment of connective tissue diseases and wound healing with low energy Nd:YAG laser was examined. Two normal fibroblast cell lines were tested for sensitivity to various levels of this dye in vitro. These cells were exposed to Q-switch II dye at concentrations of 0.01, 0.1, 1, 10, 50, and 100 micrograms/ml for 1 and 24 hours. Cell viability was assessed by the trypan blue exclusion test. Cell duplication and DNA synthesis were measured by the incorporation of [ 3 H]-thymidine at 6 and 24 hours postexposure to Q-switch II dye. At concentrations up to 10 micrograms/ml, both cell lines tested showed no changes in cell viability. However, at concentrations equal or higher than 50 micrograms/ml, more than 40% of the fibroblasts incorporated trypan blue after 24 hours of exposure to this dye, indicating significant cell destruction. The results indicate that Q-switch II dye is nontoxic to normal human fibroblast cultures and showed significant biostimulative effects on cell duplication at concentrations equal to or lower than 10 micrograms/ml. Further studies will be required to determine the usefulness of Q-switch II dye as a new photochemosensitizing agent for potential biostimulation of wound healing and/or treatment of connective tissue diseases with the Nd:YAG laser (near infrared, 1060 nm) at nonthermal levels of energies

  15. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  16. Direct biological effects of fractional ultrapulsed CO2 laser irradiation on keratinocytes and fibroblasts in human organotypic full-thickness 3D skin models.

    Science.gov (United States)

    Schmitt, L; Huth, S; Amann, P M; Marquardt, Y; Heise, R; Fietkau, K; Huth, L; Steiner, T; Hölzle, F; Baron, J M

    2018-05-01

    Molecular effects of various ablative and non-ablative laser treatments on human skin cells-especially primary effects on epidermal keratinocytes and dermal fibroblasts-are not yet fully understood. We present the first study addressing molecular effects of fractional non-sequential ultrapulsed CO 2 laser treatment using a 3D skin model that allows standardized investigations of time-dependent molecular changes ex vivo. While histological examination was performed to assess morphological changes, we utilized gene expression profiling using microarray and qRT-PCR analyses to identify molecular effects of laser treatment. Irradiated models exhibited dose-dependent morphological changes resulting in an almost complete recovery of the epidermis 5 days after irradiation. On day 5 after laser injury with a laser fluence of 100 mJ/cm 2 , gene array analysis identified an upregulation of genes associated with tissue remodeling and wound healing (e.g., COL12A1 and FGF7), genes that are involved in the immune response (e.g., CXCL12 and CCL8) as well as members of the heat shock protein family (e.g., HSPB3). On the other hand, we detected a downregulation of matrix metalloproteinases (e.g., MMP3), differentiation markers (e.g., LOR and S100A7), and the pro-inflammatory cytokine IL1α.Overall, our findings substantiate the understanding of time-dependent molecular changes after CO 2 laser treatment. The utilized 3D skin model system proved to be a reliable, accurate, and reproducible tool to explore the effects of various laser settings both on skin morphology and gene expression during wound healing.

  17. Analysis of dermal fibroblasts isolated from neonatal and child cleft lip and adult skin: Developmental implications on reconstructive surgery

    Czech Academy of Sciences Publication Activity Database

    Živicová, V.; Lacina, L.; Mateu, R.; Smetana, K.; Kavkova, R.; Krejci, E.D.; Grim, M.; Kvasilová, A.; Borský, J.; Strnad, Hynek; Hradilová, Miluše; Šáchová, Jana; Kolář, Michal; Dvořánková, B.

    2017-01-01

    Roč. 40, č. 5 (2017), s. 1323-1334 ISSN 1107-3756 R&D Projects: GA ČR GA13-20293S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) ED1.1.00/02.0109 Grant - others:GA MŠk(CZ) LM2015042 Institutional support: RVO:68378050 Keywords : dermal fibroblasts * myofibroblast * neonatal healing * trandforming growth factor-beta * cleft Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 2.341, year: 2016

  18. Rac inhibition reverses the phenotype of fibrotic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Shi-wen Xu

    Full Text Available BACKGROUND: Fibrosis, the excessive deposition of scar tissue by fibroblasts, is one of the largest groups of diseases for which there is no therapy. Fibroblasts from lesional areas of scleroderma patients possess elevated abilities to contract matrix and produce alpha-smooth muscle actin (alpha-SMA, type I collagen and CCN2 (connective tissue growth factor, CTGF. The basis for this phenomenon is poorly understood, and is a necessary prerequisite for developing novel, rational anti-fibrotic strategies. METHODS AND FINDINGS: Compared to healthy skin fibroblasts, dermal fibroblasts cultured from lesional areas of scleroderma (SSc patients possess elevated Rac activity. NSC23766, a Rac inhibitor, suppressed the persistent fibrotic phenotype of lesional SSc fibroblasts. NSC23766 caused a decrease in migration on and contraction of matrix, and alpha-SMA, type I collagen and CCN2 mRNA and protein expression. SSc fibroblasts possessed elevated Akt phosphorylation, which was also blocked by NSC23766. Overexpression of rac1 in normal fibroblasts induced matrix contraction and alpha-SMA, type I collagen and CCN2 mRNA and protein expression. Rac1 activity was blocked by PI3kinase/Akt inhibition. Basal fibroblast activity was not affected by NSC23766. CONCLUSION: Rac inhibition may be considered as a novel treatment for the fibrosis observed in SSc.

  19. Confluent holding leads to a transient enhancement in mutagenesis in UV-light-irradiated xeroderma pigmentosum, Gardner's syndrome and normal human diploid fibroblasts

    International Nuclear Information System (INIS)

    Grosovsky, A.J.; Little, J.B.

    1985-01-01

    The influence of confluent holding periods of 0-24 h of UV-light-induced mutagenesis has been investigated in several human cell strains including xeroderma pigmentosum complementation group A (XPA), Gardner's syndrome (GS) and normal human diploid fibroblasts (NHDF). Confluent cultures of NHDF exposed to UV light exhibited a time-dependent increase in survival when subculture was delayed up to 24 h after irradiation. GS and XPA fibroblasts showed no such increase. When allowed confluent holding periods of 1.5-24 h, GS, XPA and NHDF all exhibited a transient enhancement of mutagenesis such that a 5-10-fold increase in mutation frequency was observed in cells subcultured at 6-9 h after irradiation as compared to cells subcultured at 3-6 h. A decline in mutation frequency prior to the mutagenesis peak was observed in GS and normal cells but not in XPA. After 24 h of confluent holding, the mutation frequency in irradiated GS and NHDF had returned to near background levels although XPA mutation frequencies remain similar to those observed in immediately subcultured cells. A model to explain these overall results is discussed. (Auth.)

  20. The bystander cell-killing effect mediated by nitric oxide in normal human fibroblasts varies with irradiation dose but not with radiation quality.

    Science.gov (United States)

    Yokota, Yuichiro; Funayama, Tomoo; Mutou-Yoshihara, Yasuko; Ikeda, Hiroko; Kobayashi, Yasuhiko

    2015-05-01

    To investigate the dependence of the bystander cell-killing effect on radiation dose and quality, and to elucidate related molecular mechanisms. Normal human fibroblast WI-38 cells were irradiated with 0.125 - 2 Gy of γ-rays or carbon ions and were co-cultured with non-irradiated cells. Survival rates of bystander cells were investigated using the colony formation assays, and nitrite concentrations in the medium were measured using the modified Saltzman method. Survival rates of bystander cells decreased with doses of γ-rays and carbon ions of ≤ 0.5 Gy. Treatment of the specific nitric oxide (NO) radical scavenger prevented reductions in survival rates of bystander cells. Moreover, nitrite concentrations increased with doses of less than 0.25 Gy (γ-rays) and 1 Gy (carbon ions). The dose responses of increased nitrite concentrations as well as survival reduction were similar between γ-rays and carbon ions. In addition, negative relationships were observed between survival rates and nitrite concentrations. The bystander cell-killing effect mediated by NO radicals in normal human fibroblasts depends on irradiation doses of up to 0.5 Gy, but not on radiation quality. NO radical production appears to be an important determinant of γ-ray- and carbon-ion-induced bystander effects.

  1. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2018-05-01

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  3. The human PKP2/plakophilin-2 gene is induced by Wnt/β-catenin in normal and colon cancer-associated fibroblasts.

    Science.gov (United States)

    Niell, Núria; Larriba, María Jesús; Ferrer-Mayorga, Gemma; Sánchez-Pérez, Isabel; Cantero, Ramón; Real, Francisco X; Del Peso, Luis; Muñoz, Alberto; González-Sancho, José Manuel

    2018-02-15

    Colorectal cancer results from the malignant transformation of colonic epithelial cells. Stromal fibroblasts are the main component of the tumour microenvironment, and play an important role in the progression of this and other neoplasias. Wnt/β-catenin signalling is essential for colon homeostasis, but aberrant, constitutive activation of this pathway is a hallmark of colorectal cancer. Here we present the first transcriptomic study on the effect of a Wnt factor on human colonic myofibroblasts. Wnt3A regulates the expression of 1,136 genes, of which 662 are upregulated and 474 are downregulated in CCD-18Co cells. A set of genes encoding inhibitors of the Wnt/β-catenin pathway stand out among those induced by Wnt3A, which suggests that there is a feedback inhibitory mechanism. We also show that the PKP2 gene encoding the desmosomal protein Plakophilin-2 is a novel direct transcriptional target of Wnt/β-catenin in normal and colon cancer-associated fibroblasts. PKP2 is induced by β-catenin/TCF through three binding sites in the gene promoter and one additional binding site located in an enhancer 20 kb upstream from the transcription start site. Moreover, Plakophilin-2 antagonizes Wnt/β-catenin transcriptional activity in HEK-293T cells, which suggests that it may act as an intracellular inhibitor of the Wnt/β-catenin pathway. Our results demonstrate that stromal fibroblasts respond to canonical Wnt signalling and that Plakophilin-2 plays a role in the feedback control of this effect suggesting that the response to Wnt factors in the stroma may modulate Wnt activity in the tumour cells. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  4. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  5. Immortalization of normal human embryonic fibroblasts by introduction of either the human papillomavirus type 16 E6 or E7 gene alone.

    Science.gov (United States)

    Yamamoto, Akito; Kumakura, Shin-ichi; Uchida, Minoru; Barrett, J Carl; Tsutsui, Takeki

    2003-09-01

    The ability of the human papillomavirus type 16 (HPV-16) E6 or E7 gene to induce immortalization of normal human embryonic fibroblast WHE-7 cells was examined. WHE-7 cells at 9 population doublings (PD) were infected with retrovirus vectors encoding either HPV-16 E6 or E7 alone or both E6 and E7 (E6/E7). One of 4 isolated clones carrying E6 alone became immortal and is currently at >445 PD. Four of 4 isolated clones carrying E7 alone escaped from crisis and are currently at >330 PD. Three of 5 isolated clones carrying E6/E7 were also immortalized and are currently at >268 PD. The immortal clone carrying E6 only and 2 of the 3 immortal clones carrying E6/E7 expressed a high level of E6 protein, and all the immortal clones carrying E7 alone and the other immortal clone carrying E6/E7 expressed a high level of E7 protein when compared to their mortal or precrisis clones. The immortal clones expressing a high level of E6 or E7 protein were positive for telomerase activity or an alternative mechanism of telomere maintenance, respectively, known as ALT (alternative lengthening of telomeres). All the mortal or precrisis clones were negative for both phenotypes. All the immortal clones exhibited abrogation of G1 arrest after DNA damage by X-ray irradiation. The expression of INK4a protein (p16(INK4a)) was undetectable in the E6-infected mortal and immortal clones, whereas Rb protein (pRb) was hyperphosphorylated only in the immortal clone. The p16(INK4a) protein was overexpressed in all the E7-infected immortal clones and their clones in the pre-crisis period as well as all the E6/E7-infected mortal and immortal clones, but the pRb expression was downregulated in all of these clones. These results demonstrate for the first time to our knowledge that HPV-16 E6 or E7 alone can induce immortalization of normal human embryonic fibroblasts. Inactivation of p16(INK4a)/pRb pathways in combination with activation of a telomere maintenance mechanism is suggested to be necessary for

  6. Abscisic acid ameliorates the systemic sclerosis fibroblast phenotype in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bruzzone, Santina, E-mail: santina.bruzzone@unige.it [Department of Experimental Medicine, Section of Biochemistry, University of Genova, Viale Benedetto XV 1, 16132 Genova (Italy); Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova (Italy); Advanced Biotechnology Center, Largo Rosanna Benzi 10, 16132 Genova (Italy); Battaglia, Florinda [Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova (Italy); Mannino, Elena [Department of Experimental Medicine, Section of Biochemistry, University of Genova, Viale Benedetto XV 1, 16132 Genova (Italy); Parodi, Alessia [Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova (Italy); Fruscione, Floriana [Department of Experimental Medicine, Section of Biochemistry, University of Genova, Viale Benedetto XV 1, 16132 Genova (Italy); Advanced Biotechnology Center, Largo Rosanna Benzi 10, 16132 Genova (Italy); Basile, Giovanna [Department of Experimental Medicine, Section of Biochemistry, University of Genova, Viale Benedetto XV 1, 16132 Genova (Italy); Salis, Annalisa; Sturla, Laura [Department of Experimental Medicine, Section of Biochemistry, University of Genova, Viale Benedetto XV 1, 16132 Genova (Italy); Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova (Italy); Negrini, Simone; Kalli, Francesca; Stringara, Silvia [Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova (Italy); Filaci, Gilberto [Centre of Excellence for Biomedical Research, University of Genova, Viale Benedetto XV 9, 16132 Genova (Italy); Department of Internal Medicine, Viale Benedetto XV 6, 16132 Genova (Italy); and others

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer ABA is an endogenous hormone in humans, regulating different cell responses. Black-Right-Pointing-Pointer ABA reverts some of the functions altered in SSc fibroblasts to a normal phenotype. Black-Right-Pointing-Pointer UV-B irradiation increases ABA content in SSc cultures. Black-Right-Pointing-Pointer SSc fibroblasts could benefit from exposure to ABA and/or to UV-B. -- Abstract: The phytohormone abscisic acid (ABA) has been recently identified as an endogenous hormone in humans, regulating different cell functions, including inflammatory processes, insulin release and glucose uptake. Systemic sclerosis (SSc) is a chronic inflammatory disease resulting in fibrosis of skin and internal organs. In this study, we investigated the effect of exogenous ABA on fibroblasts obtained from healthy subjects and from SSc patients. Migration of control fibroblasts induced by ABA was comparable to that induced by transforming growth factor-{beta} (TGF-{beta}). Conversely, migration toward ABA, but not toward TGF-{beta}, was impaired in SSc fibroblasts. In addition, ABA increased cell proliferation in fibroblasts from SSc patients, but not from healthy subjects. Most importantly, presence of ABA significantly decreased collagen deposition by SSc fibroblasts, at the same time increasing matrix metalloproteinase-1 activity and decreasing the expression level of tissue inhibitor of metalloproteinase (TIMP-1). Thus, exogenously added ABA appeared to revert some of the functions altered in SSc fibroblasts to a normal phenotype. Interestingly, ABA levels in plasma from SSc patients were found to be significantly lower than in healthy subjects. UV-B irradiation induced an almost 3-fold increase in ABA content in SSc cultures. Altogether, these results suggest that the fibrotic skin lesions in SSc patients could benefit from exposure to high(er) ABA levels.

  7. Abscisic acid ameliorates the systemic sclerosis fibroblast phenotype in vitro

    International Nuclear Information System (INIS)

    Bruzzone, Santina; Battaglia, Florinda; Mannino, Elena; Parodi, Alessia; Fruscione, Floriana; Basile, Giovanna; Salis, Annalisa; Sturla, Laura; Negrini, Simone; Kalli, Francesca; Stringara, Silvia; Filaci, Gilberto

    2012-01-01

    Highlights: ► ABA is an endogenous hormone in humans, regulating different cell responses. ► ABA reverts some of the functions altered in SSc fibroblasts to a normal phenotype. ► UV-B irradiation increases ABA content in SSc cultures. ► SSc fibroblasts could benefit from exposure to ABA and/or to UV-B. -- Abstract: The phytohormone abscisic acid (ABA) has been recently identified as an endogenous hormone in humans, regulating different cell functions, including inflammatory processes, insulin release and glucose uptake. Systemic sclerosis (SSc) is a chronic inflammatory disease resulting in fibrosis of skin and internal organs. In this study, we investigated the effect of exogenous ABA on fibroblasts obtained from healthy subjects and from SSc patients. Migration of control fibroblasts induced by ABA was comparable to that induced by transforming growth factor-β (TGF-β). Conversely, migration toward ABA, but not toward TGF-β, was impaired in SSc fibroblasts. In addition, ABA increased cell proliferation in fibroblasts from SSc patients, but not from healthy subjects. Most importantly, presence of ABA significantly decreased collagen deposition by SSc fibroblasts, at the same time increasing matrix metalloproteinase-1 activity and decreasing the expression level of tissue inhibitor of metalloproteinase (TIMP-1). Thus, exogenously added ABA appeared to revert some of the functions altered in SSc fibroblasts to a normal phenotype. Interestingly, ABA levels in plasma from SSc patients were found to be significantly lower than in healthy subjects. UV-B irradiation induced an almost 3-fold increase in ABA content in SSc cultures. Altogether, these results suggest that the fibrotic skin lesions in SSc patients could benefit from exposure to high(er) ABA levels.

  8. Cationic star-shaped polymer as an siRNA carrier for reducing MMP-9 expression in skin fibroblast cells and promoting wound healing in diabetic rats

    Directory of Open Access Journals (Sweden)

    Li N

    2014-07-01

    Full Text Available Na Li,1,* Heng-Cong Luo,1,* Chuan Yang,1 Jun-Jie Deng,2 Meng Ren,1 Xiao-Ying Xie,1 Diao-Zhu Lin,1 Li Yan,1 Li-Ming Zhang2 1Department of Endocrinology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, People’s Republic of China; 2DSAPM Lab and PCFM Lab, Institute of Polymer Science, Department of Polymer and Materials Science, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People’s Republic of China *These authors contributed equally to this work Background: Excessive expression of matrix metalloproteinase-9 (MMP-9 is deleterious to the cutaneous wound-healing process in the context of diabetes. The aim of the present study was to explore whether a cationic star-shaped polymer consisting of ß-cyclodextrin (ß-CD core and poly(amidoamine dendron arms (ß-CD-[D3]7 could be used as the gene carrier of small interfering RNA (siRNA to reduce MMP-9 expression for enhanced diabetic wound healing. Methods: The cytotoxicity of ß-CD-(D37 was investigated by 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay (MMT method in the rat CRL1213 skin fibroblast cell line. The transfection efficiency of ß-CD-(D37/MMP-9-small interfering RNA (siRNA complexes was determined by confocal microscopy and flow cytometry. Quantitative real time (RT polymerase chain reaction was performed to measure the gene expression of MMP-9 after the transfection by ß-CD-(D37/MMP-9-siRNA complexes. The ß-CD-(D37/MMP-9-siRNA complexes were injected on the wounds of streptozocin-induced diabetic rats. Wound closure was measured on days 4 and 7 post-wounding. Results: ß-CD-(D37 exhibited low cytotoxicity in fibroblast cells, and easily formed the complexes with MMP-9-siRNA. The ß-CD-(D37/MMP-9-siRNA complexes were readily taken up by fibroblast cells, resulting in the downregulation of MMP-9 gene expression (P<0.01. Animal experiments revealed that the treatment by ß-CD-(D37/MMP-9-siRNA complexes enhanced wound

  9. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

  10. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  11. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture

    DEFF Research Database (Denmark)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh

    2016-01-01

    (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial...

  12. The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

    Science.gov (United States)

    Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

    2011-04-01

    The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  13. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  14. GSK126 (EZH2 inhibitor) interferes with ultraviolet A radiation-induced photoaging of human skin fibroblast cells

    Science.gov (United States)

    Qin, Haiyan; Zhang, Guang; Zhang, Lianbo

    2018-01-01

    Polycomb group genes (PcG) encode chromatin modification proteins that are involved in the epigenetic regulation of cell differentiation, proliferation and the aging processes. The key subunit of the PcG complex, enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2), has a central role in a variety of mechanisms, such as the formation of chromatin structure, gene expression regulation and DNA damage. In the present study, ultraviolet A (UVA) was used to radiate human dermal fibroblasts in order to construct a photo-aged cell model. Subsequently, the cell viability assay, Hoechst staining, apoptosis detection using flow cytometry, senescence-associated β-galactosidase (SA-β-gal) staining and erythrocyte exclusion experiments were performed. GSK126, a histone methylation enzyme inhibitor of EZH2, was used as an experimental factor. Results suggested that GSK126 downregulated the mRNA expression levels of EZH2 and upregulated the mRNA expression levels of BMI-1. Notably, GSK126 affected the transcription of various photoaging-related genes and thus protected against photoaging induced by UVA radiation. PMID:29545866

  15. Acrolein-Exposed Normal Human Lung Fibroblasts in Vitro: Cellular Senescence, Enhanced Telomere Erosion, and Degradation of Werner’s Syndrome Protein

    Science.gov (United States)

    Jang, Jun-Ho; Bruse, Shannon; Huneidi, Salam; Schrader, Ronald M.; Monick, Martha M.; Lin, Yong; Carter, A. Brent; Klingelhutz, Aloysius J.

    2014-01-01

    Background: Acrolein is a ubiquitous environmental hazard to human health. Acrolein has been reported to activate the DNA damage response and induce apoptosis. However, little is known about the effects of acrolein on cellular senescence. Objectives: We examined whether acrolein induces cellular senescence in cultured normal human lung fibroblasts (NHLF). Methods: We cultured NHLF in the presence or absence of acrolein and determined the effects of acrolein on cell proliferative capacity, senescence-associated β-galactosidase activity, the known senescence-inducing pathways (e.g., p53, p21), and telomere length. Results: We found that acrolein induced cellular senescence by increasing both p53 and p21. The knockdown of p53 mediated by small interfering RNA (siRNA) attenuated acrolein-induced cellular senescence. Acrolein decreased Werner’s syndrome protein (WRN), a member of the RecQ helicase family involved in DNA repair and telomere maintenance. Acrolein-induced down-regulation of WRN protein was rescued by p53 knockdown or proteasome inhibition. Finally, we found that acrolein accelerated p53-mediated telomere shortening. Conclusions: These results suggest that acrolein induces p53-mediated cellular senescence accompanied by enhanced telomere attrition and WRN protein down-regulation. Citation: Jang JH, Bruse S, Huneidi S, Schrader RM, Monick MM, Lin Y, Carter AB, Klingelhutz AJ, Nyunoya T. 2014. Acrolein-exposed normal human lung fibroblasts in vitro: cellular senescence, enhanced telomere erosion, and degradation of Werner’s syndrome protein. Environ Health Perspect 122:955–962; http://dx.doi.org/10.1289/ehp.1306911 PMID:24747221

  16. DNA rearrangements from γ-irradiated normal human fibroblasts preferentially occur in transcribed regions of the genome

    International Nuclear Information System (INIS)

    Forrester, H.B.; Radford, I.R.

    2003-01-01

    Full text: DNA rearrangement events leading to chromosomal aberrations are central to ionizing radiation-induced cell death. Although DNA double-strand breaks are probably the lesion that initiates formation of chromosomal aberrations, little is understood about the molecular mechanisms that generate and modulate DNA rearrangement. Examination of the sequences that flank sites of DNA rearrangement may provide information regarding the processes and enzymes involved in rearrangement events. Accordingly, we developed a method using inverse PCR that allows the detection and sequencing of putative radiation-induced DNA rearrangements in defined regions of the human genome. The method can detect single copies of a rearrangement event that has occurred in a particular region of the genome and, therefore, DNA rearrangement detection does not require survival and continued multiplication of the affected cell. Ionizing radiation-induced DNA rearrangements were detected in several different regions of the genome of human fibroblast cells that were exposed to 30 Gy of γ-irradiation and then incubated for 24 hours at 37 deg C. There was a 3- to 5-fold increase in the number of products amplified from irradiated as compared with control cells in the target regions 5' to the C-MYC, CDKN1A, RB1, and FGFR2 genes. Sequences were examined from 121 DNA rearrangements. Approximately half of the PCR products were derived from possible inter-chromosomal rearrangements and the remainder were from intra-chromosomal events. A high proportion of the sequences that rearranged with target regions were located in genes, suggesting that rearrangements may occur preferentially in transcribed regions. Eighty-four percent of the sequences examined by reverse transcriptase PCR were from transcribed sequences in IMR-90 cells. The distribution of DNA rearrangements within the target regions is non-random and homology occurs between the sequences involved in rearrangements in some cases but is not

  17. Single Cell Chemical Cytometry of Akt Activity in Rheumatoid Arthritis and Normal Fibroblast-like Synoviocytes in Response to Tumor Necrosis Factor α.

    Science.gov (United States)

    Mainz, Emilie R; Serafin, D Stephen; Nguyen, Tuong T; Tarrant, Teresa K; Sims, Christopher E; Allbritton, Nancy L

    2016-08-02

    The etiology of rheumatoid arthritis (RA) is poorly understood, and 30% of patients are unresponsive to established treatments targeting tumor necrosis factor α (TNFα). Akt kinase is implicated in TNFα signaling and may act as a barometer of patient responses to biologic therapies. Fluorescent peptide sensors and chemical cytometry were employed to directly measure Akt activity as well as proteolytic activity in individual fibroblast-like synoviocytes (FLS) from RA and normal subjects. The specificity of the peptide reporter was evaluated and shown to be a valid measure of Akt activity in single cells. The effect of TNFα treatment on Akt activity was highly heterogeneous between normal and RA subjects, which was not observable in bulk analyses. In 2 RA subjects, a bimodal distribution of Akt activity was observed, primarily due to a subpopulation (21.7%: RA Subject 5; 23.8%: RA Subject 6) of cells in which >60% of the reporter was phosphorylated. These subjects also possessed statistically elevated proteolytic cleavage of the reporter relative to normal subjects, suggesting heterogeneity in Akt and protease activity that may play a role in the RA-affected joint. We expect that chemical cytometry studies pairing peptide reporters with capillary electrophoresis will provide valuable data regarding aberrant kinase activity from small samples of clinical interest.

  18. Pinus densiflora extract protects human skin fibroblasts against UVB-induced photoaging by inhibiting the expression of MMPs and increasing type I procollagen expression

    Directory of Open Access Journals (Sweden)

    Hoe-Yune Jung

    2014-01-01

    Full Text Available Exposure to ultraviolet (UV light can cause skin photoaging, which is associated with upregulation of matrix metalloproteinases (MMPs and downregulation of collagen synthesis. It has been reported that MMPs, especially MMP-1, MMP-3 and MMP-9, decrease the elasticity of the dermis by degrading collagen. In this study, we assessed the effects of Pinus densiflora extract (PDE on photoaging and investigated its mechanism of action in human skin fibroblast (Hs68 cells after UVB exposure using real-time polymerase chain reaction, Western blot analysis, and enzymatic activity assays. PDE exhibited an antioxidant activity and inhibited elastase activities in vitro. We also found that PDE inhibited UVB-induced cytotoxicity, MMP-1 production and expression of MMP-1, -3 and -9 mRNA in Hs68 cells. In addition, PDE decreased UVB-induced MMP-2 activity and MMP-2 mRNA expression. Moreover, PDE prevented the decrease of type I procollagen mediated by exposure to UVB irradiation, an effect that is linked to the upregulation and downregulation of Smad3 and Smad7, respectively. Another effect of UV irradiation is to stimulate activator protein 1 (AP-1 activity via overexpression of c-Jun/c-Fos, which, in turn, upregulates MMP-1, -3, and -9. In this study, we found that PDE suppressed UV-induced c-Jun and c-Fos mRNA expression. Taken together, these results demonstrate that PDE regulates UVB-induced expression of MMPs and type I procollagen synthesis by inhibiting AP-1 activity and restoring impaired Smad signaling, suggesting that PDE may be useful as an effective anti-photoaging agent.

  19. Limbal Fibroblasts Maintain Normal Phenotype in 3D RAFT Tissue Equivalents Suggesting Potential for Safe Clinical Use in Treatment of Ocular Surface Failure.

    Science.gov (United States)

    Massie, Isobel; Dale, Sarah B; Daniels, Julie T

    2015-06-01

    Limbal epithelial stem cell deficiency can cause blindness, but transplantation of these cells on a carrier such as human amniotic membrane can restore vision. Unfortunately, clinical graft manufacture using amnion can be inconsistent. Therefore, we have developed an alternative substrate, Real Architecture for 3D Tissue (RAFT), which supports human limbal epithelial cells (hLE) expansion. Epithelial organization is improved when human limbal fibroblasts (hLF) are incorporated into RAFT tissue equivalent (TE). However, hLF have the potential to transdifferentiate into a pro-scarring cell type, which would be incompatible with therapeutic transplantation. The aim of this work was to assess the scarring phenotype of hLF in RAFT TEs in hLE+ and hLE- RAFT TEs and in nonairlifted and airlifted RAFT TEs. Diseased fibroblasts (dFib) isolated from the fibrotic conjunctivae of ocular mucous membrane pemphigoid (Oc-MMP) patients were used as a pro-scarring positive control against which hLF were compared using surrogate scarring parameters: matrix metalloproteinase (MMP) activity, de novo collagen synthesis, α-smooth muscle actin (α-SMA) expression, and transforming growth factor-β (TGF-β) secretion. Normal hLF and dFib maintained different phenotypes in RAFT TE. MMP-2 and -9 activity, de novo collagen synthesis, and α-SMA expression were all increased in dFib cf. normal hLF RAFT TEs, although TGF-β1 secretion did not differ between normal hLF and dFib RAFT TEs. Normal hLF do not progress toward a scarring-like phenotype during culture in RAFT TEs and, therefore, may be safe to include in therapeutic RAFT TE, where they can support hLE, although in vivo work is required to confirm this. dFib RAFT TEs (used in this study as a positive control) may be useful toward the development of an ex vivo disease model of Oc-MMP.

  20. Benzo(a)pyrene metabolism, DNA-binding and UV-induced repair of DNA damage in cultured skin fibroblasts from a patient with unilateral multiple basal cell carcinoma

    International Nuclear Information System (INIS)

    Don, P.S.C.; Mukhtar, H.; Das, M.; Berger, N.A.; Bickers, D.R.

    1989-01-01

    The metabolism of benzo(a)pyrene (BP), and its subsequent binding to DNA, and the repair of UV-induced DNA damage were studied in fibroblasts cultured from the skin of a 61-year-old male who had multiple basal cell carcinoma (BCC) (>100) on his left upper trunk. Results suggest that BP metabolism and repair of DNA are altered in tumor-bearing site (TSB) cells and that patients with this type of metabolic profile may be at higher risk of the development of cutaneous neoplasms. It is also possible that fibroblasts from tumour bearing skin undergo some as yet unexplained alteration in carcinogen metabolism as a consequence of the induction of neoplasia. (author)

  1. A correlation between ultraviolet-induced sister chromatid exchanges and ultraviolet-indced mutagenesis in ''Muntiacus muntjak'' (Indian Muntjac) skin fibroblasts in culture

    International Nuclear Information System (INIS)

    Lugo, M.H.

    1983-01-01

    The purpose of this thesis was to develop the capability of simultaneously assaying SCEs and mutations in Indian muntjac cells to determine (1) the relationship between the ultraviolet radiation (UVR) induction of SCEs and the UVR induction of mutations at the (UVR) HGPRT locus in Indian muntjac cells and (2) the possible role of DNA repair in the UVR induction of these two events. Indian muntjac skin fibroblasts were chosen for this study because of a unique karyotype consisting of a diploid chromosome number of 6 in females and 7 in males. An HGPRT mutation assay in Indian muntjac cells was developed by this author since at the time this study was undertaken no mutational assay system utilizing Indian muntjac cells existed. It is concluded from this study that a linear correlation exists betwen the UVR-induction of SCEs and of mutations to 6TG resistance in Indian muntjac cells. As more time is allowed between the UVR-induced DNA damage and onset of DNA replication, more of the lesions leading to both mutations and SCE formation are repaired. The fact that SCE and mutation frequencies are reduced at different rates may indicate that the lesions responsible for SCEs and for mutations are repaired differently

  2. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao

    2006-01-01

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  3. A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Abbas Rasi

    2014-01-01

    Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

  4. Modulation of clonogenicity, growth, and radiosensitivity of three human epidermoid tumor cell lines by a fibroblastic environment

    International Nuclear Information System (INIS)

    Gery, Bernard; Little, John B.; Coppey, Jacques

    1996-01-01

    Purpose: To develop a model vitro system to examine the influence of fibroblasts on the growth and survival of human tumor cells after exposure to ionizing radiation. Methods and Materials: The cell system consists of three epidermoid carcinoma cell lines derived from head and neck tumors having differing growth potentials and intrinsic radiosensitivities, as well as a low passage skin fibroblast strain from a normal human donor. The tumor cells were seeded for five days prior to exposure to radiation: (a) in the presence of different numbers of fibroblasts, (b) in conditioned medium from stationary fibroblast cultures, and (c) on an extracted fibroblastic matrix. Results: When grown with fibroblasts, all three tumor cell lines showed increased clonogenicity and increased radioresistance. The radioprotective effect was maximal at a density of approximately 10 5 fibroblasts/100 mm Petri dish, and was greatest in the intrinsically radiosensitive tumor cell line. On the other hand, the effects of incubation with conditioned medium or on a fibroblastic matrix varied among the tumor cell lines. Thus, the protective effect afforded by coculture with fibroblasts must involve several cellular factors related to the fibroblast itself. Conclusions: These observations emphasize the importance of cultural conditions on the apparent radiosensitivity of human tumor cell lines, and suggest that the fibroblastic connective tissue enveloping the malignant cells should be considered when the aim is to establish a radiopredictive assay from surgical tumors fragments

  5. Bone Morphogenetic Protein (BMP-4 and BMP-7 regulate differentially Transforming Growth Factor (TGF-β1 in normal human lung fibroblasts (NHLF

    Directory of Open Access Journals (Sweden)

    Lloyd Clare M

    2010-06-01

    Full Text Available Abstract Background Airway remodelling is thought to be under the control of a complex group of molecules belonging to the Transforming Growth Factor (TGF-superfamily. The Bone Morphogenetic Proteins (BMPs belong to this family and have been shown to regulate fibrosis in kidney and liver diseases. However, the role of BMPs in lung remodelling remains unclear. BMPs may regulate tissue remodelling in asthma by controlling TGF-β-induced profibrotic functions in lung fibroblasts. Methods Cell cultures were exposed to TGF-β1 alone or in the presence of BMP-4 or BMP-7; control cultures were exposed to medium only. Cell proliferation was assessed by quantification of the incorporation of [3H]-thymidine. The expression of the mRNA encoding collagen type I and IV, tenascin C and fibronectin in normal human lung fibroblasts (NHLF was determined by real-time quantitative PCR and the main results were confirmed by ELISA. Cell differentiation was determined by the analysis of the expression of α-smooth muscle actin (α-SMA by western blot and immunohistochemistry. The effect on matrix metalloproteinase (MMP activity was assessed by zymography. Results We have demonstrated TGF-β1 induced upregulation of mRNAs encoding the extracellular matrix proteins, tenascin C, fibronectin and collagen type I and IV when compared to unstimulated NHLF, and confirmed these results at the protein level. BMP-4, but not BMP-7, reduced TGF-β1-induced extracellular matrix protein production. TGF-β1 induced an increase in the activity of the pro-form of MMP-2 which was inhibited by BMP-7 but not BMP-4. Both BMP-4 and BMP-7 downregulated TGF-β1-induced MMP-13 release compared to untreated and TGF-β1-treated cells. TGF-β1 also induced a myofibroblast-like transformation which was partially inhibited by BMP-7 but not BMP-4. Conclusions Our study suggests that some regulatory properties of BMP-7 may be tissue or cell type specific and unveil a potential regulatory role for

  6. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  7. Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

    Science.gov (United States)

    Fullerton, A; Serup, J

    1997-02-01

    To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

  8. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  10. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with activated RAS oncogene and SV40 T-antigen

    Energy Technology Data Exchange (ETDEWEB)

    Su, L.-N.; Little, J.B. (Harvard School of Public Health, Boston, MA (United States))

    1992-08-01

    Three normal human diploid cell strains were transfected with an activated Ha-ras oncogene (EJ ras) or SV40 T-antigen. Multiple clones were examined for morphological alterations, growth requirements, ability to grow under anchorage independent conditions, immortality and tumorigenicity in nude mice. Clones expressing SV40 T-antigen alone or in combination with ras protein p21 were significantly radioresistant as compared with their parent cells or clones transfected with the neo gene only. This radioresistant phenotype persisted in post-crisis, immortalized cell lines. These data suggest that expression of the SV40 T-antigen but not activated Ha-ras plays an important role in the radiosensitivity of human diploid cells. The radioresistant phenotype in SV40 T transfected cells was not related to the enhanced level of genetic instability seen in pre-crisis and newly immortalized cells, nor to the process of immortalization itself. (author).

  11. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with activated RAS oncogene and SV40 T-antigen

    International Nuclear Information System (INIS)

    Su, L.-N.; Little, J.B.

    1992-01-01

    Three normal human diploid cell strains were transfected with an activated Ha-ras oncogene (EJ ras) or SV40 T-antigen. Multiple clones were examined for morphological alterations, growth requirements, ability to grow under anchorage independent conditions, immortality and tumorigenicity in nude mice. Clones expressing SV40 T-antigen alone or in combination with ras protein p21 were significantly radioresistant as compared with their parent cells or clones transfected with the neo gene only. This radioresistant phenotype persisted in post-crisis, immortalized cell lines. These data suggest that expression of the SV40 T-antigen but not activated Ha-ras plays an important role in the radiosensitivity of human diploid cells. The radioresistant phenotype in SV40 T transfected cells was not related to the enhanced level of genetic instability seen in pre-crisis and newly immortalized cells, nor to the process of immortalization itself. (author)

  12. Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

    Science.gov (United States)

    Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

    2018-04-06

    The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

  13. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  14. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with activated ras oncogene and SV40 T-antigen.

    Science.gov (United States)

    Su, L N; Little, J B

    1992-08-01

    Three normal human diploid cell strains were transfected with an activated Ha-ras oncogene (EJ ras) or SV40 T-antigen. Multiple clones were examined for morphological alterations, growth requirements, ability to grow under anchorage independent conditions, immortality and tumorigenicity in nude mice. Clones expressing SV40 T-antigen alone or in combination with ras protein p21 were significantly radioresistant as compared with their parent cells or clones transfected with the neo gene only. This radioresistant phenotype persisted in post-crisis, immortalized cell lines. Cells transfected with EJ ras alone showed no morphological alterations nor significant changes in radiosensitivity. Cell clones expressing ras and/or SV40 T-antigen showed a reduced requirement for serum supplements, an increase in aneuploidy and chromosomal aberrations, and enhanced growth in soft agar as an early cellular response to SV40 T-antigen expression. The sequential order of transfection with SV40 T-antigen and ras influenced radio-sensitivity but not the induction of morphological changes. These data suggest that expression of the SV40 T-antigen but not activated Ha-ras plays an important role in the radiosensitivity of human diploid cells. The radioresistant phenotype in SV40 T transfected cells was not related to the enhanced level of genetic instability seen in pre-crisis and newly immortalized cells, nor to the process of immortalization itself.

  15. The hallmarks of fibroblast ageing.

    Science.gov (United States)

    Tigges, Julia; Krutmann, Jean; Fritsche, Ellen; Haendeler, Judith; Schaal, Heiner; Fischer, Jens W; Kalfalah, Faiza; Reinke, Hans; Reifenberger, Guido; Stühler, Kai; Ventura, Natascia; Gundermann, Sabrina; Boukamp, Petra; Boege, Fritz

    2014-06-01

    Ageing is influenced by the intrinsic disposition delineating what is maximally possible and extrinsic factors determining how that frame is individually exploited. Intrinsic and extrinsic ageing processes act on the dermis, a post-mitotic skin compartment mainly consisting of extracellular matrix and fibroblasts. Dermal fibroblasts are long-lived cells constantly undergoing damage accumulation and (mal-)adaptation, thus constituting a powerful indicator system for human ageing. Here, we use the systematic of ubiquitous hallmarks of ageing (Lopez-Otin et al., 2013, Cell 153) to categorise the available knowledge regarding dermal fibroblast ageing. We discriminate processes inducible in culture from phenomena apparent in skin biopsies or primary cells from old donors, coming to the following conclusions: (i) Fibroblasts aged in culture exhibit most of the established, ubiquitous hallmarks of ageing. (ii) Not all of these hallmarks have been detected or investigated in fibroblasts aged in situ (in the skin). (iii) Dermal fibroblasts aged in vitro and in vivo exhibit additional features currently not considered ubiquitous hallmarks of ageing. (iv) The ageing process of dermal fibroblasts in their physiological tissue environment has only been partially elucidated, although these cells have been a preferred model of cell ageing in vitro for decades. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

  17. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  18. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  19. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  20. Human Wharton's jelly mesenchymal stem cells promote skin wound healing through paracrine signaling.

    Science.gov (United States)

    Arno, Anna I; Amini-Nik, Saeid; Blit, Patrick H; Al-Shehab, Mohammed; Belo, Cassandra; Herer, Elaine; Tien, Col Homer; Jeschke, Marc G

    2014-02-24

    The prevalence of nonhealing wounds is predicted to increase due to the growing aging population. Despite the use of novel skin substitutes and wound dressings, poorly vascularized wound niches impair wound repair. Mesenchymal stem cells (MSCs) have been reported to provide paracrine signals to promote wound healing, but the effect of human Wharton's jelly-derived MSCs (WJ-MSCs) has not yet been described in human normal skin. Human WJ-MSCs and normal skin fibroblasts were isolated from donated umbilical cords and normal adult human skin. Fibroblasts were treated with WJ-MSC-conditioned medium (WJ-MSC-CM) or nonconditioned medium. Expression of genes involved in re-epithelialization (transforming growth factor-β2), neovascularization (hypoxia-inducible factor-1α) and fibroproliferation (plasminogen activator inhibitor-1) was upregulated in WJ-MSC-CM-treated fibroblasts (P≤0.05). WJ-MSC-CM enhanced normal skin fibroblast proliferation (P≤0.001) and migration (P≤0.05), and promoted wound healing in an excisional full-thickness skin murine model. Under our experimental conditions, WJ-MSCs enhanced skin wound healing in an in vivo mouse model.

  1. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  2. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  3. Monoclonal antibody to the type I insulin-like growth factor (IGF-I) receptor blocks IGF-I receptor-mediated DNA synthesis: clarification of the mitogenic mechanisms of IGF-I and insulin in human skin fibroblasts

    International Nuclear Information System (INIS)

    Flier, J.S.; Usher, P.; Moses, A.C.

    1986-01-01

    Insulin and insulin-like growth factor type I (IGF-I) stimulate an overlapping spectrum of biological responses in human skin fibroblasts. Although insulin and IGF-I are known to stimulate the incorporation of [ 3 H]thymidine into DNA in these cells, the identify of the receptor(s) that mediates this effect has not been fully clarified. The mouse anti-human IGF-I receptor antibody αIR-3 binds with specificity to IGF-I but not to insulin receptors in human placental membranes; it also specifically inhibits the binding of 125 I-labeled IGF-I but not 125 I-labeled insulin to suspensions of human skin fibroblasts in a dose-dependent manner. αIR-3 competitively inhibits IGF-I-mediated stimulation of [ 3 H]thymidine incorporation into DNA. This inhibition is dependent on the concentration of αIR-3 and in the presence of a fixed antibody concentration can be partially overcome by high concentrations of IGF-I. In contrast, at concentrations of 3 H]thymidine incorporation is not inhibited by αIR-3. However, the incremental effects of higher concentrations (> 1 μg/ml) of insulin on [ 3 H]thymidine incorporation are inhibited by αIR-3. αIR-3 is a highly specific antagonist of IGF-I receptor-mediated mitogenesis in human skin fibroblasts. By using this antibody, it is shown directly that insulin can act through the IGF-I receptor to stimulate DNA synthesis but can also activate this effect through the insulin receptor itself

  4. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  5. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  6. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  7. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  8. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  9. Granulocyte macrophage colony stimulating factor (GM-CSF biological actions on human dermal fibroblasts

    Directory of Open Access Journals (Sweden)

    S Montagnani

    2009-12-01

    Full Text Available Fibroblasts are involved in all pathologies characterized by increased ExtraCellularMatrix synthesis, from wound healing to fibrosis. Granulocyte Macrophage-Colony Stimulating Factor (GM-CSF is a cytokine isolated as an hemopoietic growth factor but recently indicated as a differentiative agent on endothelial cells. In this work we demonstrated the expression of the receptor for GM-CSF (GMCSFR on human normal skin fibroblasts from healthy subjects (NFPC and on a human normal fibroblast cell line (NHDF and we try to investigate the biological effects of this cytokine. Human normal fibroblasts were cultured with different doses of GM-CSF to study the effects of this factor on GMCSFR expression, on cell proliferation and adhesion structures. In addition we studied the production of some Extra-Cellular Matrix (ECM components such as Fibronectin, Tenascin and Collagen I. The growth rate of fibroblasts from healthy donors (NFPC is not augmented by GM-CSF stimulation in spite of increased expression of the GM-CSFR. On the contrary, the proliferation of normal human dermal fibroblasts (NHDF cell line seems more influenced by high concentration of GM-CSF in the culture medium. The adhesion structures and the ECM components appear variously influenced by GM-CSF treatment as compared to fibroblasts cultured in basal condition, but newly only NHDF cells are really induced to increase their synthesis activity. We suggest that the in vitro treatment with GM-CSF can shift human normal fibroblasts towards a more differentiated state, due or accompanied by an increased expression of GM-CSFR and that such “differentiation” is an important event induced by such cytokine.

  10. The use of allodermis prepared from Euro skin bank to prepare autologous tissue engineered skin for clinical use.

    Science.gov (United States)

    Deshpande, P; Ralston, D R; MacNeil, S

    2013-09-01

    Over the past two decades a range of 3D models for human skin have been described. Some include native collagen and intrinsic basement membrane proteins and fibroblasts, others are based on xenogeneic collagen or synthetic supports often without fibroblasts. The aim of this study was to look at the influence of media calcium, basement membrane and fibroblasts on the quality of 3D tissue engineered skin produced using human de-epidermized acellular dermis. In this study we deliberately used Euro skin as the source of the donor dermis to examine to what extent this could provide an effective dermal substrate for producing 3D skin for clinical use. Keratinocytes were cultured in the presence and absence of fibroblasts and both with and without basement membrane on decellularized dermis at calcium concentrations ranging from 250μM to 1.6mM over a period of 14 days. Results showed the formation of a well attached epithelium with many of the features of normal skin in the presence of a basement membrane. This was largely independent of the presence of fibroblasts and not greatly influenced by the concentration of calcium in the media. However there was a clear requirement for physiological levels of calcium in the formation of a stratified epithelium in the absence of a basement membrane. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  11. Role of DNA lesions and DNA repair in mutagenesis by carcinogens in diploid human fibroblasts

    International Nuclear Information System (INIS)

    Maher, V.M.; McCormick, J.J.

    1986-01-01

    The authors investigated the cytotoxicity, mutagenicity, and transforming activity of carcinogens and radiation in diploid human fibroblasts, using cells which differ in their DNA repair capacity. The results indicate that cell killing and induction of mutations are correlated with the number of specific lesions remaining unrepaired in the cells at a particular time posttreatment. DNA excision repair acts to eliminate potentially cytotoxic and mutagenic (and transforming) damage from DNA before these can be converted into permanent cellular effects. Normal human fibroblasts were derived from skin biopsies or circumcision material. Skin fibroblasts from xeroderma pigmentosum (XP) patients provided cells deficient in nucleotide excision repair of pyrimidine dimers or DNA adducts formed by bulky ring structures. Cytotoxicity was determined from loss of ability to form a colony. The genetic marker used was resistance to 6-thioguanine (TG). Transformation was measured by determining the frequency of anchorage-independent cells

  12. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  13. Angiogenic effects of cryosurgery with liquid nitrogen on the normal skin of rats, through morphometric study.

    Science.gov (United States)

    Pimentel, Camila Bianco; Moraes, Aparecida Machado de; Cintra, Maria Letícia

    2014-01-01

    Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

  14. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  15. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  16. Case report 511: Fibroblastic rheumatism

    International Nuclear Information System (INIS)

    Hernandez, R.J.; Martel, W.; Headington, J.T.; Kaufman, R.A.; Cincinnati Univ., OH

    1989-01-01

    We report a ten-year-old child with the newly described entity of fibroblastic rheumatism. This child developed rapid, progressive, symmetrical polyarthritis, similar to the radiographic appearance of juvenile rheumatoid arthritis, except for the rapidity of progression. The polyarthritis was preceded by the development of skin nodules with characteristic histological changes. (orig./GDG)

  17. Wound Healing Activity of Extracts and Formulations of Aloe vera, Henna, Adiantum capillus-veneris, and Myrrh on Mouse Dermal Fibroblast Cells.

    Science.gov (United States)

    Negahdari, Samira; Galehdari, Hamid; Kesmati, Mahnaz; Rezaie, Anahita; Shariati, Gholamreza

    2017-01-01

    Among the most important factors in wound healing pathways are transforming growth factor beta1 and vascular endothelial growth factor. Fibroblasts are the main cell in all phases wound closure. In this study, the extracts of plant materials such as Adiantum capillus-veneris , Commiphora molmol , Aloe vera , and henna and one mixture of them were used to treatment of normal mouse skin fibroblasts. Cytotoxic effects of each extract and their mixture were assessed on mouse skin fibroblasts cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. We performed migration assays to assess migration properties of mouse skin fibroblasts cells in response to the extracts. Changes in the gene expression of the Tgf β1 and Vegf-A genes were monitored by real-time polymerase chain reaction. A. capillus-veneris , C. molmol and henna extract improved the expression of Tgfβ1 gene. All used extracts upregulated the expression of Vegf-A gene and promoted the migration of mouse fibroblast cells in vitro . The present study demonstrated that the mentioned herbal extracts might be effective in wound healing, through the improvement in the migration of fibroblast cells and regulating the gene expression of Tgfβ1 and Vegf-A genes in fibroblast cells treated with extracts.

  18. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  19. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  20. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  1. Scleroderma keratinocytes promote fibroblast activation independent of transforming growth factor beta.

    Science.gov (United States)

    McCoy, Sara S; Reed, Tamra J; Berthier, Celine C; Tsou, Pei-Suen; Liu, Jianhua; Gudjonsson, Johann E; Khanna, Dinesh; Kahlenberg, J Michelle

    2017-11-01

    SSc is a devastating disease that results in fibrosis of the skin and other organs. Fibroblasts are a key driver of the fibrotic process through deposition of extracellular matrix. The mechanisms by which fibroblasts are induced to become pro-fibrotic remain unclear. Thus, we examined the ability of SSc keratinocytes to promote fibroblast activation and the source of this effect. Keratinocytes were isolated from skin biopsies of 9 lcSSc, 10 dcSSc and 13 control patients. Conditioned media was saved from the cultures. Normal fresh primary fibroblasts were exposed to healthy control and SSc keratinocyte conditioned media in the presence or absence of neutralizing antibodies for TGF-β. Gene expression was assessed by microarrays and real-time PCR. Immunocytochemistry was performed for α-smooth muscle actin (α-SMA), collagen type 1 (COL1A1) and CCL5 expression. SSc keratinocyte conditioned media promoted fibroblast activation, characterized by increased α-SMA and COL1A1 mRNA and protein expression. This effect was independent of TGF-β. Microarray analysis identified upregulation of nuclear factor κB (NF-κB) and downregulation of peroxisome proliferator-activated receptor γ (PPAR-γ) pathways in both SSc subtypes. Scleroderma keratinocytes exhibited increased expression of NF-κB-regulated cytokines and chemokines and lesional skin staining confirmed upregulation of CCL5 in basal keratinocytes. Scleroderma keratinocytes promote the activation of fibroblasts in a TGF-β-independent manner and demonstrate an imbalance in NF-κB1 and PPAR-γ expression leading to increased cytokine and CCL5 production. Further study of keratinocyte mediators of fibrosis, including CCL5, may provide novel targets for skin fibrosis therapy. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  2. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  3. The expression of β-galactosidase during long-term cultured goat skin fibroblasts and the effect of donor cell passage on in vitro development of nuclear transfer embryos.

    Science.gov (United States)

    Liu, Haijun; Peng, Hui; Liu, Fang; Ma, Qun; Zhang, Wenchang

    2016-05-01

    The present study aimed to detect the expression of β-galactosidase during long-term cultured goat skin fibroblasts and investigate the effects of donor goat age, sex, and cell passage on senescence and the effects of donor cell passage on in vitro development of nuclear transfer embryos. The results showed that, in the same cell passage, more β-galactosidase-positive cells were detected in cells from older donors than younger donors. Irrespective of the donor age, the number of positive cells was higher in later passages from passages 20 to 50. In the same passage from 20 to 50, the β-galactosidase-positive rate was higher in cells from 5-yr female goat than 5-yr male goat. Using fibroblasts from male goats at various passages as donor cells, reconstructed embryos had similar fusion and cleavage rates, but the blastocyst rate was higher for cells at passages 10 and 20 than passage 30. In conclusion, donor goat age and cell passage had significant effects on the β-galactosidase-positive rate; also, cells from 5-yr female goat had a higher β-galactosidase-positive rate than those from 5-yr male goat, and the donor cell passage affected the developmental potential of nuclear transfer embryos.

  4. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  5. Modulation of radio-induced oxidative damage by the combination of pentoxifylline and γ-tocopherol in skin fibroblasts and microvascular endothelial cells

    International Nuclear Information System (INIS)

    Laurent, Carine; Roy, Laurence; Voisin, Philippe; Pouget, JeanPierre

    2004-01-01

    Clinical or accidental localized ionizing radiation exposure can induce severe skin damage constituting the cutaneous radiological syndrome which is divided in acute and late phases. The combination of pentoxifylline (PTX), antioxidant phytochemical, and γ-tocopherol, antioxidant nutrient shows effectiveness in reducing the late radio-induced skin damage with a long period. This work aims to investigate the molecular and cellular mechanisms involved in the effects of this combination

  6. Variable radiosensitivity in fibroblasts from patients with tuberous sclerosis

    International Nuclear Information System (INIS)

    Hayashi, A.; Yoshida, Y.; Tanaka, H.; Arima, M.; Ohno, K.

    1985-01-01

    It has been reported that some of the cultured cell strains derived from patients with tuberous sclerosis (TS) showed hypersensitivity to gamma-rays or a radiomimetic chemical. Thirteen fibroblast cell strains from 11 patients with TS were examined for their sensitivity to x-rays as determined from their colony-forming ability. All strains derived from normal-appearing skin of patients, either sporadic or familial cases, showed sensitivity within the normal control range. Five cell strains originating from tumorous skin of 3 patients did not show hypersensitivity. It was concluded that the sensitivity to x-rays of cultured cells of TS is essentially normal. However, the mean D0 or D10 values of the strains from tumorous skin tended to be lower compared to those for normal skin of patients. In addition, the hypersensitivity to x-rays was confirmed in the cell strains of TS which had been shown to be hypersensitive to gamma-rays. These results appear to indicate that at least some of the cells of TS are liable to change to exhibit a hypersensitive trait in unknown acquired conditions

  7. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  8. Evaluation of the effect of laser radiation on fibroblast proliferation in repair of skin wounds of rats with iron deficiency anemia

    Science.gov (United States)

    DeCastro, Isabele C. V.; Oliveira-Sampaio, Susana C. P.; Monteiro, Juliana S. de C.; Ferreira, Maria de Fátima L.; Cangussu, Maria T.; N. dos Santos, Jean; Pinheiro, Antonio Luiz B.

    2011-03-01

    The aim of this study was to assess the effect of low- level laser therapy (LLLT) on fibroblast proliferation on wound repair of rats with Iron deficiency anemia since there is no reports on literature about this subject. Iron deficiency anemia was induced on 36 newborn rats then an excisional wound was created on the dorsum of the animals which were divided into four groups: (I) - non-anemic, (II) - Anemic, (III) - non-anemic + LLLT, (IV) Anemic+ LLLT. The animals in each group were sacrificed at 7, 14 and 21 days. Laser irradiation was performed on each group (λ660nm,40Mw,CW) by contact mode with a dose of 2,5J/ cm2 in four points on the area of the wound and total of 10J/cm2 per session. Data were evaluated by analysis of variance (ANOVA) followed by Paired t-test. The results showed LLLT was able to stimulate fibroblastic proliferation in rats with iron deficiency anemia at the 21st day while at control group (III) no statistically significant differences was found.

  9. Shell extracts of the edible mussel and oyster induce an enhancement of the catabolic pathway of human skin fibroblasts, in vitro.

    Science.gov (United States)

    Latire, Thomas; Legendre, Florence; Bouyoucef, Mouloud; Marin, Frédéric; Carreiras, Franck; Rigot-Jolivet, Muriel; Lebel, Jean-Marc; Galéra, Philippe; Serpentini, Antoine

    2017-10-01

    Mollusc shells are composed of more than 95% calcium carbonate and less than 5% organic matrix consisting mostly of proteins, glycoproteins and polysaccharides. In this study, we investigated the effects of matrix macromolecular components extracted from the shells of two edible molluscs of economic interest, i.e., the blue mussel Mytilus edulis and the Pacific oyster Crassostrea gigas. The potential biological activities of these organic molecules were analysed on human dermal fibroblasts in primary culture. Our results demonstrate that shell extracts of the two studied molluscs modulate the metabolic activities of the cells. In addition, the extracts caused a decrease of type I collagen and a concomitant increase of active MMP-1, both at the mRNA and the protein levels. Therefore, our results suggest that shell extracts from M. edulis and C. gigas contain molecules that promote the catabolic pathway of human dermal fibroblasts. This work emphasises the potential use of these shell matrices in the context of anti-fibrotic strategies, particularly against scleroderma. More generally, it stresses the usefulness to valorise bivalve shells that are coproducts of shellfish farming activity.

  10. Inhibition of Mitochondrial Cytochrome c Release and Suppression of Caspases by Gamma-Tocotrienol Prevent Apoptosis and Delay Aging in Stress-Induced Premature Senescence of Skin Fibroblasts

    Directory of Open Access Journals (Sweden)

    Suzana Makpol

    2012-01-01

    Full Text Available In this study, we determined the molecular mechanism of γ-tocotrienol (GTT in preventing cellular aging by focusing on its anti-apoptotic effect in stress-induced premature senescence (SIPS model of human diploid fibroblasts (HDFs. Results obtained showed that SIPS exhibited senescent-phenotypic characteristic, increased expression of senescence-associated β-galactosidase (SA β-gal and promoted G0/G1 cell cycle arrest accompanied by shortening of telomere length with decreased telomerase activity. Both SIPS and senescent HDFs shared similar apoptotic changes such as increased Annexin V-FITC positive cells, increased cytochrome c release and increased activation of caspase-9 and caspase-3 (P<0.05. GTT treatment resulted in a significant reduction of Annexin V-FITC positive cells, inhibited cytochrome c release and decreased activation of caspase-9 and caspase-3 (P<0.05. Gene expression analysis showed that GTT treatment down regulated BAX mRNA, up-regulated BCL2A1 mRNA and decreased the ratio of Bax/Bcl-2 protein expression (P<0.05 in SIPS. These findings suggested that GTT inhibits apoptosis by modulating the upstream apoptosis cascade, causing the inhibition of cytochrome c release from the mitochondria with concomitant suppression of caspase-9 and caspase-3 activation. In conclusion, GTT delays cellular senescence of human diploid fibroblasts through the inhibition of intrinsic mitochondria-mediated pathway which involved the regulation of pro- and anti-apoptotic genes and proteins.

  11. Scleroderma fibroblasts: Some aspects of in vitro assessment of collagen synthesis

    International Nuclear Information System (INIS)

    Krieg, T.; Max-Planck-Institut fuer Biochemie, Muenchen; Luderschmidt, C.; Braun-Falco, O.; Weber, L.; Mueller, P.K.

    1981-01-01

    Fibroblasts were cultured from skin biopsies of patients with systemic sclerosis in different stages of the disease. In vitro synthesis of collagen was checked after a pulse with tritiated proline. The ratio between type I and type III collagen was normal in all patients. Six of seven cultures derived from patients in the active state showed an increased synthesis of collagen relative to other proteins. Addition of serum (normal and diseased) to the culture medium did not stimulate synthesis of collagen in any culture with normal collagen synthesis. (orig.) [de

  12. Scleroderma fibroblasts: some aspects of in vitro assessment of collagen synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Krieg, T.; Luderschmidt, C.; Braun-Falco, O.; Weber, L.; Mueller, P.K.

    1981-01-01

    Fibroblasts were cultured from skin biopsies of patients with systemic sclerosis in different stages of the disease. In vitro synthesis of collagen was checked after a pulse with tritiated proline. The ratio between type I and type III collagen was normal in all patients. Six of seven cultures derived from patients in the active state showed an increased synthesis of collagen relative to other proteins. Addition of serum (normal and diseased) to the culture medium did not stimulate synthesis of collagen in any culture with normal collagen synthesis.

  13. Analysis of plasma membrane Ca(2+)-ATPase expression in control and SV40-transformed human fibroblasts.

    Science.gov (United States)

    Reisner, P D; Brandt, P C; Vanaman, T C

    1997-01-01

    It has been long known that neoplastic transformation is accompanied by a lowered requirement for extracellular Ca2+ for growth. The studies presented here demonstrate that human fibroblastic cell lines produce the two commonly found 'housekeeping' isoforms of the plasma membrane Ca(2+)-ATPase (PMCA), PMCA1b and 4b, and at the expression of both is demonstrably lower in cell lines neoplastically transformed by SV40 than in the corresponding parental cell lines. Western blot analyses of lysates from control (GM00037) and SV40-transformed (GM00637) skin fibroblasts revealed a 138 kDa PMCA whose level was significantly lower in the SV40-transformed cells relative to either total cellular protein or alpha-tubulin. Similar analyses of plasma membrane preparations from control WI-38) and SV40-transformed (WI-38VA13) lung fibroblasts revealed 3-4-fold lower levels of PMCA in the SV40-transformed cells. Competitive ELISAs performed on detergent solubilized plasma membrane preparations indicated at least 3-4-fold lower levels of PMCA in the SV40-transformed cell lines compared to controls. Reverse transcriptase coupled-PCR analyses showed that PMCA1b and PMCA4b were the only isoforms expressed in all four cell lines. The PMCA4b mRNA level detected by Northern analysis also was substantially lower in SV40 transformed skin fibroblasts than in non-transformed fibroblasts. Quantitative RT-PCR analyses showed levels of PMCA1b and 4b mRNAs to be 5 and 10-fold lower, respectively, in GM00637 than in GM00037 when the levels of PCR products were normalized to glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA. These results demonstrate that the expression of these distinct PMCA genes is substantially lower in SV40 transformed human skin and lung fibroblasts and may be coordinately regulated in these cells.

  14. Effect of phosphatidylserine on free radical susceptibility in human diploid fibroblasts.

    Science.gov (United States)

    Latorraca, S; Piersanti, P; Tesco, G; Piacentini, S; Amaducci, L; Sorbi, S

    1993-01-01

    We studied the effect of phosphatidylserine (PdtSER) on oxygen metabolite toxicity in skin fibroblast cell lines from apparently normal subjects. Fibroblast damage was produced by the generation of oxygen metabolites during the enzymatic oxidation of acetaldehyde by xanthine-oxidase (Xo). In order to quantify cell damage, we measured lactate dehydrogenase (LDH) activity in culture medium and cell viability in fibroblast cultures, with and without preincubation for 4 days with PdtSER 13 microM, after Xo incubation. We found a significant increase of LDH activity in culture medium of cells without preincubation with PdtSER. No significant increase of LDH activity was observed in the same cell lines after preincubation with PdtSER.

  15. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...

  16. Transformation and radiosensitivity of human diploid skin fibroblasts transfected with SV40 T-antigen mutants defective in RB and P53 binding domains

    International Nuclear Information System (INIS)

    LingNah Su; Little, J.B.

    1992-01-01

    A series of human diploid fibroblast cell clones were developed by DNA transfection with either wild-type SV40 T-antigen (SV40T) or T-antigen mutants defective in its various functional domains. Cell clones expressing the wild-type SV40 T were significantly radioresistant as compared with clones transfected with the neo gene only (D o 192 ± 13 vs 127 ± 19). This radioresistance persisted in post-crisis, immortalized cell lines. A series of mutants with point or deletion mutations within each functionally active domain of SV40 T were also examined for their ability to alter radiosensitivity and induce morphological transformation. Cell clones transfected with T-antigen mutants defective in nuclear localization or origin binding showed increased radioresistance similar to clones transfected with wild-type T-antigen, and expressed morphological changes characteristic of SV40 T-transfected cells. (author)

  17. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  18. Anti-aging effects of Piper cambodianum P. Fourn. extract on normal human dermal fibroblast cells and a wound-healing model in mice

    OpenAIRE

    Lee H; Hong Y; Kwon SH; Park J; Park J

    2016-01-01

    Hyunji Lee,1 Youngeun Hong,1 So Hee Kwon,2 Jongsun Park,1 Jisoo Park1 1Department of Pharmacology and Medical Science, Metabolic Diseases and Cell Signaling Laboratory, Research Institute for Medical Sciences, College of Medicine, Chungnam National University, Daejeon, 2Department of Pharmacy, College of Pharmacy, Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Incheon, South Korea Background: Aging of skin is associated with environmental factors such as ultraviolet rays, a...

  19. Anti-aging effects of Piper cambodianum P. Fourn. extract on normal human dermal fibroblast cells and a wound-healing model in mice.

    Science.gov (United States)

    Lee, Hyunji; Hong, Youngeun; Kwon, So Hee; Park, Jongsun; Park, Jisoo

    2016-01-01

    Aging of skin is associated with environmental factors such as ultraviolet rays, air pollution, gravity, and genetic factors, all of which can lead to wrinkling of skin. Previous reports suggest that the wound repair is impaired by the aging process and strategies to manipulate the age-related wound healing are necessary in order to stimulate repair. Several traditional plant extracts are well-known for their properties of skin protection and care. Piper cambodianum P. Fourn. (PPF), a member of Piperacecae, is a plant found in Vietnam that might have therapeutic properties. Therefore, the effects of PPF stem and leaf extract on aging process were investigated in vitro and in vivo. PPF extract dissolved in methanol was investigated using Western blotting, real-time quantitative reverse transcription-polymerase chain reaction, flow cytometry, and cell wound-healing assays. We assessed the anti-aging effect of PPF in mouse using the wound-healing assay. The results were analyzed by Student's unpaired t-test; *Pwound-healing effects in mice. This study demonstrated the anti-aging and wound-healing effects of PPF extract. Therefore, PPF extract represents a promising new therapeutic agent for anti-aging and wound-healing treatments.

  20. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Directory of Open Access Journals (Sweden)

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  1. Effects of plant sterols derived from Aloe vera gel on human dermal fibroblasts in vitro and on skin condition in Japanese women

    OpenAIRE

    Tanaka, Miyuki; Misawa,Eriko; Yamauchi,Koji; Abe,Fumiaki; Ishizaki,Chiaki

    2015-01-01

    Miyuki Tanaka,1 Eriko Misawa,1 Koji Yamauchi,1 Fumiaki Abe,1 Chiaki Ishizaki2 1Functional Food Research Department, Food Science and Technology Institute, Morinaga Milk Industry Co, Ltd, Zama, Kanagawa, 2Ebisu Skin Research Center, Inforward, Inc., Tokyo, Japan Background: Aloe is known for its topical use for treating wounds and burns. Many previous studies reported the healing effects of Aloe vera. However, there are few clinical studies on the effect of orally administered A. vera gel on ...

  2. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  3. Fibroblast spheroids as a model to study sustained fibroblast quiescence and their crosstalk with tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Salmenperä, Pertteli, E-mail: pertteli.salmenpera@helsinki.fi [Department of Virology, Medicum, Faculty of Medicine, University of Helsinki, P.O. Box 21, FIN-00014 (Finland); Karhemo, Piia-Riitta [Research Programs Unit, Translational Cancer Biology, and Institute of Biomedicine, University of Helsinki, P.O. Box 63, FIN-00014 (Finland); Räsänen, Kati [Department of Virology, Medicum, Faculty of Medicine, University of Helsinki, P.O. Box 21, FIN-00014 (Finland); Laakkonen, Pirjo [Research Programs Unit, Translational Cancer Biology, and Institute of Biomedicine, University of Helsinki, P.O. Box 63, FIN-00014 (Finland); Vaheri, Antti [Department of Virology, Medicum, Faculty of Medicine, University of Helsinki, P.O. Box 21, FIN-00014 (Finland)

    2016-07-01

    Stromal fibroblasts have an important role in regulating tumor progression. Normal and quiescent fibroblasts have been shown to restrict and control cancer cell growth, while cancer-associated, i. e. activated fibroblasts have been shown to enhance proliferation and metastasis of cancer cells. In this study we describe generation of quiescent fibroblasts in multicellular spheroids and their effects on squamous cell carcinoma (SCC) growth in soft-agarose and xenograft models. Quiescent phenotype of fibroblasts was determined by global down-regulation of expression of genes related to cell cycle and increased expression of p27. Interestingly, microarray analysis showed that fibroblast quiescence was associated with similar secretory phenotype as seen in senescence and they expressed senescence-associated-β-galactosidase. Quiescent fibroblasts spheroids also restricted the growth of RT3 SCC cells both in soft-agarose and xenograft models unlike proliferating fibroblasts. Restricted tumor growth was associated with marginally increased tumor cell senescence and cellular differentiation, showed with senescence-associated-β-galactosidase and cytokeratin 7 staining. Our results show that the fibroblasts spheroids can be used as a model to study cellular quiescence and their effects on cancer cell progression. - Highlights: • Fibroblasts acquire a sustained quiescence when grown as multicellular spheroids. • This quiescence is associated with drastic change in gene expression. • Fibroblasts spheroids secrete various inflammation-linked cytokines and chemokines. • Fibroblasts spheroids reduced growth of RT3 SCC cells in xenograft model.

  4. Bioactive Constituents of Zanthoxylum rhetsa Bark and Its Cytotoxic Potential against B16-F10 Melanoma Cancer and Normal Human Dermal Fibroblast (HDF Cell Lines

    Directory of Open Access Journals (Sweden)

    Ramesh Kumar Santhanam

    2016-05-01

    Full Text Available Zanthoxylum rhetsa is an aromatic tree, known vernacularly as “Indian Prickly Ash”. It has been predominantly used by Indian tribes for the treatment of many infirmities like diabetes, inflammation, rheumatism, toothache and diarrhea. In this study, we identified major volatile constituents present in different solvent fractions of Z. rhetsa bark using GC-MS analysis and isolated two tetrahydrofuran lignans (yangambin and kobusin, a berberine alkaloid (columbamine and a triterpenoid (lupeol from the bioactive chloroform fraction. The solvent fractions and purified compounds were tested for their cytotoxic potential against human dermal fibroblasts (HDF and mouse melanoma (B16-F10 cells, using the MTT assay. All the solvent fractions and purified compounds were found to be non-cytotoxic to HDF cells. However, the chloroform fraction and kobusin exhibited cytotoxic effect against B16-F10 melanoma cells. The presence of bioactive lignans and alkaloids were suggested to be responsible for the cytotoxic property of Z. rhetsa bark against B16-F10 cells.

  5. Effect of silver/copper and copper oxide nanoparticle powder on growth of Gram-negative and Gram-positive bacteria and their toxicity against the normal human dermal fibroblasts

    International Nuclear Information System (INIS)

    Peszke, Jerzy; Nowak, Anna; Szade, Jacek; Szurko, Agnieszka; Zygadło, Dorota; Michałowska, Marlena; Krzyściak, Paweł; Zygoń, Patrycja; Ratuszna, Alicja; Ostafin, Marek M.

    2016-01-01

    Engineered nanomaterials, especially metallic nanoparticles, are the most popular system applied in daily life products. The study of their biological and toxicity properties seems to be indispensable. In this paper, we present results of biological activity of Ag/Cu nanoparticles. These nanoparticles show more promising killing/inhibiting properties on Gram-negative bacteria than for Gram-positive ones. The Gram-negative bacteria show strong effect already at the concentration of 1 ppm after 15 min of incubation. Moreover, in vitro tests of toxicity made on normal human dermal fibroblast cultures showed that after 72 h of incubation with Ag/Cu nanoparticles, they are less toxic then Cu 2 O/CuO nanoparticles.

  6. Effect of silver/copper and copper oxide nanoparticle powder on growth of Gram-negative and Gram-positive bacteria and their toxicity against the normal human dermal fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Peszke, Jerzy; Nowak, Anna, E-mail: ana.maria.nowak@gmail.com; Szade, Jacek; Szurko, Agnieszka; Zygadło, Dorota; Michałowska, Marlena [University of Silesia, A. Chelkowski Institute of Physics (Poland); Krzyściak, Paweł [Jagiellonian University Medical College, Department of Mycology Chair of Microbiology (Poland); Zygoń, Patrycja [Czestochowa University of Technology, Institute of Materials Engineering (Poland); Ratuszna, Alicja [University of Silesia, A. Chelkowski Institute of Physics (Poland); Ostafin, Marek M. [Department of Microbiology University of Agriculture (Poland)

    2016-12-15

    Engineered nanomaterials, especially metallic nanoparticles, are the most popular system applied in daily life products. The study of their biological and toxicity properties seems to be indispensable. In this paper, we present results of biological activity of Ag/Cu nanoparticles. These nanoparticles show more promising killing/inhibiting properties on Gram-negative bacteria than for Gram-positive ones. The Gram-negative bacteria show strong effect already at the concentration of 1 ppm after 15 min of incubation. Moreover, in vitro tests of toxicity made on normal human dermal fibroblast cultures showed that after 72 h of incubation with Ag/Cu nanoparticles, they are less toxic then Cu{sub 2}O/CuO nanoparticles.

  7. Antifibrotic effects of crocetin in scleroderma fibroblasts and in bleomycin-induced sclerotic mice

    Directory of Open Access Journals (Sweden)

    Yinghua Song

    2013-10-01

    Full Text Available OBJECTIVE: To investigate the antifibrotic effects of crocetin in scleroderma fibroblasts and in sclerotic mice. METHODS: Skin fibroblasts that were isolated from three systemic scleroderma (SSc patients and three healthy subjects were treated with crocetin (0.1, 1 or 10 μM. Cell proliferation was measured with an MTT assay. Alpha-smooth muscle actin was detected via an immunohistochemical method. Alpha 1 (I procollagen (COL1A1, alpha 1 (III procollagen (COL3A1, matrix metalloproteinase (MMP-1 and tissue inhibitor of matrix metalloproteinase (TIMP-1 mRNA levels were measured using real-time PCR. SSc mice were established by the subcutaneous injection of bleomycin. Crocetin (50 mg/kg/d was injected intraperitoneally for 14 days. Dermal thickness and lung fibrosis were assessed with Masson's trichrome staining. Plasma ET-1 was detected with an enzyme-linked immunosorbent assay (ELISA. Skin and lung ET-1 and COL1A1 mRNA levels were measured via real-time PCR. RESULTS: Crocetin inhibited the proliferation of SSc and normal fibroblasts, an effect that increased with crocetin concentration and incubation time. Crocetin decreased the expression of α-SMA and the levels of mRNA for COL1A1, COL3A1 and matrix metalloproteinase-1, while crocetin increased TIMP-1 mRNA levels in both SSc and normal fibroblasts. Skin and lung fibrosis was induced, and the levels of ET-1 in the plasma, skin and lungs were elevated in bleomycin-injected mice. Crocetin alleviated the thickening of the dermis and lung fibrosis; decreased COL1A1 mRNA levels in the skin and lung; and simultaneously decreased ET-1 concentrations in the plasma and ET-1 mRNA levels in the skin and lungs of the bleomycin-induced sclerotic mice, especially during the early phase (weeks 1-3. CONCLUSION: Crocetin inhibits cell proliferation, differentiation and collagen production in SSc fibroblasts. Crocetin alleviates skin and lung fibrosis in a bleomycin-induced SSc mouse model, in part due to a

  8. Linkages between the life-history evolution of tropical and temperate birds and the resistance of cultured skin fibroblasts to oxidative and non-oxidative chemical injury.

    Science.gov (United States)

    Jimenez, Ana Gabriela; Harper, James M; Queenborough, Simon A; Williams, Joseph B

    2013-04-15

    A fundamental challenge facing physiological ecologists is to understand how variation in life history at the whole-organism level might be linked to cellular function. Thus, because tropical birds have higher annual survival and lower rates of metabolism, we hypothesized that cells from tropical species would have greater cellular resistance to chemical injury than cells from temperate species. We cultured dermal fibroblasts from 26 tropical and 26 temperate species of birds and examined cellular resistance to cadmium, H(2)O(2), paraquat, thapsigargin, tunicamycium, methane methylsulfonate (MMS) and UV light. Using ANCOVA, we found that the values for the dose that killed 50% of cells (LD(50)) from tropical birds were significantly higher for H(2)O(2) and MMS. When we tested for significance using a generalized least squares approach accounting for phylogenetic relationships among species to model LD(50), we found that cells from tropical birds had greater tolerance for Cd, H(2)O(2), paraquat, tunicamycin and MMS than cells from temperate birds. In contrast, tropical birds showed either lower or no difference in tolerance to thapsigargin and UV light in comparison with temperate birds. These findings are consistent with the idea that natural selection has uniquely fashioned cells of long-lived tropical bird species to be more resistant to forms of oxidative and non-oxidative stress than cells from shorter-lived temperate species.

  9. Electrospun Poly(lactic acid-co-glycolic acid) Scaffolds for Skin Tissue Engineering

    Science.gov (United States)

    Kumbar, Sangamesh G.; Nukavarapu, Syam Prasad; James, Roshan; Nair, Lakshmi S.; Laurencin, Cato T.

    2008-01-01

    Electrospun fiber matrices composed of scaffolds of varying fiber diameters were investigated for potential application of severe skin loss. Few systematic studies have been performed to examine the effect of varying fiber diameter electrospun fiber matrices for skin regeneration. The present study reports the fabrication of poly[lactic acid-co-glycolic acid] (PLAGA) matrices with fiber diameters of 150–225, 200–300, 250–467, 500–900, 600–1200, 2500–3000 and 3250–6000 nm via electrospinning. All fiber matrices found to have a tensile modulus from 39.23 ± 8.15 to 79.21 ± 13.71 MPa which falls in the range for normal human skin. Further, the porous fiber matrices have porosity between 38–60 % and average pore diameters between 10–14µm. We evaluated the efficacy of these biodegradable fiber matrices as skin substitutes by seeding them with human skin fibroblasts (hSF). Human skin fibroblasts acquired a well spread morphology and showed significant progressive growth on fiber matrices in the 350–1100 nm diameter range. Collagen type III gene expression was significantly up-regulated in hSF seeded on matrices with fiber diameters in the range of 350–1100 nm. Based on the need, the proposed fiber skin substitutes can be successfully fabricated and optimized for skin fibroblast attachment and growth. PMID:18639927

  10. Individual variation in p53 and Cip1 expression profiles in normal human fibroblast strains following exposure to high-let radiation

    International Nuclear Information System (INIS)

    Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D.

    1995-01-01

    Exposure to α-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of α-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to α-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G 1 portion of the cell cycle. Arrest in G 1 portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following α-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following α-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant

  11. Individual variation in p53 and Cip1 expression profiles in normal human fibroblast strains following exposure to high-let radiation

    Energy Technology Data Exchange (ETDEWEB)

    Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D. [Univ. of New Mexico, Albuquerque, NM (United States)] [and others

    1995-12-01

    Exposure to {alpha}-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of {alpha}-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to {alpha}-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G{sub 1} portion of the cell cycle. Arrest in G{sub 1} portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following {alpha}-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following {alpha}-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant.

  12. Abnormal ultraviolet mutagenic spectrum in plasmid DNA replicated in cultured fibroblasts from a patient with the skin cancer-prone disease, xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Seetharam, S.; Protic-Sabljic, M.; Seidman, M.M.; Kraemer, K.H.

    1987-01-01

    A shuttle vector plasmid, pZ189, was utilized to assess the types of mutations that cells from a patient with xeroderma pigmentosum, complementation group D, introduce into ultraviolet (UV) damaged, replicating DNA. Patients with xeroderma pigmentosum have clinical and cellular UV hypersensitivity, increased frequency of sun-induced skin cancer, and deficient DNA repair. In comparison to UV-treated pZ189 replicated in DNA repair-proficient cells, there were fewer surviving plasmids, a higher frequency of plasmids with mutations, fewer plasmids with two or more mutations in the marker gene, and a new mutagenic hotspot. The major type of base substitution mutation was the G:C to A:T transition with both cell lines. These results, together with similar findings published earlier with cells from a xeroderma pigmentosum patient in complementation group A, suggest that isolated G:C to A:T somatic mutations may be particularly important in generation of human skin cancer by UV radiation

  13. Progranulin Overproduction Due to Fli-1 Deficiency Contributes to the Resistance of Dermal Fibroblasts to Tumor Necrosis Factor in Systemic Sclerosis.

    Science.gov (United States)

    Ichimura, Yohei; Asano, Yoshihide; Akamata, Kaname; Noda, Shinji; Taniguchi, Takashi; Takahashi, Takehiro; Toyama, Tetsuo; Tada, Yayoi; Sugaya, Makoto; Sato, Shinichi; Kadono, Takafumi

    2015-12-01

    Progranulin is a growth factor that is active in wound repair and is an antagonist of tumor necrosis factor (TNF) receptors, regulating fibroblast activation, angiogenesis, and inflammation. Because long-standing activation of gene programs related to wound healing is a hallmark of systemic sclerosis (SSc), we sought to investigate the role of progranulin in SSc. Progranulin expression levels in human and murine skin samples were determined by immunohistochemical analysis and quantitative reverse transcription-polymerase chain reaction. The role of progranulin in fibroblast activation was examined using a gene-silencing technique. Progranulin levels in serum obtained from 60 patients with SSc and 16 healthy control subjects were determined by enzyme-linked immunosorbent assay. Progranulin expression was increased in SSc dermal fibroblasts compared with normal dermal fibroblasts, both in vivo and in vitro. Transcription factor Fli-1, a deficiency of which is involved in the activation of SSc dermal fibroblasts, served as a potent repressor of the progranulin gene, and Fli-1(+/-) mice and bleomycin-treated wild-type mice exhibited up-regulated expression of progranulin in dermal fibroblasts. SSc dermal fibroblasts were resistant to the antifibrotic effect of TNF, but this resistance was reversed by gene silencing of progranulin. Serum progranulin levels were elevated in patients with early diffuse cutaneous SSc (dcSSc), especially in those with inflammatory skin symptoms, and were positively correlated with the C-reactive protein level. Progranulin overproduction due to Fli-1 deficiency may contribute to the constitutive activation of SSc dermal fibroblasts by antagonizing the antifibrotic effect of TNF. Progranulin may also be involved in the inflammatory process associated with progressive skin sclerosis in early dcSSc. © 2015, American College of Rheumatology.

  14. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  15. The response of normal and ataxia-telangiectasia human fibroblasts to the lethal effects of far, mid and near ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; McAleer, M.A.; Davies, D.J.G.; Moss, S.H.

    1985-01-01

    The responses of two ataxia-telangiectasia (A-T) cell strains to the lethal effects of monochromatic far, mid and near ultraviolet radiations have been determined and compared with the responses of three normal human cell strains. The authors results confirm a previous observation that the A-T cell strain AT4BI is abnormally sensitive to the lethal effects of mid u.v. (313 nm) radiation. After far u.v. (254 nm) radiation the strain AT4BI exhibits a small but statistically significant increase in sensitivity compared to the normal strains. Of most interest, in terms of a mechanistic interpretation of the sensitivity of A-T strains, the survival responses of neither A-T strain tested to near u.v. (365 nm) radiation differed significantly from the mean response of the normal strains, although it is of interest that one normal strain (48BR) was found to be significantly more resistant to near u.v. radiation than any of the other strains tested. The results are discussed in terms of the possible induction of radiogenic lesions in DNA by ultraviolet radiations and the possible mechanisms of radiation sensitivity in ataxia-telangiectasia. (author)

  16. Chemosensitivity of primary human fibroblasts with defective unhooking of DNA interstrand cross-links

    International Nuclear Information System (INIS)

    Clingen, Peter H.; Arlett, Colin F.; Hartley, John A.; Parris, Christopher N.

    2007-01-01

    Xeroderma pigmentosum (XP) is characterised by defects in nucleotide excision repair, ultraviolet (UV) radiation sensitivity and increased skin carcinoma. Compared to other complementation groups, XP-F patients show relatively mild cutaneous symptoms. DNA interstrand cross-linking agents are a highly cytotoxic class of DNA damage induced by common cancer chemotherapeutics such as cisplatin and nitrogen mustards. Although the XPF-ERCC1 structure-specific endonuclease is required for the repair of ICLs cellular sensitivity of primary human XP-F cells has not been established. In clonogenic survival assays, primary fibroblasts from XP-F patients were moderately sensitive to both UVC and HN2 compared to normal cells (2- to 3-fold and 3- to 5-fold, respectively). XP-A fibroblasts were considerably more sensitive to UVC (10- to 12-fold) but not sensitive to HN2. The sensitivity of XP-F fibroblasts to HN2 correlated with the defective incision or 'unhooking' step of ICL repair. Using the comet assay, XP-F cells exhibited only 20% residual unhooking activity over 24 h. Over the same time, normal and XP-A cells unhooked greater than 95% and 62% of ICLs, respectively. After HN2 treatment, ICL-associated DNA double-strand breaks (DSBs) are detected by pulse field gel electrophoresis in dividing cells. Induction and repair of DNA DSBs was normal in XP-F fibroblasts. These findings demonstrate that in primary human fibroblasts, XPF is required for the unhooking of ICLs and not for the induction or repair of ICL-associated DNA DSBs induced by HN2. In terms of cancer chemotherapy, people with mild DNA repair defects affecting ICL repair may be more prevalent in the general population than expected. Since cellular sensitivity of primary human fibroblasts usually reflects clinical sensitivity such patients with cancer would be at risk of increased toxicity

  17. Protective Effects of Chlorella-Derived Peptide Against UVC-Induced Cytotoxicity through Inhibition of Caspase-3 Activity and Reduction of the Expression of Phosphorylated FADD and Cleaved PARP-1 in Skin Fibroblasts

    Directory of Open Access Journals (Sweden)

    Jong Yuh Cherng

    2012-08-01

    Full Text Available UVC irradiation induces oxidative stress and leads to cell death through an apoptotic pathway. This apoptosis is caused by activation of caspase-3 and formation of poly(ADP-ribose polymerase-1 (PARP-1. In this study, the underlying mechanisms of Chlorella derived peptide (CDP activity against UVC-induced cytotoxicity were investigated. Human skin fibroblasts were treated with CDP, vitamin C, or vitamin E after UVC irradiation for a total energy of 15 J/cm2. After the UVC exposure, cell proliferation and caspase-3 activity were measured at 12, 24, 48, and 72 h later. Expression of phosphorylated FADD and cleaved PARP-1 were measured 16 h later. DNA damage (expressed as pyrimidine (6-4 pyrimidone photoproducts DNA concentration and fragmentation assay were performed 24 h after the UVC exposure. Results showed that UVC irradiation induced cytotoxicity in all groups except those treated with CDP. The caspase-3 activity in CDP-treated cells was inhibited from 12 h onward. Expression of phosphorylated FADD and cleaved PARP-1 were also reduced in CDP-treated cells. Moreover, UVC-induced DNA damage and fragmentation were also prevented by the CDP treatment. This study shows that treatment of CDP provides protective effects against UVC-induced cytotoxicity through the inhibition of caspase-3 activity and the reduction of phosphorylated FADD and cleaved PARP-1 expression.

  18. Reduced temperature (22 degrees C) results in enhancement of cell killing and neoplastic transformation in noncycling HeLa x skin fibroblast human hybrid cells irradiated with low-dose-rate gamma radiation

    International Nuclear Information System (INIS)

    Redpath, J.L.; Antoniono, R.J.

    1995-01-01

    The effect of reduced temperature (22 degrees C) or serum deprivation during low-dose-rate (0.66 cGy/min) γ irradiation on cell killing and neoplastic transformation has been examined using the HeLa x skin fibroblast human hybrid cell system. The reduced temperature stops progression of these cells through the cell cycle while serum deprivation slows down cell turnover markedly. The data demonstrate an enhancement in both of the end points when cells are held at 22 degrees C compared to parallel experiments done at 37 degrees C. In operational terms, the decreased survival and increased neoplastic transformation are consistent with our earlier hypothesis of a higher probability of misrepair at reduced temperature. The interpretation that this damage enhancement was associated with the reduced temperature, and not the fact that the cells were noncycling, was supported by the results of experiments performed with cells cultured at 37 degrees C in serum-free medium for 35 h prior to and then during the 12.24 h low-dose-rate radiation exposure. Under these conditions, cell cycle progression, as shown by reduction in growth rate and dual-parameter flow cytometric analysis, was considerable inhibited (cell cycle time increased from 20 h to 40 h), and there was no significant enhancement of cell killing or neoplastic transformation. 23 refs., 2 figs., 1 tab

  19. Forehead Skin Blood Flow in Normal Neonates during Active and Quiet Sleep, Measured with a Diode Laser Doppler Instrument

    NARCIS (Netherlands)

    Suichies, H.E.; Aarnoudse, J.G.; Okken, A.; Jentink, H.W.; de Mul, F.F.M.; Greve, Jan

    1988-01-01

    Changes in forehead skin blood flow during active and quiet sleep were determined in 16 healthy neonates using a recently developed semi-conductor laser Doppler flow meter without light conducting fibres. Measurements were carried out at a postnatal age varying from 5 hours to 7 days. The two sleep

  20. Induction and rejoining of DNA double-strand breaks and interphase chromosome breaks after exposure to x-rays in one normal and two hypersensitive human fibroblast cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Badie, C.; Alsbeih, G.; Malaise, E.P. [Institute Gustave-Roussy, Villejuif (France)] [and others

    1995-10-01

    The aim of this work was to measure simultaneously and in a quantitative manner double-strand breaks (DSBs), interphase chromosome breaks and cell lethality either immediately after irradiation, or at various times thereafter (up to 24 h), in cells of three nontransformed human fibroblast cell lines of widely different intrinsic radiosensitivity. We wished to assess initial damage, repair kinetics and residual damage at the DNA and the chromosome level, and to correlate these parameters with cell killings. We employed HF19 cells, a normal fibroblast cell line, AT2 cells, a radiosensitive cell line from a patient suffering from ataxia telangiectasia (AT), and 180BR cells, a radiosensitive cell line from a patient with no clinical symptoms of AT. AT2 and 180BR cells, in addition to being radiosensitive, also display a reduced ability to repair potentially lethal damage compared to HF19 cells. The yield of DSBs, as measured by pulsed-field gel electrophoresis, is similar in all three cell lines (slopes correspond to 1.6-1.7% Gy{sup -1} of DNA-associated radioactivity released from the gel well into the lane). In contrast, residual DSBs measured 24 h after irradiation are almost zero for HF19 cells (0.1% confidence interval=0-1.4%), but are 12.5% ({plus_minus}2.3%) and 43.8% ({plus_minus}1.2%) of those measured immediately after irradiation in HF19, AT2 and 180BR cells, respectively. Neither the initial yield of DSBs nor that of excess interphase chromosomes breaks can explain the differences in radiosensitivity between the three cell lines; however, there is a correlation between residual DSBs, rate of DSB rejoining at 24 h, residual interphase chromosome breaks on the one hand and cell survival on the other hand. 74 refs., 6 figs., 4 tabs.

  1. Ginseng-berry-mediated gold and silver nanoparticle synthesis and evaluation of their in vitro antioxidant, antimicrobial, and cytotoxicity effects on human dermal fibroblast and murine melanoma skin cell lines

    Directory of Open Access Journals (Sweden)

    Jiménez Pérez ZE

    2017-02-01

    Full Text Available Zuly Elizabeth Jiménez Pérez,1 Ramya Mathiyalagan,1 Josua Markus,1 Yeon-Ju Kim,2 Hyun Mi Kang,3 Ragavendran Abbai,1 Kwang Hoon Seo,2 Dandan Wang,2 Veronika Soshnikova,2 Deok Chun Yang1,21Department of Biotechnology and Ginseng Bank, 2Department of Oriental Medicine Biotechnology, College of Life Sciences, Kyung Hee University, Yongin, Republic of Korea; 3Advanced Cosmeceutical Technology R&D Center, Suwon, Republic of KoreaAbstract: There has been a growing interest in the design of environmentally affable and biocompatible nanoparticles among scientists to find novel and safe biomaterials. Panax ginseng Meyer berries have unique phytochemical profile and exhibit beneficial pharmacological activities such as antihyperglycemic, antiobesity, antiaging, and antioxidant properties. A comprehensive study of the biologically active compounds in ginseng berry extract (GBE and the ability of ginseng berry (GB as novel material for the biosynthesis of gold nanoparticles (GBAuNPs and silver nanoparticles (GBAgNPs was conducted. In addition, the effects of GBAuNPs and GBAgNPs on skin cell lines for further potential biological applications are highlighted. GBAuNPs and GBAgNPs were synthesized using aqueous GBE as a reducing and capping agent. The synthesized nanoparticles were characterized for their size, morphology, and crystallinity. The nanoparticles were evaluated for antioxidant, anti-tyrosinase, antibacterial, and cytotoxicity activities and for morphological changes in human dermal fibroblast and murine melanoma skin cell lines. The phytochemicals contained in GBE effectively reduced and capped gold and silver ions to form GBAuNPs and GBAgNPs. The optimal synthesis conditions (ie, temperature and v/v % of GBE and kinetics were investigated. Polysaccharides and phenolic compounds present in GBE were suggested to be responsible for stabilization and functionalization of nanoparticles. GBAuNPs and GBAgNPs showed increased scavenging activity

  2. Differential inhibition of the rejoining of x-ray-induced DNA strand breaks in normal and transformed human fibroblasts treated with 1,3-bis(2-chloroethyl)-1-nitrosourea in vitro

    International Nuclear Information System (INIS)

    Erickson, L.C.; Bradley, M.O.; Kohn, K.W.

    1978-01-01

    The effects of 1,3-bis(2-chloroethyl)-1-nitrosourea on the rejoining of x-ray-induced DNA strand breaks were examined in normal human fibroblasts (WI-38) and a simian virus 40-transformed derivative (VA-13) with the use of alkaline sucrose sedimentation. 1,3-Bis(2-chloroethyl)-1-nitrosourea was capable of partially inhibiting repair of x-ray-produced DNA strand breaks in both cell types when the drug was added to the culture medium immediately after x-irradiation. However, when 1,3-bis(2-chloroethyl)-1-nitrosourea exposure preceded x-ray by 1 hr, DNA repair was inhibited to a much greater extent than it was when 1,3-bis(2-chloroethyl)-1-nitrosourea followed x-ray. The inhibition of DNA repair by 1,3-bis(2-chloroethyl)-1-nitrosourea appeared to be complete in the transformed VA-13 cells, while only partial inhibition of repair was observed in the normal WI-38 cells

  3. Growth of fibroblasts and endothelial cells on wettability gradient surfaces

    NARCIS (Netherlands)

    Ruardy, TG; Moorlag, HE; Schakenraad, JM; VanderMei, HC; Busscher, HJ

    1997-01-01

    The growth, spreading, and shape of human skin fibroblasts (PK 84) and human umbilical cord endothelial cells on dichlorodimethylsilane (DDS) and dimethyloctadecylchlorosilane (DOGS) gradient surfaces were investigated in the presence of serum proteins. Gradient surfaces were prepared on glass using

  4. [Acetyl-11-keto-beta-boswellic acid and arsenic trioxide regulate the productions and activities of matrix metalloproteinases in human skin fibroblasts and human leukemia cell line THP-1].

    Science.gov (United States)

    Liang, Ya-hui; Li, Ping; Zhao, Jing-xia; Liu, Xin; Huang, Qi-fu

    2010-11-01

    In order to reveal the treatment mechanism of Chinese medicine with the effect of activating blood and resolving putridity, we selected acetyl-11-keto-beta-boswellic acid (AKBA) and arsenic trioxide (ATO), the main monomeric components of frankincense and arsenolite which are two most commonly used Chinese medicine with effect of activating blood and resolving putridity. We combined AKBA and ATO as a compound, and explored its regulatory role in productions and activities of matrix metalloproteinase (MMP)-1, MMP-2 and MMP-9 in human skin fibroblasts (HSFbs) and human acute monocytic leukemia cell line THP-1 in inflammatory state. In order to simulate the inflammatory micro-environment of chronic wounds, we established 3 cell models: HSFb model activated by tumor necrosis factor-alpha (TNF-α), THP-1 cell model activated by phorbol-12-myristate-13-acetate (PMA) and HSFb-THP-1 cell coculture system. AKBA and ATO were cocultured with these cell models. Enzyme-linked immunosorbent assay (ELISA), gelatin zymography assay and reverse transcription-polymerase chain reaction (RT-PCR) were used to test the secretions, activities and mRNA expressions of MMP-1, MMP-2 and MMP-9. In the study of the regulatory mechanism of AKBA and ATO on MMPs, AKBA and ATO were cocultured with the cell models. ELISA was used to test the secretions of TNF-α and interleukin-1beta (IL-β) and Western blot was used to test the phosphorylation levels of extracellular signal-regulated kinases 1 and 2 (ERK1/2) and p38 mitogen-activated proteinkinase (p38MAPK). Compound of AKBA and ATO inhibited MMP-1, MMP-2 and MMP-9 mRNA expressions, secretions and activities respectively in HSFbs and THP-1 cells in inflammatory state (PTHP-1 cells and cell coculture system (PTHP-1 cells (P<0.05, P<0.01). The combined use of AKBA and ATO which in line with the rule of activating blood and resolving putridity inhibits fibroblasts and inflammatory cells in producing MMPs in inflammatory state through inhibiting the

  5. An oral TRPV1 antagonist attenuates laser radiant-heat-evoked potentials and pain ratings from UV(B)-inflamed and normal skin.

    Science.gov (United States)

    Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram

    2013-02-01

    Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  6. Ultrastructure of elastosis in facial rhytidectomy skin

    International Nuclear Information System (INIS)

    Rudolph, R.; Woodward, M.

    1981-01-01

    Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation

  7. Investigation of the predictive validity of laser-EPs in normal, UVB-inflamed and capsaicin-irritated skin with four analgesic compounds in healthy volunteers.

    Science.gov (United States)

    Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim

    2017-07-01

    The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical

  8. Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

    Institute of Scientific and Technical Information of China (English)

    CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

    2005-01-01

    Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

  9. The radiation response of human dermal fibroblasts

    Science.gov (United States)

    Mitchell, Stephen Andrew

    A clinically reliable predictive assay based on normal-tissue radiosensitivity may lead to improved tumour control through individualised dose prescriptions. In-vitro fibroblast radiosensitivity has been shown, in several studies, to correlate with late radiation morbidity. The aim of this study was to investigate some of the cellular mechanisms underlying the normal-tissue response. In this study, seventeen primary fibroblast strains were established by enzymatic disaggregation of skin biopsies obtained from patients. These comprised seven who experienced acute tissue reactions to radiotherapy, four patients with a normal response and six non-cancer volunteers. An AT cell line was included as a positive control for radiosensitivity. In-vitro radiosensitivity was measured using a clonogenic assay at both high (HDR: 1.6 Gymin-1) and low dose rate (LDR: 0.01 Gymin-1). The radiation parameter HDR SF2 was the most sensitive in discriminating the seven sensitive patients from the remaining ten normal patients (range 0.11-0.19 sensitive patients compared with 0.17-0.34 control patients: puse of an internal control or LDR radiation protocol increased this discrimination. Pulsed-field gel electrophoresis (PFGE) was used to measure the level of initial and residual double-strand breaks following irradiation. No correlation was found between HDR SF2 and initial DNA damage. However, a strong correlation was found between clonogenic survival and both residual DNA damage (measured over 10-70 Gy, allowing 4 h repair, correlation coefficient: 0.90, <0.0001) and the ratio of residual/initial DNA damage, with the sensitive cell lines generally showing a higher level of residual DNA damage. Cell-cycle delays were found in all 18 cell strains in response to 2 Gy irradiation, but were not found to discriminate between sensitive and normal patients. Associated studies found no mutations of the ATM gene in the five radiosensitive patients studied. However, a coding sequence alteration

  10. Fibroblasts and myofibroblasts in wound healing

    Directory of Open Access Journals (Sweden)

    Darby IA

    2014-11-01

    Full Text Available Ian A Darby,1 Betty Laverdet,2 Frédéric Bonté3, Alexis Desmoulière2 1School of Medical Sciences, RMIT University, Melbourne, VIC, Australia; 2Department of Physiology and EA 6309, FR 3503, Faculties of Medicine and Pharmacy, University of Limoges, Limoges, France; 3LVMH Recherche, Saint Jean de Braye, France Abstract: (Myofibroblasts are key players for maintaining skin homeostasis and for orchestrating physiological tissue repair. (Myofibroblasts are embedded in a sophisticated extracellular matrix (ECM that they secrete, and a complex and interactive dialogue exists between (myofibroblasts and their microenvironment. In addition to the secretion of the ECM, (myofibroblasts, by secreting matrix metalloproteinases and tissue inhibitors of metalloproteinases, are able to remodel this ECM. (Myofibroblasts and their microenvironment form an evolving network during tissue repair, with reciprocal actions leading to cell differentiation, proliferation, quiescence, or apoptosis, and actions on growth factor bioavailability by binding, sequestration, and activation. In addition, the (myofibroblast phenotype is regulated by mechanical stresses to which they are subjected and thus by mechanical signaling. In pathological situations (excessive scarring or fibrosis, or during aging, this dialogue between the (myofibroblasts and their microenvironment may be altered or disrupted, leading to repair defects or to injuries with damaged and/or cosmetic skin alterations such as wrinkle development. The intimate dialogue between the (myofibroblasts and their microenvironment therefore represents a fascinating domain that must be better understood in order not only to characterize new therapeutic targets and drugs able to prevent or treat pathological developments but also to interfere with skin alterations observed during normal aging or premature aging induced by a deleterious environment. Keywords: myofibroblast, fibroblast, α-smooth muscle actin

  11. The effect of postirradiation holding at 22 degrees C on the repair of sublethal, potentially lethal and potentially neoplastic transforming damage in gamma-irradiated HeLa x skin fibroblast human hybrid cells

    International Nuclear Information System (INIS)

    Redpath, J.L.; Antoniono, R.J.; Mendonca, M.S.; Sun, C.

    1994-01-01

    The effect of postirradiation holding at 22 degrees C on cell growth, progression of cells through the cell cycle, and the repair of sublethal, potentially lethal and potentially neoplastic transforming damage in γ-irradiated HeLa x skin fibroblast human hybrid cells has been examined. Cell growth and cell cycle progression were essentially stopped at this reduced temperature. Cell survival was dramatically reduced by holding confluent cultures for 6 h at 22 degrees C, as opposed to 37 degrees C, after 7.5 Gy γ radiation delivered at a rate of 2 Gy/min. Return of the cells to 37 degrees C for 6 h after holding at 22 degrees C did not result in increased survival. A similar effect was obtained when the cells were held at 22 degrees C between split-dose irradiation of log-phase cultures where no increase in survival was observed over a split-dose interval of 4 h. In this case a partial increase in survival was observed upon returning the cells to 37 degrees C for 3 h after holding at 22 degrees C for the first 3 h of the split-dose interval. Neoplastic transformation frequency was not enhanced by holding confluent cultures for 6 h at 22 degrees C after 7.5 Gy γ radiation. This is consistent with previous observations that misrepair of potentially neoplastic transforming damage already occurs at 37 degrees C. The overall results are interpreted in terms of the reduced temperature favoring misrepair, rather than inhibition of repair, of sublethal, potentially lethal and potentially transforming radiation damage. 24 refs., 5 figs., 3 tabs

  12. Ultrasonic Stimulation of Mouse Skin Reverses the Healing Delays in Diabetes and Aging by Activation of Rac1.

    Science.gov (United States)

    Roper, James A; Williamson, Rosalind C; Bally, Blandine; Cowell, Christopher A M; Brooks, Rebecca; Stephens, Phil; Harrison, Andrew J; Bass, Mark D

    2015-11-01

    Chronic skin-healing defects are one of the leading challenges to lifelong well-being, affecting 2-5% of populations. Chronic wound formation is linked to age and diabetes and frequently leads to major limb amputation. Here we identify a strategy to reverse fibroblast senescence and improve healing rates. In healthy skin, fibronectin activates Rac1 in fibroblasts, causing migration into the wound bed, and driving wound contraction. We discover that mechanical stimulation of the skin with ultrasound can overturn healing defects by activating a calcium/CamKinaseII/Tiam1/Rac1 pathway that substitutes for fibronectin-dependent signaling and promotes fibroblast migration. Treatment of diabetic and aged mice recruits fibroblasts to the wound bed and reduces healing times by 30%, restoring healing rates to those observed in young, healthy animals. Ultrasound treatment is equally effective in rescuing the healing defects of animals lacking fibronectin receptors, and can be blocked by pharmacological inhibition of the CamKinaseII pathway. Finally, we discover that the migration defects of fibroblasts from human venous leg ulcer patients can be reversed by ultrasound, demonstrating that the approach is applicable to human chronic samples. By demonstrating that this alternative Rac1 pathway can substitute for that normally operating in the skin, we identify future opportunities for management of chronic wounds.

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. Hydrogen water intake via tube-feeding for patients with pressure ulcer and its reconstructive effects on normal human skin cells in vitro

    Science.gov (United States)

    2013-01-01

    Background Pressure ulcer (PU) is common in immobile elderly patients, and there are some research works to investigate a preventive and curative method, but not to find sufficient effectiveness. The aim of this study is to clarify the clinical effectiveness on wound healing in patients with PU by hydrogen-dissolved water (HW) intake via tube-feeding (TF). Furthermore, normal human dermal fibroblasts OUMS-36 and normal human epidermis-derived cell line HaCaT keratinocytes were examined in vitro to explore the mechanisms relating to whether hydrogen plays a role in wound-healing at the cellular level. Methods Twenty-two severely hospitalized elderly Japanese patients with PU were recruited in the present study, and their ages ranged from 71.0 to 101.0 (86.7 ± 8.2) years old, 12 male and 10 female patients, all suffering from eating disorder and bedridden syndrome as the secondary results of various underlying diseases. All patients received routine care treatments for PU in combination with HW intake via TF for 600 mL per day, in place of partial moisture replenishment. On the other hand, HW was prepared with a hydrogen-bubbling apparatus which produces HW with 0.8-1.3 ppm of dissolved hydrogen concentration (DH) and −602 mV to −583 mV of oxidation-reduction potential (ORP), in contrast to reversed osmotic ultra-pure water (RW), as the reference, with DH of < 0.018 ppm and ORP of +184 mV for use in the in vitro experimental research. In in vitro experiments, OUMS-36 fibroblasts and HaCaT keratinocytes were respectively cultured in medium prepared with HW and/or RW. Immunostain was used for detecting type-I collagen reconstruction in OUMS-36 cells. And intracellular reactive oxygen species (ROS) were quantified by NBT assay, and cell viability of HaCaT cells was examined by WST-1 assay, respectively. Results Twenty-two patients were retrospectively divided into an effective group (EG, n = 12) and a less effective group (LG, n = 10) according to

  15. Hedgehog signaling contributes to basic fibroblast growth factor-regulated fibroblast migration

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Zhong Xin [School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Sun, Cong Cong [School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Wenzhou People' s Hospital, Wenzhou, Zhejiang (China); Ting Zhu, Yu; Wang, Ying; Wang, Tao; Chi, Li Sha; Cai, Wan Hui [School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Zheng, Jia Yong [Wenzhou People' s Hospital, Wenzhou, Zhejiang (China); Zhou, Xuan [Ningbo First Hospital, Ningbo, Zhejiang (China); Cong, Wei Tao [School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Li, Xiao Kun, E-mail: proflxk@163.com [School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China); Jin, Li Tai, E-mail: jin_litai@126.com [School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang (China)

    2017-06-15

    Fibroblast migration is a central process in skin wound healing, which requires the coordination of several types of growth factors. bFGF, a well-known fibroblast growth factor (FGF), is able to accelerate fibroblast migration; however, the underlying mechanism of bFGF regulation fibroblast migration remains unclear. Through the RNA-seq analysis, we had identified that the hedgehog (Hh) canonical pathway genes including Smoothened (Smo) and Gli1, were regulated by bFGF. Further analysis revealed that activation of the Hh pathway via up-regulation of Smo promoted fibroblast migration, invasion, and skin wound healing, but which significantly reduced by GANT61, a selective antagonist of Gli1/Gli2. Western blot analyses and siRNA transfection assays demonstrated that Smo acted upstream of phosphoinositide 3-kinase (PI3K)-c-Jun N-terminal kinase (JNK)-β-catenin to promote cell migration. Moreover, RNA-seq and qRT-PCR analyses revealed that Hh pathway genes including Smo and Gli1 were under control of β-catenin, suggesting that β-catenin turn feedback activates Hh signaling. Taken together, our analyses identified a new bFGF-regulating mechanism by which Hh signaling regulates human fibroblast migration, and the data presented here opens a new avenue for the wound healing therapy. - Highlights: • bFGF regulates Hedgehog (Hh) signaling in fibroblasts. • The Smo and Gli two master regulators of Hh signaling positively regulate fibroblast migration. • Smo facilitates β-catenin nuclear translocation via activation PI3K/JNK/GSK3β. • β-catenin positively regulates fibroblast cell migration and the expression of Hh signaling genes including Smo and Gli.

  16. Hedgehog signaling contributes to basic fibroblast growth factor-regulated fibroblast migration

    International Nuclear Information System (INIS)

    Zhu, Zhong Xin; Sun, Cong Cong; Ting Zhu, Yu; Wang, Ying; Wang, Tao; Chi, Li Sha; Cai, Wan Hui; Zheng, Jia Yong; Zhou, Xuan; Cong, Wei Tao; Li, Xiao Kun; Jin, Li Tai

    2017-01-01

    Fibroblast migration is a central process in skin wound healing, which requires the coordination of several types of growth factors. bFGF, a well-known fibroblast growth factor (FGF), is able to accelerate fibroblast migration; however, the underlying mechanism of bFGF regulation fibroblast migration remains unclear. Through the RNA-seq analysis, we had identified that the hedgehog (Hh) canonical pathway genes including Smoothened (Smo) and Gli1, were regulated by bFGF. Further analysis revealed that activation of the Hh pathway via up-regulation of Smo promoted fibroblast migration, invasion, and skin wound healing, but which significantly reduced by GANT61, a selective antagonist of Gli1/Gli2. Western blot analyses and siRNA transfection assays demonstrated that Smo acted upstream of phosphoinositide 3-kinase (PI3K)-c-Jun N-terminal kinase (JNK)-β-catenin to promote cell migration. Moreover, RNA-seq and qRT-PCR analyses revealed that Hh pathway genes including Smo and Gli1 were under control of β-catenin, suggesting that β-catenin turn feedback activates Hh signaling. Taken together, our analyses identified a new bFGF-regulating mechanism by which Hh signaling regulates human fibroblast migration, and the data presented here opens a new avenue for the wound healing therapy. - Highlights: • bFGF regulates Hedgehog (Hh) signaling in fibroblasts. • The Smo and Gli two master regulators of Hh signaling positively regulate fibroblast migration. • Smo facilitates β-catenin nuclear translocation via activation PI3K/JNK/GSK3β. • β-catenin positively regulates fibroblast cell migration and the expression of Hh signaling genes including Smo and Gli.

  17. Chromosome aberration induction in human diploid fibroblast and epithelial cells

    International Nuclear Information System (INIS)

    Scott, D.

    1986-01-01

    The relative sensitivity of cultured human fibroblasts and epithelial cells to radiation-induced chromosomal aberrations was investigated. Lung fibroblast and kidney epithelial cells from the same fetus were compared, as were skin fibroblasts and epithelial keratinocytes from the same foreskin sample. After exposure of proliferating fetal cells to 1.5 Gy X-rays there was a very similar aberration yield in the fibroblasts and epithelial cells. Observations of either little or no difference in chromosomal sensitivity between human fibroblasts and epithelial cells give added confidence that quantitative cytogenetic data obtained from cultured fibroblasts are relevant to the question of sensitivity of epithelial cells which are the predominant cell type in human cancers. (author)

  18. Skin manifestations of growth hormone-induced diseases.

    Science.gov (United States)

    Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

    2016-09-01

    The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

  19. S100A4 amplifies TGF-β-induced fibroblast activation in systemic sclerosis

    DEFF Research Database (Denmark)

    Tomcik, Michal; Palumbo-Zerr, Katrin; Zerr, Pawel

    2015-01-01

    (SSc). METHODS: The expression of S100A4 was analysed in human samples, murine models of SSc and in cultured fibroblasts by real-time PCR, immunohistochemistry and western blot. The functional role of S100A4 was evaluated using siRNA, overexpression, recombinant protein and S100A4 knockout (S100A4...... or stimulation with recombinant S100A4 induced an activated phenotype in resting normal fibroblasts. In contrast, knockdown of S100A4 reduced the pro-fibrotic effects of TGF-β and decreased the release of collagen. S100A4(-/-) mice were protected from bleomycin-induced skin fibrosis with reduced dermal...

  20. Age-associated intracellular superoxide dismutase deficiency potentiates dermal fibroblast dysfunction during wound healing.

    Science.gov (United States)

    Fujiwara, Toshihiro; Dohi, Teruyuki; Maan, Zeshaan N; Rustad, Kristine C; Kwon, Sun Hyung; Padmanabhan, Jagannath; Whittam, Alexander J; Suga, Hirotaka; Duscher, Dominik; Rodrigues, Melanie; Gurtner, Geoffrey C

    2017-07-04

    Reactive oxygen species (ROS) impair wound healing through destructive oxidation of intracellular proteins, lipids and nucleic acids. Intracellular superoxide dismutase (SOD1) regulates ROS levels and plays a critical role in tissue homoeostasis. Recent evidence suggests that age-associated wound healing impairments may partially result from decreased SOD1 expression. We investigated the mechanistic basis by which increased oxidative stress links to age-associated impaired wound healing. Fibroblasts were isolated from unwounded skin of young and aged mice, and myofibroblast differentiation was assessed by measuring α-smooth muscle actin and collagen gel contraction. Excisional wounds were created on young and aged mice to study the healing rate, ROS levels and SOD1 expression. A mechanistic link between oxidative stress and fibroblast function was explored by assessing the TGF-β1 signalling pathway components in young and aged mice. Age-related wounds displayed reduced myofibroblast differentiation and delayed wound healing, consistent with a decrease in the in vitro capacity for fibroblast-myofibroblast transition following oxidative stress. Young fibroblasts with normal SOD1 expression exhibited increased phosphorylation of ERK in response to elevated ROS. In contrast, aged fibroblasts with reduced SOD1 expression displayed a reduced capacity to modulate intracellular ROS. Collectively, age-associated wound healing impairments are associated with fibroblast dysfunction that is likely the result of decreased SOD1 expression and subsequent dysregulation of intracellular ROS. Strategies targeting these mechanisms may suggest a new therapeutic approach in the treatment of chronic non-healing wounds in the aged population. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli