WorldWideScience

Sample records for normal main sequence

  1. Main sequence mass loss

    International Nuclear Information System (INIS)

    Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.

    1987-01-01

    It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs

  2. A main sequence for quasars

    Science.gov (United States)

    Marziani, Paola; Dultzin, Deborah; Sulentic, Jack W.; Del Olmo, Ascensión; Negrete, C. A.; Martínez-Aldama, Mary L.; D'Onofrio, Mauro; Bon, Edi; Bon, Natasa; Stirpe, Giovanna M.

    2018-03-01

    The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  3. A Main Sequence for Quasars

    Directory of Open Access Journals (Sweden)

    Paola Marziani

    2018-03-01

    Full Text Available The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  4. Nitrogen chronology of massive main sequence stars

    NARCIS (Netherlands)

    Köhler, K.; Borzyszkowski, M.; Brott, I.; Langer, N.; de Koter, A.

    2012-01-01

    Context. Rotational mixing in massive main sequence stars is predicted to monotonically increase their surface nitrogen abundance with time. Aims. We use this effect to design a method for constraining the age and the inclination angle of massive main sequence stars, given their observed luminosity,

  5. The double main sequence of Omega Centauri

    Science.gov (United States)

    Bedin, L. R.; Piotto, G.; Anderson, J.; King, I. R.; Cassisi, S.; Momany, Y.

    Recent, high precision photometry of Omega Centauri, the biggest Galactic globular cluster, has been obtained with Hubble Space Telescope (HST). The color magnitude diagram reveals an unexpected bifurcation of colors in the main sequence (MS). The newly found double MS, the multiple turnoffs and subgiant branches, and other sequences discovered in the past along the red giant branch of this cluster add up to a fascinating but frustrating puzzle. Among the possible explanations for the blue main sequence an anomalous overabundance of helium is suggested. The hypothesis will be tested with a set of FLAMES@VLT data we have recently obtained (ESO DDT program), and with forthcoming ACS@HST images. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  6. Post-main-sequence planetary system evolution

    Science.gov (United States)

    Veras, Dimitri

    2016-01-01

    The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries. PMID:26998326

  7. Main-sequence photometry in NGC 2808

    International Nuclear Information System (INIS)

    Buonanno, R.; Corsi, C.E.; Fusi Pecci, F.; Harris, W.E.

    1984-01-01

    We have obtained a color-magnitude diagram for the southern globular cluster NGC 2808, to V/sub lim/approx. =21 (about 2 mag below the main-sequence turnoff). The internal photographic errors are sigma/sub V/approx. =0.02, sigma/sub B/-Vapprox. =0.03, small enough to permit a precise definition of the turnoff region and an estimate of the ''cosmic scatter'' along the main sequence. Fitting of the CMD to VandenBerg's [Astrophys. J. Suppl. 51, 29 (1983)] isochrones shows that an excellent match to the observations is achieved for model parameters of Yapprox. =0.2, Zapprox. =0.003 ([Fe/H]approx. =-0.8), and an age of (16 +- 2) billion years. All these characteristics are within the expected range from other observational constraints; no new clues from the main-sequence data alone have arisen to help explain the presence of the anomalous blue horizontal-branch stars

  8. Normal form theory and spectral sequences

    OpenAIRE

    Sanders, Jan A.

    2003-01-01

    The concept of unique normal form is formulated in terms of a spectral sequence. As an illustration of this technique some results of Baider and Churchill concerning the normal form of the anharmonic oscillator are reproduced. The aim of this paper is to show that spectral sequences give us a natural framework in which to formulate normal form theory. © 2003 Elsevier Science (USA). All rights reserved.

  9. Circumstellar Material on and off the Main Sequence

    Science.gov (United States)

    Steele, Amy; Debes, John H.; Deming, Drake

    2017-06-01

    There is evidence of circumstellar material around main sequence, giant, and white dwarf stars that originates from the small-body population of planetary systems. These bodies tell us something about the chemistry and evolution of protoplanetary disks and the planetary systems they form. What happens to this material as its host star evolves off the main sequence, and how does that inform our understanding of the typical chemistry of rocky bodies in planetary systems? In this talk, I will discuss the composition(s) of circumstellar material on and off the main sequence to begin to answer the question, “Is Earth normal?” In particular, I look at three types of debris disks to understand the typical chemistry of planetary systems—young debris disks, debris disks around giant stars, and dust around white dwarfs. I will review the current understanding on how to infer dust composition for each class of disk, and present new work on constraining dust composition from infrared excesses around main sequence and giant stars. Finally, dusty and polluted white dwarfs hold a unique key to our understanding of the composition of rocky bodies around other stars. In particular, I will discuss WD1145+017, which has a transiting, disintegrating planetesimal. I will review what we know about this system through high speed photometry and spectroscopy and present new work on understanding the complex interplay of physics that creates white dwarf pollution from the disintegration of rocky bodies.

  10. The evolution of coronal activity in main sequence cool stars

    International Nuclear Information System (INIS)

    Stern, R.A.

    1984-01-01

    Stars spend most of their lifetime and show the least amount of nuclear evolution on the main sequence. However, the x-ray luminosities of cool star coronas change by orders of magnitude as a function of main sequence age. Such coronal evolution is discussed in relation to our knowledge of the solar corona, solar and stellar flares, stellar rotation and binarity. The relevance of X-ray observations to current speculations on stellar dynamos is also considered

  11. Main sequences defined by Hyades and field stars

    International Nuclear Information System (INIS)

    Upgren, A.R.

    1978-01-01

    The author reviews the main sequences defined by members of the Hyades cluster and by the field stars in the solar neighborhood. For this purpose, the discussion is limited primarily to the stars of the lower portions of the main sequence, especially those of spectral classes K and early M. There are two reasons for emphasis on the faint red dwarf stars. First, the value of a parallax depends on its size or, more accurately, on the error in parallax divided by the parallax itself. Large parallaxes of high precision occur in large numbers only for stars inhabiting the lower main sequence. Furthermore, brighter stars of earlier spectral classes are more likely to be influenced by evolutionary effects which may differ between the Hyades and field stars, and which are difficult to calibrate. (Auth.)

  12. Stochastically excited oscillations on the upper main sequence

    DEFF Research Database (Denmark)

    Antoci, Victoria

    2013-01-01

    Convective envelopes in stars on the main sequence are usually connected only with stars of spectral types F5 or later. However, observations as well as theory indicate that the convective outer layers in earlier stars, despite being shallow, are still effective and turbulent enough to stochastic......Convective envelopes in stars on the main sequence are usually connected only with stars of spectral types F5 or later. However, observations as well as theory indicate that the convective outer layers in earlier stars, despite being shallow, are still effective and turbulent enough...... Pulsating B and Be stars, all in the context of solar-like oscillations....

  13. Domino effect in chemical accidents: main features and accident sequences.

    Science.gov (United States)

    Darbra, R M; Palacios, Adriana; Casal, Joaquim

    2010-11-15

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes are external events (31%) and mechanical failure (29%). Storage areas (35%) and process plants (28%) are by far the most common settings for domino accidents. Eighty-nine per cent of the accidents involved flammable materials, the most frequent of which was LPG. The domino effect sequences were analyzed using relative probability event trees. The most frequent sequences were explosion→fire (27.6%), fire→explosion (27.5%) and fire→fire (17.8%). Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Solar Luminosity on the Main Sequence, Standard Model and Variations

    Science.gov (United States)

    Ayukov, S. V.; Baturin, V. A.; Gorshkov, A. B.; Oreshina, A. V.

    2017-05-01

    Our Sun became Main Sequence star 4.6 Gyr ago according Standard Solar Model. At that time solar luminosity was 30% lower than current value. This conclusion is based on assumption that Sun is fueled by thermonuclear reactions. If Earth's albedo and emissivity in infrared are unchanged during Earth history, 2.3 Gyr ago oceans had to be frozen. This contradicts to geological data: there was liquid water 3.6-3.8 Gyr ago on Earth. This problem is known as Faint Young Sun Paradox. We analyze luminosity change in standard solar evolution theory. Increase of mean molecular weight in the central part of the Sun due to conversion of hydrogen to helium leads to gradual increase of luminosity with time on the Main Sequence. We also consider several exotic models: fully mixed Sun; drastic change of pp reaction rate; Sun consisting of hydrogen and helium only. Solar neutrino observations however exclude most non-standard solar models.

  15. Solar-Type Activity in Main-Sequence Stars

    CERN Document Server

    Gershberg, Roald E

    2005-01-01

    Solar-type activity over the whole range of the electromagnetic spectrum is a phenomenon inherent in the majority of low- and moderate-mass main sequence stars. In this monograph observational results are summarized in a systematic and comprehensive fashion. The analysis of the various manifestations of such stellar activity leads to the identification of these phenomena with macroscopic non-linear processes in a magnetized plasma. Comparative study of flare stars and the Sun has become increasingly fruitful and is presently an active field of research involving stellar and solar physicists, experts in plasma physics and high-energy astrophysicists. This book will provide them with both an introduction and overview of observational results from the first optical photometry and spectroscopy, from the satellite telescopes International Ultraviolet Explorer to Hubble Space Telescope, XMM-Newton and Chandra, as well as with the present physical interpretation of solar-type activity in main sequence stars. Gershbe...

  16. Additional measurements of pre-main-sequence stellar rotation

    International Nuclear Information System (INIS)

    Hartmann, L.; Stauffer, J.R.

    1989-01-01

    New rotational-velocity measurements for pre-main-sequence stars in the Taurus-Auriga molecular cloud are reported. Rotational velocities or upper limits of 10 km/s are now available for 90 percent of the T Tauri stars with V less than 14.7 in the catalog of Cohen and Kuhi. Measurements of 'continuum emission' stars, thought to be accreting high-angular-momentum material from a circumstellar disk, show that these objects are not especially rapid rotators. The results confirm earlier findings that angular-momentum loss proceeds very efficiently in the earliest stages of star formation, and suggest that stars older than about one million yr contract to the main sequence at nearly constant angular momentum. The slow rotation of T Tauri stars probably requires substantial angular-momentum loss via a magnetically coupled wind. 35 references

  17. On the Roche constants for main-sequence binaries

    International Nuclear Information System (INIS)

    Giannuzzi, M.A.

    1979-01-01

    The ratios C 1 /C 2 of the constants defining the equipotential surfaces which describe the external forms of the components of a close binary system have been calculated on the basis of evolutionary models. Theoretical systems have been considered allowing for a wide range of input parameters (masses and separation) and taking into account the evolutionary effects on the radii of the stars during their Main-Sequence lifetime. The systems have not undergone any transfer of matter and are representative of detached binaries with Main-sequence components. The ratios of the constants are confined in limited intervals and, for the highest values of the mass-ratios, they are clustered around the unit. (Auth.)

  18. Domino effect in chemical accidents: main features and accident sequences

    OpenAIRE

    Casal Fàbrega, Joaquim; Darbra Roman, Rosa Maria

    2010-01-01

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes a...

  19. Three aspects of stellar evolution near the main sequence

    International Nuclear Information System (INIS)

    Morgan, J.C.

    1979-05-01

    Three problems of stellar evolution are considered: the gap in the HR diagram of M67, the evolutionary status of RS CVn binaries and the solar neutrino problem. The physical basis of the Eggleton stellar evolution computer program is described. The program was used to calculate a grid of evolutionary tracks for models with masses between 0.7 and 1.29 solar masses. The more massive stars considered here have expanding convective cores during their main sequence evolution. The isochrone of the old galactic cluster M67 has a gap at the top of its main sequence because of the rapid evolution of stars at hydrogen exhaustion. RS CVn binaries present a complex collection of observational phenomena although they appear to be detached binaries. Their evolutionary status has remained controversial because of their high space density. Here it is shown that a post main sequence interpretation is satisfactory. Models of the Sun with metal poor interiors have been proposed in an attempt to resolve the solar neutrino problem. Here the evolution of two such models is calculated in detail, including a gradual contamination of the surface convection zone to produce the observed metal abundance, giving fully consistent models of the Sun as it is observed. (author)

  20. Lithium depletion and rotation in main-sequence stars

    International Nuclear Information System (INIS)

    Balachandran, S.

    1990-01-01

    Lithium abundances were measured in nearly 200 old disk-population F stars to examine the effects of rotational braking on the depletion of Li. The sample was selected to be slightly evolved off the main sequence so that the stars have completed all the Li depletion they will undergo on the main sequence. A large scatter in Li abundances in the late F stars is found, indicating that the Li depletion is not related to age and spectral type alone. Conventional depletion mechanisms like convective overshoot and microscopic diffusion are unable to explain Li depletion in F stars with thin convective envelopes and are doubly taxed to explain such a scatter. No correlation is found between Li abundance and the present projected rotational velocity and some of the most rapid rotators are undepleted, ruling out meridional circulation as the cause of Li depletion. There is a somewhat larger spread in Li abundances in the spun-down late F stars compared to the early F stars which should remain rotationally unaltered on the main sequence. 85 refs

  1. Infrared photometry of upper main sequence stars in M39

    International Nuclear Information System (INIS)

    Manteiga, M.; Martinez-Roger, C.; Morales, C.; Sabau, L.

    1991-01-01

    Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10 8 years

  2. Infrared photometry of upper main sequence stars in M39

    Energy Technology Data Exchange (ETDEWEB)

    Manteiga, M.; Martinez-Roger, C. (Instituto de Astrofisica de Canarias, Tenerife, (ES)); Morales, C.; Sabau, L. (Instituto de Tecnica Aeroespacial, Madrid, (ES))

    1991-03-01

    Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10{sup 8} years.

  3. Environmental impact analysis for the main accidental sequences of ignitor

    International Nuclear Information System (INIS)

    Carpignano, A.; Francabandiera, S.; Vella, R.; Zucchetti, M.

    1996-01-01

    A safety analysis study has been applied to the Ignitor machine using Probabilistic Safety Assessment. The main initiating events have been identified, and accident sequences have been studied by means of traditional methods such as Failure Mode and Effect Analysis (FMEA), Fault Trees (FT) and Event Trees (ET). The consequences of the radioactive environmental releases have been assessed in terms of Effective Dose Equivalent (EDEs) to the Most Exposed Individuals (MEI) of the chosen site, by means of a population dose code. Results point out the low enviromental impact of the machine. 13 refs., 1 fig., 3 tabs

  4. Photometric monitoring of pre-main sequence stars - 2

    International Nuclear Information System (INIS)

    Evans, A.; Davies, J.K.; Kilkenny, D.; Bode, M.F.

    1989-01-01

    A discussion is presented of the infrared and optical photometric variability of the pre-main sequence stars BF Ori and UX Ori. In the former case, the reddening that occurs during decline, at both optical and infrared wavelengths, is consistent with variable extinction by circumstellar grains having an interstellar-like reddening law. While in the case of UX Ori, the data suggest variability due to starspots. In both cases, a study of the polarimetric variability would be valuable to confirm these conclusions. (author)

  5. DISSECTING THE QUASAR MAIN SEQUENCE: INSIGHT FROM HOST GALAXY PROPERTIES

    International Nuclear Information System (INIS)

    Sun, Jiayi; Shen, Yue

    2015-01-01

    The diverse properties of broad-line quasars appear to follow a well-defined main sequence along which the optical Fe ii strength increases. It has been suggested that this sequence is mainly driven by the Eddington ratio (L/L Edd ) of the black hole (BH) accretion. Shen and Ho demonstrated with quasar clustering analysis that the average BH mass decreases with increasing Fe ii strength when quasar luminosity is fixed, consistent with this suggestion. Here we perform an independent test by measuring the stellar velocity dispersion σ * (hence, the BH mass via the M–σ * relation) from decomposed host spectra in low-redshift Sloan Digital Sky Survey quasars. We found that at fixed quasar luminosity, σ * systematically decreases with increasing Fe ii strength, confirming that the Eddington ratio increases with Fe ii strength. We also found that at fixed luminosity and Fe ii strength, there is little dependence of σ * on the broad Hβ FWHM. These new results reinforce the framework that the Eddington ratio and orientation govern most of the diversity seen in broad-line quasar properties

  6. Pre-main sequence sun: a dynamic approach

    International Nuclear Information System (INIS)

    Newman, M.J.; Winkler, K.H.A.

    1979-01-01

    The classical pre-main sequence evolutionary behavior found by Hayashi and his coworkers for the Sun depends crucially on the choice of initial conditions. The Hayashi picture results from beginning the calculation with an already centrally condensed, highly Jeans unstable object not terribly far removed from the stellar state initially. The present calculation follows the work of Larson in investigating the hydrodynamic collapse and self-gravitational accretion of an initially uniform, just Jeans unstable interstellar gas-dust cloud. The resulting picture for the early history of the Sun is quite different from that found by Hayashi. A rather small (R approx. = 2 R/sub sun/), low-luminosity (L greater than or equal to L/sub sun/) protostellar core develops. A fully convective stellar core, characteristic of Hayashi's work, is not found during the accretion process, and can only develop, if at all, in the subsequent pre-main sequence Kelvin-Helmholtz contraction of the core. 3 figures, 1 table

  7. On precise ZAMSs, the solar color, and pre-main-sequence lithium depletion

    International Nuclear Information System (INIS)

    Vandenberg, D.A.; Poll, H.E.

    1989-01-01

    This paper describes a semiempirical main-sequence-fitting method for the determination of distances to stellar systems, which uses a ZAMS locus carefully normalized to the sun, and whose shape is defined by a quartic over the color range for (B-V)0 values between 0.2 and 1.0 such that the morphology of the Pleiades C-M diagram is accurately reproduced. Using this technique, distances were derived for a number of star clusters. It was found that the observed depletion of lithium among cool main-sequence stars in the Hyades and Pleiades can be matched quite well by the present models. Calculations also show that the depletion of Li at a fixed T(eff) along the main sequence is a sensitive function of Fe/H. 98 refs

  8. Normal anatomy and MR findings of fetal main organs at MR imaging

    International Nuclear Information System (INIS)

    Xia Liming; Zou Mingli; Feng Dingyi; Hu Junwu; Qi Jianpin; Wang Chengyuan

    2005-01-01

    Objective: To investigate normal anatomy and MR findings of fetal main organs. Methods: Forty-seven fetus underwented fast MR imaging, SSFSE sequence was used, the normal anatomy and MR findings of fetal main organs was observed in different gestational age. The organs included: brain, lungs, heart, liver, spleen, gastrointestinal tract, urinary collecting systems, bladder, bones, spine, and subcutaneous fat. Results: Results of MR in 47 fetus showed that the main organs had developed by 20-week-old fetus, about 20 weeks gestation, cerebral cortical surface was smooth, no cortical gyri and sulci, then cortical gyri and sulci developed slowly. The lungs, trachea, bronchus, gastrointestinal tract, renal collecting system and bladder showed high signal intensity; the heart, great vessels, liver, spleen, bones and muscles appeared hypointense; the kidneys appeared isointense, the spine had developed and subcutaneous fat was seen in 20-week-old fetus, the subcutaneous fat increased with fetus maturating. Conclusion: Normal anatomy and MR findings of fetal main organs were clearly showed by fast MR imaging, and they are different from the newborns. (authors)

  9. Pre-main-sequence disk accretion in Z Canis Majoris

    International Nuclear Information System (INIS)

    Hartmann, L.; Kenyon, S.J.; Hewett, R.; Edwards, S.; Strom, K.M.; Strom, S.E.; Stauffer, J.R.

    1989-01-01

    It is suggested that the pre-main-sequence object Z CMa is a luminous accretion disk, similar in many respects to the FU Orionis variables. Z CMa shows the broad, doubled optical absorption lines expected from a rapidly rotating accretion disk. The first overtone CO absorption detected in Z CMa is blue-shifted, suggesting line formation in a disk wind. Accretion at rates about 0.001 solar mass/yr over 100 yr is required to explain the luminosity of Z CMa. The large amount of material accreted (0.1 solar mass/yr) indicates that Z CMa is in a very early stage of stellar evolution, possibly in an initial phase of massive disk accretion. 41 references

  10. Main-sequence turnoff of the Draco dwarf galaxy

    International Nuclear Information System (INIS)

    Stetson, P.B.; Mcclure, R.D.; Vandenberg, D.A.; Victoria Univ., Canada)

    1985-01-01

    Deep photometry on the B,V system for 182 stars in the dwarf spheroidal galaxy in Draco was obtained with a CCD camera at the Cassegrain focus of the Canada-France-Hawaii 3.6-m telescope. Draco's main-sequence turnoff if found near V(to) = 23.5, which is about 3.4 magnitudes below the galaxy's horizontal branch. This leads to the interpretation that Draco is not measurably younger than the clusters or Ursa Minor: the age of Draco is about 18 Gyr according to current star-revolution chronologies. No blue stragglers are definitely detected in Draco, and it is concluded that any young population in Draco probably represents less than 10 percent of the total. 30 references

  11. Orbital motion in pre-main sequence binaries

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, G. H. [The CHARA Array of Georgia State University, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Simon, M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Patience, J., E-mail: schaefer@chara-array.org [Astrophysics Group, School of Physics, University of Exeter, Exeter, EX4 4QL (United Kingdom)

    2014-06-01

    We present results from our ongoing program to map the visual orbits of pre-main sequence (PMS) binaries in the Taurus star forming region using adaptive optics imaging at the Keck Observatory. We combine our results with measurements reported in the literature to analyze the orbital motion for each binary. We present preliminary orbits for DF Tau, T Tau S, ZZ Tau, and the Pleiades binary HBC 351. Seven additional binaries show curvature in their relative motion. Currently, we can place lower limits on the orbital periods for these systems; full solutions will be possible with more orbital coverage. Five other binaries show motion that is indistinguishable from linear motion. We suspect that these systems are bound and might show curvature with additional measurements in the future. The observations reported herein lay critical groundwork toward the goal of measuring precise masses for low-mass PMS stars.

  12. Pre-main-sequence disk accretion in Z Canis Majoris

    Science.gov (United States)

    Hartmann, L.; Kenyon, S. J.; Hewett, R.; Edwards, S.; Strom, K. M.; Strom, S. E.; Stauffer, J. R.

    1989-01-01

    It is suggested that the pre-main-sequence object Z CMa is a luminous accretion disk, similar in many respects to the FU Orionis variables. Z CMa shows the broad, doubled optical absorption lines expected from a rapidly rotating accretion disk. The first overtone CO absorption detected in Z CMa is blue-shifted, suggesting line formation in a disk wind. Accretion at rates about 0.001 solar mass/yr over 100 yr is required to explain the luminosity of Z CMa. The large amount of material accreted (0.1 solar mass/yr) indicates that Z CMa is in a very early stage of stellar evolution, possibly in an initial phase of massive disk accretion.

  13. Metallicity and ultraviolet excesses of late main sequence stars

    International Nuclear Information System (INIS)

    Suchkov, A.A.; Marsakov, V.A.; Shevelev, Yu.G.

    1987-01-01

    The comparison of the characteristics of ultraviolet (UV) excesses δ(U-B) and metallicity [Fe/H] distributions of F, G, and K dwarfs reveals a number of discrepancies. It is shown that they can be eliminated if we assume that UV excesses of K and late G dwarfs, and [Fe/H] values from detailed analysis for F dwarfs are underestimated. Such an assumption enables to account for low values of for F, K and late G dwarfs, and for the difference of the free terms in the metallicity - UV-excess relation for these stars as compared to early G dwarfs. In this case the F5-F9 dwarfs turn out to be more metal-rich (by 0.1 in [Fe/H]) than G and K dwarfs, and the metallicity of the Hyades cluster turns out to be larger than the solar one, [Fe/H] Hyades =+0.1. The ''conditional'' metallicity - UV-excess calibrations are obtained for four groups of main-sequence stars: F5-F9, G0-G4, G5-G9, K0-K5

  14. Pre-main-sequence evolution of the sun

    International Nuclear Information System (INIS)

    Gough, D.

    1980-01-01

    The phase of solar evolution after the dynamical collapse is considered. The physics of the Kelvin-Helmholtz phase of gravitational collapse is described, attention being given to the early stages of the star when it was completely convective. It is noted that subsequently, a radiative core developed and evolution was controlled by the rate at which heat can diffuse through it by radiative transfer. Since the study of the Kelvin-Helmholtz contraction alone does not give enough information regarding the state of the sun when it first settled down to approximate hydrostatic equilibrium, other stars are studied, and information on the sun is obtained by analogy. Many young solar-type stars, such as the T Tauri stars, are not in the completely convective Hayashi (1961) phase hence it is proposed that the sun was completely mixed soon after its formation, which has some bearing on the sun's chemical structure. It is suggested that the surface of the sun was very nonuniform compared with the photosphere of today. The simple solar evolution model presented gives a good guide to the general way in which the sun contracted to the main sequence

  15. On the Statistical Properties of the Lower Main Sequence

    International Nuclear Information System (INIS)

    Angelou, George C.; Bellinger, Earl P.; Hekker, Saskia; Basu, Sarbani

    2017-01-01

    Astronomy is in an era where all-sky surveys are mapping the Galaxy. The plethora of photometric, spectroscopic, asteroseismic, and astrometric data allows us to characterize the comprising stars in detail. Here we quantify to what extent precise stellar observations reveal information about the properties of a star, including properties that are unobserved, or even unobservable. We analyze the diagnostic potential of classical and asteroseismic observations for inferring stellar parameters such as age, mass, and radius from evolutionary tracks of solar-like oscillators on the lower main sequence. We perform rank correlation tests in order to determine the capacity of each observable quantity to probe structural components of stars and infer their evolutionary histories. We also analyze the principal components of classic and asteroseismic observables to highlight the degree of redundancy present in the measured quantities and demonstrate the extent to which information of the model parameters can be extracted. We perform multiple regression using combinations of observable quantities in a grid of evolutionary simulations and appraise the predictive utility of each combination in determining the properties of stars. We identify the combinations that are useful and provide limits to where each type of observable quantity can reveal information about a star. We investigate the accuracy with which targets in the upcoming TESS and PLATO missions can be characterized. We demonstrate that the combination of observations from GAIA and PLATO will allow us to tightly constrain stellar masses, ages, and radii with machine learning for the purposes of Galactic and planetary studies.

  16. HABITABLE ZONES OF POST-MAIN SEQUENCE STARS

    International Nuclear Information System (INIS)

    Ramirez, Ramses M.; Kaltenegger, Lisa

    2016-01-01

    Once a star leaves the main sequence and becomes a red giant, its Habitable Zone (HZ) moves outward, promoting detectable habitable conditions at larger orbital distances. We use a one-dimensional radiative-convective climate and stellar evolutionary models to calculate post-MS HZ distances for a grid of stars from 3700 to 10,000 K (∼M1 to A5 stellar types) for different stellar metallicities. The post-MS HZ limits are comparable to the distances of known directly imaged planets. We model the stellar as well as planetary atmospheric mass loss during the Red Giant Branch (RGB) and Asymptotic Giant Branch (AGB) phases for super-Moons to super-Earths. A planet can stay between 200 million years up to 9 Gyr in the post-MS HZ for our hottest and coldest grid stars, respectively, assuming solar metallicity. These numbers increase for increased stellar metallicity. Total atmospheric erosion only occurs for planets in close-in orbits. The post-MS HZ orbital distances are within detection capabilities of direct imaging techniques.

  17. HABITABLE ZONES OF POST-MAIN SEQUENCE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez, Ramses M.; Kaltenegger, Lisa [Carl Sagan Institute, Cornell University, Ithaca, NY (United States)

    2016-05-20

    Once a star leaves the main sequence and becomes a red giant, its Habitable Zone (HZ) moves outward, promoting detectable habitable conditions at larger orbital distances. We use a one-dimensional radiative-convective climate and stellar evolutionary models to calculate post-MS HZ distances for a grid of stars from 3700 to 10,000 K (∼M1 to A5 stellar types) for different stellar metallicities. The post-MS HZ limits are comparable to the distances of known directly imaged planets. We model the stellar as well as planetary atmospheric mass loss during the Red Giant Branch (RGB) and Asymptotic Giant Branch (AGB) phases for super-Moons to super-Earths. A planet can stay between 200 million years up to 9 Gyr in the post-MS HZ for our hottest and coldest grid stars, respectively, assuming solar metallicity. These numbers increase for increased stellar metallicity. Total atmospheric erosion only occurs for planets in close-in orbits. The post-MS HZ orbital distances are within detection capabilities of direct imaging techniques.

  18. On the Statistical Properties of the Lower Main Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Angelou, George C.; Bellinger, Earl P.; Hekker, Saskia [Max-Planck-Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, D-37077 Göttingen (Germany); Basu, Sarbani [Department of Astronomy, Yale University, New Haven, CT 06520 (United States)

    2017-04-20

    Astronomy is in an era where all-sky surveys are mapping the Galaxy. The plethora of photometric, spectroscopic, asteroseismic, and astrometric data allows us to characterize the comprising stars in detail. Here we quantify to what extent precise stellar observations reveal information about the properties of a star, including properties that are unobserved, or even unobservable. We analyze the diagnostic potential of classical and asteroseismic observations for inferring stellar parameters such as age, mass, and radius from evolutionary tracks of solar-like oscillators on the lower main sequence. We perform rank correlation tests in order to determine the capacity of each observable quantity to probe structural components of stars and infer their evolutionary histories. We also analyze the principal components of classic and asteroseismic observables to highlight the degree of redundancy present in the measured quantities and demonstrate the extent to which information of the model parameters can be extracted. We perform multiple regression using combinations of observable quantities in a grid of evolutionary simulations and appraise the predictive utility of each combination in determining the properties of stars. We identify the combinations that are useful and provide limits to where each type of observable quantity can reveal information about a star. We investigate the accuracy with which targets in the upcoming TESS and PLATO missions can be characterized. We demonstrate that the combination of observations from GAIA and PLATO will allow us to tightly constrain stellar masses, ages, and radii with machine learning for the purposes of Galactic and planetary studies.

  19. Common Warm Dust Temperatures Around Main Sequence Stars

    Science.gov (United States)

    Morales, Farisa; Rieke, George; Werner, Michael; Stapelfeldt, Karl; Bryden, Geoffrey; Su, Kate

    2011-01-01

    We compare the properties of warm dust emission from a sample of main-sequence A-type stars (B8-A7) to those of dust around solar-type stars (F5-KO) with similar Spitzer Space Telescope Infrared Spectrograph/MIPS data and similar ages. Both samples include stars with sources with infrared spectral energy distributions that show evidence of multiple components. Over the range of stellar types considered, we obtain nearly the same characteristic dust temperatures (∼ 190 K and ∼60 K for the inner and outer dust components, respectively)-slightly above the ice evaporation temperature for the inner belts. The warm inner dust temperature is readily explained if populations of small grains are being released by sublimation of ice from icy planetesimals. Evaporation of low-eccentricity icy bodies at ∼ 150 K can deposit particles into an inner/warm belt, where the small grains are heated to dust Temperatures of -190 K. Alternatively, enhanced collisional processing of an asteroid belt-like system of parent planetesimals just interior to the snow line may account for the observed uniformity in dust temperature. The similarity in temperature of the warmer dust across our B8-KO stellar sample strongly suggests that dust-producing planetesimals are not found at similar radial locations around all stars, but that dust production is favored at a characteristic temperature horizon.

  20. Elevation or Suppression? The Resolved Star Formation Main Sequence of Galaxies with Two Different Assembly Modes

    Science.gov (United States)

    Liu, Qing; Wang, Enci; Lin, Zesen; Gao, Yulong; Liu, Haiyang; Berhane Teklu, Berzaf; Kong, Xu

    2018-04-01

    We investigate the spatially resolved star formation main sequence in star-forming galaxies using Integral Field Spectroscopic observations from the Mapping Nearby Galaxies at the Apache Point Observatory survey. We demonstrate that the correlation between the stellar mass surface density (Σ*) and star formation rate surface density (ΣSFR) holds down to the sub-galactic scale, leading to the sub-galactic main sequence (SGMS). By dividing galaxies into two populations based on their recent mass assembly modes, we find the resolved main sequence in galaxies with the “outside-in” mode is steeper than that in galaxies with the “inside-out” mode. This is also confirmed on a galaxy-by-galaxy level, where we find the distributions of SGMS slopes for individual galaxies are clearly separated for the two populations. When normalizing and stacking the SGMS of individual galaxies on one panel for the two populations, we find that the inner regions of galaxies with the “inside-out” mode statistically exhibit a suppression in star formation, with a less significant trend in the outer regions of galaxies with the “outside-in” mode. In contrast, the inner regions of galaxies with “outside-in” mode and the outer regions of galaxies with “inside-out” mode follow a slightly sublinear scaling relation with a slope ∼0.9, which is in good agreement with previous findings, suggesting that they are experiencing a universal regulation without influences of additional physical processes.

  1. Germline Variants in Targeted Tumor Sequencing Using Matched Normal DNA.

    Science.gov (United States)

    Schrader, Kasmintan A; Cheng, Donavan T; Joseph, Vijai; Prasad, Meera; Walsh, Michael; Zehir, Ahmet; Ni, Ai; Thomas, Tinu; Benayed, Ryma; Ashraf, Asad; Lincoln, Annie; Arcila, Maria; Stadler, Zsofia; Solit, David; Hyman, David M; Hyman, David; Zhang, Liying; Klimstra, David; Ladanyi, Marc; Offit, Kenneth; Berger, Michael; Robson, Mark

    2016-01-01

    Tumor genetic sequencing identifies potentially targetable genetic alterations with therapeutic implications. Analysis has concentrated on detecting tumor-specific variants, but recognition of germline variants may prove valuable as well. To estimate the burden of germline variants identified through routine clinical tumor sequencing. Patients with advanced cancer diagnoses eligible for studies of targeted agents at Memorial Sloan Kettering Cancer Center are offered tumor-normal sequencing with MSK-IMPACT, a 341-gene panel. We surveyed the germline variants seen in 187 overlapping genes with Mendelian disease associations in 1566 patients who had undergone tumor profiling between March and October 2014. The number of presumed pathogenic germline variants (PPGVs) and variants of uncertain significance per person in 187 genes associated with single-gene disorders and the proportions of individuals with PPGVs in clinically relevant gene subsets, in genes consistent with known tumor phenotypes, and in genes with evidence of second somatic hits in their tumors. The mean age of the 1566 patients was 58 years, and 54% were women. Presumed pathogenic germline variants in known Mendelian disease-associated genes were identified in 246 of 1566 patients (15.7%; 95% CI, 14.0%-17.6%), including 198 individuals with mutations in genes associated with cancer susceptibility. Germline findings in cancer susceptibility genes were concordant with the individual's cancer type in only 81 of 198 cases (40.9%; 95% CI, 34.3%-47.9%). In individuals with PPGVs retained in the tumor, somatic alteration of the other allele was seen in 39 of 182 cases (21.4%; 95% CI, 16.1%-28.0%), of which 13 cases did not show a known correlation of the germline mutation and a known syndrome. Mutations in non-cancer-related Mendelian disease genes were seen in 55 of 1566 cases (3.5%; 95% CI, 27.1%-45.4%). Almost every individual had more than 1 variant of uncertain significance (1565 of 1566 patients; 99

  2. Lithium evolution in metal-poor stars: from Pre-Main Sequence to the Spite plateau

    OpenAIRE

    Fu, Xiaoting; Bressan, Alessandro; Molaro, Paolo; Marigo, Paola

    2015-01-01

    Lithium abundance derived in metal-poor main sequence stars is about three times lower than the value of primordial Li predicted by the standard Big Bang nucleosynthesis when the baryon density is taken from the CMB or the deuterium measurements. This disagreement is generally referred as the lithium problem. We here reconsider the stellar Li evolution from the pre-main sequence to the end of the main sequence phase by introducing the effects of convective overshooting and residual mass accre...

  3. Unifying cancer and normal RNA sequencing data from different sources

    Science.gov (United States)

    Wang, Qingguo; Armenia, Joshua; Zhang, Chao; Penson, Alexander V.; Reznik, Ed; Zhang, Liguo; Minet, Thais; Ochoa, Angelica; Gross, Benjamin E.; Iacobuzio-Donahue, Christine A.; Betel, Doron; Taylor, Barry S.; Gao, Jianjiong; Schultz, Nikolaus

    2018-01-01

    Driven by the recent advances of next generation sequencing (NGS) technologies and an urgent need to decode complex human diseases, a multitude of large-scale studies were conducted recently that have resulted in an unprecedented volume of whole transcriptome sequencing (RNA-seq) data, such as the Genotype Tissue Expression project (GTEx) and The Cancer Genome Atlas (TCGA). While these data offer new opportunities to identify the mechanisms underlying disease, the comparison of data from different sources remains challenging, due to differences in sample and data processing. Here, we developed a pipeline that processes and unifies RNA-seq data from different studies, which includes uniform realignment, gene expression quantification, and batch effect removal. We find that uniform alignment and quantification is not sufficient when combining RNA-seq data from different sources and that the removal of other batch effects is essential to facilitate data comparison. We have processed data from GTEx and TCGA and successfully corrected for study-specific biases, enabling comparative analysis between TCGA and GTEx. The normalized datasets are available for download on figshare. PMID:29664468

  4. Constraining the magnitude of the largest event in a foreshock-main shock-aftershock sequence

    Science.gov (United States)

    Shcherbakov, Robert; Zhuang, Jiancang; Ogata, Yosihiko

    2018-01-01

    Extreme value statistics and Bayesian methods are used to constrain the magnitudes of the largest expected earthquakes in a sequence governed by the parametric time-dependent occurrence rate and frequency-magnitude statistics. The Bayesian predictive distribution for the magnitude of the largest event in a sequence is derived. Two types of sequences are considered, that is, the classical aftershock sequences generated by large main shocks and the aftershocks generated by large foreshocks preceding a main shock. For the former sequences, the early aftershocks during a training time interval are used to constrain the magnitude of the future extreme event during the forecasting time interval. For the latter sequences, the earthquakes preceding the main shock are used to constrain the magnitudes of the subsequent extreme events including the main shock. The analysis is applied retrospectively to past prominent earthquake sequences.

  5. Pre-main-sequence depletion of Li-6 and Li-7

    International Nuclear Information System (INIS)

    Proffitt, C.R.; Michaud, G.

    1989-01-01

    Depletion of Li-6 and Li-7 during premain-sequence contraction has been calculated for several evolutionary sequences. Slightly greater Li-7 depletion was found than by other recent workers. On the premain sequence, Li-6 is depleted by a factor of at least 10 in the present models for stars with T(eff) lower than 6800 K on the main sequence. Because of the shorter destruction time scale for Li-6 as compared to Li-7, the determination of the abundances of these two isotopes would place strict constraints on the structure of premain-sequence stars. 39 refs

  6. Tracing early stellar evolution with asteroseismology: pre-main sequence stars in NGC 2264

    Directory of Open Access Journals (Sweden)

    Zwintz Konstanze

    2015-01-01

    Full Text Available Asteroseismology has been proven to be a successful tool to unravel details of the internal structure for different types of stars in various stages of their main sequence and post-main sequence evolution. Recently, we found a relation between the detected pulsation properties in a sample of 34 pre-main sequence (pre-MS δ Scuti stars and the relative phase in their pre-MS evolution. With this we are able to demonstrate that asteroseismology is similarly powerful if applied to stars in the earliest stages of evolution before the onset of hydrogen core burning.

  7. AN OBJECTIVE DEFINITION FOR THE MAIN SEQUENCE OF STAR-FORMING GALAXIES

    Energy Technology Data Exchange (ETDEWEB)

    Renzini, Alvio [INAF—Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy); Peng, Ying-jie, E-mail: alvio.renzini@oapd.inaf.it, E-mail: y.peng@mrao.cam.ac.uk [Cavendish Laboratory, University of Cambridge, 19 J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2015-03-10

    The main sequence (MS) of star-forming (SF) galaxies plays a fundamental role in driving galaxy evolution and our efforts to understand it. However, different studies find significant differences in the normalization, slope, and shape of the MS. These discrepancies arise mainly from the different selection criteria adopted to isolate SF galaxies, which may include or exclude galaxies with a specific star formation rate (SFR) substantially below the MS value. To obviate this limitation of all current criteria, we propose an objective definition of the MS that does not rely at all on a pre-selection of SF galaxies. Constructing the 3D SFR–mass–number plot, the MS is then defined as the ridge line of the SF peak, as illustrated with various figures. The advantages of such a definition are manifold. If generally adopted, it will facilitate the inter-comparison of results from different groups using the same SFR and stellar mass diagnostics, or it will highlight the relative systematics of different diagnostics. All of this could help to understand MS galaxies as systems in a quasi-steady state equilibrium and would also provide a more objective criterion for identifying quenching galaxies.

  8. AN OBJECTIVE DEFINITION FOR THE MAIN SEQUENCE OF STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Renzini, Alvio; Peng, Ying-jie

    2015-01-01

    The main sequence (MS) of star-forming (SF) galaxies plays a fundamental role in driving galaxy evolution and our efforts to understand it. However, different studies find significant differences in the normalization, slope, and shape of the MS. These discrepancies arise mainly from the different selection criteria adopted to isolate SF galaxies, which may include or exclude galaxies with a specific star formation rate (SFR) substantially below the MS value. To obviate this limitation of all current criteria, we propose an objective definition of the MS that does not rely at all on a pre-selection of SF galaxies. Constructing the 3D SFR–mass–number plot, the MS is then defined as the ridge line of the SF peak, as illustrated with various figures. The advantages of such a definition are manifold. If generally adopted, it will facilitate the inter-comparison of results from different groups using the same SFR and stellar mass diagnostics, or it will highlight the relative systematics of different diagnostics. All of this could help to understand MS galaxies as systems in a quasi-steady state equilibrium and would also provide a more objective criterion for identifying quenching galaxies

  9. Magnetic fields in O-, B- and A-type stars on the main sequence

    Directory of Open Access Journals (Sweden)

    Briquet Maryline

    2015-01-01

    Full Text Available In this review, the latest observational results on magnetic fields in main-sequence stars with radiative envelopes are summarised together with the theoretical works aimed at explaining them.

  10. Did A Planet Survive A Post-Main Sequence Evolutionary Event?

    Science.gov (United States)

    Sorber, Rebecca; Jang-Condell, Hannah; Zimmerman, Mara

    2018-06-01

    The GL86 is star system approximately 10 pc away with a main sequence K- type ~ 0.77 M⊙ star (GL 86A) with a white dwarf ~0.49 M⊙ companion (GL86 B). The system has a ~ 18.4 AU semi-major axis, an orbital period of ~353 yrs, and an eccentricity of ~ 0.39. A 4.5 MJ planet orbits the main sequence star with a semi-major axis of 0.113 AU, an orbital period of 15.76 days, in a near circular orbit with an eccentricity of 0.046. If we assume that this planet was formed during the time when the white dwarf was a main sequence star, it would be difficult for the planet to have remained in a stable orbit during the post-main sequence evolution of GL86 B. The post-main sequence evolution with planet survival will be examined by modeling using the program Mercury (Chambers 1999). Using the model, we examine the origins of the planet: whether it formed before or after the post-main sequence evolution of GL86B. The modeling will give us insight into the dynamical evolution of, not only, the binary star system, but also the planet’s life cycle.

  11. Central limit theorems for sequences with m(n)-dependent main part

    NARCIS (Netherlands)

    Nieuwenhuis, G.

    1992-01-01

    Let (Xi(n); n ϵ N, 1⩽i⩽h(n)) be a double sequence of random variables with h(n)→∞ as n→∞. Suppose that the sequence can be split into two parts: an m(n)-dependent sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of main terms and a sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of residual terms. Here (m(n)) may be

  12. The research on AP1000 nuclear main pumps’ complete characteristics and the normalization method

    International Nuclear Information System (INIS)

    Zhu, Rongsheng; Liu, Yong; Wang, Xiuli; Fu, Qiang; Yang, Ailing; Long, Yun

    2017-01-01

    Highlights: • Complete characteristics of main pump are researched into. • The quadratic character of head and torque under some operatings. • The characteristics tend to be the same under certain conditions. • The normalization method gives proper estimations on external characteristics. • The normalization method can efficiently improve the security computing. - Abstract: The paper summarizes the complete characteristics of nuclear main pumps based on experimental results and makes a detailed study, and then draws a series of important conclusions: with regard to the overall flow area, the runaway operating and 0-revolving-speed operating of nuclear main pumps both have quadratic characteristics; with regard to the infinite flow, the braking operation and the 0-revolving-speed operation show consistent external characteristics. To remedy the shortcomings of the traditional complete-characteristic expression with regards to only describing limited flow sections at specific revolving speeds, the paper proposes a normalization method. As an important boundary condition of the security computing of unstable transient process of the primary reactor coolant pump and the nuclear island primary circuit and secondary circuit, the precision of complete-characteristic data and curve impacts the precision of security computing. A normalization curve obtained by applying the normalization method to process complete-characteristic data could correctly, completely and precisely express the complete characteristics of the primary reactor coolant pump under any rotational speed and full flow, and is capable of giving proper estimations on external characteristics of the flow outside the test range and even of the infinite flow. These advantages are of great significance for the improvement of security computing of transient processes of the primary reactor coolant pump and the circuit system.

  13. 13-colour photometry of pre-main sequence stars: preliminary report and results

    Energy Technology Data Exchange (ETDEWEB)

    Chavarria-K, C; de Lara, E [Universidad Nacional Autonoma de Mexico, Mexico City. Inst. de Astronomia

    1981-01-01

    Broad (UBVRI) and intermediate (13-colour) band photometry of 160 stars selected mainly from the Herbig Rao catalogue are being carried on currently, mainly to complement the published data of these stars in the optical window (for example shortward of the Balmer and longward of the Paschen discontinuities). The 13-colour photometric system and its applications to pre-main sequences stars are briefly discussed. First results are presented.

  14. Pre-main sequence masses and the age spread in the Orion cluster

    International Nuclear Information System (INIS)

    McNamara, B.J.

    1975-01-01

    The spread in formation times for stars earlier than GO in the Orion cluster is investigated. The range of stellar ages in this cluster is found to extend from at least 10 6 years to about 10 7 years. On the basis of this evidence and the similarity of the color--magnitude diagrams of other young clusters to the Orion cluster, it is suggested that the current method of dating these clusters (from the point at which the most massive stars just reach the zero-age main sequence) might not be valid. The masses of forty-one pre-main sequence stars within the ranges 4.05 less than or equal to log(Te) less than or equal to 3.77 and 0.6 less than or equal to log (L/L/sub sun/) less than or equal to 2.1 are determined from observed effective temperatures, luminosities, and gravities. These masses were then compared with those expected from Iben's (1965) pre-main sequence evolutionary calculations. In most cases, the agreement between these values was found to be within the observational errors. Finally, the pre-main sequence stars possessing infrared excesses are found to be apparently among the most massive and youngest stars still contracting toward the zero-age main sequence

  15. An extensive VLT/X-shooter library of photospheric templates of pre-main sequence stars

    Science.gov (United States)

    Manara, C. F.; Frasca, A.; Alcalá, J. M.; Natta, A.; Stelzer, B.; Testi, L.

    2017-09-01

    Context. Studies of the formation and evolution of young stars and their disks rely on knowledge of the stellar parameters of the young stars. The derivation of these parameters is commonly based on comparison with photospheric template spectra. Furthermore, chromospheric emission in young active stars impacts the measurement of mass accretion rates, a key quantity for studying disk evolution. Aims: Here we derive stellar properties of low-mass (M⋆≲ 2 M⊙) pre-main sequence stars without disks, which represent ideal photospheric templates for studies of young stars. We also use these spectra to constrain the impact of chromospheric emission on the measurements of mass accretion rates. The spectra are reduced, flux-calibrated, and corrected for telluric absorption, and are made available to the community. Methods: We derive the spectral type for our targets by analyzing the photospheric molecular features present in their VLT/X-shooter spectra by means of spectral indices and comparison of the relative strength of photospheric absorption features. We also measure effective temperature, gravity, projected rotational velocity, and radial velocity from our spectra by fitting them with synthetic spectra with the ROTFIT tool. The targets have negligible extinction (AVpresented in our previous publication. We perform synthetic photometry on the spectra to derive the typical colors of young stars in different filters. We measure the luminosity of the emission lines present in the spectra and estimate the noise due to chromospheric emission in the measurements of accretion luminosity in accreting stars. Results: We provide a calibration of the photospheric colors of young pre-main sequence stars as a function of their spectral type in a set of standard broad-band optical and near-infrared filters. The logarithm of the noise on the accretion luminosity normalized to the stellar luminosity is roughly constant and equal to -2.3 for targets with masses larger than 1 solar

  16. A near-infrared survey for pre-main sequence stars in Taurus

    Science.gov (United States)

    Gomez, Mercedes; Kenyon, Scott J.; Hartmann, Lee

    1994-01-01

    We present a near-infrared survey of approximately 2 sq deg covering parts of L1537, L1538, and Heiles cloud 2 in the Taurus-Auriga molecular cloud. Although this study is more sensitive than previous attempts to identify pre-main sequence stars in Taurus-Auriga, our survey regions contain only one new optically visible, young star. We did find several candidate embedded protostars; additional 10 micrometer photometry is necessary to verify the pre-main sequence nature of these sources. Our results--combined with those of previous surveys--show that the L1537/L1538 clouds contain no pre-main sequence stars. These two clouds are less dense than the active star formation sites in Taurus-Auriga, which suggests a cloud must achieve a threshold density to form stars.

  17. Effects of main-sequence mass loss on stellar and galactic chemical evolution

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1988-01-01

    L.A. Willson, G.H. Bowen and C. Struck-Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10 -9 M mass of sun/yr, diminishing over several times 10 8 years. The author attempts to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M 0 , and mass-loss rates decreasing exponentially over 2-3 x 10 8 years. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 M mass of sun and mass loss timescales 0.2 to 2.0 Gry. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M mass of sun and a metallicity-dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus-remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main sequence to the present

  18. Effects of mass loss on the evolution of massive stars. I. Main-sequence evolution

    International Nuclear Information System (INIS)

    Dearborn, D.S.P.; Blake, J.B.; Hainebach, K.L.; Schramm, D.N.

    1978-01-01

    The effect of mass loss on the evolution and surface composition of massive stars during main-sequence evolution are examined. While some details of the evolutionary track depend on the formula used for the mass loss, the results appear most sensitive to the total mass removed during the main-sequence lifetime. It was found that low mass-loss rates have very little effect on the evolution of a star; the track is slightly subluminous, but the lifetime is almost unaffected. High rates of mass loss lead to a hot, high-luminosity stellar model with a helium core surrounded by a hydrogen-deficient (Xapprox.0.1) envelope. The main-sequence lifetime is extended by a factor of 2--3. These models may be identified with Wolf-Rayet stars. Between these mass-loss extremes are intermediate models which appear as OBN stars on the main sequence. The mass-loss rates required for significant observable effects range from 8 x 10 -7 to 10 -5 M/sub sun/ yr -1 , depending on the initial stellar mass. It is found that observationally consistent mass-loss rates for stars with M> or =30 M/sub sun/ may be sufficiently high that these stars lose mass on a time scale more rapidly than their main-sequence core evolution time. This result implies that the helium cores resulting from the main-sequence evolution of these massive stars may all be very similar to that of a star of Mapprox.30 M/sub sun/ regardless of the zero-age mass

  19. The Star-forming Main Sequence of Dwarf Low Surface Brightness Galaxies

    Science.gov (United States)

    McGaugh, Stacy S.; Schombert, James M.; Lelli, Federico

    2017-12-01

    We explore the star-forming properties of late-type, low surface brightness (LSB) galaxies. The star-forming main sequence ({SFR}-{M}* ) of LSB dwarfs has a steep slope, indistinguishable from unity (1.04 ± 0.06). They form a distinct sequence from more massive spirals, which exhibit a shallower slope. The break occurs around {M}* ≈ {10}10 {M}⊙ , and can also be seen in the gas mass—stellar mass plane. The global Kennicutt-Schmidt law ({SFR}-{M}g) has a slope of 1.47 ± 0.11 without the break seen in the main sequence. There is an ample supply of gas in LSB galaxies, which have gas depletion times well in excess of a Hubble time, and often tens of Hubble times. Only ˜ 3 % of this cold gas needs be in the form of molecular gas to sustain the observed star formation. In analogy with the faint, long-lived stars of the lower stellar main sequence, it may be appropriate to consider the main sequence of star-forming galaxies to be defined by thriving dwarfs (with {M}* {10}10 {M}⊙ ) are weary giants that constitute more of a turn-off population.

  20. AK Sco: a tidally induced atmospheric dynamo in a pre-main sequence binary?

    Science.gov (United States)

    Gómez de Castro, A. I.

    2009-02-01

    AK Sco is a unique source: a 10-30 Myrs old pre-main sequence spectroscopic binary composed by two nearly equal F5 stars that at periastron are separated by barely eleven stellar radii so, the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes of AK Sco, the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during pre-main sequence evolution. Evidence of this effect is reported in this contribution.

  1. Reconciling mass functions with the star-forming main sequence via mergers

    Science.gov (United States)

    Steinhardt, Charles L.; Yurk, Dominic; Capak, Peter

    2017-06-01

    We combine star formation along the 'main sequence', quiescence and clustering and merging to produce an empirical model for the evolution of individual galaxies. Main-sequence star formation alone would significantly steepen the stellar mass function towards low redshift, in sharp conflict with observation. However, a combination of star formation and merging produces a consistent result for correct choice of the merger rate function. As a result, we are motivated to propose a model in which hierarchical merging is disconnected from environmentally independent star formation. This model can be tested via correlation functions and would produce new constraints on clustering and merging.

  2. Sequence of decommissioning of the main equipment in a central type VVER 440 V-230

    International Nuclear Information System (INIS)

    Andres, E.; Garcia Ruiz, R.

    2014-01-01

    IBERDROLA Ingenieria y Construccion S.A.U., leader of consortium with Empresarios Agrupados and INDRA, has developed the Basic Engineering for the decommissioning of contaminated systems and building of a VVER 440 V-230 Nuclear Power Plant, establishing the sequence and methodology for the main equipment fragmentation. For that, it has been designed dry and wet cutting zones to be set up in the area where steam generators, main cooling pumps and pressurizer are located; these components will be dismantled previously. (Author)

  3. Variations of the ISM conditions accross the Main Sequence of star forming galaxies: observations and simulations.

    Science.gov (United States)

    Martinez Galarza, Juan R.; Smith, Howard Alan; Lanz, Lauranne; Hayward, Christopher C.; Zezas, Andreas; Hung, Chao-Ling; Rosenthal, Lee; Weiner, Aaron

    2015-01-01

    A significant amount of evidence has been gathered that leads to the existence of a main sequence (MS) of star formation in galaxies. This MS is expressed in terms of a correlation between the SFR and the stellar mass of the form SFR ∝ M* and spans a few orders of magnitude in both quantities. Several ideas have been suggested to explain fundamental properties of the MS, such as its slope, its dispersion, and its evolution with redshift, but no consensus has been reached regarding its true nature, and whether the membership or not of particular galaxies to this MS underlies the existence of two different modes of star formation. In order to advance in the understanding of the MS, here we use a statistically robust Bayesian SED analysis method (CHIBURST) to consistently analyze the star-forming properties of a set of hydro-dynamical simulations of mergers, as well as observations of real mergers, both local and at intermediate redshift. We find a remarkable, very tight correlation between the specific star formation rate (sSFR) of galaxies, and the typical ISM conditions near their inernal star-forming regions, parametrized via a novel quantity: the compactness parameter (C). The evolution of mergers along this correlation explains the spread of the MS, and implies that the physical conditions of the ISM smoothly evolve between on-MS (secular) conditions and off-MS (coalescence/starburst) conditions. Furthermore, we show that the slope of the correlation can be interpreted in terms of the efficiency in the conversion of gas into stars, and that this efficiency remains unchanged along and across the MS. Finally, we discuss differences in the normalization of the correlation as a function of merger mass and redshift, and conclude that these differences imply the existence of two different modes of star formation, unrelated to the smooth evolution across the MS: a disk-like, low pressure mode and a compact nuclear-starburst mode.

  4. The Star Formation Main Sequence in the Hubble Space Telescope Frontier Fields

    Science.gov (United States)

    Santini, Paola; Fontana, Adriano; Castellano, Marco; Di Criscienzo, Marcella; Merlin, Emiliano; Amorin, Ricardo; Cullen, Fergus; Daddi, Emanuele; Dickinson, Mark; Dunlop, James S.; Grazian, Andrea; Lamastra, Alessandra; McLure, Ross J.; Michałowski, Michał. J.; Pentericci, Laura; Shu, Xinwen

    2017-09-01

    We investigate the relation between star formation rate (SFR) and stellar mass (M), I.e., the main sequence (MS) relation of star-forming galaxies, at 1.3≤slant zFrontier Fields, on the basis of rest-frame UV observations. Gravitational lensing combined with deep HST observations allows us to extend the analysis of the MS down to {log} M/{M}⊙ ˜ 7.5 at z≲ 4 and {log} M/{M}⊙ ˜ 8 at higher redshifts, a factor of ˜10 below most previous results. We perform an accurate simulation to take into account the effect of observational uncertainties and correct for the Eddington bias. This step allows us to reliably measure the MS and in particular its slope. While the normalization increases with redshift, we fit an unevolving and approximately linear slope. We nicely extend to lower masses the results of brighter surveys. Thanks to the large dynamic range in mass and by making use of the simulation, we analyzed any possible mass dependence of the dispersion around the MS. We find tentative evidence that the scatter decreases with increasing mass, suggesting a larger variety of star formation histories in low-mass galaxies. This trend agrees with theoretical predictions and is explained as either a consequence of the smaller number of progenitors of low-mass galaxies in a hierarchical scenario and/or of the efficient but intermittent stellar feedback processes in low-mass halos. Finally, we observe an increase in the SFR per unit stellar mass with redshift milder than predicted by theoretical models, implying a still incomplete understanding of the processes responsible for galaxy growth.

  5. The Lower Main Sequence of Stars in the Solar Neighborhood: Model Predictions Versus Observation

    Directory of Open Access Journals (Sweden)

    Bartašiūtė S.

    2012-09-01

    Full Text Available We have used the Simbad database and VizieR catalogue access tools to construct the observational color-absolute magnitude diagrams of nearby K-M dwarfs with precise Hipparcos parallaxes (σπ/π ≤ 0:05. Particular attention has been paid to removing unresolved double/multiple stars and variables. In addition to archival data, we have made use of nearly 2000 new radial-velocity measurements of K-M dwarfs to identify spectroscopic binary candidates. The main sequences, cleaned from unresolved binaries, variable stars, and old population stars which can also widen the sequence due to their presumably lower metallicity, were compared to available solar-metallicity models. Significant offsets of most of the model main-sequence lines are seen with respect to observational data, especially for the lower-mass stars. Only the location and slope of the Victoria-Regina and, partly, BaSTI isochrones match the data quite well.

  6. The main sequence of NGC 6231 and the calibration of absolute magnitudes

    International Nuclear Information System (INIS)

    Garrison, R.F.

    1978-01-01

    The author presents a discussion of a new approach to the calibration of absolute magnitudes for MK spectral types. With the addition of the NGC 6231 main sequence down to A0, the material for the cluster fitting method using very carefully determined MK types is complete. (Auth.)

  7. Oscillation mode linewidths of main-sequence and subgiant stars observed by Kepler

    DEFF Research Database (Denmark)

    Appourchaux, T.; Benomar, O.; Gruberbauer, M.

    2012-01-01

    Solar-like oscillations have been observed by {{\\it Kepler}} and CoRoT in several solar-type stars. We study the variations of stellar p-mode linewidth as a function of effective temperature. Time series of 9 months of Kepler data have been used. The power spectra of 42 cool main-sequence stars a...

  8. IRAS IDENTIFICATION OF PRE-MAIN-SEQUENCE STARS IN THE CHAMELEON-II ASSOCIATION

    NARCIS (Netherlands)

    PRUSTI, T; WHITTET, DCB; ASSENDORP, R; WESSELIUS, PR

    We report the results of a search for new pre-main sequence candidates in the Chamaeleon II dark cloud based on three IRAS catalogues (the Point Source Catalog, the Serendipitous Survey Catalog and the Faint Source Survey). A total of 30 sources were selected. Twelve of these display IRAS colours

  9. Relation of chromospheric activity to convection, rotation, and pre-main-sequence evolution

    International Nuclear Information System (INIS)

    Gilliland, R.L.

    1986-01-01

    Pre-main-sequence, or T Tauri, stars are characterized by much larger fluxes of nonradiative origin than their main-sequence counterparts. As a class, the T Tauri stars have only moderate rotation rates, making an explanation of their chromospheric properties based on rapid rotation problematic. The recent success of correlating nonradiative fluxes to the Rossby number, Ro = P/sub rot//tau/sub conv/, a central parameter of simple dynamo theories of magnetic field generation, has led to the suggestion that the same relation might be of use in explaining the pre-main-sequence (PMS) stars if tau/sub conv/ is very large. We show that tau/sub conv/ does depend strongly on evolutionary effects above the main sequence (MS), but that this dependence alone cannot account for the high observed nonradiative fluxes. The acoustic flux is also strongly dependent on PMS evolutionary state, and when coupled to the parameterization of magnetic activity based on Ro, these two mechanisms seem capable of explaining the high observed level of chromospheric activity in T Tauri stars. The moment of inertia decreases by two to three order of magnitude during PMS evolution. Since young MS stars do not rotate two to three orders of magnitude faster than PMS stars, rapid loss or redistribution of angular momentum must occur

  10. The SAMI Galaxy Survey: spatially resolving the main sequence of star formation

    Science.gov (United States)

    Medling, Anne M.; Cortese, Luca; Croom, Scott M.; Green, Andrew W.; Groves, Brent; Hampton, Elise; Ho, I.-Ting; Davies, Luke J. M.; Kewley, Lisa J.; Moffett, Amanda J.; Schaefer, Adam L.; Taylor, Edward; Zafar, Tayyaba; Bekki, Kenji; Bland-Hawthorn, Joss; Bloom, Jessica V.; Brough, Sarah; Bryant, Julia J.; Catinella, Barbara; Cecil, Gerald; Colless, Matthew; Couch, Warrick J.; Drinkwater, Michael J.; Driver, Simon P.; Federrath, Christoph; Foster, Caroline; Goldstein, Gregory; Goodwin, Michael; Hopkins, Andrew; Lawrence, J. S.; Leslie, Sarah K.; Lewis, Geraint F.; Lorente, Nuria P. F.; Owers, Matt S.; McDermid, Richard; Richards, Samuel N.; Sharp, Robert; Scott, Nicholas; Sweet, Sarah M.; Taranu, Dan S.; Tescari, Edoardo; Tonini, Chiara; van de Sande, Jesse; Walcher, C. Jakob; Wright, Angus

    2018-04-01

    We present the ˜800 star formation rate maps for the Sydney-AAO Multi-object Integral field spectrograph (SAMI) Galaxy Survey based on H α emission maps, corrected for dust attenuation via the Balmer decrement, that are included in the SAMI Public Data Release 1. We mask out spaxels contaminated by non-stellar emission using the [O III]/H β, [N II]/H α, [S II]/H α, and [O I]/H α line ratios. Using these maps, we examine the global and resolved star-forming main sequences of SAMI galaxies as a function of morphology, environmental density, and stellar mass. Galaxies further below the star-forming main sequence are more likely to have flatter star formation profiles. Early-type galaxies split into two populations with similar stellar masses and central stellar mass surface densities. The main-sequence population has centrally concentrated star formation similar to late-type galaxies, while galaxies >3σ below the main sequence show significantly reduced star formation most strikingly in the nuclear regions. The split populations support a two-step quenching mechanism, wherein halo mass first cuts off the gas supply and remaining gas continues to form stars until the local stellar mass surface density can stabilize the reduced remaining fuel against further star formation. Across all morphologies, galaxies in denser environments show a decreased specific star formation rate from the outside in, supporting an environmental cause for quenching, such as ram-pressure stripping or galaxy interactions.

  11. A consistency test of white dwarf and main sequence ages: NGC 6791

    Directory of Open Access Journals (Sweden)

    Córsico A.H.

    2013-03-01

    Full Text Available NGC 6791 is an open cluster that it is so close to us that can be imaged down to very faint luminosities. The main sequence turn-off age (∼8 Gyr and the age derived from the cut-off of the white dwarf luminosity function (∼6 Gyr were found to be significantly different. Here we demonstrate that the origin of this age discrepancy lies in an incorrect evaluation of the white dwarf cooling ages, and we show that when the relevant physical separation processes are included in the calculation of white dwarf sequences both ages are coincident.

  12. Effects of Main-Sequence Mass Loss on Stellar and Galactic Chemical Evolution.

    Science.gov (United States)

    Guzik, Joyce Ann

    1988-06-01

    L. A. Willson, G. H. Bowen and C. Struck -Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10^{-9}M o/yr, diminishing over several times 10^8 years. We attempted to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M o, and mass-loss rates decreasing exponentially over 2-3 times 10^8 years. Compared to a constant -mass model, these models require a reduced initial ^4He abundance, have deeper envelope convection zones and higher ^8B neutrino fluxes. Early processing of present surface layers at higher interior temperatures increases the surface ^3He abundance, destroys Li, Be and B, and decreases the surface C/N ratio following first dredge-up. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 Mo and mass loss timescales 0.2 to 2.0 Gyr. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M o and a metallicity -dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus -remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main

  13. On the normalization of the minimum free energy of RNAs by sequence length.

    Directory of Open Access Journals (Sweden)

    Edoardo Trotta

    Full Text Available The minimum free energy (MFE of ribonucleic acids (RNAs increases at an apparent linear rate with sequence length. Simple indices, obtained by dividing the MFE by the number of nucleotides, have been used for a direct comparison of the folding stability of RNAs of various sizes. Although this normalization procedure has been used in several studies, the relationship between normalized MFE and length has not yet been investigated in detail. Here, we demonstrate that the variation of MFE with sequence length is not linear and is significantly biased by the mathematical formula used for the normalization procedure. For this reason, the normalized MFEs strongly decrease as hyperbolic functions of length and produce unreliable results when applied for the comparison of sequences with different sizes. We also propose a simple modification of the normalization formula that corrects the bias enabling the use of the normalized MFE for RNAs longer than 40 nt. Using the new corrected normalized index, we analyzed the folding free energies of different human RNA families showing that most of them present an average MFE density more negative than expected for a typical genomic sequence. Furthermore, we found that a well-defined and restricted range of MFE density characterizes each RNA family, suggesting the use of our corrected normalized index to improve RNA prediction algorithms. Finally, in coding and functional human RNAs the MFE density appears scarcely correlated with sequence length, consistent with a negligible role of thermodynamic stability demands in determining RNA size.

  14. On the normalization of the minimum free energy of RNAs by sequence length.

    Science.gov (United States)

    Trotta, Edoardo

    2014-01-01

    The minimum free energy (MFE) of ribonucleic acids (RNAs) increases at an apparent linear rate with sequence length. Simple indices, obtained by dividing the MFE by the number of nucleotides, have been used for a direct comparison of the folding stability of RNAs of various sizes. Although this normalization procedure has been used in several studies, the relationship between normalized MFE and length has not yet been investigated in detail. Here, we demonstrate that the variation of MFE with sequence length is not linear and is significantly biased by the mathematical formula used for the normalization procedure. For this reason, the normalized MFEs strongly decrease as hyperbolic functions of length and produce unreliable results when applied for the comparison of sequences with different sizes. We also propose a simple modification of the normalization formula that corrects the bias enabling the use of the normalized MFE for RNAs longer than 40 nt. Using the new corrected normalized index, we analyzed the folding free energies of different human RNA families showing that most of them present an average MFE density more negative than expected for a typical genomic sequence. Furthermore, we found that a well-defined and restricted range of MFE density characterizes each RNA family, suggesting the use of our corrected normalized index to improve RNA prediction algorithms. Finally, in coding and functional human RNAs the MFE density appears scarcely correlated with sequence length, consistent with a negligible role of thermodynamic stability demands in determining RNA size.

  15. Seismic evidence of conjugate normal faulting: The 1994 Devil Canyon earthquake sequence near Challis, Idaho

    International Nuclear Information System (INIS)

    Jackson, S.M.

    1994-08-01

    In this study, the term ''conjugate'' refers to faults that occur in two intersecting sets and coordinated kinematically, with each set being distinctive in both orientation and sense of shear (Davis, 1984). Contemporaneous activity along the conjugate faults is defined as occurring within the time frame of the mainshock-aftershock sequence (three weeks for this sequence and generally less than one month in other observed cases). Detailed recordings of microearthquakes from a dense array of temporary analog seismic stations are analyzed. The focal mechanisms and hypocenter spatial and temporal characteristics are combined with geological information to assess the style, geometry, timing, kinematics, and mechanics of conjugate normal faulting. The characteristics of conjugate normal faulting observed in the Devil Canyon sequence are compared to other conjugate normal faulting sequences, and strike-slip and thrust conjugate sequences worldwide

  16. SDSS-IV MaNGA: Spatially Resolved Star Formation Main Sequence and LI(N)ER Sequence

    Science.gov (United States)

    Hsieh, B. C.; Lin, Lihwai; Lin, J. H.; Pan, H. A.; Hsu, C. H.; Sánchez, S. F.; Cano-Díaz, M.; Zhang, K.; Yan, R.; Barrera-Ballesteros, J. K.; Boquien, M.; Riffel, R.; Brownstein, J.; Cruz-González, I.; Hagen, A.; Ibarra, H.; Pan, K.; Bizyaev, D.; Oravetz, D.; Simmons, A.

    2017-12-01

    We present our study on the spatially resolved Hα and M * relation for 536 star-forming and 424 quiescent galaxies taken from the MaNGA survey. We show that the star formation rate surface density ({{{Σ }}}{SFR}), derived based on the Hα emissions, is strongly correlated with the M * surface density ({{{Σ }}}* ) on kiloparsec scales for star-forming galaxies and can be directly connected to the global star-forming sequence. This suggests that the global main sequence may be a consequence of a more fundamental relation on small scales. On the other hand, our result suggests that ∼20% of quiescent galaxies in our sample still have star formation activities in the outer region with lower specific star formation rate (SSFR) than typical star-forming galaxies. Meanwhile, we also find a tight correlation between {{{Σ }}}{{H}α } and {{{Σ }}}* for LI(N)ER regions, named the resolved “LI(N)ER” sequence, in quiescent galaxies, which is consistent with the scenario that LI(N)ER emissions are primarily powered by the hot, evolved stars as suggested in the literature.

  17. Rotation in moderate-mass pre-main-sequence radiative track G stars

    International Nuclear Information System (INIS)

    Mcnamara, B.

    1990-01-01

    Recent studies suggest that the observed high-mass radiative track velocity histograms for pre-main-sequence stars differ significantly. In the Vogel and Kuhi (1981) study, these stars were found to possess a rather broad distribution of rotational velocities with a moderate peak at low velocities. In contrast, Smith et al. (1983), found a very sharply peaked distribution located at low values of v sin i. The difference in these velocity distributions is shown to be due to inadequate allowance for field stars in the Smith, et al., work. Once these stars are removed, the high-mass velocity distributions of the two regions are remarkably similar. This result suggests that a unique velocity distribution might be used in modeling very young stars. Assuming that the Orion Ic proto-F stars continue to contract in a homologous fashion, their average current rotational velocity is in agreement with that expected for zero-age main sequence F stars. 27 refs

  18. BVI CCD photometry of the broad main-sequence globular cluster NGC 1851

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.; Alvarado, F.; Wenderoth, E.

    1990-01-01

    Three-color CCD C-M diagrams are presented for the globular cluster NGC 1851, showing an extreme breadth of the main-sequence, similar to that of Omega Centauri. It is found that the main-sequence turnoff points are located at V(TO) = 19.44 + or - 0.10, with colors at B-V = 0.54 + or - 0.02, V-I = 0.61 + or - 0.02, and B-I = 1.15 + or - 0.03. The best fit to the VandenBerg and Bell (1985) isochrones is shown to be all C-M diagrams with Y = 0.20, Fe/H abundance ratio = -1.27, and (m-M)v = 15.45. It is concluded that NGC 1851 has a Delta V(TO - HB) = 3.34 + or - 0.10 and an age of 16 + or - 2 Gyr. 29 refs

  19. Radio emission from pre-main-sequence stars in Corona Australis

    International Nuclear Information System (INIS)

    Brown, A.

    1987-01-01

    The central region of the Corona Australis molecular cloud surrounding the stars R and TY CrA has been studied using the VLA at 6 cm. Eleven radio sources are detected including five associated with pre-main-sequence objects. The most striking is associated with the near-IR source IRS 7 and shows a complex structure comprising two strong pointlike sources positioned either side of the deeply embedded IR source and two extended lobes of radio emission. The IRS 7 radio source appears to be similar to that associated with Lynds 1551 IRS 5 but has a considerably larger angular size. The other detected sources include the massive pre-main-sequence star TY CrA, the near-IR sources IRS 1 and IRS 5, and the Herbig-Haro object HH 101. The stars R and T CrA were not detected. 35 references

  20. Mass loss from pre-main-sequence accretion disks. I - The accelerating wind of FU Orionis

    Science.gov (United States)

    Calvet, Nuria; Hartmann, Lee; Kenyon, Scott J.

    1993-01-01

    We present evidence that the wind of the pre-main-sequence object FU Orionis arises from the surface of the luminous accretion disk. A disk wind model calculated assuming radiative equilibrium explains the differential behavior of the observed asymmetric absorption-line profiles. The model predicts that strong lines should be asymmetric and blueshifted, while weak lines should be symmetric and double-peaked due to disk rotation, in agreement with observations. We propose that many blueshifted 'shell' absorption features are not produced in a true shell of material, but rather form in a differentially expanding wind that is rapidly rotating. The inference of rapid rotation supports the proposal that pre-main-sequence disk winds are rotationally driven.

  1. Turbulence and the Li abundance in main sequence and giant stars

    International Nuclear Information System (INIS)

    Charbonneau, P.; Michaud, G.

    1990-01-01

    Calculations of Li burning via turbulent transport are conducted to determine the extent to which observed Li abundances in first ascent giants constrain the various turbulence parameterizations used to model the main-sequence surface Li abundance evolution. A full time-dependent solution to the transport equation is performed, including nuclear reaction terms and evolutionary effects. It is found that turbulence can lead to the extreme Li underabundances observed in giants of M67 and NGC 752. Consideration is given to the possibility of using observations of Li abundances to discriminate between turbulent particle transport and meridional circulation transport. Numerical solutions of the turbulent diffusion coefficient of Vauclair (1988) is used to model the Hyades Li abundance gap. The astrophysical implications of the results for main-sequence and giant stars are discussed. 36 refs

  2. MRI investigation of normal fetal lung maturation using signal intensities on different imaging sequences

    International Nuclear Information System (INIS)

    Balassy, Csilla; Kasprian, Gregor; Weber, Michael; Hoermann, Marcus; Prayer, Daniela; Brugger, Peter C.; Csapo, Bence; Mittermayer, Christoph

    2007-01-01

    To purpose of this paper is to study the relation between normal lung maturation signal and changes in intensity ratios (SIR) and to determine which magnetic resonance imaging sequence provides the strongest correlation of normal lung SIs with gestational age. 126 normal singleton pregnancies (20-37 weeks) were examined with a 1.5 Tesla unit. Mean SIs for lungs, liver, and gastric fluid were assessed on six different sequences, and SIRs of lung/liver (LLSIR) and lung/gastric fluid (LGSIR) were correlated with gestational age for each sequence. To evaluate the feasibility of SIRs in the prediction of the state of the lung maturity, accuracy of the predicted SIRs (D*) was measured by calculating relative residuals (D*-D)/D for each sequence. LLSIRs showed significant changes in every sequence (p<0.05), while LGSIRs only on two sequences. Significant differences were shown for the mean of absolute residuals for both LLSIRs (p<0.001) and for LGSIRs (p=0.003). Relative residuals of LLSIRs were significantly smaller on T1-weighted sequence, whereas they were significantly higher for LGSIRs on FLAIR sequence. Fetal liver seems to be adequate reference for the investigation of lung maturation. T1-weighted sequence was the most accurate for the measurement of the lung SIs; thus, we propose to determine LLSIR on T1-weighted sequence when evaluating lung development. (orig.)

  3. MRI investigation of normal fetal lung maturation using signal intensities on different imaging sequences

    Energy Technology Data Exchange (ETDEWEB)

    Balassy, Csilla; Kasprian, Gregor; Weber, Michael; Hoermann, Marcus; Prayer, Daniela [Medical University of Vienna, Department of Radiology, Vienna (Austria); Brugger, Peter C. [Medical University of Vienna, Center of Anatomy and Cell Biology, Vienna (Austria); Csapo, Bence [Medical University of Vienna, Department of Obstetrics and Gyneocology, Vienna (Austria); Mittermayer, Christoph [Medical University of Vienna, Department of Pediatrics, Vienna (Austria)

    2007-03-15

    To purpose of this paper is to study the relation between normal lung maturation signal and changes in intensity ratios (SIR) and to determine which magnetic resonance imaging sequence provides the strongest correlation of normal lung SIs with gestational age. 126 normal singleton pregnancies (20-37 weeks) were examined with a 1.5 Tesla unit. Mean SIs for lungs, liver, and gastric fluid were assessed on six different sequences, and SIRs of lung/liver (LLSIR) and lung/gastric fluid (LGSIR) were correlated with gestational age for each sequence. To evaluate the feasibility of SIRs in the prediction of the state of the lung maturity, accuracy of the predicted SIRs (D*) was measured by calculating relative residuals (D*-D)/D for each sequence. LLSIRs showed significant changes in every sequence (p<0.05), while LGSIRs only on two sequences. Significant differences were shown for the mean of absolute residuals for both LLSIRs (p<0.001) and for LGSIRs (p=0.003). Relative residuals of LLSIRs were significantly smaller on T1-weighted sequence, whereas they were significantly higher for LGSIRs on FLAIR sequence. Fetal liver seems to be adequate reference for the investigation of lung maturation. T1-weighted sequence was the most accurate for the measurement of the lung SIs; thus, we propose to determine LLSIR on T1-weighted sequence when evaluating lung development. (orig.)

  4. RADIO AND MID-INFRARED PROPERTIES OF COMPACT STARBURSTS: DISTANCING THEMSELVES FROM THE MAIN SEQUENCE

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, E. J. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Stierwalt, S.; Armus, L. [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States); Condon, J. J. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States); Evans, A. S., E-mail: emurphy@obs.carnegiescience.edu [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States)

    2013-05-01

    We investigate the relationship between 8.44 GHz brightness temperatures and 1.4 to 8.44 GHz radio spectral indices with 6.2 {mu}m polycyclic aromatic hydrocarbon (PAH) emission and 9.7 {mu}m silicate absorption features for a sample of 36 local luminous and ultraluminous infrared galaxies. We find that galaxies having small 6.2 {mu}m PAH equivalent widths (EQWs), which signal the presence of weak PAH emission and/or an excess of very hot dust, also have flat spectral indices. The three active galactic nuclei (AGN) identified through their excessively large 8.44 GHz brightness temperatures are also identified as AGN via their small 6.2 {mu}m PAH EQWs. We also find that the flattening of the radio spectrum increases with increasing silicate optical depth, 8.44 GHz brightness temperature, and decreasing size of the radio source even after removing potential AGN, supporting the idea that compact starbursts show spectral flattening as the result of increased free-free absorption. These correlations additionally suggest that the dust obscuration in these galaxies must largely be coming from the vicinity of the compact starburst itself, and is not distributed throughout the (foreground) disk of the galaxy. Finally, we investigate the location of these infrared-bright systems relative to the main sequence (star formation rate versus stellar mass) of star-forming galaxies in the local universe. We find that the radio spectral indices of galaxies flatten with increasing distance above the main sequence, or in other words, with increasing specific star formation rate. This indicates that galaxies located above the main sequence, having high specific star formation rates, are typically compact starbursts hosting deeply embedded star formation that becomes more optically thick in the radio and infrared with increased distance above the main sequence.

  5. On the mass-spectrum relation for the main sequence stars

    International Nuclear Information System (INIS)

    Svechnikov, M.A.; Tajdakova, T.A.

    1984-01-01

    From 240 main-sequence stars with well-determined masses, a new mass-spectrum relation is obtained, which differs appreciably in certain intervals of spectral types from the mass-spectrum relations of Allen and Trimble. The accuracy of mass determination for the components of eclipsing binary systems of different types from their spectra given in the General Catalogue of Variable Stars (3rd edition) and in its supplements is evaluated

  6. Possible evidence for metal accretion onto the surfaces of metal-poor main-sequence stars

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Kohei; Yoshii, Yuzuru [Institute of Astronomy, School of Science, University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Beers, Timothy C. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Carollo, Daniela [Department of Physics and Astronomy, Macquarie University, Sydney, 2109 NSW (Australia); Lee, Young Sun, E-mail: khattori@ioa.s.u-tokyo.ac.jp [Department of Astronomy, New Mexico State University, Las Cruces, NM 88003 (United States)

    2014-04-01

    The entire evolution of the Milky Way, including its mass-assembly and star-formation history, is imprinted onto the chemo-dynamical distribution function of its member stars, f(x, v, [X/H]), in the multi-dimensional phase space spanned by position, velocity, and elemental abundance ratios. In particular, the chemo-dynamical distribution functions for low-mass stars (e.g., G- or K-type dwarfs) are precious tracers of the earliest stages of the Milky Way's formation, since their main-sequence lifetimes approach or exceed the age of the universe. A basic tenet of essentially all previous analyses is that the stellar metallicity, usually parameterized as [Fe/H], is conserved over time for main-sequence stars (at least those that have not been polluted due to mass transfer from binary companions). If this holds true, any correlations between metallicity and kinematics for long-lived main-sequence stars of different masses, effective temperatures, or spectral types must strictly be the same, since they reflect the same mass-assembly and star-formation histories. By analyzing a sample of nearby metal-poor halo and thick-disk stars on the main sequence, taken from Data Release 8 of the Sloan Digital Sky Survey, we find that the median metallicity of G-type dwarfs is systematically higher (by about 0.2 dex) than that of K-type dwarfs having the same median rotational velocity about the Galactic center. If it can be confirmed, this finding may invalidate the long-accepted assumption that the atmospheric metallicities of long-lived stars are conserved over time.

  7. Carbon, nitrogen, and oxygen abundances in main-sequence stars. II. 20 F and G stars

    International Nuclear Information System (INIS)

    Clegg, R.E.S.; Lambert, D.L.; Tomkin, J.

    1981-01-01

    High-resolution Reticon spectra of red and near-infrared C I, N I, and O I lines have been analyzed to determine C, N, and O abundances in a sample of 20 F and G main-sequence stars. Their iron abundances, which have been determined from analysis of additional Reticon spectra of red Fe I lines, cover the range -0.9< or =[Fe/H]< or =+0.4. Sulfur abundances have also been obtained

  8. Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123

    DEFF Research Database (Denmark)

    Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto

    2017-01-01

    A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (T......-eff = 7600 K, log g = 4.2, xi = 3.1 kms(-1) and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe...

  9. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    Energy Technology Data Exchange (ETDEWEB)

    Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

    2009-08-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  10. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    International Nuclear Information System (INIS)

    Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

    2009-01-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  11. Discovery of three x-ray luminous pre-main-sequence stars

    International Nuclear Information System (INIS)

    Feigelson, E.D.; Kriss, G.A.

    1981-01-01

    Three X-ray sources found serendipitously in Einstein images of the Taurus-Auriga cloud complex were observed at the McGraw-Hill Observatory and are found to be associated with approx.12 mag stars with weak Hα emission. The stars lie on the edges of dark clouds and are spectroscopically similar to the least active emission-line pre-main-sequence stars. Although they lie well above the ZAMS in the H-R diagram, they do not exhibit ultraviolet excess, strong optical variability, or evidence for mass outflow/inflow characteristics of the more active T Tauri stars. Their only unusual property is high X-ray luminosity (approx.10 30 ergs s1). It is suggested that the X-ray emission from pre-main-sequence stars is not closely linked to the conditions giving rise to their unusual spectroscopic properties. The emission may instead represent an enhanced form of the coronal activity producing X-rays observed in late-type main-sequence stars

  12. Binary pulsar PSR 1718-19 contains a stripped main-sequence turn-off star

    International Nuclear Information System (INIS)

    Zwitter, T.

    1993-05-01

    Lyne et al. (1993) have recently announced the discovery of a 1-second globular cluster pulsar, 1718-19, in a 6.2-hour binary system which is embedded in a cloud of material originating from the companion star. However the incident flux of the pulsar's radiation on the companion is too low to ablate it and a main sequence companion is too small to fill its Roche lobe. Here I argue that the companion is a stripped turn-off star of 0.2-0.4 solar masses (M sun ) and with approx. 0.1M sun helium core. It has approx. 1.8-times larger radius than a main sequence star of equal mass. Its position in the Hertzsprung-Russell diagram overlaps that of a ∼ 0.65M sun main-sequence star. The evolutionary state of the companion and the highly magnetized slowly rotating neutron star place the system on the verge of the low mass X-ray binary phase. (author). 19 refs, 2 figs

  13. The V Band Empirical Mass-Luminosity Relation for Main Sequence Stars

    Science.gov (United States)

    Xia, F.; Fu, Y. N.

    2010-01-01

    Stellar mass is an indispensable parameter in the studies of stellar physics and stellar dynamics. On the one hand, the most reliable way to determine the stellar dynamical mass is via orbital determination of binaries. On the other hand, however, most stellar masses have to be estimated by using the mass-luminosity relation (MLR). Therefore, it is important to obtain the empirical MLR through fitting the data of stellar dynamical mass and luminosity. The effect of metallicity can make this relation disperse in the V-band, but studies show that this is mainly limited to the case when the stellar mass is less than 0.6M⊙. Recently, many relevant data have been accumulated for main sequence stars with larger mass, which make it possible to significantly improve the corresponding MLR. Using a fitting method which can reasonably assign weight to the observational data including two quantities with different dimensions, we obtain a V-band MLR based on the dynamical masses and luminosities of 203 main sequence stars. Compared with the previous work, the improved MLR is statistically significant, and the relative error of mass estimation reaches about 5%. Therefore, our MLR is useful not only in studies of statistical nature, but also in studies of concrete stellar systems, such as the long-term dynamical study and the short-term positioning study of a specific multiple star system.

  14. The V-band Empirical Mass-luminosity Relation for Main Sequence Stars

    Science.gov (United States)

    Xia, Fang; Fu, Yan-Ning

    2010-07-01

    Stellar mass is an indispensable parameter in the studies of stellar physics and stellar dynamics. On the one hand, the most reliable way to determine the stellar dynamical mass is via orbital determinations of binaries. On the other hand, however, most stellar masses have to be estimated by using the mass luminosity relation (MLR). Therefore, it is important to obtain the empirical MLR through fitting the data of stellar dynamical mass and luminosity. The effect of metallicity can make this relation disperse in the V-band, but studies show that this is mainly limited to the case when the stellar mass is less than 0.6M⊙ Recently, many relevant data have been accumulated for main sequence stars with larger masses, which make it possible to significantly improve the corresponding MLR. Using a fitting method which can reasonably assign weights to the observational data including two quantities with different dimensions, we obtain a V-band MLR based on the dynamical masses and luminosities of 203 main sequence stars. In comparison with the previous work, the improved MLR is statistically significant, and the relative error of mass estimation reaches about 5%. Therefore, our MLR is useful not only in the studies of statistical nature, but also in the studies of concrete stellar systems, such as the long-term dynamical study and the short-term positioning study of a specific multiple star system.

  15. BVRI main-sequence photometry of the globular cluster M4

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    We present BV and RI photographic photometry of 1421 and 189 stars, respectively, in the intermediate metallicity globular cluster M4 (NGC 6121). This investigation includes the first results of RI main-sequence photometry of a globular cluster. The use of longer wavelengths and longer color baselines provides the potential of improved isochrone fittings and underscores the urgent need for calculations of RI synthetic isochrones to be compared with observations. The Pickering-Racine wedge was used with the ESO 3.6 m telescope, the Las Campanas 2.5 m du Pont telescope, and the CTIO 1 m Yale telescope to extend the photoelectric limit from Vroughly-equal16.1 to Vroughly-equal19.1. We have determined the position of the main-sequence turnoff to lie at V = 16.6 +- 0.2 (m.e.) and B-V = 0.80 +- 0.03 (m.e.). A comparison of our BV observations with the CCD data of Richer and Fahlman shows excellent agreement: the two fifucial main sequences agree at all points to within 0.025 mag and, on average, to 0.013 mag. For the cluster we derive a distance modulus (m-M)/sub V/ = 12.52 +- 0.2 and reddening E(B-V) = 0.44 +- 0.03, results which confirm that at a distance of 2 kpc, M4 is the closest globular clusters to the Sun. Using the isochrones of VandenBerg, we deduce an age 13 +- 2 Gyr. As noted in several other investigations, there is a striking deficiency of stars in certain parts of the color-magnitude diagram; in M4 we find a pronounced gap over approx.0.6 mag at the base of the subgiant branch

  16. Discovery and characterization of 3000+ main-sequence binaries from APOGEE spectra

    Science.gov (United States)

    El-Badry, Kareem; Ting, Yuan-Sen; Rix, Hans-Walter; Quataert, Eliot; Weisz, Daniel R.; Cargile, Phillip; Conroy, Charlie; Hogg, David W.; Bergemann, Maria; Liu, Chao

    2018-05-01

    We develop a data-driven spectral model for identifying and characterizing spatially unresolved multiple-star systems and apply it to APOGEE DR13 spectra of main-sequence stars. Binaries and triples are identified as targets whose spectra can be significantly better fit by a superposition of two or three model spectra, drawn from the same isochrone, than any single-star model. From an initial sample of ˜20 000 main-sequence targets, we identify ˜2500 binaries in which both the primary and secondary stars contribute detectably to the spectrum, simultaneously fitting for the velocities and stellar parameters of both components. We additionally identify and fit ˜200 triple systems, as well as ˜700 velocity-variable systems in which the secondary does not contribute detectably to the spectrum. Our model simplifies the process of simultaneously fitting single- or multi-epoch spectra with composite models and does not depend on a velocity offset between the two components of a binary, making it sensitive to traditionally undetectable systems with periods of hundreds or thousands of years. In agreement with conventional expectations, almost all the spectrally identified binaries with measured parallaxes fall above the main sequence in the colour-magnitude diagram. We find excellent agreement between spectrally and dynamically inferred mass ratios for the ˜600 binaries in which a dynamical mass ratio can be measured from multi-epoch radial velocities. We obtain full orbital solutions for 64 systems, including 14 close binaries within hierarchical triples. We make available catalogues of stellar parameters, abundances, mass ratios, and orbital parameters.

  17. Systematic main sequence photometry of globular cluster stars for age determination

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    The individual photometric study of the coeval stars in globular clusters presents one of the best observational tests of the stellar evolution theory. Our own globular cluster system provides fundamental clues to the dynamical and chemical evolutionary history of the galaxy, and the study of their ages give a lower limit to the age of the galaxy as well as to that of the universe. The authors have undertaken a systematic research program, and discuss the ages deduced by fitting main sequence photometry to theoretical isochrones of six galactic globular clusters: M4, M22, M30, NGC 288, NGC 3201 and NGC 6397. (Auth.)

  18. The SFR-M∗ main sequence archetypal star-formation history and analytical models

    Science.gov (United States)

    Ciesla, L.; Elbaz, D.; Fensch, J.

    2017-12-01

    The star-formation history (SFH) of galaxies is a key assumption to derive their physical properties and can lead to strong biases. In this work, we derive the SFH of main sequence (MS) galaxies and show how the peak SFH of a galaxy depends on its seed mass at, for example, z = 5. This seed mass reflects the galaxy's underlying dark matter (DM) halo environment. We show that, following the MS, galaxies undergo a drastic slow down of their stellar mass growth after reaching the peak of their SFH. According to abundance matching, these masses correspond to hot and massive DM halos which state could result in less efficient gas inflows on the galaxies and thus could be the origin of limited stellar mass growth. As a result, we show that galaxies, still on the MS, can enter the passive region of the UVJ diagram while still forming stars. The best fit to the MS SFH is provided by a right skew peak function for which we provide parameters depending on the seed mass of the galaxy. The ability of the classical analytical SFHs to retrieve the star-formation rate (SFR) of galaxies from spectral energy distribution (SED) fitting is studied. Due to mathematical limitations, the exponentially declining and delayed SFH struggle to model high SFR, which starts to be problematic at z > 2. The exponentially rising and log-normal SFHs exhibit the opposite behavior with the ability to reach very high SFR, and thus model starburst galaxies, but they are not able to model low values such as those expected at low redshift for massive galaxies. By simulating galaxies SED from the MS SFH, we show that these four analytical forms recover the SFR of MS galaxies with an error dependent on the model and the redshift. They are, however, sensitive enough to probe small variations of SFR within the MS, with an error ranging from 5 to 40% depending on the SFH assumption and redshift; but all the four fail to recover the SFR of rapidly quenched galaxies. However, these SFHs lead to an artificial

  19. Asteroseismic measurement of surface-to-core rotation in a main-sequence star*

    Directory of Open Access Journals (Sweden)

    Kurtz Donald W.

    2015-01-01

    Full Text Available We have discovered rotationally split core g-mode triplets and surface p-mode triplets and quintuplets in a terminal age main-sequence A star, KIC 11145123, that shows both δ Sct p-mode pulsations and γ Dor g-mode pulsations. This gives the first robust determination of the rotation of the deep core and surface of a main-sequence star, essentially model-independently. We find its rotation to be nearly uniform with a period near 100 d, but we show with high confidence that the surface rotates slightly faster than the core. A strong angular momentum transfer mechanism must be operating to produce the nearly rigid rotation, and a mechanism other than viscosity must be operating to produce a more rapidly rotating surface than core. Our asteroseismic result, along with previous asteroseismic constraints on internal rotation in some B stars, and measurements of internal rotation in some subgiant, giant and white dwarf stars, has made angular momentum transport in stars throughout their lifetimes an observational science.

  20. ABSOLUTE PROPERTIES OF THE PRE-MAIN-SEQUENCE ECLIPSING BINARY STAR NP PERSEI

    Energy Technology Data Exchange (ETDEWEB)

    Lacy, Claud H. Sandberg [Physics Department, University of Arkansas, Fayetteville, AR 72701 (United States); Fekel, Francis C.; Muterspaugh, Matthew W. [Center of Excellence in Information Systems, Tennessee State University, Nashville, TN 37209 (United States); Pavlovski, Krešimir [Department of Physics, Faculty of Science, University of Zagreb, Bijenička cesta 32, 10000 Zagreb (Croatia); Torres, Guillermo, E-mail: clacy@uark.edu, E-mail: fekel@evans.tsuniv.edu, E-mail: pavlovski@phy.hr, E-mail: gtorres@cfa.harvard.edu, E-mail: matthew1@coe.tsuniv.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2016-07-01

    NP Per is a well-detached, 2.2 day eclipsing binary whose components are both pre-main-sequence stars that are still contracting toward the main-sequence phase of evolution. We report extensive photometric and spectroscopic observations with which we have determined their properties accurately. Their surface temperatures are quite different: 6420 ± 90 K for the larger F5 primary star and 4540 ± 160 K for the smaller K5e star. Their masses and radii are 1.3207 ± 0.0087 solar masses and 1.372 ± 0.013 solar radii for the primary, and 1.0456 ± 0.0046 solar masses and 1.229 ± 0.013 solar radii for the secondary. The orbital period is variable over long periods of time. A comparison of the observations with current stellar evolution models from MESA indicates that the stars cannot be fit at a single age: the secondary appears significantly younger than the primary. If the stars are assumed to be coeval and to have the age of the primary (17 Myr), then the secondary is larger and cooler than predicted by current models. The H α spectral line of the secondary component is completely filled by, presumably, chromospheric emission due to a magnetic activity cycle.

  1. Impacts of WIMP dark matter upon stellar evolution: main-sequence stars

    CERN Document Server

    Scott, Pat; Edsjo, Joakim

    2008-01-01

    The presence of large amounts of WIMP dark matter in stellar cores has been shown to have significant effects upon models of stellar evolution. We present a series of detailed grids of WIMP-influenced stellar models for main sequence stars, computed using the DarkStars code. We describe the changes in stellar structure and main sequence evolution which occur for masses ranging from 0.3 to 2.0 solar masses and metallicities from Z = 0.0003-0.02, as a function of the rate of energy injection by WIMPs. We then go on to show what rates of energy injection can be obtained using realistic orbital parameters for stars near supermassive black holes, including detailed considerations of dark matter halo velocity and density profiles. Capture and annihilation rates are strongly boosted when stars follow elliptical rather than circular orbits, causing WIMP annihilation to provide up to 100 times the energy of hydrogen fusion in stars at the Galactic centre.

  2. Characterizing Intermediate-Mass, Pre-Main-Sequence Stars via X-Ray Emision

    Science.gov (United States)

    Haze Nunez, Evan; Povich, Matthew Samuel; Binder, Breanna Arlene; Broos, Patrick; Townsley, Leisa K.

    2018-01-01

    The X-ray emission from intermediate-mass, pre-main-sequence stars (IMPS) can provide useful constraints on the ages of very young (${getting power from the gravitational contraction of the star. Main-sequence late-B and A-type stars are not expected to be strong X-ray emitters, because they lack the both strong winds of more massive stars and the magneto-coronal activity of lower-mass stars. There is, however, mounting evidence that IMPS are powerful intrinsic x-ray emitters during their convection-dominated early evolution, before the development and rapid growth of a radiation zone. We present our prime candidates for intrinsic, coronal X-ray emission from IMPS identified in the Chandra Carina Complex Project. The Carina massive star-forming complex is of special interest due to the wide variation of star formation stages within the region. Candidate IMPS were identified using infrared spectral energy distribution (SED) models. X-ray properties, including thermal plasma temperatures and absorption-corrected fluxes, were derived from XSPEC fits performed using absorption ($N_{H}$) constrained by the extinction values returned by the infrared SED fits. We find that IMPS have systematically higher X-ray luminosities compared to their lower-mass cousins, the TTauri stars.This work is supported by the National Science Foundation under grant CAREER-1454334 and by NASA through Chandra Award 18200040.

  3. Effects of main-sequence mass loss on the turnoff ages of globular clusters

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1989-01-01

    Willson, Bowen, and Struck-Marcell have proposed that globular cluster main-sequence turnoff ages can be reconciled with the lower ages of the Galaxy and universe deduced from other methods by incorporating an epoch of early main-sequence mass-loss by stars of spectral types A through early-F. The proposed mass loss is pulsation-driven, and facilitated by rapid rotation. This paper presents stellar evolution calculations of Pop. II (Z = 0.001) mass-losing stars of initial mass 0.8 to 1.6 M circle dot , with exponentially-decreasing mass loss rates of e-folding times 0.5 to 2.0 Gyr, evolving to a final mass of 0.7 M circle dot . The calculations indicate that a globular cluster with apparent turnoff age 18 Gyr could have an actual age as low as ∼12 Gyr. Observational implications that may help to verify the hypothesis, e.g. low C/N abundance ratios among red giants following first dredge-up, blue stragglers, red giant deficiencies, and signatures in cluster mass/luminosity functions, are also discussed.25 refs., 4 figs., 3 tabs

  4. Discovery of Extended Main-sequence Turnoffs in Four Young Massive Clusters in the Magellanic Clouds

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chengyuan [Department of Physics and Astronomy, Macquarie University, Sydney, NSW 2109 (Australia); De Grijs, Richard [Kavli Institute for Astronomy and Astrophysics and Department of Astronomy, Peking University, Yi He Yuan Lu 5, Hai Dian District, Beijing 100871 (China); Deng, Licai [Key Laboratory for Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Milone, Antonino P. [Research School of Astronomy and Astrophysics, Australian National University, Mt. Stromlo Observatory, Cotter Road, Weston, ACT 2611 (Australia)

    2017-08-01

    An increasing number of young massive clusters (YMCs) in the Magellanic Clouds have been found to exhibit bimodal or extended main sequences (MSs) in their color–magnitude diagrams (CMDs). These features are usually interpreted in terms of a coeval stellar population with different stellar rotational rates, where the blue and red MS stars are populated by non- (or slowly) and rapidly rotating stellar populations, respectively. However, some studies have shown that an age spread of several million years is required to reproduce the observed wide turnoff regions in some YMCs. Here we present the ultraviolet–visual CMDs of four Large and Small Magellanic Cloud YMCs, NGC 330, NGC 1805, NGC 1818, and NGC 2164, based on high-precision Hubble Space Telescope photometry. We show that they all exhibit extended main-sequence turnoffs (MSTOs). The importance of age spreads and stellar rotation in reproducing the observations is investigated. The observed extended MSTOs cannot be explained by stellar rotation alone. Adopting an age spread of 35–50 Myr can alleviate this difficulty. We conclude that stars in these clusters are characterized by ranges in both their ages and rotation properties, but the origin of the age spread in these clusters remains unknown.

  5. Hypercapnic normalization of BOLD fMRI: comparison across field strengths and pulse sequences

    DEFF Research Database (Denmark)

    Cohen, Eric R.; Rostrup, Egill; Sidaros, Karam

    2004-01-01

    to be more accurately localized and quantified based on changes in venous blood oxygenation alone. The normalized BOLD signal induced by the motor task was consistent across different magnetic fields and pulse sequences, and corresponded well with cerebral blood flow measurements. Our data suggest...... size, as well as experimental, such as pulse sequence and static magnetic field strength (B(0)). Thus, it is difficult to compare task-induced fMRI signals across subjects, field strengths, and pulse sequences. This problem can be overcome by normalizing the neural activity-induced BOLD fMRI response...... for global stimulation, subjects breathed a 5% CO(2) gas mixture. Under all conditions, voxels containing primarily large veins and those containing primarily active tissue (i.e., capillaries and small veins) showed distinguishable behavior after hypercapnic normalization. This allowed functional activity...

  6. Music as a mnemonic to learn gesture sequences in normal aging and Alzheimer’s disease

    OpenAIRE

    Aline eMoussard; Emmanuel eBigand; Emmanuel eBigand; Isabelle ePeretz; Isabelle ePeretz; Isabelle ePeretz; Sylvie eBelleville; Sylvie eBelleville

    2014-01-01

    Strong links between music and motor functions suggest that music could represent an interesting aid for motor learning. The present study aims for the first time to test the potential of music to assist in the learning of sequences of gestures in normal and pathological aging. Participants with mild Alzheimer's disease (AD) and healthy older adults (Controls) learned sequences of meaningless gestures that were either accompanied by music or a metronome. We also manipulated the learning proce...

  7. Music as a Mnemonic to Learn Gesture Sequences in Normal Aging and Alzheimer’s Disease

    OpenAIRE

    Moussard, Aline; Bigand, Emmanuel; Belleville, Sylvie; Peretz, Isabelle

    2014-01-01

    Strong links between music and motor functions suggest that music could represent an interesting aid for motor learning. The present study aims for the first time to test the potential of music to assist in the learning of sequences of gestures in normal and pathological aging. Participants with mild Alzheimer’s disease (AD) and healthy older adults (controls) learned sequences of meaningless gestures that were either accompanied by music or a metronome. We also manipulated the learning proce...

  8. The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Panda, Swayamtrupta; Czerny, Bożena [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland); Nicolaus Copernicus Astronomical Center, Polish Academy of Sciences, Warsaw (Poland); Wildy, Conor, E-mail: panda@cft.edu.pl [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland)

    2017-11-07

    Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992) used Principal Component Analysis (PCA), and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1) was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR) diagram (Sulentic et al., 2001). The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle) is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED). We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.

  9. The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence

    Directory of Open Access Journals (Sweden)

    Swayamtrupta Panda

    2017-11-01

    Full Text Available Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992 used Principal Component Analysis (PCA, and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1 was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR diagram (Sulentic et al., 2001. The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED. We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.

  10. A Population Study of Wide-Separation Brown Dwarf Companions to Main Sequence Stars

    Science.gov (United States)

    Smith, Jeffrey J.

    2005-01-01

    Increased interest in infrared astronomy has opened the frontier to study cooler objects that shed significant light on the formation of planetary systems. Brown dwarf research provides a wealth of information useful for sorting through a myriad of proposed formation theories. Our study combines observational data from 2MASS with rigorous computer simulations to estimate the true population of long-range (greater than 1000 AU) brown dwarf companions in the solar neighborhood (less than 25 pc from Earth). Expanding on Gizis et al. (2001), we have found the margin of error in previous estimates to be significantly underestimated after we included orbit eccentricity, longitude of pericenter, angle of inclination, field star density, and primary and secondary luminosities as parameters influencing the companion systems in observational studies. We apply our simulation results to current L- and T-dwarf catalogs to provide updated estimates on the frequency of wide-separation brown dwarf companions to main sequence stars.

  11. Effect of Generalized Uncertainty Principle on Main-Sequence Stars and White Dwarfs

    Directory of Open Access Journals (Sweden)

    Mohamed Moussa

    2015-01-01

    Full Text Available This paper addresses the effect of generalized uncertainty principle, emerged from different approaches of quantum gravity within Planck scale, on thermodynamic properties of photon, nonrelativistic ideal gases, and degenerate fermions. A modification in pressure, particle number, and energy density are calculated. Astrophysical objects such as main-sequence stars and white dwarfs are examined and discussed as an application. A modification in Lane-Emden equation due to a change in a polytropic relation caused by the presence of quantum gravity is investigated. The applicable range of quantum gravity parameters is estimated. The bounds in the perturbed parameters are relatively large but they may be considered reasonable values in the astrophysical regime.

  12. New radio detections of early-type pre-main-sequence stars

    Science.gov (United States)

    Skinner, Stephen L.; Brown, Alexander; Linsky, Jeffrey L.

    1990-01-01

    Results of VLA radio continuum observations of 13 early-type pre-main-sequence stars selected from the 1984 catalog of Finkenzeller and Mundt are presented. The stars HD 259431 and MWC 1080 were detected at 3.6 cm, while HD 200775 and TY CrA were detected at both 3.6 and 6 cm. The flux density of HD 200775 has a frequency dependence consistent with the behavior expected for free-free emission originating in a fully ionized wind. However, an observation in A configuration suggests that the source geometry may not be spherically symmetric. In contrast, the spectral index of TY CrA is negative with a flux behavior implying nonthermal emission. The physical mechanism responsible for the nonthermal emission has not yet been identified, although gyrosynchrotron and synchrotron processes cannot be ruled out.

  13. THE DISCOVERY OF SOLAR-LIKE ACTIVITY CYCLES BEYOND THE END OF THE MAIN SEQUENCE?

    Energy Technology Data Exchange (ETDEWEB)

    Route, Matthew, E-mail: mroute@purdue.edu [Research Computing, Information Technology at Purdue, Purdue University, 155 S. Grant Street, West Lafayette, IN 47907 (United States)

    2016-10-20

    The long-term magnetic behavior of objects near the cooler end of the stellar main sequence is poorly understood. Most theoretical work on the generation of magnetism in these ultracool dwarfs (spectral type ≥M7 stars and brown dwarfs) suggests that their magnetic fields should not change in strength and direction. Using polarized radio emission measurements of their magnetic field orientations, I demonstrate that these cool, low-mass, fully convective objects appear to undergo magnetic polarity reversals analogous to those that occur on the Sun. This powerful new technique potentially indicates that the patterns of magnetic activity displayed by the Sun continue to exist, despite the fully convective interiors of these objects, in contravention of several leading theories of the generation of magnetic fields by internal dynamos.

  14. ON THE MULTIPLICITY OF THE ZERO-AGE MAIN-SEQUENCE O STAR HERSCHEL 36

    International Nuclear Information System (INIS)

    Arias, Julia I.; Barba, Rodolfo H.; Gamen, Roberto C.; Morrell, Nidia I.; Apellaniz, Jesus MaIz; Alfaro, Emilio J.; Sota, Alfredo; Walborn, Nolan R.; Bidin, Christian Moni

    2010-01-01

    We present the analysis of high-resolution optical spectroscopic observations of the zero-age main-sequence O star Herschel 36 spanning six years. This star is definitely a multiple system, with at least three components detected in its spectrum. Based on our radial-velocity (RV) study, we propose a picture of a close massive binary and a more distant companion, most probably in wide orbit about each other. The orbital solution for the binary, whose components we identify as O9 V and B0.5 V, is characterized by a period of 1.5415 ± 0.0006 days. With a spectral type O7.5 V, the third body is the most luminous component of the system and also presents RV variations with a period close to 498 days. Some possible hypotheses to explain the variability are briefly addressed and further observations are suggested.

  15. New radio detections of early-type pre-main-sequence stars

    International Nuclear Information System (INIS)

    Skinner, S.L.; Brown, A.; Linsky, J.L.

    1990-01-01

    Results of VLA radio continuum observations of 13 early-type pre-main-sequence stars selected from the 1984 catalog of Finkenzeller and Mundt are presented. The stars HD 259431 and MWC 1080 were detected at 3.6 cm, while HD 200775 and TY CrA were detected at both 3.6 and 6 cm. The flux density of HD 200775 has a frequency dependence consistent with the behavior expected for free-free emission originating in a fully ionized wind. However, an observation in A configuration suggests that the source geometry may not be spherically symmetric. In contrast, the spectral index of TY CrA is negative with a flux behavior implying nonthermal emission. The physical mechanism responsible for the nonthermal emission has not yet been identified, although gyrosynchrotron and synchrotron processes cannot be ruled out. 32 refs

  16. Making Sense of Atmospheric Models and Fundamental Stellar Properties at the Bottom of the Main Sequence

    Science.gov (United States)

    Dieterich, Sergio; Henry, Todd; Jao, W.-C.; Washington, Robert; Silverstein, Michele; Winters, J.; RECONS

    2018-01-01

    We present a detailed comparison of atmospheric model predictions and photometric observations for late M and L dwarfs. We discuss which wavelength regions are best for determining the fundamental properties of these cool stellar and substellar atmospheres and use this analysis to refine the HR diagram for the hydrogen burning limit first presented in 2014. We also add several new objects to the HR diagram and find little qualitative difference in the HR diagram's overall morphology when compared to our 2014 results. The L2 dwarf 2MASS 0523-1403 remains the smallest hydrogen burning star for which we calculated a radius, thus likely indicating the end of the stellar main sequence. This work is supported by the NSF Astronomy and Astrophysics Postdoctoral Fellowship program through grant AST-1400680.

  17. Globules, dark clouds, and low mass pre-main sequence stars

    International Nuclear Information System (INIS)

    Hyland, A.R.

    1981-01-01

    The current observational and theoretical literature on Bok globules and their relationship to star formation is reviewed. Recent observations of globules at optical, infrared, and far infrared wavelengths are shown to provide important constraints on their structure and evolutionary status, and the suggestion that many globules are gravitationally unstable is seriously questioned. Dark clouds associated with T associations are well-known sites of recent and continuing star formation. In recent years molecular observations and far infrared surveys have provided maps of such regions from which possible sites of star formation may be identified. Optical (Hα) and near infrared surveys have enabled a clear identification of pre-main sequence (PMS) objects within the clouds. Methods of distinguishing these from background objects and the nature of their infrared excesses are examined in the light of recent observations in the near and far infrared. The perennial question as to the existence of anomalous reddening within dark clouds is also investigated. (Auth.)

  18. New Insights into the Formation of the Blue Main Sequence in NGC 1850

    Science.gov (United States)

    Yang, Yujiao; Li, Chengyuan; Deng, Licai; de Grijs, Richard; Milone, Antonino P.

    2018-06-01

    Recent discoveries of bimodal main sequences (MSs) associated with young clusters (with ages ≲1 Gyr) in the Magellanic Clouds have drawn a lot of attention. One of the prevailing formation scenarios attributes these split MSs to a bimodal distribution in stellar rotation rates, with most stars belonging to a rapidly rotating population. In this scenario, only a small fraction of stars populating a secondary blue sequence are slowly or non-rotating stars. Here, we focus on the blue MS in the young cluster NGC 1850. We compare the cumulative number fraction of the observed blue-MS stars to that of the high-mass-ratio binary systems at different radii. The cumulative distributions of both populations exhibit a clear anti-correlation, characterized by a highly significant Pearson coefficient of ‑0.97. Our observations are consistent with the possibility that blue-MS stars are low-mass-ratio binaries, and therefore their dynamical disruption is still ongoing. High-mass-ratio binaries, on the other hand, are more centrally concentrated.

  19. Hubble Tarantula Treasury Project - VI. Identification of Pre-Main-Sequence Stars using Machine Learning techniques

    Science.gov (United States)

    Ksoll, Victor F.; Gouliermis, Dimitrios A.; Klessen, Ralf S.; Grebel, Eva K.; Sabbi, Elena; Anderson, Jay; Lennon, Daniel J.; Cignoni, Michele; de Marchi, Guido; Smith, Linda J.; Tosi, Monica; van der Marel, Roeland P.

    2018-05-01

    The Hubble Tarantula Treasury Project (HTTP) has provided an unprecedented photometric coverage of the entire star-burst region of 30 Doradus down to the half Solar mass limit. We use the deep stellar catalogue of HTTP to identify all the pre-main-sequence (PMS) stars of the region, i.e., stars that have not started their lives on the main-sequence yet. The photometric distinction of these stars from the more evolved populations is not a trivial task due to several factors that alter their colour-magnitude diagram positions. The identification of PMS stars requires, thus, sophisticated statistical methods. We employ Machine Learning Classification techniques on the HTTP survey of more than 800,000 sources to identify the PMS stellar content of the observed field. Our methodology consists of 1) carefully selecting the most probable low-mass PMS stellar population of the star-forming cluster NGC2070, 2) using this sample to train classification algorithms to build a predictive model for PMS stars, and 3) applying this model in order to identify the most probable PMS content across the entire Tarantula Nebula. We employ Decision Tree, Random Forest and Support Vector Machine classifiers to categorise the stars as PMS and Non-PMS. The Random Forest and Support Vector Machine provided the most accurate models, predicting about 20,000 sources with a candidateship probability higher than 50 percent, and almost 10,000 PMS candidates with a probability higher than 95 percent. This is the richest and most accurate photometric catalogue of extragalactic PMS candidates across the extent of a whole star-forming complex.

  20. Chemically Dissected Rotation Curves of the Galactic Bulge from Main-sequence Proper Motions

    Science.gov (United States)

    Clarkson, William I.; Calamida, Annalisa; Sahu, Kailash C.; Brown, Thomas M.; Gennaro, Mario; Avila, Roberto J.; Valenti, Jeff; Debattista, Victor P.; Rich, R. Michael; Minniti, Dante; Zoccali, Manuela; Aufdemberge, Emily R.

    2018-05-01

    We report results from an exploratory study implementing a new probe of Galactic evolution using archival Hubble Space Telescope imaging observations. Precise proper motions are combined with photometric relative metallicity and temperature indices, to produce the proper-motion rotation curves of the Galactic bulge separately for metal-poor and metal-rich main-sequence samples. This provides a “pencil-beam” complement to large-scale wide-field surveys, which to date have focused on the more traditional bright giant branch tracers. We find strong evidence that the Galactic bulge rotation curves drawn from “metal-rich” and “metal-poor” samples are indeed discrepant. The “metal-rich” sample shows greater rotation amplitude and a steeper gradient against line-of-sight distance, as well as possibly a stronger central concentration along the line of sight. This may represent a new detection of differing orbital anisotropy between metal-rich and metal-poor bulge objects. We also investigate selection effects that would be implied for the longitudinal proper-motion cut often used to isolate a “pure-bulge” sample. Extensive investigation of synthetic stellar populations suggests that instrumental and observational artifacts are unlikely to account for the observed rotation curve differences. Thus, proper-motion-based rotation curves can be used to probe chemodynamical correlations for main-sequence tracer stars, which are orders of magnitude more numerous in the Galactic bulge than the bright giant branch tracers. We discuss briefly the prospect of using this new tool to constrain detailed models of Galactic formation and evolution. Based on observations made with the NASA/ESA Hubble Space Telescope and obtained from the data archive at the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555.

  1. EXTENDED MAGNETOSPHERES IN PRE-MAIN-SEQUENCE EVOLUTION: FROM T TAURI STARS TO THE BROWN DWARF LIMIT

    Energy Technology Data Exchange (ETDEWEB)

    Gomez de Castro, Ana I.; Marcos-Arenal, Pablo [Grupo de Investigacion Complutense AEGORA, Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2012-04-20

    Low-mass pre-main-sequence stars, i.e., T Tauri stars (TTSs), strongly radiate at high energies, from X-rays to the ultraviolet (UV). This excess radiation with respect to main-sequence cool stars (MSCSs) is associated with the accretion process, i.e., it is produced in the extended magnetospheres, in the accretion shocks on the stellar surface, and in the outflows. Although evidence of accretion shocks and outflow contribution to the high-energy excess have been recently addressed, there is not an updated revision of the magnetospheric contribution. This article addresses this issue. The UV observations of the TTSs in the well-known Taurus region have been analyzed together with the XMM-Newton observations compiled in the XEST survey. For the first time the high sensitivity of the Hubble Space Telescope UV instrumentation has allowed measurement of the UV line fluxes of TTSs to M8 type. UV- and X-ray-normalized fluxes have been determined to study the extent and properties of the TTS magnetospheres as a class. They have been compared with the atmospheres of the MSCSs. The main results from this analysis are (1) the normalized fluxes of all the tracers are correlated; this correlation is independent of the broad mass range and the hardness of the X-ray radiation field; (2) the TTS correlations are different than the MSCS correlations; (3) there is a very significant excess emission in O I in the TTSs compared with MSCSs that seems to be caused by recombination radiation from the disk atmosphere after photoionization by extreme UV radiation; the Fe II/Mg II recombination continuum has also been detected in several TTSs and most prominently in AA Tau; and (4) the normalized flux of the UV tracers anticorrelates with the strength of the X-ray flux, i.e., the stronger the X-ray surface flux is, the weaker the observed UV flux. This last behavior is counterintuitive within the framework of stellar dynamo theory and suggests that UV emission can be produced in the

  2. INTRINSIC COLORS, TEMPERATURES, AND BOLOMETRIC CORRECTIONS OF PRE-MAIN-SEQUENCE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Pecaut, Mark J.; Mamajek, Eric E. [University of Rochester, Department of Physics and Astronomy, Rochester, NY 14627-0171 (United States)

    2013-09-01

    We present an analysis of the intrinsic colors and temperatures of 5-30 Myr old pre-main-sequence (pre-MS) stars using the F0- through M9-type members of nearby, negligibly reddened groups: the η Cha cluster, the TW Hydra Association, the β Pic Moving Group, and the Tucana-Horologium Association. To check the consistency of spectral types from the literature, we estimate new spectral types for 52 nearby pre-MS stars with spectral types F3 through M4 using optical spectra taken with the SMARTS 1.5 m telescope. Combining these new types with published spectral types and photometry from the literature (Johnson-Cousins BVI{sub C} , 2MASS JHK{sub S} and WISE W1, W2, W3, and W4), we derive a new empirical spectral type-color sequence for 5-30 Myr old pre-MS stars. Colors for pre-MS stars match dwarf colors for some spectral types and colors, but for other spectral types and colors, deviations can exceed 0.3 mag. We estimate effective temperatures (T {sub eff}) and bolometric corrections (BCs) for our pre-MS star sample through comparing their photometry to synthetic photometry generated using the BT-Settl grid of model atmosphere spectra. We derive a new T {sub eff} and BC scale for pre-MS stars, which should be a more appropriate match for T Tauri stars than often-adopted dwarf star scales. While our new T {sub eff} scale for pre-MS stars is within ≅100 K of dwarfs at a given spectral type for stars sequence for O9V-M9V MS stars based on an extensive literature survey, (2) a revised Q-method relation for dereddening UBV photometry of OB-type stars, and (3) introduce two candidate spectral standard stars as representatives of spectral types K8V and K9V.

  3. Iterative normalization technique for reference sequence generation for zero-tail discrete fourier transform spread orthogonal frequency division multiplexing

    DEFF Research Database (Denmark)

    2017-01-01

    , and performing an iterative manipulation of the input sequence. The performing of the iterative manipulation of the input sequence may include, for example: computing frequency domain response of the sequence, normalizing elements of the computed frequency domain sequence to unitary power while maintaining phase...

  4. Galactic chemical evolution with main-sequence mass loss and the distribution of F and G dwarfs

    International Nuclear Information System (INIS)

    Guzik, J.A.; Struck-Marcell, C.

    1988-01-01

    Simple closed galactic chemical-evolution models incorporating early main-sequence stellar mass loss have been developed for disk ages of 5, 10, and 15 Gyr. Relative to models without stellar mass loss, the models are shown to produce a 30-60 percent increase in the present mass ratio of dwarfs to dwarfs plus remnants, and a 200-250 percent increase in the total mass of late F dwarfs remaining on the main sequence at the current disk age. For present disk ages 5 and 10 Gyr, the total mass of mid-F dwarfs remaining on the main sequence is also shown to increase by 90-120 percent. It is concluded that models with main-sequence mass loss have a slightly reduced gas metallicity and slightly increased gas fraction midway through the evolution. 30 references

  5. Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123

    Science.gov (United States)

    Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto; Murphy, Simon J.; Takata, Masao; Saio, Hideyuki; Sekii, Takashi

    2017-10-01

    A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (Teff = 7600 K, log g = 4.2, ξ = 3.1 km s-1 and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe/H] = -0.71 ± 0.11 dex and a high radial velocity of -135.4 ± 0.2 km s-1. These are remarkable among late-A stars. Our best asteroseismic models with this low [Fe/H] have slightly high helium abundance and low masses of 1.4 M⊙. All of these results strongly suggest that KIC 11145123 is a Population II blue straggler; (2) the projected rotation velocity confirms the asteroseismically predicted slow rotation of the star; (3) comparisons of abundance patterns between KIC 11145123 and Am, Ap, and blue stragglers show that KIC 11145123 is neither an Am star nor an Ap star, but has abundances consistent with a blue straggler. We conclude that the remarkably long 100-d rotation period of this star is a consequence of it being a blue straggler, but both pathways for the formation of blue stragglers - merger and mass loss in a binary system - pose difficulties for our understanding of the exceedingly slow rotation. In particular, we show that there is no evidence of any secondary companion star, and we put stringent limits on the possible mass of any such purported companion through the phase modulation technique.

  6. WHITE-DWARF-MAIN-SEQUENCE BINARIES IDENTIFIED FROM THE LAMOST PILOT SURVEY

    International Nuclear Information System (INIS)

    Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang

    2013-01-01

    We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample

  7. Verifying reddening and extinction for Gaia DR1 TGAS main sequence stars

    Science.gov (United States)

    Gontcharov, George A.; Mosenkov, Aleksandr V.

    2017-12-01

    We compare eight sources of reddening and extinction estimates for approximately 60 000 Gaia DR1 Tycho-Gaia Astrometric Solution (TGAS) main sequence stars younger than 3 Gyr with a relative error of the Gaia parallax less than 0.1. For the majority of the stars, the best 2D dust emission-based reddening maps show considerable differences between the reddening to infinity and the one calculated to the stellar distance using the barometric law of the dust distribution. This proves that the majority of the TGAS stars are embedded in the Galactic dust layer and a proper 3D treatment of the reddening/extinction is required to calculate their dereddened colours and absolute magnitudes reliably. Sources with 3D estimates of reddening are tested in their ability to put the stars among the PARSEC and MIST theoretical isochrones in the Hertzsprung-Russell diagram based on the precise Gaia, Tycho-2, 2MASS and WISE photometry. Only the reddening/extinction estimates by Arenou et al. and Gontcharov, being appropriate for nearby stars within 280 pc, provide both the minimal number of outliers bluer than any reasonable isochrone and the correct number of stars younger than 3 Gyr in agreement with the Besançon Galaxy model.

  8. Evolution Models of Helium White Dwarf–Main-sequence Star Merger Remnants

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xianfei; Bi, Shaolan [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Hall, Philip D.; Jeffery, C. Simon, E-mail: zxf@bnu.edu.cn [Armagh Observatory, College Hill, Armagh BT61 9DG (United Kingdom)

    2017-02-01

    It is predicted that orbital decay by gravitational-wave radiation and tidal interaction will cause some close binary stars to merge within a Hubble time. The merger of a helium-core white dwarf with a main-sequence (MS) star can produce a red giant branch star that has a low-mass hydrogen envelope when helium is ignited and thus become a hot subdwarf. Because detailed calculations have not been made, we compute post-merger models with a stellar evolution code. We find the evolutionary paths available to merger remnants and find the pre-merger conditions that lead to the formation of hot subdwarfs. We find that some such mergers result in the formation of stars with intermediate helium-rich surfaces. These stars later develop helium-poor surfaces owing to diffusion. Combining our results with a model population and comparing to observed stars, we find that some observed intermediate helium-rich hot subdwarfs can be explained as the remnants of the mergers of helium-core white dwarfs with low-mass MS stars.

  9. MAGNETIC ACTIVITY ANALYSIS FOR A SAMPLE OF G-TYPE MAIN SEQUENCE KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Mehrabi, Ahmad [Department of Physics, Bu Ali Sina University, 65178, 016016, Hamedan (Iran, Islamic Republic of); He, Han [National Astronomical Observatories, Chinese Academy of Sciences, Beijing (China); Khosroshahi, Habib, E-mail: mehrabi@basu.ac.ir [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), 19395-5531, Tehran (Iran, Islamic Republic of)

    2017-01-10

    The variation of a stellar light curve owing to rotational modulation by magnetic features (starspots and faculae) on the star’s surface can be used to investigate the magnetic properties of the host star. In this paper, we use the periodicity and magnitude of the light-curve variation as two proxies to study the stellar magnetic properties for a large sample of G-type main sequence Kepler targets, for which the rotation periods were recently determined. By analyzing the correlation between the two magnetic proxies, it is found that: (1) the two proxies are positively correlated for most of the stars in our sample, and the percentages of negative, zero, and positive correlations are 4.27%, 6.81%, and 88.91%, respectively; (2) negative correlation stars cannot have a large magnitude of light-curve variation; and (3) with the increase of rotation period, the relative number of positive correlation stars decreases and the negative correlation one increases. These results indicate that stars with shorter rotation period tend to have positive correlation between the two proxies, and a good portion of the positive correlation stars have a larger magnitude of light-curve variation (and hence more intense magnetic activities) than negative correlation stars.

  10. THE MULTIPLE PRE-MAIN-SEQUENCE SYSTEM HBC 515 IN L1622

    International Nuclear Information System (INIS)

    Reipurth, Bo; Aspin, Colin; Herbig, George

    2010-01-01

    The bright pre-main-sequence star HBC 515 (HD 288313) located in the L1622 cometary cloud in Orion has been studied extensively with optical/infrared imaging and ultraviolet/optical/infrared spectroscopy. The spectra indicate that HBC 515 is a weakline T Tauri star (TTS) of spectral type K2V. Adaptive optics imaging in the K band reveals that HBC 515 is a binary with two equally bright components separated by 0.''5. A very faint third component is found 5'' to the northwest. Spitzer IRAC and MIPS observations show that at mid-infrared wavelengths this third source dominates the system, suggesting that it is a protostar still embedded in the nascent cloud of HBC 515. The close association of a weakline TTS with a newborn protostar in a multiple system is noteworthy. Two nearby TTSs are likely associated with the HBC 515 multiple system, and the dynamical evolution of the complex that would lead to such a configuration is considered.

  11. Evolution Models of Helium White Dwarf–Main-sequence Star Merger Remnants

    International Nuclear Information System (INIS)

    Zhang, Xianfei; Bi, Shaolan; Hall, Philip D.; Jeffery, C. Simon

    2017-01-01

    It is predicted that orbital decay by gravitational-wave radiation and tidal interaction will cause some close binary stars to merge within a Hubble time. The merger of a helium-core white dwarf with a main-sequence (MS) star can produce a red giant branch star that has a low-mass hydrogen envelope when helium is ignited and thus become a hot subdwarf. Because detailed calculations have not been made, we compute post-merger models with a stellar evolution code. We find the evolutionary paths available to merger remnants and find the pre-merger conditions that lead to the formation of hot subdwarfs. We find that some such mergers result in the formation of stars with intermediate helium-rich surfaces. These stars later develop helium-poor surfaces owing to diffusion. Combining our results with a model population and comparing to observed stars, we find that some observed intermediate helium-rich hot subdwarfs can be explained as the remnants of the mergers of helium-core white dwarfs with low-mass MS stars.

  12. Main sequence of the metal-poor globular cluster M30 (NGC 7099)

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1980-01-01

    We present photographic photometry for 673 stars in the metal-poor globular cluster M30 (NGC 7099). The Racine wedge was used with the CTIO 1-m Yale telescope (Δm=3/sup m/.60), the CTIO 4-m telescope (Δm=6/sup m/.83), and the ESO 3.6-m telescope (Δm=4/sup m/.12) to extend the photoelectric limit from Vapprox. =16.3 to Vapprox. =20.4. For the main-sequence turn-off, we have determined its position to lie at V=18.4 +- 0.1 (m.e.) and B-V=0.49 +- 0.03 (m.e.). From these values, we calculate the intrinsic values M/sub v/ =3.87 and (B-V) 0 =0.47. For the cluster as a whole, we derive a distance modulus (m-M)/sub V/=14.53 +- 0.15 and reddening E(B-V)=0.02 +- 0.02. Using the models of Iben and Rood [Astrophys. J. 159, 605 (1970)] and the isochrones of Demarque and McClure [(1977), in Evolution of Galaxies and Stellar Populations, edited by B. Tinsley and R. B. Larson (Yale University Observatory, New Haven), p. 199], we deduce the cluster's age to be 14.5( +- 4.0) x 10 9 yr. The large uncertainty in this value emphasizes the dire need for more work on cluster evolution

  13. Phylogenetic reconstruction of Bantu kinship challenges Main Sequence Theory of human social evolution.

    Science.gov (United States)

    Opie, Christopher; Shultz, Susanne; Atkinson, Quentin D; Currie, Thomas; Mace, Ruth

    2014-12-09

    Kinship provides the fundamental structure of human society: descent determines the inheritance pattern between generations, whereas residence rules govern the location a couple moves to after they marry. In turn, descent and residence patterns determine other key relationships such as alliance, trade, and marriage partners. Hunter-gatherer kinship patterns are viewed as flexible, whereas agricultural societies are thought to have developed much more stable kinship patterns as they expanded during the Holocene. Among the Bantu farmers of sub-Saharan Africa, the ancestral kinship patterns present at the beginning of the expansion are hotly contested, with some arguing for matrilineal and matrilocal patterns, whereas others maintain that any kind of lineality or sex-biased dispersal only emerged much later. Here, we use Bayesian phylogenetic methods to uncover the history of Bantu kinship patterns and trace the interplay between descent and residence systems. The results suggest a number of switches in both descent and residence patterns as Bantu farming spread, but that the first Bantu populations were patrilocal with patrilineal descent. Across the phylogeny, a change in descent triggered a switch away from patrifocal kinship, whereas a change in residence triggered a switch back from matrifocal kinship. These results challenge "Main Sequence Theory," which maintains that changes in residence rules precede change in other social structures. We also indicate the trajectory of kinship change, shedding new light on how this fundamental structure of society developed as farming spread across the globe during the Neolithic.

  14. THE ORIGIN OF HVS17, AN UNBOUND MAIN SEQUENCE B STAR AT 50 kpc

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Warren R.; Geller, Margaret J.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden Street, Cambridge, MA 02138 (United States); Cohen, Judith G., E-mail: wbrown@cfa.harvard.edu, E-mail: mgeller@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: jlc@astro.caltech.edu [Palomar Observatory, Mail Stop 249-17, California Institute of Technology, Pasadena, CA 91125 (United States)

    2013-09-20

    We analyze Keck Echellette Spectrograph and Imager spectroscopy of HVS17, a B-type star traveling with a Galactic rest frame radial velocity of +445 km s{sup –1} in the outer halo of the Milky Way. HVS17 has the projected rotation of a main sequence B star and is chemically peculiar, with solar iron abundance and sub-solar alpha abundance. Comparing measured T{sub eff} and log g with stellar evolution tracks implies that HVS17 is a 3.91 ± 0.09 M{sub ☉}, 153 ± 9 Myr old star at a Galactocentric distance of r = 48.5 ± 4.6 kpc. The time between its formation and ejection significantly exceeds 10 Myr and thus is difficult to reconcile with any Galactic disk runaway scenario involving massive stars. The observations are consistent, on the other hand, with a hypervelocity star ejection from the Galactic center. We show that Gaia proper motion measurements will easily discriminate between a disk and Galactic center origin, thus allowing us to use HVS17 as a test particle to probe the shape of the Milky Way's dark matter halo.

  15. THE ORIGIN OF HVS17, AN UNBOUND MAIN SEQUENCE B STAR AT 50 kpc

    International Nuclear Information System (INIS)

    Brown, Warren R.; Geller, Margaret J.; Kenyon, Scott J.; Cohen, Judith G.

    2013-01-01

    We analyze Keck Echellette Spectrograph and Imager spectroscopy of HVS17, a B-type star traveling with a Galactic rest frame radial velocity of +445 km s –1 in the outer halo of the Milky Way. HVS17 has the projected rotation of a main sequence B star and is chemically peculiar, with solar iron abundance and sub-solar alpha abundance. Comparing measured T eff and log g with stellar evolution tracks implies that HVS17 is a 3.91 ± 0.09 M ☉ , 153 ± 9 Myr old star at a Galactocentric distance of r = 48.5 ± 4.6 kpc. The time between its formation and ejection significantly exceeds 10 Myr and thus is difficult to reconcile with any Galactic disk runaway scenario involving massive stars. The observations are consistent, on the other hand, with a hypervelocity star ejection from the Galactic center. We show that Gaia proper motion measurements will easily discriminate between a disk and Galactic center origin, thus allowing us to use HVS17 as a test particle to probe the shape of the Milky Way's dark matter halo

  16. THE EVOLVED MAIN-SEQUENCE CHANNEL: HST AND LBT OBSERVATIONS OF CSS 120422:111127+571239

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, M.; Callanan, P. [Department of Physics, University College Cork, Cork (Ireland); Garnavich, P.; Littlefield, C. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Szkody, P. [Department of Astronomy, University of Washington, Seattle, WA (United States); Pogge, R. [Department of Astronomy, The Ohio State University, 140 W. 18th Avenue, Columbus, OH 43202 (United States)

    2015-12-20

    The “evolved main-sequence (EMS)” channel is thought to contribute significantly to the population of AM CVn-type systems in the Galaxy, and also to the number of cataclysmic variables (CVs) detected below the period minimum for hydrogen rich systems. CSS 120422:J111127+571239 was discovered by the Catalina Sky Survey in 2012 April. Its period was found to be 56 minutes, well below the minimum, and the optical spectrum is clearly depleted in hydrogen relative to helium, but still has two orders of magnitude more hydrogen than AM CVn stars. Doppler tomography of the Hα line hinted at a spiral structure existing in the disk. Here we present spectroscopy of CSS 120422:J111127+571239 using the Cosmic Origins Spectrograph FUV instrument on the Hubble Space Telescope and using the MODS spectrograph on the Large Binocular Telescope. The UV spectrum shows Si iv, N v, and He ii, but no detectable C iv. The anomalous nitrogen/carbon ratio is seen in a small number of other CVs and confirms a unique binary evolution. We also present and compare the optical spectrum of V418 Ser and advocate that it is also an EMS system.

  17. ULTRAVIOLET-SELECTED FIELD AND PRE-MAIN-SEQUENCE STARS TOWARD TAURUS AND UPPER SCORPIUS

    International Nuclear Information System (INIS)

    Findeisen, K.; Hillenbrand, L.

    2010-01-01

    We have carried out a Galaxy Evolution Explorer (GALEX) Cycle 1 guest investigator program covering 56 deg 2 near the Taurus T association and 12 deg 2 along the northern edge of the Upper Scorpius OB association. We combined photometry in the GALEX far-ultraviolet and near-ultraviolet bands with data from the Two Micron All Sky Survey to identify candidate young (∼<100 Myr old) stars as those with an ultraviolet excess relative to older main-sequence stars. Follow-up spectroscopy of a partial sample of these candidates suggests five new members of Taurus, with 8-20 expected from additional observations, and five new members of Upper Scorpius, with three to six expected from additional observations. These candidate new members appear to represent a distributed, non-clustered population in either region, although our sample statistics are as of yet too poor to constrain the nature or extent of this population. Rather, our study demonstrates the ability of GALEX observations to identify young stellar populations distributed over a wide area of the sky. We also highlight the necessity of a better understanding of the Galactic ultraviolet source population to support similar investigations. In particular, we report a large population of stars with an ultraviolet excess but no optical indicators of stellar activity or accretion, and briefly argue against several interpretations of these sources.

  18. STELLAR DIAMETERS AND TEMPERATURES. II. MAIN-SEQUENCE K- AND M-STARS

    Energy Technology Data Exchange (ETDEWEB)

    Boyajian, Tabetha S.; McAlister, Harold A.; Jones, Jeremy; White, Russel; Henry, Todd; Gies, Douglas; Jao, Wei-Chun; Parks, J. Robert [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar; Kane, Stephen R.; Ciardi, David [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Ten Brummelaar, Theo A.; Schaefer, Gail; Sturmann, Laszlo; Sturmann, Judit [The CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Muirhead, Philip S. [Department of Astronomy, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Lopez-Morales, Mercedes [Institut de Ciencies de L' Espai (CSIC-IEEC), E-08193 Bellaterra (Spain); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States); Rojas-Ayala, Barbara [Department of Astrophysics, Division of Physical Sciences, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); and others

    2012-10-01

    We present interferometric angular diameter measurements of 21 low-mass, K- and M-dwarfs made with the CHARA Array. This sample is enhanced by adding a collection of radius measurements published in the literature to form a total data set of 33 K-M-dwarfs with diameters measured to better than 5%. We use these data in combination with the Hipparcos parallax and new measurements of the star's bolometric flux to compute absolute luminosities, linear radii, and effective temperatures for the stars. We develop empirical relations for {approx}K0 to M4 main-sequence stars that link the stellar temperature, radius, and luminosity to the observed (B - V), (V - R), (V - I), (V - J), (V - H), and (V - K) broadband color index and stellar metallicity [Fe/H]. These relations are valid for metallicities ranging from [Fe/H] = -0.5 to +0.1 dex and are accurate to {approx}2%, {approx}5%, and {approx}4% for temperature, radius, and luminosity, respectively. Our results show that it is necessary to use metallicity-dependent transformations in order to properly convert colors into stellar temperatures, radii, and luminosities. Alternatively, we find no sensitivity to metallicity on relations we construct to the global properties of a star omitting color information, e.g., temperature-radius and temperature-luminosity. Thus, we are able to empirically quantify to what order the star's observed color index is impacted by the stellar iron abundance. In addition to the empirical relations, we also provide a representative look-up table via stellar spectral classifications using this collection of data. Robust examinations of single star temperatures and radii compared to evolutionary model predictions on the luminosity-temperature and luminosity-radius planes reveal that models overestimate the temperatures of stars with surface temperatures <5000 K by {approx}3%, and underestimate the radii of stars with radii <0.7 R{sub Sun} by {approx}5%. These conclusions additionally

  19. White dwarf-main sequence binaries from LAMOST: the DR5 catalogue

    Science.gov (United States)

    Ren, J.-J.; Rebassa-Mansergas, A.; Parsons, S. G.; Liu, X.-W.; Luo, A.-L.; Kong, X.; Zhang, H.-T.

    2018-03-01

    We present the data release (DR) 5 catalogue of white dwarf-main sequence (WDMS) binaries from the Large Area Multi-Object fiber Spectroscopic Telescope (LAMOST). The catalogue contains 876 WDMS binaries, of which 757 are additions to our previous LAMOST DR1 sample and 357 are systems that have not been published before. We also describe a LAMOST-dedicated survey that aims at obtaining spectra of photometrically-selected WDMS binaries from the Sloan Digital Sky Survey (SDSS) that are expected to contain cool white dwarfs and/or early type M dwarf companions. This is a population under-represented in previous SDSS WDMS binary catalogues. We determine the stellar parameters (white dwarf effective temperatures, surface gravities and masses, and M dwarf spectral types) of the LAMOST DR5 WDMS binaries and make use of the parameter distributions to analyse the properties of the sample. We find that, despite our efforts, systems containing cool white dwarfs remain under-represented. Moreover, we make use of LAMOST DR5 and SDSS DR14 (when available) spectra to measure the Na I λλ 8183.27, 8194.81 absorption doublet and/or Hα emission radial velocities of our systems. This allows identifying 128 binaries displaying significant radial velocity variations, 76 of which are new. Finally, we cross-match our catalogue with the Catalina Surveys and identify 57 systems displaying light curve variations. These include 16 eclipsing systems, two of which are new, and nine binaries that are new eclipsing candidates. We calculate periodograms from the photometric data and measure (estimate) the orbital periods of 30 (15) WDMS binaries.

  20. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: DEPENDENCE ON PLANETARY MASS

    International Nuclear Information System (INIS)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kasting, James F.; SchottelKotte, James; Domagal-Goldman, Shawn; Eymet, Vincent

    2014-01-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1 M ⊕ and 5 M ⊕ . Assuming H 2 O-(inner HZ) and CO 2 -(outer HZ) dominated atmospheres, and scaling the background N 2 atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (∼10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H 2 O column depth. For larger planets, the H 2 O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing longwave radiation. Hence the inner edge moves inward (∼7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs

  1. YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Calderon, M.; Stauffer, J. R.; Rebull, L. M. [Spitzer Science Center, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Stassun, K. G. [Physics and Astronomy Department, Vanderbilt University, 1807 Station B, Nashville, TN 37235 (United States); Vrba, F. J. [U. S. Naval Observatory, Flagstaff Station, 10391 W. Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A.; Carpenter, J. M. [Astronomy Department, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Terebey, S.; Angione, J. [Department of Physics and Astronomy, California State University at Los Angeles, Los Angeles, CA 90032 (United States); Covey, K. R. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Terndrup, D. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Gutermuth, R. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Song, I. [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Marchis, F. [SETI Institute, Carl Sagan Center, 189 N San Bernado Av, Mountain View, CA 94043 (United States); Garcia, E. V. [Department of Physics, Fisk University, 1000 17th Ave. N, Nashville, TN 37208 (United States); Margheim, S. [Gemini Observatory, Southern Operations Center, Casilla 603, La Serena (Chile); Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Irwin, J. M., E-mail: mariamc@cab.inta-csic.es [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)

    2012-07-10

    Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for {approx}2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass ({theta}{sup 1} Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M{sub Sun }) and longest-period (ISOY J053505.71-052354.1, P {approx} 20 days) PMS EBs currently known. In two cases ({theta}{sup 1} Ori E and ISOY J053526.88-044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

  2. Time Variability of the Dust Sublimation Zones in Pre-Main Sequence Disk Systems

    Science.gov (United States)

    Sitko, Michael L.; Carpenter, W. J.; Grady, C. A.; Russel, R. W.; Lynch, D. K.; Rudy, R. J.; Mazuk, S. M.; Venturini, C. C.; Kimes, R. L.; Beerman, L. C.; hide

    2007-01-01

    The dust sublimation zone (DSZ) is the region of pre-main sequence (PMS) disks where dust grains most easily anneal, sublime, and condense out of the gas. Because of this, it is a location where crystalline material may be enhanced and redistributed throughout the rest of the disk. A decade-long program to monitor the thermal emission of the grains located in this region demonstrates that large changes in emitted flux occur in many systems. Changes in the thermal emission between 3 and 13.5 microns were observed in HD 31648 (MWC 480), HD 163296 (MWC 275), and DG Tau. This emission is consistent with it being produced at the DSZ, where the transition from a disk of gas to one of gas+dust occurs. In the case of DG Tau, the outbursts were accompanied by increased emission on the 10 micron silicate band on one occasion, while on another occasion it went into absorption. This requires lofting of the material above the disk into the line of sight. Such changes will affect the determination of the inner disk structure obtained through interferometry measurements, and this has been confirmed in the case of HD 163296. Cyclic variations in the heating of the DSZ will lead to the annealing of large grains, the sublimation of smaller grains, possibly followed by re-condensation as the zone enters a cooling phase. Lofting of dust above the disk plane, and outward acceleration by stellar winds and radiation pressure, can re-distribute the processed material to cooler regions of the disk, where cometesimals form. This processing is consistent with the detection of the preferential concentration of large crystalline grains in the inner few AU of PMS disks using interferometric spectroscopy with the VLTI.

  3. THE QUADRUPLE PRE-MAIN-SEQUENCE SYSTEM LkCa 3: IMPLICATIONS FOR STELLAR EVOLUTION MODELS

    International Nuclear Information System (INIS)

    Torres, Guillermo; Latham, David W.; Ruíz-Rodríguez, Dary; Prato, L.; Wasserman, Lawrence H.; Badenas, Mariona; Schaefer, G. H.; Mathieu, Robert D.

    2013-01-01

    We report the discovery that the pre-main-sequence (PMS) object LkCa 3 in the Taurus-Auriga star-forming region is a hierarchical quadruple system of M stars. It was previously known to be a close (∼0.''5) visual pair, with one component being a moderately eccentric 12.94 day single-lined spectroscopic binary. A re-analysis of archival optical spectra complemented by new near-infrared (NIR) spectroscopy shows both visual components to be double lined; the second one has a period of 4.06 days and a circular orbit. In addition to the orbital elements, we determine optical and NIR flux ratios, effective temperatures, and projected rotational velocities for all four stars. Using existing photometric monitoring observations of the system that had previously revealed the rotational period of the primary in the longer-period binary, we also detect the rotational signal of the primary in the 4.06 day binary, which is synchronized with the orbital motion. With only the assumption of coevality, a comparison of all of these constraints with current stellar evolution models from the Dartmouth series points to an age of 1.4 Myr and a distance of 133 pc, consistent with previous estimates for the region and suggesting that the system is on the near side of the Taurus complex. Similar comparisons of the properties of LkCa 3 and the well-known quadruple PMS system GG Tau with the widely used models from the Lyon series for a mixing length parameter of α ML = 1.0 strongly favor the Dartmouth models

  4. YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

    International Nuclear Information System (INIS)

    Morales-Calderón, M.; Stauffer, J. R.; Rebull, L. M.; Stassun, K. G.; Vrba, F. J.; Prato, L.; Hillenbrand, L. A.; Carpenter, J. M.; Terebey, S.; Angione, J.; Covey, K. R.; Terndrup, D. M.; Gutermuth, R.; Song, I.; Plavchan, P.; Marchis, F.; García, E. V.; Margheim, S.; Luhman, K. L.; Irwin, J. M.

    2012-01-01

    Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for ∼2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass (θ 1 Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M ☉ ) and longest-period (ISOY J053505.71–052354.1, P ∼ 20 days) PMS EBs currently known. In two cases (θ 1 Ori E and ISOY J053526.88–044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

  5. Lithium abundances for 185 main-sequence stars: Galactic evolution and stellar depletion of lithium

    Science.gov (United States)

    Chen, Y. Q.; Nissen, P. E.; Benoni, T.; Zhao, G.

    2001-06-01

    We present a survey of lithium abundances in 185 main-sequence field stars with 5600 interesting result from this study is the presence of a large gap in the log varepsilon (Li) - Teff plane, which distinguishes ``Li-dip'' stars like those first identified in the Hyades cluster by Boesgaard & Tripicco (\\cite{Boesgaard86}) from other stars with a much higher Li abundance. The Li-dip stars concentrate on a certain mass, which decreases with metallicity from about 1.4 Msun at solar metallicity to 1.1 Msun at [Fe/H] =~ -1.0. Excluding the Li-dip stars and a small group of lower mass stars with Teff rate of angular momentum loss. It cannot be excluded, however, that a cosmic scatter of the Li abundance in the Galaxy at a given metallicity contributes to the dispersion in Li abundance. These problems make it difficult to determine the Galactic evolution of Li from the data, but a comparison of the upper envelope of the distribution of stars in the log varepsilon (Li) - [Fe/H] plane with recent Galactic evolutionary models by Romano et al. (\\cite{Romano99}) suggests that novae are a major source for the Li production in the Galactic disk; their occurrence seems to be the explanation for the steep increase of Li abundance at [Fe/H] =~ -0.4. Based on observations carried out at Beijing Astronomical Observatory (Xinglong, PR China) and European Southern Observatory, La Silla, Chile. Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/371/943 and at http://www.edpsciences.org

  6. Habitable Zones Around Main-Sequence Stars: Dependence on Planetary Mass

    Science.gov (United States)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kotte, James Schottel; Kasting, James F.; Domagal-Goldman, Shawn; Eymet, Vincent

    2014-01-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1M and 5M. Assuming H2O-(inner HZ) and CO2-(outer HZ) dominated atmospheres, and scaling the background N2 atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (approx.10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H2O column depth. For larger planets, the H2O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing long-wave radiation. Hence the inner edge moves inward (approx.7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs.

  7. On the Use of the Main-sequence Knee (Saddle) to Measure Globular Cluster Ages

    Science.gov (United States)

    Saracino, S.; Dalessandro, E.; Ferraro, F. R.; Lanzoni, B.; Origlia, L.; Salaris, M.; Pietrinferni, A.; Geisler, D.; Kalirai, J. S.; Correnti, M.; Cohen, R. E.; Mauro, F.; Villanova, S.; Moni Bidin, C.

    2018-06-01

    In this paper, we review the operational definition of the so-called main-sequence knee (MS-knee), a feature in the color-magnitude diagram (CMD) occurring at the low-mass end of the MS. The magnitude of this feature is predicted to be independent of age at fixed chemical composition. For this reason, its difference in magnitude with respect to the MS turn-off (MS-TO) point has been suggested as a possible diagnostic to estimate absolute globular cluster (GC) ages. We first demonstrate that the operational definition of the MS-knee currently adopted in the literature refers to the inflection point of the MS (which we here more appropriately named MS-saddle), a feature that is well distinct from the knee and which cannot be used as its proxy. The MS-knee is only visible in near-infrared CMDs, while the MS-saddle can be also detected in optical–NIR CMDs. By using different sets of isochrones, we then demonstrate that the absolute magnitude of the MS-knee varies by a few tenths of a dex from one model to another, thus showing that at the moment stellar models may not capture the full systematic error in the method. We also demonstrate that while the absolute magnitude of the MS-saddle is almost coincident in different models, it has a systematic dependence on the adopted color combinations which is not predicted by stellar models. Hence, it cannot be used as a reliable reference for absolute age determination. Moreover, when statistical and systematic uncertainties are properly taken into account, the difference in magnitude between the MS-TO and the MS-saddle does not provide absolute ages with better accuracy than other methods like the MS-fitting.

  8. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: DEPENDENCE ON PLANETARY MASS

    Energy Technology Data Exchange (ETDEWEB)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kasting, James F. [Department of Geosciences, Penn State University, 443 Deike Building, University Park, PA 16802 (United States); SchottelKotte, James [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Domagal-Goldman, Shawn [NASA Astrobiology Institute' s Virtual Planetary Laboratory, P.O. Box 351580, Seattle, WA 98195 (United States); Eymet, Vincent, E-mail: ruk15@psu.edu [Laboratoire d' Astrophysique de Bordeaux, Universite de Bordeaux 1, UMR 5804, F-33270 Floirac (France)

    2014-06-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1 M {sub ⊕} and 5 M {sub ⊕}. Assuming H{sub 2}O-(inner HZ) and CO{sub 2}-(outer HZ) dominated atmospheres, and scaling the background N{sub 2} atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (∼10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H{sub 2}O column depth. For larger planets, the H{sub 2}O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing longwave radiation. Hence the inner edge moves inward (∼7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs.

  9. Matrix based method for synthesis of main intensified and integrated distillation sequences

    International Nuclear Information System (INIS)

    Khalili-Garakani, Amirhossein; Kasiri, Norollah; Ivakpour, Javad

    2016-01-01

    The objective of many studies in this area has involved access to a column-sequencing algorithm enabling designers and researchers alike to generate a wide range of sequences in a broad search space, and be as mathematically and as automated as possible for programing purposes and with good generality. In the present work an algorithm previously developed by the authors, called the matrix method, has been developed much further. The new version of the algorithm includes thermally coupled, thermodynamically equivalent, intensified, simultaneous heat and mass integrated and divided-wall column sequences which are of gross application and provide vast saving potential both on capital investment, operating costs and energy usage in industrial applications. To demonstrate the much wider searchable space now accessible, a three component separation has been thoroughly examined as a case study, always resulting in an integrated sequence being proposed as the optimum.

  10. Empirical tests of pre-main-sequence stellar evolution models with eclipsing binaries

    Science.gov (United States)

    Stassun, Keivan G.; Feiden, Gregory A.; Torres, Guillermo

    2014-06-01

    We examine the performance of standard pre-main-sequence (PMS) stellar evolution models against the accurately measured properties of a benchmark sample of 26 PMS stars in 13 eclipsing binary (EB) systems having masses 0.04-4.0 M⊙ and nominal ages ≈1-20 Myr. We provide a definitive compilation of all fundamental properties for the EBs, with a careful and consistent reassessment of observational uncertainties. We also provide a definitive compilation of the various PMS model sets, including physical ingredients and limits of applicability. No set of model isochrones is able to successfully reproduce all of the measured properties of all of the EBs. In the H-R diagram, the masses inferred for the individual stars by the models are accurate to better than 10% at ≳1 M⊙, but below 1 M⊙ they are discrepant by 50-100%. Adjusting the observed radii and temperatures using empirical relations for the effects of magnetic activity helps to resolve the discrepancies in a few cases, but fails as a general solution. We find evidence that the failure of the models to match the data is linked to the triples in the EB sample; at least half of the EBs possess tertiary companions. Excluding the triples, the models reproduce the stellar masses to better than ∼10% in the H-R diagram, down to 0.5 M⊙, below which the current sample is fully contaminated by tertiaries. We consider several mechanisms by which a tertiary might cause changes in the EB properties and thus corrupt the agreement with stellar model predictions. We show that the energies of the tertiary orbits are comparable to that needed to potentially explain the scatter in the EB properties through injection of heat, perhaps involving tidal interaction. It seems from the evidence at hand that this mechanism, however it operates in detail, has more influence on the surface properties of the stars than on their internal structure, as the lithium abundances are broadly in good agreement with model predictions. The

  11. A search for pre-main-sequence stars in high-latitude molecular clouds. 3: A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris; Fryer, Chris

    1995-01-01

    In order to discern whether the high-latitude molecular clouds are regions of ongoing star formation, we have used X-ray emission as a tracer of youthful stars. The entire Einstein database yields 18 images which overlap 10 of the clouds mapped partially or completely in the CO (1-0) transition, providing a total of approximately 6 deg squared of overlap. Five previously unidentified X-ray sources were detected: one has an optical counterpart which is a pre-main-sequence (PMS) star, and two have normal main-sequence stellar counterparts, while the other two are probably extragalactic sources. The PMS star is located in a high Galactic latitude Lynds dark cloud, so this result is not too suprising. The translucent clouds, though, have yet to reveal any evidence of star formation.

  12. MR of normal pancreas : comparison of five pulse sequences and enhancing patterns on dynamic imaging

    International Nuclear Information System (INIS)

    Jang, Hyun Jung; Kim, Tae Kyoung; Hong, Sung Hwan; Han, Joon Koo; Choi, Byung Ihn

    1997-01-01

    To compare T1-weighted FLASH and turbo spin echo (SE) T2-weighted sequences with conventional T1- and T2-weighted sequences in imaging normal pancreas and to describe the enhancing patterns on dynamic MR imging. Forty-four patients with presumed hepatic hemangiomas were studied at 1.0T or 1.5T by using conventional SE sequences (T1-weighted, T2-weighted, and heavily T2-weighted), turbo-SE T2-weighted sequences, and breath-hold T1-weighted FLASH sequences acquired before, immediately on, and at 1, 2, 3, and 5 or 10 minutes after injection of a bolus of gadopentetate dimeglumine. No patients had either a history or its clinical features of pancreatic disease. Images were quantitatively analyzed for signal-difference-to noise ratios (SD/Ns) between the pancreas and peripancreatic fat. Percentage enhancement of the pancreas was measured on each dynamic MR image. Conspicuity of the pancreatic border was qualitatively evaluated according to a consensus, reached by three radiologists. Turbo-SE T2-weighted images had a significantly higher SD/N ratio (p<0.001) and better conspicuity of the pancreatic border (p<0.001) than SE T2- and heavily T2-weighted images;T1-weighted SE images had a significantly higher SD/N ratio than T1-weighted FLASH images (p<0.001), but there was no significant difference between tham in qualitative analysis (p=0.346). Percentage enhancement immediately on and at 1, 2, 3, 5, and 10 minutes after administration of contrast material was 39.9%, 44.5%, 42.9%, 40.8%, 36.3%, 29.9%, respectively, with peak enhancement at 1 minute. In MR imaging of normal pancreas, turbo-SE T2-weighted imaging is superior to SE T2- and heavily T2- weighted imaging, and SE T1-weighted imaging is superior to T1-weighted FLASH imaging. On serial gadolinium-enhanced FLASH imaging, normal pancreas shows peak enhancement at 1 minute

  13. Transit detections of extrasolar planets around main-sequence stars. I. Sky maps for hot Jupiters

    Science.gov (United States)

    Heller, R.; Mislis, D.; Antoniadis, J.

    2009-12-01

    Context: The findings of more than 350 extrasolar planets, most of them nontransiting Hot Jupiters, have revealed correlations between the metallicity of the main-sequence (MS) host stars and planetary incidence. This connection can be used to calculate the planet formation probability around other stars, not yet known to have planetary companions. Numerous wide-field surveys have recently been initiated, aiming at the transit detection of extrasolar planets in front of their host stars. Depending on instrumental properties and the planetary distribution probability, the promising transit locations on the celestial plane will differ among these surveys. Aims: We want to locate the promising spots for transit surveys on the celestial plane and strive for absolute values of the expected number of transits in general. Our study will also clarify the impact of instrumental properties such as pixel size, field of view (FOV), and magnitude range on the detection probability. Methods: We used data of the Tycho catalog for ≈1 million objects to locate all the stars with 0^m~≲~m_V~≲~11.5m on the celestial plane. We took several empirical relations between the parameters listed in the Tycho catalog, such as distance to Earth, m_V, and (B-V), and those parameters needed to account for the probability of a star to host an observable, transiting exoplanet. The empirical relations between stellar metallicity and planet occurrence combined with geometrical considerations were used to yield transit probabilities for the MS stars in the Tycho catalog. Magnitude variations in the FOV were simulated to test whether this fluctuations would be detected by BEST, XO, SuperWASP and HATNet. Results: We present a sky map of the expected number of Hot Jupiter transit events on the basis of the Tycho catalog. Conditioned by the accumulation of stars towards the galactic plane, the zone of the highest number of transits follows the same trace, interrupted by spots of very low and high

  14. Multidetector computed tomography angiography of the celiac trunk and hepatic arterial system: normal anatomy and main variants

    Energy Technology Data Exchange (ETDEWEB)

    Araujo-Neto, Severino Aires; Mello-Junior, Carlos Fernando de; Franca, Henrique Almeida; Duarte, Claudia Martina Araujo; Borges, Rafael Farias; Magalhaes, Ana Guardiana Ximenes de, E-mail: severinoaires@hotmail.com [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil)

    2016-01-15

    Although digital angiography remains as the gold standard for imaging the celiac arterial trunk and hepatic arteries, multidetector computed tomography in association with digital images processing by software resources represents a useful tool particularly attractive for its non invasiveness. Knowledge of normal anatomy as well as of its variations is helpful in images interpretation and to address surgical planning on a case-by-case basis. The present essay illustrates several types of anatomical variations of celiac trunk, hepatic artery and its main branches, by means of digitally reconstructed computed tomography images, correlating their prevalence in the population with surgical implications. (author)

  15. Luminosity and Intrinsic Color Calibration of Main-Sequence Stars With 2Mass Photometry: All Sky Local Extinction

    Directory of Open Access Journals (Sweden)

    Knude Jens

    2003-12-01

    Full Text Available We present a new color index vs. absolute magnitude calibration of 2MASS JHK photometry. For the A0 to ~G5 and M segments of the main sequence information on the amount of interstellar extinction and its location in space may be obtained.

  16. Music as a mnemonic to learn gesture sequences in normal aging and Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Aline eMoussard

    2014-05-01

    Full Text Available Strong links between music and motor functions suggest that music could represent an interesting aid for motor learning. The present study aims for the first time to test the potential of music to assist in the learning of sequences of gestures in normal and pathological aging. Participants with mild Alzheimer's disease (AD and healthy older adults (Controls learned sequences of meaningless gestures that were either accompanied by music or a metronome. We also manipulated the learning procedure such that participants had to imitate the gestures to-be-memorized in synchrony with the experimenter or after the experimenter during encoding. Results show different patterns of performance for the two groups. Overall, musical accompaniment had no impact on the Controls' performance, but improved those of AD participants. Conversely, synchronization of gestures during learning helped Controls but seemed to interfere with retention in AD. We discuss these findings regarding their relevance for a better understanding of auditory-motor memory, and we propose recommendations to maximize the mnemonic effect of music for motor sequence learning for dementia care.

  17. Music as a Mnemonic to Learn Gesture Sequences in Normal Aging and Alzheimer’s Disease

    Science.gov (United States)

    Moussard, Aline; Bigand, Emmanuel; Belleville, Sylvie; Peretz, Isabelle

    2014-01-01

    Strong links between music and motor functions suggest that music could represent an interesting aid for motor learning. The present study aims for the first time to test the potential of music to assist in the learning of sequences of gestures in normal and pathological aging. Participants with mild Alzheimer’s disease (AD) and healthy older adults (controls) learned sequences of meaningless gestures that were either accompanied by music or a metronome. We also manipulated the learning procedure such that participants had to imitate the gestures to-be-memorized in synchrony with the experimenter or after the experimenter during encoding. Results show different patterns of performance for the two groups. Overall, musical accompaniment had no impact on the controls’ performance but improved those of AD participants. Conversely, synchronization of gestures during learning helped controls but seemed to interfere with retention in AD. We discuss these findings regarding their relevance for a better understanding of auditory–motor memory, and we propose recommendations to maximize the mnemonic effect of music for motor sequence learning for dementia care. PMID:24860476

  18. Music as a mnemonic to learn gesture sequences in normal aging and Alzheimer's disease.

    Science.gov (United States)

    Moussard, Aline; Bigand, Emmanuel; Belleville, Sylvie; Peretz, Isabelle

    2014-01-01

    Strong links between music and motor functions suggest that music could represent an interesting aid for motor learning. The present study aims for the first time to test the potential of music to assist in the learning of sequences of gestures in normal and pathological aging. Participants with mild Alzheimer's disease (AD) and healthy older adults (controls) learned sequences of meaningless gestures that were either accompanied by music or a metronome. We also manipulated the learning procedure such that participants had to imitate the gestures to-be-memorized in synchrony with the experimenter or after the experimenter during encoding. Results show different patterns of performance for the two groups. Overall, musical accompaniment had no impact on the controls' performance but improved those of AD participants. Conversely, synchronization of gestures during learning helped controls but seemed to interfere with retention in AD. We discuss these findings regarding their relevance for a better understanding of auditory-motor memory, and we propose recommendations to maximize the mnemonic effect of music for motor sequence learning for dementia care.

  19. visnormsc: A Graphical User Interface to Normalize Single-cell RNA Sequencing Data.

    Science.gov (United States)

    Tang, Lijun; Zhou, Nan

    2017-12-26

    Single-cell RNA sequencing (RNA-seq) allows the analysis of gene expression with high resolution. The intrinsic defects of this promising technology imports technical noise into the single-cell RNA-seq data, increasing the difficulty of accurate downstream inference. Normalization is a crucial step in single-cell RNA-seq data pre-processing. SCnorm is an accurate and efficient method that can be used for this purpose. An R implementation of this method is currently available. On one hand, the R package possesses many excellent features from R. On the other hand, R programming ability is required, which prevents the biologists who lack the skills from learning to use it quickly. To make this method more user-friendly, we developed a graphical user interface, visnormsc, for normalization of single-cell RNA-seq data. It is implemented in Python and is freely available at https://github.com/solo7773/visnormsc . Although visnormsc is based on the existing method, it contributes to this field by offering a user-friendly alternative. The out-of-the-box and cross-platform features make visnormsc easy to learn and to use. It is expected to serve biologists by simplifying single-cell RNA-seq normalization.

  20. The main challenges that remain in applying high-throughput sequencing to clinical diagnostics.

    Science.gov (United States)

    Loeffelholz, Michael; Fofanov, Yuriy

    2015-01-01

    Over the last 10 years, the quality, price and availability of high-throughput sequencing instruments have improved to the point that this technology may be close to becoming a routine tool in the diagnostic microbiology laboratory. Two groups of challenges, however, have to be resolved in order to move this powerful research technology into routine use in the clinical microbiology laboratory. The computational/bioinformatics challenges include data storage cost and privacy concerns, requiring analysis to be performed without access to cloud storage or expensive computational infrastructure. The logistical challenges include interpretation of complex results and acceptance and understanding of the advantages and limitations of this technology by the medical community. This article focuses on the approaches to address these challenges, such as file formats, algorithms, data collection, reporting and good laboratory practices.

  1. Differentiating the two main histologic categories of fibroadenoma tissue from normal breast tissue by using multiphoton microscopy.

    Science.gov (United States)

    Nie, Y T; Wu, Y; Fu, F M; Lian, Y E; Zhuo, S M; Wang, C; Chen, J X

    2015-04-01

    Multiphoton microscopy has become a novel biological imaging technique that allows cellular and subcellular microstructure imaging based on two-photon excited fluorescence and second harmonic generation. In this work, we used multiphoton microscopy to obtain the high-contrast images of human normal breast tissue and two main histologic types of fibroadenoma (intracanalicular, pericanalicular). Moreover, quantitative image analysis was performed to characterize the changes of collagen morphology (collagen content, collagen orientation). The results show that multiphoton microscopy combined with quantitative method has the ability to identify the characteristics of fibroadenoma including changes of the duct architecture and collagen morphology in stroma. With the advancement of multiphoton microscopy, we believe that the technique has great potential to be a real-time histopathological diagnostic tool for intraoperative detection of fibroadenoma in the future. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

  2. Testing Scaling Relations for Solar-like Oscillations from the Main Sequence to Red Giants Using Kepler Data

    DEFF Research Database (Denmark)

    Huber, D.; Bedding, T.R.; Stello, D.

    2011-01-01

    ), and oscillation amplitudes. We show that the difference of the Δν-νmax relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M) s......We have analyzed solar-like oscillations in ~1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power (νmax), the large frequency separation (Δν...... scaling nor the revised scaling relation by Kjeldsen & Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of ~25%. The residuals show...

  3. A catalog of pre-main-sequence emission-line stars with IRAS source associations

    International Nuclear Information System (INIS)

    Weintraub, D.A.

    1990-01-01

    To aid in finding premain-sequence (PMS) emission-line stars that might have dusty circumstellar environments, 361 PMS stars that are associated with 304 separate IRAS sources were identified. These stars include 200 classical T Tauri stars, 25 weak-lined (naked) T Tauri stars, 56 Herbig Ae/Be stars, six FU Orionis stars, and two SU Aurigae stars. All six of the FU Orionis stars surveyed by IRAS were detected. Of the PMS-IRAS Point Source Catalog (PSC) associations, 90 are new and are not noted in the PSC. The other 271 entries include 104 that are correctly identified in the PSC but have not yet appeared in the literature, 56 more that can be found in both the PSC and in the published and unpublished iterature, and 111 that are in the literature but not in the PSC. Spectral slope diagrams constructed from the 12-, 25-, and 60-micron flux densities reveal unique distributions for the different PMS subclasses; these diagrams may help identify the best candidate PMS stars for observations of circumstellar dust. 30 refs

  4. On the determination of the He abundance distribution in globular clusters from the width of the main sequence

    Science.gov (United States)

    Cassisi, Santi; Salaris, Maurizio; Pietrinferni, Adriano; Hyder, David

    2017-01-01

    One crucial piece of information to study the origin of multiple stellar populations in globular clusters is the range of initial helium abundances ΔY amongst the sub-populations hosted by each cluster. These estimates are commonly obtained by measuring the width in colour of the unevolved main sequence in an optical colour-magnitude diagram (CMD). The measured colour spread is then compared with predictions from theoretical stellar isochrones with varying initial He abundances to determine ΔY. The availability of UV/optical magnitudes, thanks to the Hubble Space Telescope UV Legacy Survey of Galactic GCs project, will allow the homogeneous determination of ΔY for a large Galactic globular cluster sample. From a theoretical point of view, accurate UV CMDs can efficiently disentangle the various sub-populations, and main sequence colour differences in the ACS F606W - (F606W - F814W) diagram allow an estimate of ΔY. We demonstrate that from a theoretical perspective, the (F606W - F814W) colour is an extremely reliable He-abundance indicator. The derivative dY/d(F606W - F814W), computed at a fixed luminosity along the unevolved main sequence, is largely insensitive to the physical assumptions made in stellar model computations, being more sensitive to the choice of the bolometric correction scale, and is only slightly dependent on the adopted set of stellar models. From a theoretical point of view, the (F606W - F814W) colour width of the cluster main sequence is therefore a robust diagnostic of the ΔY range.

  5. The age-metallicity relation in the solar neighbourhood from a pilot sample of white dwarf-main sequence binaries

    OpenAIRE

    Rebassa-Mansergas, A.; Anguiano, B.; García-Berro, E.; Freeman, K. C.; Cojocaru, R.; Manser, C. J.; Pala, A. F.; Gänsicke, B. T.; Liu, X. -W.

    2016-01-01

    The age–metallicity relation (AMR) is a fundamental observational constraint for understanding how the Galactic disc formed and evolved chemically in time. However, there is not yet an agreement on the observational properties of the AMR for the solar neighbourhood, primarily due to the difficulty in obtaining accurate stellar ages for individual field stars. We have started an observational campaign for providing the much needed observational input by using wide white-dwarf–main-sequence (WD...

  6. Magnetic inhibition of convection and the fundamental properties of low-mass stars. II. Fully convective main-sequence stars

    Energy Technology Data Exchange (ETDEWEB)

    Feiden, Gregory A. [Department of Physics and Astronomy, Uppsala University, Box 516, SE-751 20 Uppsala (Sweden); Chaboyer, Brian, E-mail: gregory.a.feiden@gmail.com, E-mail: brian.chaboyer@dartmouth.edu [Department of Physics and Astronomy, Dartmouth College, 6127 Wilder Laboratory, Hanover, NH 03755 (United States)

    2014-07-01

    We examine the hypothesis that magnetic fields are inflating the radii of fully convective main-sequence stars in detached eclipsing binaries (DEBs). The magnetic Dartmouth stellar evolution code is used to analyze two systems in particular: Kepler-16 and CM Draconis. Magneto-convection is treated assuming stabilization of convection and also by assuming reductions in convective efficiency due to a turbulent dynamo. We find that magnetic stellar models are unable to reproduce the properties of inflated fully convective main-sequence stars, unless strong interior magnetic fields in excess of 10 MG are present. Validation of the magnetic field hypothesis given the current generation of magnetic stellar evolution models therefore depends critically on whether the generation and maintenance of strong interior magnetic fields is physically possible. An examination of this requirement is provided. Additionally, an analysis of previous studies invoking the influence of star spots is presented to assess the suggestion that star spots are inflating stars and biasing light curve analyses toward larger radii. From our analysis, we find that there is not yet sufficient evidence to definitively support the hypothesis that magnetic fields are responsible for the observed inflation among fully convective main-sequence stars in DEBs.

  7. STELLAR AGES AND CONVECTIVE CORES IN FIELD MAIN-SEQUENCE STARS: FIRST ASTEROSEISMIC APPLICATION TO TWO KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Silva Aguirre, V.; Christensen-Dalsgaard, J.; Chaplin, W. J. [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Basu, S.; Deheuvels, S. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Brandao, I. M.; Cunha, M. S.; Sousa, S. G. [Centro de Astrofisica and Faculdade de Ciencias, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Dogan, G. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Metcalfe, T. S. [Space Science Institute, Boulder, CO 80301 (United States); Serenelli, A. M.; Garcia, R. A. [Kavli Institute for Theoretical Physics, Santa Barbara, CA 93106 (United States); Ballot, J. [Institut de Recherche en Astrophysique et Planetologie, CNRS, 14 avenue Edouard Belin, F-31400 Toulouse (France); Weiss, A. [Max Planck Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85748 Garching bei Muenchen (Germany); Appourchaux, T. [Institut d' Astrophysique Spatiale, Universite Paris Sud-CNRS (UMR8617) Batiment 121, F-91405 Orsay Cedex (France); Casagrande, L. [Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, The Australian National University, ACT 2611 (Australia); Cassisi, S. [INAF-Astronomical Observatory of Teramo, Via M. Maggini sn, I-64100 Teramo (Italy); Creevey, O. L. [Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, CNRS, I-06300 Nice, France. (France); Lebreton, Y. [Observatoire de Paris, GEPI, CNRS UMR 8111, F-92195 Meudon (France); Noels, A. [Institute of Astrophysics and Geophysics, University of Liege, B-4000 Liege (Belgium); and others

    2013-06-01

    Using asteroseismic data and stellar evolution models we obtain the first detection of a convective core in a Kepler field main-sequence star, putting a stringent constraint on the total size of the mixed zone and showing that extra mixing beyond the formal convective boundary exists. In a slightly less massive target the presence of a convective core cannot be conclusively discarded, and thus its remaining main-sequence lifetime is uncertain. Our results reveal that best-fit models found solely by matching individual frequencies of oscillations corrected for surface effects do not always properly reproduce frequency combinations. Moreover, slightly different criteria to define what the best-fit model is can lead to solutions with similar global properties but very different interior structures. We argue that the use of frequency ratios is a more reliable way to obtain accurate stellar parameters, and show that our analysis in field main-sequence stars can yield an overall precision of 1.5%, 4%, and 10% in radius, mass, and age, respectively. We compare our results with those obtained from global oscillation properties, and discuss the possible sources of uncertainties in asteroseismic stellar modeling where further studies are still needed.

  8. GMPR: A robust normalization method for zero-inflated count data with application to microbiome sequencing data

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-04-01

    Full Text Available Normalization is the first critical step in microbiome sequencing data analysis used to account for variable library sizes. Current RNA-Seq based normalization methods that have been adapted for microbiome data fail to consider the unique characteristics of microbiome data, which contain a vast number of zeros due to the physical absence or under-sampling of the microbes. Normalization methods that specifically address the zero-inflation remain largely undeveloped. Here we propose geometric mean of pairwise ratios—a simple but effective normalization method—for zero-inflated sequencing data such as microbiome data. Simulation studies and real datasets analyses demonstrate that the proposed method is more robust than competing methods, leading to more powerful detection of differentially abundant taxa and higher reproducibility of the relative abundances of taxa.

  9. GMPR: A robust normalization method for zero-inflated count data with application to microbiome sequencing data.

    Science.gov (United States)

    Chen, Li; Reeve, James; Zhang, Lujun; Huang, Shengbing; Wang, Xuefeng; Chen, Jun

    2018-01-01

    Normalization is the first critical step in microbiome sequencing data analysis used to account for variable library sizes. Current RNA-Seq based normalization methods that have been adapted for microbiome data fail to consider the unique characteristics of microbiome data, which contain a vast number of zeros due to the physical absence or under-sampling of the microbes. Normalization methods that specifically address the zero-inflation remain largely undeveloped. Here we propose geometric mean of pairwise ratios-a simple but effective normalization method-for zero-inflated sequencing data such as microbiome data. Simulation studies and real datasets analyses demonstrate that the proposed method is more robust than competing methods, leading to more powerful detection of differentially abundant taxa and higher reproducibility of the relative abundances of taxa.

  10. POST-MAIN SEQUENCE EVOLUTION OF ICY MINOR PLANETS: IMPLICATIONS FOR WATER RETENTION AND WHITE DWARF POLLUTION

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Uri; Perets, Hagai B., E-mail: uri.mal@tx.technion.ac.il, E-mail: hperets@physics.technion.ac.il [Department of Physics, Technion (Israel)

    2016-12-01

    Most observations of polluted white dwarf atmospheres are consistent with accretion of water-depleted planetary material. Among tens of known cases, merely two involve accretion of objects that contain a considerable mass fraction of water. The purpose of this study is to investigate the relative scarcity of these detections. Based on a new and highly detailed model, we evaluate the retention of water inside icy minor planets during the high-luminosity stellar evolution that follows the main sequence. Our model fully considers the thermal, physical, and chemical evolution of icy bodies, following their internal differentiation as well as water depletion, from the moment of their birth and through all stellar evolution phases preceding the formation of the white dwarf. We also account for different initial compositions and formation times. Our results differ from previous studies, which have either underestimated or overestimated water retention. We show that water can survive in a variety of circumstances and in great quantities, and therefore other possibilities are discussed in order to explain the infrequency of water detection. We predict that the sequence of accretion is such that water accretes earlier, and more rapidly, than the rest of the silicate disk, considerably reducing the chance of its detection in H-dominated atmospheres. In He-dominated atmospheres, the scarcity of water detections could be observationally biased. It implies that the accreted material is typically intrinsically dry, which may be the result of the inside-out depopulation sequence of minor planets.

  11. POST-MAIN SEQUENCE EVOLUTION OF ICY MINOR PLANETS: IMPLICATIONS FOR WATER RETENTION AND WHITE DWARF POLLUTION

    International Nuclear Information System (INIS)

    Malamud, Uri; Perets, Hagai B.

    2016-01-01

    Most observations of polluted white dwarf atmospheres are consistent with accretion of water-depleted planetary material. Among tens of known cases, merely two involve accretion of objects that contain a considerable mass fraction of water. The purpose of this study is to investigate the relative scarcity of these detections. Based on a new and highly detailed model, we evaluate the retention of water inside icy minor planets during the high-luminosity stellar evolution that follows the main sequence. Our model fully considers the thermal, physical, and chemical evolution of icy bodies, following their internal differentiation as well as water depletion, from the moment of their birth and through all stellar evolution phases preceding the formation of the white dwarf. We also account for different initial compositions and formation times. Our results differ from previous studies, which have either underestimated or overestimated water retention. We show that water can survive in a variety of circumstances and in great quantities, and therefore other possibilities are discussed in order to explain the infrequency of water detection. We predict that the sequence of accretion is such that water accretes earlier, and more rapidly, than the rest of the silicate disk, considerably reducing the chance of its detection in H-dominated atmospheres. In He-dominated atmospheres, the scarcity of water detections could be observationally biased. It implies that the accreted material is typically intrinsically dry, which may be the result of the inside-out depopulation sequence of minor planets.

  12. Fluid-driven normal faulting earthquake sequences in the Taiwan orogen

    Science.gov (United States)

    Wang, Ling-hua; Rau, Ruey-Juin; Lee, En-Jui

    2017-04-01

    Seismicity in the Central Range of Taiwan shows normal faulting mechanisms with T-axes directing NE, subparallel to the strike of the mountain belt. We analyze earthquake sequences occurred within 2012-2015 in the Nanshan area of northern Taiwan which indicating swarm behavior and migration characteristics. We select events larger than 2.0 from Central Weather Bureau catalog and use the double-difference relocation program hypoDD with waveform cross-correlation in the Nanshan area. We obtained a final count of 1406 (95%) relocated earthquakes. Moreover, we compute focal mechanisms using USGS program HASH by P-wave first motion and S/P ratio picking and 114 fault plane solutions with M 3.0-5.87 were determined. To test for fluid diffusion, we model seismicity using the equation of Shapiro et al. (1997) by fitting earthquake diffusing rate D during the migration period. According to the relocation result, seismicity in the Taiwan orogenic belt present mostly N25E orientation parallel to the mountain belt with the same direction of the tension axis. In addition, another seismic fracture depicted by seismicity rotated 35 degree counterclockwise to the NW direction. Nearly all focal mechanisms are normal fault type. In the Nanshan area, events show N10W distribution with a focal depth range from 5-12 km and illustrate fault plane dipping about 45-60 degree to SW. Three months before the M 5.87 mainshock which occurred in March, 2013, there were some foreshock events occurred in the shallow part of the fault plane of the mainshock. Half a year following the mainshock, earthquakes migrated to the north and south, respectively with processes matched the diffusion model at a rate of 0.2-0.6 m2/s. This migration pattern and diffusion rate offer an evidence of 'fluid-driven' process in the fault zone. We also find the upward migration of earthquakes in the mainshock source region. These phenomena are likely caused by the opening of the permeable conduit due to the M 5

  13. AN M DWARF COMPANION TO AN F-TYPE STAR IN A YOUNG MAIN-SEQUENCE BINARY

    Energy Technology Data Exchange (ETDEWEB)

    Eigmüller, Ph.; Csizmadia, Sz.; Erikson, A.; Fridlund, M.; Pasternacki, Th.; Rauer, H. [Institute of Planetary Research, German Aerospace Center Rutherfordstr. 2, D-12489 Berlin (Germany); Eislöffel, J.; Lehmann, H.; Hartmann, M.; Hatzes, A. [Thüringer Landessternwarte Tautenburg Sternwarte 5, D-07778 Tautenburg (Germany); Tkachenko, A. [Instituut voor Sterrenkunde, KU Leuven Celestijnenlaan 200D, 3001 Leuven (Belgium); Voss, H., E-mail: philipp.eigmueller@dlr.de [Universitat de Barcelona, Department of Astronomy and Meteorology Martí i Franquès, 1, E-08028 Barcelona (Spain)

    2016-03-15

    Only a few well characterized very low-mass M dwarfs are known today. Our understanding of M dwarfs is vital as these are the most common stars in our solar neighborhood. We aim to characterize the properties of a rare F+dM stellar system for a better understanding of the low-mass end of the Hertzsprung–Russel diagram. We used photometric light curves and radial velocity follow-up measurements to study the binary. Spectroscopic analysis was used in combination with isochrone fitting to characterize the primary star. The primary star is an early F-type main-sequence star with a mass of (1.493 ± 0.073) M{sub ⊙} and a radius of (1.474 ± 0.040) R{sub ⊙}. The companion is an M dwarf with a mass of (0.188 ± 0.014) M{sub ⊙} and a radius of (0.234 ± 0.009) R{sub ⊙}. The orbital period is (1.35121 ± 0.00001) days. The secondary star is among the lowest-mass M dwarfs known to date. The binary has not reached a 1:1 spin–orbit synchronization. This indicates a young main-sequence binary with an age below ∼250 Myr. The mass–radius relation of both components are in agreement with this finding.

  14. TESTING SCALING RELATIONS FOR SOLAR-LIKE OSCILLATIONS FROM THE MAIN SEQUENCE TO RED GIANTS USING KEPLER DATA

    Energy Technology Data Exchange (ETDEWEB)

    Huber, D.; Bedding, T. R.; Stello, D. [Sydney Institute for Astronomy (SIfA), School of Physics, University of Sydney, NSW 2006 (Australia); Hekker, S. [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Mathur, S. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Mosser, B. [LESIA, CNRS, Universite Pierre et Marie Curie, Universite Denis, Diderot, Observatoire de Paris, 92195 Meudon cedex (France); Verner, G. A.; Elsworth, Y. P.; Hale, S. J.; Chaplin, W. J. [School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Bonanno, A. [INAF Osservatorio Astrofisico di Catania (Italy); Buzasi, D. L. [Eureka Scientific, 2452 Delmer Street Suite 100, Oakland, CA 94602-3017 (United States); Campante, T. L. [Centro de Astrofisica da Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Kallinger, T. [Department of Physics and Astronomy, University of British Columbia, Vancouver (Canada); Silva Aguirre, V. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, 85748 Garching (Germany); De Ridder, J. [Instituut voor Sterrenkunde, K.U.Leuven (Belgium); Garcia, R. A. [Laboratoire AIM, CEA/DSM-CNRS, Universite Paris 7 Diderot, IRFU/SAp, Centre de Saclay, 91191, Gif-sur-Yvette (France); Appourchaux, T. [Institut d' Astrophysique Spatiale, UMR 8617, Universite Paris Sud, 91405 Orsay Cedex (France); Frandsen, S. [Danish AsteroSeismology Centre (DASC), Department of Physics and Astronomy, Aarhus University, DK-8000 Aarhus C (Denmark); Houdek, G., E-mail: dhuber@physics.usyd.edu.au [Institute of Astronomy, University of Vienna, 1180 Vienna (Austria); and others

    2011-12-20

    We have analyzed solar-like oscillations in {approx}1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power ({nu}{sub max}), the large frequency separation ({Delta}{nu}), and oscillation amplitudes. We show that the difference of the {Delta}{nu}-{nu}{sub max} relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M){sup s} scaling nor the revised scaling relation by Kjeldsen and Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of {approx}25%. The residuals show an offset particularly for unevolved stars, suggesting that an additional physical dependency is necessary to fully reproduce the observed amplitudes. We investigate correlations between amplitudes and stellar activity, and find evidence that the effect of amplitude suppression is most pronounced for subgiant stars. Finally, we test the location of the cool edge of the instability strip in the Hertzsprung-Russell diagram using solar-like oscillations and find the detections in the hottest stars compatible with a domain of hybrid stochastically excited and opacity driven pulsation.

  15. PRE-MAIN-SEQUENCE TURN-ON AS A CHRONOMETER FOR YOUNG CLUSTERS: NGC 346 AS A BENCHMARK

    International Nuclear Information System (INIS)

    Cignoni, M.; Tosi, M.; Sabbi, E.; Nota, A.; Degl'Innocenti, S.; Moroni, P. G. Prada; Gallagher, J. S.

    2010-01-01

    We present a novel approach to deriving the age of very young star clusters, by using the Turn-On (TOn). The TOn is the point in the color-magnitude diagram (CMD) where the pre-main sequence (PMS) joins the main sequence (MS). In the MS luminosity function (LF) of the cluster, the TOn is identified as a peak followed by a dip. We propose that by combining the CMD analysis with the monitoring of the spatial distribution of MS stars it is possible to reliably identify the TOn in extragalactic star-forming regions. Compared to alternative methods, this technique is complementary to the turnoff dating and avoids the systematic biases affecting the PMS phase. We describe the method and its uncertainties and apply it to the star-forming region NGC 346, which has been extensively imaged with the Hubble Space Telescope (HST). This study extends the LF approach in crowded extragalactic regions and opens the way for future studies with HST/WFC3, the James Webb Space Telescope and from the ground with adaptive optics.

  16. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  17. Characterizing the heterogeneity of triple-negative breast cancers using microdissected normal ductal epithelium and RNA-sequencing.

    Science.gov (United States)

    Radovich, Milan; Clare, Susan E; Atale, Rutuja; Pardo, Ivanesa; Hancock, Bradley A; Solzak, Jeffrey P; Kassem, Nawal; Mathieson, Theresa; Storniolo, Anna Maria V; Rufenbarger, Connie; Lillemoe, Heather A; Blosser, Rachel J; Choi, Mi Ran; Sauder, Candice A; Doxey, Diane; Henry, Jill E; Hilligoss, Eric E; Sakarya, Onur; Hyland, Fiona C; Hickenbotham, Matthew; Zhu, Jin; Glasscock, Jarret; Badve, Sunil; Ivan, Mircea; Liu, Yunlong; Sledge, George W; Schneider, Bryan P

    2014-01-01

    Triple-negative breast cancers (TNBCs) are a heterogeneous set of tumors defined by an absence of actionable therapeutic targets (ER, PR, and HER-2). Microdissected normal ductal epithelium from healthy volunteers represents a novel comparator to reveal insights into TNBC heterogeneity and to inform drug development. Using RNA-sequencing data from our institution and The Cancer Genome Atlas (TCGA) we compared the transcriptomes of 94 TNBCs, 20 microdissected normal breast tissues from healthy volunteers from the Susan G. Komen for the Cure Tissue Bank, and 10 histologically normal tissues adjacent to tumor. Pathway analysis comparing TNBCs to optimized normal controls of microdissected normal epithelium versus classic controls composed of adjacent normal tissue revealed distinct molecular signatures. Differential gene expression of TNBC compared with normal comparators demonstrated important findings for TNBC-specific clinical trials testing targeted agents; lack of over-expression for negative studies and over-expression in studies with drug activity. Next, by comparing each individual TNBC to the set of microdissected normals, we demonstrate that TNBC heterogeneity is attributable to transcriptional chaos, is associated with non-silent DNA mutational load, and explains transcriptional heterogeneity in addition to known molecular subtypes. Finally, chaos analysis identified 146 core genes dysregulated in >90 % of TNBCs revealing an over-expressed central network. In conclusion, use of microdissected normal ductal epithelium from healthy volunteers enables an optimized approach for studying TNBC and uncovers biological heterogeneity mediated by transcriptional chaos.

  18. Grain temperature, radiation pressure and electric potential in the vicinity of main sequence and white dwarf stars

    Energy Technology Data Exchange (ETDEWEB)

    Leiknes, J.; Havnes, O. (University of Tromso, Auroral Observatory (Norway))

    1984-08-01

    We present results of calculations of the grain physical parameters temperature, lifetime against evaporation, radiation pressure and electric potential for spherical grains near main sequence stars, hydrogen type (DA) white dwarfs and helium type (DB) white dwarfs. These parameters are essential in determining the behaviour of grains near such stars. The grain temperature as a function of stellar distance is calculated for grains of sizes 0.1 and 1 ..mu.. (micron) for grain materials of silicate (obsidian), iron and graphite. The lifetime due to thermal evaporation as a function of grain temperature of these materials is also given. The radiation pressure is given for grain sizes from 0.01 to 10 ..mu.. for the same three grain materials. Grain potentials have been calculated as functions of stellar distance for one photoelectron high yield material (silicate) and one low yield material (graphite) for grains of radius 0.1 ..mu.. embedded in a thermal plasma of temperature T = 10/sup 4/ K.

  19. Radio-emission of pre-main sequence stars of the Rho Ophiuchi cloud: observations and interpretation

    International Nuclear Information System (INIS)

    Andre, P.

    1987-11-01

    Observations of the radio continuum emission of a young star population have been made at VLA on the whole molecular cloud Rho Ophiuchi, one of the closest site of star formation. A dozen of stellar sources have been detected. Radio emission of some identified objects seems to have a magnetic nature and be produced by gyrosynchrotron mechanism. In particular, one of the sources shows a radio radiation circularly polarized; two other stars have a radiation strongly variable probably due to magnetic eruptions more important than those detected in X radiation. More generally, radio observations select probably a specific population of young stars characterized by magnetic field presence extended on several stellar radii and by absence of dense circumstellar environment. Spatial distribution of these objects suggest, they are younger than most of the pre-main sequence stars [fr

  20. The Solar Neighborhood. XLI. A Study of the Wide Main Sequence for M Dwarfs—Long-term Photometric Variability

    Energy Technology Data Exchange (ETDEWEB)

    Clements, Tiffany D.; Jao, Wei-Chun; Silverstein, Michele L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Henry, Todd J.; Hosey, Altonio D. [RECONS Institute, Chambersburg, PA 17201 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Dieterich, Sergio B. [Carnegie Institution for Science, Washington, DC 20015 (United States); Riedel, Adric R., E-mail: pewett@astro.gsu.edu, E-mail: jao@astro.gsu.edu, E-mail: silverstein@astro.gsu.edu, E-mail: toddhenry28@gmail.com, E-mail: altoniohosey@gmail.com, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: sdieterich@carnegiescience.edu, E-mail: adric.riedel@gmail.com [Space Telescope Science Institute, Baltimore, MD 21218 (United States)

    2017-09-01

    We report findings from a long-term photometric variability study of M dwarfs carried out at the SMARTS 0.9 m telescope at the Cerro Tololo Inter-American Observatory. As part of a multi-faceted effort to investigate the range of luminosities of M dwarfs of a given color on the Hertzsprung–Russell Diagram, 76 M dwarfs have been observed for 3–17 years in the Johnson–Kron–Cousins V band. We find that stars elevated above the center of the main sequence distribution tend to have higher levels of variability, likely caused by magnetic activity, than their fainter counterparts below the center. This study provides insight into how the long-term magnetic activity of these stars may be affecting their sizes, luminosities, and thus positions on the H-R Diagram.

  1. Lithium abundances and metallicities in stars near the main-sequence turnoff and a giant in M67

    International Nuclear Information System (INIS)

    Garcia Lopez, R.J.; Rebolo, R.; Beckman, J.E.

    1988-01-01

    The iron abundance of seven stars near the main-sequence (MS) turnoff and a giant in M67 are spectroscopically derived, and the results are discussed. The resulting mean iron abundance of the turnoff stars is (Fe/H) = 0.04 + or - 0.04. Taken together with previous determinations for younger clusters, this shows that there has been relatively little change of the iron abundance in the solar neighborhood during the last 5 Gyr. Lithium was detected in one unevolved star and marginally in the giant, while in the other MS stars only upper limits were found. The considerable differences in Li abundances for stars with similar surface temperature imply that there is at least one parameter affecting Li depletion apart from stellar mass and metallicity. Nonsimultaneous star formation in the cluster cloud explain the scatter in lithium abundances. 50 references

  2. X-ray sources in regions of star formation. II. The pre-main-sequence G star HDE 283572

    International Nuclear Information System (INIS)

    Walter, F.M.; Brown, A.; Linsky, J.L.; Rydgren, A.E.; Vrba, F.; Joint Institute for Laboratory Astrophysics, Boulder, CO; Computer Sciences Corp., El Segundo, CA; Naval Observatory, Flagstaff, AZ)

    1987-01-01

    This paper reports the detection of HDE 283572, a ninth-magnitude G star 8 arcmin south of RY Tau, as a bright X-ray source. The observations reveal this object to be a fairly massive (about 2 solar masses) pre-main-sequence star associated with the Taurus-Auriga star formation complex. It exhibits few of the characteristics of the classical T Tauri stars and is a good example of a naked T Tauri star. The star is a mid-G subgiant, of about three solar radii and rotates with a period of 1.5 d. The coronal and chromospheric surface fluxes are similar to those of the most active late type stars (excluding T Tauri stars). The X-ray and UV lines most likely arise in different atmospheric structures. Radiative losses are some 1000 times the quiet solar value and compare favorably with those of T Tauri stars. 49 references

  3. Stellar Variability at the Main-sequence Turnoff of the Intermediate-age LMC Cluster NGC 1846

    Science.gov (United States)

    Salinas, R.; Pajkos, M. A.; Vivas, A. K.; Strader, J.; Contreras Ramos, R.

    2018-04-01

    Intermediate-age (IA) star clusters in the Large Magellanic Cloud (LMC) present extended main-sequence turn-offs (MSTO) that have been attributed to either multiple stellar populations or an effect of stellar rotation. Recently it has been proposed that these extended main sequences can also be produced by ill-characterized stellar variability. Here we present Gemini-S/Gemini Multi-Object Spectrometer (GMOS) time series observations of the IA cluster NGC 1846. Using differential image analysis, we identified 73 new variable stars, with 55 of those being of the Delta Scuti type, that is, pulsating variables close the MSTO for the cluster age. Considering completeness and background contamination effects, we estimate the number of δ Sct belonging to the cluster between 40 and 60 members, although this number is based on the detection of a single δ Sct within the cluster half-light radius. This amount of variable stars at the MSTO level will not produce significant broadening of the MSTO, albeit higher-resolution imaging will be needed to rule out variable stars as a major contributor to the extended MSTO phenomenon. Though modest, this amount of δ Sct makes NGC 1846 the star cluster with the highest number of these variables ever discovered. Lastly, our results present a cautionary tale about the adequacy of shallow variability surveys in the LMC (like OGLE) to derive properties of its δ Sct population. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the National Research Council (Canada), CONICYT (Chile), Ministerio de Ciencia, Tecnología e Innovación Productiva (Argentina), and Ministério da Ciência, Tecnologia e Inovação (Brazil).

  4. MASS LOSS IN PRE-MAIN-SEQUENCE STARS VIA CORONAL MASS EJECTIONS AND IMPLICATIONS FOR ANGULAR MOMENTUM LOSS

    Energy Technology Data Exchange (ETDEWEB)

    Aarnio, Alicia N. [Astronomy Department, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States); Matt, Sean P. [Laboratoire AIM Paris-Saclay, CEA/Irfu Universite Paris-Diderot CNRS/INSU, F-91191 Gif-sur-Yvette (France); Stassun, Keivan G., E-mail: aarnio@umich.edu [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States)

    2012-11-20

    We develop an empirical model to estimate mass-loss rates via coronal mass ejections (CMEs) for solar-type pre-main-sequence (PMS) stars. Our method estimates the CME mass-loss rate from the observed energies of PMS X-ray flares, using our empirically determined relationship between solar X-ray flare energy and CME mass: log (M {sub CME}[g]) = 0.63 Multiplication-Sign log (E {sub flare}[erg]) - 2.57. Using masses determined for the largest flaring magnetic structures observed on PMS stars, we suggest that this solar-calibrated relationship may hold over 10 orders of magnitude in flare energy and 7 orders of magnitude in CME mass. The total CME mass-loss rate we calculate for typical solar-type PMS stars is in the range 10{sup -12}-10{sup -9} M {sub Sun} yr{sup -1}. We then use these CME mass-loss rate estimates to infer the attendant angular momentum loss leading up to the main sequence. Assuming that the CME outflow rate for a typical {approx}1 M {sub Sun} T Tauri star is <10{sup -10} M {sub Sun} yr{sup -1}, the resulting spin-down torque is too small during the first {approx}1 Myr to counteract the stellar spin-up due to contraction and accretion. However, if the CME mass-loss rate is {approx}> 10{sup -10} M {sub Sun} yr{sup -1}, as permitted by our calculations, then the CME spin-down torque may influence the stellar spin evolution after an age of a few Myr.

  5. Detection of [O III] at z ∼ 3: A Galaxy Above the Main Sequence, Rapidly Assembling Its Stellar Mass

    Science.gov (United States)

    Vishwas, Amit; Ferkinhoff, Carl; Nikola, Thomas; Parshley, Stephen C.; Schoenwald, Justin P.; Stacey, Gordon J.; Higdon, Sarah J. U.; Higdon, James L.; Weiss, Axel; Güsten, Rolf; Menten, Karl M.

    2018-04-01

    We detect bright emission in the far-infrared (far-IR) fine structure [O III] 88 μm line from a strong lensing candidate galaxy, H-ATLAS J113526.3-014605, hereafter G12v2.43, at z = 3.127, using the second-generation Redshift (z) and Early Universe Spectrometer (ZEUS-2) at the Atacama Pathfinder Experiment Telescope (APEX). This is only the fifth detection of this far-IR line from a submillimeter galaxy at the epoch of galaxy assembly. The observed [O III] luminosity of 7.1 × 109 ≤ft(\\tfrac{10}{μ }\\right) L ⊙ likely arises from H II regions around massive stars, and the amount of Lyman continuum photons required to support the ionization indicate the presence of (1.2–5.2) × 106 ≤ft(\\tfrac{10}{μ }\\right) equivalent O5.5 or higher stars, where μ would be the lensing magnification factor. The observed line luminosity also requires a minimum mass of ∼2 × 108 ≤ft(\\tfrac{10}{μ }\\right) M ⊙ in ionized gas, that is 0.33% of the estimated total molecular gas mass of 6 × 1010 ≤ft(\\tfrac{10}{μ }\\right) M ⊙. We compile multi-band photometry tracing rest-frame ultraviolet to millimeter continuum emission to further constrain the properties of this dusty high-redshift, star-forming galaxy. Via SED modeling we find G12v2.43 is forming stars at a rate of 916 ≤ft(\\tfrac{10}{μ }\\right) M ⊙ yr‑1 and already has a stellar mass of 8 × 1010 ≤ft(\\tfrac{10}{μ }\\right) M ⊙. We also constrain the age of the current starburst to be ≤slant 5 Myr, making G12v2.43 a gas-rich galaxy lying above the star-forming main sequence at z ∼ 3, undergoing a growth spurt, and it could be on the main sequence within the derived gas depletion timescale of ∼66 Myr.

  6. New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes for radiation molecular cytogenetics

    Directory of Open Access Journals (Sweden)

    Repin Mikhail V

    2009-06-01

    Full Text Available Abstract Background The objective of this work is to obtain the correct relative DNA contents of chromosomes in the normal male and female human diploid genomes for the use at FISH analysis of radiation-induced chromosome aberrations. Results The relative DNA contents of chromosomes in the male and female human diploid genomes have been calculated from the publicly available international Human Genome Project data. New sequence-based data on the relative DNA contents of human chromosomes were compared with the data recommended by the International Atomic Energy Agency in 2001. The differences in the values of the relative DNA contents of chromosomes obtained by using different approaches for 15 human chromosomes, mainly for large chromosomes, were below 2%. For the chromosomes 13, 17, 20 and 22 the differences were above 5%. Conclusion New sequence-based data on the relative DNA contents of chromosomes in the normal male and female human diploid genomes were obtained. This approach, based on the genome sequence, can be recommended for the use in radiation molecular cytogenetics.

  7. Speech Motor Sequence Learning: Acquisition and Retention in Parkinson Disease and Normal Aging

    Science.gov (United States)

    Whitfield, Jason A.; Goberman, Alexander M.

    2017-01-01

    Purpose: The aim of the current investigation was to examine speech motor sequence learning in neurologically healthy younger adults, neurologically healthy older adults, and individuals with Parkinson disease (PD) over a 2-day period. Method: A sequential nonword repetition task was used to examine learning over 2 days. Participants practiced a…

  8. Effective Normalization for Copy Number Variation Detection from Whole Genome Sequencing

    NARCIS (Netherlands)

    Janevski, A.; Varadan, V.; Kamalakaran, S.; Banerjee, N.; Dimitrova, D.

    2012-01-01

    Background Whole genome sequencing enables a high resolution view ofthe human genome and provides unique insights into genome structureat an unprecedented scale. There have been a number of tools to infer copy number variation in the genome. These tools while validatedalso include a number of

  9. Post-main-sequence Evolution of Icy Minor Planets. II. Water Retention and White Dwarf Pollution around Massive Progenitor Stars

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Uri; Perets, Hagai B., E-mail: uri.mal@tx.technion.ac.il, E-mail: hperets@physics.technion.ac.il [Department of Physics, Technion (Israel)

    2017-06-10

    Most studies suggest that the pollution of white dwarf (WD) atmospheres arises from the accretion of minor planets, but the exact properties of polluting material, and in particular the evidence for water in some cases, are not yet understood. Here we study the water retention of small icy bodies in exo-solar planetary systems, as their respective host stars evolve through and off the main sequence and eventually become WDs. We explore, for the first time, a wide range of star masses and metallicities. We find that the mass of the WD progenitor star is of crucial importance for the retention of water, while its metallicity is relatively unimportant. We predict that minor planets around lower-mass WD progenitors would generally retain more water and would do so at closer distances from the WD than compared with high-mass progenitors. The dependence of water retention on progenitor mass and other parameters has direct implications for the origin of observed WD pollution, and we discuss how our results and predictions might be tested in the future as more observations of WDs with long cooling ages become available.

  10. Rotation-induced YORP break-up of small bodies to produce post-main-sequence debris

    Science.gov (United States)

    Veras, D.; Jacobson, S. A.; Gänsicke, B. T.

    2017-09-01

    We hypothesize that the in situ break-up of small bodies such as asteroids spun to fission during the giant branch phases of stellar evolution provides an important contribution to the debris orbiting and ultimately polluting white dwarfs. The YORP (Yarkovsky-O'Keefe-Radviesvki-Paddock) effect, which arises from radiation pressure, accelerates the spin rate of asymmetric asteroids, which can eventually shear themselves apart. This pressure is maintained and enhanced around dying stars because the outward push of an asteroid due to stellar mass loss is insignificant compared to the resulting stellar luminosity increase. Consequently, giant star radiation will destroy nearly all bodies with radii in the range 100 m-10 km that survive their parent star's main-sequence lifetime within a distance of about 7 au; smaller bodies are spun apart to their strongest, competent components. This estimate is conservative and would increase for highly asymmetric shapes or incorporation of the inward drag due to giant star stellar wind. The resulting debris field, which could extend to thousands of au, may be perturbed by remnant planetary systems to reproduce the observed dusty and gaseous discs which accompany polluted white dwarfs.

  11. THE EXTENDED MAIN-SEQUENCE TURNOFF CLUSTERS OF THE LARGE MAGELLANIC CLOUD-MISSING LINKS IN GLOBULAR CLUSTER EVOLUTION

    International Nuclear Information System (INIS)

    Keller, Stefan C.; Mackey, A. Dougal; Da Costa, Gary S.

    2011-01-01

    Recent observations of intermediate-age (1-3 Gyr) massive star clusters in the Large Magellanic Cloud have revealed that the majority possess bifurcated or extended main-sequence turnoff (EMSTO) morphologies. This effect can be understood to arise from subsequent star formation among the stellar population with age differences between constituent stars amounting to 50-300 Myr. Age spreads of this order are similarly invoked to explain the light-element abundance variations witnessed in ancient globular clusters (GCs). In this paper, we explore the proposition that the clusters exhibiting the EMSTO phenomenon are a general phase in the evolution of massive clusters, one that naturally leads to the particular chemical properties of the ancient GC population. We show that the isolation of EMSTO clusters to intermediate ages is the consequence of observational selection effects. In our proposed scenario, the EMSTO phenomenon is identical to that which establishes the light-element abundance variations that are ubiquitous in the ancient GC population. Our scenario makes a strong prediction: EMSTO clusters will exhibit abundance variations in the light-elements characteristic of the ancient GC population.

  12. AK SCO, FIRST DETECTION OF A HIGHLY DISTURBED ATMOSPHERE IN A PRE-MAIN-SEQUENCE CLOSE BINARY

    International Nuclear Information System (INIS)

    Gomez de Castro, Ana I.

    2009-01-01

    AK Sco is a unique source: a ∼10 Myr old pre-main-sequence (PMS) spectroscopic binary composed of two nearly equal F5 stars that at periastron are separated by barely 11 stellar radii, so the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes AK Sco the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during PMS evolution. In this Letter, the detection of a highly disturbed (σ ≅ 100 km s -1 ) and very dense atmosphere (n e = 1.6 x 10 10 cm -3 ) is reported. Significant line broadening blurs any signs of ion belts or bow shocks in the spectrum of the atmospheric plasma. The radiative losses cannot be accounted for solely by the dissipation of energy from the tidal wave propagating in the stellar atmosphere or by the accreting material. The release of internal energy from the star seems to be the most likely source of the plasma heating. This is the first clear indication of a highly disturbed atmosphere surrounding a PMS close binary.

  13. AK Sco, First Detection of a Highly Disturbed Atmosphere in a Pre-Main-Sequence Close Binary

    Science.gov (United States)

    Gómez de Castro, Ana I.

    2009-06-01

    AK Sco is a unique source: a ~10 Myr old pre-main-sequence (PMS) spectroscopic binary composed of two nearly equal F5 stars that at periastron are separated by barely 11 stellar radii, so the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes AK Sco the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during PMS evolution. In this Letter, the detection of a highly disturbed (σ sime 100 km s-1) and very dense atmosphere (n e = 1.6 × 1010 cm-3) is reported. Significant line broadening blurs any signs of ion belts or bow shocks in the spectrum of the atmospheric plasma. The radiative losses cannot be accounted for solely by the dissipation of energy from the tidal wave propagating in the stellar atmosphere or by the accreting material. The release of internal energy from the star seems to be the most likely source of the plasma heating. This is the first clear indication of a highly disturbed atmosphere surrounding a PMS close binary.

  14. 2D and 3D Models of Convective Turbulence and Oscillations in Intermediate-Mass Main-Sequence Stars

    Science.gov (United States)

    Guzik, Joyce Ann; Morgan, Taylor H.; Nelson, Nicholas J.; Lovekin, Catherine; Kitiashvili, Irina N.; Mansour, Nagi N.; Kosovichev, Alexander

    2015-08-01

    We present multidimensional modeling of convection and oscillations in main-sequence stars somewhat more massive than the sun, using three separate approaches: 1) Applying the spherical 3D MHD ASH (Anelastic Spherical Harmonics) code to simulate the core convection and radiative zone. Our goal is to determine whether core convection can excite low-frequency gravity modes, and thereby explain the presence of low frequencies for some hybrid gamma Dor/delta Sct variables for which the envelope convection zone is too shallow for the convective blocking mechanism to drive g modes; 2) Using the 3D planar ‘StellarBox’ radiation hydrodynamics code to model the envelope convection zone and part of the radiative zone. Our goals are to examine the interaction of stellar pulsations with turbulent convection in the envelope, excitation of acoustic modes, and the role of convective overshooting; 3) Applying the ROTORC 2D stellar evolution and dynamics code to calculate evolution with a variety of initial rotation rates and extents of core convective overshooting. The nonradial adiabatic pulsation frequencies of these nonspherical models will be calculated using the 2D pulsation code NRO of Clement. We will present new insights into gamma Dor and delta Sct pulsations gained by multidimensional modeling compared to 1D model expectations.

  15. Sequence of activation of template biosyntheses in normal and transformed human cells after synchronization with a double thimidine block

    International Nuclear Information System (INIS)

    Alekseev, S.B.; Boikov, P.Ya.; Ebralidze, L.K.; Stepanova, L.G.

    1986-01-01

    The sequences of synthesis of DNA, RNA, and various groups of proteins in normal and transformed human fibroblasts was studied in the first mitotic cycle synchronization of the cells by a double thymidine block. Two peculiarities of the synthesis of acid-soluble histone and acid-insoluble proteins in the normal and transformed cells, were detected: (1) in normal fibroblasts the synthesis of the two groups of proteins is a minimum before DNA replication, and the greatest activity is achieved in the G 2 phase; in transformed cells protein synthesis is a maximum after the removal of the thymine block, while in the G 2 phase it is decreased; (2) in normal fibroblasts the synthesis of acid-insoluble proteins is a maximum before the maximum synthesis of DNA, and that of acid-soluble proteins is a maximum after the maximum of DNA synthesis. The opposite picture is observed in transformed cells. RNA synthesis in normal and transformed cells is activated at the end of the G 2 phase. In normal cells the synthesis of proteins is coupled with the activation of RNA synthesis, while in transformed cells protein synthesis is evidently transferred to the following mitotic cycle. Especially pronounced differences were detected in the expression of certain LMG proteins. Thus, in transformed cells the regulation of the coupling of the template syntheses is modified

  16. A Correlation Study between Geometry of Collared Coils and Normal Quadrupole Multipole in the Main LHC Dipoles

    CERN Document Server

    Bertinelli, F; Berthollon-Vitte, S; Glaude, D; Vanenkov, I

    2006-01-01

    The quality control implemented at all LHC dipole assemblers includes precise mechanical measurements of the geometry of collared coils. A cross-analysis performed between mechanical and magnetic measurements data shows a correlation between collared coils outer dimensions and the normal quadrupole multipole (b2) for one dipole assembler. The profile geometry of the single collars - as determined from 3D measurements at the collar suppliers and CERN - could not account alone for the significant left – right aperture asymmetry observed. This triggered a deeper investigation on different elements of the geometry of single collars. The results of this work show that the relative positioning of the collaring holes, allowing a small bending deformation of collars under the effect of coil pre-stress, is an important effect that generates a b2 multipole at the limit of specification. The study has deepened the understanding of the factors affecting collared coil geometry and field quality. The precision of 3D m...

  17. The Problem of Hipparcos Distances to Open Clusters. Report 1; Constraints from Multicolor a Main-Sequence Fitting

    Science.gov (United States)

    Pinsonneault, Marc H.; Stauffer, John; Soderblom, David R.; King, Jeremy R.; Hanson, Robert B.

    1998-01-01

    Parallax data from the Hipparcos mission allow the direct distance to open clusters to be compared with the distance inferred from main-sequence (MS) fitting. There are surprising differences between the two distance measurements. indicating either the need for changes in the cluster compositions or reddening, underlying problems with the technique of MS fitting, or systematic errors in the Hipparcos parallaxes at the 1 mas level. We examine the different possibilities, focusing on MS fitting in both metallicity-sensitive B-V and metallicity-insensitive V-I for five well-studied systems (the Hyades, Pleiades, alpha Per, Praesepe, and Coma Ber). The Hipparcos distances to the Hyades and alpha Per are within 1 sigma of the MS-fitting distance in B-V and V-I, while the Hipparcos distances to Coma Ber and the Pleiades are in disagreement with the MS-fitting distance at more than the 3 sigma level. There are two Hipparcos measurements of the distance to Praesepe; one is in good agreement with the MS-fitting distance and the other disagrees at the 2 sigma level. The distance estimates from the different colors are in conflict with one another for Coma but in agreement for the Pleiades. Changes in the relative cluster metal abundances, age related effects, helium, and reddening are shown to be unlikely to explain the puzzling behavior of the Pleiades. We present evidence for spatially dependent systematic errors at the 1 mas level in the parallaxes of Pleiades stars. The implications of this result are discussed.

  18. ON THE RELIABILITY OF STELLAR AGES AND AGE SPREADS INFERRED FROM PRE-MAIN-SEQUENCE EVOLUTIONARY MODELS

    International Nuclear Information System (INIS)

    Hosokawa, Takashi; Offner, Stella S. R.; Krumholz, Mark R.

    2011-01-01

    We revisit the problem of low-mass pre-main-sequence stellar evolution and its observational consequences for where stars fall on the Hertzsprung-Russell diagram (HRD). In contrast to most previous work, our models follow stars as they grow from small masses via accretion, and we perform a systematic study of how the stars' HRD evolution is influenced by their initial radius, by the radiative properties of the accretion flow, and by the accretion history, using both simple idealized accretion histories and histories taken from numerical simulations of star cluster formation. We compare our numerical results to both non-accreting isochrones and to the positions of observed stars in the HRD, with a goal of determining whether both the absolute ages and the age dispersions inferred from non-accreting isochrones are reliable. We show that non-accreting isochrones can sometimes overestimate stellar ages for more massive stars (those with effective temperatures above ∼3500 K), thereby explaining why non-accreting isochrones often suggest a systematic age difference between more and less massive stars in the same cluster. However, we also find the only way to produce a similar overestimate for the ages of cooler stars is if these stars grow from ∼0.01 M sun seed protostars that are an order of magnitude smaller than predicted by current theoretical models, and if the size of the seed protostar correlates systematically with the final stellar mass at the end of accretion. We therefore conclude that, unless both of these conditions are met, inferred ages and age spreads for cool stars are reliable, at least to the extent that the observed bolometric luminosities and temperatures are accurate. Finally, we note that the time dependence of the mass accretion rate has remarkably little effect on low-mass stars' evolution on the HRD, and that such time dependence may be neglected for all stars except those with effective temperatures above ∼4000 K.

  19. Probabilistic Inference on Multiple Normalized Signal Profiles from Next Generation Sequencing: Transcription Factor Binding Sites

    KAUST Repository

    Wong, Ka-Chun; Peng, Chengbin; Li, Yue

    2015-01-01

    With the prevalence of chromatin immunoprecipitation (ChIP) with sequencing (ChIP-Seq) technology, massive ChIP-Seq data has been accumulated. The ChIP-Seq technology measures the genome-wide occupancy of DNA-binding proteins in vivo. It is well-known that different DNA-binding protein occupancies may result in a gene being regulated in different conditions (e.g. different cell types). To fully understand a gene's function, it is essential to develop probabilistic models on multiple ChIP-Seq profiles for deciphering the gene transcription causalities. In this work, we propose and describe two probabilistic models. Assuming the conditional independence of different DNA-binding proteins' occupancies, the first method (SignalRanker) is developed as an intuitive method for ChIP-Seq genome-wide signal profile inference. Unfortunately, such an assumption may not always hold in some gene regulation cases. Thus, we propose and describe another method (FullSignalRanker) which does not make the conditional independence assumption. The proposed methods are compared with other existing methods on ENCODE ChIP-Seq datasets, demonstrating its regression and classification ability. The results suggest that FullSignalRanker is the best-performing method for recovering the signal ranks on the promoter and enhancer regions. In addition, FullSignalRanker is also the best-performing method for peak sequence classification. We envision that SignalRanker and FullSignalRanker will become important in the era of next generation sequencing. FullSignalRanker program is available on the following website: http://www.cs.toronto.edu/∼wkc/FullSignalRanker/ © 2015 IEEE.

  20. Probabilistic Inference on Multiple Normalized Signal Profiles from Next Generation Sequencing: Transcription Factor Binding Sites

    KAUST Repository

    Wong, Ka-Chun

    2015-04-20

    With the prevalence of chromatin immunoprecipitation (ChIP) with sequencing (ChIP-Seq) technology, massive ChIP-Seq data has been accumulated. The ChIP-Seq technology measures the genome-wide occupancy of DNA-binding proteins in vivo. It is well-known that different DNA-binding protein occupancies may result in a gene being regulated in different conditions (e.g. different cell types). To fully understand a gene\\'s function, it is essential to develop probabilistic models on multiple ChIP-Seq profiles for deciphering the gene transcription causalities. In this work, we propose and describe two probabilistic models. Assuming the conditional independence of different DNA-binding proteins\\' occupancies, the first method (SignalRanker) is developed as an intuitive method for ChIP-Seq genome-wide signal profile inference. Unfortunately, such an assumption may not always hold in some gene regulation cases. Thus, we propose and describe another method (FullSignalRanker) which does not make the conditional independence assumption. The proposed methods are compared with other existing methods on ENCODE ChIP-Seq datasets, demonstrating its regression and classification ability. The results suggest that FullSignalRanker is the best-performing method for recovering the signal ranks on the promoter and enhancer regions. In addition, FullSignalRanker is also the best-performing method for peak sequence classification. We envision that SignalRanker and FullSignalRanker will become important in the era of next generation sequencing. FullSignalRanker program is available on the following website: http://www.cs.toronto.edu/∼wkc/FullSignalRanker/ © 2015 IEEE.

  1. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  2. Magnetic resonance imaging of the normal pituitary gland using ultrashort TE (UTE) pulse sequences (REV 1.0)

    International Nuclear Information System (INIS)

    Portman, Olivia; Flemming, Stephen; Cox, Jeremy P.D.; Johnston, Desmond G.; Bydder, Graeme M.

    2008-01-01

    The purpose of this study was to examine the normal pituitary gland in male subjects with ultrashort echo time (TE) pulse sequences, describe its appearance and measure its signal intensity before and after contrast enhancement. Eleven male volunteers (mean age 57.1 years; range 36-81 years) were examined with a fat-suppressed ultrashort TE (= 0.08 ms) pulse sequence. The studies were repeated after the administration of intravenous gadodiamide. The MR scans were examined for gland morphology and signal intensity before and after enhancement. Endocrinological evaluation included baseline pituitary function tests and a glucagon stimulatory test to assess pituitary cortisol and growth hormone reserve. High signal intensity was observed in the anterior pituitary relative to the brain in nine of the 11 subjects. These regions involved the whole of the anterior pituitary in three subjects, were localised to one side in two examples and were seen inferiorly in three subjects. Signal intensities relative to the brain increased with age, with a peak around the sixth or seventh decade and decreasing thereafter. Overall, the pituitary function tests were considered to be within normal limits and did not correlate with pituitary gland signal intensity. The anterior pituitary shows increased signal intensity in normal subjects when examined with T 1 -weighted ultrashort TE pulse sequences. The cause of this increased intensity is unknown, but fibrosis and iron deposition are possible candidates. The variation in signal intensity with age followed the temporal pattern of iron content observed at post mortem. No relationship with endocrine status was observed. (orig.)

  3. Magnetic resonance imaging of the normal pituitary gland using ultrashort TE (UTE) pulse sequences (REV 1.0)

    Energy Technology Data Exchange (ETDEWEB)

    Portman, Olivia; Flemming, Stephen; Cox, Jeremy P.D.; Johnston, Desmond G. [Imperial College Faculty of Medicine, St Mary' s Hospital, Endocrinology and Metabolic Medicine, London (United Kingdom); Bydder, Graeme M. [University of California, San Diego, Department of Radiology, San Diego, CA (United States)

    2008-03-15

    The purpose of this study was to examine the normal pituitary gland in male subjects with ultrashort echo time (TE) pulse sequences, describe its appearance and measure its signal intensity before and after contrast enhancement. Eleven male volunteers (mean age 57.1 years; range 36-81 years) were examined with a fat-suppressed ultrashort TE (= 0.08 ms) pulse sequence. The studies were repeated after the administration of intravenous gadodiamide. The MR scans were examined for gland morphology and signal intensity before and after enhancement. Endocrinological evaluation included baseline pituitary function tests and a glucagon stimulatory test to assess pituitary cortisol and growth hormone reserve. High signal intensity was observed in the anterior pituitary relative to the brain in nine of the 11 subjects. These regions involved the whole of the anterior pituitary in three subjects, were localised to one side in two examples and were seen inferiorly in three subjects. Signal intensities relative to the brain increased with age, with a peak around the sixth or seventh decade and decreasing thereafter. Overall, the pituitary function tests were considered to be within normal limits and did not correlate with pituitary gland signal intensity. The anterior pituitary shows increased signal intensity in normal subjects when examined with T{sub 1}-weighted ultrashort TE pulse sequences. The cause of this increased intensity is unknown, but fibrosis and iron deposition are possible candidates. The variation in signal intensity with age followed the temporal pattern of iron content observed at post mortem. No relationship with endocrine status was observed. (orig.)

  4. A strand specific high resolution normalization method for chip-sequencing data employing multiple experimental control measurements

    DEFF Research Database (Denmark)

    Enroth, Stefan; Andersson, Claes; Andersson, Robin

    2012-01-01

    High-throughput sequencing is becoming the standard tool for investigating protein-DNA interactions or epigenetic modifications. However, the data generated will always contain noise due to e.g. repetitive regions or non-specific antibody interactions. The noise will appear in the form of a backg......, the background is only used to adjust peak calling and not as a pre-processing step that aims at discerning the signal from the background noise. A normalization procedure that extracts the signal of interest would be of universal use when investigating genomic patterns....

  5. GOODS-HERSCHEL: STAR FORMATION, DUST ATTENUATION, AND THE FIR–RADIO CORRELATION ON THE MAIN SEQUENCE OF STAR-FORMING GALAXIES UP TO z ≃ 4

    Energy Technology Data Exchange (ETDEWEB)

    Pannella, M.; Elbaz, D.; Daddi, E.; Hwang, H. S.; Schreiber, C.; Strazzullo, V.; Aussel, H.; Bethermin, M.; Cibinel, A.; Juneau, S.; Floc’h, E. Le; Leiton, R. [Laboratoire AIM-Paris-Saclay, CEA/DSM/Irfu—CNRS—Université Paris Diderot, CEA-Saclay, F-91191 Gif-sur-Yvette (France); Dickinson, M. [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Buat, V. [Aix-Marseille Université, CNRS, LAM (Laboratoire d’Astrophysique de Marseille) UMR7326, F-13388, Marseille (France); Charmandaris, V.; Magdis, G. [Institute for Astronomy, Astrophysics, Space Applications and Remote Sensing, National Observatory of Athens, 15236, Penteli (Greece); Ivison, R. J. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Borgne, D. Le [Institut d’Astrophysique de Paris, UMR 7095, CNRS, 98bis boulevard Arago, F-75005 Paris (France); Lin, L. [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei 106, Taiwan (China); Morrison, G. E. [Institute for Astronomy, University of Hawaii, Honolulu, Hawaii, HI-96822 (United States); and others

    2015-07-10

    We use deep panchromatic data sets in the GOODS-N field, from GALEX to the deepest Herschel far-infrared (FIR) and VLA radio continuum imaging, to explore the evolution of star-formation activity and dust attenuation properties of star-forming galaxies to z ≃ 4, using mass-complete samples. Our main results can be summarized as follows: (i) the slope of the star-formation rate–M{sub *} correlation is consistent with being constant ≃0.8 up to z ≃ 1.5, while its normalization keeps increasing with redshift; (ii) for the first time we are able to explore the FIR–radio correlation for a mass-selected sample of star-forming galaxies: the correlation does not evolve up to z ≃ 4; (iii) we confirm that galaxy stellar mass is a robust proxy for UV dust attenuation in star-forming galaxies, with more massive galaxies being more dust attenuated. Strikingly, we find that this attenuation relation evolves very weakly with redshift, with the amount of dust attenuation increasing by less than 0.3 mag over the redshift range [0.5–4] for a fixed stellar mass; (iv) the correlation between dust attenuation and the UV spectral slope evolves with redshift, with the median UV slope becoming bluer with redshift. By z ≃ 3, typical UV slopes are inconsistent, given the measured dust attenuations, with the predictions of commonly used empirical laws. (v) Finally, building on existing results, we show that gas reddening is marginally larger (by a factor of around 1.3) than the stellar reddening at all redshifts probed. Our results support a scenario where the ISM conditions of typical star-forming galaxies evolve with redshift, such that at z ≥ 1.5 Main Sequence galaxies have ISM conditions moving closer to those of local starbursts.

  6. OLD MAIN-SEQUENCE TURNOFF PHOTOMETRY IN THE SMALL MAGELLANIC CLOUD. II. STAR FORMATION HISTORY AND ITS SPATIAL GRADIENTS

    International Nuclear Information System (INIS)

    Noel, Noelia E. D.; Gallart, Carme; Hidalgo, Sebastian L.; Aparicio, Antonio; Costa, Edgardo; Mendez, Rene A.

    2009-01-01

    We present a quantitative analysis of the star formation history (SFH) of 12 fields in the Small Magellanic Cloud (SMC) based on unprecedented deep [(B - R), R] color-magnitude diagrams (CMDs). Our fields reach down to the oldest main-sequence turnoff with a high photometric accuracy, which is vital for obtaining accurate SFHs, particularly at intermediate and old ages. We use the IAC-pop code to obtain the SFH, using synthetic CMDs generated with IAC-star. We obtain the SFH as a function ψ(t, z) of age and metallicity. We also consider several auxiliary functions: the initial mass function (IMF), φ(m), and a function accounting for the frequency and relative mass distribution of binary stars, β(f, q). We find that there are several main periods of enhancement of star formation: a young one peaked at ∼0.2-0.5 Gyr old, only present in the eastern and in the central-most fields; two at intermediate ages present in all fields: a conspicuous one peaked at ∼4-5 Gyr, and a less significant one peaked at ∼1.5-2.5; and an old one, peaked at ∼10 Gyr in all fields but the western ones. In the western fields, this old enhancement splits into two, one peaked at ∼8 Gyr old and another at ∼12 Gyr old. This 'two-enhancement' zone is unaffected by our choice of stellar evolutionary library but more data covering other fields of the SMC are necessary in order to ascertain its significancy. Correlation between star formation rate enhancements and SMC-Milky Way encounters is not clear. Some correlation could exist with encounters taken from the orbit determination of Kallivayalil et al. But our results would also fit in a first pericenter passage scenario like the one claimed by Besla et al. For SMC-Large Magellanic Cloud encounters, we find a correlation only for the most recent encounter ∼0.2 Gyr ago. This coincides with the youngest ψ(t) enhancement peaked at these ages in our eastern fields. The population younger than 1 Gyr represents ∼7%-12% of the total

  7. Sequence analysis of annually normalized citation counts: an empirical analysis based on the characteristic scores and scales (CSS) method.

    Science.gov (United States)

    Bornmann, Lutz; Ye, Adam Y; Ye, Fred Y

    2017-01-01

    In bibliometrics, only a few publications have focused on the citation histories of publications, where the citations for each citing year are assessed. In this study, therefore, annual categories of field- and time-normalized citation scores (based on the characteristic scores and scales method: 0 = poorly cited, 1 = fairly cited, 2 = remarkably cited, and 3 = outstandingly cited) are used to study the citation histories of papers. As our dataset, we used all articles published in 2000 and their annual citation scores until 2015. We generated annual sequences of citation scores (e.g., [Formula: see text]) and compared the sequences of annual citation scores of six broader fields (natural sciences, engineering and technology, medical and health sciences, agricultural sciences, social sciences, and humanities). In agreement with previous studies, our results demonstrate that sequences with poorly cited (0) and fairly cited (1) elements dominate the publication set; sequences with remarkably cited (3) and outstandingly cited (4) periods are rare. The highest percentages of constantly poorly cited papers can be found in the social sciences; the lowest percentages are in the agricultural sciences and humanities. The largest group of papers with remarkably cited (3) and/or outstandingly cited (4) periods shows an increasing impact over the citing years with the following orders of sequences: [Formula: see text] (6.01%), which is followed by [Formula: see text] (1.62%). Only 0.11% of the papers ( n  = 909) are constantly on the outstandingly cited level.

  8. A Hierarchical Poisson Log-Normal Model for Network Inference from RNA Sequencing Data

    Science.gov (United States)

    Gallopin, Mélina; Rau, Andrea; Jaffrézic, Florence

    2013-01-01

    Gene network inference from transcriptomic data is an important methodological challenge and a key aspect of systems biology. Although several methods have been proposed to infer networks from microarray data, there is a need for inference methods able to model RNA-seq data, which are count-based and highly variable. In this work we propose a hierarchical Poisson log-normal model with a Lasso penalty to infer gene networks from RNA-seq data; this model has the advantage of directly modelling discrete data and accounting for inter-sample variance larger than the sample mean. Using real microRNA-seq data from breast cancer tumors and simulations, we compare this method to a regularized Gaussian graphical model on log-transformed data, and a Poisson log-linear graphical model with a Lasso penalty on power-transformed data. For data simulated with large inter-sample dispersion, the proposed model performs better than the other methods in terms of sensitivity, specificity and area under the ROC curve. These results show the necessity of methods specifically designed for gene network inference from RNA-seq data. PMID:24147011

  9. Spectral Sequences of Type Ia Supernovae. I. Connecting Normal and Subluminous SNe Ia and the Presence of Unburned Carbon

    Energy Technology Data Exchange (ETDEWEB)

    Heringer, E.; Kerkwijk, M. H. van [Department of Astronomy and Astrophysics, University of Toronto, 50 Saint George Street, Toronto, ON M5S 3H4 (Canada); Sim, S. A. [Astrophysics Research Centre, School of Mathematics and Physics, Queens University Belfast, Belfast BT7 1NN (United Kingdom); Kerzendorf, W. E. [European Southern Observatory (ESO), Karl-Schwarzschild-Straße 2, D-85748 Garching (Germany)

    2017-09-01

    Type Ia supernovae (SNe Ia) are generally agreed to arise from thermonuclear explosions of carbon–oxygen white dwarfs. The actual path to explosion, however, remains elusive, with numerous plausible parent systems and explosion mechanisms suggested. Observationally, SNe Ia have multiple subclasses, distinguished by their light curves and spectra. This raises the question of whether these indicate that multiple mechanisms occur in nature or that explosions have a large but continuous range of physical properties. We revisit the idea that normal and 91bg-like SNe can be understood as part of a spectral sequence in which changes in temperature dominate. Specifically, we find that a single ejecta structure is sufficient to provide reasonable fits of both the normal SN Ia SN 2011fe and the 91bg-like SN 2005bl, provided that the luminosity and thus temperature of the ejecta are adjusted appropriately. This suggests that the outer layers of the ejecta are similar, thus providing some support for a common explosion mechanism. Our spectral sequence also helps to shed light on the conditions under which carbon can be detected in premaximum SN Ia spectra—we find that emission from iron can “fill in” the carbon trough in cool SNe Ia. This may indicate that the outer layers of the ejecta of events in which carbon is detected are relatively metal-poor compared to events in which carbon is not detected.

  10. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  11. Organelle Simple Sequence Repeat Markers Help to Distinguish Carpelloid Stamen and Normal Cytoplasmic Male Sterile Sources in Broccoli

    Science.gov (United States)

    Shu, Jinshuai; Liu, Yumei; Li, Zhansheng; Zhang, Lili; Fang, Zhiyuan; Yang, Limei; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao

    2015-01-01

    We previously discovered carpelloid stamens when breeding cytoplasmic male sterile lines in broccoli (Brassica oleracea var. italica). In this study, hybrids and multiple backcrosses were produced from different cytoplasmic male sterile carpelloid stamen sources and maintainer lines. Carpelloid stamens caused dysplasia of the flower structure and led to hooked or coiled siliques with poor seed setting, which were inherited in a maternal fashion. Using four distinct carpelloid stamens and twelve distinct normal stamens from cytoplasmic male sterile sources and one maintainer, we used 21 mitochondrial simple sequence repeat (mtSSR) primers and 32 chloroplast SSR primers to identify a mitochondrial marker, mtSSR2, that can differentiate between the cytoplasm of carpelloid and normal stamens. Thereafter, mtSSR2 was used to identify another 34 broccoli accessions, with an accuracy rate of 100%. Analysis of the polymorphic sequences revealed that the mtSSR2 open reading frame of carpelloid stamen sterile sources had a deletion of 51 bases (encoding 18 amino acids) compared with normal stamen materials. The open reading frame is located in the coding region of orf125 and orf108 of the mitochondrial genomes in Brassica crops and had the highest similarity with Raphanus sativus and Brassica carinata. The current study has not only identified a useful molecular marker to detect the cytoplasm of carpelloid stamens during broccoli breeding, but it also provides evidence that the mitochondrial genome is maternally inherited and provides a basis for studying the effect of the cytoplasm on flower organ development in plants. PMID:26407159

  12. How Dusty Is Alpha Centauri? Excess or Non-excess over the Infrared Photospheres of Main-sequence Stars

    Science.gov (United States)

    Wiegert, J.; Liseau, R.; Thebault, P.; Olofsson, G.; Mora, A.; Bryden, G.; Marshall, J. P.; Eiroa, C.; Montesinos, B.; Ardila, D.; hide

    2014-01-01

    Context. Debris discs around main-sequence stars indicate the presence of larger rocky bodies. The components of the nearby, solar-type binary Centauri have metallicities that are higher than solar, which is thought to promote giant planet formation. Aims. We aim to determine the level of emission from debris around the stars in the Cen system. This requires knowledge of their photospheres.Having already detected the temperature minimum, Tmin, of CenA at far-infrared wavelengths, we here attempt to do the same for the moreactive companion Cen B. Using the Cen stars as templates, we study the possible eects that Tmin may have on the detectability of unresolveddust discs around other stars. Methods.We used Herschel-PACS, Herschel-SPIRE, and APEX-LABOCA photometry to determine the stellar spectral energy distributions in thefar infrared and submillimetre. In addition, we used APEX-SHeFI observations for spectral line mapping to study the complex background around Cen seen in the photometric images. Models of stellar atmospheres and of particulate discs, based on particle simulations and in conjunctionwith radiative transfer calculations, were used to estimate the amount of debris around these stars. Results. For solar-type stars more distant than Cen, a fractional dust luminosity fd LdustLstar 2 107 could account for SEDs that do not exhibit the Tmin eect. This is comparable to estimates of fd for the Edgeworth-Kuiper belt of the solar system. In contrast to the far infrared,slight excesses at the 2:5 level are observed at 24 m for both CenA and B, which, if interpreted as due to zodiacal-type dust emission, wouldcorrespond to fd (13) 105, i.e. some 102 times that of the local zodiacal cloud. Assuming simple power-law size distributions of the dustgrains, dynamical disc modelling leads to rough mass estimates of the putative Zodi belts around the Cen stars, viz.4106 M$ of 4 to 1000 msize grains, distributed according to n(a) a3:5. Similarly, for filled-in Tmin

  13. A ChIP-Seq benchmark shows that sequence conservation mainly improves detection of strong transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Tony Håndstad

    Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.

  14. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  15. The environmental impacts on the star formation main sequence: An Hα study of the newly discovered rich cluster at z = 1.52

    Energy Technology Data Exchange (ETDEWEB)

    Koyama, Yusei; Kodama, Tadayuki; Tadaki, Ken-ichi; Hayashi, Masao [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Tanaka, Ichi [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A' ohoku Place, Hilo, HI 96720 (United States); Shimakawa, Rhythm, E-mail: koyama.yusei@nao.ac.jp [Department of Astronomical Science, The Graduate University for Advanced Studies, Mitaka, Tokyo 181-8588 (Japan)

    2014-07-01

    We report the discovery of a strong over-density of galaxies in the field of a radio galaxy at z = 1.52 (4C 65.22) based on our broadband and narrow-band (Hα) photometry with the Subaru Telescope. We find that Hα emitters are located in the outskirts of the density peak (cluster core) dominated by passive red-sequence galaxies. This resembles the situation in lower-redshift clusters, suggesting that the newly discovered structure is a well-evolved rich galaxy cluster at z = 1.5. Our data suggest that the color-density and stellar mass-density relations are already in place at z ∼ 1.5, mostly driven by the passive red massive galaxies residing within r{sub c} ≲ 200 kpc from the cluster core. These environmental trends almost disappear when we consider only star-forming (SF) galaxies. We do not find SFR-density or SSFR-density relations amongst SF galaxies, and the location of the SF main sequence does not significantly change with environment. Nevertheless, we find a tentative hint that star-bursting galaxies (up-scattered objects from the main sequence) are preferentially located in a small group at ∼1 Mpc away from the main body of the cluster. We also argue that the scatter of the SF main sequence could be dependent on the distance to the nearest neighboring galaxy.

  16. MicroRNA and piRNA profiles in normal human testis detected by next generation sequencing.

    Directory of Open Access Journals (Sweden)

    Qingling Yang

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are the class of small endogenous RNAs that play an important regulatory role in cells by negatively affecting gene expression at transcriptional and post-transcriptional levels. There have been extensive studies aiming to discover miRNAs and to analyze their functions in the cells from a variety of species. However, there are no published studies of miRNA profiles in human testis using next generation sequencing (NGS technology. RESULTS: We employed Solexa sequencing technology to profile miRNAs in normal human testis. Total 770 known and 5 novel human miRNAs, and 20121 piRNAs were detected, indicating that the human testis has a complex population of small RNAs. The expression of 15 known and 5 novel detected miRNAs was validated by qRT-PCR. We have also predicted the potential target genes of the abundant known and novel miRNAs, and subjected them to GO and pathway analysis, revealing the involvement of miRNAs in many important biological phenomenon including meiosis and p53-related pathways that are implicated in the regulation of spermatogenesis. CONCLUSIONS: This study reports the first genome-wide miRNA profiles in human testis using a NGS approach. The presence of large number of miRNAs and the nature of their target genes suggested that miRNAs play important roles in spermatogenesis. Here we provide a useful resource for further elucidation of the regulatory role of miRNAs and piRNAs in the spermatogenesis. It may also facilitate the development of prophylactic strategies for male infertility.

  17. Comparison of lesion conspicuity of radiofrequency ablation zones among MR sequences according to time in the normal rabbit liver

    International Nuclear Information System (INIS)

    Ku, Myong Seo; Kim, Seung Kwon; Hong, Hyun Pyo; Kwag, Hyon Joo

    2007-01-01

    To compare the lesion conspicuity of radiofrequency ablation (RFA) zones among MR sequences according to time in the normal rabbit liver. RFA zones were created in 12 rabbit livers with a 17-gauge internally cooled electrode (1-cm active tip, 30 Watts, 3 minutes). Three rabbits were sacrificed immediately, three days, two weeks, and six weeks after the RFA procedure, respectively. Before sacrifice, T1-, T2-weighted images (WI), and gadolinium-enhanced (GE)-T1WI images were obtained. The lesion conspicuity of the RAF zone and the contrast-to-noise ratio (CNR) of the RFA zone to the liver parenchyma were analyzed and compared among the MR sequences according to time. On T1WI, the RFA zones were only clearly seen on acute phase. On T2WI, the RFA zones were clearly seen on all phases except the hyperacute phase. On GE T1WI, the RFA zones were clearly seen on all phases. The CNRs of the RFA zone to the liver parenchyma of GE-T1WI (8.1-12.4) were significantly higher than the CNRs of TIWI (1.6-2.7) and T2WI (1.7-6.3) on all phases (ρ < 0.05), but the visual lesion conspicuity between GE T1WI and T2WI were similar. On hyperacute phase, GE T1WI showed better lesion conspicuity of the RFA zone than T1WI and T2WI. On other phases, GE T1WI and T2WI showed similar lesion conspicuity

  18. A search for pre-main sequence stars in the high-latitude molecular clouds. II - A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris

    1990-01-01

    The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.

  19. Evolution models of helium white dwarf-main-sequence star merger remnants: the mass distribution of single low-mass white dwarfs

    Science.gov (United States)

    Zhang, Xianfei; Hall, Philip D.; Jeffery, C. Simon; Bi, Shaolan

    2018-02-01

    It is not known how single white dwarfs with masses less than 0.5Msolar -- low-mass white dwarfs -- are formed. One way in which such a white dwarf might be formed is after the merger of a helium-core white dwarf with a main-sequence star that produces a red giant branch star and fails to ignite helium. We use a stellar-evolution code to compute models of the remnants of these mergers and find a relation between the pre-merger masses and the final white dwarf mass. Combining our results with a model population, we predict that the mass distribution of single low-mass white dwarfs formed through this channel spans the range 0.37 to 0.5Msolar and peaks between 0.45 and 0.46Msolar. Helium white dwarf--main-sequence star mergers can also lead to the formation of single helium white dwarfs with masses up to 0.51Msolar. In our model the Galactic formation rate of single low-mass white dwarfs through this channel is about 8.7X10^-3yr^-1. Comparing our models with observations, we find that the majority of single low-mass white dwarfs (<0.5Msolar) are formed from helium white dwarf--main-sequence star mergers, at a rate which is about $2$ per cent of the total white dwarf formation rate.

  20. THE CONTRIBUTIONS OF INTERACTIVE BINARY STARS TO DOUBLE MAIN-SEQUENCE TURNOFFS AND DUAL RED CLUMP OF INTERMEDIATE-AGE STAR CLUSTERS

    International Nuclear Information System (INIS)

    Yang Wuming; Bi Shaolan; Tian Zhijia; Li Tanda; Liu Kang; Meng Xiangcun

    2011-01-01

    Double or extended main-sequence turnoffs (DMSTOs) and dual red clump (RC) were observed in intermediate-age clusters, such as in NGC 1846 and 419. The DMSTOs are interpreted as that the cluster has two distinct stellar populations with differences in age of about 200-300 Myr but with the same metallicity. The dual RC is interpreted as a result of a prolonged star formation. Using a stellar population-synthesis method, we calculated the evolution of a binary-star stellar population. We found that binary interactions and merging can reproduce the dual RC in the color-magnitude diagrams of an intermediate-age cluster, whereas in actuality only a single population exists. Moreover, the binary interactions can lead to an extended main-sequence turnoff (MSTO) rather than DMSTOs. However, the rest of the main sequence, subgiant branch, and first giant branch are hardly spread by the binary interactions. Part of the observed dual RC and extended MSTO may be the results of binary interactions and mergers.

  1. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    International Nuclear Information System (INIS)

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas; Von Braun, Kaspar; Van Belle, Gerard; Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm; Ridgway, Stephen

    2013-01-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR J I J JHK), Cousins (R C I C ), Kron (R K I K ), Sloan (griz), and WISE (W 3 W 4 ) photometric systems. These relations have an average standard deviation of ∼3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T eff > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only ∼2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  2. Variable extinction in HD 45677 and the evolution of dust grains in pre-main-sequence disks

    Science.gov (United States)

    Sitko, Michael L.; Halbedel, Elaine M.; Lawrence, Geoffrey F.; Smith, J. Allyn; Yanow, Ken

    1994-01-01

    Changes in the UV extinction and IR emission were sought in the Herbig Ae/Be star candidate HD 45677 (= FS CMa) by comparing UV, optical, and IR observations made approximately 10 yr apart. HD 45677 varied significantly, becoming more than 50% brighter in the UV and optical than it was a decade ago. A comparison of the observations between epochs indicates that if the variations are due to changes in dust obscuration, the dust acts as a gray absorber into the near-IR and must be depleted in grains smaller than 1 micron. This is similar to the results obtained on the circumstellar disks of stars like Vega and Beta Pic, and suggests that radiation pressure may be responsible for the small-grain depletion. In addition, the total IR flux seems to have declined, indicating a decrease in the total mass of the dust envelope that contributes to the IR emission in this part of the spectrum. Due to the anomalous nature of the extinction, the use of normal extinction curves to deredden the spectral energy distributions of stars with circumstellar dust may lead to significant errors and should be used with great caution.

  3. Iterative normalization technique for reference sequence generation for zero-tail discrete fourier transform spread orthogonal frequency division multiplexing

    DEFF Research Database (Denmark)

    2017-01-01

    Systems, methods, apparatuses, and computer program products for generating sequences for zero-tail discrete fourier transform (DFT)-spread-orthogonal frequency division multiplexing (OFDM) (ZT DFT-s-OFDM) reference signals. One method includes adding a zero vector to an input sequence...... of each of the elements, converting the sequence to time domain, generating a zero-padded sequence by forcing a zero head and tail of the sequence, and repeating the steps until a final sequence with zero-tail and flat frequency response is obtained....

  4. LINEAR RELATION FOR WIND-BLOWN BUBBLE SIZES OF MAIN-SEQUENCE OB STARS IN A MOLECULAR ENVIRONMENT AND IMPLICATION FOR SUPERNOVA PROGENITORS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yang; Zhou Ping [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Chu Youhua [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States)

    2013-05-20

    We find a linear relationship between the size of a massive star's main-sequence bubble in a molecular environment and the star's initial mass: R{sub b} Almost-Equal-To 1.22 M/M{sub Sun} - 9.16 pc, assuming a constant interclump pressure. Since stars in the mass range of 8 to 25-30 M{sub Sun} will end their evolution in the red supergiant phase without launching a Wolf-Rayet wind, the main-sequence wind-blown bubbles are mainly responsible for the extent of molecular gas cavities, while the effect of the photoionization is comparatively small. This linear relation can thus be used to infer the masses of the massive star progenitors of supernova remnants (SNRs) that are discovered to evolve in molecular cavities, while few other means are available for inferring the properties of SNR progenitors. We have used this method to estimate the initial masses of the progenitors of eight SNRs: Kes 69, Kes 75, Kes 78, 3C 396, 3C 397, HC 40, Vela, and RX J1713-3946.

  5. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm [CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States)

    2013-07-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR{sub J} I{sub J} JHK), Cousins (R{sub C} I{sub C}), Kron (R{sub K} I{sub K}), Sloan (griz), and WISE (W{sub 3} W{sub 4}) photometric systems. These relations have an average standard deviation of {approx}3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T{sub eff} > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only {approx}2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  6. Evolution models of helium white dwarf--main-sequence star merger remnants: the mass distribution of single low-mass white dwarfs

    OpenAIRE

    Zhang, Xianfei; Hall, Philip D.; Jeffery, C. Simon; Bi, Shaolan

    2017-01-01

    It is not known how single white dwarfs with masses less than 0.5Msolar -- low-mass white dwarfs -- are formed. One way in which such a white dwarf might be formed is after the merger of a helium-core white dwarf with a main-sequence star that produces a red giant branch star and fails to ignite helium. We use a stellar-evolution code to compute models of the remnants of these mergers and find a relation between the pre-merger masses and the final white dwarf mass. Combining our results with ...

  7. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  8. Mitochondrial import of human and yeast fumarase in live mammalian cells: Retrograde translocation of the yeast enzyme is mainly caused by its poor targeting sequence

    International Nuclear Information System (INIS)

    Singh, Bhag; Gupta, Radhey S.

    2006-01-01

    Studies on yeast fumarase provide the main evidence for dual localization of a protein in mitochondria and cytosol by means of retrograde translocation. We have examined the subcellular targeting of yeast and human fumarase in live cells to identify factors responsible for this. The cDNAs for mature yeast or human fumarase were fused to the gene for enhanced green fluorescent protein (eGFP) and they contained, at their N-terminus, a mitochondrial targeting sequence (MTS) derived from either yeast fumarase, human fumarase, or cytochrome c oxidase subunit VIII (COX) protein. Two nuclear localization sequences (2x NLS) were also added to these constructs to facilitate detection of any cytosolic protein by its targeting to nucleus. In Cos-1 cells transfected with these constructs, human fumarase with either the native or COX MTSs was detected exclusively in mitochondria in >98% of the cells, while the remainder 1-2% of the cells showed varying amounts of nuclear labeling. In contrast, when human fumarase was fused to the yeast MTS, >50% of the cells showed nuclear labeling. Similar studies with yeast fumarase showed that with its native MTS, nuclear labeling was seen in 80-85% of the cells, but upon fusion to either human or COX MTS, nuclear labeling was observed in only 10-15% of the cells. These results provide evidence that extramitochondrial presence of yeast fumarase is mainly caused by the poor mitochondrial targeting characteristics of its MTS (but also affected by its primary sequence), and that the retrograde translocation mechanism does not play a significant role in the extramitochondrial presence of mammalian fumarase

  9. Stress rotations due to the M6.5 foreshock and M7.3 main shock in the 2016 Kumamoto, SW Japan, earthquake sequence

    Science.gov (United States)

    Yoshida, Keisuke; Hasegawa, Akira; Saito, Tatsuhiko; Asano, Youichi; Tanaka, Sachiko; Sawazaki, Kaoru; Urata, Yumi; Fukuyama, Eiichi

    2016-10-01

    A shallow M7.3 event with a M6.5 foreshock occurred along the Futagawa-Hinagu fault zone in Kyushu, SW Japan. We investigated the spatiotemporal variation of the stress orientations in and around the source area of this 2016 Kumamoto earthquake sequence by inverting 1218 focal mechanisms. The results show that the σ3 axis in the vicinity of the fault plane significantly rotated counterclockwise after the M6.5 foreshock and rotated clockwise after the M7.3 main shock in the Hinagu fault segment. This observation indicates that a significant portion of the shear stress was released both by the M6.5 foreshock and M7.3 main shock. It is estimated that the stress release by the M6.5 foreshock occurred in the shallower part of the Hinagu fault segment, which brought the stress concentration in its deeper part. This might have caused the M7.3 main shock rupture mainly along the deeper part of the Hinagu fault segment after 28 h.

  10. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.

    Directory of Open Access Journals (Sweden)

    Tanaka Yoshiyuki

    2012-07-01

    Full Text Available Abstract Background Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138. Results Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%. It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size that are non-syntenic to normal-type genome, and the gene orf138

  11. POPULATION PARAMETERS OF INTERMEDIATE-AGE STAR CLUSTERS IN THE LARGE MAGELLANIC CLOUD. II. NEW INSIGHTS FROM EXTENDED MAIN-SEQUENCE TURNOFFS IN SEVEN STAR CLUSTERS

    International Nuclear Information System (INIS)

    Goudfrooij, Paul; Kozhurina-Platais, Vera; Puzia, Thomas H.; Chandar, Rupali

    2011-01-01

    We discuss new photometry from high-resolution images of seven intermediate-age (1-2 Gyr) star clusters in the Large Magellanic Cloud taken with the Advanced Camera for Surveys on board the Hubble Space Telescope. We fit color-magnitude diagrams (CMDs) with several different sets of theoretical isochrones and determine systematic uncertainties for population parameters when derived using any one set of isochrones. The cluster CMDs show several interesting features, including extended main-sequence turnoff (MSTO) regions, narrow red giant branches, and clear sequences of unresolved binary stars. We show that the extended MSTOs are not caused by photometric uncertainties, contamination by field stars, or the presence of binary stars. Enhanced helium abundances in a fraction of cluster stars are also ruled out as the reason for the extended MSTOs. Quantitative comparisons with simulations indicate that the MSTO regions are better described by a spread in ages than by a bimodal age distribution, although we cannot formally rule out the latter for the three lowest-mass clusters in our sample (which have masses lower than ∼3 x 10 4 M sun ). This conclusion differs from that of some previous works which suggested that the age distribution in massive clusters in our sample is bimodal. This suggests that any secondary star formation occurred in an extended fashion rather than through short bursts. We discuss these results in the context of the nature of multiple stellar populations in star clusters.

  12. Extended Main-sequence Turn-offs in Intermediate-age Star Clusters: Stellar Rotation Diminishes, but Does Not Eliminate, Age Spreads

    Energy Technology Data Exchange (ETDEWEB)

    Goudfrooij, Paul; Correnti, Matteo [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Girardi, Léo, E-mail: goudfroo@stsci.edu [Osservatorio Astronomico di Padova—INAF, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy)

    2017-09-01

    Extended main-sequence turn-off (eMSTO) regions are a common feature in color–magnitude diagrams of young- and intermediate-age star clusters in the Magellanic Clouds. The nature of eMSTOs remains debated in the literature. The currently most popular scenarios are extended star formation activity and ranges of stellar rotation rates. Here we study details of differences in main-sequence turn-off (MSTO) morphology expected from spreads in age versus spreads in rotation rates, using Monte Carlo simulations with the Geneva syclist isochrone models that include the effects of stellar rotation. We confirm a recent finding of Niederhofer et al. that a distribution of stellar rotation velocities yields an MSTO extent that is proportional to the cluster age, as observed. However, we find that stellar rotation yields MSTO crosscut widths that are generally smaller than observed ones at a given age. We compare the simulations with high-quality Hubble Space Telescope data of NGC 1987 and NGC 2249, which are the two only relatively massive star clusters with an age of ∼1 Gyr for which such data is available. We find that the distribution of stars across the eMSTOs of these clusters cannot be explained solely by a distribution of stellar rotation velocities, unless the orientations of rapidly rotating stars are heavily biased toward an equator-on configuration. Under the assumption of random viewing angles, stellar rotation can account for ∼60% and ∼40% of the observed FWHM widths of the eMSTOs of NGC 1987 and NGC 2249, respectively. In contrast, a combination of distributions of stellar rotation velocities and stellar ages fits the observed eMSTO morphologies very well.

  13. A tale of two anomalies: Depletion, dispersion, and the connection between the stellar lithium spread and inflated radii on the pre-main sequence

    Energy Technology Data Exchange (ETDEWEB)

    Somers, Garrett; Pinsonneault, Marc H., E-mail: somers@astronomy.ohio-state.edu, E-mail: pinsono@astronomy.ohio-state.edu [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43201 (United States)

    2014-07-20

    We investigate lithium depletion in standard stellar models (SSMs) and main sequence (MS) open clusters, and explore the origin of the Li dispersion in young, cool stars of equal mass, age, and composition. We first demonstrate that SSMs accurately predict the Li abundances of solar analogs at the zero-age main sequence (ZAMS) within theoretical uncertainties. We then measure the rate of MS Li depletion by removing the [Fe/H]-dependent ZAMS Li pattern from three well-studied clusters, and comparing the detrended data. MS depletion is found to be mass-dependent, in the sense of more depletion at low mass. A dispersion in Li abundance at fixed T{sub eff} is nearly universal, and sets in by ∼200 Myr. We discuss mass and age dispersion trends, and the pattern is mixed. We argue that metallicity impacts the ZAMS Li pattern, in agreement with theoretical expectations but contrary to the findings of some previous studies, and suggest Li as a test of cluster metallicity. Finally, we argue that a radius dispersion in stars of fixed mass and age, during the epoch of pre-MS Li destruction, is responsible for the spread in Li abundances and the correlation between rotation and Li in young cool stars, most well known in the Pleiades. We calculate stellar models, inflated to match observed radius anomalies in magnetically active systems, and the resulting range of Li abundances reproduces the observed patterns of young clusters. We discuss ramifications for pre-MS evolutionary tracks and age measurements of young clusters, and suggest an observational test.

  14. The evolution of surface magnetic fields in young solar-type stars II: the early main sequence (250-650 Myr)

    Science.gov (United States)

    Folsom, C. P.; Bouvier, J.; Petit, P.; Lèbre, A.; Amard, L.; Palacios, A.; Morin, J.; Donati, J.-F.; Vidotto, A. A.

    2018-03-01

    There is a large change in surface rotation rates of sun-like stars on the pre-main sequence and early main sequence. Since these stars have dynamo-driven magnetic fields, this implies a strong evolution of their magnetic properties over this time period. The spin-down of these stars is controlled by interactions between stellar and magnetic fields, thus magnetic evolution in turn plays an important role in rotational evolution. We present here the second part of a study investigating the evolution of large-scale surface magnetic fields in this critical time period. We observed stars in open clusters and stellar associations with known ages between 120 and 650 Myr, and used spectropolarimetry and Zeeman Doppler Imaging to characterize their large-scale magnetic field strength and geometry. We report 15 stars with magnetic detections here. These stars have masses from 0.8 to 0.95 M⊙, rotation periods from 0.326 to 10.6 d, and we find large-scale magnetic field strengths from 8.5 to 195 G with a wide range of geometries. We find a clear trend towards decreasing magnetic field strength with age, and a power law decrease in magnetic field strength with Rossby number. There is some tentative evidence for saturation of the large-scale magnetic field strength at Rossby numbers below 0.1, although the saturation point is not yet well defined. Comparing to younger classical T Tauri stars, we support the hypothesis that differences in internal structure produce large differences in observed magnetic fields, however for weak-lined T Tauri stars this is less clear.

  15. PHIBSS: MOLECULAR GAS CONTENT AND SCALING RELATIONS IN z ∼ 1-3 MASSIVE, MAIN-SEQUENCE STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Tacconi, L. J.; Genzel, R.; Wuyts, S.; Förster Schreiber, N. M.; Gracia-Carpio, J.; Lutz, D.; Saintonge, A.; Neri, R.; Cox, P.; Combes, F.; Bolatto, A.; Cooper, M. C.; Bournaud, F.; Burkert, A.; Comerford, J.; Davis, M.; Newman, S.; García-Burillo, S.; Naab, T.; Omont, A.

    2013-01-01

    We present PHIBSS, the IRAM Plateau de Bure high-z blue sequence CO 3-2 survey of the molecular gas properties in massive, main-sequence star-forming galaxies (SFGs) near the cosmic star formation peak. PHIBSS provides 52 CO detections in two redshift slices at z ∼ 1.2 and 2.2, with log(M * (M ☉ )) ≥ 10.4 and log(SFR(M ☉ /yr)) ≥ 1.5. Including a correction for the incomplete coverage of the M * -SFR plane, and adopting a ''Galactic'' value for the CO-H 2 conversion factor, we infer average gas fractions of ∼0.33 at z ∼ 1.2 and ∼0.47 at z ∼ 2.2. Gas fractions drop with stellar mass, in agreement with cosmological simulations including strong star formation feedback. Most of the z ∼ 1-3 SFGs are rotationally supported turbulent disks. The sizes of CO and UV/optical emission are comparable. The molecular-gas-star-formation relation for the z = 1-3 SFGs is near-linear, with a ∼0.7 Gyr gas depletion timescale; changes in depletion time are only a secondary effect. Since this timescale is much less than the Hubble time in all SFGs between z ∼ 0 and 2, fresh gas must be supplied with a fairly high duty cycle over several billion years. At given z and M * , gas fractions correlate strongly with the specific star formation rate (sSFR). The variation of sSFR between z ∼ 0 and 3 is mainly controlled by the fraction of baryonic mass that resides in cold gas.

  16. A tale of two anomalies: Depletion, dispersion, and the connection between the stellar lithium spread and inflated radii on the pre-main sequence

    International Nuclear Information System (INIS)

    Somers, Garrett; Pinsonneault, Marc H.

    2014-01-01

    We investigate lithium depletion in standard stellar models (SSMs) and main sequence (MS) open clusters, and explore the origin of the Li dispersion in young, cool stars of equal mass, age, and composition. We first demonstrate that SSMs accurately predict the Li abundances of solar analogs at the zero-age main sequence (ZAMS) within theoretical uncertainties. We then measure the rate of MS Li depletion by removing the [Fe/H]-dependent ZAMS Li pattern from three well-studied clusters, and comparing the detrended data. MS depletion is found to be mass-dependent, in the sense of more depletion at low mass. A dispersion in Li abundance at fixed T eff is nearly universal, and sets in by ∼200 Myr. We discuss mass and age dispersion trends, and the pattern is mixed. We argue that metallicity impacts the ZAMS Li pattern, in agreement with theoretical expectations but contrary to the findings of some previous studies, and suggest Li as a test of cluster metallicity. Finally, we argue that a radius dispersion in stars of fixed mass and age, during the epoch of pre-MS Li destruction, is responsible for the spread in Li abundances and the correlation between rotation and Li in young cool stars, most well known in the Pleiades. We calculate stellar models, inflated to match observed radius anomalies in magnetically active systems, and the resulting range of Li abundances reproduces the observed patterns of young clusters. We discuss ramifications for pre-MS evolutionary tracks and age measurements of young clusters, and suggest an observational test.

  17. Draft Genome Sequence of a Picorna-Like Virus Associated with Gill Tissue in Clinically Normal Brook Trout, Salvelinus fontinalis

    OpenAIRE

    Iwanowicz, Luke R.; Iwanowicz, Deborah D.; Adams, Cynthia R.; Galbraith, Heather; Aunins, Aaron; Cornman, Robert S.

    2017-01-01

    ABSTRACT Here, we report a draft genome sequence of a picorna-like virus associated with brook trout, Salvelinus fontinalis, gill tissue. The draft genome comprises 8,681 nucleotides, excluding the poly(A) tract, and contains two open reading frames. It is most similar to picorna-like viruses that infect invertebrates.

  18. Draft Genome Sequence of a Picorna-Like Virus Associated with Gill Tissue in Clinically Normal Brook Trout, Salvelinus fontinalis.

    Science.gov (United States)

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Adams, Cynthia R; Galbraith, Heather; Aunins, Aaron; Cornman, Robert S

    2017-10-12

    Here, we report a draft genome sequence of a picorna-like virus associated with brook trout, Salvelinus fontinalis , gill tissue. The draft genome comprises 8,681 nucleotides, excluding the poly(A) tract, and contains two open reading frames. It is most similar to picorna-like viruses that infect invertebrates.

  19. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  20. Possession of ATM Sequence Variants as Predictor for Late Normal Tissue Responses in Breast Cancer Patients Treated With Radiotherapy

    International Nuclear Information System (INIS)

    Ho, Alice Y.; Fan, Grace; Atencio, David P.; Green, Sheryl; Formenti, Silvia C.; Haffty, Bruce G.; Iyengar, Preetha B.A.; Bernstein, Jonine L.; Stock, Richard G.; Cesaretti, Jamie A.; Rosenstein, Barry S.

    2007-01-01

    Purpose: The ATM gene product is a central component of cell cycle regulation and genomic surveillance. We hypothesized that DNA sequence alterations in ATM predict for adverse effects after external beam radiotherapy for early breast cancer. Methods and Materials: A total of 131 patients with a minimum of 2 years follow-up who had undergone breast-conserving surgery and adjuvant radiotherapy were screened for sequence alterations in ATM using DNA from blood lymphocytes. Genetic variants were identified using denaturing high performance liquid chromatography. The Radiation Therapy Oncology Group late morbidity scoring schemes for skin and subcutaneous tissues were applied to quantify the radiation-induced effects. Results: Of the 131 patients, 51 possessed ATM sequence alterations located within exons or in short intron regions flanking each exon that encompass putative splice site regions. Of these 51 patients, 21 (41%) exhibited a minimum of a Grade 2 late radiation response. In contrast, of the 80 patients without an ATM sequence variation, only 18 (23%) had radiation-induced adverse responses, for an odds ratio of 2.4 (95% confidence interval, 1.1-5.2). Fifteen patients were heterozygous for the G→A polymorphism at nucleotide 5557, which causes substitution of asparagine for aspartic acid at position 1853 of the ATM protein. Of these 15 patients, 8 (53%) exhibited a Grade 2-4 late response compared with 31 (27%) of the 116 patients without this alteration, for an odds ratio of 3.1 (95% confidence interval, 1.1-9.4). Conclusion: Sequence variants located in the ATM gene, in particular the 5557 G→A polymorphism, may predict for late adverse radiation responses in breast cancer patients

  1. Mutation Detection in Patients With Advanced Cancer by Universal Sequencing of Cancer-Related Genes in Tumor and Normal DNA vs Guideline-Based Germline Testing.

    Science.gov (United States)

    Mandelker, Diana; Zhang, Liying; Kemel, Yelena; Stadler, Zsofia K; Joseph, Vijai; Zehir, Ahmet; Pradhan, Nisha; Arnold, Angela; Walsh, Michael F; Li, Yirong; Balakrishnan, Anoop R; Syed, Aijazuddin; Prasad, Meera; Nafa, Khedoudja; Carlo, Maria I; Cadoo, Karen A; Sheehan, Meg; Fleischut, Megan H; Salo-Mullen, Erin; Trottier, Magan; Lipkin, Steven M; Lincoln, Anne; Mukherjee, Semanti; Ravichandran, Vignesh; Cambria, Roy; Galle, Jesse; Abida, Wassim; Arcila, Marcia E; Benayed, Ryma; Shah, Ronak; Yu, Kenneth; Bajorin, Dean F; Coleman, Jonathan A; Leach, Steven D; Lowery, Maeve A; Garcia-Aguilar, Julio; Kantoff, Philip W; Sawyers, Charles L; Dickler, Maura N; Saltz, Leonard; Motzer, Robert J; O'Reilly, Eileen M; Scher, Howard I; Baselga, Jose; Klimstra, David S; Solit, David B; Hyman, David M; Berger, Michael F; Ladanyi, Marc; Robson, Mark E; Offit, Kenneth

    2017-09-05

    Guidelines for cancer genetic testing based on family history may miss clinically actionable genetic changes with established implications for cancer screening or prevention. To determine the proportion and potential clinical implications of inherited variants detected using simultaneous sequencing of the tumor and normal tissue ("tumor-normal sequencing") compared with genetic test results based on current guidelines. From January 2014 until May 2016 at Memorial Sloan Kettering Cancer Center, 10 336 patients consented to tumor DNA sequencing. Since May 2015, 1040 of these patients with advanced cancer were referred by their oncologists for germline analysis of 76 cancer predisposition genes. Patients with clinically actionable inherited mutations whose genetic test results would not have been predicted by published decision rules were identified. Follow-up for potential clinical implications of mutation detection was through May 2017. Tumor and germline sequencing compared with the predicted yield of targeted germline sequencing based on clinical guidelines. Proportion of clinically actionable germline mutations detected by universal tumor-normal sequencing that would not have been detected by guideline-directed testing. Of 1040 patients, the median age was 58 years (interquartile range, 50.5-66 years), 65.3% were male, and 81.3% had stage IV disease at the time of genomic analysis, with prostate, renal, pancreatic, breast, and colon cancer as the most common diagnoses. Of the 1040 patients, 182 (17.5%; 95% CI, 15.3%-19.9%) had clinically actionable mutations conferring cancer susceptibility, including 149 with moderate- to high-penetrance mutations; 101 patients tested (9.7%; 95% CI, 8.1%-11.7%) would not have had these mutations detected using clinical guidelines, including 65 with moderate- to high-penetrance mutations. Frequency of inherited mutations was related to case mix, stage, and founder mutations. Germline findings led to discussion or initiation of

  2. A computational approach to distinguish somatic vs. germline origin of genomic alterations from deep sequencing of cancer specimens without a matched normal.

    Directory of Open Access Journals (Sweden)

    James X Sun

    2018-02-01

    Full Text Available A key constraint in genomic testing in oncology is that matched normal specimens are not commonly obtained in clinical practice. Thus, while well-characterized genomic alterations do not require normal tissue for interpretation, a significant number of alterations will be unknown in whether they are germline or somatic, in the absence of a matched normal control. We introduce SGZ (somatic-germline-zygosity, a computational method for predicting somatic vs. germline origin and homozygous vs. heterozygous or sub-clonal state of variants identified from deep massively parallel sequencing (MPS of cancer specimens. The method does not require a patient matched normal control, enabling broad application in clinical research. SGZ predicts the somatic vs. germline status of each alteration identified by modeling the alteration's allele frequency (AF, taking into account the tumor content, tumor ploidy, and the local copy number. Accuracy of the prediction depends on the depth of sequencing and copy number model fit, which are achieved in our clinical assay by sequencing to high depth (>500x using MPS, covering 394 cancer-related genes and over 3,500 genome-wide single nucleotide polymorphisms (SNPs. Calls are made using a statistic based on read depth and local variability of SNP AF. To validate the method, we first evaluated performance on samples from 30 lung and colon cancer patients, where we sequenced tumors and matched normal tissue. We examined predictions for 17 somatic hotspot mutations and 20 common germline SNPs in 20,182 clinical cancer specimens. To assess the impact of stromal admixture, we examined three cell lines, which were titrated with their matched normal to six levels (10-75%. Overall, predictions were made in 85% of cases, with 95-99% of variants predicted correctly, a significantly superior performance compared to a basic approach based on AF alone. We then applied the SGZ method to the COSMIC database of known somatic variants

  3. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  4. Hydrodynamic ejection of bipolar flows from objects undergoing disk accretion: T Tauri stars, massive pre-main-sequence objects, and cataclysmic variables

    International Nuclear Information System (INIS)

    Torbett, M.V.

    1984-01-01

    A general mechanism is presented for generating pressure-driven winds that are intrinsically bipolar from objects undergoing disk accretion. The energy librated in a boundary layer shock as the disk matter impacts the central object is shown to be sufficient to eject a fraction βapprox.10 -2 to 10 -3 of the accreted mass. These winds are driven by a mechanism that accelerates the flow perpendicular to the plane of the disk and can therefore account for the bipolar geometry of the mass loss observed near young stars. The mass loss contained in these winds is comparable to that inferred for young stars. Thus, disk accretion-driven winds may constitute the T Tauri phase of stellar evolution. This mechanism is generally applicable, and thus massive pre-main-sequence objects as well as cataclysmic variables at times of enhanced accretion are predicted to eject bipolar outflows as well. Unmagnetized accreting neutron stas are also expected to eject bipolar flows. Since this mechanism requires stellar surfaces, however, it will not operate in disk accretion onto black holes

  5. The Gaia-ESO Survey: the present-day radial metallicity distribution of the Galactic disc probed by pre-main-sequence clusters

    Science.gov (United States)

    Spina, L.; Randich, S.; Magrini, L.; Jeffries, R. D.; Friel, E. D.; Sacco, G. G.; Pancino, E.; Bonito, R.; Bravi, L.; Franciosini, E.; Klutsch, A.; Montes, D.; Gilmore, G.; Vallenari, A.; Bensby, T.; Bragaglia, A.; Flaccomio, E.; Koposov, S. E.; Korn, A. J.; Lanzafame, A. C.; Smiljanic, R.; Bayo, A.; Carraro, G.; Casey, A. R.; Costado, M. T.; Damiani, F.; Donati, P.; Frasca, A.; Hourihane, A.; Jofré, P.; Lewis, J.; Lind, K.; Monaco, L.; Morbidelli, L.; Prisinzano, L.; Sousa, S. G.; Worley, C. C.; Zaggia, S.

    2017-05-01

    Context. The radial metallicity distribution in the Galactic thin disc represents a crucial constraint for modelling disc formation and evolution. Open star clusters allow us to derive both the radial metallicity distribution and its evolution over time. Aims: In this paper we perform the first investigation of the present-day radial metallicity distribution based on [Fe/H] determinations in late type members of pre-main-sequence clusters. Because of their youth, these clusters are therefore essential for tracing the current interstellar medium metallicity. Methods: We used the products of the Gaia-ESO Survey analysis of 12 young regions (age ages is not easily explained by the models. Our results reveal a complex interplay of several processes (e.g. star formation activity, initial mass function, supernova yields, gas flows) that controlled the recent evolution of the Milky Way. Based on observations made with the ESO/VLT, at Paranal Observatory, under program 188.B-3002 (The Gaia-ESO Public Spectroscopic Survey).Full Table 1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/601/A70

  6. RADIO PROPERTIES OF THE BAT AGNs: THE FIR–RADIO RELATION, THE FUNDAMENTAL PLANE, AND THE MAIN SEQUENCE OF STAR FORMATION

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Krista Lynne; Mushotzky, Richard F.; Vogel, Stuart; Shimizu, Thomas T. [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Miller, Neal, E-mail: klsmith@astro.umd.edu [Department of Mathematics and Physics, Stevenson University, Stevenson, MD 21117 (United States)

    2016-12-01

    We conducted 22 GHz 1″ JVLA imaging of 70 radio-quiet active galactic nuclei (AGNs) from the Swift -BAT survey. We find radio cores in all but three objects. The radio morphologies of the sample fall into three groups: compact and core-dominated, extended, and jet-like. We spatially decompose each image into core flux and extended flux, and compare the extended radio emission with that predicted from previous Herschel observations using the canonical FIR–radio relation. After removing the AGN contribution to the FIR and radio flux densities, we find that the relation holds remarkably well despite the potentially different star formation physics in the circumnuclear environment. We also compare our core radio flux densities with predictions of coronal models and scale-invariant jet models for the origin of radio emission in radio-quiet AGNs, and find general consistency with both models. However, we find that the L {sub R}/ L {sub X} relation does not distinguish between star formation and non-relativistic AGN-driven outflows as the origin of radio emission in radio-quiet AGNs. Finally, we examine where objects with different radio morphologies fall in relation to the main sequence (MS) of star formation, and conclude that those AGNs that fall below the MS, as X-ray selected AGNs have been found to do, have core-dominated or jet-like 22 GHz morphologies.

  7. RNA-sequence data normalization through in silico prediction of reference genes: the bacterial response to DNA damage as case study.

    Science.gov (United States)

    Berghoff, Bork A; Karlsson, Torgny; Källman, Thomas; Wagner, E Gerhart H; Grabherr, Manfred G

    2017-01-01

    Measuring how gene expression changes in the course of an experiment assesses how an organism responds on a molecular level. Sequencing of RNA molecules, and their subsequent quantification, aims to assess global gene expression changes on the RNA level (transcriptome). While advances in high-throughput RNA-sequencing (RNA-seq) technologies allow for inexpensive data generation, accurate post-processing and normalization across samples is required to eliminate any systematic noise introduced by the biochemical and/or technical processes. Existing methods thus either normalize on selected known reference genes that are invariant in expression across the experiment, assume that the majority of genes are invariant, or that the effects of up- and down-regulated genes cancel each other out during the normalization. Here, we present a novel method, moose 2 , which predicts invariant genes in silico through a dynamic programming (DP) scheme and applies a quadratic normalization based on this subset. The method allows for specifying a set of known or experimentally validated invariant genes, which guides the DP. We experimentally verified the predictions of this method in the bacterium Escherichia coli , and show how moose 2 is able to (i) estimate the expression value distances between RNA-seq samples, (ii) reduce the variation of expression values across all samples, and (iii) to subsequently reveal new functional groups of genes during the late stages of DNA damage. We further applied the method to three eukaryotic data sets, on which its performance compares favourably to other methods. The software is implemented in C++ and is publicly available from http://grabherr.github.io/moose2/. The proposed RNA-seq normalization method, moose 2 , is a valuable alternative to existing methods, with two major advantages: (i) in silico prediction of invariant genes provides a list of potential reference genes for downstream analyses, and (ii) non-linear artefacts in RNA-seq data

  8. Development of normal fetal brain by MRI with a half-Fourier rapid acquisition with relaxation enhancement sequence

    International Nuclear Information System (INIS)

    Li Meilan; Liu Xuejun; Wang Jianhong; Zhao Cheng; Li Xiang

    2006-01-01

    Objective: To evaluate normal maturation of the fetal brain with half-Fourier rapid acquisition with relaxation enhancement (RARE) MRI. Methods: The normal brains of 25 fetuses of 12-38 weeks gestational age were examined in utero with half-Fourier RARE imaging. Gyrus maturation, gray and white matter differentiation, ventricle-to-brain diameter ratio, and subarachnoid space size were evaluated with respect to gestational age. Results: At 12-23 weeks, the brain had a smooth surface, and two or three layers were differentiated in the cerebral cortex. At 24-26 weeks, only a few shallow grooves were seen in the central sulcus, and three layers, including the immature cortex, intermediate zone, and germinal matrix, were differentiated in all fetuses. At 27-29 weeks, sulcus formation was observed in various regions of the brain parenchyma, and the germinal matrix became invisible. Sulcation was seen in the whole cerebral cortex from 30 weeks on. However, the cortex did not undergo infolding, and opercular formation was not seen before 33 weeks. At 23 weeks and earlier, the cerebral ventricles were large; thereafter, they gradually became smaller. The subarachnoid space overlying the cortical convexities was slightly dilated at all gestational ages, most markedly at 21-26 weeks. Conclusion: Changes in brain maturation proceed through stages in an orderly and predictable fashion and can be evaluated reliably with half-Fourier RARE MRI. (authors)

  9. MRI of normal pancreas : comparison of T2-weighted pulse sequences using turbo spin echo, turbo spin echo with fat suppression, HASTE and HASTE with fat suppression

    International Nuclear Information System (INIS)

    Lee, Kyoung Ho; Kim, Tae Kyoung; Jang, Hyun Jung; Kim, Young Hoon; Han, Sang Wook; Han, Joon Koo; Choi, Byung Ihn

    1998-01-01

    To compare various breath-hold T2 weighted sequences in imaging normal pancreas with a phased-array coil. HASTE showed higher SD/N than TSE or FS-HASTE (p<0.01). TSE was superior to TSE in the delineation of pancreatic duct (p<0.001). TSE showed more artifacts than FS-TSE (p<0.001): HASTE and FS-HASTE showed no artifact. TSE is better than HASTE for the delineation of pancreatic margin but HASTE shows less artifacts and a more conspicuous pancreatic duct. Fat suppression decreases artifacts but makes the pancreatic margin indistinct. (author). 19 refs., 1 tab., 2 figs

  10. Escherichia coli Sequence Type 131 H30 Is the Main Driver of Emerging Extended-Spectrum-β-Lactamase-Producing E. coli at a Tertiary Care Center.

    Science.gov (United States)

    Johnson, James R; Johnston, Brian; Thuras, Paul; Launer, Bryn; Sokurenko, Evgeni V; Miller, Loren G

    2016-01-01

    The H 30 strain of Escherichia coli sequence type 131 (ST131- H 30) is a recently emerged, globally disseminated lineage associated with fluoroquinolone resistance and, via its H 30Rx subclone, the CTX-M-15 extended-spectrum beta-lactamase (ESBL). Here, we studied the clonal background and resistance characteristics of 109 consecutive recent E. coli clinical isolates (2015) and 41 historical ESBL-producing E. coli blood isolates (2004 to 2011) from a public tertiary care center in California with a rising prevalence of ESBL-producing E. coli isolates. Among the 2015 isolates, ST131, which was represented mainly by ST131- H 30, was the most common clonal lineage (23% overall). ST131- H 30 accounted for 47% (8/17) of ESBL-producing, 47% (14/30) of fluoroquinolone-resistant, and 33% (11/33) of multidrug-resistant isolates. ST131- H 30 also accounted for 53% (8/14) of dually fluoroquinolone-resistant, ESBL-producing isolates, with the remaining 47% comprised of diverse clonal groups that contributed a single isolate each. ST131- H 30Rx, with CTX-M-15, was the major ESBL producer (6/8) among ST131- H 30 isolates. ST131- H 30 and H 30Rx also dominated (46% and 37%, respectively) among the historical ESBL-producing isolates (2004 to 2011), without significant temporal shifts in relative prevalence. Thus, this medical center's recently emerging ESBL-producing E. coli strains, although multiclonal, are dominated by ST131- H 30 and H 30Rx, which are the only clonally expanded fluoroquinolone-resistant, ESBL-producing lineages. Measures to rapidly and effectively detect, treat, and control these highly successful lineages are needed. IMPORTANCE The ever-rising prevalence of resistance to first-line antibiotics among clinical Escherichia coli isolates leads to worse clinical outcomes and higher health care costs, thereby creating a need to discover its basis so that effective interventions can be developed. We found that the H 30 subset within E. coli sequence type 131

  11. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    Directory of Open Access Journals (Sweden)

    De Marzo Angelo M

    2011-06-01

    Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.

  12. EFFECT OF METALLICITY ON THE EVOLUTION OF THE HABITABLE ZONE FROM THE PRE-MAIN SEQUENCE TO THE ASYMPTOTIC GIANT BRANCH AND THE SEARCH FOR LIFE

    Energy Technology Data Exchange (ETDEWEB)

    Danchi, William C. [Exoplanets and Stellar Astrophysics Laboratory, NASA Goddard Space Flight Center, Code 667, Greenbelt, MD 20771 (United States); Lopez, Bruno, E-mail: william.c.danchi@nasa.gov, E-mail: bruno.lopez@oca.eu [Observatoire de la Cote d' Azur, Laboratoire Lagrange UMR 7293, BP 4229, F-06034 Nice Cedex 4 (France)

    2013-05-20

    During the course of stellar evolution, the location and width of the habitable zone changes as the luminosity and radius of the star evolves. The duration of habitability for a planet located at a given distance from a star is greatly affected by the characteristics of the host star. A quantification of these effects can be used observationally in the search for life around nearby stars. The longer the duration of habitability, the more likely it is that life has evolved. The preparation of observational techniques aimed at detecting life would benefit from the scientific requirements deduced from the evolution of the habitable zone. We present a study of the evolution of the habitable zone around stars of 1.0, 1.5, and 2.0 M{sub Sun} for metallicities ranging from Z = 0.0001 to Z = 0.070. We also consider the evolution of the habitable zone from the pre-main sequence until the asymptotic giant branch is reached. We find that metallicity strongly affects the duration of the habitable zone for a planet as well as the distance from the host star where the duration is maximized. For a 1.0 M{sub Sun} star with near solar metallicity, Z = 0.017, the duration of the habitable zone is >10 Gyr at distances 1.2-2.0 AU from the star, whereas the duration is >20 Gyr for high-metallicity stars (Z = 0.070) at distances of 0.7-1.8 AU, and {approx}4 Gyr at distances of 1.8-3.3 AU for low-metallicity stars (Z = 0.0001). Corresponding results have been obtained for stars of 1.5 and 2.0 solar masses.

  13. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Energy Technology Data Exchange (ETDEWEB)

    Bellini, A.; Anderson, J.; Van der Marel, R. P. [Space Telescope Science Institute, 3700 San Martin Dr., Baltimore, MD 21218 (United States); Milone, A. P.; Marino, A. F. [Research School of Astronomy and Astrophysics, Australian National University, Mt Stromlo Observatory, via Cotter Rd, Weston, ACT 2611 (Australia); Piotto, G.; Bedin, L. R. [Istituto Nazionale di Astrofisica, Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, Padova, I-35122 (Italy); King, I. R., E-mail: bellini@stsci.edu [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States)

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with.

  14. A HIGHLY CONSISTENT FRAMEWORK FOR THE EVOLUTION OF THE STAR-FORMING ''MAIN SEQUENCE'' FROM z ∼ 0-6

    Energy Technology Data Exchange (ETDEWEB)

    Speagle, J. S. [Harvard University Department of Astronomy, 60 Garden Street, MS 46, Cambridge, MA 02138 (United States); Steinhardt, C. L.; Silverman, J. D. [Kavli IPMU, University of Tokyo, Kashiwanoha 5-1-5, Kashiwa-shi, Chiba 277-8583 (Japan); Capak, P. L., E-mail: jspeagle@cfa.harvard.edu [California Institute of Technology, MC 105-24, 1200 East California Boulevard, Pasadena, CA 91125 (United States)

    2014-10-01

    Using a compilation of 25 studies from the literature, we investigate the evolution of the star-forming galaxy (SFG) main sequence (MS) in stellar mass and star formation rate (SFR) out to z ∼ 6. After converting all observations to a common set of calibrations, we find a remarkable consensus among MS observations (∼0.1 dex 1σ interpublication scatter). By fitting for time evolution of the MS in bins of constant mass, we deconvolve the observed scatter about the MS within each observed redshift bin. After accounting for observed scatter between different SFR indicators, we find the width of the MS distribution is ∼0.2 dex and remains constant over cosmic time. Our best fits indicate the slope of the MS is likely time-dependent, with our best-fit log SFR(M {sub *}, t) = (0.84 ± 0.02 – 0.026 ± 0.003 × t)log M {sub *} – (6.51 ± 0.24 – 0.11 ± 0.03 × t), where t is the age of the universe in Gyr. We use our fits to create empirical evolutionary tracks in order to constrain MS galaxy star formation histories (SFHs), finding that (1) the most accurate representations of MS SFHs are given by delayed-τ models, (2) the decline in fractional stellar mass growth for a ''typical'' MS galaxy today is approximately linear for most of its lifetime, and (3) scatter about the MS can be generated by galaxies evolving along identical evolutionary tracks assuming an initial 1σ spread in formation times of ∼1.4 Gyr.

  15. Photometric Determination of the Mass Accretion Rates of Pre-main-sequence Stars. V. Recent Star Formation in the 30 Dor Nebula

    Science.gov (United States)

    De Marchi, Guido; Panagia, Nino; Beccari, Giacomo

    2017-09-01

    We report on the properties of the low-mass stars that recently formed in the central ˜ 2\\buildrel{ \\prime}\\over{.} 7× 2\\buildrel{ \\prime}\\over{.} 7 of 30 Dor, including the R136 cluster. Using the photometric catalog of De Marchi et al., based on observations with the Hubble Space Telescope, and the most recent extinction law for this field, we identify 1035 bona fide pre-main-sequence (PMS) stars showing {{H}}α excess emission at the 4σ level with an {{H}}α equivalent width of 20 Å or more. We find a wide spread in age spanning the range ˜ 0.1{--}50 {Myr}. We also find that the older PMS objects are placed in front of the R136 cluster and are separated from it by a conspicuous amount of absorbing material, indicating that star formation has proceeded from the periphery into the interior of the region. We derive physical parameters for all PMS stars, including masses m, ages t, and mass accretion rates {\\dot{M}}{acc}. To identify reliable correlations between these parameters, which are intertwined, we use a multivariate linear regression fit of the type {log}{\\dot{M}}{acc}=a× {log}t+b× {log}m+c. The values of a and b for 30 Dor are compatible with those found in NGC 346 and NGC 602. We extend the fit to a uniform sample of 1307 PMS stars with 0.5contract NAS5-26555.

  16. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Science.gov (United States)

    Bellini, A.; Milone, A. P.; Anderson, J.; Marino, A. F.; Piotto, G.; van der Marel, R. P.; Bedin, L. R.; King, I. R.

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with. Based on archival observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  17. A HIGHER EFFICIENCY OF CONVERTING GAS TO STARS PUSHES GALAXIES AT z ∼ 1.6 WELL ABOVE THE STAR-FORMING MAIN SEQUENCE

    Energy Technology Data Exchange (ETDEWEB)

    Silverman, J. D.; Rujopakarn, W. [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, The University of Tokyo, Kashiwa, Chiba 277-8583 (Japan); Daddi, E.; Liu, D. [Laboratoire AIM, CEA/DSM-CNRS-Universite Paris Diderot, Irfu/Service d’Astrophysique, CEA Saclay (France); Rodighiero, G. [Dipartimento di Fisica e Astronomia, Universita di Padova, vicolo Osservatorio, 3, I-35122 Padova (Italy); Sargent, M. [Astronomy Centre, Department of Physics and Astronomy, University of Sussex, Brighton BN1 9QH (United Kingdom); Renzini, A. [Instituto Nazionale de Astrofisica, Osservatorio Astronomico di Padova, v.co dell’Osservatorio 5, I-35122 Padova (Italy); Feruglio, C. [IRAM—Institut de RadioAstronomie Millimétrique, 300 rue de la Piscine, F-38406 Saint Martin d’Hères (France); Kashino, D. [Division of Particle and Astrophysical Science, Graduate School of Science, Nagoya University, Nagoya 464-8602 (Japan); Sanders, D. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Kartaltepe, J. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Nagao, T. [Graduate School of Science and Engineering, Ehime University, 2-5 Bunkyo-cho, Matsuyama 790-8577 (Japan); Arimoto, N. [Subaru Telescope, 650 North A’ohoku Place, Hilo, HI-96720 (United States); Berta, S.; Lutz, D. [Max-Planck-Institut für extraterrestrische Physik, D-84571 Garching (Germany); Béthermin, M. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Koekemoer, A., E-mail: john.silverman@ipmu.jp [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD, 21218 (United States); and others

    2015-10-20

    Local starbursts have a higher efficiency of converting gas into stars, as compared to typical star-forming galaxies at a given stellar mass, possibly indicative of different modes of star formation. With the peak epoch of galaxy formation occurring at z > 1, it remains to be established whether such an efficient mode of star formation is occurring at high redshift. To address this issue, we measure the molecular gas content of seven high-redshift (z ∼ 1.6) starburst galaxies with the Atacama Large Millimeter/submillimeter Array and IRAM/Plateau de Bure Interferometer. Our targets are selected from the sample of Herschel far-infrared-detected galaxies having star formation rates (∼300–800 M{sub ⊙} yr{sup −1}) elevated (≳4×) above the star-forming main sequence (MS) and included in the FMOS-COSMOS near-infrared spectroscopic survey of star-forming galaxies at z ∼ 1.6 with Subaru. We detect CO emission in all cases at high levels of significance, indicative of high gas fractions (∼30%–50%). Even more compelling, we firmly establish with a clean and systematic selection that starbursts, identified as MS outliers, at high redshift generally have a lower ratio of CO to total infrared luminosity as compared to typical MS star-forming galaxies, although with a smaller offset than expected based on past studies of local starbursts. We put forward a hypothesis that there exists a continuous increase in star formation efficiency with elevation from the MS with galaxy mergers as a possible physical driver. Along with a heightened star formation efficiency, our high-redshift sample is similar in other respects to local starbursts, such as being metal rich and having a higher ionization state of the interstellar medium.

  18. EFFECT OF METALLICITY ON THE EVOLUTION OF THE HABITABLE ZONE FROM THE PRE-MAIN SEQUENCE TO THE ASYMPTOTIC GIANT BRANCH AND THE SEARCH FOR LIFE

    International Nuclear Information System (INIS)

    Danchi, William C.; Lopez, Bruno

    2013-01-01

    During the course of stellar evolution, the location and width of the habitable zone changes as the luminosity and radius of the star evolves. The duration of habitability for a planet located at a given distance from a star is greatly affected by the characteristics of the host star. A quantification of these effects can be used observationally in the search for life around nearby stars. The longer the duration of habitability, the more likely it is that life has evolved. The preparation of observational techniques aimed at detecting life would benefit from the scientific requirements deduced from the evolution of the habitable zone. We present a study of the evolution of the habitable zone around stars of 1.0, 1.5, and 2.0 M ☉ for metallicities ranging from Z = 0.0001 to Z = 0.070. We also consider the evolution of the habitable zone from the pre-main sequence until the asymptotic giant branch is reached. We find that metallicity strongly affects the duration of the habitable zone for a planet as well as the distance from the host star where the duration is maximized. For a 1.0 M ☉ star with near solar metallicity, Z = 0.017, the duration of the habitable zone is >10 Gyr at distances 1.2-2.0 AU from the star, whereas the duration is >20 Gyr for high-metallicity stars (Z = 0.070) at distances of 0.7-1.8 AU, and ∼4 Gyr at distances of 1.8-3.3 AU for low-metallicity stars (Z = 0.0001). Corresponding results have been obtained for stars of 1.5 and 2.0 solar masses.

  19. A Constraint on the Formation Timescale of the Young Open Cluster NGC 2264: Lithium Abundance of Pre-main Sequence Stars

    Science.gov (United States)

    Lim, Beomdu; Sung, Hwankyung; Kim, Jinyoung S.; Bessell, Michael S.; Hwang, Narae; Park, Byeong-Gon

    2016-11-01

    The timescale of cluster formation is an essential parameter in order to understand the formation process of star clusters. Pre-main sequence (PMS) stars in nearby young open clusters reveal a large spread in brightness. If the spread were considered to be a result of a real spread in age, the corresponding cluster formation timescale would be about 5-20 Myr. Hence it could be interpreted that star formation in an open cluster is prolonged for up to a few tens of Myr. However, difficulties in reddening correction, observational errors, and systematic uncertainties introduced by imperfect evolutionary models for PMS stars can result in an artificial age spread. Alternatively, we can utilize Li abundance as a relative age indicator of PMS star to determine the cluster formation timescale. The optical spectra of 134 PMS stars in NGC 2264 have been obtained with MMT/Hectochelle. The equivalent widths have been measured for 86 PMS stars with a detectable Li line (3500\\lt {T}{eff}[{{K}}]≤slant 6500). Li abundance under the condition of local thermodynamic equilibrium (LTE) was derived using the conventional curve of growth method. After correction for non-LTE effects, we find that the initial Li abundance of NGC 2264 is A({Li})=3.2+/- 0.2. From the distribution of the Li abundances, the underlying age spread of the visible PMS stars is estimated to be about 3-4 Myr and this, together with the presence of embedded populations in NGC 2264, suggests that the cluster formed on a timescale shorter than 5 Myr.

  20. The Pisa pre-main sequence tracks and isochrones. A database covering a wide range of Z, Y, mass, and age values

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-09-01

    Context. In recent years new observations of pre-main sequence stars (pre-MS) with Z ≤ Z⊙ have been made available. To take full advantage of the continuously growing amount of data of pre-MS stars in different environments, we need to develop updated pre-MS models for a wide range of metallicity to assign reliable ages and masses to the observed stars. Aims: We present updated evolutionary pre-MS models and isochrones for a fine grid of mass, age, metallicity, and helium values. Methods: We use a standard and well-tested stellar evolutionary code (i.e. FRANEC), that adopts outer boundary conditions from detailed and realistic atmosphere models. In this code, we incorporate additional improvements to the physical inputs related to the equation of state and the low temperature radiative opacities essential to computing low-mass stellar models. Results: We make available via internet a large database of pre-MS tracks and isochrones for a wide range of chemical compositions (Z = 0.0002-0.03), masses (M = 0.2-7.0 M⊙), and ages (1-100 Myr) for a solar-calibrated mixing length parameter α (i.e. 1.68). For each chemical composition, additional models were computed with two different mixing length values, namely α = 1.2 and 1.9. Moreover, for Z ≥ 0.008, we also provided models with two different initial deuterium abundances. The characteristics of the models have been discussed in detail and compared with other work in the literature. The main uncertainties affecting theoretical predictions have been critically discussed. Comparisons with selected data indicate that there is close agreement between theory and observation. Tracks and isochrones are available on the web at the http://astro.df.unipi.it/stellar-models/Tracks and isochrones are also available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/533/A109

  1. XMM-NEWTON MONITORING OF THE CLOSE PRE-MAIN-SEQUENCE BINARY AK SCO. EVIDENCE OF TIDE-DRIVEN FILLING OF THE INNER GAP IN THE CIRCUMBINARY DISK

    Energy Technology Data Exchange (ETDEWEB)

    Gomez de Castro, Ana Ines [S. D. Astronomia y Geodesia and Instituto de Matematica Interdisciplinar, Fac. de CC Matematicas, Universidad Complutense, E-28040 Madrid (Spain); Lopez-Santiago, Javier [Departamento de Astrofisica, Fac de CC Fisicas, Universidad Complutense, E-28040 Madrid (Spain); Talavera, Antonio [European Space Astronomy Center, Villanueva de la Canada, E-28691, Madrid (Spain); Sytov, A. Yu.; Bisikalo, D. [Institute of Astronomy of the Russian Academy of Sciences, Pyatnitskaya St. 48, 109017 Moscow (Russian Federation)

    2013-03-20

    AK Sco stands out among pre-main-sequence binaries because of its prominent ultraviolet excess, the high eccentricity of its orbit, and the strong tides driven by it. AK Sco consists of two F5-type stars that get as close as 11 R{sub *} at periastron passage. The presence of a dense (n{sub e} {approx} 10{sup 11} cm{sup -3}) extended envelope has been unveiled recently. In this article, we report the results from an XMM-Newton-based monitoring of the system. We show that at periastron, X-ray and UV fluxes are enhanced by a factor of {approx}3 with respect to the apastron values. The X-ray radiation is produced in an optically thin plasma with T {approx} 6.4 Multiplication-Sign 10{sup 6} K and it is found that the N{sub H} column density rises from 0.35 Multiplication-Sign 10{sup 21} cm{sup -2} at periastron to 1.11 Multiplication-Sign 10{sup 21} cm{sup -2} at apastron, in good agreement with previous polarimetric observations. The UV emission detected in the Optical Monitor band seems to be caused by the reprocessing of the high-energy magnetospheric radiation on the circumstellar material. Further evidence of the strong magnetospheric disturbances is provided by the detection of line broadening of 278.7 km s{sup -1} in the N V line with Hubble Space Telescope/Space Telescope Imaging Spectrograph. Numerical simulations of the mass flow from the circumbinary disk to the components have been carried out. They provide a consistent scenario with which to interpret AK Sco observations. We show that the eccentric orbit acts like a gravitational piston. At apastron, matter is dragged efficiently from the inner disk border, filling the inner gap and producing accretion streams that end as ring-like structures around each component of the system. At periastron, the ring-like structures come into contact, leading to angular momentum loss, and thus producing an accretion outburst.

  2. Finite-size effects in transcript sequencing count distribution: its power-law correction necessarily precedes downstream normalization and comparative analysis.

    Science.gov (United States)

    Wong, Wing-Cheong; Ng, Hong-Kiat; Tantoso, Erwin; Soong, Richie; Eisenhaber, Frank

    2018-02-12

    signal-to-noise ratio by 50% and the statistical/detection sensitivity by as high as 30% regardless of the downstream mapping and normalization methods. Most importantly, the power-law correction improves concordance in significant calls among different normalization methods of a data series averagely by 22%. When presented with a higher sequence depth (4 times difference), the improvement in concordance is asymmetrical (32% for the higher sequencing depth instance versus 13% for the lower instance) and demonstrates that the simple power-law correction can increase significant detection with higher sequencing depths. Finally, the correction dramatically enhances the statistical conclusions and eludes the metastasis potential of the NUGC3 cell line against AGS of our dilution analysis. The finite-size effects due to undersampling generally plagues transcript count data with reproducibility issues but can be minimized through a simple power-law correction of the count distribution. This distribution correction has direct implication on the biological interpretation of the study and the rigor of the scientific findings. This article was reviewed by Oliviero Carugo, Thomas Dandekar and Sandor Pongor.

  3. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  4. Magnetic resonance imaging of articular cartilage in the knee. Evaluation of 3D-fat-saturation FLASH sequence in normal volunteer and patient with osteoarthritis

    International Nuclear Information System (INIS)

    Sato, Katsuhiko

    1996-01-01

    MR imaging of normal and abnormal articular cartilage of the knee was performed using 3D-fat-saturation FLASH sequence (FSF). Contrast-to-noise ratios between the cartilage and fluid, and cartilage and bone marrow were evaluated respectively in 10 normal volunteers. The optimal imaging parameters were determined as flip angle of 40deg and TE of 10 ms. Good correlation was noted between MR images and macroscopic appearance of the hyaline cartilages in the cadaver knees. Comparison of MR and radiographic findings was made in 39 cases of osteoarthritis. MR was significantly more sensitive than radiography in detecting cartilage abnormalities. In patient with radiographically normal joint spaces, cartilage abnormality was detected by MRI in the medial compartment of 13 cases and the lateral compartment of 19 cases. Signal intensity of joint effusion was sufficiently suppressed and did not hamper evaluation of the cartilages. FSF method was considered as a valuable imaging technique in the evaluation of cartilage abnormalities of the knee. (author)

  5. Magnetic resonance imaging of articular cartilage in the knee. Evaluation of 3D-fat-saturation FLASH sequence in normal volunteer and patient with osteoarthritis

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Katsuhiko [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine

    1996-07-01

    MR imaging of normal and abnormal articular cartilage of the knee was performed using 3D-fat-saturation FLASH sequence (FSF). Contrast-to-noise ratios between the cartilage and fluid, and cartilage and bone marrow were evaluated respectively in 10 normal volunteers. The optimal imaging parameters were determined as flip angle of 40deg and TE of 10 ms. Good correlation was noted between MR images and macroscopic appearance of the hyaline cartilages in the cadaver knees. Comparison of MR and radiographic findings was made in 39 cases of osteoarthritis. MR was significantly more sensitive than radiography in detecting cartilage abnormalities. In patient with radiographically normal joint spaces, cartilage abnormality was detected by MRI in the medial compartment of 13 cases and the lateral compartment of 19 cases. Signal intensity of joint effusion was sufficiently suppressed and did not hamper evaluation of the cartilages. FSF method was considered as a valuable imaging technique in the evaluation of cartilage abnormalities of the knee. (author)

  6. The evolution of stellar metallicity gradients of the Milky Way disk from LSS-GAC main sequence turn-off stars: a two-phase disk formation history?

    International Nuclear Information System (INIS)

    Xiang, Mao-Sheng; Liu, Xiao-Wei; Huang, Yang; Wang, Chun; Ren, Juan-Juan; Chen, Bing-Qiu; Sun, Ning-Chen; Zhang, Hua-Wei; Yuan, Hai-Bo; Rebassa-Mansergas, Alberto; Huo, Zhi-Ying

    2015-01-01

    Accurate measurements of stellar metallicity gradients in the radial and vertical directions of the disk and their temporal variations provide important constraints on the formation and evolution of the Milky Way disk. We use 297 042 main sequence turn-off stars selected from the LAMOST Spectroscopic Survey of the Galactic Anti-center (LSS-GAC) to determine the radial and vertical gradients of stellar metallicity, Δ[Fe/H]/ΔR and Δ[Fe/H]/Δ|Z| of the Milky Way disk in the direction of the anticenter. We determine ages of those turn-off stars by isochrone fitting and measure the temporal variations of metallicity gradients. We have carried out a detailed analysis of the selection effects resulting from the selection, observation and data reduction of LSS-GAC targets and the potential biases of a magnitude limited sample on the determinations of metallicity gradients. Our results show that the gradients, both in the radial and vertical directions, exhibit significant spatial and temporal variations. The radial gradients yielded by stars with the oldest ages (≳ 11 Gyr) are essentially zero at all heights from the disk midplane, while those given by younger stars are always negative. The vertical gradients deduced from stars with the oldest ages (≳ 11 Gyr) are negative and only show very weak variations with Galactocentric distance in the disk plane, R, while those yielded by younger stars show strong variations with R. After being essentially flat at the earliest epochs of disk formation, the radial gradients steepen as age decreases, reaching a maximum (steepest) at age 7–8 Gyr, and then they flatten again. Similar temporal trends are also found for the vertical gradients. We infer that the assembly of the Milky Way disk may have experienced at least two distinct phases. The earlier phase is probably related to a slow, pressure-supported collapse of gas, when the gas settles down to the disk mainly in the vertical direction. In the later phase, there are

  7. Main Memory DBMS

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractA main memory database system is a DBMS that primarily relies on main memory for computer data storage. In contrast, normal database management systems employ hard disk based persisntent storage.

  8. Gadolinium-enhanced MR imaging of normal renal transplants. An evaluation of a T1-weighted dynamic echo-planar sequence

    International Nuclear Information System (INIS)

    Dupas, B.; Blancho, G.; Havet, T.; Leaute, F.

    1999-01-01

    Purpose: To evaluate the potential usefulness of dynamic MR with echoplanar imaging (EPI) in assessing the renal function in patients with renal allografts. Material and methods: Using a T1-weighted sequence, EPI was performed after injection of a Gd-chelate in 17 patients with normally functioning renal allografts. Time-intensity curves were plotted from the signal intensity (SI) measurements of the cortex and the medulla. Results: The pattern of corticomedullar differentiation (CMD) observed after constrast enhancement was divided into four phases using the T1-EPI. After a rapid decrease in the SI of cortical structures, and a subsequent return to precontrast levels, a gradual fall in the SI of the medulla was observed. The average time between the two periods of signal loss was 60 s. Conclusion: This study illustrated the potential use of dynamic T1-EPI to demonstrate contrast-induced CMD in renal allografts. (orig.)

  9. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

    Science.gov (United States)

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

    2017-06-01

    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Three dimensional and high resolution magnetic resonance imaging of the inner ear. Normal ears and anomaly scanned with 3D-CISS sequence

    International Nuclear Information System (INIS)

    Edamatsu, Hideo; Uechi, Yoko; Honjyo, Shiro; Yamashita, Koichi; Tonami, Hisao.

    1997-01-01

    The MRI system used in this study was a new scanning sequence, 3D-CISS (Three dimensional-constructive interference in steady state) with 1.5 Tesla. Ten normal ears and one ear with Mondini type anomaly were scanned and reconstructed. In imagings of normal inner ears, the cochlea has three spiral layers; basal, middle and apical turns. Each turn was separated into three parts; the scala vestibuli, osseous spiral lamina and scala tympani. Three semicircular ducts, utricle and saccule were also reconstructed in one frame. In the inner ear of Mondini anomaly, 3D MRI showed cochlear aplasia, hypoplasia of semicircular ducts and widely dilated vestibule. The imaging was identical with findings of ''common cavity''. The anomaly was easily recognized in 3D MRI more than in 2D imagings. The detailed and cubic imagings of the Mondini anomaly in 3D MRI could not be observed with conventional 2D MRI. 3D MRI is not invasive method and can scan a target very quickly. (author)

  11. Transcriptome profiling of the cancer, adjacent non-tumor and distant normal tissues from a colorectal cancer patient by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Yan'an Wu

    Full Text Available Colorectal cancer (CRC is one of the most commonly diagnosed cancers in the world. A genome-wide screening of transcriptome dysregulation between cancer and normal tissue would provide insight into the molecular basis of CRC initiation and progression. Compared with microarray technology, which is commonly used to identify transcriptional changes, the recently developed RNA-seq technique has the ability to detect other abnormal regulations in the cancer transcriptome, such as alternative splicing, novel transcripts or gene fusion. In this study, we performed high-throughput transcriptome sequencing at ~50× coverage on CRC, adjacent non-tumor and distant normal tissue. The results revealed cancer-specific, differentially expressed genes and differential alternative splicing, suggesting that the extracellular matrix and metabolic pathways are activated and the genes related to cell homeostasis are suppressed in CRC. In addition, one tumor-restricted gene fusion, PRTEN-NOTCH2, was also detected and experimentally confirmed. This study reveals some common features in tumor invasion and provides a comprehensive survey of the CRC transcriptome, which provides better insight into the complexity of regulatory changes during tumorigenesis.

  12. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Directory of Open Access Journals (Sweden)

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  13. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability.

    Science.gov (United States)

    Joardar, Vinita; Abrams, Natalie F; Hostetler, Jessica; Paukstelis, Paul J; Pakala, Suchitra; Pakala, Suman B; Zafar, Nikhat; Abolude, Olukemi O; Payne, Gary; Andrianopoulos, Alex; Denning, David W; Nierman, William C

    2012-12-12

    The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus), A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum). The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25-36 Kb) among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin) and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum) do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus), contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent annotations for future genetic, evolutionary and population

  14. Bioconductor workflow for single-cell RNA sequencing: Normalization, dimensionality reduction, clustering, and lineage inference [version 1; referees: 1 approved, 2 approved with reservations

    Directory of Open Access Journals (Sweden)

    Fanny Perraudeau

    2017-07-01

    Full Text Available Novel single-cell transcriptome sequencing assays allow researchers to measure gene expression levels at the resolution of single cells and offer the unprecendented opportunity to investigate at the molecular level fundamental biological questions, such as stem cell differentiation or the discovery and characterization of rare cell types. However, such assays raise challenging statistical and computational questions and require the development of novel methodology and software. Using stem cell differentiation in the mouse olfactory epithelium as a case study, this integrated workflow provides a step-by-step tutorial to the methodology and associated software for the following four main tasks: (1 dimensionality reduction accounting for zero inflation and over dispersion and adjusting for gene and cell-level covariates; (2 cell clustering using resampling-based sequential ensemble clustering; (3 inference of cell lineages and pseudotimes; and (4 differential expression analysis along lineages.

  15. Pattern of phylogenetic diversification of the Cychrini ground beetles in the world as deduced mainly from sequence comparisons of the mitochondrial genes.

    Science.gov (United States)

    Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Osawa, Syozo

    2004-02-04

    The phylogenetic position of the tribe Cychrini within the subfamily Carabinae (the family Carabidae) was estimated by comparing the nucleotide sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and the nuclear 28S ribosomal DNA (rDNA). The phylogenetic trees suggest that the Cychrini would most probably be the oldest line within the Carabinae. Phylogenetic trees were constructed by comparing the mitochondrial cytochrome C oxidase subunit I (COI) gene sequences from 33 species of the Cychrini from various localities that include the whole distribution ranges of the representative species within all the known genera in the world. The trees suggest that the Cychrini members radiated into a number of phylogenetic lineages within a short period, starting about 44 million years ago (MYA). Most of the phylogenetic lineages or sublineages are geographically linked, each consisting of a single or only a few species without scarce morphological differentiation in spite of their long evolutionary histories (silent or near-silent evolution [see Adv. Biophys. 36 (1999) 65; J. Mol. Evol. 53 (2001) 517]). The fact suggests that the geographic isolation per se did not bring about conspicuous morphological differentiation. The phylogenetic lineages of the Cychrini well correspond to the taxonomically defined genera and the subgenera.

  16. Small RNA Sequencing Uncovers New miRNAs and moRNAs Differentially Expressed in Normal and Primary Myelofibrosis CD34+ Cells.

    Directory of Open Access Journals (Sweden)

    Paola Guglielmelli

    Full Text Available Myeloproliferative neoplasms (MPN are chronic myeloid cancers thought to arise at the level of CD34+ hematopoietic stem/progenitor cells. They include essential thrombocythemia (ET, polycythemia vera (PV and primary myelofibrosis (PMF. All can progress to acute leukemia, but PMF carries the worst prognosis. Increasing evidences indicate that deregulation of microRNAs (miRNAs might plays an important role in hematologic malignancies, including MPN. To attain deeper knowledge of short RNAs (sRNAs expression pattern in CD34+ cells and of their possible role in mediating post-transcriptional regulation in PMF, we sequenced with Illumina HiSeq2000 technology CD34+ cells from healthy subjects and PMF patients. We detected the expression of 784 known miRNAs, with a prevalence of miRNA up-regulation in PMF samples, and discovered 34 new miRNAs and 99 new miRNA-offset RNAs (moRNAs, in CD34+ cells. Thirty-seven small RNAs were differentially expressed in PMF patients compared with healthy subjects, according to microRNA sequencing data. Five miRNAs (miR-10b-5p, miR-19b-3p, miR-29a-3p, miR-379-5p, and miR-543 were deregulated also in PMF granulocytes. Moreover, 3'-moR-128-2 resulted consistently downregulated in PMF according to RNA-seq and qRT-PCR data both in CD34+ cells and granulocytes. Target predictions of these validated small RNAs de-regulated in PMF and functional enrichment analyses highlighted many interesting pathways involved in tumor development and progression, such as signaling by FGFR and DAP12 and Oncogene Induced Senescence. As a whole, data obtained in this study deepened the knowledge of miRNAs and moRNAs altered expression in PMF CD34+ cells and allowed to identify and validate a specific small RNA profile that distinguishes PMF granulocytes from those of normal subjects. We thus provided new information regarding the possible role of miRNAs and, specifically, of new moRNAs in this disease.

  17. Sequencing and annotation of the chloroplast DNAs and identification of polymorphisms distinguishing normal male-fertile and male-sterile cytoplasms of onion.

    Science.gov (United States)

    von Kohn, Christopher; Kiełkowska, Agnieszka; Havey, Michael J

    2013-12-01

    Male-sterile (S) cytoplasm of onion is an alien cytoplasm introgressed into onion in antiquity and is widely used for hybrid seed production. Owing to the biennial generation time of onion, classical crossing takes at least 4 years to classify cytoplasms as S or normal (N) male-fertile. Molecular markers in the organellar DNAs that distinguish N and S cytoplasms are useful to reduce the time required to classify onion cytoplasms. In this research, we completed next-generation sequencing of the chloroplast DNAs of N- and S-cytoplasmic onions; we assembled and annotated the genomes in addition to identifying polymorphisms that distinguish these cytoplasms. The sizes (153 538 and 153 355 base pairs) and GC contents (36.8%) were very similar for the chloroplast DNAs of N and S cytoplasms, respectively, as expected given their close phylogenetic relationship. The size difference was primarily due to small indels in intergenic regions and a deletion in the accD gene of N-cytoplasmic onion. The structures of the onion chloroplast DNAs were similar to those of most land plants with large and small single copy regions separated by inverted repeats. Twenty-eight single nucleotide polymorphisms, two polymorphic restriction-enzyme sites, and one indel distributed across 20 chloroplast genes in the large and small single copy regions were selected and validated using diverse onion populations previously classified as N or S cytoplasmic using restriction fragment length polymorphisms. Although cytoplasmic male sterility is likely associated with the mitochondrial DNA, maternal transmission of the mitochondrial and chloroplast DNAs allows for polymorphisms in either genome to be useful for classifying onion cytoplasms to aid the development of hybrid onion cultivars.

  18. Atypical yeasts identified as Saccharomyces cerevisiae by MALDI-TOF MS and gene sequencing are the main responsible of fermentation of chicha, a traditional beverage from Peru.

    Science.gov (United States)

    Vallejo, Juan Andrés; Miranda, Patricia; Flores-Félix, José David; Sánchez-Juanes, Fernando; Ageitos, José M; González-Buitrago, José Manuel; Velázquez, Encarna; Villa, Tomás G

    2013-12-01

    Chicha is a drink prepared in several Andean countries from Inca's times by maize fermentation. Currently this fermentation is carried out in familiar artesanal "chicherías" that make one of the most known types of chicha, the "chicha de jora". In this study we isolate and identify the yeasts mainly responsible of the fermentation process in this type of chicha in 10 traditional "chicherías" in Cusco region in Peru. We applied by first time MALDI-TOF MS analysis for the identification of yeast of non-clinic origin and the results showed that all of yeast strains isolated belong to the species Saccharomyces cerevisiae. These results agree with those obtained after the analysis of the D1/D2 and 5.8S-ITS regions. However the chicha strains have a phenotypic profile that differed in more than 40% as compared to that of current S. cerevisiae strains. To the best of our knowledge this is the first report concerning the yeasts involved in chicha fermentation. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  20. Main Memory

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random

  1. Main Memory

    OpenAIRE

    Boncz, Peter; Liu, Lei; Özsu, M.

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random Access Memory (RAM), to indicate that load/store instructions can access data at any location at the same cost, is usually implemented using DRAM chips, which are connected to the CPU and other per...

  2. Main findings

    International Nuclear Information System (INIS)

    2014-01-01

    Licensing regimes vary from country to country. When the license regime involves several regulators and several licenses, this may lead to complex situations. Identifying a leading organisation in charge of overall coordination including preparation of the licensing decision is a useful practice. Also, if a stepwise licensing process is implemented, it is important to fix in legislation decisions and/or time points and to identify the relevant actors. There is considerable experience in civil and mining engineering that can be applied when constructing a deep geological disposal facility. Specific challenges are, however, the minimization of disturbances to the host rock and the understanding of its long-term behavior. Construction activities may affect the geo-hydraulic and geochemical properties of the various system components which are important safety features of the repository system. Clearly defined technical specifications and an effective quality management plan are important in ensuring successful repository implementation which is consistent with safety requirements. Monitoring plan should also be defined in advance. The regulatory organization should prepare itself to the licensing review before construction by allocating sufficient resources. It should increase its competence, e.g., by interacting early with the implementer and through its own R and D. This will allow the regulator to define appropriate technical conditions associated to the construction license and to elaborate a relevant inspection plan of the construction work. After construction, obtaining the operational license is the most important and crucial step. Main challenges include (a) establishing sufficient confidence so that the methods for closing the individual disposal units comply with the safety objectives and (b) addressing the issue of ageing of materials during a 50-100 years operational period. This latter challenge is amplified when reversibility/retrievability is required

  3. Stellar evolution IV: evolution of a star of 1.5 M(S) from the main-sequence to the red-giant branch with and without overshooting from convective core

    International Nuclear Information System (INIS)

    Maeder, A.

    1975-01-01

    For a star of 1.5 M(S) with an initial composition given by X=0.70 and Z=0.03, three sets of evolutionary models are computed with different assumptions on the non-local effects characterizing the turbulent motions in the convective core. Some overshooting from the convective core may occur during Main-sequence evolution. The changes in the stellar structure, lifetimes and evolutionary tracks brought about by this process are studied. Some characteristics of the evolutionary tracks in the theoretical HR diagram have a very high sensitivity to the exact extent of the convective core, and this may provide powerful tests of events occurring in the deep stellar interior. (orig./BJ) [de

  4. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  5. 16S rRNA Amplicon Sequencing Demonstrates that Indoor-Reared Bumblebees (Bombus terrestris Harbor a Core Subset of Bacteria Normally Associated with the Wild Host.

    Directory of Open Access Journals (Sweden)

    Ivan Meeus

    Full Text Available A MiSeq multiplexed 16S rRNA amplicon sequencing of the gut microbiota of wild and indoor-reared Bombus terrestris (bumblebees confirmed the presence of a core set of bacteria, which consisted of Neisseriaceae (Snodgrassella, Orbaceae (Gilliamella, Lactobacillaceae (Lactobacillus, and Bifidobacteriaceae (Bifidobacterium. In wild B. terrestris we detected several non-core bacteria having a more variable prevalence. Although Enterobacteriaceae are unreported by non next-generation sequencing studies, it can become a dominant gut resident. Furthermore the presence of some non-core lactobacilli were associated with the relative abundance of bifidobacteria. This association was not observed in indoor-reared bumblebees lacking the non-core bacteria, but having a more standardized microbiota compared to their wild counterparts. The impact of the bottleneck microbiota of indoor-reared bumblebees when they are used in the field for pollination purpose is discussed.

  6. A Search for Coronal Emission at the Bottom of the Main-Sequence: Stars and Brown Dwarf Candidates with Spectral Types Later than M7 and the Rotation-Activity Relation

    Science.gov (United States)

    Stringfellow, Guy

    2004-01-01

    This program intended to test whether the lowest mass stars at the bottom end of the main sequence and the lower mass brown dwarfs have coronae. If they have coronae, what are the coronal characteristics and what drives them? In the classical dynamo picture, the closed magnetic loop structure is generated near the boundary of the convective envelope and the radiative core. Stars with mass below 0.30 Msun however are fully convective, and the nature of the dynamo responsible for the generation of the coronae in this regime is poorly understood. Previous results from the ROSAT mission (e.g., Fleming et al. 1993, 1995; Schmitt et al. 1995) had confirmed three very important characteristics of M-star coronae: (1) a very high percentage of all M dwarfs have coronae (of order 85% in the local 7 pc sample), (2) those M dwarfs showing high chromospheric activity, such as having the Balmer series in emission or large/numerous optical flaring, indeed exhibit the highest coronal activity, and (3) that the maximum saturation boundary in X-ray luminosity, which amounts to 0.0001-0.001 for Lx/Lbol for the dMe stars, extends down to the current detection limit, through spectral types M7. It was likely that the incompleteness noted for result (1) above was simply a detection limit problem; for more distant sources, the X-ray fainter dM stars will drop below detection thresholds before the more X-ray luminous dMe stars. The latest stars for which direct detection of the corona had been successful were of spectral type dM7 (e.g., VB8, LHS 3003). This program proposed to obtain ROSAT HRI observations for a large number of the coolest known (at that time) stars at the bottom of the main-sequence, which had spectral types of M9 or later. Three stars were approved for observations with ROSAT-HRI totaling 180 ksec. The goal was to obtain X-ray detections or low upper limits for the three approved stars.

  7. Secuencia constructiva de las plazas en el Grupo Principal de El Palmar, Campeche, México Constructive Sequence of Plazas in the Main Group of El Palmar, Campeche, México

    Directory of Open Access Journals (Sweden)

    Kenichiro Tsukamoto

    2012-01-01

    Full Text Available La ubicación y dimensión de los espacios abiertos fueron aspectos considerados al planificar las ciudades de las Tierras Bajas Mayas en el periodo prehispánico. Las plazas eran los espacios políticos donde las élites gobernantes legitimaban a sus autoridades y manifestaban a otros participantes sus capacidades para comunicarse con los ancestros o deidades. Este trabajo se centra en la secuencia constructiva de ocho plazas en el Grupo Principal del sitio arqueológico de El Palmar, Campeche, México. Los resultados obtenidos durante las temporadas de campo en el 2007 y el 2009 indican que las grandes plazas fueron construidas durante la segunda mitad del Clásico Temprano (400-600 d.C. y que en ellas se celebraron ceremonias públicas inscritas en los monumentos conmemorativos.The location and dimension of open spaces were important aspects involved in Maya Lowlands planning during the prehispanic period. Plazas were political spaces in which ruling elites legitimated their authorities and manifested to other participants their capacities of communication with ancestors or deities. This paper focuses on the construction sequence of eight plazas at the Main Group of El Palmar, Campeche, Mexico. The results recovered from the 2007 and 2009 fieldwork seasons indicate that large plazas were build during the second part of the Early Classic period (400-600 AD, with the erection of commemorative monuments narrating public ceremonies.

  8. The Intrinsic Characteristics of Galaxies on the SFR–M ∗ Plane at 1.2 < z < 4: I. The Correlation between Stellar Age, Central Density, and Position Relative to the Main Sequence

    Science.gov (United States)

    Lee, Bomee; Giavalisco, Mauro; Whitaker, Katherine; Williams, Christina C.; Ferguson, Henry C.; Acquaviva, Viviana; Koekemoer, Anton M.; Straughn, Amber N.; Guo, Yicheng; Kartaltepe, Jeyhan S.; Lotz, Jennifer; Pacifici, Camilla; Croton, Darren J.; Somerville, Rachel S.; Lu, Yu

    2018-02-01

    We use the deep CANDELS observations in the GOODS North and South fields to revisit the correlations between stellar mass (M *), star formation rate (SFR) and morphology, and to introduce a fourth dimension, the mass-weighted stellar age, in galaxies at 1.2history for each galaxy. Like others, we find that the slope of the main sequence (MS) of star formation in the ({M}* ;{SFR}) plane bends at high mass. We observe clear morphological differences among galaxies across the MS, which also correlate with stellar age. At all redshifts, galaxies that are quenching or quenched, and thus old, have high {{{Σ }}}1 (the projected density within the central 1 kpc), while younger, star-forming galaxies span a much broader range of {{{Σ }}}1, which includes the high values observed for quenched galaxies, but also extends to much lower values. As galaxies age and quench, the stellar age and the dispersion of {{{Σ }}}1 for fixed values of M * shows two different regimes: one at the low-mass end, where quenching might be driven by causes external to the galaxies; the other at the high-mass end, where quenching is driven by internal causes, very likely the mass given the low scatter of {{{Σ }}}1 (mass quenching). We suggest that the monotonic increase of central density as galaxies grow is one manifestation of a more general phenomenon of structural transformation that galaxies undergo as they evolve.

  9. The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

    Science.gov (United States)

    Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

    2017-05-01

    Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

  10. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  11. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  12. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  13. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    Science.gov (United States)

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  14. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  15. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  16. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  17. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  18. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  19. Smooth quantile normalization.

    Science.gov (United States)

    Hicks, Stephanie C; Okrah, Kwame; Paulson, Joseph N; Quackenbush, John; Irizarry, Rafael A; Bravo, Héctor Corrada

    2018-04-01

    Between-sample normalization is a critical step in genomic data analysis to remove systematic bias and unwanted technical variation in high-throughput data. Global normalization methods are based on the assumption that observed variability in global properties is due to technical reasons and are unrelated to the biology of interest. For example, some methods correct for differences in sequencing read counts by scaling features to have similar median values across samples, but these fail to reduce other forms of unwanted technical variation. Methods such as quantile normalization transform the statistical distributions across samples to be the same and assume global differences in the distribution are induced by only technical variation. However, it remains unclear how to proceed with normalization if these assumptions are violated, for example, if there are global differences in the statistical distributions between biological conditions or groups, and external information, such as negative or control features, is not available. Here, we introduce a generalization of quantile normalization, referred to as smooth quantile normalization (qsmooth), which is based on the assumption that the statistical distribution of each sample should be the same (or have the same distributional shape) within biological groups or conditions, but allowing that they may differ between groups. We illustrate the advantages of our method on several high-throughput datasets with global differences in distributions corresponding to different biological conditions. We also perform a Monte Carlo simulation study to illustrate the bias-variance tradeoff and root mean squared error of qsmooth compared to other global normalization methods. A software implementation is available from https://github.com/stephaniehicks/qsmooth.

  20. Cyanogen strengths of globular cluster post-main-sequence stars

    International Nuclear Information System (INIS)

    Hesser, J.E.; Hartwick, F.D.A.; McClure, R.D.

    1976-01-01

    CN strengths in the peculiar clusters ω Cen and M22 and the metal-rich clusters 47 Tuc, M71, and NGC 6352 are found to vary markedly from star to star. The strong variations in CN strength found earlier for ω Cen by Norris and Bessell and by Dickens and Bell are shown to extend to fainter stars, although expected correlations of CN strength with position in the color-magnitude (C-M) diagram are less evident in our sample. Several CN and metal-strong stars were also observed in M22. We conclude that CN, once it appears in globular clusters, can vary much more than it does in equivalent Population I samples, a result we briefly examine in light of current understanding regarding physical processes in the stars themselves and of models of galactic chemical evolution

  1. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: NEW ESTIMATES

    Energy Technology Data Exchange (ETDEWEB)

    Kopparapu, Ravi Kumar; Ramirez, Ramses; Kasting, James F. [Department of Geosciences, Penn State University, 443 Deike Building, University Park, PA 16802 (United States); Eymet, Vincent [Laboratoire d' Astrophysique de Bordeaux, Universite de Bordeaux 1, UMR 5804, F-33270 Floirac (France); Robinson, Tyler D.; Domagal-Goldman, Shawn; Meadows, Victoria [NASA Astrobiology Institute' s Virtual Planetary Laboratory (United States); Mahadevan, Suvrath; Terrien, Ryan C.; Deshpande, Rohit [Center for Exoplanets and Habitable Worlds, The Pennsylvania State University, University Park, PA 16802 (United States)

    2013-03-10

    Identifying terrestrial planets in the habitable zones (HZs) of other stars is one of the primary goals of ongoing radial velocity (RV) and transit exoplanet surveys and proposed future space missions. Most current estimates of the boundaries of the HZ are based on one-dimensional (1D), cloud-free, climate model calculations by Kasting et al. However, this model used band models that were based on older HITRAN and HITEMP line-by-line databases. The inner edge of the HZ in the Kasting et al. model was determined by loss of water, and the outer edge was determined by the maximum greenhouse provided by a CO{sub 2} atmosphere. A conservative estimate for the width of the HZ from this model in our solar system is 0.95-1.67 AU. Here an updated 1D radiative-convective, cloud-free climate model is used to obtain new estimates for HZ widths around F, G, K, and M stars. New H{sub 2}O and CO{sub 2} absorption coefficients, derived from the HITRAN 2008 and HITEMP 2010 line-by-line databases, are important improvements to the climate model. According to the new model, the water-loss (inner HZ) and maximum greenhouse (outer HZ) limits for our solar system are at 0.99 and 1.70 AU, respectively, suggesting that the present Earth lies near the inner edge. Additional calculations are performed for stars with effective temperatures between 2600 and 7200 K, and the results are presented in parametric form, making them easy to apply to actual stars. The new model indicates that, near the inner edge of the HZ, there is no clear distinction between runaway greenhouse and water-loss limits for stars with T{sub eff} {approx}< 5000 K, which has implications for ongoing planet searches around K and M stars. To assess the potential habitability of extrasolar terrestrial planets, we propose using stellar flux incident on a planet rather than equilibrium temperature. This removes the dependence on planetary (Bond) albedo, which varies depending on the host star's spectral type. We suggest that conservative estimates of the HZ (water-loss and maximum greenhouse limits) should be used for current RV surveys and Kepler mission to obtain a lower limit on {eta}{sub Circled-Plus }, so that future flagship missions like TPF-C and Darwin are not undersized. Our model does not include the radiative effects of clouds; thus, the actual HZ boundaries may extend further in both directions than the estimates just given.

  2. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: NEW ESTIMATES

    International Nuclear Information System (INIS)

    Kopparapu, Ravi Kumar; Ramirez, Ramses; Kasting, James F.; Eymet, Vincent; Robinson, Tyler D.; Domagal-Goldman, Shawn; Meadows, Victoria; Mahadevan, Suvrath; Terrien, Ryan C.; Deshpande, Rohit

    2013-01-01

    Identifying terrestrial planets in the habitable zones (HZs) of other stars is one of the primary goals of ongoing radial velocity (RV) and transit exoplanet surveys and proposed future space missions. Most current estimates of the boundaries of the HZ are based on one-dimensional (1D), cloud-free, climate model calculations by Kasting et al. However, this model used band models that were based on older HITRAN and HITEMP line-by-line databases. The inner edge of the HZ in the Kasting et al. model was determined by loss of water, and the outer edge was determined by the maximum greenhouse provided by a CO 2 atmosphere. A conservative estimate for the width of the HZ from this model in our solar system is 0.95-1.67 AU. Here an updated 1D radiative-convective, cloud-free climate model is used to obtain new estimates for HZ widths around F, G, K, and M stars. New H 2 O and CO 2 absorption coefficients, derived from the HITRAN 2008 and HITEMP 2010 line-by-line databases, are important improvements to the climate model. According to the new model, the water-loss (inner HZ) and maximum greenhouse (outer HZ) limits for our solar system are at 0.99 and 1.70 AU, respectively, suggesting that the present Earth lies near the inner edge. Additional calculations are performed for stars with effective temperatures between 2600 and 7200 K, and the results are presented in parametric form, making them easy to apply to actual stars. The new model indicates that, near the inner edge of the HZ, there is no clear distinction between runaway greenhouse and water-loss limits for stars with T eff ∼ ⊕ , so that future flagship missions like TPF-C and Darwin are not undersized. Our model does not include the radiative effects of clouds; thus, the actual HZ boundaries may extend further in both directions than the estimates just given.

  3. Be ABUNDANCES IN COOL MAIN-SEQUENCE STARS WITH EXOPLANETS

    Energy Technology Data Exchange (ETDEWEB)

    Delgado Mena, E.; Israelian, G.; Gonzalez Hernandez, J. I.; Rebolo, R. [Instituto de Astrofisica de Canarias, 38200 La Laguna, Tenerife (Spain); Santos, N. C., E-mail: edm@iac.es [Centro de Astrofisica, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal)

    2012-02-10

    We present new Ultraviolet and Visual Echelle Spectrograph (UVES) spectra of a sample of 15 cool unevolved stars with and without detected planetary companions. Together with previous determinations, we study Be depletion and possible differences in Be abundances between the two groups of stars. We obtain a final sample of 89 and 40 stars with and without planets, respectively, which covers a wide range of effective temperatures, from 4700 K to 6400 K, and includes several cool dwarf stars for the first time. We determine Be abundances for these stars and find that for most of them (the coolest ones) the Be II resonance lines are often undetectable, implying significant Be depletion. While for hot stars Be abundances are approximately constant, with a slight fall as T{sub eff} decreases and the Li-Be gap around 6300 K, we find a steep drop of Be content as T{sub eff} decreases for T{sub eff} < 5500 K, confirming the results of previous papers. Therefore, for these stars there is an unknown mechanism destroying Be that is not reflected in current models of Be depletion. Moreover, this strong Be depletion in cool objects takes place for all the stars regardless of the presence of planets; thus, the effect of extra Li depletion in solar-type stars with planets when compared with stars without detected planets does not seem to be present for Be, although the number of stars at those temperatures is still small to reach a final conclusion.

  4. Pleiades and the zero-age main sequence

    International Nuclear Information System (INIS)

    McNamara, B.J.

    1976-01-01

    New four-color uvby observations of the Pleiades are used to calibrate the ZAMS in the spectral range A2 to F5. Although the Pleiades c 0 versus (b - y) 0 calibration is in good agreement with the ZAMS calibration presented by Crawford, its m 0 versus (b - y) 0 relation shows a systematic difference from his values. This difference is believed to be caused by the higher mean rotational velocity of the Pleiades stars in comparison to field stars

  5. Dust discs around low-mass main-sequence stars

    International Nuclear Information System (INIS)

    Wolstencroft, R.D.; Walker, H.J.

    1988-01-01

    Current understanding of the formation of circumstellar discs as a natural accompaniment to the process of low-mass star formation is briefly reviewed. Models of the thermal emission from the dust discs around the prototype stars α Lyr, α PsA, β Pic and ε Eri are discussed, which indicate that the central regions of three of these discs are almost devoid of dust within radii ranging between 17 and 26 AU, with the temperature of the hottest dust lying between about 115 and 210 K. One possible explanation of the dust-free zones is the presence of a planet at the inner boundary of each cloud that sweeps up grains crossing its orbit. The colour, diameter and thickness of the optical image of β Pic, obtained by coronagraphic techniques, have provided further information on the size, radial distribution of number density and orbital inclination of the grains. The difference in surface brightness on the two sides of the disc is puzzling, but might be explained if the grains are elongated and aligned by the combined effects of a stellar wind and a magnetic field of spiral configuration. Finally, we discuss the orbital evolution and lifetimes of particles in these discs, which are governed primarily by radiation pressure, Poynting-Robertson drag and grain-grain collisions. (author)

  6. Effects of magnetic fields on main sequence stars

    International Nuclear Information System (INIS)

    Hubbard, E.N.

    1981-01-01

    A number of effects of low to medium strength ( 2 /8π) magnetic field pressure term so that the only effect of such a field may come from its inhibiting convection in the core. Isochrones of both convective and radiative core models of 2-5 M are presented. In the deep envelope, mixing of partially nuclear processed material driven by rising and falling magnetic flux tubes may be seen. The effects of this mixing will be brought to the surface during the deep convection phase of the star's tenure as a red giant. This model is used to predict a signature for magnetic mixing based on the CNO isotope and abundance ratios. In the outer envelope the gas pressure is low enough that one might expect to see a perturbation of the stellar structure due to the magnetic field pressure itself. This perturbation is calculated under several physical models for intermediate and high mass stars and it is determined that sufficient magnetic field energy may be available in the outer envelope to expand a star by about 20% over its unperturbed radius. Finally the evidence for the existence of non-magnetic neutron stars is considered, concluding that while no non-magnetic neutron stars have ever been positively identified, there is no evidence that prevents the existence of at least as many non-magnetic as magnetic neutron stars

  7. Acne at The Bottom Of The Main Sequence

    Science.gov (United States)

    Barnes, John; Haswell, C.; Jenkins, J.; Jeffers, S.; Jones, H. R. A.; Lohr, M.; Pavlenko, Y.

    2016-08-01

    Starspots are an important manifestation of stellar activity and yet their distribution patterns on the lowest mass stars is not well known. Time series spectra of fully convective M dwarfs taken in the red-optical with UVES reveal numerous line profile distortions which are interpreted as starspots. We derive Doppler images for four M4.5V - M9V stars and find that contrast ratios corresponding to photosphere-spot temperature differences of only 200-300 K are sufficient to model the timeseries spectra. Although more starspot structure is found at high latitudes, spots are reconstructed at a range of phases and latitudes with mean spot filling factors of only a few per cent. The occurrence of low-contrast spots at predominantly high latitudes is in general likely to be responsible for the low amplitude photometric variability seen in late-M dwarfs. The recovered starspot patterns are used to assess their effect on precision radial velocity surveys aimed at detecting planets around this population of stars.

  8. Be ABUNDANCES IN COOL MAIN-SEQUENCE STARS WITH EXOPLANETS

    International Nuclear Information System (INIS)

    Delgado Mena, E.; Israelian, G.; González Hernández, J. I.; Rebolo, R.; Santos, N. C.

    2012-01-01

    We present new Ultraviolet and Visual Echelle Spectrograph (UVES) spectra of a sample of 15 cool unevolved stars with and without detected planetary companions. Together with previous determinations, we study Be depletion and possible differences in Be abundances between the two groups of stars. We obtain a final sample of 89 and 40 stars with and without planets, respectively, which covers a wide range of effective temperatures, from 4700 K to 6400 K, and includes several cool dwarf stars for the first time. We determine Be abundances for these stars and find that for most of them (the coolest ones) the Be II resonance lines are often undetectable, implying significant Be depletion. While for hot stars Be abundances are approximately constant, with a slight fall as T eff decreases and the Li-Be gap around 6300 K, we find a steep drop of Be content as T eff decreases for T eff < 5500 K, confirming the results of previous papers. Therefore, for these stars there is an unknown mechanism destroying Be that is not reflected in current models of Be depletion. Moreover, this strong Be depletion in cool objects takes place for all the stars regardless of the presence of planets; thus, the effect of extra Li depletion in solar-type stars with planets when compared with stars without detected planets does not seem to be present for Be, although the number of stars at those temperatures is still small to reach a final conclusion.

  9. Maine's Employability Skills Program

    Science.gov (United States)

    McMahon, John M.; Wolffe, Karen E.; Wolfe, Judy; Brooker, Carrie

    2013-01-01

    This Practice Report describes the development and implementation of the "Maine Employability Skills Program," a model employment program developed by the Maine Division for the Blind and Visually Impaired (DBVI). The program was designed to support the efforts of the chronically unemployed or underemployed. These consumers were either…

  10. Turbine main engines

    CERN Document Server

    Main, John B; Herbert, C W; Bennett, A J S

    1965-01-01

    Turbine Main Engines deals with the principle of operation of turbine main engines. Topics covered include practical considerations that affect turbine design and efficiency; steam turbine rotors, blades, nozzles, and diaphragms; lubricating oil systems; and gas turbines for use with nuclear reactors. Gas turbines for naval boost propulsion, merchant ship propulsion, and naval main propulsion are also considered. This book is divided into three parts and begins with an overview of the basic mode of operation of the steam turbine engine and how it converts the pressure energy of the ingoing ste

  11. Maine highway safety plan

    Science.gov (United States)

    2010-01-01

    Each September 1, the MeBHS must provide NHTSA a comprehensive plan to reduce : traffic crashes and resulting deaths, injuries and property damage. The Highway Safety : Plan (HSP) serves as Maines application for available federal funds for these ...

  12. Maine Field Station

    Data.gov (United States)

    Federal Laboratory Consortium — In 2000 NOAA's National Marine Fisheries Service established the Maine Field Station in Orono, ME to have more direct involvement in the conservation of the living...

  13. Maine's forests 2008

    Science.gov (United States)

    George L. McCaskill; William H. McWilliams; Charles J. Barnett; Brett J. Butler; Mark A. Hatfield; Cassandra M. Kurtz; Randall S. Morin; W. Keith Moser; Charles H. Perry; Christopher W. Woodall

    2011-01-01

    The second annual inventory of Maine's forests was completed in 2008 after more than 3,160 forested plots were measured. Forest land occupies almost 17.7 million acres, which represents 82 percent of the total land area of Maine. The dominant forest-type groups are maple/beech/yellow birch, spruce/fir, white/red/jack pine, and aspen/white birch. Statewide volume...

  14. Maine Forests 2013

    Science.gov (United States)

    George L. McCaskill; Thomas Albright; Charles J. Barnett; Brett J. Butler; Susan J. Crocker; Cassandra M. Kurtz; William H. McWilliams; Patrick D. Miles; Randall S. Morin; Mark D. Nelson; Richard H. Widmann; Christopher W. Woodall

    2016-01-01

    The third 5-year annualized inventory of Maine's forests was completed in 2013 after more than 3170 forested plots were measured. Maine contains more than 17.6 million acres of forest land, an area that has been quite stable since 1960, covering more than 82 percent of the total land area. The number of live trees greater than 1 inch in diameter are approaching 24...

  15. Group normalization for genomic data.

    Science.gov (United States)

    Ghandi, Mahmoud; Beer, Michael A

    2012-01-01

    Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN), to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  16. Group normalization for genomic data.

    Directory of Open Access Journals (Sweden)

    Mahmoud Ghandi

    Full Text Available Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN, to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  17. FERMILAB: Main Injector

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10 31 cm -2 s -1 in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction

  18. FERMILAB: Main Injector

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1993-06-15

    The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10{sup 31} cm{sup -2} s{sup -1} in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction.

  19. Main facts 1995

    International Nuclear Information System (INIS)

    1996-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, monitoring and plants operations

  20. Main designations and attributions

    International Nuclear Information System (INIS)

    2010-01-01

    The chapter presents the main designations and attributions of the LNMRI - Brazilian National Laboratory of Metrology of Ionizing Radiation, the Cooperative Center in Radiation Protection and Medical Preparations for Accidents with Radiation; the Treaty for fully banning of nuclear tests and the Regional Center for Training of IAEA

  1. Maine Bouguer Gravity Grid

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A 2 kilometer Bouguer anomaly grid for the state of Maine. Number of columns is 197 and number of rows is 292. The order of the data is from the lower left to the...

  2. Main facts 1993

    International Nuclear Information System (INIS)

    1994-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, network analysis, information and informatic equipment

  3. Preferrential rearrangement in normal rabbits of the 3' VHa allotype gene that is deleted in Alicia mutants; somatic hypermutation/conversion may play a major role in generating the heterogeneity of rabbit heavy chain variable region sequences.

    Science.gov (United States)

    Allegrucci, M; Young-Cooper, G O; Alexander, C B; Newman, B A; Mage, R G

    1991-02-01

    The rabbit is unique in having well-defined allotypes in the variable region of the heavy chain. Products of the VHa locus, (with alleles a1, a2, and a3), account for the majority of the serum immunoglobulins. A small percentage of the serum immunoglobulins are a-negative. In 1986, Kelus and Weiss described a mutation that depressed the expression of the Ig VH a2 genes in an a1/a2 rabbit. From this animal the Alicia rabbit strain was developed and the mutation was termed ali. We previously showed, using Southern analysis and the transverse alternating field electrophoresis technique, that the difference between the ali rabbit and normal is a relatively small deletion including some of the most 3' VH genes. The most JH proximal 3' VH1 genes in DNA from normal rabbits of a1, a2 and a3 haplotypes encode a1, a2 and a3 molecules respectively, and it has been suggested that these genes are responsible for allelic inheritance of VHa allotypes. The present study suggests that the 3' end of the VH locus probably plays a key role in regulation of VH gene expression in rabbits because VH gene(s) in this region are the target(s) of preferential VDJ rearrangements. This raises the possibility that mechanisms such as somatic gene conversion and hypermutation are at work to generate the antibody repertoire in this species. Our data support the view that the 3' VH1 gene may be the preferred target for rearrangement in normal rabbits, and for the normal chromosome in heterozygous ali animals. However, homozygous ali rabbits with a deletion that removed the a2-encoding VH1 on both chromosomes do survive, rearrange other VH genes and produce normal levels of immunoglobulins as well as a significant percentage of B cells which bear the a2 allotype. This challenges the view that one VH gene, VH1, is solely responsible for the inheritance pattern of VHa allotypes.

  4. Renovating the Main Building

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    CERN's "Main Building" is exactly that. The Organization's central hub, with hundreds of staff and visitors passing through its doors every day, will soon be getting a well-earned facelift. Refurbishment work will proceed in phases, starting with the Salle des Pas Perdus, the concourse between the Council Chamber and the Main Auditorium. By the end of August, informal seating areas will be installed, electronic display panels will provide practical information and improved sound insulation will enhance conditions in the auditoria and surrounding meeting rooms.   In light green the area that will undergo the facelift. Work will start in July. The ground floor is home to the entrance to Restaurant No. 1, the bank, the post office, the travel agent, the Users Office, the Staff Association, the notice boards etc. Step up to the first floor to access CERN's largest lecture theatre, the Council Chamber and its "Pas Perdus" lobby. Everyone who works at or visits CERN i...

  5. Fermilab Main Injector plan

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-07-15

    The Fermilab Main Injector is the centrepiece of the 'Fermilab III' scheme to significantly upgrade the Laboratory's existing accelerator complex. The new accelerator is designed to provide increased particle beam levels to boost the collision rate in the Tevatron proton-antiproton collider (luminosity in excess of 5 x 10{sup 31} per sq cm per s) and, if approved, would provide increased flexibility in all areas of high energy physics research.

  6. Fermilab Main Injector plan

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    The Fermilab Main Injector is the centrepiece of the 'Fermilab III' scheme to significantly upgrade the Laboratory's existing accelerator complex. The new accelerator is designed to provide increased particle beam levels to boost the collision rate in the Tevatron proton-antiproton collider (luminosity in excess of 5 x 10 31 per sq cm per s) and, if approved, would provide increased flexibility in all areas of high energy physics research

  7. Maine coast winds

    Energy Technology Data Exchange (ETDEWEB)

    Avery, Richard

    2000-01-28

    The Maine Coast Winds Project was proposed for four possible turbine locations. Significant progress has been made at the prime location, with a lease-power purchase contract for ten years for the installation of turbine equipment having been obtained. Most of the site planning and permitting have been completed. It is expect that the turbine will be installed in early May. The other three locations are less suitable for the project, and new locations are being considered.

  8. Project evaluation: main characteristics

    OpenAIRE

    Moutinho, Nuno

    2010-01-01

    — The evaluation process of real investment projects must consider not only the traditional financial approach, but also non-financial aspects. Non financial analysis can provide additional relevant information about projects. We investigate financial and non-financial areas most relevant in project appraisal. We present main critical success factors and areas of analysis that lead to the perception of project success. Finally, companies are segmented to verify its financial and non-financial...

  9. Marketing Maine Tablestock Potatoes

    OpenAIRE

    Berney, Gerald; Grajewski, Gregory; Hinman, Don; Prater, Marvin E.; Taylor, April

    2010-01-01

    The Marketing Services Division of USDA’s Agricultural Marketing Service (AMS) was asked by USDA’s Agricultural Research Service (ARS) National Program Leader and ARS’s New England Soil and Water Research Laboratory personnel to help with existing efforts to assist Maine fresh potato farmers in their search for alternative marketing strategies, and reverse the recent decline in the profitability of their operations. ARS researchers previously had conducted an exhaustive study defining possibl...

  10. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  11. Mapping sequences by parts

    Directory of Open Access Journals (Sweden)

    Guziolowski Carito

    2007-09-01

    Full Text Available Abstract Background: We present the N-map method, a pairwise and asymmetrical approach which allows us to compare sequences by taking into account evolutionary events that produce shuffled, reversed or repeated elements. Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores. Results: We introduce an algorithm computing an optimal N-map with time complexity O (|s| × |t| × N using O (|s| × |t| × N memory space. Among all the numbers of parts taken in a reasonable range, we select the value N for which the optimal N-map has the most significant score. To evaluate this significance, we study the empirical distributions of the scores of optimal N-maps and show that they can be approximated by normal distributions with a reasonable accuracy. We test the functionality of the approach over random sequences on which we apply artificial evolutionary events. Practical Application: The method is illustrated with four case studies of pairs of sequences involving non-standard evolutionary events.

  12. MRI of normal fetal brain development

    International Nuclear Information System (INIS)

    Prayer, Daniela; Kasprian, Gregor; Krampl, Elisabeth; Ulm, Barbara; Witzani, Linde; Prayer, Lucas; Brugger, Peter C.

    2006-01-01

    Normal fetal brain maturation can be studied by in vivo magnetic resonance imaging (MRI) from the 18th gestational week (GW) to term, and relies primarily on T2-weighted and diffusion-weighted (DW) sequences. These maturational changes must be interpreted with a knowledge of the histological background and the temporal course of the respective developmental steps. In addition, MR presentation of developing and transient structures must be considered. Signal changes associated with maturational processes can mainly be ascribed to the following changes in tissue composition and organization, which occur at the histological level: (1) a decrease in water content and increasing cell-density can be recognized as a shortening of T1- and T2-relaxation times, leading to increased T1-weighted and decreased T2-weighted intensity, respectively; (2) the arrangement of microanatomical structures to create a symmetrical or asymmetrical environment, leading to structural differences that may be demonstrated by DW-anisotropy; (3) changes in non-structural qualities, such as the onset of a membrane potential in premyelinating axons. The latter process also influences the appearance of a structure on DW sequences. Thus, we will review the in vivo MR appearance of different maturational states of the fetal brain and relate these maturational states to anatomical, histological, and in vitro MRI data. Then, the development of the cerebral cortex, white matter, temporal lobe, and cerebellum will be reviewed, and the MR appearance of transient structures of the fetal brain will be shown. Emphasis will be placed on the appearance of the different structures with the various sequences. In addition, the possible utility of dynamic fetal sequences in assessing spontaneous fetal movements is discussed

  13. MRI of normal fetal brain development

    Energy Technology Data Exchange (ETDEWEB)

    Prayer, Daniela [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria)]. E-mail: Daniela.prayer@meduniwien.ac.at; Kasprian, Gregor [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria); Krampl, Elisabeth [Department of Obstetrics and Gynecology, Medical University of Vienna, Vienna (Austria); Ulm, Barbara [Department of Prenatal Diagnosis, Medical University of Vienna, Vienna (Austria); Witzani, Linde [Department of Radiodiagnostics, Medical University of Vienna, Vienna (Austria); Prayer, Lucas [Diagnosezentrum Urania, Vienna (Austria); Brugger, Peter C. [Center of Anatomy and Cell Biology, Medical University of Vienna, Vienna (Austria)

    2006-02-15

    Normal fetal brain maturation can be studied by in vivo magnetic resonance imaging (MRI) from the 18th gestational week (GW) to term, and relies primarily on T2-weighted and diffusion-weighted (DW) sequences. These maturational changes must be interpreted with a knowledge of the histological background and the temporal course of the respective developmental steps. In addition, MR presentation of developing and transient structures must be considered. Signal changes associated with maturational processes can mainly be ascribed to the following changes in tissue composition and organization, which occur at the histological level: (1) a decrease in water content and increasing cell-density can be recognized as a shortening of T1- and T2-relaxation times, leading to increased T1-weighted and decreased T2-weighted intensity, respectively; (2) the arrangement of microanatomical structures to create a symmetrical or asymmetrical environment, leading to structural differences that may be demonstrated by DW-anisotropy; (3) changes in non-structural qualities, such as the onset of a membrane potential in premyelinating axons. The latter process also influences the appearance of a structure on DW sequences. Thus, we will review the in vivo MR appearance of different maturational states of the fetal brain and relate these maturational states to anatomical, histological, and in vitro MRI data. Then, the development of the cerebral cortex, white matter, temporal lobe, and cerebellum will be reviewed, and the MR appearance of transient structures of the fetal brain will be shown. Emphasis will be placed on the appearance of the different structures with the various sequences. In addition, the possible utility of dynamic fetal sequences in assessing spontaneous fetal movements is discussed.

  14. Summary of main points

    International Nuclear Information System (INIS)

    2006-01-01

    In conjunction with its 6. annual meeting, the WPDD in close co-operation with the FSC held a Topical session on 'Stakeholder Involvement in Decommissioning' on November 14, 2005. The session was attended by 36 participants totally representing 14 NEA member countries and 2 international organisations. Two keynote addresses were given at the Topical Session. The first one treated of what is needed for robust decisions and how to bring all stakeholders into the debate. In the second keynote address a summary was made on what have been said on stakeholder involvement in decommissioning during earlier meetings of the WPDD. The main part of the session was then devoted to views from different stakeholders regarding their role and their involvement. This part contained viewpoints from local communities (Kaevlinge in Sweden and Port Hope in Canada), authorities (Scottish Executive and CSNC) and operators (EDF from France and EWN from Germany). Case studies from the decommissioning of Dounrey in the UK and from Trojan and Main Yankee in the USA were presented in the end part of the Topical session followed by a summary and lessons learnt report by the Rapporteur. A detailed programme of the Topical session can be seen in Appendix 1

  15. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  16. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  17. Random Generators and Normal Numbers

    OpenAIRE

    Bailey, David H.; Crandall, Richard E.

    2002-01-01

    Pursuant to the authors' previous chaotic-dynamical model for random digits of fundamental constants, we investigate a complementary, statistical picture in which pseudorandom number generators (PRNGs) are central. Some rigorous results are achieved: We establish b-normality for constants of the form $\\sum_i 1/(b^{m_i} c^{n_i})$ for certain sequences $(m_i), (n_i)$ of integers. This work unifies and extends previously known classes of explicit normals. We prove that for coprime $b,c>1$ the...

  18. TRIGA reactor main systems

    International Nuclear Information System (INIS)

    Boeck, H.; Villa, M.

    2007-01-01

    This module describes the main systems of low power (<2 MW) and higher power (≥2 MW) TRIGA reactors. The most significant difference between the two is that forced reactor cooling and an emergency core cooling system are generally required for the higher power TRIGA reactors. However, those TRIGA reactors that are designed to be operated above 3 MW also use a TRIGA fuel that is specifically designed for those higher power outputs (3 to 14 MW). Typical values are given for the respective systems although each TRIGA facility will have unique characteristics that may only be determined by the experienced facility operators. Due to the inherent wide scope of these research reactor facilities construction and missions, this training module covers those systems found at most operating TRIGA reactor facilities but may also discuss non-standard equipment that was found to be operationally useful although not necessarily required. (author)

  19. The Orthology Clause in the Next Generation Sequencing Era: Novel Reference Genes Identified by RNA-seq in Humans Improve Normalization of Neonatal Equine Ovary RT-qPCR Data.

    Directory of Open Access Journals (Sweden)

    Dragos Scarlet

    Full Text Available Vertebrate evolution is accompanied by a substantial conservation of transcriptional programs with more than a third of unique orthologous genes showing constrained levels of expression. Moreover, there are genes and exons exhibiting excellent expression stability according to RNA-seq data across a panel of eighteen tissues including the ovary (Human Body Map 2.0.We hypothesized that orthologs of these exons would also be highly uniformly expressed across neonatal ovaries of the horse, which would render them appropriate reference genes (RGs for normalization of reverse transcription quantitative PCR (RT-qPCR data in this context. The expression stability of eleven novel RGs (C1orf43, CHMP2A, EMC7, GPI, PSMB2, PSMB4, RAB7A, REEP5, SNRPD3, VCP and VPS29 was assessed by RT-qPCR in ovaries of seven neonatal fillies and compared to that of the expressed repetitive element ERE-B, two universal (OAZ1 and RPS29 and four traditional RGs (ACTB, GAPDH, UBB and B2M. Expression stability analyzed with the software tool RefFinder top ranked the normalization factor constituted of the genes SNRPD3 and VCP, a gene pair that is not co-expressed according to COEXPRESdb and GeneMANIA. The traditional RGs GAPDH, B2M, ACTB and UBB were only ranked 3rd and 12th to 14th, respectively.The functional diversity of the novel RGs likely facilitates expression studies over a wide range of physiological and pathological contexts related to the neonatal equine ovary. In addition, this study augments the potential for RT-qPCR-based profiling of human samples by introducing seven new human RG assays (C1orf43, CHMP2A, EMC7, GPI, RAB7A, VPS29 and UBB.

  20. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  1. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Directory of Open Access Journals (Sweden)

    Debnath Bhattacharyya

    2013-01-01

    Full Text Available We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant as well as query sequence (virus. Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size. This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length.

  2. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Science.gov (United States)

    Mandal, Bijoy Kumar; Kim, Tai-hoon

    2013-01-01

    We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

  3. Computational Methods for Quality Check, Preprocessing and Normalization of RNA-Seq Data for Systems Biology and Analysis

    DEFF Research Database (Denmark)

    Mazzoni, Gianluca; Kadarmideen, Haja N.

    2016-01-01

    quality control, trimming and filtering procedures, alignment, postmapping quality control, counting, normalization and differential expression test. For each step, we present the most common tools and we give a complete description of their main characteristics and advantages focusing on the statistics......The use of RNA sequencing (RNA-Seq) technologies is increasing mainly due to the development of new next-generation sequencing machines that have reduced the costs and the time needed for data generation. Nevertheless, microarrays are still the more common choice and one of the reasons...

  4. Normal forms in Poisson geometry

    NARCIS (Netherlands)

    Marcut, I.T.

    2013-01-01

    The structure of Poisson manifolds is highly nontrivial even locally. The first important result in this direction is Conn's linearization theorem around fixed points. One of the main results of this thesis (Theorem 2) is a normal form theorem in Poisson geometry, which is the Poisson-geometric

  5. MR imaging of the normal pancreas

    International Nuclear Information System (INIS)

    Itoh, Hisao; Takahashi, Norio; Uchida, Yoshie; Nakayama, Gen; Bito, Kaoru; Haba, Hirotsugu; Kawamura, Masashi; Kataoka, Masaaki; Hamamoto, Ken.

    1989-01-01

    To evaluate current 1.5-T MR imaging with respiratory ordered phase encoding (ROPE) technique in the identification of pancreatic contour and main pancreatic duct, 100 normal subjects examined with spin echo technique including transaxial scans of T 1 -WI,T 2 -WI, and proton density (PD)-WI were reviewed. The results of MR imaging were then compared with computed tomography (CT). Pancreatic contour was divided into 3 parts; head, body, and tail. T 1 -WI was the best pulse sequence in describing pancreas and the rates of specific identification of head, body, and tail were 69%, 97%, and 92%, respectively. While these rates were 62%, 90%, and 92% with plain CT and 69%, 94%, and 94% with contrast-enhanced CT, respectively. A combination of MR imaging and CT yielded better rates of identification. The main pancreatic duct was visible in 44% as a low intensity line on T 1 -WI and in 16% on plain CT. Dorsal to pancreas, all of the major vessels were seen in every patients. Ventrally, retroperitoneal fat was important, however, it was not a limiting factor. When respiratory compensation using ROPE functioned well, it was possible to differentiate bowel from pancreas in patients with sparse fat because signal intensity of the pancreas tended to be higher than that of gastrointestinal wall and its contents on T 1 -WI. Current MR imaging seemed to be a complementary method with CT in the identification of the pancreas. (author)

  6. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  7. Weak disorder in Fibonacci sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ben-Naim, E [Theoretical Division and Center for Nonlinear Studies, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Krapivsky, P L [Department of Physics and Center for Molecular Cybernetics, Boston University, Boston, MA 02215 (United States)

    2006-05-19

    We study how weak disorder affects the growth of the Fibonacci series. We introduce a family of stochastic sequences that grow by the normal Fibonacci recursion with probability 1 - {epsilon}, but follow a different recursion rule with a small probability {epsilon}. We focus on the weak disorder limit and obtain the Lyapunov exponent that characterizes the typical growth of the sequence elements, using perturbation theory. The limiting distribution for the ratio of consecutive sequence elements is obtained as well. A number of variations to the basic Fibonacci recursion including shift, doubling and copying are considered. (letter to the editor)

  8. 14 CFR 23.753 - Main float design.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Main float design. 23.753 Section 23.753... STANDARDS: NORMAL, UTILITY, ACROBATIC, AND COMMUTER CATEGORY AIRPLANES Design and Construction Floats and Hulls § 23.753 Main float design. Each seaplane main float must meet the requirements of § 23.521. [Doc...

  9. Normal foot and ankle

    International Nuclear Information System (INIS)

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  10. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  11. Installation Strategy for the LHC Main Dipoles

    CERN Multimedia

    Fartoukh, Stephane David

    2004-01-01

    All positions in the LHC machine are not equivalent in terms of beam requirements on the geometry and the field quality of the main dipoles. In the presence of slightly or strongly out-of tolerance magnets, a well-defined installation strategy will therefore contribute to preserve or even optimize the performance of the machine. Based on the present status of the production, we have anticipated a list of potential issues (geometry, transfer function, field direction and random b3) which, combined by order of priority, have been taken into account to define a simple but efficient installation algorithm for the LHC main dipoles. Its output is a prescription for installing the available dipoles in sequence while reducing to an absolute minimum the number of holes required by geometry or FQ issues.

  12. Normalization of Gravitational Acceleration Models

    Science.gov (United States)

    Eckman, Randy A.; Brown, Aaron J.; Adamo, Daniel R.

    2011-01-01

    Unlike the uniform density spherical shell approximations of Newton, the con- sequence of spaceflight in the real universe is that gravitational fields are sensitive to the nonsphericity of their generating central bodies. The gravitational potential of a nonspherical central body is typically resolved using spherical harmonic approximations. However, attempting to directly calculate the spherical harmonic approximations results in at least two singularities which must be removed in order to generalize the method and solve for any possible orbit, including polar orbits. Three unique algorithms have been developed to eliminate these singularities by Samuel Pines [1], Bill Lear [2], and Robert Gottlieb [3]. This paper documents the methodical normalization of two1 of the three known formulations for singularity-free gravitational acceleration (namely, the Lear [2] and Gottlieb [3] algorithms) and formulates a general method for defining normalization parameters used to generate normalized Legendre Polynomials and ALFs for any algorithm. A treatment of the conventional formulation of the gravitational potential and acceleration is also provided, in addition to a brief overview of the philosophical differences between the three known singularity-free algorithms.

  13. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  14. Differentially Private Event Histogram Publication on Sequences over Graphs

    Institute of Scientific and Technical Information of China (English)

    Ning Wang; Yu Gu; Jia Xu; Fang-Fang Li; Ge Yu

    2017-01-01

    The big data era is coming with strong and ever-growing demands on analyzing personal information and footprints in the cyber world. To enable such analysis without privacy leak risk, differential privacy (DP) has been quickly rising in recent years, as the first practical privacy protection model with rigorous theoretical guarantee. This paper discusses how to publish differentially private histograms on events in time series domain, with sequences of personal events over graphs with events as edges. Such individual-generated sequences commonly appear in formalized industrial workflows, online game logs, and spatial-temporal trajectories. Directly publishing the statistics of sequences may compromise personal privacy. While existing DP mechanisms mainly target at normalized domains with fixed and aligned dimensions, our problem raises new challenges when the sequences could follow arbitrary paths on the graph. To tackle the problem, we reformulate the problem with a three-step framework, which 1) carefully truncates the original sequences, trading off errors introduced by the truncation with those introduced by the noise added to guarantee privacy, 2) decomposes the event graph into path sub-domains based on a group of event pivots, and 3) employs a deeply optimized tree-based histogram construction approach for each sub-domain to benefit with less noise addition. We present a careful analysis on our framework to support thorough optimizations over each step of the framework, and verify the huge improvements of our proposals over state-of-the-art solutions.

  15. Diagnosing in building main pipelines

    Energy Technology Data Exchange (ETDEWEB)

    Telegin, L.G.; Gorelov, A.S.; Kurepin, B.N.; Orekhov, V.I.; Vasil' yev, G.G.; Yakovlev, Ye. I.

    1984-01-01

    General principles are examined for technical diagnosis in building main pipelines. A technique is presented for diagnosis during construction, as well as diagnosis of the technical state of the pipeline-construction machines and mechanisms. The survey materials could be used to set up construction of main pipelines.

  16. Maine Agricultural Foods. Project SEED.

    Science.gov (United States)

    Beaulieu, Peter; Ossenfort, Pat

    This paper describes an activity-based program that teaches students in grades 4-12 about the importance of Maine agriculture in their lives. Specifically, the goal is to increase student awareness of how the foods they eat are planted, harvested, and processed. The emphasis is on crops grown in Maine such as potatoes, broccoli, peas, blueberries,…

  17. Main Propulsion Test Article (MPTA)

    Science.gov (United States)

    Snoddy, Cynthia

    2010-01-01

    Scope: The Main Propulsion Test Article integrated the main propulsion subsystem with the clustered Space Shuttle Main Engines, the External Tank and associated GSE. The test program consisted of cryogenic tanking tests and short- and long duration static firings including gimbaling and throttling. The test program was conducted on the S1-C test stand (Position B-2) at the National Space Technology Laboratories (NSTL)/Stennis Space Center. 3 tanking tests and 20 hot fire tests conducted between December 21 1 1977 and December 17, 1980 Configuration: The main propulsion test article consisted of the three space shuttle main engines, flightweight external tank, flightweight aft fuselage, interface section and a boilerplate mid/fwd fuselage truss structure.

  18. Baby Poop: What's Normal?

    Science.gov (United States)

    ... I'm breast-feeding my newborn and her bowel movements are yellow and mushy. Is this normal for baby poop? Answers from Jay L. Hoecker, M.D. Yellow, mushy bowel movements are perfectly normal for breast-fed babies. Still, ...

  19. Visual Memories Bypass Normalization.

    Science.gov (United States)

    Bloem, Ilona M; Watanabe, Yurika L; Kibbe, Melissa M; Ling, Sam

    2018-05-01

    How distinct are visual memory representations from visual perception? Although evidence suggests that briefly remembered stimuli are represented within early visual cortices, the degree to which these memory traces resemble true visual representations remains something of a mystery. Here, we tested whether both visual memory and perception succumb to a seemingly ubiquitous neural computation: normalization. Observers were asked to remember the contrast of visual stimuli, which were pitted against each other to promote normalization either in perception or in visual memory. Our results revealed robust normalization between visual representations in perception, yet no signature of normalization occurring between working memory stores-neither between representations in memory nor between memory representations and visual inputs. These results provide unique insight into the nature of visual memory representations, illustrating that visual memory representations follow a different set of computational rules, bypassing normalization, a canonical visual computation.

  20. Making nuclear 'normal'

    International Nuclear Information System (INIS)

    Haehlen, Peter; Elmiger, Bruno

    2000-01-01

    The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

  1. Left main percutaneous coronary intervention.

    Science.gov (United States)

    Teirstein, Paul S; Price, Matthew J

    2012-10-23

    The introduction of drug-eluting stents and advances in catheter techniques have led to increasing acceptance of percutaneous coronary intervention (PCI) as a viable alternative to coronary artery bypass graft (CABG) for unprotected left main disease. Current guidelines state that it is reasonable to consider unprotected left main PCI in patients with low to intermediate anatomic complexity who are at increased surgical risk. Data from randomized trials involving patients who are candidates for either treatment strategy provide novel insight into the relative safety and efficacy of PCI for this lesion subset. Herein, we review the current data comparing PCI with CABG for left main disease, summarize recent guideline recommendations, and provide an update on technical considerations that may optimize clinical outcomes in left main PCI. Copyright © 2012 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  2. 14 CFR 27.753 - Main float design.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Main float design. 27.753 Section 27.753... STANDARDS: NORMAL CATEGORY ROTORCRAFT Design and Construction Floats and Hulls § 27.753 Main float design. (a) Bag floats. Each bag float must be designed to withstand— (1) The maximum pressure differential...

  3. Main: FEB3 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available nt to sterilization and rinsing - One of the main components of biofilms is polysaccharides - Some pit-formi...ng bacteria such as Sphingomonas species A1 possess superchannels that directly incorporate and decompose polysaccharides - Detai...e entrance of the superchannel have been elucidated - We have obtained the crystals of ABC importer complexe...of water pipes and dental plaque are examples of biofilms. One of the main components of biofilms is polysac

  4. Decontamination of main coolant pumps

    International Nuclear Information System (INIS)

    Roofthooft, R.

    1988-01-01

    Last year a number of main coolant pumps in Belgian nuclear power plants were decontaminated. A new method has been developed to reduce the time taken for decontamination and the volume of waste to be treated. The method comprises two phases: Oxidation with permanganate in nitric acid and dissolution in oxalic acid. The decontamination of main coolant pumps can now be achieved in less than one day. The decontamination factors attained range between 15 and 150. (orig.) [de

  5. Normal human bone marrow and its variations in MRI

    International Nuclear Information System (INIS)

    Vahlensieck, M.; Schmidt, H.M.

    2000-01-01

    Physiology and age dependant changes of human bone marrow are described. The resulting normal distribution patterns of active and inactive bone marrow including the various contrasts on different MR-sequences are discussed. (orig.) [de

  6. Normal Pressure Hydrocephalus

    Science.gov (United States)

    ... improves the chance of a good recovery. Without treatment, symptoms may worsen and cause death. What research is being done? The NINDS conducts and supports research on neurological disorders, including normal pressure hydrocephalus. Research on disorders such ...

  7. Normality in Analytical Psychology

    Science.gov (United States)

    Myers, Steve

    2013-01-01

    Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity. PMID:25379262

  8. Normal pressure hydrocephalus

    Science.gov (United States)

    Hydrocephalus - occult; Hydrocephalus - idiopathic; Hydrocephalus - adult; Hydrocephalus - communicating; Dementia - hydrocephalus; NPH ... Ferri FF. Normal pressure hydrocephalus. In: Ferri FF, ed. ... Elsevier; 2016:chap 648. Rosenberg GA. Brain edema and disorders ...

  9. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  10. Normal growth and development

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/002456.htm Normal growth and development To use the sharing features on this page, please enable JavaScript. A child's growth and development can be divided into four periods: ...

  11. Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen

    2006-10-01

    Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and

  12. Compressed normalized block difference for object tracking

    Science.gov (United States)

    Gao, Yun; Zhang, Dengzhuo; Cai, Donglan; Zhou, Hao; Lan, Ge

    2018-04-01

    Feature extraction is very important for robust and real-time tracking. Compressive sensing provided a technical support for real-time feature extraction. However, all existing compressive tracking were based on compressed Haar-like feature, and how to compress many more excellent high-dimensional features is worth researching. In this paper, a novel compressed normalized block difference feature (CNBD) was proposed. For resisting noise effectively in a highdimensional normalized pixel difference feature (NPD), a normalized block difference feature extends two pixels in the original formula of NPD to two blocks. A CNBD feature can be obtained by compressing a normalized block difference feature based on compressive sensing theory, with the sparse random Gaussian matrix as the measurement matrix. The comparative experiments of 7 trackers on 20 challenging sequences showed that the tracker based on CNBD feature can perform better than other trackers, especially than FCT tracker based on compressed Haar-like feature, in terms of AUC, SR and Precision.

  13. New Main Ring control system

    International Nuclear Information System (INIS)

    Seino, K.; Anderson, L.; Ducar, R.; Franck, A.; Gomilar, J.; Hendricks, B.; Smedinghoff, J.

    1990-03-01

    The Fermilab Main Ring control system has been operational for over sixteen years. Aging and obsolescence of the equipment make the maintenance difficult. Since the advent of the Tevatron, considerable upgrades have been made to the controls of all the Fermilab accelerators except the Main Ring. Modernization of the equipment and standardization of the hardware and software have thus become inevitable. The Tevatron CAMAC serial system has been chosen as a basic foundation in order to make the Main Ring control system compatible with the rest of the accelerator complex. New hardware pieces including intelligent CAMAC modules have been designed to satisfy unique requirements. Fiber optic cable and repeaters have been installed in order to accommodate new channel requirements onto the already saturated communication medium system. 8 refs., 2 figs

  14. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  15. A random walk down Main Street

    Directory of Open Access Journals (Sweden)

    David Matthew Levinson

    2016-08-01

    Full Text Available US suburbs have often been characterized by their relatively low walk accessibility compared to more urban environments, and US urban environments have been char- acterized by low walk accessibility compared to cities in other countries. Lower overall density in the suburbs implies that activities, if spread out, would have a greater distance between them. But why should activities be spread out instead of developed contiguously? This brief research note builds a positive model for the emergence of contiguous development along “Main Street” to illustrate the trade-offs that result in the built environment we observe. It then suggests some policy interventions to place a “thumb on the scale” to choose which parcels will develop in which sequence to achieve socially preferred outcomes.

  16. Main: FBB2 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available ion of the c-ring - A subunit packing model of E. coli c-ring has been proposed - The main chain secondary s...tructure of thermophile c-ring has been obtained ATP synthase is a general term for an enzyme that can synth

  17. Main: FEA5 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available al or an anti-cancer drug, is the main cause of hospital-acquired infection - Dru...e will elucidate the entire structure of the transport machinery in action to understand its functions in detail. FEA5.csml ...

  18. Residential Energy Efficiency Potential: Maine

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Eric J [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-11-02

    Energy used by Maine single-family homes that can be saved through cost-effective improvements. Prepared by Eric Wilson and Noel Merket, NREL, and Erin Boyd, U.S. Department of Energy Office of Energy Policy and Systems Analysis.

  19. CENTRE OF THE MAIN INTERESTS

    Directory of Open Access Journals (Sweden)

    DIANA DELEANU

    2013-05-01

    Full Text Available The centre of the main interests of the debtor is a legal tool meant to settle conflicts that can arise between jurisdictions in cross-border insolvencies, based on the principles of mutual recognition and co-operation.

  20. Update on normal tension glaucoma

    Directory of Open Access Journals (Sweden)

    Jyotiranjan Mallick

    2016-01-01

    Full Text Available Normal tension glaucoma (NTG is labelled when typical glaucomatous disc changes, visual field defects and open anterior chamber angles are associated with intraocular pressure (IOP constantly below 21 mmHg. Chronic low vascular perfusion, Raynaud's phenomenon, migraine, nocturnal systemic hypotension and over-treated systemic hypertension are the main causes of normal tension glaucoma. Goldmann applanation tonometry, gonioscopy, slit lamp biomicroscopy, optical coherence tomography and visual field analysis are the main tools of investigation for the diagnosis of NTG. Management follows the same principles of treatment for other chronic glaucomas: To reduce IOP by a substantial amount, sufficient to prevent disabling visual loss. Treatment is generally aimed to lower IOP by 30% from pre-existing levels to 12-14 mmHg. Betaxolol, brimonidine, prostaglandin analogues, trabeculectomy (in refractory cases, systemic calcium channel blockers (such as nifedipine and 24-hour monitoring of blood pressure are considered in the management of NTG. The present review summarises risk factors, causes, pathogenesis, diagnosis and management of NTG.

  1. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  2. Sequences, groups, and number theory

    CERN Document Server

    Rigo, Michel

    2018-01-01

    This collaborative book presents recent trends on the study of sequences, including combinatorics on words and symbolic dynamics, and new interdisciplinary links to group theory and number theory. Other chapters branch out from those areas into subfields of theoretical computer science, such as complexity theory and theory of automata. The book is built around four general themes: number theory and sequences, word combinatorics, normal numbers, and group theory. Those topics are rounded out by investigations into automatic and regular sequences, tilings and theory of computation, discrete dynamical systems, ergodic theory, numeration systems, automaton semigroups, and amenable groups.  This volume is intended for use by graduate students or research mathematicians, as well as computer scientists who are working in automata theory and formal language theory. With its organization around unified themes, it would also be appropriate as a supplemental text for graduate level courses.

  3. New paleomagnetic and paleointensity results from late pliocene volcanic sequences from southern Georgia (Caucasus)

    Energy Technology Data Exchange (ETDEWEB)

    Calvo-Rathert, Manuel; Bogalo, Maria-Felicidad; Carrancho, Angel; Villalain, Juan Jose [Universidad de Burgos, Burgos (Spain). Departamento de Fisica, EPS; Goguichaichvili, Avto [Universidad Nacional Autonoma de Mexico, Morelia (Mexico). Laboratorio de Magnetismo Natural, Instituto de Geofisica; Vegas-Tubia, Nestor [Universidad del Pais Vasco, Bilbao (Spain). Departamento de Geodinamica; Sologashvili, Jemal [Ivane Javakhishvili State University of Tbilisi, Tbilisi (Georgia). Department of Geophysics

    2009-07-01

    Complete text of publication follows. Paleomagnetic and rock-magnetic experiments were carried out on 21 basaltic lava flows belonging to four different sequences of late Pliocene age from southern Georgia (Caucasus): Dmanisi (11 flows), Diliska (5 flows), Kvemo Orozmani (5 flows), and Zemo Karabulaki (3 flows). Paleomagnetic analysis generally showed the presence of a single component (mainly in the Dmanisi sequence) but also two more or less superimposed components in several other cases. All sites except one clearly displayed a normal-polarity characteristic component. Rock-magnetic experiments included measurement of thermomagnetic curves and hysteresis parameters. Susceptibility-versus-temperature curves measured in argon atmosphere on whole-rock powdered samples yielded low-Ti titanomagnetite as main carrier of remanence, although a lower T{sub C}-component was also observed in several cases. Both reversible and non-reversible k-T curves were measured. A pilot paleointensity study was performed with the Coe (1967) method on two samples of each of those sites considered suitable after interpretation of rock-magnetic and paleomagnetic data from all sites. The pilot study showed that reliable paleointensity results were mainly obtained from sites of the Dmanisi sequence. This thick sequence of basaltic lava flows records the upper end of the normal-polarity Olduvai subchron, a fact confirmed by {sup 40}Ar/{sup 39}Ar dating of the uppermost lava flow and overlying volcanogenic ashes, which yields ages of 1.8 to 1.85 My. A second paleointensity experiment was carried out only on samples belonging to the Dmanisi sequence. Preliminary results show that paleointensities often are low, their values lying between 10 and 20 muT in many cases. For comparison, present day field is 47 muT. The Dmanisi sequence of lava flows directly underlies the Dmanisi paleoanthropologic site, in which the end of the Olduvai subchron is recorded.

  4. Monitoring the normal body

    DEFF Research Database (Denmark)

    Nissen, Nina Konstantin; Holm, Lotte; Baarts, Charlotte

    2015-01-01

    of practices for monitoring their bodies based on different kinds of calculations of weight and body size, observations of body shape, and measurements of bodily firmness. Biometric measurements are familiar to them as are health authorities' recommendations. Despite not belonging to an extreme BMI category...... provides us with knowledge about how to prevent future overweight or obesity. This paper investigates body size ideals and monitoring practices among normal-weight and moderately overweight people. Methods : The study is based on in-depth interviews combined with observations. 24 participants were...... recruited by strategic sampling based on self-reported BMI 18.5-29.9 kg/m2 and socio-demographic factors. Inductive analysis was conducted. Results : Normal-weight and moderately overweight people have clear ideals for their body size. Despite being normal weight or close to this, they construct a variety...

  5. Normal modified stable processes

    DEFF Research Database (Denmark)

    Barndorff-Nielsen, Ole Eiler; Shephard, N.

    2002-01-01

    Gaussian (NGIG) laws. The wider framework thus established provides, in particular, for added flexibility in the modelling of the dynamics of financial time series, of importance especially as regards OU based stochastic volatility models for equities. In the special case of the tempered stable OU process......This paper discusses two classes of distributions, and stochastic processes derived from them: modified stable (MS) laws and normal modified stable (NMS) laws. This extends corresponding results for the generalised inverse Gaussian (GIG) and generalised hyperbolic (GH) or normal generalised inverse...

  6. Normalization of satellite imagery

    Science.gov (United States)

    Kim, Hongsuk H.; Elman, Gregory C.

    1990-01-01

    Sets of Thematic Mapper (TM) imagery taken over the Washington, DC metropolitan area during the months of November, March and May were converted into a form of ground reflectance imagery. This conversion was accomplished by adjusting the incident sunlight and view angles and by applying a pixel-by-pixel correction for atmospheric effects. Seasonal color changes of the area can be better observed when such normalization is applied to space imagery taken in time series. In normalized imagery, the grey scale depicts variations in surface reflectance and tonal signature of multi-band color imagery can be directly interpreted for quantitative information of the target.

  7. The normal holonomy group

    International Nuclear Information System (INIS)

    Olmos, C.

    1990-05-01

    The restricted holonomy group of a Riemannian manifold is a compact Lie group and its representation on the tangent space is a product of irreducible representations and a trivial one. Each one of the non-trivial factors is either an orthogonal representation of a connected compact Lie group which acts transitively on the unit sphere or it is the isotropy representation of a single Riemannian symmetric space of rank ≥ 2. We prove that, all these properties are also true for the representation on the normal space of the restricted normal holonomy group of any submanifold of a space of constant curvature. 4 refs

  8. ONKALO - Main drawings in 2007

    International Nuclear Information System (INIS)

    2008-05-01

    The first overall site characterisation programme for a Finnish repository of spent nuclear fuel was introduced in 1982. This programme already suggested that the site confirmation for a detailed repository design and safety assessment should include characterisation performed in an underground rock characterisation facility (URCF). This idea was confirmed during the detailed site characterisation. International views have also emphasised the importance of underground characterisation before the final decision to construct the repository is taken. The underground rock characterisation facility (ONKALO) is excavated at Olkiluoto in the municipality of Eurajoki. ONKALO should be constructed to allow characterisation work for site confirmation without jeopardising long-term safety of the repository site. It should also be possible to link ONKALO later to the repository as to a part of it. The construction of ONKALO was started in 2004 and will be completed in 2014. The characterisation work has started in ONKALO and will focus on the disposal depth. In the main drawings stage, ONKALO was described at the level of detail needed for a construction permit in 2003. This meant description of the location, final structures and final systems. This summary report describes the development of design to updated main drawings in 2007 at the same level of detail (no temporary arrangements are described). The main changes are the added exhaust air shaft and advancing the controlled area's inlet air shaft to the ONKALO phase. Also the layout and the depth of the characterisation levels have been updated according to the current bedrock information. Some buildings on the surface will house sets of equipment directly connected with underground facility and this equipment is described in this report. No buildings or other equipment are described in this report, because they are not directly connected with the underground facility. The main element of ONKALO is a system of

  9. At ISR Main Control Room

    CERN Multimedia

    1983-01-01

    After 13 years the exploitation of the Intersecting Storage Rings as a beam-beam collider went to an end. In this last year the demands were very exacting, both in terms of operating time and diversified running conditions (Annual Report 1983 p. 123). Before dismantelement the photographer made a last tour, see photos 8310889X --> 8310667X. This photo shows the Main Control Room.

  10. Multimodal sequence learning.

    Science.gov (United States)

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Sequence Read Archive (SRA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Sequence Read Archive (SRA) stores raw sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome...

  12. Aspects of coverage in medical DNA sequencing

    Directory of Open Access Journals (Sweden)

    Wilson Richard K

    2008-05-01

    Full Text Available Abstract Background DNA sequencing is now emerging as an important component in biomedical studies of diseases like cancer. Short-read, highly parallel sequencing instruments are expected to be used heavily for such projects, but many design specifications have yet to be conclusively established. Perhaps the most fundamental of these is the redundancy required to detect sequence variations, which bears directly upon genomic coverage and the consequent resolving power for discerning somatic mutations. Results We address the medical sequencing coverage problem via an extension of the standard mathematical theory of haploid coverage. The expected diploid multi-fold coverage, as well as its generalization for aneuploidy are derived and these expressions can be readily evaluated for any project. The resulting theory is used as a scaling law to calibrate performance to that of standard BAC sequencing at 8× to 10× redundancy, i.e. for expected coverages that exceed 99% of the unique sequence. A differential strategy is formalized for tumor/normal studies wherein tumor samples are sequenced more deeply than normal ones. In particular, both tumor alleles should be detected at least twice, while both normal alleles are detected at least once. Our theory predicts these requirements can be met for tumor and normal redundancies of approximately 26× and 21×, respectively. We explain why these values do not differ by a factor of 2, as might intuitively be expected. Future technology developments should prompt even deeper sequencing of tumors, but the 21× value for normal samples is essentially a constant. Conclusion Given the assumptions of standard coverage theory, our model gives pragmatic estimates for required redundancy. The differential strategy should be an efficient means of identifying potential somatic mutations for further study.

  13. Normality in Analytical Psychology

    Directory of Open Access Journals (Sweden)

    Steve Myers

    2013-11-01

    Full Text Available Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity.

  14. Medically-enhanced normality

    DEFF Research Database (Denmark)

    Møldrup, Claus; Traulsen, Janine Morgall; Almarsdóttir, Anna Birna

    2003-01-01

    Objective: To consider public perspectives on the use of medicines for non-medical purposes, a usage called medically-enhanced normality (MEN). Method: Examples from the literature were combined with empirical data derived from two Danish research projects: a Delphi internet study and a Telebus...

  15. The Normal Fetal Pancreas.

    Science.gov (United States)

    Kivilevitch, Zvi; Achiron, Reuven; Perlman, Sharon; Gilboa, Yinon

    2017-10-01

    The aim of the study was to assess the sonographic feasibility of measuring the fetal pancreas and its normal development throughout pregnancy. We conducted a cross-sectional prospective study between 19 and 36 weeks' gestation. The study included singleton pregnancies with normal pregnancy follow-up. The pancreas circumference was measured. The first 90 cases were tested to assess feasibility. Two hundred ninety-seven fetuses of nondiabetic mothers were recruited during a 3-year period. The overall satisfactory visualization rate was 61.6%. The intraobserver and interobserver variability had high interclass correlation coefficients of of 0.964 and 0.967, respectively. A cubic polynomial regression described best the correlation of pancreas circumference with gestational age (r = 0.744; P pancreas circumference percentiles for each week of gestation were calculated. During the study period, we detected 2 cases with overgrowth syndrome and 1 case with an annular pancreas. In this study, we assessed the feasibility of sonography for measuring the fetal pancreas and established a normal reference range for the fetal pancreas circumference throughout pregnancy. This database can be helpful when investigating fetomaternal disorders that can involve its normal development. © 2017 by the American Institute of Ultrasound in Medicine.

  16. Sir Robert Sidney’s Poems Revisited: the alternative sequence

    OpenAIRE

    Relvas, Maria de Jesus C.

    1997-01-01

    The essay approaches the lyric sequence written by Sir Robert Sidney (1563-1626) in the Elizabethan age, by mainly exploring its unique formal structure, which encloses an alternative sequence formed by a re-numbering of several poems.

  17. Methods for otpimum and near optimum disassembly sequencing

    NARCIS (Netherlands)

    Lambert, A.J.D.; Gupta, S.M.

    2008-01-01

    This paper considers disassembly sequencing problems subjected to sequence dependent disassembly costs. In practice, the methods for dealing with such problems rely mainly on metaheuristic and heuristic methods, which intrinsically generate suboptimum solutions. Exact methods are NP-hard and

  18. The 2016-2017 Central Italy Seismic Sequence: Source Complexity Inferred from Rupture Models.

    Science.gov (United States)

    Scognamiglio, L.; Tinti, E.; Casarotti, E.; Pucci, S.; Villani, F.; Cocco, M.; Magnoni, F.; Michelini, A.

    2017-12-01

    The Apennines have been struck by several seismic sequences in recent years, showing evidence of the activation of multiple segments of normal fault systems in a variable and, relatively short, time span, as in the case of the 1980 Irpinia earthquake (three shocks in 40 s), the 1997 Umbria-Marche sequence (four main shocks in 18 days) and the 2009 L'Aquila earthquake having three segments activated within a few weeks. The 2016-2017 central Apennines seismic sequence begin on August 24th with a MW 6.0 earthquake, which strike the region between Amatrice and Accumoli causing 299 fatalities. This earthquake ruptures a nearly 20 km long normal fault and shows a quite heterogeneous slip distribution. On October 26th, another main shock (MW 5.9) occurs near Visso extending the activated seismogenic area toward the NW. It is a double event rupturing contiguous patches on the fault segment of the normal fault system. Four days after the second main shock, on October 30th, a third earthquake (MW 6.5) occurs near Norcia, roughly midway between Accumoli and Visso. In this work we have inverted strong motion waveforms and GPS data to retrieve the source model of the MW 6.5 event with the aim of interpreting the rupture process in the framework of this complex sequence of moderate magnitude earthquakes. We noted that some preliminary attempts to model the slip distribution of the October 30th main shock using a single fault plane oriented along the Apennines did not provide convincing fits to the observed waveforms. In addition, the deformation pattern inferred from satellite observations suggested the activation of a multi-fault structure, that is coherent to the complexity and the extension of the geological surface deformation. We investigated the role of multi-fault ruptures and we found that this event revealed an extraordinary complexity of the rupture geometry and evolution: the coseismic rupture propagated almost simultaneously on a normal fault and on a blind fault

  19. An evaluation of two-channel ChIP-on-chip and DNA methylation microarray normalization strategies

    Science.gov (United States)

    2012-01-01

    Background The combination of chromatin immunoprecipitation with two-channel microarray technology enables genome-wide mapping of binding sites of DNA-interacting proteins (ChIP-on-chip) or sites with methylated CpG di-nucleotides (DNA methylation microarray). These powerful tools are the gateway to understanding gene transcription regulation. Since the goals of such studies, the sample preparation procedures, the microarray content and study design are all different from transcriptomics microarrays, the data pre-processing strategies traditionally applied to transcriptomics microarrays may not be appropriate. Particularly, the main challenge of the normalization of "regulation microarrays" is (i) to make the data of individual microarrays quantitatively comparable and (ii) to keep the signals of the enriched probes, representing DNA sequences from the precipitate, as distinguishable as possible from the signals of the un-enriched probes, representing DNA sequences largely absent from the precipitate. Results We compare several widely used normalization approaches (VSN, LOWESS, quantile, T-quantile, Tukey's biweight scaling, Peng's method) applied to a selection of regulation microarray datasets, ranging from DNA methylation to transcription factor binding and histone modification studies. Through comparison of the data distributions of control probes and gene promoter probes before and after normalization, and assessment of the power to identify known enriched genomic regions after normalization, we demonstrate that there are clear differences in performance between normalization procedures. Conclusion T-quantile normalization applied separately on the channels and Tukey's biweight scaling outperform other methods in terms of the conservation of enriched and un-enriched signal separation, as well as in identification of genomic regions known to be enriched. T-quantile normalization is preferable as it additionally improves comparability between microarrays. In

  20. Idiopathic Normal Pressure Hydrocephalus

    Directory of Open Access Journals (Sweden)

    Basant R. Nassar BS

    2016-04-01

    Full Text Available Idiopathic normal pressure hydrocephalus (iNPH is a potentially reversible neurodegenerative disease commonly characterized by a triad of dementia, gait, and urinary disturbance. Advancements in diagnosis and treatment have aided in properly identifying and improving symptoms in patients. However, a large proportion of iNPH patients remain either undiagnosed or misdiagnosed. Using PubMed search engine of keywords “normal pressure hydrocephalus,” “diagnosis,” “shunt treatment,” “biomarkers,” “gait disturbances,” “cognitive function,” “neuropsychology,” “imaging,” and “pathogenesis,” articles were obtained for this review. The majority of the articles were retrieved from the past 10 years. The purpose of this review article is to aid general practitioners in further understanding current findings on the pathogenesis, diagnosis, and treatment of iNPH.

  1. Normal Weight Dyslipidemia

    DEFF Research Database (Denmark)

    Ipsen, David Hojland; Tveden-Nyborg, Pernille; Lykkesfeldt, Jens

    2016-01-01

    Objective: The liver coordinates lipid metabolism and may play a vital role in the development of dyslipidemia, even in the absence of obesity. Normal weight dyslipidemia (NWD) and patients with nonalcoholic fatty liver disease (NAFLD) who do not have obesity constitute a unique subset...... of individuals characterized by dyslipidemia and metabolic deterioration. This review examined the available literature on the role of the liver in dyslipidemia and the metabolic characteristics of patients with NAFLD who do not have obesity. Methods: PubMed was searched using the following keywords: nonobese......, dyslipidemia, NAFLD, NWD, liver, and metabolically obese/unhealthy normal weight. Additionally, article bibliographies were screened, and relevant citations were retrieved. Studies were excluded if they had not measured relevant biomarkers of dyslipidemia. Results: NWD and NAFLD without obesity share a similar...

  2. JWST-MIRI spectrometer main optics design and main results

    Science.gov (United States)

    Navarro, Ramón; Schoenmaker, Ton; Kroes, Gabby; Oudenhuysen, Ad; Jager, Rieks; Venema, Lars

    2017-11-01

    MIRI ('Mid InfraRed Instrument') is the combined imager and integral field spectrometer for the 5-29 micron wavelength range under development for the James Webb Space Telescope JWST. The flight acceptance tests of the Spectrometer Main Optics flight models (SMO), part of the MIRI spectrometer, are completed in the summer of 2008 and the system is delivered to the MIRI-JWST consortium. The two SMO arms contain 14 mirrors and form the MIRI optical system together with 12 selectable gratings on grating wheels. The entire system operates at a temperature of 7 Kelvin and is designed on the basis of a 'no adjustments' philosophy. This means that the optical alignment precision depends strongly on the design, tolerance analysis and detailed knowledge of the manufacturing process. Because in principle no corrections are needed after assembly, continuous tracking of the alignment performance during the design and manufacturing phases is important. The flight hardware is inspected with respect to performance parameters like alignment and image quality. The stability of these parameters is investigated after exposure to various vibration levels and successive cryogenic cool downs. This paper describes the philosophy behind the acceptance tests, the chosen test strategy and reports the results of these tests. In addition the paper covers the design of the optical test setup, focusing on the simulation of the optical interfaces of the SMO. Also the relation to the SMO qualification and verification program is addressed.

  3. Ethics and "normal birth".

    Science.gov (United States)

    Lyerly, Anne Drapkin

    2012-12-01

    The concept of "normal birth" has been promoted as ideal by several international organizations, although debate about its meaning is ongoing. In this article, I examine the concept of normalcy to explore its ethical implications and raise a trio of concerns. First, in its emphasis on nonuse of technology as a goal, the concept of normalcy may marginalize women for whom medical intervention is necessary or beneficial. Second, in its emphasis on birth as a socially meaningful event, the mantra of normalcy may unintentionally avert attention to meaning in medically complicated births. Third, the emphasis on birth as a normal and healthy event may be a contributor to the long-standing tolerance for the dearth of evidence guiding the treatment of illness during pregnancy and the failure to responsibly and productively engage pregnant women in health research. Given these concerns, it is worth debating not just what "normal birth" means, but whether the term as an ideal earns its keep. © 2012, Copyright the Authors Journal compilation © 2012, Wiley Periodicals, Inc.

  4. Main ring transition crossing simulations

    International Nuclear Information System (INIS)

    Kourbanis, I.; Ng, King-Yuen.

    1990-10-01

    We used ESME to simulate transition crossing in the Main Ring (MR). For the simulations, we followed the MR 29 cycle used currently for bar p production with a flat top of 120 GeV. In Sect. II, some inputs are discussed. In Sect. III, we present simulations with space charge turned off so that the effect of nonlinearity can be studied independently. When space charge is turned on in Sect. IV, we are faced with the problem of statistical errors due to binning, an analysis of which is given in the Appendices. Finally in Sects. V and VI, the results of simulations with space charge are presented and compared with the experimental measurements. 7 refs., 6 figs

  5. Improvement of main control room

    International Nuclear Information System (INIS)

    Chae, Sung Ki; Ham, Chang Sik; Kwon, Ki Chun

    1991-07-01

    Information display system, advanced alarm system and fiber optical communication system were developed to improve the main control room in nuclear power plant. Establishing the new hierachical information structure of plant operation data, plant overview status board(POSB) and digital indicator(DI) were designed and manufactured. The prototype advanced alarm system which employed the new alarm logics and algorithm compared with the conventional alarm system were developed and its effectiveness was proved. Optical communication system which has multi-drop feature and capability of upgrading to large-scale system by using BITBUS communication protocol which is proven technology, were developed. Reliability of that system was enhanced by using distributed control. (Author)

  6. The role of Main Institutions

    DEFF Research Database (Denmark)

    Persson, H Thomas R; Chabanet, Didier; Rakar, Fredrik

    2017-01-01

    ), in many countries the need emerged to understand the best methods to promote their establishment and continued success. In order to understand these issues, to contribute to the academic debate on SEs and to give useful policy advice on a truly enabling ecosystem, in November 2013 a consortium of 11...... Entrepreneurship”; to identify the “New Generation” of Social Entrepreneurs; to build an “Evolutionary Theory of Social Entrepreneurship”; to provide effective policy advices to stakeholders. In order to pursue and achieve these research objectives, the consortium implemented a complex research design...... in the social economy; - In the fifth chapter the authors address the role of the main institutions in developing (or hindering) social enterprises; - In the sixth chapter, stakeholder network maps are used to identify four ‘ecosystem types’ across the 10 partner countries; - The seventh chapter gives...

  7. Normal cranial CT anatomy

    International Nuclear Information System (INIS)

    Gado, M.H.; Rao, K.C.V.G.

    1987-01-01

    The human brain consists of well-known anatomical components. Some parts of these components have been shown to be concerned with certain functions. A complete cranial CT examination consists of a series of several slices obtained in a sequence usually from the base to the vertex of the cranial vault, in the axial mode. The ultimate goal of this chapter is to pinpoint those slices that depict a given anatomical structure or several structures that deal with a given function. To achieve this goal, the discussion of CT cranial anatomy is presented in three sections

  8. Rapid Multiplex Small DNA Sequencing on the MinION Nanopore Sequencing Platform

    Directory of Open Access Journals (Sweden)

    Shan Wei

    2018-05-01

    Full Text Available Real-time sequencing of short DNA reads has a wide variety of clinical and research applications including screening for mutations, target sequences and aneuploidy. We recently demonstrated that MinION, a nanopore-based DNA sequencing device the size of a USB drive, could be used for short-read DNA sequencing. In this study, an ultra-rapid multiplex library preparation and sequencing method for the MinION is presented and applied to accurately test normal diploid and aneuploidy samples’ genomic DNA in under three hours, including library preparation and sequencing. This novel method shows great promise as a clinical diagnostic test for applications requiring rapid short-read DNA sequencing.

  9. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  10. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  11. Comparative study and application of MR sialography using different pulse sequences

    International Nuclear Information System (INIS)

    Shi Ruihua; Qi Jianping; Feng Dingyi; Zou Mingli; Hu Junwu; Zhu Wenzhen; Xia Liming; Wang Chengyuan

    2004-01-01

    Objective: To evaluate the accuracy of MR sialography in demonstrating the main salivary duct systems by using a series of pulse sequences and stimulation of salivation by vitamin C. Methods: MR sialography was prospectively performed with STIR, heavily T 2 weighted FSE, and SS FSE sequences in 17 patients suspected with salivary duct abnormalities and 13 volunteers, respectively, and MR sialography was further performed in 16 patients after vitamin C stimulation. The results of the above three sequences were compared with each other. Results: The main salivary gland duct was depicted in all cases by any of the mentioned sequence. The STIR images were significantly superior to SS FSE and heavily T 2 weighted FSE images for demonstrating the salivary duct system, followed by heavily T 2 weighted FSE images. On STIR images, first- and second- order intraglandular branches were clearly depicted in all cases, and the thinnest branches were about 0.8 mm. On heavily T 2 weighted FSE images, the first-order and the second-order intraglandular branches were delineated in 25 of 30 and 18 of 30 cases, respectively. But on SS FSE images, only 20 to 30 first-order and 10 of 30 second-order intraglandular branches could be detected. MR sialography with vitamin C stimulation revealed the good visualization of the salivary duct system, and the ducts became wider than before. In 7 cases with acute sialadenitis, the main duct became slightly wider and the distal ducts were dilated; In 7 cases with benign tumor, the ducts were displaced but remained continuous; The duct in one patients with submandibular gland cancer showed destruction and discontinuity. The ducts of one patient with Sjogren syndrome and one with sialidosis displayed normal. Conclusion: MR sialography with evoked salivation is noninvasive and allows delineation of both normal and abnormal parotid and submandibular gland duct systems, and the images are especially better on STIR sequence

  12. Results of tests under normal and abnormal operating conditions concerning LMFBR fuel element behaviour

    International Nuclear Information System (INIS)

    Languille, A.; Bergeonneau, P.; Essig, C.; Guerin, Y.

    1985-04-01

    The objective of this paper is to improve the knowledge on LMFBR fuel element behaviour during protected and unprotected transients in RAPSODIE and PHENIX reactors in order to evaluate its reliability. The range of the tests performed in these reactors is sufficiently large to cover normal and also extreme off normal conditions such as fuel melting. Results of such tests allow to better establish transient design limits for reactor structural components in particular for fuel pin cladding which play a lead role in controlling the accident sequence. Three main topics are emphasized in this paper: fuel melting during slow over-power excursions; influence of the fuel element geometrical evolution on reactivity feedback effects and reactor dynamic behaviour; clad damage evaluation during a transient (essentially very severe loss of flow)

  13. Normal modes of Bardeen discs

    International Nuclear Information System (INIS)

    Verdaguer, E.

    1983-01-01

    The short wavelength normal modes of self-gravitating rotating polytropic discs in the Bardeen approximation are studied. The discs' oscillations can be seen in terms of two types of modes: the p-modes whose driving forces are pressure forces and the r-modes driven by Coriolis forces. As a consequence of differential rotation coupling between the two takes place and some mixed modes appear, their properties can be studied under the assumption of weak coupling and it is seen that they avoid the crossing of the p- and r-modes. The short wavelength analysis provides a basis for the classification of the modes, which can be made by using the properties of their phase diagrams. The classification is applied to the large wavelength modes of differentially rotating discs with strong coupling and to a uniformly rotating sequence with no coupling, which have been calculated in previous papers. Many of the physical properties and qualitative features of these modes are revealed by the analysis. (author)

  14. Main injector synchronous timing system

    International Nuclear Information System (INIS)

    Blokland, W.; Steimel, J.

    1998-01-01

    The Synchronous Timing System is designed to provide sub-nanosecond timing to instrumentation during the acceleration of particles in the Main Injector. Increased energy of the beam particles leads to a small but significant increase in speed, reducing the time it takes to complete a full turn of the ring by 61 nanoseconds (or more than 3 rf buckets). In contrast, the reference signal, used to trigger instrumentation and transmitted over a cable, has a constant group delay. This difference leads to a phase slip during the ramp and prevents instrumentation such as dampers from properly operating without additional measures. The Synchronous Timing System corrects for this phase slip as well as signal propagation time changes due to temperature variations. A module at the LLRF system uses a 1.2 Gbit/s G-Link chip to transmit the rf clock and digital data (e.g. the current frequency) over a single mode fiber around the ring. Fiber optic couplers at service buildings split off part of this signal for a local module which reconstructs a synchronous beam reference signal. This paper describes the background, design and expected performance of the Synchronous Timing System. copyright 1998 American Institute of Physics

  15. Main injector synchronous timing system

    International Nuclear Information System (INIS)

    Blokland, Willem; Steimel, James

    1998-01-01

    The Synchronous Timing System is designed to provide sub-nanosecond timing to instrumentation during the acceleration of particles in the Main Injector. Increased energy of the beam particles leads to a small but significant increase in speed, reducing the time it takes to complete a full turn of the ring by 61 nanoseconds (or more than 3 rf buckets). In contrast, the reference signal, used to trigger instrumentation and transmitted over a cable, has a constant group delay. This difference leads to a phase slip during the ramp and prevents instrumentation such as dampers from properly operating without additional measures. The Synchronous Timing System corrects for this phase slip as well as signal propagation time changes due to temperature variations. A module at the LLRF system uses a 1.2 Gbit/s G-Link chip to transmit the rf clock and digital data (e.g. the current frequency) over a single mode fiber around the ring. Fiber optic couplers at service buildings split off part of this signal for a local module which reconstructs a synchronous beam reference signal. This paper describes the background, design and expected performance of the Synchronous Timing System

  16. Main technical topics in 1999

    International Nuclear Information System (INIS)

    2000-01-01

    This Safety Authority annual report strives to present current organizational provisions and future trends in nuclear safety supervision in France and to describe the most outstanding occurrences during the past year. A first part presents nine documents concerning the main topics of 1999: aging of nuclear installations, the Offsite Emergency Plans (PPI), the impact of nuclear activities on man and the environment, the criticality hazards, EDF in 1999, the EPR project, the Andra in 1999, the transport incidents, the nuclear safety in eastern Europe. The second part presents the missions and actions of the Nuclear Installations Safety in the domains of the liabilities, the organization of the nuclear safety control, the regulations of the INB, the public information, the international relations, the crisis management, the radioactive materials transportation, the radioactive wastes. The equipment, the radiation protection and the exploitation of the pressurized water reactors are also treated just as the experimental reactors, the fuel cycle installations and the the nuclear installations dismantling. (A.L.B.)

  17. Main challenges of residential areas

    Directory of Open Access Journals (Sweden)

    Oana Luca

    2017-06-01

    Full Text Available The present article is a position paper aiming to initiate a professional debate related to the aspects related to the urban dysfunctions leading to the wear of the residential areas. The paper proposes a definition of the wear process, identify the main causes leading to its occurrence and propose a number of solutions to neutralise the dysfunctions. The three wearing phases of residential areas components are emphasized, exploring their lifecycle. In order to perform the study of urban wear, the status of the residential areas components can be established and monitored, and also the variables of the function that can mathematically model the specific wear process may be considered. The paper is considered a first step for the model adjustment, to be tested and validated in the following steps. Based on the mathematical method and model, there can be created, in a potential future research, the possibility of determining the precarity degree for residential areas/neighbourhoods and cities, by minimising the subjective component of the analyses preceding the decision for renovation or regeneration.

  18. Research in auditing: main themes

    Directory of Open Access Journals (Sweden)

    Marcelo Porte

    Full Text Available ABSTRACT The passage of the Sarbanes-Oxley Act (SOX was a turning point in auditing and in auditors practice for the academic world. Research concerning the characterization of academic production related to auditing is in its third decade. Its analysis is accomplished by means of definition of keywords, abstracts or title, and information on thematic association within the academic production itself in auditing is undisclosed. In order to revise this gap in auditing literature, this study identified the main themes in auditing and their association in post-SOX era by analyzing the content of objectives and hypothesis of 1,650 publications in Web of Science (2002-2014. The findings in this study extended those from the study by Lesage and Wechtler (2012 from 16 auditing thematic typologies to 22. The results demonstrate that the themes audit report & financial statement users, corporate governance, audit market, external audit, socio-economic data of the company, international regulation, and fraud risk & audit risk were the most addressed in the publications about auditing. Corporate governance has a broader association with the other themes in the area. Future researches may use these themes and relate them to the methodologies applied to audit studies.

  19. Evaluation of normalization methods in mammalian microRNA-Seq data

    Science.gov (United States)

    Garmire, Lana Xia; Subramaniam, Shankar

    2012-01-01

    Simple total tag count normalization is inadequate for microRNA sequencing data generated from the next generation sequencing technology. However, so far systematic evaluation of normalization methods on microRNA sequencing data is lacking. We comprehensively evaluate seven commonly used normalization methods including global normalization, Lowess normalization, Trimmed Mean Method (TMM), quantile normalization, scaling normalization, variance stabilization, and invariant method. We assess these methods on two individual experimental data sets with the empirical statistical metrics of mean square error (MSE) and Kolmogorov-Smirnov (K-S) statistic. Additionally, we evaluate the methods with results from quantitative PCR validation. Our results consistently show that Lowess normalization and quantile normalization perform the best, whereas TMM, a method applied to the RNA-Sequencing normalization, performs the worst. The poor performance of TMM normalization is further evidenced by abnormal results from the test of differential expression (DE) of microRNA-Seq data. Comparing with the models used for DE, the choice of normalization method is the primary factor that affects the results of DE. In summary, Lowess normalization and quantile normalization are recommended for normalizing microRNA-Seq data, whereas the TMM method should be used with caution. PMID:22532701

  20. Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

    Science.gov (United States)

    A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.

  1. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  2. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  3. CATEGORIZATION OF EVENT SEQUENCES FOR LICENSE APPLICATION

    Energy Technology Data Exchange (ETDEWEB)

    G.E. Ragan; P. Mecheret; D. Dexheimer

    2005-04-14

    The purposes of this analysis are: (1) Categorize (as Category 1, Category 2, or Beyond Category 2) internal event sequences that may occur before permanent closure of the repository at Yucca Mountain. (2) Categorize external event sequences that may occur before permanent closure of the repository at Yucca Mountain. This includes examining DBGM-1 seismic classifications and upgrading to DBGM-2, if appropriate, to ensure Beyond Category 2 categorization. (3) State the design and operational requirements that are invoked to make the categorization assignments valid. (4) Indicate the amount of material put at risk by Category 1 and Category 2 event sequences. (5) Estimate frequencies of Category 1 event sequences at the maximum capacity and receipt rate of the repository. (6) Distinguish occurrences associated with normal operations from event sequences. It is beyond the scope of the analysis to propose design requirements that may be required to control radiological exposure associated with normal operations. (7) Provide a convenient compilation of the results of the analysis in tabular form. The results of this analysis are used as inputs to the consequence analyses in an iterative design process that is depicted in Figure 1. Categorization of event sequences for permanent retrieval of waste from the repository is beyond the scope of this analysis. Cleanup activities that take place after an event sequence and other responses to abnormal events are also beyond the scope of the analysis.

  4. CATEGORIZATION OF EVENT SEQUENCES FOR LICENSE APPLICATION

    International Nuclear Information System (INIS)

    G.E. Ragan; P. Mecheret; D. Dexheimer

    2005-01-01

    The purposes of this analysis are: (1) Categorize (as Category 1, Category 2, or Beyond Category 2) internal event sequences that may occur before permanent closure of the repository at Yucca Mountain. (2) Categorize external event sequences that may occur before permanent closure of the repository at Yucca Mountain. This includes examining DBGM-1 seismic classifications and upgrading to DBGM-2, if appropriate, to ensure Beyond Category 2 categorization. (3) State the design and operational requirements that are invoked to make the categorization assignments valid. (4) Indicate the amount of material put at risk by Category 1 and Category 2 event sequences. (5) Estimate frequencies of Category 1 event sequences at the maximum capacity and receipt rate of the repository. (6) Distinguish occurrences associated with normal operations from event sequences. It is beyond the scope of the analysis to propose design requirements that may be required to control radiological exposure associated with normal operations. (7) Provide a convenient compilation of the results of the analysis in tabular form. The results of this analysis are used as inputs to the consequence analyses in an iterative design process that is depicted in Figure 1. Categorization of event sequences for permanent retrieval of waste from the repository is beyond the scope of this analysis. Cleanup activities that take place after an event sequence and other responses to abnormal events are also beyond the scope of the analysis

  5. Theory of normal metals

    International Nuclear Information System (INIS)

    Mahan, G.D.

    1992-01-01

    The organizers requested that I give eight lectures on the theory of normal metals, ''with an eye on superconductivity.'' My job was to cover the general properties of metals. The topics were selected according to what the students would need to known for the following lectures on superconductivity. My role was to prepare the ground work for the later lectures. The problem is that there is not yet a widely accepted theory for the mechanism which pairs the electrons. Many mechanisms have been proposed, with those of phonons and spin fluctuations having the most followers. So I tried to discuss both topics. I also introduced the tight-binding model for metals, which forms the basis for most of the work on the cuprate superconductors

  6. Multilocus sequence typing and rtxA toxin gene sequencing analysis of Kingella kingae isolates demonstrates genetic diversity and international clones.

    Directory of Open Access Journals (Sweden)

    Romain Basmaci

    Full Text Available BACKGROUND: Kingella kingae, a normal component of the upper respiratory flora, is being increasingly recognized as an important invasive pathogen in young children. Genetic diversity of this species has not been studied. METHODS: We analyzed 103 strains from different countries and clinical origins by a new multilocus sequence-typing (MLST schema. Putative virulence gene rtxA, encoding an RTX toxin, was also sequenced, and experimental virulence of representative strains was assessed in a juvenile-rat model. RESULTS: Thirty-six sequence-types (ST and nine ST-complexes (STc were detected. The main STc 6, 14 and 23 comprised 23, 17 and 20 strains respectively, and were internationally distributed. rtxA sequencing results were mostly congruent with MLST, and showed horizontal transfer events. Of interest, all members of the distantly related ST-6 (n = 22 and ST-5 (n = 4 harboured a 33 bp duplication or triplication in their rtxA sequence, suggesting that this genetic trait arose through selective advantage. The animal model revealed significant differences in virulence among strains of the species. CONCLUSION: MLST analysis reveals international spread of ST-complexes and will help to decipher acquisition and evolution of virulence traits and diversity of pathogenicity among K. kingae strains, for which an experimental animal model is now available.

  7. Long sequence correlation coprocessor

    Science.gov (United States)

    Gage, Douglas W.

    1994-09-01

    A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.

  8. Roles of repetitive sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  9. Anomaly Detection in Sequences

    Data.gov (United States)

    National Aeronautics and Space Administration — We present a set of novel algorithms which we call sequenceMiner, that detect and characterize anomalies in large sets of high-dimensional symbol sequences that...

  10. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  11. sequenceMiner algorithm

    Data.gov (United States)

    National Aeronautics and Space Administration — Detecting and describing anomalies in large repositories of discrete symbol sequences. sequenceMiner has been open-sourced! Download the file below to try it out....

  12. Gnomoniopsis castanea is the main agent of chestnut nut rot in Switzerland

    Directory of Open Access Journals (Sweden)

    Francesca G. DENNERT

    2015-09-01

    Full Text Available Nuts of sweet chestnut have been an important food source for the alpine population in Switzerland since the Middle Ages and are still valued today for the preparation of traditional food commodities. Nut quality is reduced by insect damage and by various pathogenic fungi. In the last few years, producers and consumers perceived an increase of brown nut rot; while the nut rot agent Gnomoniopsis castanea was reported locally in southern Switzerland, its presence has not been investigated over large areas until now. This study assessed the incidence of brown nut rot and identified the causal agent present in Switzerland. Fully ripened nuts were collected from the main sweet chestnut growing areas of Switzerland. A filamentous fungus morphologically identified as G. castanea was isolated from 10 to 91% of the sampled nuts, despite only 3 to 21% of the sampled nuts showing brown rot symptoms. This fungus was isolated from symptomatic chestnuts as well as from apparently healthy chestnuts. Our results suggest a possible endophytic lifestyle in ripened nuts as well as in branches, leaves and unripe nuts as previously found. Species identity of 45 isolates was confirmed by EF-1alpha, beta-tubulin and ITS sequencing. Concatenation of β-tubulin and calmodulin sequences showed that several haplotypes were present at each sampling locality. No other nut rot pathogens could be isolated in this study, suggesting that G. castanea is the main causal agent of nut rot in Switzerland. The presence of this species is reported for the first time in a site in northern Switzerland. Further studies are needed to assess the influence of meteorological conditions and chestnut varieties on the incidence of G. castanea in order to provide prevention strategies for chestnut growers. Normal 0 21 false false false FR-CH X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso

  13. Clinical evaluation of further-developed MRCP sequences in comparison with standard MRCP sequences

    International Nuclear Information System (INIS)

    Hundt, W.; Scheidler, J.; Reiser, M.; Petsch, R.

    2002-01-01

    The purpose of this study was the comparison of technically improved single-shot magnetic resonance cholangiopancreatography (MRCP) sequences with standard single-shot rapid acquisition with relaxation enhancement (RARE) and half-Fourier acquired single-shot turbo spin-echo (HASTE) sequences in evaluating the normal and abnormal biliary duct system. The bile duct system of 45 patients was prospectively investigated on a 1.5-T MRI system. The investigation was performed with RARE and HASTE MR cholangiography sequences with standard and high spatial resolutions, and with a delayed-echo half-Fourier RARE (HASTE) sequence. Findings of the improved MRCP sequences were compared with the standard MRCP sequences. The level of confidence in assessing the diagnosis was divided into five groups. The Wilcoxon signed-rank test at a level of p<0.05 was applied. In 15 patients no pathology was found. The MRCP showed stenoses of the bile duct system in 10 patients and choledocholithiasis and cholecystolithiasis in 16 patients. In 12 patients a dilatation of the bile duct system was found. Comparison of the low- and high spatial resolution sequences and the short and long TE times of the half-Fourier RARE (HASTE) sequence revealed no statistically significant differences regarding accuracy of the examination. The diagnostic confidence level in assessing normal or pathological findings for the high-resolution RARE and half-Fourier RARE (HASTE) was significantly better than for the standard sequences. For the delayed-echo half-Fourier RARE (HASTE) sequence no statistically significant difference was seen. The high-resolution RARE and half-Fourier RARE (HASTE) sequences had a higher confidence level, but there was no significant difference in diagnosis in terms of detection and assessment of pathological changes in the biliary duct system compared with standard sequences. (orig.)

  14. Effectiveness of Ninth-Grade Physics in Maine: Conceptual Understanding

    OpenAIRE

    O'Brien, Michael; Thompson, John

    2009-01-01

    The Physics First movement - teaching a true physics course to ninth grade students - is gaining popularity in high schools. There are several different rhetorical arguments for and against this movement, and it is quite controversial in physics education. However, there is no actual evidence to assess the success, or failure, of this substantial shift in the science teaching sequence. We have undertaken a comparison study of physics classes taught in ninth- and 12th grade classes in Maine. C...

  15. [Surgical angioplasty of the left main coronary artery].

    Science.gov (United States)

    Vranes, Mile; Velinović, Milos; Kocica, Mladen; Mikić, Aleksandar; Velimirović, Dusan; Djukić, Petar

    2010-01-01

    The conventional treatment for isolated stenosis of the left main coronary artery is bypass surgery (myocardial revascularization). However, the process of atherosclerosis is not arrested by myocardial revascularization and it will lead to the occlusion of the left main coronary artery. Revascularization will establish retrograde perfusion for 50-70% of the myocardium of the left ventricle. Direct surgical angioplasty of the left main coronary artery enables normal physiological perfusion of the whole myocardium and better myocardial function. The aim of our study is to point out a new surgical approach of treating left main coronary artery stenosis. Between October 2002 and October 2003, direct surgical angioplasty of the main left coronary artery was performed on three patients with isolated stenosis of the left main coronary artery using the anterior approach and the pericardium as a patch. The procedure was performed under total endotracheal anaesthesia and standard cardiopulmonary circulation, moderate hypothermia, anterograde St. Tomas cardioplegia and local cooling. Patients were followed clinically, echocardiographically and by load-tests. All three patients were without complications. In postoperative follow-up (54-68 months) neither angina pectoris nor electrocardiographically registered ischaemic changes were found. Load-tests performed every six months on all three patients were negative. Surgical angioplasty of isolated stenosis of the left main coronary artery is a preferred method for treating this type of coronary disease. Contraindications for this type of treatment are stenosis of the left main coronary artery with bifurcation and advanced calcification of the left main coronary artery.

  16. Comparison of next generation sequencing technologies for transcriptome characterization

    Directory of Open Access Journals (Sweden)

    Soltis Douglas E

    2009-08-01

    Full Text Available Abstract Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19. We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica and the magnoliid avocado (Persea americana using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB, 119,518 (88.7% mapped exactly to known exons, while 1,117 (0.8% mapped to introns, 11,524 (8.6% spanned annotated intron/exon boundaries, and 3,066 (2.3% extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance

  17. Role of the normal gut microbiota.

    Science.gov (United States)

    Jandhyala, Sai Manasa; Talukdar, Rupjyoti; Subramanyam, Chivkula; Vuyyuru, Harish; Sasikala, Mitnala; Nageshwar Reddy, D

    2015-08-07

    Relation between the gut microbiota and human health is being increasingly recognised. It is now well established that a healthy gut flora is largely responsible for overall health of the host. The normal human gut microbiota comprises of two major phyla, namely Bacteroidetes and Firmicutes. Though the gut microbiota in an infant appears haphazard, it starts resembling the adult flora by the age of 3 years. Nevertheless, there exist temporal and spatial variations in the microbial distribution from esophagus to the rectum all along the individual's life span. Developments in genome sequencing technologies and bioinformatics have now enabled scientists to study these microorganisms and their function and microbe-host interactions in an elaborate manner both in health and disease. The normal gut microbiota imparts specific function in host nutrient metabolism, xenobiotic and drug metabolism, maintenance of structural integrity of the gut mucosal barrier, immunomodulation, and protection against pathogens. Several factors play a role in shaping the normal gut microbiota. They include (1) the mode of delivery (vaginal or caesarean); (2) diet during infancy (breast milk or formula feeds) and adulthood (vegan based or meat based); and (3) use of antibiotics or antibiotic like molecules that are derived from the environment or the gut commensal community. A major concern of antibiotic use is the long-term alteration of the normal healthy gut microbiota and horizontal transfer of resistance genes that could result in reservoir of organisms with a multidrug resistant gene pool.

  18. Tinkering at the main-ring lattice

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuma, S.

    1982-08-23

    To improve production of usable antiprotons using the proton beam from the main ring and the lossless injection of cooled antiprotons into the main ring, modifications of the main ring lattice are recommended.

  19. Generalized locally Toeplitz sequences theory and applications

    CERN Document Server

    Garoni, Carlo

    2017-01-01

    Based on their research experience, the authors propose a reference textbook in two volumes on the theory of generalized locally Toeplitz sequences and their applications. This first volume focuses on the univariate version of the theory and the related applications in the unidimensional setting, while the second volume, which addresses the multivariate case, is mainly devoted to concrete PDE applications. This book systematically develops the theory of generalized locally Toeplitz (GLT) sequences and presents some of its main applications, with a particular focus on the numerical discretization of differential equations (DEs). It is the first book to address the relatively new field of GLT sequences, which occur in numerous scientific applications and are especially dominant in the context of DE discretizations. Written for applied mathematicians, engineers, physicists, and scientists who (perhaps unknowingly) encounter GLT sequences in their research, it is also of interest to those working in the fields of...

  20. Bending-Twisting Motions and Main Interactions in Nucleoplasmin Nuclear Import.

    Directory of Open Access Journals (Sweden)

    Marcos Tadeu Geraldo

    Full Text Available Alpha solenoid proteins play a key role in regulating the classical nuclear import pathway, recognizing a target protein and transporting it into the nucleus. Importin-α (Impα is the solenoid responsible for cargo protein recognition, and it has been extensively studied by X-ray crystallography to understand the binding specificity. To comprehend the main motions of Impα and to extend the information about the critical interactions during carrier-cargo recognition, we surveyed different conformational states based on molecular dynamics (MD and normal mode (NM analyses. Our model of study was a crystallographic structure of Impα complexed with the classical nuclear localization sequence (cNLS from nucleoplasmin (Npl, which was submitted to multiple 100 ns of MD simulations. Representative conformations were selected for calculating the 87 lowest frequencies NMs of vibration, and a displacement approach was applied along each NM. Based on geometric criteria, using the radius of curvature and inter-repeat angles as the reference metrics, the main motions of Impα were described. Moreover, we determined the salt bridges, hydrogen bonds and hydrophobic interactions in the Impα-NplNLS interface. Our results show the bending and twisting motions participating in the recognition of nuclear proteins, allowing the accommodation and adjustment of a classical bipartite NLS sequence. The essential contacts for the nuclear import were also described and were mostly in agreement with previous studies, suggesting that the residues in the cNLS linker region establish important contacts with Impα adjusting the cNLS backbone. The MD simulations combined with NM analysis can be applied to the Impα-NLS system to help understand interactions between Impα and cNLSs and the analysis of non-classic NLSs.

  1. Normal ordering problem and the extensions of the Stirling grammar

    Science.gov (United States)

    Ma, S.-M.; Mansour, T.; Schork, M.

    2014-04-01

    The purpose of this paper is to investigate the connection between context-free grammars and normal ordered problem, and then to explore various extensions of the Stirling grammar. We present grammatical characterizations of several well known combinatorial sequences, including the generalized Stirling numbers of the second kind related to the normal ordered problem and the r-Dowling polynomials. Also, possible avenues for future research are described.

  2. Short proofs of strong normalization

    OpenAIRE

    Wojdyga, Aleksander

    2008-01-01

    This paper presents simple, syntactic strong normalization proofs for the simply-typed lambda-calculus and the polymorphic lambda-calculus (system F) with the full set of logical connectives, and all the permutative reductions. The normalization proofs use translations of terms and types to systems, for which strong normalization property is known.

  3. Enhanced Dynamic Algorithm of Genome Sequence Alignments

    OpenAIRE

    Arabi E. keshk

    2014-01-01

    The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

  4. Comparison of aftershock sequences between 1975 Haicheng earthquake and 1976 Tangshan earthquake

    Science.gov (United States)

    Liu, B.

    2017-12-01

    The 1975 ML 7.3 Haicheng earthquake and the 1976 ML 7.8 Tangshan earthquake occurred in the same tectonic unit. There are significant differences in spatial-temporal distribution, number of aftershocks and time duration for the aftershock sequence followed by these two main shocks. As we all know, aftershocks could be triggered by the regional seismicity change derived from the main shock, which was caused by the Coulomb stress perturbation. Based on the rate- and state- dependent friction law, we quantitative estimated the possible aftershock time duration with a combination of seismicity data, and compared the results from different approaches. The results indicate that, aftershock time durations from the Tangshan main shock is several times of that form the Haicheng main shock. This can be explained by the significant relationship between aftershock time duration and earthquake nucleation history, normal stressand shear stress loading rateon the fault. In fact the obvious difference of earthquake nucleation history from these two main shocks is the foreshocks. 1975 Haicheng earthquake has clear and long foreshocks, while 1976 Tangshan earthquake did not have clear foreshocks. In that case, abundant foreshocks may mean a long and active nucleation process that may have changed (weakened) the rocks in the source regions, so they should have a shorter aftershock sequences for the reason that stress in weak rocks decay faster.

  5. Size of corpus callosum in normal subjects and patients with Alzheimer's disease

    International Nuclear Information System (INIS)

    Yoshii, Fumihito; Duara, R.

    1989-01-01

    The area of the corpus callosum (CC) on midsagittal spin-echo sequence magnetic resonance (MR) scans was measured in 64 normal subjects and 12 patients with Alzheimer's disease (AD). The normal subjects consisted of 32 males and 32 females, aged 25 to 83 years old. There was no significant age difference between males and females. Fifty-five out of the 64 subjects were right-handed (RH) and 9 were left-handed or ambidextrous (NRH). Among patients with AD, 5 were males and 7 were females, aged 53 to 79 years old. Diagnosis of AD was performed mainly based on clinical history, magnetic resonance image (MRI) and positron emission tomographic findings. The outline of the CC on midsagittal MR film was traced and the total callosal sectional area (CCT) as well as the anterior half (CCA), posterior half (CCP) and posterior 5th or splenium (CCS) area measurements were performed using a planimeter. In either normal males or females, the CCA showed a significant negative correlation with age, but the CCP and the CCS did not correlate with age. Total CC (CCT) area was 691.2±91.0 sq. mm for the whole group and no difference was found between males and females. When the CC area was normalized with respect to the midsagittal area of the supratentorial portion of the brain (MSB), females were found to have a large CC than males. No portion of the CC area was significantly different between RH and NRH subjects in absolute or normalized measures. Compared with 36 age-matched normals, patients with AD had smaller MSB and each portion of the CC, with significant reduction in the CCA and the CCT. In conclusion, relationships between age, sex and the size of the CC have been found, providing some insights into the connectivity of the human brain. Characteristics of white matter loss in AD were also clarified in this study. (author)

  6. The Semiparametric Normal Variance-Mean Mixture Model

    DEFF Research Database (Denmark)

    Korsholm, Lars

    1997-01-01

    We discuss the normal vairance-mean mixture model from a semi-parametric point of view, i.e. we let the mixing distribution belong to a non parametric family. The main results are consistency of the non parametric maximum likelihood estimat or in this case, and construction of an asymptotically...... normal and efficient estimator....

  7. What Drives Embryo Development? Chromosomal Normality or Mitochondria?

    Directory of Open Access Journals (Sweden)

    A. Bayram

    2017-01-01

    Full Text Available Objective. To report the arrest of euploid embryos with high mtDNA content. Design. A report of 2 cases. Setting. Private fertility clinic. Patients. 2 patients, 45 and 40 years old undergoing IVF treatment. Interventions. Mature oocytes were collected and vitrified from two ovarian stimulations. Postthaw, survived mature oocytes underwent fertilization by intracytoplasmic sperm injection (ICSI. Preimplantation genetic screening (PGS and mitochondrial DNA (mtDNA copy number were done using next generation sequencing (NGS. The only normal embryo among the all-biopsied embryos had the highest “Mitoscore” value and was the only arrested embryo in both cases. Therefore, the embryo transfer was cancelled. Main Outcome Measures. Postthaw survival and fertilization rate, embryo euploidy, mtDNA copy number, and embryo development. Results. In both patients, after PGS only 1 embryo was euploid. Both embryos had the highest mtDNA copy number from all tested embryos and both embryos were arrested on further development. Conclusions. These cases clearly demonstrate the lack of correlation between mtDNA value (Mitoscore and chromosomal status of embryo.

  8. Stars of type MS with evidence of white dwarf companions. [IUE, Main Sequence (MS)

    Science.gov (United States)

    Peery, Benjamin F., Jr.

    1986-01-01

    A search for white dwarf companions of MS-type stars was conducted, using IUE. The overendowments of these stars in typical S-process nuclides suggest that they, like the Ba II stars, may owe their peculiar compositions to earlier mass transfer. Short-wavelength IUE spectra show striking emission line variability in HD35155, HD61913, and 4 Ori; HD35155 and 4 Ori show evidence of white dwarf companions.

  9. Some aspects of cool main sequence star ages derived from stellar rotation (gyrochronology)

    Science.gov (United States)

    Barnes, S. A.; Spada, F.; Weingrill, J.

    2016-09-01

    Rotation periods for cool stars can be measured with good precision by monitoring starspot light modulation. Observations have shown that the rotation periods of dwarf stars of roughly solar metallicity have such systematic dependencies on stellar age and mass that they can be used to derive reliable ages, a procedure called gyrochronology. We review the method and show illustrative cases, including recent ground- and space-based data. The age uncertainties approach 10 % in the best cases, making them a valuable complement to, and constraint on, asteroseismic or other ages. Edited, updated, and refereed version of a presentation at the WE-Heraeus-Seminar in Bad Honnef, Germany: Reconstructing the Milky Way's History: Spectroscopic Surveys, Asteroseismology and Chemodynamical Models

  10. THE DUSTIEST POST-MAIN SEQUENCE STARS IN THE MAGELLANIC CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Olivia C.; Meixner, Margaret; Roman-Duval, Julia [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Sargent, Benjamin A. [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States); Boyer, Martha L. [Observational Cosmology Lab, Code 665, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Sewiło, Marta [The Johns Hopkins University, Department of Physics and Astronomy, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Hony, Sacha [Institut für Theoretische Astrophysik, Zentrum für Astronomie, Universitt Heidelberg, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany)

    2015-10-01

    Using observations from the Herschel Inventory of The Agents of Galaxy Evolution (HERITAGE) survey of the Magellanic Clouds (MC), we have found 35 evolved stars and stellar end products that are bright in the far-infrared. These 28 (LMC) and 7 (SMC) sources were selected from the 529 evolved star candidates in the HERITAGE far-infrared point source catalogs. Our source identification method is based on spectral confirmation, spectral energy distribution characteristics, careful examination of the multiwavelength images and includes constraints on the luminosity, resulting in a thoroughly vetted list of evolved stars. These sources span a wide range in luminosity and hence initial mass. We found 13 low- to intermediate-mass evolved stars, including asymptotic giant branch (AGB) stars, post-AGB stars, planetary nebulae, and a symbiotic star. We also identify 10 high mass stars, including 4 of the 15 known B[e] stars in the MC, 3 extreme red supergiants that are highly enshrouded by dust, a Luminous Blue Variable, a Wolf–Rayet star, and two supernova remnants. Further, we report the detection of 9 probable evolved objects which were previously undescribed in the literature. These sources are likely to be among the dustiest evolved objects in the MC. The Herschel emission may either be due to dust produced by the evolved star or it may arise from swept-up interstellar medium material.

  11. Prospects for detecting decreasing exoplanet frequency with main-sequence age using PLATO

    Science.gov (United States)

    Veras, D.; Brown, D. J. A.; Mustill, A. J.; Pollacco, D.

    2017-09-01

    The space mission PLATO will usher in a new era of exoplanetary science by expanding our current inventory of transiting systems and constraining host star ages, which are currently highly uncertain. This capability might allow PLATO to detect changes in planetary system architecture with time, particularly because planetary scattering due to Lagrange instability may be triggered long after the system was formed. Here, we utilize previously published instability time-scale prescriptions to determine PLATO's capability to detect a trend of decreasing planet frequency with age for systems with equal- mass planets. For two-planet systems, our results demonstrate that PLATO may detect a trend for planet masses which are at least as massive as super-Earths. For systems with three or more planets, we link their initial compactness to potentially detectable frequency trends in order to aid future investigations when these populations will be better characterized.

  12. Important consequences of atomic diffusion inside main-sequence stars: opacities, extra-mixing, oscillations

    Directory of Open Access Journals (Sweden)

    Deal M.

    2017-01-01

    Full Text Available Atomic diffusion, including the effects of radiative accelerations on individual elements, leads to important variations of the chemical composition inside stars. The accumulation of important elements in specific layers leads to a local increase of the average opacity and to hydrodynamic instabilities that modify the internal stellar structure. This can also have important consequences for asteroseismology.

  13. Intrinsic width and luminosity function of the M92 main sequence

    International Nuclear Information System (INIS)

    Sandage, A.; Katem, B.

    1983-01-01

    Measurements of B and V magnitudes of approx.475 identified stars in the magnitude interval 18.0 - 4 is too low. The luminosity function, obtained from the present data, is compared with that determined earlier by Tayler, by Hartwick, by van den Bergh, and with Fukuoka and Simoda, with good agreement. The evidence favors that phi(M/sub v/) flattens fainter than M/sub v/approx. =+6 as predicted in some dynamical models, due to loss of low mass stars

  14. Theory and evidence of global Rossby waves in upper main-sequence stars

    DEFF Research Database (Denmark)

    Saio, Hideyuki; Kurtz, Donald W.; Murphy, Simon J.

    2018-01-01

    in the observational frame by considering the visibility of these modes. We find that the frequencies of r modes of azimuthal order m appear as groups at slightly lower frequency than m times the rotation frequency. Comparing the visibility curves for r modes with Fourier amplitude spectra of Kepler light curves...

  15. Oscillation mode frequencies of 61 main-sequence and subgiant stars observed by Kepler

    DEFF Research Database (Denmark)

    Appourchaux, T.; Chaplin, W. J.; García, R. A.

    2012-01-01

    Solar-like oscillations have been observed by Kepler and CoRoT in several solar-type stars, thereby providing a way to probe the stars using asteroseismology Aims. We provide the mode frequencies of the oscillations of various stars required to perform a comparison with those obtained from stella...

  16. VizieR Online Data Catalog: Pisa pre-main sequence tracks and isochrones (Tognelli+, 2011)

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-07-01

    Evolutionary tracks and Isochrones in the log L vs log Te plane, for the following chemical compositions: Z Y Y Y 2.00E-04 0.230 0.249 0.250 1.00E-03 0.232 0.251 0.254 2.00E-03 0.234 0.253 0.259 3.00E-03 0.236 0.254 0.263 4.00E-03 0.238 0.256 0.269 5.00E-03 0.240 0.258 0.273 6.00E-03 0.242 0.260 0.279 7.00E-03 0.244 0.262 0.283 8.00E-03 0.246 0.265 0.289 9.00E-03 0.248 0.267 0.294 1.00E-02 0.250 0.268 0.299 1.25E-02 0.255 0.274 0.311 1.50E-02 0.260 0.278 0.323 1.75E-02 0.265 0.284 0.336 2.00E-02 0.270 0.288 0.349 2.25E-02 0.275 0.294 0.361 2.50E-02 0.280 0.299 0.374 2.75E-02 0.285 0.304 0.386 3.00E-02 0.290 0.308 0.398 Each model is calculated with an initial Deuterium abundance XD=4.0E-05. For Z>=0.008, models with XD=2.0E-05 are available, too. Each model is calculated with three different values of the mixing length parameter alpha = 1.20, 1.68 (solar calibrated), 1.90. There is also a dataset for our Standard Solar Model parameters (Z=0.01377, Y=0.2533, alpha=1.68, XD=2.0E-05). (5 data files).

  17. Extreme value statistics for two-dimensional convective penetration in a pre-main sequence star

    Science.gov (United States)

    Pratt, J.; Baraffe, I.; Goffrey, T.; Constantino, T.; Viallet, M.; Popov, M. V.; Walder, R.; Folini, D.

    2017-08-01

    Context. In the interior of stars, a convectively unstable zone typically borders a zone that is stable to convection. Convective motions can penetrate the boundary between these zones, creating a layer characterized by intermittent convective mixing, and gradual erosion of the density and temperature stratification. Aims: We examine a penetration layer formed between a central radiative zone and a large convection zone in the deep interior of a young low-mass star. Using the Multidimensional Stellar Implicit Code (MUSIC) to simulate two-dimensional compressible stellar convection in a spherical geometry over long times, we produce statistics that characterize the extent and impact of convective penetration in this layer. Methods: We apply extreme value theory to the maximal extent of convective penetration at any time. We compare statistical results from simulations which treat non-local convection, throughout a large portion of the stellar radius, with simulations designed to treat local convection in a small region surrounding the penetration layer. For each of these situations, we compare simulations of different resolution, which have different velocity magnitudes. We also compare statistical results between simulations that radiate energy at a constant rate to those that allow energy to radiate from the stellar surface according to the local surface temperature. Results: Based on the frequency and depth of penetrating convective structures, we observe two distinct layers that form between the convection zone and the stable radiative zone. We show that the probability density function of the maximal depth of convective penetration at any time corresponds closely in space with the radial position where internal waves are excited. We find that the maximal penetration depth can be modeled by a Weibull distribution with a small shape parameter. Using these results, and building on established scalings for diffusion enhanced by large-scale convective motions, we propose a new form for the diffusion coefficient that may be used for one-dimensional stellar evolution calculations in the large Péclet number regime. These results should contribute to the 321D link.

  18. YSOVAR: Six Pre-main-sequence Eclipsing Binaries in the Orion Nebula Cluster

    Science.gov (United States)

    2012-06-25

    ISOY J053446.01−044922.1i V1448 Ori 17.43c 15.61c 13.88 13.26 12.95 12.73 12.66 12.91 . . . K5c 0.5424125 ISOY J053605.95−050041.2i 2MASS J05360595...identified 12 EB candidates. Four of them, 2MASS 05352184−0546085 (Stassun et al. 2006), V1174 Ori (Stassun et al. 2004), Par1802 (Cargile et al. 2008...Zero points for the photometry were established by reference to data for non-variable stars in our FOV from the Two Micron All Sky Survey ( 2MASS

  19. VizieR Online Data Catalog: Habitable zones around main-sequence stars (Kopparapu+, 2014)

    Science.gov (United States)

    Kopparapu, R. K.; Ramirez, R. M.; Schottelkotte, J.; Kasting, J. F.; Domagal-Goldman, S.; Eymet, V.

    2017-08-01

    Language: Fortran 90 Code tested under the following compilers/operating systems: ifort/CentOS linux Description of input data: No input necessary. Description of output data: Output files: HZs.dat, HZ_coefficients.dat System requirements: No major system requirement. Fortran compiler necessary. Calls to external routines: None. Additional comments: None (1 data file).

  20. Carbon Monoxide and the Potential for Prebiotic Chemistry on Habitable Planets Around Main Sequence M Stars

    Science.gov (United States)

    Nava-Sedeno, J. Manik; Ortiz-Cervantes, Adrian; Segura, Antigona; Domagal-Goldman, Shawn D.

    2016-01-01

    Lifeless planets with CO2 atmospheres produce CO by CO2 photolysis. On planets around M dwarfs, CO is a long-lived atmospheric compound, as long as UV emission due to the stars chromospheric activity lasts, and the sink of CO and O2 in seawater is small compared to its atmospheric production. Atmospheres containing reduced compounds, like CO, may undergo further energetic and chemical processing to give rise to organic compounds of potential importance for the origin of life. We calculated the yield of organic compounds from CO2-rich atmospheres of planets orbiting M dwarf stars, which were previously simulated by Domagal- Goldman et al. (2014) and Harman et al. (2015), by cosmic rays and lightning using results of experiments by Miyakawaet al. (2002) and Schlesinger and Miller (1983a, 1983b). Stellar protons from active stars may be important energy sources for abiotic synthesis and increase production rates of biological compounds by at least 2 orders of magnitude compared to cosmic rays. Simple compounds such as HCN and H2CO are more readily synthesized than more complex ones, such as amino acids and uracil (considered here as an example), resulting in higher yields for the former and lower yields for the latter. Electric discharges are most efficient when a reducing atmosphere is present. Nonetheless, atmospheres with high quantities of CO2 are capable of producing higher amounts of prebiotic compounds, given that CO is constantly produced in the atmosphere. Our results further support planetary systems around M dwarf stars as candidates for supporting life or its origin.

  1. Relative stellar occurrence of exoplanets in habitable zones of the main sequence F, G, K stars

    Czech Academy of Sciences Publication Activity Database

    Pintr, Pavel; Peřinová, V.; Lukš, A.; Pathak, A.

    2014-01-01

    Roč. 99, sept2014 (2014), s. 1-6 ISSN 0032-0633 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0079 Institutional support: RVO:61389021 Keywords : Exoplanets * Methods: statistical * Stars: planetary systems Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 1.875, year: 2014 http://www.sciencedirect.com/science/article/pii/S003206331400172X#

  2. Apparent Brecciation Gradient, Mount Desert Island, Maine

    Science.gov (United States)

    Hawkins, A. T.; Johnson, S. E.

    2004-05-01

    Mount Desert Island, Maine, comprises a shallow level, Siluro-Devonian igneous complex surrounded by a distinctive breccia zone ("shatter zone" of Gilman and Chapman, 1988). The zone is very well exposed on the southern and eastern shores of the island and provides a unique opportunity to examine subvolcanic processes. The breccia of the Shatter Zone shows wide variation in percent matrix and clast, and may represent a spatial and temporal gradient in breccia formation due to a single eruptive or other catastrophic volcanic event. The shatter zone was divided into five developmental stages based on the extent of brecciation: Bar Harbor Formation, Sols Cliffs breccia, Seeley Road breccia, Dubois breccia, and Great Head breccia. A digital camera was employed to capture scale images of representative outcrops using a 0.5 m square Plexiglas frame. Individual images were joined in Adobe Photoshop to create a composite image of each outcrop. The composite photo was then exported to Adobe Illustrator, which was used to outline the clasts and produce a digital map of the outcrop for analysis. The fractal dimension (Fd) of each clast was calculated using NIH Image and a Euclidean distance mapping method described by Bérubé and Jébrak (1999) to quantify the morphology of the fragments, or the complexity of the outline. The more complex the fragment outline, the higher the fractal dimension, indicating that the fragment is less "mature" or has had less exposure to erosional processes, such as the injection of an igneous matrix. Sols Cliffs breccia has an average Fd of 1.125, whereas Great Head breccia has an average Fd of 1.040, with the stages between having intermediate values. The more complex clasts of the Sols Cliffs breccia with a small amount (26.38%) of matrix material suggests that it is the first stage in a sequence of brecciation ending at the more mature, matrix-supported (71.37%) breccia of Great Head. The results of this study will be used to guide isotopic

  3. 75 FR 27863 - Savings Bank of Maine, MHC and Savings Bank of Maine, Gardiner, Maine; Approval of Conversion...

    Science.gov (United States)

    2010-05-18

    ... DEPARTMENT OF THE TREASURY Office of Thrift Supervision [AC-38: OTS Nos. 06947 and H 4709] Savings Bank of Maine, MHC and Savings Bank of Maine, Gardiner, Maine; Approval of Conversion Application Notice is hereby given that on May 7, 2010, the Office of Thrift Supervision approved the application of...

  4. Sequences for Student Investigation

    Science.gov (United States)

    Barton, Jeffrey; Feil, David; Lartigue, David; Mullins, Bernadette

    2004-01-01

    We describe two classes of sequences that give rise to accessible problems for undergraduate research. These problems may be understood with virtually no prerequisites and are well suited for computer-aided investigation. The first sequence is a variation of one introduced by Stephen Wolfram in connection with his study of cellular automata. The…

  5. Quasi-periodic latitudinal shift of Saturn's main auroral emission

    Science.gov (United States)

    Roussos, E.; Palmaerts, B.; Grodent, D. C.; Radioti, K.; Krupp, N.; Yao, Z.

    2017-12-01

    The main component of the ultraviolet auroral emissions at Saturn consists in a ring of emission around each pole of the planet. This main ring of emission has been revealed to oscillate by a few degrees in the prenoon-premidnight direction with a period of 10.8h. This auroral oscillation is thought to be induced by a rotating external magnetospheric current system associated with the planetary period oscillations. Here we report, by means of auroral imaging sequences obtained with the Ultraviolet Imaging Spectrograph (UVIS) on board the Cassini spacecraft, the first direct observation of an additional motion of the main emission superimposed to this oscillation. The whole main emission ring exhibits step-like displacements in latitude mainly towards dayside, decoupled from the 10.8h oscillation. These latitude shifts recur around every hour, which is a typical short periodicity at Saturn previously identified in the aurora intensity, in the charged particle fluxes and in the magnetic field. This unique observation directly demonstrates what has been inferred from past in-situ and remote measurements: the 1-hour periodicities reveal a global and fundamental magnetospheric oscillation mode that acts independently of the local magnetospheric conditions. However, the magnetospheric mechanism responsible for these 1-hour auroral shifts is still unknown. It is possible that Alfvén waves inducing hourly magnetic fluctuations might also modify the place where the field-aligned electrons precipitate in the ionosphere and produce the main emission.

  6. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  7. Bicervical normal uterus with normal vagina | Okeke | Annals of ...

    African Journals Online (AJOL)

    To the best of our knowledge, only few cases of bicervical normal uterus with normal vagina exist in the literature; one of the cases had an anterior‑posterior disposition. This form of uterine abnormality is not explicable by the existing classical theory of mullerian anomalies and suggests that a complex interplay of events ...

  8. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities

    Directory of Open Access Journals (Sweden)

    Baldwin Stephen A

    2011-03-01

    Full Text Available Abstract Background Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. Results The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. Conclusions PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

  9. PIMS sequencing extension: a laboratory information management system for DNA sequencing facilities.

    Science.gov (United States)

    Troshin, Peter V; Postis, Vincent Lg; Ashworth, Denise; Baldwin, Stephen A; McPherson, Michael J; Barton, Geoffrey J

    2011-03-07

    Facilities that provide a service for DNA sequencing typically support large numbers of users and experiment types. The cost of services is often reduced by the use of liquid handling robots but the efficiency of such facilities is hampered because the software for such robots does not usually integrate well with the systems that run the sequencing machines. Accordingly, there is a need for software systems capable of integrating different robotic systems and managing sample information for DNA sequencing services. In this paper, we describe an extension to the Protein Information Management System (PIMS) that is designed for DNA sequencing facilities. The new version of PIMS has a user-friendly web interface and integrates all aspects of the sequencing process, including sample submission, handling and tracking, together with capture and management of the data. The PIMS sequencing extension has been in production since July 2009 at the University of Leeds DNA Sequencing Facility. It has completely replaced manual data handling and simplified the tasks of data management and user communication. Samples from 45 groups have been processed with an average throughput of 10000 samples per month. The current version of the PIMS sequencing extension works with Applied Biosystems 3130XL 96-well plate sequencer and MWG 4204 or Aviso Theonyx liquid handling robots, but is readily adaptable for use with other combinations of robots. PIMS has been extended to provide a user-friendly and integrated data management solution for DNA sequencing facilities that is accessed through a normal web browser and allows simultaneous access by multiple users as well as facility managers. The system integrates sequencing and liquid handling robots, manages the data flow, and provides remote access to the sequencing results. The software is freely available, for academic users, from http://www.pims-lims.org/.

  10. Glymphatic MRI in idiopathic normal pressure hydrocephalus.

    Science.gov (United States)

    Ringstad, Geir; Vatnehol, Svein Are Sirirud; Eide, Per Kristian

    2017-10-01

    The glymphatic system has in previous studies been shown as fundamental to clearance of waste metabolites from the brain interstitial space, and is proposed to be instrumental in normal ageing and brain pathology such as Alzheimer's disease and brain trauma. Assessment of glymphatic function using magnetic resonance imaging with intrathecal contrast agent as a cerebrospinal fluid tracer has so far been limited to rodents. We aimed to image cerebrospinal fluid flow characteristics and glymphatic function in humans, and applied the methodology in a prospective study of 15 idiopathic normal pressure hydrocephalus patients (mean age 71.3 ± 8.1 years, three female and 12 male) and eight reference subjects (mean age 41.1 + 13.0 years, six female and two male) with suspected cerebrospinal fluid leakage (seven) and intracranial cyst (one). The imaging protocol included T1-weighted magnetic resonance imaging with equal sequence parameters before and at multiple time points through 24 h after intrathecal injection of the contrast agent gadobutrol at the lumbar level. All study subjects were kept in the supine position between examinations during the first day. Gadobutrol enhancement was measured at all imaging time points from regions of interest placed at predefined locations in brain parenchyma, the subarachnoid and intraventricular space, and inside the sagittal sinus. Parameters demonstrating gadobutrol enhancement and clearance in different locations were compared between idiopathic normal pressure hydrocephalus and reference subjects. A characteristic flow pattern in idiopathic normal hydrocephalus was ventricular reflux of gadobutrol from the subarachnoid space followed by transependymal gadobutrol migration. At the brain surfaces, gadobutrol propagated antegradely along large leptomeningeal arteries in all study subjects, and preceded glymphatic enhancement in adjacent brain tissue, indicating a pivotal role of intracranial pulsations for glymphatic function. In

  11. Sequence complexity and work extraction

    International Nuclear Information System (INIS)

    Merhav, Neri

    2015-01-01

    We consider a simplified version of a solvable model by Mandal and Jarzynski, which constructively demonstrates the interplay between work extraction and the increase of the Shannon entropy of an information reservoir which is in contact with a physical system. We extend Mandal and Jarzynski’s main findings in several directions: first, we allow sequences of correlated bits rather than just independent bits. Secondly, at least for the case of binary information, we show that, in fact, the Shannon entropy is only one measure of complexity of the information that must increase in order for work to be extracted. The extracted work can also be upper bounded in terms of the increase in other quantities that measure complexity, like the predictability of future bits from past ones. Third, we provide an extension to the case of non-binary information (i.e. a larger alphabet), and finally, we extend the scope to the case where the incoming bits (before the interaction) form an individual sequence, rather than a random one. In this case, the entropy before the interaction can be replaced by the Lempel–Ziv (LZ) complexity of the incoming sequence, a fact that gives rise to an entropic meaning of the LZ complexity, not only in information theory, but also in physics. (paper)

  12. Molecular genotyping of anisakis larvae in Middle Eastern Japan and endoscopic evidence for preferential penetration of normal over atrophic mucosa.

    Directory of Open Access Journals (Sweden)

    Toshio Arai

    Full Text Available BACKGROUND: Anisakiasis is a parasitic disease caused primarily by Anisakis spp. larvae in Asia and in Western countries. The aim of this study was to investigate the genotype of Anisakis larvae endoscopically removed from Middle Eastern Japanese patients and to determine whether mucosal atrophy affects the risk of penetration in gastric anisakiasis. METHODS: In this study, 57 larvae collected from 44 patients with anisakiasis (42 gastric and 2 colonic anisakiasis were analyzed retrospectively. Genotyping was confirmed by restriction fragment length polymorphism (RFLP analysis of ITS regions and by sequencing the mitochondrial small subunit (SSU region. In the cases of gastric anisakiasis, correlation analyses were conducted between the frequency of larval penetration in normal/atrophic area and the manifestation of clinical symptoms. RESULTS: Nearly all larvae were A. simplex seusu stricto (s.s. (99%, and one larva displayed a hybrid genotype. The A. simplex larvae penetrated normal mucosa more frequently than atrophic area (p = 0.005. Finally, patients with normal mucosa infection were more likely to exhibit clinical symptoms than those with atrophic mucosa infection (odds ratio, 6.96; 95% confidence interval, 1.52-31.8. CONCLUSIONS: In Japan, A. simplex s.s. is the main etiological agent of human anisakiasis and tends to penetrate normal gastric mucosa. Careful endoscopic examination of normal gastric mucosa, particularly in the greater curvature of the stomach will improve the detection of Anisakis larvae.

  13. Molecular Genotyping of Anisakis Larvae in Middle Eastern Japan and Endoscopic Evidence for Preferential Penetration of Normal over Atrophic Mucosa

    Science.gov (United States)

    Arai, Toshio; Akao, Nobuaki; Seki, Takenori; Kumagai, Takashi; Ishikawa, Hirofumi; Ohta, Nobuo; Hirata, Nobuto; Nakaji, So; Yamauchi, Kenji; Hirai, Mitsuru; Shiratori, Toshiyasu; Kobayashi, Masayoshi; Fujii, Hiroyuki; Ishii, Eiji; Naito, Mikio; Saitoh, Shin-ichi; Yamaguchi, Toshikazu; Shibata, Nobumitsu; Shimo, Masamune; Tokiwa, Toshihiro

    2014-01-01

    Background Anisakiasis is a parasitic disease caused primarily by Anisakis spp. larvae in Asia and in Western countries. The aim of this study was to investigate the genotype of Anisakis larvae endoscopically removed from Middle Eastern Japanese patients and to determine whether mucosal atrophy affects the risk of penetration in gastric anisakiasis. Methods In this study, 57 larvae collected from 44 patients with anisakiasis (42 gastric and 2 colonic anisakiasis) were analyzed retrospectively. Genotyping was confirmed by restriction fragment length polymorphism (RFLP) analysis of ITS regions and by sequencing the mitochondrial small subunit (SSU) region. In the cases of gastric anisakiasis, correlation analyses were conducted between the frequency of larval penetration in normal/atrophic area and the manifestation of clinical symptoms. Results Nearly all larvae were A. simplex seusu stricto (s.s.) (99%), and one larva displayed a hybrid genotype. The A. simplex larvae penetrated normal mucosa more frequently than atrophic area (p = 0.005). Finally, patients with normal mucosa infection were more likely to exhibit clinical symptoms than those with atrophic mucosa infection (odds ratio, 6.96; 95% confidence interval, 1.52–31.8). Conclusions In Japan, A. simplex s.s. is the main etiological agent of human anisakiasis and tends to penetrate normal gastric mucosa. Careful endoscopic examination of normal gastric mucosa, particularly in the greater curvature of the stomach will improve the detection of Anisakis larvae. PMID:24586583

  14. Comparison of spectrum normalization techniques for univariate ...

    Indian Academy of Sciences (India)

    Laser-induced breakdown spectroscopy; univariate study; normalization models; stainless steel; standard error of prediction. Abstract. Analytical performance of six different spectrum normalization techniques, namelyinternal normalization, normalization with total light, normalization with background along with their ...

  15. 30 CFR 57.6160 - Main facilities.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Main facilities. 57.6160 Section 57.6160...-Underground Only § 57.6160 Main facilities. (a) Main facilities used to store explosive material underground... facilities will not prevent escape from the mine, or cause detonation of the contents of another storage...

  16. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  17. Posterior fossa malformations: main features and limits in prenatal diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Garel, Catherine [Hopital d' Enfants Armand-Trousseau, Department of Radiology, Paris (France)

    2010-06-15

    Posterior fossa (PF) malformations are commonly observed during prenatal screening. Their understanding requires knowledge of the main steps of PF development and knowledge of normal patterns in US and MR imaging. The vast majority of PF malformations can be strongly suspected by acquiring a midline sagittal slice and a transverse slice and by systematically scrutinizing the elements of the PF: cerebellar vermis, hemispheres, brainstem, fourth ventricle, PF fluid spaces and tentorium. Analysis of cerebellar echogenicity and biometry is also useful. This review explains how to approach the diagnosis of the main PF malformations by performing these two slices and answering six key questions about the elements of the PF. The main imaging characteristics of PF malformations are also reviewed. (orig.)

  18. Normal matter storage of antiprotons

    International Nuclear Information System (INIS)

    Campbell, L.J.

    1987-01-01

    Various simple issues connected with the possible storage of anti p in relative proximity to normal matter are discussed. Although equilibrium storage looks to be impossible, condensed matter systems are sufficiently rich and controllable that nonequilibrium storage is well worth pursuing. Experiments to elucidate the anti p interactions with normal matter are suggested. 32 refs

  19. The N'ormal Distribution

    Indian Academy of Sciences (India)

    An optimal way of choosing sample size in an opinion poll is indicated using the normal distribution. Introduction. In this article, the ubiquitous normal distribution is intro- duced as a convenient approximation for computing bino- mial probabilities for large values of n. Stirling's formula. • and DeMoivre-Laplace theorem ...

  20. The Colliding Beams Sequencer

    International Nuclear Information System (INIS)

    Johnson, D.E.; Johnson, R.P.

    1989-01-01

    The Colliding Beam Sequencer (CBS) is a computer program used to operate the pbar-p Collider by synchronizing the applications programs and simulating the activities of the accelerator operators during filling and storage. The Sequencer acts as a meta-program, running otherwise stand alone applications programs, to do the set-up, beam transfers, acceleration, low beta turn on, and diagnostics for the transfers and storage. The Sequencer and its operational performance will be described along with its special features which include a periodic scheduler and command logger. 14 refs., 3 figs

  1. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  2. Is this the right normalization? A diagnostic tool for ChIP-seq normalization.

    Science.gov (United States)

    Angelini, Claudia; Heller, Ruth; Volkinshtein, Rita; Yekutieli, Daniel

    2015-05-09

    Chip-seq experiments are becoming a standard approach for genome-wide profiling protein-DNA interactions, such as detecting transcription factor binding sites, histone modification marks and RNA Polymerase II occupancy. However, when comparing a ChIP sample versus a control sample, such as Input DNA, normalization procedures have to be applied in order to remove experimental source of biases. Despite the substantial impact that the choice of the normalization method can have on the results of a ChIP-seq data analysis, their assessment is not fully explored in the literature. In particular, there are no diagnostic tools that show whether the applied normalization is indeed appropriate for the data being analyzed. In this work we propose a novel diagnostic tool to examine the appropriateness of the estimated normalization procedure. By plotting the empirical densities of log relative risks in bins of equal read count, along with the estimated normalization constant, after logarithmic transformation, the researcher is able to assess the appropriateness of the estimated normalization constant. We use the diagnostic plot to evaluate the appropriateness of the estimates obtained by CisGenome, NCIS and CCAT on several real data examples. Moreover, we show the impact that the choice of the normalization constant can have on standard tools for peak calling such as MACS or SICER. Finally, we propose a novel procedure for controlling the FDR using sample swapping. This procedure makes use of the estimated normalization constant in order to gain power over the naive choice of constant (used in MACS and SICER), which is the ratio of the total number of reads in the ChIP and Input samples. Linear normalization approaches aim to estimate a scale factor, r, to adjust for different sequencing depths when comparing ChIP versus Input samples. The estimated scaling factor can easily be incorporated in many peak caller algorithms to improve the accuracy of the peak identification. The

  3. Isolators Including Main Spring Linear Guide Systems

    Science.gov (United States)

    Goold, Ryan (Inventor); Buchele, Paul (Inventor); Hindle, Timothy (Inventor); Ruebsamen, Dale Thomas (Inventor)

    2017-01-01

    Embodiments of isolators, such as three parameter isolators, including a main spring linear guide system are provided. In one embodiment, the isolator includes first and second opposing end portions, a main spring mechanically coupled between the first and second end portions, and a linear guide system extending from the first end portion, across the main spring, and toward the second end portion. The linear guide system expands and contracts in conjunction with deflection of the main spring along the working axis, while restricting displacement and rotation of the main spring along first and second axes orthogonal to the working axis.

  4. MRI appearance of radiation-induced changes of normal cervical tissues

    International Nuclear Information System (INIS)

    Noemayr, A.; Lell, M.; Bautz, W.; Sweeney, R.; Lukas, P.

    2001-01-01

    Irradiation causes specific MRI changes in anatomic morphology and signal intensity. To avoid misinterpretation, it is important to consider the potential radiation changes of normal tissue in MRI. The aim of this study was to describe the detected radiation effects on normal cervical tissues in MRI. Pretreatment and posttreatment MRI of 52 patients with primary neck tumors were evaluated retrospectively. The MR imaging was performed before initiating radiotherapy and at the end of the treatment period. Patients underwent follow-up studies within 24 months after the end of irradiation. Edema was the main radiation-induced effect. It was detected in the epiglottis, larynx, pharynx wall, retro- and parapharyngeal space, salivary glands, muscles, and subcutaneous tissue. In some cases the bone marrow of the mandible showed edema, due to osteonecrosis. We additionally detected fluid accumulation in the mastoid cells. Radiation caused volume reduction of the parotid gland, thickening of the pharynx wall, and fatty degeneration of bone marrow. Magnetic resonance imaging is an excellent method of depicting radiation-induced changes of normal tissue. Especially T2-weighted sequences allow the detection of even slight edema. It is important to be aware of the most common radiation-induced changes in MRI and to take them into account when assessing an examination. (orig.)

  5. Supervised Sequence Labelling with Recurrent Neural Networks

    CERN Document Server

    Graves, Alex

    2012-01-01

    Supervised sequence labelling is a vital area of machine learning, encompassing tasks such as speech, handwriting and gesture recognition, protein secondary structure prediction and part-of-speech tagging. Recurrent neural networks are powerful sequence learning tools—robust to input noise and distortion, able to exploit long-range contextual information—that would seem ideally suited to such problems. However their role in large-scale sequence labelling systems has so far been auxiliary.    The goal of this book is a complete framework for classifying and transcribing sequential data with recurrent neural networks only. Three main innovations are introduced in order to realise this goal. Firstly, the connectionist temporal classification output layer allows the framework to be trained with unsegmented target sequences, such as phoneme-level speech transcriptions; this is in contrast to previous connectionist approaches, which were dependent on error-prone prior segmentation. Secondly, multidimensional...

  6. Suitable Image Intensity Normalization for Arterial Visualization

    Directory of Open Access Journals (Sweden)

    Yara Omran

    2012-12-01

    Full Text Available Ultrasonic imaging is a widely used non-invasivemedical imaging procedure since it is economical, comparativelysafe, portable and adaptable. However, one of its main weaknessesis the poor quality of images, which makes the enhancementof image quality an important issue in order to have a moreaccurate diagnose of the disease, or for the transformation of theimage through telemedicine channel and in many other imageprocessing tasks [1]. The purpose of this paper is to automaticallyenhance the image quality after the automatic detection of theartery wall. This step is essential before subsequent measurementsof arterial parameters [9]. This was performed automaticallyby applying linear normalization, where results showedthat normalization of ultra sound images is an important step inenhancing the image quality for later processing. In comparisonwith other methods, our method is automatic. The evaluationof image quality was done mathematically by comparing pixelintensities of images before and after enhancement, in additionto a visual evaluation.

  7. Inverted temperature sequences: role of deformation partitioning

    Science.gov (United States)

    Grujic, D.; Ashley, K. T.; Coble, M. A.; Coutand, I.; Kellett, D.; Whynot, N.

    2015-12-01

    The inverted metamorphism associated with the Main Central thrust zone in the Himalaya has been historically attributed to a number of tectonic processes. Here we show that there is actually a composite peak and deformation temperature sequence that formed in succession via different tectonic processes. The deformation partitioning seems to the have played a key role, and the magnitude of each process has varied along strike of the orogen. To explain the formation of the inverted metamorphic sequence across the Lesser Himalayan Sequence (LHS) in eastern Bhutan, we used Raman spectroscopy of carbonaceous material (RSCM) to determine the peak metamorphic temperatures and Ti-in-quartz thermobarometry to determine the deformation temperatures combined with thermochronology including published apatite and zircon U-Th/He and fission-track data and new 40Ar/39Ar dating of muscovite. The dataset was inverted using 3D-thermal-kinematic modeling to constrain the ranges of geological parameters such as fault geometry and slip rates, location and rates of localized basal accretion, and thermal properties of the crust. RSCM results indicate that there are two peak temperature sequences separated by a major thrust within the LHS. The internal temperature sequence shows an inverted peak temperature gradient of 12 °C/km; in the external (southern) sequence, the peak temperatures are constant across the structural sequence. Thermo-kinematic modeling suggest that the thermochronologic and thermobarometric data are compatible with a two-stage scenario: an Early-Middle Miocene phase of fast overthrusting of a hot hanging wall over a downgoing footwall and inversion of the synkinematic isotherms, followed by the formation of the external duplex developed by dominant underthrusting and basal accretion. To reconcile our observations with the experimental data, we suggest that pervasive ductile deformation within the upper LHS and along the Main Central thrust zone at its top stopped at

  8. Gomphid DNA sequence data

    Data.gov (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  9. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  10. A comparative evaluation of sequence classification programs

    Directory of Open Access Journals (Sweden)

    Bazinet Adam L

    2012-05-01

    Full Text Available Abstract Background A fundamental problem in modern genomics is to taxonomically or functionally classify DNA sequence fragments derived from environmental sampling (i.e., metagenomics. Several different methods have been proposed for doing this effectively and efficiently, and many have been implemented in software. In addition to varying their basic algorithmic approach to classification, some methods screen sequence reads for ’barcoding genes’ like 16S rRNA, or various types of protein-coding genes. Due to the sheer number and complexity of methods, it can be difficult for a researcher to choose one that is well-suited for a particular analysis. Results We divided the very large number of programs that have been released in recent years for solving the sequence classification problem into three main categories based on the general algorithm they use to compare a query sequence against a database of sequences. We also evaluated the performance of the leading programs in each category on data sets whose taxonomic and functional composition is known. Conclusions We found significant variability in classification accuracy, precision, and resource consumption of sequence classification programs when used to analyze various metagenomics data sets. However, we observe some general trends and patterns that will be useful to researchers who use sequence classification programs.

  11. Dynamic Sequence Assignment.

    Science.gov (United States)

    1983-12-01

    D-136 548 DYNAMIIC SEQUENCE ASSIGNMENT(U) ADVANCED INFORMATION AND 1/2 DECISION SYSTEMS MOUNTAIN YIELW CA C A 0 REILLY ET AL. UNCLSSIIED DEC 83 AI/DS...I ADVANCED INFORMATION & DECISION SYSTEMS Mountain View. CA 94040 84 u ,53 V,..’. Unclassified _____ SCURITY CLASSIFICATION OF THIS PAGE REPORT...reviews some important heuristic algorithms developed for fas- ter solution of the sequence assignment problem. 3.1. DINAMIC MOGRAMUNIG FORMULATION FOR

  12. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  13. General LTE Sequence

    OpenAIRE

    Billal, Masum

    2015-01-01

    In this paper,we have characterized sequences which maintain the same property described in Lifting the Exponent Lemma. Lifting the Exponent Lemma is a very powerful tool in olympiad number theory and recently it has become very popular. We generalize it to all sequences that maintain a property like it i.e. if p^{\\alpha}||a_k and p^\\b{eta}||n, then p^{{\\alpha}+\\b{eta}}||a_{nk}.

  14. Pairwise Sequence Alignment Library

    Energy Technology Data Exchange (ETDEWEB)

    2015-05-20

    Vector extensions, such as SSE, have been part of the x86 CPU since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. The trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based on striped data layouts. Therefore, a novel SIMD implementation of a parallel scan-based sequence alignment algorithm that can better exploit wider SIMD units was implemented as part of the Parallel Sequence Alignment Library (parasail). Parasail features: Reference implementations of all known vectorized sequence alignment approaches. Implementations of Smith Waterman (SW), semi-global (SG), and Needleman Wunsch (NW) sequence alignment algorithms. Implementations across all modern CPU instruction sets including AVX2 and KNC. Language interfaces for C/C++ and Python.

  15. MR imaging of the various stages of normal myelination during the first year of life

    International Nuclear Information System (INIS)

    Knaap, M.S. van der; Valk, J.

    1990-01-01

    The normal process of myelination of the brain mainly occurs during the first year of life. This process as known from histology can be visualized by MRI. Because of the very long T1 and T2 of immature brain tissue it is necessary to use adjusted pulse sequences with a long TR in order to obtain sufficient tissue contrast. With long TR SE images five stages can be recognized in the process of normal myelination and brain maturation. During the first month of life long TR short TE SE images show what are believed to be myelinated structures by correlation with published histological studies with a high signal intensity, unmyelinated white matter with a low signal intensity and gray matter with an intermediate signal intensity. The signal intensity of unmyelinated and myelinated white matter is reversed on long TR long TE SE images. In the course of a few weeks the signal intensity of unmyelinated white matter becomes high and the signal intensity of myelinated white matter becomes low also on long TR short TE SE images. These changes are believed to be caused by a loss of water and a change in chemical composition of brain tissue just prior to the onset of a wave of myelination. With progression of myelination the signal intensity of white matter changes from high to intermediate to low. These changes result in stages of isointensity, first in the central parts of the brain, later in the lobar parts. At the end of the first year the adult contrast pattern is reached in all parts of the brain. IR images are also able to depict the progress of myelination, but appear to be less sensitive to subtle changes in the degree of myelination. The precise normal values for the five stages depend on the magnetic field strength and the pulse sequences used. (orig.)

  16. Effect of normalization methods on the performance of supervised learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a predictor of survival in patients with colon adenocarcinoma.

    Science.gov (United States)

    Shahriyari, Leili

    2017-11-03

    One of the main challenges in machine learning (ML) is choosing an appropriate normalization method. Here, we examine the effect of various normalization methods on analyzing FPKM upper quartile (FPKM-UQ) RNA sequencing data sets. We collect the HTSeq-FPKM-UQ files of patients with colon adenocarcinoma from TCGA-COAD project. We compare three most common normalization methods: scaling, standardizing using z-score and vector normalization by visualizing the normalized data set and evaluating the performance of 12 supervised learning algorithms on the normalized data set. Additionally, for each of these normalization methods, we use two different normalization strategies: normalizing samples (files) or normalizing features (genes). Regardless of normalization methods, a support vector machine (SVM) model with the radial basis function kernel had the maximum accuracy (78%) in predicting the vital status of the patients. However, the fitting time of SVM depended on the normalization methods, and it reached its minimum fitting time when files were normalized to the unit length. Furthermore, among all 12 learning algorithms and 6 different normalization techniques, the Bernoulli naive Bayes model after standardizing files had the best performance in terms of maximizing the accuracy as well as minimizing the fitting time. We also investigated the effect of dimensionality reduction methods on the performance of the supervised ML algorithms. Reducing the dimension of the data set did not increase the maximum accuracy of 78%. However, it leaded to discovery of the 7SK RNA gene expression as a predictor of survival in patients with colon adenocarcinoma with accuracy of 78%. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  17. Magnetic measurements of the correction and adjustment magnets of the main ring

    International Nuclear Information System (INIS)

    Trbojevic, D.

    1986-07-01

    Correction magnets correct the field imperfections and alignment errors of the main quadrupole and bend magnets. For reducing and controlling chromaticity there are 186 sextupoles and 78 octupoles, while for suppressing various resonances there are 12 normal and 18 skew sextupoles and 24 normal and 19 skew quadrupoles. Beam positions are individually controlled by 108 horizontal and 108 skew dipoles. This report includes results of the all Main Ring correction and adjustment magnet harmonic measurements. The measurement principle and basic equations are described

  18. Technical normalization in the geoinformatics branch

    Directory of Open Access Journals (Sweden)

    Bronislava Horáková

    2006-09-01

    Full Text Available A basic principle of the technical normalisation is to hold the market development by developing unified technical rules for all concerned subjects. The information and communication technological industry is characterised by certain specific features contrary to the traditional industry. These features bring to the normalisation domain new demands, mainly the flexibility enabling to reflect the rapidly development market of ICT elastic way. The goal of the paper is to provide a comprehensive overview of the current process of technical normalization in the geoinformatic branch

  19. Main: OPAQUE2ZM22Z [PLACE

    Lifescience Database Archive (English)

    Full Text Available OPAQUE2ZM22Z S000017 17-May-2001 (last modified) uchi Opaque-2 (O2) target sequence...ene: maize 22-kD zein; transacting factor: 02; O2; opaque; 22-kD zein; seed; ACGT; opaque-2; maize (Zea mays) TCCACGTAGA ...

  20. Complete Normal Ordering 1: Foundations

    CERN Document Server

    Ellis, John; Skliros, Dimitri P.

    2016-01-01

    We introduce a new prescription for quantising scalar field theories perturbatively around a true minimum of the full quantum effective action, which is to `complete normal order' the bare action of interest. When the true vacuum of the theory is located at zero field value, the key property of this prescription is the automatic cancellation, to any finite order in perturbation theory, of all tadpole and, more generally, all `cephalopod' Feynman diagrams. The latter are connected diagrams that can be disconnected into two pieces by cutting one internal vertex, with either one or both pieces free from external lines. In addition, this procedure of `complete normal ordering' (which is an extension of the standard field theory definition of normal ordering) reduces by a substantial factor the number of Feynman diagrams to be calculated at any given loop order. We illustrate explicitly the complete normal ordering procedure and the cancellation of cephalopod diagrams in scalar field theories with non-derivative i...