normal immune function: Topics by WorldWideScience.org

Sample records for normal immune function

Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

Science.gov (United States)

Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

2017-01-01

Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714
Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

Science.gov (United States)

Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

2017-03-01

Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.
Modulation of Immune Functions by Foods

Directory of Open Access Journals (Sweden)

Shuichi Kaminogawa

2004-01-01

Full Text Available Evidence is rapidly accumulating as to the beneficial effects of foods. However, it is not always clear whether the information is based on data evaluated impartially in a scientific fashion. Human research into whether foods modulate immune functions in either intervention studies or randomized controlled trials can be classified into three categories according to the physical state of subjects enrolled for investigation: (i studies examining the effect of foods in healthy individuals; (ii studies analyzing the effect of foods on patients with hypersensitivity; and (iii studies checking the effect of foods on immunocompromized subjects, including patients who had undergone surgical resection of cancer and newborns. The systematization of reported studies has made it reasonable to conclude that foods are able to modulate immune functions manifesting as either innate immunity (phagocytic activity, NK cell activity or acquired immunity (T cell response, antibody production. Moreover, improvement of immune functions by foods can normalize the physical state of allergic patients or cancer patients, and may reduce the risk of diseases in healthy individuals. Therefore, it is valuable to assess the immune-modulating abilities of foods by measuring at least one parameter of either innate or acquired immunity.
EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2014 . Scientific Opinion on the substantiation of a health claim related to zinc and normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

substantiation of a health claim related to zinc and normal function of the immune system. The food constituent, zinc, which is the subject of the health claim is sufficiently characterised. Normal function of the immune system is a beneficial physiological effect for infants and young children. A claim on zinc...... and function of the immune system in the general population has already been assessed with a favourable outcome. The Panel considers that the role of zinc in normal function of the immune system applies to all ages, including infants and young children (from birth to three years). The Panel concludes...... that a cause and effect relationship has been established between the dietary intake of zinc and normal function of the immune system. The following wording reflects the scientific evidence: “zinc contributes to normal function of the immune system”....
Suppression of adoptive antituberculosis immunity by normal recipient animals

International Nuclear Information System (INIS)

Lefford, M.J.

1983-01-01

Adoptive immunity is poorly expressed in normal syngeneic mice. This phenomenon was studied by using experimental antituberculosis immunity as a model system representing pure cell-mediated immunity. Expression of adoptive immunity was facilitated by pretreating recipients with sublethal ionizing radiation (500 rads) or high doses (200 mg/kg) of cyclophosphamide or by using adult thymectomized, lethally irradiated, bone-marrow-reconstituted (TXB) mice. Adult thymectomy was less effective, and a low dose of cyclophosphamide (20 mg/kg) was completely ineffective. The beneficial effect of sublethal irradiation was reduced over time; it persisted for 4 weeks and was absent after 8 weeks. Attempts to restore the suppressed state of normal mice to sublethally irradiated mice by using normal spleen or thymus cells did not succeed. Even in rats, which express adoptive antituberculosis immunity without immunosuppressive treatment, the use of sublethally irradiated or TXB recipients potentiated adoptive immunity. It was concluded that suppression of adoptive immunization in normal recipient mice is mediated predominantly, if not exclusively, by T lymphocytes that are sensitive to a number of immunosuppressive agents. The suppressor cells are long-lived and can be regenerated from precursors that are resistant to 500 but not to 900 rads of ionizing radiation
EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2015. Scientific Opinion on the substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

2015-01-01

on the scientific substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system. The Panel considers that vitamin D is sufficiently characterised. Contribution to the normal function of the immune system is a beneficial physiological effect for children....... The Panel had previously assessed a claim on vitamin D and contribution to the normal function of the immune system with a favourable outcome. The target population was the general population. The Panel considered that vitamin D plays a regulatory role in the functioning of the immune system. The Panel...... considers that the role of vitamin D in the functioning of the immune system applies to all ages, including children. The Panel concludes that a cause and effect relationship has been established between the dietary intake of vitamin D and contribution to the normal function of the immune system...
Role of Polyamines in Immune Cell Functions

Directory of Open Access Journals (Sweden)

Rebecca S. Hesterberg

2018-03-01

Full Text Available The immune system is remarkably responsive to a myriad of invading microorganisms and provides continuous surveillance against tissue damage and developing tumor cells. To achieve these diverse functions, multiple soluble and cellular components must react in an orchestrated cascade of events to control the specificity, magnitude and persistence of the immune response. Numerous catabolic and anabolic processes are involved in this process, and prominent roles for l-arginine and l-glutamine catabolism have been described, as these amino acids serve as precursors of nitric oxide, creatine, agmatine, tricarboxylic acid cycle intermediates, nucleotides and other amino acids, as well as for ornithine, which is used to synthesize putrescine and the polyamines spermidine and spermine. Polyamines have several purported roles and high levels of polyamines are manifest in tumor cells as well in autoreactive B- and T-cells in autoimmune diseases. In the tumor microenvironment, l-arginine catabolism by both tumor cells and suppressive myeloid cells is known to dampen cytotoxic T-cell functions suggesting there might be links between polyamines and T-cell suppression. Here, we review studies suggesting roles of polyamines in normal immune cell function and highlight their connections to autoimmunity and anti-tumor immune cell function.
Position statement. Part one: Immune function and exercise

DEFF Research Database (Denmark)

Walsh, Neil P; Gleeson, Michael; Shephard, Roy J

2011-01-01

responses and falls in stimulated B cell Ig synthesis. The cause of this apparent depression in acquired immunity appears to be related to elevated circulating stress hormones, and alterations in the pro/anti-inflammatory cytokine balance in response to exercise. The clinical significance of these changes...... and immediately after exercise, proportional to exercise intensity and duration, with numbers of cells (T cells and to a lesser extent B cells) falling below pre-exercise levels during the early stages of recovery, before returning to resting values normally within 24 h. Mobilization of T and B cell subsets...... risk of URTI during heavy training. An important question for exercise immunologists remains: how does one measure immune function in a meaningful way? One approach to assessing immune function that extends beyond blood or salivary measures involves challenging study participants with antigenic stimuli...
Exercise and the Regulation of Immune Functions.

Science.gov (United States)

Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

2015-01-01

Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.
Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Innate immune functions of microglia isolated from human glioma patients

Directory of Open Access Journals (Sweden)

Grimm Elizabeth

2006-03-01

Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.
Immune responses at brain barriers and implications for brain development and neurological function in later life

Directory of Open Access Journals (Sweden)

Helen B. Stolp

2013-08-01

Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.
Molecular and Functional Neuroscience in Immunity.

Science.gov (United States)

Pavlov, Valentin A; Chavan, Sangeeta S; Tracey, Kevin J

2018-04-26

The nervous system regulates immunity and inflammation. The molecular detection of pathogen fragments, cytokines, and other immune molecules by sensory neurons generates immunoregulatory responses through efferent autonomic neuron signaling. The functional organization of this neural control is based on principles of reflex regulation. Reflexes involving the vagus nerve and other nerves have been therapeutically explored in models of inflammatory and autoimmune conditions, and recently in clinical settings. The brain integrates neuro-immune communication, and brain function is altered in diseases characterized by peripheral immune dysregulation and inflammation. Here we review the anatomical and molecular basis of the neural interface with immunity, focusing on peripheral neural control of immune functions and the role of the brain in the model of the immunological homunculus. Clinical advances stemming from this knowledge within the framework of bioelectronic medicine are also briefly outlined.
Loss of renal function causes premature aging of the immune system.

Science.gov (United States)

Betjes, Michiel G H; Meijers, Ruud W J; Litjens, Nicolle H R

2013-01-01

Uremia-associated immune deficiency is a well-known complication of loss of renal function and contributes significantly to the overall mortality and morbidity of patients with end-stage renal disease. Chronic inflammation and increased oxidative stress are underlying the uremia-associated immune deficiency. In this review, the differential impact of uremia on the cellular immune system is summarized. Virtually all immune cells studied show a combination of an activated status and loss of function. However, uremia preferentially decreases the number and function of lymphoid cells while myeloid cells show normal and/or elevated cell numbers with increased production of inflammatory cytokines and reactive oxygen species. These particular changes are compatible with immunological aging, which is characterized by loss of thymic function, attrition of telomeres and an expanded memory T cell population. Similar to aging in healthy individuals, the proinflammatory and potential cardiotoxic subsets of CD28(null) T cells and CD16(+) monocytes are increased. Epigenetically changed hematopoietic stem cells may be involved in immunological aging as specific DNA regions become hypermethylated. Proinflammatory T cells and monocytes persist after kidney transplantation, which constitutes a persistent cardiovascular risk factor. Possible therapeutic options to reverse or halt uremia-associated immunological aging are discussed. Premature aging of the immune system is a dominant feature in patients with end-stage renal failure, which corresponds to immunological aging in elderly healthy individuals, which is characterized by preferential loss of cells belonging to the lymphoid cell lineage, inflammation and expansion of proinflammatory immune cells. © 2013 S. Karger AG, Basel.
The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

NARCIS (Netherlands)

Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

1987-01-01

The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells
Immune function in arctic mammals

DEFF Research Database (Denmark)

Desforges, Jean-Pierre; Jasperse, Lindsay; Jensen, Trine Hammer

2018-01-01

Natural killer (NK) cells are a vital part of the rapid and non-specific immune defense against invading pathogens and tumor cells. This study evaluated NK cell-like activity by flow cytometry for the first time in three ecologically and culturally important Arctic mammal species: polar bear (Ursus...... the effector:target cell ratio increased. Comparing NK activity between fresh and cryopreserved mouse lymphocytes revealed little to no difference in function, highlighting the applicability of cryopreserving cells in field studies. The evaluation of this important innate immune function in Arctic mammals can...... contribute to future population health assessments, especially as pollution-induced suppression of immune function may increase infectious disease susceptibility....
The function of the Mediator complex in plant immunity.

Science.gov (United States)

An, Chuanfu; Mou, Zhonglin

2013-03-01

Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.
Heme oxygenase and the immune system in normal and pathological pregnancies

Directory of Open Access Journals (Sweden)

Maide eOzen

2015-04-01

Full Text Available Normal pregnancy is an immunotolerant state. Many factors, including environmental, socioeconomic, genetic, and immunologic changes by infection and/or other causes of inflammation, may contribute to inter-individual differences resulting in a normal or pathologic pregnancy. In particular, imbalances in the immune system can cause many pregnancy-related diseases, such as infertility, abortions, pre-eclampsia, and preterm labor, which result in maternal/fetal death, prematurity, or small-for-gestational age newborns. New findings imply that myeloid regulatory cells and regulatory T cells (Tregs may mediate immunotolerance during normal pregnancy. Effector T cells (Teffs have, in contrast, been implicated to cause adverse pregnancy outcomes. Furthermore, feto-maternal tolerance affects the developing fetus. It has been shown that the Treg/Teff balance affects litter size and adoptive transfer of pregnancy-induced Tregs can prevent fetal rejection in the mouse. Heme oxygenase-1 (HO-1 has a protective role in many conditions through its anti-inflammatory, anti-apoptotic, antioxidative, and anti-proliferative actions. HO-1 is highly expressed in the placenta and plays a role in angiogenesis and placental vascular development and in regulating vascular tone in pregnancy. In addition, HO-1 is a major regulator of immune homeostasis by mediating crosstalk between innate and adaptive immune systems. Moreover, HO-1 can inhibit inflammation-induced phenotypic maturation of immune effector cells and pro-inflammatory cytokine secretion and promote anti-inflammatory cytokine production. HO-1 may also be associated with T-cell activation and can limit immune-based tissue injury by promoting Treg suppression of effector responses. Thus, HO-1 and its byproducts may protect against pregnancy complications by its immunomodulatory effects, and the regulation of HO-1 or its downstream effects has the potential to prevent or treat pregnancy complications and
Impaired immune function in children and adults with Fanconi anemia.

Science.gov (United States)

Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

2017-11-01

Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.
Reversibility of alcohol-induced immune depression

DEFF Research Database (Denmark)

Tønnesen, H; Kaiser, A H; Nielsen, B B

1992-01-01

Alcohol abusers have suppressed cellular immune function. The aim of the study was to investigate the time of sobriety required to normalize immune function. Delayed hypersensitivity was investigated during disulfiram controlled abstinence in ten heavy alcoholics and in seven moderate drinkers...... months of abstinence. The results suggest that while 2 weeks of abstinence from alcohol will improve the depressed cellular immunity, 2 months of sobriety is necessary to normalize it....

EFSA NDA Panel (EFSA Panel on Dietetic Product s, Nutrition and Allergies), 2013 . Scientific Opinion on the substantiation of a health claim related to vitamin A and contribution to normal development and function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

of infants and young children (from birth to three years). The Panel concludes that a cause and effect relationship has been established between dietary intake of vitamin A and contribution to normal development and function of the immune system. The following wording reflects the scientific evidence......: “Vitamin A contributes to the normal function of the immune system”. The target population is infants and children up to three years. © European Food Safety Authority, 2013...
Monounsaturated fats and immune function

Directory of Open Access Journals (Sweden)

P. Yaqoob

1998-04-01

Full Text Available Animal studies suggest that olive oil is capable of modulating functions of cells of the immune system in a manner similar to, albeit weaker than, fish oils. There is some evidence that the effects of olive oil on immune function in animal studies are due to oleic acid rather than to trace elements or antioxidants. Importantly, several studies have demonstrated effects of oleic acid-containing diets on in vivo immune responses. In contrast, consumption of a monounsaturated fatty acid (MUFA-rich diet by humans does not appear to bring about a general suppression of immune cell functions. The effects of this diet in humans are limited to decreasing aspects of adhesion of peripheral blood mononuclear cells, although there are trends towards decreases in natural killer cell activity and proliferation. The lack of a clear effect of MUFA in humans may be attributable to the higher level of monounsaturated fat used in the animal studies, although it is ultimately of importance to examine the effects of intakes which are in no way extreme. The effects of MUFA on adhesion molecules are potentially important, since these molecules appear to have a role in the pathology of a number of diseases involving the immune system. This area clearly deserves further exploration
Season of birth shapes neonatal immune function

DEFF Research Database (Denmark)

Thysen, Anna Hammerich; Rasmussen, Morten Arendt; Kreiner-Møller, Eskil

2016-01-01

Birth season has been reported to be a risk factor for several immune-mediated diseases. We hypothesized that this association is mediated by differential changes in neonatal immune phenotype and function with birth season. We sought to investigate the influence of season of birth on cord blood...... immune cell subsets and inflammatory mediators in neonatal airways. Cord blood was phenotyped for 26 different immune cell subsets, and at 1 month of age, 20 cytokines and chemokines were quantified in airway mucosal lining fluid. Multivariate partial least squares discriminant analyses were applied...... to determine whether certain immune profiles dominate by birth season, and correlations between individual cord blood immune cells and early airway immune mediators were defined. We found a birth season-related fluctuation in neonatal immune cell subsets and in early-life airway mucosal immune function...
A non-canonical function of Ezh2 preserves immune homeostasis.

Science.gov (United States)

Vasanthakumar, Ajithkumar; Xu, Dakang; Lun, Aaron Tl; Kueh, Andrew J; van Gisbergen, Klaas Pjm; Iannarella, Nadia; Li, Xiaofang; Yu, Liang; Wang, Die; Williams, Bryan Rg; Lee, Stanley Cw; Majewski, Ian J; Godfrey, Dale I; Smyth, Gordon K; Alexander, Warren S; Herold, Marco J; Kallies, Axel; Nutt, Stephen L; Allan, Rhys S

2017-04-01

Enhancer of zeste 2 (Ezh2) mainly methylates lysine 27 of histone-H3 (H3K27me3) as part of the polycomb repressive complex 2 (PRC2) together with Suz12 and Eed. However, Ezh2 can also modify non-histone substrates, although it is unclear whether this mechanism has a role during development. Here, we present evidence for a chromatin-independent role of Ezh2 during T-cell development and immune homeostasis. T-cell-specific depletion of Ezh2 induces a pronounced expansion of natural killer T (NKT) cells, although Ezh2-deficient T cells maintain normal levels of H3K27me3. In contrast, removal of Suz12 or Eed destabilizes canonical PRC2 function and ablates NKT cell development completely. We further show that Ezh2 directly methylates the NKT cell lineage defining transcription factor PLZF, leading to its ubiquitination and subsequent degradation. Sustained PLZF expression in Ezh2-deficient mice is associated with the expansion of a subset of NKT cells that cause immune perturbation. Taken together, we have identified a chromatin-independent function of Ezh2 that impacts on the development of the immune system. © 2017 The Authors.
Pregnancy immunology: decidual immune cells.

Science.gov (United States)

Sanguansermsri, Donruedee; Pongcharoen, Sutatip

2008-01-01

Human pregnancy is a complex process. Placental development depends on the function of secretory molecules produced by placental trophoblast cells as well as by maternal uterine immune cells within the decidua. These decidual immune cells are T cells, natural killer cells, macrophages and dendritic cells. The interactions between the trophoblast cells and the maternal immune cells have an impact on the outcome of the pregnancy. Knowledge about the phenotypes and functions of the maternal immune cells in normal and pathological pregnancies including recurrent spontaneous abortions, preeclampsia and hydatidiform moles may improve our understanding of the immunobiology of the normal pregnancy as a whole and may provide approaches for improving the treatment of pathological pregnancies.
Nutrition, immune function and health of dairy cattle

DEFF Research Database (Denmark)

Ingvartsen, Klaus Lønne; Moyes, Kasey

2013-01-01

not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our......) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where...... the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response...
Problematic Internet Usage and Immune Function.

Science.gov (United States)

Reed, Phil; Vile, Rebecca; Osborne, Lisa A; Romano, Michela; Truzoli, Roberto

2015-01-01

Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health - General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.
Problematic Internet Usage and Immune Function.

Directory of Open Access Journals (Sweden)

Phil Reed

Full Text Available Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test, depression and anxiety (Hospital Anxiety and Depression Scales, social isolation (UCLA Loneliness Questionnaire, sleep problems (Pittsburgh Sleep Quality Index, and their current health - General Health Questionnaire (GHQ-28, and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28. This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.
Problematic Internet Usage and Immune Function

Science.gov (United States)

Reed, Phil; Vile, Rebecca; Osborne, Lisa A.; Romano, Michela; Truzoli, Roberto

2015-01-01

Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health – General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol. PMID:26244339
Effect of psychological intervention in the form of relaxation and guided imagery on cellular immune function in normal healthy subjects. An overview

DEFF Research Database (Denmark)

Zachariae, R; Kristensen, J S; Hokland, P

1991-01-01

The present study measured the effects of relaxation and guided imagery on cellular immune function. During a period of 10 days 10 healthy subjects were given one 1-hour relaxation procedure and one combined relaxation and guided imagery procedure, instructing the subjects to imagine their immune...... on the immune defense and could form the basis of further studies on psychological intervention and immunological status. Udgivelsesdato: 1990-null...
Vitamin E, immunity, and infection

Science.gov (United States)

A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...
Mental resilience, perceived immune functioning, and health

Directory of Open Access Journals (Sweden)

Van Schrojenstein Lantman M

2017-03-01

Full Text Available Marith Van Schrojenstein Lantman,1 Marlou Mackus,1 Leila S Otten,1 Deborah de Kruijff,1 Aurora JAE van de Loo,1,2 Aletta D Kraneveld,1,2 Johan Garssen,1,3 Joris C Verster1,2,4 1Division of Pharmacology, Utrecht University, Utrecht, the Netherlands; 2Institute for Risk Assessment Sciences, Utrecht University, Utrecht, the Netherlands; 3Nutricia Research, Utrecht, the Netherlands; 4Centre for Human Psychopharmacology, Swinburne University, Melbourne, Australia Background: Mental resilience can be seen as a trait that enables an individual to recover from stress and to face the next stressor with optimism. People with resilient traits are considered to have a better mental and physical health. However, there are limited data available assessing the relationship between resilient individuals and their perspective of their health and immune status. Therefore, this study was conducted to examine the relationship between mental resilience, perceived health, and perceived immune status. Methods: A total of 779 participants recruited at Utrecht University completed a questionnaire consisting of demographic characteristics, the brief resilience scale for the assessment of mental resilience, the immune function questionnaire (IFQ, and questions regarding their perceived health and immune status. Results: When correcting for gender, age, height, weight, smoker status, amount of cigarettes smoked per week, alcohol consumption status, amount of drinks consumed per week, drug use, and frequency of past year drug use, mental resilience was significantly correlated with perceived health (r=0.233, p=0.0001, perceived immune functioning (r=0.124, p=0.002, and IFQ score (r=−0.185, p=0.0001. Conclusion: A significant, albeit modest, relationship was found between mental resilience and perceived immune functioning and health. Keywords: mental resilience, immune functioning, health, vitality, quality of life
Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

Science.gov (United States)

Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

2016-10-01

The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.
Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

Science.gov (United States)

Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

2017-08-01

Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects
Early enteral immune nutrition support after radical operation for gastric cancer on promoting the recovery of gastrointestinal function and immune function

Directory of Open Access Journals (Sweden)

Zhi-Gang Li

2016-05-01

Full Text Available Objective: To analyze the effect of early enteral immune nutrition support after radical operation for gastric cancer on the recovery of gastrointestinal function and immune function. Methods: A total of 106 cases of patients received radical operation for gastric cancer in our hospital were selected as research subjects, and according to different ways of postoperative nutrition intervention, all patients were divided into observation group (n=50 and control group (n=56. Control group received conventional enteral nutrition intervention, observation group received postoperative early enteral immune nutrition support, and then differences in postoperative intestinal mucosa barrier function, gastrointestinal hormone levels, immune function levels and nutrition-related indicator values were compared between two groups. Results: After observation group received enteral immune nutrition intervention, serum DAO, PS and D-lactate levels as well as urine L/M ratio were lower than those of control group; serum GAS, CCK, MTL and SP values of observation group after intervention were higher than those of control group, and GLU, VIP, GIP and SS values were lower than those of control group; CD4, IgG, NK cell, C3, C4, CH50 and S-IgA levels of observation group after intervention were higher than those of control group; serum ALB, PRE, TRF and RBP levels of observation group after intervention were higher than those of control group. Conclusion: Early enteral immune nutrition support after radical operation for gastric cancer is conducive to the recovery of gastrointestinal function and the promotion of immune state, eventually promotes patients’ postoperative overall recovery and has active clinical significance.
Analysis and comparison of immune reactivity in guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni

International Nuclear Information System (INIS)

Rogers, M.V.; McLaren, D.J.

1987-01-01

Guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni develop close to complete resistance to reinfection at weeks 12 and 4.5 respectively. We here analyse and compare the immune responses induced by the two populations of cercariae. Both radiation-attenuated and normal parasites of S. mansoni elicited an extensive germinal centre response in guinea-pigs by week 4.5 post-immunization. The anti-parasite antibody titre and cytotoxic activity of serum from 4.5-week-vaccinated, or 4.5-week-infected guinea-pigs were approximately equal, but sera from 12-week-infected individuals had high titres of anti-parasite antibody, which promoted significant larvicidal activity in vitro. In all cases, larvicidal activity was mediated by the IgG 2 fraction of the immune serum. Lymphocyte transformation tests conducted on splenic lymphocytes from 4.5-week vaccinated guinea-pigs revealed maximal stimulation against cercarial, 2-week and 3-week worm antigens, whereas spleen cells from 4.5-week-infected guinea-pigs were maximally stimulated by cercarial and 6-week worm antigens. The splenic lymphocyte responses of 12-week infected animals were dramatic against antigens prepared from all life-stages of the parasite. (author)
The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

Science.gov (United States)

Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

2017-04-01

The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.
Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

Energy Technology Data Exchange (ETDEWEB)

Spector, June T., E-mail: spectj@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); De Roos, Anneclaire J., E-mail: ajd335@drexel.edu [Epidemiology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Ulrich, Cornelia M., E-mail: neli.ulrich@nct-heidelberg.de [Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Cancer Prevention Program, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Sheppard, Lianne, E-mail: sheppard@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Biostatistics, School of Public Health, University of Washington, Seattle, WA (United States); Sjoedin, Andreas, E-mail: asjodin@cdc.gov [National Center for Environmental Health, CDC, 4770 Buford Highway NE, Atlanta, GA 30341 (United States); Wener, Mark H., E-mail: wener@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); Wood, Brent, E-mail: woodbl@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); and others

2014-05-01

Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation
Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

International Nuclear Information System (INIS)

Spector, June T.; De Roos, Anneclaire J.; Ulrich, Cornelia M.; Sheppard, Lianne; Sjoedin, Andreas; Wener, Mark H.; Wood, Brent

2014-01-01

Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation
Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

Science.gov (United States)

Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

2018-03-01

Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

Immune functions of the garment workers.

Science.gov (United States)

Sultana, R; Ferdous, K J; Hossain, M; Zahid, M S H; Islam, L N

2012-10-01

Occupational exposure to cotton dust, fibers, metal fumes and different chemicals used in the aparrel manufacturing industries cause a wide range of physical and psychological health problems in the garment workers that may also affect their immune function. To assess the immune system function in garment workers. A total of 45 workers of a garment factory, and 41 control subjects, not exposed to the garment working environment were enrolled in this study. In the study subjects, the complement system function was assessed as bactericidal activity on Escherichia coli DH5α cells using the standard plate count method. Serum complement components C3 and C4 were measured by immunoprecipitation, and IgG was measured by immunonephelometry. The bactericidal activity of serum complement in the garment workers (range: 93.5%-99.9%) was significantly (pgarment workers, the mean levels of complement C3, and C4 were 1.75 and 0.26 g/L, respectively that were close to those of the controls. The mean IgG level in the garment workers was 13.5 g/L that was significantly (pgarment factory may affect the immune system.
Regulation of immune responses and tolerance: the microRNA perspective

Science.gov (United States)

Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

2013-01-01

Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642
Regulation of immune responses and tolerance: the microRNA perspective.

Science.gov (United States)

Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

2013-05-01

Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.
Differential Gender Effects in the Relationship between Perceived Immune Functioning and Autistic Traits.

Science.gov (United States)

Mackus, Marlou; Kruijff, Deborah de; Otten, Leila S; Kraneveld, Aletta D; Garssen, Johan; Verster, Joris C

2017-04-12

Altered immune functioning has been demonstrated in individuals with autism spectrum disorder (ASD). The current study explores the relationship between perceived immune functioning and experiencing ASD traits in healthy young adults. N = 410 students from Utrecht University completed a survey on immune functioning and autistic traits. In addition to a 1-item perceived immune functioning rating, the Immune Function Questionnaire (IFQ) was completed to assess perceived immune functioning. The Dutch translation of the Autism-Spectrum Quotient (AQ) was completed to examine variation in autistic traits, including the domains "social insights and behavior", "difficulties with change", "communication", "phantasy and imagination", and "detail orientation". The 1-item perceived immune functioning score did not significantly correlate with the total AQ score. However, a significant negative correlation was found between perceived immune functioning and the AQ subscale "difficulties with change" (r = -0.119, p = 0.019). In women, 1-item perceived immune functioning correlated significantly with the AQ subscales "difficulties with change" (r = -0.149, p = 0.029) and "communication" (r = -0.145, p = 0.032). In men, none of the AQ subscales significantly correlated with 1-item perceived immune functioning. In conclusion, a modest relationship between perceived immune functioning and several autistic traits was found.
Nutrition, immune function and health of dairy cattle.

Science.gov (United States)

Ingvartsen, K L; Moyes, K

2013-03-01

The large increase in milk yield and the structural changes in the dairy industry have caused major changes in the housing, feeding and management of the dairy cow. However, while large improvements have occurred in production and efficiency, the disease incidence, based on veterinary records, does not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our understanding of disease risk and our effort to develop health and welfare improving strategies, including proactive management for preventing diseases and reducing the severity of diseases. To build onto this the main purpose of this review will therefore be on the effect of physiological imbalance (PI) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response and the effect of nutrition may be directly through nutrients or indirectly by metabolites, for example, in situations with PI. This review discusses the complex relationships between metabolic status and immune function and how these complex interactions increase the risk of disease during early lactation. A special focus will be placed on the major energetic fuels currently known to be used by immune cells (i.e. glucose, non-esterified fatty acids, beta
Normal Functioning Family

Science.gov (United States)

... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...
[Impact of thymic function in age-related immune deterioration].

Science.gov (United States)

Ferrando-Martínez, Sara; de la Fuente, Mónica; Guerrero, Juan Miguel; Leal, Manuel; Muñoz-Fernández, M Ángeles

2013-01-01

Age-related biological deterioration also includes immune system deterioration and, in consequence, a rise in the incidence and prevalence of infections and cancers, as well as low responses to vaccination strategies. Out of all immune cell subsets, T-lymphocytes seem to be involved in most of the age-related defects. Since T-lymphocytes mature during their passage through the thymus, and the thymus shows an age-related process of atrophy, thymic regression has been proposed as the triggering event of this immune deterioration in elderly people. Historically, it has been accepted that the young thymus sets the T-lymphocyte repertoire during the childhood, whereupon atrophy begins until the elderly thymus is a non-functional evolutionary trace. However, a rising body of knowledge points toward the thymus functioning during adulthood. In the elderly, higher thymic function is associated with a younger immune system, while thymic function failure is associated with all-cause mortality. Therefore, any new strategy focused on the improvement of the elderly quality of life, especially those trying to influence the immune system, should take into account, together with peripheral homeostasis, thymus function as a key element in slowing down age-related decline. Copyright © 2012 SEGG. Published by Elsevier Espana. All rights reserved.
Staphylococcal Immune Evasion Proteins: Structure, Function, and Host Adaptation.

Science.gov (United States)

Koymans, Kirsten J; Vrieling, Manouk; Gorham, Ronald D; van Strijp, Jos A G

2017-01-01

Staphylococcus aureus is a successful human and animal pathogen. Its pathogenicity is linked to its ability to secrete a large amount of virulence factors. These secreted proteins interfere with many critical components of the immune system, both innate and adaptive, and hamper proper immune functioning. In recent years, numerous studies have been conducted in order to understand the molecular mechanism underlying the interaction of evasion molecules with the host immune system. Structural studies have fundamentally contributed to our understanding of the mechanisms of action of the individual factors. Furthermore, such studies revealed one of the most striking characteristics of the secreted immune evasion molecules: their conserved structure. Despite high-sequence variability, most immune evasion molecules belong to a small number of structural categories. Another remarkable characteristic is that S. aureus carries most of these virulence factors on mobile genetic elements (MGE) or ex-MGE in its accessory genome. Coevolution of pathogen and host has resulted in immune evasion molecules with a highly host-specific function and prevalence. In this review, we explore how these shared structures and genomic locations relate to function and host specificity. This is discussed in the context of therapeutic options for these immune evasion molecules in infectious as well as in inflammatory diseases.
Effect of radiotherapy on immunity function of cancer patients receiving radiotherapy

International Nuclear Information System (INIS)

Li Xinli; Zhu Shentao; Xu Jiuhong

2003-01-01

Objective: In order to observe the effect of radiotherapy on immunity function of cancer patients receiving radiotherapy. Methods: Cellular immunity is determined by APAAP; Humoral immunity is determined by transmission method. Results: The items of cellular immunity is lower than the control after radiotherapy. These items decrease continually. The difference between before and after radiotherapy has statistic significance. Of all Humoral immunity items, IgA, IgM decreased after radiotherapy and the difference has statistic significance. Conclusions: Radiotherapy can damage patients' immunity function
Vitamin D and neonatal immune function.

LENUS (Irish Health Repository)

Clancy, N

2013-05-01

Vitamin D deficiency is widespread in the neonatal and paediatric population of northern latitudes, particularly in children of African, Middle Eastern and Asian ethnicity. This is associated with diminished immune function and increases the risk of Th1 autoimmune diseases like type 1 diabetes. Epidermiological studies have also shown a link between vitamin D deficiency in children and a more severe course of illness with lower respiratory tract infection or Respiratory Syncitial Virus (RSV) bronchiolitis. The mechanism by which vitamin D enhances immunity is complex. It acts through the innate immune system by inducing antimicrobial peptides in epithelial cells, neutrophils and macrophages. The role of Vitamin D in neonatal and paediatric immunomodulation requires further study.
MenTORing Immunity: mTOR Signaling in the Development and Function of Tissue-Resident Immune Cells.

Science.gov (United States)

Jones, Russell G; Pearce, Edward J

2017-05-16

Tissue-resident immune cells must balance survival in peripheral tissues with the capacity to respond rapidly upon infection or tissue damage, and in turn couple these responses with intrinsic metabolic control and conditions in the tissue microenvironment. The serine/threonine kinase mammalian/mechanistic target of rapamycin (mTOR) is a central integrator of extracellular and intracellular growth signals and cellular metabolism and plays important roles in both innate and adaptive immune responses. This review discusses the function of mTOR signaling in the differentiation and function of tissue-resident immune cells, with focus on the role of mTOR as a metabolic sensor and its impact on metabolic regulation in innate and adaptive immune cells. We also discuss the impact of metabolic constraints in tissues on immune homeostasis and disease, and how manipulating mTOR activity with drugs such as rapamycin can modulate immunity in these contexts. Copyright © 2017. Published by Elsevier Inc.
Maternal immunization increases nestling energy expenditure, immune function, and fledging success in a passerine bird

Directory of Open Access Journals (Sweden)

Gary Burness

2018-04-01

Full Text Available Female birds transfer maternally derived antibodies (matAb to their nestlings, via the egg yolk. These antibodies are thought to provide passive protection, and allow nestlings to avoid the costs associated with mounting an innate immune response. To test whether there is an energetic benefit to nestlings from receiving matAb, we challenged adult female tree swallows (Tachycineta bicolor prior to clutch initiation with either lipopolysaccharide (LPS or saline (Control. Following hatching, one half of each female's nestlings were immunized on day 8 post-hatch with LPS or saline, and the 4-h post-immunization nestling metabolic rate (MR was measured. There was no difference in either LPS-reactive antibodies or total Ig levels between offspring of immunized and non-immunized mothers on day 6 or 14 post-hatch, possibly reflecting a relatively short half-life of matAbs in altricial birds. Additionally, we found no evidence that nestlings from LPS-immunized mothers could avoid the growth suppression that may result from activation of an inflammatory response. Unexpectedly, we found that control nestlings from LPS mothers had higher resting MR than control nestlings of control mothers. We attribute the increased MR to the costs associated with a general non-specific enhancement of immune function in nestlings from LPS-immunized mothers. Consistent with enhanced immune function, nestlings of immunized mothers had a more robust inflammatory response to phytohaemagglutinin and higher fledging success. Our results suggest that maternal antigen exposure pre-laying can result in increased fitness for both mothers and offspring, depending on food availability.
Semigroups of data normalization functions

NARCIS (Netherlands)

Warrens, Matthijs J.

2016-01-01

Variable centering and scaling are functions that are typically used in data normalization. Various properties of centering and scaling functions are presented. It is shown that if we use two centering functions (or scaling functions) successively, the result depends on the order in which the
Vitamin C and Immune Function

Directory of Open Access Journals (Sweden)

Anitra C. Carr

2017-11-01

Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.
Does Exercise Alter Immune Function and Respiratory Infections?

Science.gov (United States)

Nieman, David C.

2001-01-01

This paper examines whether physical activity influences immune function as a consequence risk of infection from the common cold and other upper respiratory tract infections (URTI) and whether the immune system responds differently to moderate versus intense physical exertion. Research indicates that people who participate in regular moderate…
Tumor-altered dendritic cell function: implications for anti-tumor immunity

Directory of Open Access Journals (Sweden)

Kristian Michael Hargadon

2013-07-01

Full Text Available Dendritic cells are key regulators of both innate and adaptive immunity, and the array of immunoregulatory functions exhibited by these cells is dictated by their differentiation, maturation, and activation status. Although a major role for these cells in the induction of immunity to pathogens has long been appreciated, data accumulated over the last several years has demonstrated that DC are also critical regulators of anti-tumor immune responses. However, despite the potential for stimulation of robust anti-tumor immunity by DC, tumor-altered DC function has been observed in many cancer patients and tumor-bearing animals and is often associated with tumor immune escape. Such dysfunction has significant implications for both the induction of natural anti-tumor immune responses as well as the efficacy of immunotherapeutic strategies that target endogenous DC in situ or that employ exogenous DC as part of anti-cancer immunization maneuvers. In this review, the major types of tumor-altered DC function will be described, with emphasis on recent insights into the mechanistic bases for the inhibition of DC differentiation from hematopoietic precursors, the altered programming of DC precursors to differentiate into myeloid-derived suppressor cells or tumor-associated macrophages, the suppression of DC maturation and activation, and the induction of immunoregulatory DC by tumors, tumor-derived factors, and tumor-associated cells within the milieu of the tumor microenvironment. The impact of these tumor-altered cells on the quality of the overall anti-tumor immune response will also be discussed. Finally, this review will also highlight questions concerning tumor-altered DC function that remain unanswered, and it will address factors that have limited advances in the study of this phenomenon in order to focus future research efforts in the field on identifying strategies for interfering with tumor-associated DC dysfunction and improving DC-mediated anti
Zinc as a Gatekeeper of Immune Function

Directory of Open Access Journals (Sweden)

Inga Wessels

2017-11-01

Full Text Available After the discovery of zinc deficiency in the 1960s, it soon became clear that zinc is essential for the function of the immune system. Zinc ions are involved in regulating intracellular signaling pathways in innate and adaptive immune cells. Zinc homeostasis is largely controlled via the expression and action of zinc “importers” (ZIP 1–14, zinc “exporters” (ZnT 1–10, and zinc-binding proteins. Anti-inflammatory and anti-oxidant properties of zinc have long been documented, however, underlying mechanisms are still not entirely clear. Here, we report molecular mechanisms underlying the development of a pro-inflammatory phenotype during zinc deficiency. Furthermore, we describe links between altered zinc homeostasis and disease development. Consequently, the benefits of zinc supplementation for a malfunctioning immune system become clear. This article will focus on underlying mechanisms responsible for the regulation of cellular signaling by alterations in zinc homeostasis. Effects of fast zinc flux, intermediate “zinc waves”, and late homeostatic zinc signals will be discriminated. Description of zinc homeostasis-related effects on the activation of key signaling molecules, as well as on epigenetic modifications, are included to emphasize the role of zinc as a gatekeeper of immune function.
[Changes and the impact on immune function of opioid-dependent subjects by Jitai tabelets during the withdrawal stage].

Science.gov (United States)

Li, X X; Fan, H Y; Sun, L; Liang, J C; Deng, Y P

2017-04-10

Objective: To detect the changes in the immune function of opioid-dependent subjects during the withdrawal stage through the administration of Jitai tablet. Methods: Subjects were treated as Jitai tablet alone, Jitai tablet plus buprenorphine and placebo, in a randomized,double-blind, placebo-controlled trial. Before and after the 14(th) day of withdrawal, levels of immunoglobulin (IgM, IgA, IgG), T cell subsets (CD(3)(+), CD(4)(+), CD(8)(+), CD(4)(+)/CD(8)(+)) and cytokines (IL-2, IFN-γ, IL-4, IFN-γ/IL-4) were detected. Results: Compared with healthy people, immunity function before withdrawal among the opioid abusers showed higher levels of IgM, IL-2, IFN-γ, IL-4 and lower level of CD(3)(+)T, as (1.67±0.87) g/L, (14.44±13.50) % , (20.23±15.10) % , (1.97±1.59) % , (47.01±13.62) % , respectively, with difference statistically significant ( P 0.05). At the 14(th) day of withdrawal in placebo group, levels of IL-4 returned to normal while IFN-γ/IL-4 ratio increased by 3.43 times ( P 0.05). Compared with placebo group, fluctuation of IgG and IgM decreased in Jitai group during withdrawal period, together with a normal level of IgM at the 14(th) day. Level of IL-4 abnormally rose up by 0.54 times in Jitai tablet plus buprenorphine group, while IFN-γ/IL-4 ratio been switched back at the 14(th) day of withdrawal. Other immune indicators were not affected by medical interventions. Conclusion: We noticed that certain impairment of the immune function might be restored by Jitai tablet during the withdrawal period.
Tradeoffs between immune function and childhood growth among Amazonian forager-horticulturalists.

Science.gov (United States)

Urlacher, Samuel S; Ellison, Peter T; Sugiyama, Lawrence S; Pontzer, Herman; Eick, Geeta; Liebert, Melissa A; Cepon-Robins, Tara J; Gildner, Theresa E; Snodgrass, J Josh

2018-04-24

Immune function is an energetically costly physiological activity that potentially diverts calories away from less immediately essential life tasks. Among developing organisms, the allocation of energy toward immune function may lead to tradeoffs with physical growth, particularly in high-pathogen, low-resource environments. The present study tests this hypothesis across diverse timeframes, branches of immunity, and conditions of energy availability among humans. Using a prospective mixed-longitudinal design, we collected anthropometric and blood immune biomarker data from 261 Amazonian forager-horticulturalist Shuar children (age 4-11 y old). This strategy provided baseline measures of participant stature, s.c. body fat, and humoral and cell-mediated immune activity as well as subsample longitudinal measures of linear growth (1 wk, 3 mo, 20 mo) and acute inflammation. Multilevel analyses demonstrate consistent negative effects of immune function on growth, with children experiencing up to 49% growth reduction during periods of mildly elevated immune activity. The direct energetic nature of these relationships is indicated by ( i ) the manifestation of biomarker-specific negative immune effects only when examining growth over timeframes capturing active competition for energetic resources, ( ii ) the exaggerated impact of particularly costly inflammation on growth, and ( iii ) the ability of children with greater levels of body fat (i.e., energy reserves) to completely avoid the growth-inhibiting effects of acute inflammation. These findings provide evidence for immunologically and temporally diverse body fat-dependent tradeoffs between immune function and growth during childhood. We discuss the implications of this work for understanding human developmental energetics and the biological mechanisms regulating variation in human ontogeny, life history, and health.
Immune cells in the normal ovary and spontaneous ovarian tumors in the laying hen (Gallus domesticus) model of human ovarian cancer.

Science.gov (United States)

Bradaric, Michael J; Penumatsa, Krishna; Barua, Animesh; Edassery, Seby L; Yu, Yi; Abramowicz, Jacques S; Bahr, Janice M; Luborsky, Judith L

2013-01-01

Spontaneous ovarian cancer in chickens resembles human tumors both histologically and biochemically. The goal was to determine if there are differences in lymphocyte content between normal ovaries and ovarian tumors in chickens as a basis for further studies to understand the role of immunity in human ovarian cancer progression. Hens were selected using grey scale and color Doppler ultrasound to determine if they had normal or tumor morphology. Cells were isolated from ovaries (n = 6 hens) and lymphocyte numbers were determined by flow cytometry using antibodies to avian CD4 and CD8 T and B (Bu1a) cells. Ovarian sections from another set of hens (n = 26) were assessed to verify tumor type and stage and to count CD4, CD8 and Bu1a immunostained cells by morphometric analysis. T and B cells were more numerous in ovarian tumors than in normal ovaries by flow cytometry and immunohistochemistry. There were less CD4+ cells than CD8+ and Bu1a+ cells in normal ovaries or ovarian tumors. CD8+ cells were the dominant T cell sub-type in both ovarian stroma and in ovarian follicles compared to CD4+ cells. Bu1a+ cells were consistently found in the stroma of normal ovaries and ovarian tumors but were not associated with follicles. The number of immune cells was highest in late stage serous tumors compared to endometrioid and mucinous tumors. The results suggest that similar to human ovarian cancer there are comparatively more immune cells in chicken ovarian tumors than in normal ovaries, and the highest immune cell content occurs in serous tumors. Thus, this study establishes a foundation for further study of tumor immune responses in a spontaneous model of ovarian cancer which will facilitate studies of the role of immunity in early ovarian cancer progression and use of the hen in pre-clinical vaccine trials.

Control of Immune Cell Homeostasis and Function by lncRNAs.

Science.gov (United States)

Mowel, Walter K; Kotzin, Jonathan J; McCright, Sam J; Neal, Vanessa D; Henao-Mejia, Jorge

2018-01-01

The immune system is composed of diverse cell types that coordinate responses to infection and maintain tissue homeostasis. In each of these cells, extracellular cues determine highly specific epigenetic landscapes and transcriptional profiles to promote immunity while maintaining homeostasis. New evidence indicates that long non-coding RNAs (lncRNAs) play crucial roles in epigenetic and transcriptional regulation in mammals. Thus, lncRNAs have emerged as key regulatory molecules of immune cell gene expression programs in response to microbial and tissue-derived cues. We review here how lncRNAs control the function and homeostasis of cell populations during immune responses, emphasizing the diverse molecular mechanisms by which lncRNAs tune highly contextualized transcriptional programs. In addition, we discuss the new challenges faced in interrogating lncRNA mechanisms and function in the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.
TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

Science.gov (United States)

Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

2008-05-02

Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.
Learning and Memory... and the Immune System

Science.gov (United States)

Marin, Ioana; Kipnis, Jonathan

2013-01-01

The nervous system and the immune system are two main regulators of homeostasis in the body. Communication between them ensures normal functioning of the organism. Immune cells and molecules are required for sculpting the circuitry and determining the activity of the nervous system. Within the parenchyma of the central nervous system (CNS),…
Normal families and isolated singularities of meromorphic functions

International Nuclear Information System (INIS)

Chee, P.S.; Subramaniam, A.

1985-06-01

Based on the criterion of Zalcman for normal families, a generalization of a well-known result relating normal families and isolated essential singularities of meromorphic functions is proved, using a theorem of Lehto and Virtanen on normal functions. (author)
Roles of Zinc Signaling in the Immune System.

Science.gov (United States)

Hojyo, Shintaro; Fukada, Toshiyuki

2016-01-01

Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.
[Effects of Early Enteral Immunonutrition on Postoperative Immune Function and Rehabilitation of Patients with Gastric Cancer and Nutritional Risk].

Science.gov (United States)

Peng, Chang-Bing; Li, Wen-Zhong; Xu, Rui; Zhuang, Wen

2017-05-01

To investigate the effects of early enteral immunonutrition on postoperative immune function and rehabilitation of gastric cancer patients with nutritional risk. New hospitalized patients with gastric cancer were evaluated the nutrient status based on NRS 2002. The patients who scored between 3 to 5 points were randomized into two groups(30 cases for each group), and those in experimental group were given 7-d early postoperative enteral immune nutrition, those in control group were given normal nutrition. The immune indexes (CD3 + , CD4 + , CD8 + and CD4 + /CD8 + ) and nutritional indexes(transferrin, pre-albumin, albumin) were measured before operation and at the 3 rd and 7 th day postoperatively. In addition, the first flatus time, gastrointestinal adverse reactions and complications, length of hospital stays were compared between the two groups. The level of CD4 + /CD8 + and transferrin, pre-albumin, albumin in experimental group were significantly higher than those in control group at the third and seventh day postoperatively ( P 0.05). Early enteral immunonutrition can effectively promote the recovery of nutritional status and immune function in gastric cancer patients with nutrition risk.
The multitasking organ: recent insights into skin immune function.

Science.gov (United States)

Di Meglio, Paola; Perera, Gayathri K; Nestle, Frank O

2011-12-23

The skin provides the first line defense of the human body against injury and infection. By integrating recent findings in cutaneous immunology with fundamental concepts of skin biology, we portray the skin as a multitasking organ ensuring body homeostasis. Crosstalk between the skin and its microbial environment is also highlighted as influencing the response to injury, infection, and autoimmunity. The importance of the skin immune network is emphasized by the identification of several skin-resident cell subsets, each with its unique functions. Lessons learned from targeted therapy in inflammatory skin conditions, such as psoriasis, provide further insights into skin immune function. Finally, we look at the skin as an interacting network of immune signaling pathways exemplified by the development of a disease interactome for psoriasis. Copyright © 2011 Elsevier Inc. All rights reserved.
The effects of probiotics, prebiotics and synbiotics on gut flora, immune function and blood characteristics of broilers

OpenAIRE

Akoy, Rebin Aswad Mirza

2015-01-01

Abstract The microbial populations in the gastrointestinal tracts of poultry play an important role in normal digestive processes and in maintaining animal health. The purpose of this study was to evaluate the effects of probiotics, prebiotics and synbiotics on the growth parameters, gut ecosystem, histology and immune function. In this study, four experiments one in vitro and three in vivo were conducted using specific pathogen free (SPF) and Hubbard broiler chickens. The first exper...
Strategies to enhance immune function for marathon runners : what can be done?

DEFF Research Database (Denmark)

Åkerström, Thorbjörn; Pedersen, Bente K

2007-01-01

immune cells. During this period of immune suppression, by some referred to as an 'open window' in immune function, it has been hypothesised that viruses and bacteria might gain a foothold, which would increase the risk of infections. In light of this, nutritional interventions that can enhance immune...
Normal Function of the Colon and Anorectal Area

Science.gov (United States)

... What is Constipation Introduction: What is Constipation? Normal Function Common Questions & Mistaken Beliefs Signs & Symptoms Symptoms Overview ... What is Constipation Introduction: What is Constipation? Normal Function Common Questions & Mistaken Beliefs Signs & Symptoms Symptoms Overview ...
Trade-off between growth and immune function : a meta-analysis of selection experiments

NARCIS (Netherlands)

van der Most, Peter; de Jong, Berber; Parmentier, Henk K.; Verhulst, Simon

P>1. Evidence suggests that developing and maintaining an effective immune system may be costly and that an organism has to make a trade-off between immune function and other fitness-enhancing traits. To test for a trade-off between growth and immune function we carried out a meta-analysis of data
Normal Functions As A New Way Of Defining Computable Functions

Directory of Open Access Journals (Sweden)

Leszek Dubiel

2004-01-01

Full Text Available Report sets new method of defining computable functions. This is formalization of traditional function descriptions, so it allows to define functions in very intuitive way. Discovery of Ackermann function proved that not all functions that can be easily computed can be so easily described with Hilbert’s system of recursive functions. Normal functions lack this disadvantage.
Normal Functions as a New Way of Defining Computable Functions

Directory of Open Access Journals (Sweden)

Leszek Dubiel

2004-01-01

Full Text Available Report sets new method of defining computable functions. This is formalization of traditional function descriptions, so it allows to define functions in very intuitive way. Discovery of Ackermann function proved that not all functions that can be easily computed can be so easily described with Hilbert's system of recursive functions. Normal functions lack this disadvantage.
Sleep and immune function: glial contributions and consequences of aging.

Science.gov (United States)

Ingiosi, Ashley M; Opp, Mark R; Krueger, James M

2013-10-01

The reciprocal interactions between sleep and immune function are well-studied. Insufficient sleep induces innate immune responses as evidenced by increased expression of pro-inflammatory mediators in the brain and periphery. Conversely, immune challenges upregulate immunomodulator expression, which alters central nervous system-mediated processes and behaviors, including sleep. Recent studies indicate that glial cells, namely microglia and astrocytes, are active contributors to sleep and immune system interactions. Evidence suggests glial regulation of these interactions is mediated, in part, by adenosine and adenosine 5'-triphosphate actions at purinergic type 1 and type 2 receptors. Furthermore, microglia and astrocytes may modulate declines in sleep-wake behavior and immunity observed in aging. Copyright © 2013. Published by Elsevier Ltd.
In-Situ Monitoring of Immune Function, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — Monitoring the health and wellness of mission pilots is a critically important function. Space flight has an adverse effect on the human immune response. During...
Functional comparison of innate immune signaling pathways in primates.

Directory of Open Access Journals (Sweden)

Luis B Barreiro

2010-12-01

Full Text Available Humans respond differently than other primates to a large number of infections. Differences in susceptibility to infectious agents between humans and other primates are probably due to inter-species differences in immune response to infection. Consistent with that notion, genes involved in immunity-related processes are strongly enriched among recent targets of positive selection in primates, suggesting that immune responses evolve rapidly, yet providing only indirect evidence for possible inter-species functional differences. To directly compare immune responses among primates, we stimulated primary monocytes from humans, chimpanzees, and rhesus macaques with lipopolysaccharide (LPS and studied the ensuing time-course regulatory responses. We find that, while the universal Toll-like receptor response is mostly conserved across primates, the regulatory response associated with viral infections is often lineage-specific, probably reflecting rapid host-virus mutual adaptation cycles. Additionally, human-specific immune responses are enriched for genes involved in apoptosis, as well as for genes associated with cancer and with susceptibility to infectious diseases or immune-related disorders. Finally, we find that chimpanzee-specific immune signaling pathways are enriched for HIV-interacting genes. Put together, our observations lend strong support to the notion that lineage-specific immune responses may help explain known inter-species differences in susceptibility to infectious diseases.
Ex vivo cytosolic delivery of functional macromolecules to immune cells.

Directory of Open Access Journals (Sweden)

Armon Sharei

Full Text Available Intracellular delivery of biomolecules, such as proteins and siRNAs, into primary immune cells, especially resting lymphocytes, is a challenge. Here we describe the design and testing of microfluidic intracellular delivery systems that cause temporary membrane disruption by rapid mechanical deformation of human and mouse immune cells. Dextran, antibody and siRNA delivery performance is measured in multiple immune cell types and the approach's potential to engineer cell function is demonstrated in HIV infection studies.
Immune activation is associated with decreased thymic function in ...

African Journals Online (AJOL)

Background: Reduced thymic function causes poor immunological reconstitution in human immunodeficiency virus (HIV)-positive patients on combined antiretroviral therapy (cART). The association between immune activation and thymic function in asymptomatic HIVpositive treatment-naive individuals has thus far not been ...
T lymphocytes and normal tissue responses to radiation

International Nuclear Information System (INIS)

Schaue, Dörthe; McBride, William H.

2012-01-01

There is compelling evidence that lymphocytes are a recurring feature in radiation damaged normal tissues, but assessing their functional significance has proven difficult. Contradictory roles have been postulated in both tissue pathogenesis and protection, although these are not necessarily mutually exclusive as the immune system can display what may seem to be opposing faces at any one time. While the exact role of T lymphocytes in irradiated normal tissue responses may still be obscure, their accumulation after tissue damage suggests they may be critical targets for radiotherapeutic intervention and worthy of further study. This is accentuated by recent findings that pathologically damaged “self,” such as occurs after exposure to ionizing radiation, can generate danger signals with the ability to activate pathways similar to those that activate adoptive immunity to pathogens. In addition, the demonstration of T cell subsets with their recognition radars tuned to “self” moieties has revolutionized our ideas on how all immune responses are controlled and regulated. New concepts of autoimmunity have resulted based on the dissociation of immune functions between different subsets of immune cells. It is becoming axiomatic that the immune system has the power to regulate radiation-induced tissue damage, from failure of regeneration to fibrosis, to acute and chronic late effects, and even to carcinogenesis. Our understanding of the interplay between T lymphocytes and radiation-damaged tissue may still be rudimentary but this is a good time to re-examine their potential roles, their radiobiological and microenvironmental influences, and the possibilities for therapeutic manipulation. This review will discuss the yin and yang of T cell responses within the context of radiation exposures, how they might drive or protect against normal tissue side effects and what we may be able do about it.
Natural functional SNPs in miR-155 alter its expression level, blood cell counts and immune responses

Directory of Open Access Journals (Sweden)

Congcong Li

2016-08-01

Full Text Available miR-155 has been confirmed to be a key factor in immune responses in humans and other mammals. Therefore, investigation of variations in miR-155 could be useful for understanding the differences in immunity between individuals. In this study, four SNPs in miR-155 were identified in mice (Mus musculus and humans (Homo sapiens. In mice, the four SNPs were closely linked and formed two miR-155 haplotypes (A and B. Ten distinct types of blood parameters were associated with miR-155 expression under normal conditions. Additionally, 4 and 14 blood parameters were significantly different between these two genotypes under normal and lipopolysaccharide (LPS stimulation conditions, respectively. Moreover, the expression levels of miR-155, the inflammatory response to LPS stimulation and the lethal ratio following Salmonella typhimurium infection were significantly increased in mice harboring the AA genotype. Further, two SNPs, one in the loop region and the other near the 3' terminal of pre-miR-155, were confirmed to be responsible for the differential expression of miR-155 in mice. Interestingly, two additional SNPs, one in the loop region and the other in the middle of miR-155*, modulated the function of miR-155 in humans. Predictions of secondary RNA structure using RNAfold showed that these SNPs affected the structure of miR-155 in both mice and humans. Our results provide novel evidence of the natural functional SNPs of miR-155 in both mice and humans, which may affect the expression levels of mature miR-155 by modulating its secondary structure. The SNPs of human miR-155 may be considered as causal mutations for some immune-related diseases in the clinic. The two genotypes of mice could be used as natural models for studying the mechanisms of immune diseases caused by abnormal expression of miR-155 in humans.

Diverse novel functions of neutrophils in immunity, inflammation, and beyond.

Science.gov (United States)

Mócsai, Attila

2013-07-01

Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10-20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellular pathogens such as viruses and mycobacteria. They have been shown to intimately shape the adaptive immune response at various levels, including marginal zone B cells, plasmacytoid dendritic cells and T cell populations, and even to control NK cell homeostasis. Neutrophils have been shown to mediate an alternative pathway of systemic anaphylaxis and to participate in allergic skin reactions. Finally, neutrophils were found to be involved in physiological and pathological processes beyond the immune system, such as diabetes, atherosclerosis, and thrombus formation. Many of those functions appear to be related to their unique ability to release neutrophil extracellular traps even in the absence of pathogens. This review summarizes those novel findings on versatile functions of neutrophils and how they change our view of neutrophil biology in health and disease.
Functional evaluation of transplanted kidneys in normal function and acute rejection using BOLD MR imaging

International Nuclear Information System (INIS)

Xiao Wenbo; Xu Jingjing; Wang Qindong; Xu Ying; Zhang Minming

2012-01-01

In this study, we evaluated a large number of subjects using BOLD MRI to provide more information about oxygen metabolism in the normal function of transplanted kidneys and to distinguish acute graft rejection from normal function kidneys. This study included 122 subjects (20 volunteers, 72 patients with normal functioning transplants, and 21 patients with acute rejection), and 9 patients had normal function grafts received examination while grafts dysfunction occurred within 6 months during the follow-up. The R2* (1/s) values in the cortex and medulla as well as the R2* ratio of the medulla to cortex (R2* ratio of M/C) were recorded. The R2* values of the medulla were higher than those of the cortex in the normal function group and the volunteers which have a steep R2* ratio of M/C. All the R2* values in the acute rejection group were lower than those in the normal function grafts group (P 1.1) is an important reason for keeping clinical normal function.
Low Dose Ionizing Radiation Modulates Immune Function

International Nuclear Information System (INIS)

Nelson, Gregory A.

2016-01-01

In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a 'Th2 polarized' immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in
Low Dose Ionizing Radiation Modulates Immune Function

Energy Technology Data Exchange (ETDEWEB)

Nelson, Gregory A. [Loma Linda Univ., CA (United States)

2016-01-12

In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a “Th2 polarized” immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in the
Influence of Physical Activity and Nutrition on Obesity-Related Immune Function

Directory of Open Access Journals (Sweden)

Chun-Jung Huang

2013-01-01

Full Text Available Research examining immune function during obesity suggests that excessive adiposity is linked to impaired immune responses leading to pathology. The deleterious effects of obesity on immunity have been associated with the systemic proinflammatory profile generated by the secretory molecules derived from adipose cells. These include inflammatory peptides, such as TNF-α, CRP, and IL-6. Consequently, obesity is now characterized as a state of chronic low-grade systemic inflammation, a condition considerably linked to the development of comorbidity. Given the critical role of adipose tissue in the inflammatory process, especially in obese individuals, it becomes an important clinical objective to identify lifestyle factors that may affect the obesity-immune system relationship. For instance, stress, physical activity, and nutrition have each shown to be a significant lifestyle factor influencing the inflammatory profile associated with the state of obesity. Therefore, the purpose of this review is to comprehensively evaluate the impact of lifestyle factors, in particular psychological stress, physical activity, and nutrition, on obesity-related immune function with specific focus on inflammation.
Behavioural conditioning of immune functions: how the central nervous system controls peripheral immune responses by evoking associative learning processes.

Science.gov (United States)

Riether, Carsten; Doenlen, Raphaël; Pacheco-López, Gustavo; Niemi, Maj-Britt; Engler, Andrea; Engler, Harald; Schedlowski, Manfred

2008-01-01

During the last 30 years of psychoneuroimmunology research the intense bi-directional communication between the central nervous system (CNS) and the immune system has been demonstrated in studies on the interaction between the nervous-endocrine-immune systems. One of the most intriguing examples of such interaction is the capability of the CNS to associate an immune status with specific environmental stimuli. In this review, we systematically summarize experimental evidence demonstrating the behavioural conditioning of peripheral immune functions. In particular, we focus on the mechanisms underlying the behavioural conditioning process and provide a theoretical framework that indicates the potential feasibility of behaviourally conditioned immune changes in clinical situations.
Incubation period and immune function: A comparative field study among coexisting birds

Science.gov (United States)

Palacios, M.G.; Martin, T.E.

2006-01-01

Developmental periods are integral components of life history strategies that can have important fitness consequences and vary enormously among organisms. However, the selection pressures and mechanisms causing variation in length of developmental periods are poorly understood. Particularly puzzling are prolonged developmental periods, because their selective advantage is unclear. Here we tested the hypotheses that immune function is stronger in species that are attacked at a higher rate by parasites and that prolonged embryonic development allows the development of this stronger immune system. Through a comparative field study among 12 coexisting passerine bird species, we show that species with higher blood parasite prevalence mounted stronger cellular immune responses than species with lower prevalence. These results provide support for the hypothesis that species facing greater selection pressure from parasites invest more in immune function. However, species with longer incubation periods mounted weaker cellular immune responses than species with shorter periods. Therefore, cellular immune responses do not support the hypothesis that longer development time enhances immunocompentence. Future studies should assess other components of the immune system and test alternative causes of variation in incubation periods among bird species. ?? Springer-Verlag 2005.
Normal central retinal function and structure preserved in retinitis pigmentosa.

Science.gov (United States)

Jacobson, Samuel G; Roman, Alejandro J; Aleman, Tomas S; Sumaroka, Alexander; Herrera, Waldo; Windsor, Elizabeth A M; Atkinson, Lori A; Schwartz, Sharon B; Steinberg, Janet D; Cideciyan, Artur V

2010-02-01

To determine whether normal function and structure, as recently found in forms of Usher syndrome, also occur in a population of patients with nonsyndromic retinitis pigmentosa (RP). Patients with simplex, multiplex, or autosomal recessive RP (n = 238; ages 9-82 years) were studied with static chromatic perimetry. A subset was evaluated with optical coherence tomography (OCT). Co-localized visual sensitivity and photoreceptor nuclear layer thickness were measured across the central retina to establish the relationship of function and structure. Comparisons were made to patients with Usher syndrome (n = 83, ages 10-69 years). Cross-sectional psychophysical data identified patients with RP who had normal rod- and cone-mediated function in the central retina. There were two other patterns with greater dysfunction, and longitudinal data confirmed that progression can occur from normal rod and cone function to cone-only central islands. The retinal extent of normal laminar architecture by OCT corresponded to the extent of normal visual function in patients with RP. Central retinal preservation of normal function and structure did not show a relationship with age or retained peripheral function. Usher syndrome results were like those in nonsyndromic RP. Regional disease variation is a well-known finding in RP. Unexpected was the observation that patients with presumed recessive RP can have regions with functionally and structurally normal retina. Such patients will require special consideration in future clinical trials of either focal or systemic treatment. Whether there is a common molecular mechanism shared by forms of RP with normal regions of retina warrants further study.
Do all roads lead to Rome? The role of neuro-immune interactions before birth in the programming of offspring obesity

Directory of Open Access Journals (Sweden)

Christine eJasoni

2015-02-01

Full Text Available The functions of the nervous system can be powerfully modulated by the immune system. Although traditionally considered to be quite separate, neuro-immune interactions are increasingly recognized as critical for both normal and pathological nervous system function in the adult. However, a growing body of information supports a critical role for neuro-immune interactions before birth, particularly in the prenatal programming of later-life neurobehavioral disease risk. This review will focus on maternal obesity, as it represents an environment of pathological immune system function during pregnancy that elevates offspring neurobehavioral disease risk. We will first delineate the normal role of the immune system during pregnancy, including the role of the placenta as both a barrier and relayer of inflammatory information between the maternal and fetal environments. This will be followed by the current exciting findings of how immuno-modulatory molecules may elevate offspring risk of neurobehavioral disease by altering brain development and, consequently, later life function. Finally, by drawing parallels with pregnancy complications other than obesity, we will suggest that aberrant immune activation, irrespective of its origin, may lead to neuro-immune interactions that otherwise would not exist in the developing brain. These interactions could conceivably derail normal brain development and/or later life function, and thereby elevate risk for obesity and other neurobehavioral disorders later in the offspring’s life.
A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues

Science.gov (United States)

Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.

2016-01-01

Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654
Effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer

Directory of Open Access Journals (Sweden)

Hua-Jia Dai

2016-05-01

Full Text Available Objective: To investigate the effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer. Methods: A total of 100 patients with gastric cancer were selected and randomly divided into the observation group and the control group with 50 cases in each group. The control group received routine perioperative enteral and parenteral nutrition, on the basis of conventional nutritional support, and the observation group was given enteral nutrition emulsion immune support. Then, the immune function and the inflammatory factor of postoperative day 1 and day 7 were compared between the two groups. Results: (1 With the preoperative data as the basis, the levels of serum IgG, IgA, C3 and C4 decreased at the postoperative day 1 and then increased at the postoperative day 7, while the level of IgM showed an increasing trend and then a decreasing trend in the two groups, and the corresponding figures for the postoperative day 1 and day 7 were statistically different between the two groups. In the observation group, the levels of IgG, IgA, C3 and C4 were higher, while the level of IgM was lower at the postoperative day 1 and day 7 than that in the control group, and the differences were statistically significant; (2 With the preoperative data as the basis, the levels of serum TNF-α, IL-6 and CRP significantly increased at the postoperative day 1 and then decreased at the postoperative day 7 in the two groups, and the corresponding figures for the postoperative day 1 and day 7 in the observation group were lower than those in the control group, and the differences were statistically significant. Conclusion: Immune nutritional support can help to reduce the damage of immune function and the inflammatory response induced by surgery in patients with gastric cancer, which is worthy of clinical application.
Characteristic functions of scale mixtures of multivariate skew-normal distributions

KAUST Repository

Kim, Hyoung-Moon

2011-08-01

We obtain the characteristic function of scale mixtures of skew-normal distributions both in the univariate and multivariate cases. The derivation uses the simple stochastic relationship between skew-normal distributions and scale mixtures of skew-normal distributions. In particular, we describe the characteristic function of skew-normal, skew-t, and other related distributions. © 2011 Elsevier Inc.
Effect of long-term fluticasone treatment on immune function in horses with heaves.

Science.gov (United States)

Dauvillier, J; Felippe, M J B; Lunn, D P; Lavoie-Lamoureux, A; Leclère, M; Beauchamp, G; Lavoie, J-P

2011-01-01

Corticosteroids currently are the most effective pharmacological treatment available to control heaves in horses. Systemically administered corticosteroids have been shown to alter immune response in horses, humans, and other species. Aerosolized administration theoretically minimizes systemic adverse effects, but the effect of inhaled corticosteroids on immune function has not been evaluated in horses. To evaluate the effects of prolonged administration of inhaled fluticasone on the immune system of heaves-affected horses. Heaves-affected horses were treated with inhaled fluticasone (n = 5) for 11 months or received environmental modifications only (n = 5). Prospective analysis. Clinical parameters and CBC, lymphocyte subpopulations and function, and circulating neutrophil gene expression were sequentially measured. Primary and anamnestic immune responses also were evaluated by measuring antigen-specific antibodies in response to vaccination with bovine viral antigen and tetanus toxoid, respectively. No clinical adverse effects were observed and no differences in immune function were detected between treated and untreated horses. The treatment of heaves-affected horses with inhaled fluticasone at therapeutic dosages for 11 months has no significant detectable effect on innate and adaptive (both humoral and cell-mediated) immune parameters studied. These results suggest that prolonged administration of fluticasone would not compromise the systemic immune response to pathogens nor vaccination in adult horses. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Neutrophil degranulation and immunosuppression in patients with GBM: restoration of cellular immune function by targeting arginase I.

Science.gov (United States)

Sippel, Trisha R; White, Jason; Nag, Kamalika; Tsvankin, Vadim; Klaassen, Marci; Kleinschmidt-DeMasters, B K; Waziri, Allen

2011-11-15

The source of glioblastoma (GBM)-associated immunosuppression remains multifactorial. We sought to clarify and therapeutically target myeloid cell-derived peripheral immunosuppression in patients with GBM. Direct ex vivo T-cell function, serum Arginase I (ArgI) levels, and circulating myeloid lineage populations were compared between patients with GBM and normal donors or patients with other intracranial tumors. Immunofunctional assays were conducted using bulk and sorted cell populations to explore the potential transfer of myeloid cell-mediated immunosuppression and to identify a potential mechanism for these effects. ArgI-mediated immunosuppression was therapeutically targeted in vitro through pharmacologic inhibition or arginine supplementation. We identified a significantly expanded population of circulating, degranulated neutrophils associated with elevated levels of serum ArgI and decreased T-cell CD3ζ expression within peripheral blood from patients with GBM. Sorted CD11b(+) cells from patients with GBM were found to markedly suppress normal donor T-cell function in coculture, and media harvested from mitogen-stimulated GBM peripheral blood mononuclear cell (PBMC) or GBM-associated mixed lymphoid reactions showed ArgI levels that were significantly higher than controls. Critically, T-cell suppression in both settings could be completely reversed through pharmacologic ArgI inhibition or with arginine supplementation. These data indicate that peripheral cellular immunosuppression in patients with GBM is associated with neutrophil degranulation and elevated levels of circulating ArgI, and that T-cell function can be restored in these individuals by targeting ArgI. These data identify a novel pathway of GBM-mediated suppression of cellular immunity and offer a potential therapeutic window for improving antitumor immunity in affected patients.
Olive oil and immune system functions: potential involvement in immunonutrition

Directory of Open Access Journals (Sweden)

Álvarez de Cienfuegos, Gerardo

2004-03-01

Full Text Available Olive oil plays a crucial role as a main component of the Mediterranean diet, which has shown important benefits for the human health. According to the current knowledge, the administration of diets containing olive oil exerts some beneficial effects on the immune system functions due likely to the action of oleic acid rather than other substances contained in this fat. In the last few years, epidemiological, clinical and experimental studies have evidenced the potential of certain dietary lipids (containing polyunsaturated or monounsaturated fatty acids as modulators of immune system functions due to their ability to suppress several functions of immune system in both humans and animals. As a result, these fats have been applied in the reduction of symptoms from diseases characterized by an overactivation of the immune system (autoimmune diseases or in the reduction of cancer risk. Here, we review several relevant experimental and clinical data associated with the beneficial effects of olive oil upon the health, the mechanisms of action and the immune function susceptible of being be altered by the administration of dietary lipids and particularly of olive oil. In addition, we will also discuss the detrimental effects on the immune system functions caused by the administration of certain dietary lipids attributed mainly to a reduction of host natural resistance against infectious microorganisms as well as the involvement of olive oil diets in the regulation of immune resistance.El aceite de oliva tiene un papel crucial como componente de la dieta Mediterránea, con importantes beneficios sobre la salud humana. Dietas conteniendo aceite de oliva actúan de manera favorable en las funciones del sistema inmune por la acción sobretodo del ácido oleico. Los estudios epidemiológicos, clínicos y experimentales publicados en los últimos años demuestran que ciertos lípidos de la dieta [ácidos grasos monoinsaturados (MUFA y poliinsaturados (PUFA
Age-dependent changes in innate immune phenotype and function in rhesus macaques (Macaca mulatta

Directory of Open Access Journals (Sweden)

Mark Asquith

2012-06-01

Full Text Available Aged individuals are more susceptible to infections due to a general decline in immune function broadly referred to as immune senescence. While age-related changes in the adaptive immune system are well documented, aging of the innate immune system remains less well understood, particularly in nonhuman primates. A more robust understanding of age-related changes in innate immune function would provide mechanistic insight into the increased susceptibility of the elderly to infection. Rhesus macaques have proved a critical translational model for aging research, and present a unique opportunity to dissect age-dependent modulation of the innate immune system. We examined age-related changes in: (i innate immune cell frequencies; (ii expression of pattern recognition receptors (PRRs and innate signaling molecules; (iii cytokine responses of monocytes and dendritic cells (DC following stimulation with PRR agonists; and (iv plasma cytokine levels in this model. We found marked changes in both the phenotype and function of innate immune cells. This included an age-associated increased frequency of myeloid DC (mDC. Moreover, we found toll-like receptor (TLR agonists lipopolysaccharide (TLR4, fibroblast stimulating ligand-1 (TLR2/6, and ODN2006 (TLR7/9 induced reduced cytokine responses in aged mDC. Interestingly, with the exception of the monocyte-derived TNFα response to LPS, which increased with age, TNFα, IL-6, and IFNα responses declined with age. We also found that TLR4, TLR5, and innate negative regulator, sterile alpha and TIR motif containing protein (SARM, were all expressed at lower levels in young animals. By contrast, absent in melanoma 2 and retinoic acid-inducible gene I expression was lowest in aged animals. Together, these observations indicate that several parameters of innate immunity are significantly modulated by age and contribute to differential immune function in aged macaques.
Studying the Impact of Spaceflight Environment on Immune Functions Using New Molecular Diagnostics System

Science.gov (United States)

Cohen, Luchino

Immune functions are altered during space flights. Latent virus reactivation, reduction in the number of immune cells, decreased cell activation and increased sensitivity of astronauts to infections following their return on Earth demonstrate that the immune system is less efficient during space flight. The causes of this immune deficiency are not fully understood and this dysfunction during long-term missions could result in the appearance of opportunistic infections or a decrease in the immuno-surveillance mechanisms that eradicate cancer cells. Therefore, the immune functions of astronauts will have to be monitored continuously during long-term missions in space, using miniature and semi-automated diagnostic systems. The objectives of this project are to study the causes of space-related immunodeficiency, to develop countermeasures to maintain an optimal immune function and to improve our capacity to detect infectious diseases during space missions through the monitoring of astronauts' immune system. In order to achieve these objectives, an Immune Function Diagnostic System (IFDS) will be designed to perform a set of immunological assays on board spacecrafts or on planet-bound bases. Through flow cytometric assays and molecular biology analyses, this diagnostic system could improve medical surveillance of astronauts and could be used to test countermeasures aimed at preventing immune deficiency during space missions. The capacity of the instrument to assess cellular fluorescence and to quantify the presence of soluble molecules in biological samples would support advanced molecular studies in space life sciences. Finally, such diagnostic system could also be used on Earth in remote areas or in mobile hospitals following natural disasters to fight against infectious diseases and other pathologies.
Hyperthyroidism caused by acquired immune deficiency syndrome.

Science.gov (United States)

Wang, J-J; Zhou, J-J; Yuan, X-L; Li, C-Y; Sheng, H; Su, B; Sheng, C-J; Qu, S; Li, H

2014-01-01

Acquired immune deficiency syndrome (AIDS) is an immune deficiency disease. The etiology of hyperthyroidism, which can also be immune-related, is usually divided into six classical categories, including hypophyseal, hypothalamic, thyroid, neoplastic, autoimmune and inflammatory hyperthyroidism. Hyperthyroidism is a rare complication of highly active antimicrobial therapy (HAART) for human immunodeficiency virus (HIV). Hyperthyroidism caused directly by AIDS has not been previously reported. A 29-year-old man who complained of dyspnea and asthenia for 1 month, recurrent fever for more than 20 days, and breathlessness for 1 week was admitted to our hospital. The thyroid function test showed that the level of free thyroxine (FT4) was higher than normal and that the level of thyroid-stimulating hormone (TSH) was below normal. He was diagnosed with hyperthyroidism. Additional investigations revealed a low serum albumin level and chest infection, along with diffuse lung fibrosis. Within 1 month, he experienced significant weight loss, no hand tremors, intolerance of heat, and perspiration proneness. We recommended an HIV examination; subsequently, AIDS was diagnosed based on the laboratory parameters. This is the first reported case of hyperthyroidism caused by AIDS. AIDS may cause hyperthyroidism by immunization regulation with complex, atypical, and easily ignored symptoms. Although hyperthyroidism is rare in patients with AIDS, clinicians should be aware of this potential interaction and should carefully monitor thyroid function in HIV-positive patients.
Endometrial immune markers are potential predictors of normal fertility and pregnancy after in vitro fertilization.

Science.gov (United States)

Kofod, Louise; Lindhard, Anette; Bzorek, Michael; Eriksen, Jens Ole; Larsen, Lise Grupe; Hviid, Thomas Vauvert F

2017-09-01

Elucidating immune mechanisms in the endometrium, which lead to the success of implantation and pregnancy, is important in reproductive medicine. Studies of immune cell abundance have shown conflicting results, and the expression and importance of HLA class Ib proteins in pre-implantation endometrium have not yet been investigated. The study population consisted of four subgroups: a hydrosalpinx, a salpingectomy, an unexplained infertility, and a fertile control group. Endometrial samples were collected during the implantation window. Immune markers (CD56 + and CD16 + cells, FoxP3 + Tregs, HLA-G, HLA-F) were quantified in the samples. The outcome of the subsequent IVF treatment was recorded. Increased CD56 + uNK cells and high HLA-G expression served as predictor for successful pregnancy outcome. HLA-F expression was positively correlated with uNK cells, being indirectly predictive for achieving pregnancy. Endometrial uNK cell abundance in the pre-implantation endometrium seems to be important for normal fertility and pregnancy success, and they may be used as clinical markers to predict implantation success in IVF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Perceived Immune Status and Sleep: A Survey among Dutch Students

Directory of Open Access Journals (Sweden)

Anouk A. M. T. Donners

2015-01-01

Full Text Available Reduced immune functioning may have a negative impact on sleep and health, and vice versa. A survey among Dutch young adults (18–35 years old was administered to collect information on perception of reduced immunity and its relationship to sleep disorders, sleep duration, and quality. Sleep disorders were assessed with the SLEEP-50 questionnaire subscales of sleep apnea, insomnia, circadian rhythm disorder, and daily functioning. Dutch young adults (N = 574 completed the survey. Among them, subjects (N = 209; 36.4% reported perceived reduced immunity. Relative to those with a normal immune status, subjects reporting reduced immunity had significantly higher scores (p=0.0001 on sleep apnea (2.6 versus 3.6, insomnia (5.1 versus 6.8, and circadian rhythm disorder (2.1 versus 2.7. Subjects reporting reduced immunity also had significantly poorer daily functioning scores (5.4 versus 7.6, p=0.0001. No differences were observed in total sleep time, but those reporting reduced immunity had significantly poorer ratings of sleep quality (6.8 versus 7.2, p=0.0001. Our findings suggest that perceived reduced immunity is associated with sleep disturbances, impaired daily functioning, and a poorer sleep quality. Experimental studies including the assessment of immune biomarkers and objective measures of sleep (polysomnography should confirm the current observations.

Trade-offs between sexual advertisement and immune function in the pied flycatcher (Ficedula hypoleuca).

OpenAIRE

Kilpimaa, Janne; Alatalo, Rauno V.; Siitari, Heli

2004-01-01

Good genes models of sexual selection assume that sexual advertisement is costly and thus the level of advertisement honestly reveals heritable viability. Recently it has been suggested that an important cost of sexual advertisement might be impairment of the functioning of the immune system. In this field experiment we investigated the possible trade-offs between immune function and sexual advertisement by manipulating both mating effort and activity of immune defence in male pied flycatcher...
Streptavidin-functionalized capillary immune microreactor for highly efficient chemiluminescent immunoassay

Energy Technology Data Exchange (ETDEWEB)

Yang Zhanjun [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China); Zong Chen [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Ju Huangxian, E-mail: hxju@nju.edu.cn [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Yan Feng, E-mail: yanfeng2007@sohu.com [Jiangsu Institute of Cancer Prevention and Cure, Nanjing 210009 (China)

2011-11-07

Highlights: {yields} A novel capillary immune microreactor was proposed for highly efficient flow-through chemiluminescent immunoassay. {yields} The microreactor was prepared by functionalizing capillary inner wall with streptavidin for capture of biotinylated antibody. {yields} The proposed immunoassay method showed wide dynamic range, good reproducibility, stability and practicality. {yields} The microreactor was low-cost and disposable, and possessed several advantages over the conventional immunoreactors. - Abstract: A streptavidin functionalized capillary immune microreactor was designed for highly efficient flow-through chemiluminescent (CL) immunoassay. The functionalized capillary could be used as both a support for highly efficient immobilization of antibody and a flow cell for flow-through immunoassay. The functionalized inner wall and the capture process were characterized using scanning electron microscopy. Compared to conventional packed tube or thin-layer cell immunoreactor, the proposed microreactor showed remarkable properties such as lower cost, simpler fabrication, better practicality and wider dynamic range for fast CL immunoassay with good reproducibility and stability. Using {alpha}-fetoprotein as model analyte, the highly efficient CL flow-through immunoassay system showed a linear range of 3 orders of magnitude from 0.5 to 200 ng mL{sup -1} and a low detection limit of 0.1 ng mL{sup -1}. The capillary immune microreactor could make up the shortcoming of conventional CL immunoreactors and provided a promising alternative for highly efficient flow-injection immunoassay.
What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

Science.gov (United States)

Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

2017-01-01

Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365
What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

Directory of Open Access Journals (Sweden)

Lorena Ruiz

2017-06-01

Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.
Validation of Procedures for Monitoring Crewmember Immune Function

Science.gov (United States)

Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

2009-01-01

There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly
Diverse novel functions of neutrophils in immunity, inflammation, and beyond

OpenAIRE

Mocsai, A.

2013-01-01

Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10–20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellu...
The Immune System: Basis of so much Health and Disease: 4. Immunocytes.

Science.gov (United States)

Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

2017-05-01

The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system, this article covers cells of the immune system (immunocytes). Clinical relevance: Modern dental clinicians need a basic understanding of the immune system as it underlies health and disease.
Effect of spirulina food supplement on blood morphological parameters, biochemical composition and on the immune function of sportsmen

Directory of Open Access Journals (Sweden)

K Milasius

2009-07-01

Full Text Available Of highest biological value are natural concentrates of optimally combined substances produced by nature. One of food supplements of this kind is dietary Spirulina produced by the Tianshi firm (China. It is a most rationally balanced food supplement of a high biological value; it satisfies the needs of the whole body, including its immune system. The aim of the current work was to assess the effect of the multicomponent natural food supplement Spirulina on the physical development, blood morphological, biochemical picture and immune function of sportsmen. Materials and Methods: The study cohort comprised 12 high performance sportsmen (age 20-22 years. They were using tablets of Spirulina, a dietary product for 14 days. Physical development was determined with the aid of standard methods. The general blood picture was analyzed with the aid of a Micros-60 hematological analyzer (company ABX DIAGNOSTICS, France. Lymphocytes and their subsets were analysed by flow cytometery (FACSCalibur, Becton Dickinson Immunocytometry Systems (BDIS, USA and the absolute and percentage values were calculated. To evaluate immune function lymphocyte blasttransformation response to mitogens was studied. Results: Investigations carried out on endurance-training sportsmen showed that a 14-d administration of Spirulina exerted a positive effect on blood morphological composition indices and its biochemical changes. The results of our study confirm the positive effect of Spirulina food supplement on the quantitative parameters of immune system. Part of the study cohort after weeks showed a tendency of normalizing CD3 , CD3 CD4 lympocite count: positive changes were still present two weeks following the interruption of Spirulina intake
Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

Science.gov (United States)

Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

2017-01-01

Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.
Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

Directory of Open Access Journals (Sweden)

Joanna Bandoła

2017-08-01

Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.
The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

Science.gov (United States)

Adamo, Shelley A

2014-09-01

Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration
Temperament Affects Sympathetic Nervous Function in a Normal Population

OpenAIRE

Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

2012-01-01

Objective Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Methods Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean vers...
Innate immune system and preeclampsia

Directory of Open Access Journals (Sweden)

Alejandra ePerez-Sepulveda

2014-05-01

Full Text Available Normal pregnancy is considered as a Th2 type immunological state that favors an immune-tolerance environment in order to prevent fetal rejection. PE has been classically described as a Th1/Th2 imbalance; however, the Th1/Th2 paradigm has proven insufficient to fully explain the functional and molecular changes observed during normal/pathological pregnancies. Recent studies have expanded the Th1/Th2 into a Th1⁄Th2⁄Th17 and regulatory T (Treg cells paradigm and where dendritic cells could have a crucial role. Recently, some evidence has emerged supporting the idea that mesenchymal stem cells might be part of the feto-maternal tolerance environment. This review will discuss the involvement of the innate immune system in the establishment of a physiological environment that favors pregnancy and possible alterations related to the development of preeclampsia.
Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs

Science.gov (United States)

Shin, Jin-Hong; Yue, Yongping; Smith, Bruce

2012-01-01

Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468
Effects of methylmercury exposure on the immune function of juvenile common loons (Gavia immer)

Science.gov (United States)

Kenow, K.P.; Grasman, K.A.; Hines, R.K.; Meyer, M.W.; Gendron-Fitzpatrick, A.; Spalding, M.G.; Gray, B.R.

2007-01-01

We conducted a dose-response laboratory study to quantify the level of exposure to dietary Hg, delivered as methylmercury chloride (CH3HgCl), that is associated with suppressed immune function in captive-reared common loon (Gavia immer) chicks. We used the phytohemagglutinin (PHA) skin test to assess T-lymphocyte function and the sheep red blood cell (SRBC) hemagglutination test to measure antibody-mediated immunity. The PHA stimulation index among chicks receiving dietary Hg treatment did not differ significantly from those of chicks on the control diet (p = 0.15). Total antibody (immunoglobulin [Ig] M [primary antibody] + IgG [secondary response]) production to the SRBC antigen in chicks treated with dietary methylmercury (MeHg), however, was suppressed (p = 0.04) relative to chicks on control diets. Analysis indicated suppression of total Ig production (p = 0.025 with comparisonwise ?? level = 0.017) between control and 0.4 ??g Hg/g wet food intake treatment groups. Furthermore, the control group exhibited a higher degree of variability in antibody response compared to the Hg groups, suggesting that in addition to reducing the mean response, Hg treatment reduced the normal variation attributable to other biological factors. We observed bursal lymphoid depletion in chicks receiving the 1.2 ??g Hg/g treatment (p = 0.017) and a marginally significant effect (p = 0.025) in chicks receiving the 0.4 ??g Hg/g diet. These findings suggest that common loon chick immune systems may be compromised at an ecologically relevant dietary exposure concentration (0.4 ??g Hg/g wet wt food intake). We also found that chicks hatched from eggs collected from low-pH lakes exhibited higher levels of lymphoid depletion in bursa tissue relative to chicks hatched from eggs collected from neutral-pH lakes. ?? 2007 SETAC.
Normal function of immunologic stem cells from aged mice

International Nuclear Information System (INIS)

Harrison, D.E.; Doubleday, J.W.

1975-01-01

Marrow or spleen grafts from aged donor mice produced antibody-forming cells as effectively as did grafts from younger controls in recipients tested 3 to 10 months after the transplantation. All recipients were lethally irradiated, and the T6 chromosome marker was used to demonstrate that they were populated by donor cell lines. Recipients of aged or younger control grafts gave similar responses when stimulated with varying doses of antigen and when tested at different times after the transplantation except in two cases. Recipients of aged spleen grafts gave significantly lower responses than younger controls for the first few weeks after the transplantation. If recipients had been thymectomized before lethal irradiation, aged cell lines (pooled marrow and spleen cells) gave only 37 percent of the responses of younger controls. Given sufficient time and intact young recipients, immunologic stem cell lines from old donors populated recipients with cells having normal immune responses. These results suggest that age-related immunologic defects are not intrinsically timed in the precursor cell lines that populate the immune system. (U.S.)
Jungle Honey Enhances Immune Function and Antitumor Activity

Directory of Open Access Journals (Sweden)

Miki Fukuda

2011-01-01

Full Text Available Jungle honey (JH is collected from timber and blossom by wild honey bees that live in the tropical forest of Nigeria. JH is used as a traditional medicine for colds, skin inflammation and burn wounds as well as general health care. However, the effects of JH on immune functions are not clearly known. Therefore, we investigated the effects of JH on immune functions and antitumor activity in mice. Female C57BL/6 mice were injected with JH (1 mg/mouse/day, seven times intra-peritoneal. After seven injections, peritoneal cells (PC were obtained. Antitumor activity was assessed by growth of Lewis Lung Carcinoma/2 (LL/2 cells. PC numbers were increased in JH-injected mice compared to control mice. In Dot Plot analysis by FACS, a new cell population appeared in JH-injected mice. The percent of Gr-1 surface antigen and the intensity of Gr-1 antigen expression of PC were increased in JH-injected mice. The new cell population was neutrophils. JH possessed chemotactic activity for neutrophils. Tumor incidence and weight were decreased in JH-injected mice. The ratio of reactive oxygen species (ROS producing cells was increased in JH-injected mice. The effective component in JH was fractionized by gel filtration using HPLC and had an approximate molecular weight (MW of 261. These results suggest that neutrophils induced by JH possess potent antitumor activity mediated by ROS and the effective immune component of JH is substrate of MW 261.
Effects of early-life adversity on immune function are mediated by prenatal environment: Role of prenatal alcohol exposure.

Science.gov (United States)

Raineki, Charlis; Bodnar, Tamara S; Holman, Parker J; Baglot, Samantha L; Lan, Ni; Weinberg, Joanne

2017-11-01

The contribution of the early postnatal environment to the pervasive effects of prenatal alcohol exposure (PAE) is poorly understood. Moreover, PAE often carries increased risk of exposure to adversity/stress during early life. Dysregulation of immune function may play a role in how pre- and/or postnatal adversity/stress alters brain development. Here, we combine two animal models to examine whether PAE differentially increases vulnerability to immune dysregulation in response to early-life adversity. PAE and control litters were exposed to either limited bedding (postnatal day [PN] 8-12) to model early-life adversity or normal bedding, and maternal behavior and pup vocalizations were recorded. Peripheral (serum) and central (amygdala) immune (cytokines and C-reactive protein - CRP) responses of PAE animals to early-life adversity were evaluated at PN12. Insufficient bedding increased negative maternal behavior in both groups. Early-life adversity increased vocalization in all animals; however, PAE pups vocalized less than controls. Early-life adversity reduced serum TNF-α, KC/GRO, and IL-10 levels in control but not PAE animals. PAE increased serum CRP, and levels were even higher in pups exposed to adversity. Finally, PAE reduced KC/GRO and increased IL-10 levels in the amygdala. Our results indicate that PAE alters immune system development and both behavioral and immune responses to early-life adversity, which could have subsequent consequences for brain development and later life health. Copyright © 2017 Elsevier Inc. All rights reserved.
[Effects of electromagnetic radiation on health and immune function of operators].

Science.gov (United States)

Li, Yan-zhong; Chen, Shao-hua; Zhao, Ke-fu; Gui, Yun; Fang, Si-xin; Xu, Ying; Ma, Zi-jian

2013-08-01

To investigate the effects of electromagnetic radiation on the physiological indices and immune function of operators. The general conditions and electromagnetic radiation awareness rate of 205 operators under electromagnetic radiation were evaluated using a self-designed questionnaire. Physical examination, electrocardiography, and routine urine test were performed in these operators. Peripheral blood was collected from the operators under electromagnetic radiation for blood cell counting and biochemical testing, and their peripheral blood lymphocytes were cultured for determination of chromosomal aberrant frequency and micronucleus frequency. The data from these operators (exposure group) were compared with those of 95 ordinary individuals (control group). The chief complaint of giddiness, tiredness, dizziness, and amnesia showed significant differences between the exposure group and control group (P electromagnetic radiation damage was significantly higher in the exposure group than in the control group. The difference in bradycardia was significant between the two groups (P Electromagnetic radiation may lead to the changes in physiological indices, genetic effects, and immune function and affect the health and immune function in operators. The adverse effects are increased as the working years increase. So it is important to strengthen occupational protection of operators under electromagnetic radiation.
Studies on the control mechanism and the degenerative immune function of dendritic cells using radiation

International Nuclear Information System (INIS)

Yee, Sung Tae; Kim, Jong Jin; Choi, Ji Na; Park, Jung Eun; Jeong, Young Ran

2010-05-01

Dendritic cells are actively used as cellular adjuvant in cancer immunotherapy. However, although DC immunotherapies primarily target the elderly population, little is known about the effect of aging on DC functions. Here, we compared the T-cell stimulation, cytokine production, and costimulatory molecule expression of spleen or bone marrow-derived CD11c + DCs of C57BL/6 mice. In the first year, we compared various function of dendritic cells isolated from young and gamma-irradiated 57BL/6 mice(5 weeks after γ-radiation) for the development of aging models using radiation. In the second year, we also compared the function of spleen- and bone marrow-derived dendritic cells of young(2-3 months) and old(23-24 months) 57BL/6 mice. And we studied the differences of spleen- and bone marrow-derived dendritic cells of young and gamma-irradiated 57BL/6 mice(2, 4, 6 months after γ-radiation) for the development of aging models in third year. And we obtained various differences between spleen- and bone marrow-derived dendritic cells of normal and old(23-24 months) or γ-irradiated 57BL/6 mice. It is possible to use our results as age-associated model for modulation of the declined immunity and hematopoiesis for treatment of cancer, adult diseases and stress in aging. Such studies on the mechanism of aging model would further lead to new avenues for the development of functional foods which effect such as pathogenesis, inflammatory and autoimmune disorders. It will contributed to activation of related industry conforming quality and diversity of radiation industry. The techniques developed in our research may provide novel therapeutic modalities for age-associated immune dysfunctions

Function of endoplasmic reticulum calcium ATPase in innate immunity-mediated programmed cell death

Science.gov (United States)

Zhu, Xiaohong; Caplan, Jeffrey; Mamillapalli, Padmavathi; Czymmek, Kirk; Dinesh-Kumar, Savithramma P

2010-01-01

Programmed cell death (PCD) initiated at the pathogen-infected sites during the plant innate immune response is thought to prevent the development of disease. Here, we describe the identification and characterization of an ER-localized type IIB Ca2+-ATPase (NbCA1) that function as a regulator of PCD. Silencing of NbCA1 accelerates viral immune receptor N- and fungal-immune receptor Cf9-mediated PCD, as well as non-host pathogen Pseudomonas syringae pv. tomato DC3000 and the general elicitor cryptogein-induced cell death. The accelerated PCD rescues loss-of-resistance phenotype of Rar1, HSP90-silenced plants, but not SGT1-silenced plants. Using a genetically encoded calcium sensor, we show that downregulation of NbCA1 results in the modulation of intracellular calcium signalling in response to cryptogein elicitor. We further show that NbCAM1 and NbrbohB function as downstream calcium decoders in N-immune receptor-mediated PCD. Our results indicate that ER-Ca2+-ATPase is a component of the calcium efflux pathway that controls PCD during an innate immune response. PMID:20075858
Chromatin versus pathogens: the function of epigenetics in plant immunity

Science.gov (United States)

Ding, Bo; Wang, Guo-Liang

2015-01-01

To defend against pathogens, plants have developed a sophisticated innate immunity that includes effector recognition, signal transduction, and rapid defense responses. Recent evidence has demonstrated that plants utilize the epigenetic control of gene expression to fine-tune their defense when challenged by pathogens. In this review, we highlight the current understanding of the molecular mechanisms of histone modifications (i.e., methylation, acetylation, and ubiquitination) and chromatin remodeling that contribute to plant immunity against pathogens. Functions of key histone-modifying and chromatin remodeling enzymes are discussed. PMID:26388882
The importance of vitamins D and K for the bone health and immune function in inflammatory bowel disease.

Science.gov (United States)

Iijima, Hideki; Shinzaki, Shinichiro; Takehara, Tetsuo

2012-11-01

This review summarizes the recent literature about the roles of vitamins D and K in bone metabolism and immunity-mediated inflammatory processes in inflammatory bowel diseases (IBDs). The levels of vitamins D and K are lower than normal in patients with IBD, especially in Crohn's disease. Although vitamins D and K are important for the maintenance of bone mineral density in non-IBD patients, an association between vitamins D or K and bone metabolism is not apparent in IBD patients. Recent studies showed that vitamins D and K are suggested to have immune-suppressive effects, both in animal models of colitis and human trials. In particular, vitamin D suppresses dendritic and T-cell functions by inhibiting the production of proinflammatory cytokines. Insufficiency of vitamin D is associated with the activated phenotype of IBD. Vitamins D and K potentially contribute to the maintenance of bone health in IBD, but this effect may be diminished by other factors such as steroid use, reduced exposure to sunlight, and inflammatory cytokines. Vitamin D and possibly vitamin K are suggested to be involved in the suppression of immune-mediated inflammation and modulation of disease activity.
Metabolites related to renal function, immune activation, and carbamylation are associated with muscle composition in older adults.

Science.gov (United States)

Lustgarten, Michael S; Fielding, Roger A

2017-12-15

Reduced skeletal muscle density in older adults is associated with insulin resistance, decreased physical function, and an increased all-cause mortality risk. To elucidate mechanisms that may underlie the maintenance of skeletal muscle density, we conducted a secondary analysis of previously published muscle composition and serum metabolomic data in 73 older adults (average age, 78y). Multivariable-adjusted linear regression was used to examine associations between 321 metabolites with muscle composition, defined as the ratio between normal density (NDM) with low density (LDM) thigh muscle cross sectional area (NDM/LDM). Sixty metabolites were significantly (p≤0.05 and qMetabolites that were significantly associated with muscle composition were then tested for their association with circulating markers of renal function (blood urea nitrogen, creatinine, uric acid), and with the immune response (neutrophils/lymphocytes) and activation (kynurenine/tryptophan). 43 significant NDM/LDM metabolites (including urea) were co-associated with at least 1 marker of renal function; 23 of these metabolites have been previously identified as uremic solutes. The neutrophil/lymphocyte ratio was significantly associated with NDM/LDM (β±SE: -0.3±0.1, p=0.01, q=0.04). 35 significant NDM/LDM metabolites were co-associated with immune activation. Carbamylation (defined as homocitrulline/lysine) was identified as a pathway that may link renal function and immune activation with muscle composition, as 29 significant NDM/LDM metabolites were co-associated with homocitrulline/lysine, with at least 2 markers of renal function, and with kynurenine/tryptophan. When considering that elevated urea and uremic metabolites have been linked with an increased systemic microbial burden, that antimicrobial defense can be reduced in the presence of carbamylation, and that adipocytes can promote host defense, we propose the novel hypothesis that the age-related increase in adipogenesis within muscle
Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging

OpenAIRE

Palmer, Clovis S.; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M.

2018-01-01

An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...
Wheat homologs of yeast ATG6 function in autophagy and are implicated in powdery mildew immunity.

Science.gov (United States)

Yue, Jieyu; Sun, Hong; Zhang, Wei; Pei, Dan; He, Yang; Wang, Huazhong

2015-04-01

Autophagy-related ATG6 proteins are pleiotropic proteins functioning in autophagy and the phosphatidylinositol 3-phosphate-signaling pathways. Arabidopsis ATG6 regulates normal plant growth, pollen development and germination, and plant responses to biotic/abiotic stresses. However, the ATG6 functions in wheat (Triticum aestivum L.), an important food crop, are lacking. We identified three members, TaATG6a-6c, of the ATG6 family from common wheat. TaATG6a, 6b and 6c were localized on homeologous chromosomes 3DL, 3BL and 3AL, respectively, of the allo-hexaploid wheat genome, and evidence was provided for their essential role in autophagy. The TaATG6a-GFP fusion protein was found in punctate pre-autophagosomal structures. The expression of each TaATG6 gene restored the accumulation of autophagic bodies in atg6-mutant yeast. Additionally, TaATG6 knockdown plants showed impaired constitutive and pathogen-induced autophagy and growth abnormalities under normal conditions. We also examined the expression patterns of wheat ATG6s for clues to their physiological roles, and found that their expression was induced by the fungus Blumeria graminis f. sp. tritici (Bgt), the causal agent of powdery mildew, and by abiotic stress factors. A role for TaATG6s in wheat immunity to powdery mildew was further implied when knockdowns of TaATG6s weakly compromised the broad-spectrum powdery mildew resistance gene Pm21-triggered resistance response and, conversely and significantly, enhanced the basal resistance of susceptible plants. In addition, leaf cell death was sometimes induced by growth-retarded small Bgt mycelia on susceptible TaATG6 knockdown plants after a long period of interaction. Thus, we provide an important extension of the previous characterization of plant ATG6 genes in wheat, and observed a role for autophagy genes in wheat immune responses to fungal pathogens. Three wheat ATG6s were identified and shown to be essential for autophagy biogenesis. Wheat ATG6s are
SYNTHESIS METHODS OF ALGEBRAIC NORMAL FORM OF MANY-VALUED LOGIC FUNCTIONS

Directory of Open Access Journals (Sweden)

A. V. Sokolov

2016-01-01

Full Text Available The rapid development of methods of error-correcting coding, cryptography, and signal synthesis theory based on the principles of many-valued logic determines the need for a more detailed study of the forms of representation of functions of many-valued logic. In particular the algebraic normal form of Boolean functions, also known as Zhegalkin polynomial, that well describe many of the cryptographic properties of Boolean functions is widely used. In this article, we formalized the notion of algebraic normal form for many-valued logic functions. We developed a fast method of synthesis of algebraic normal form of 3-functions and 5-functions that work similarly to the Reed-Muller transform for Boolean functions: on the basis of recurrently synthesized transform matrices. We propose the hypothesis, which determines the rules of the synthesis of these matrices for the transformation from the truth table to the coefficients of the algebraic normal form and the inverse transform for any given number of variables of 3-functions or 5-functions. The article also introduces the definition of algebraic degree of nonlinearity of the functions of many-valued logic and the S-box, based on the principles of many-valued logic. Thus, the methods of synthesis of algebraic normal form of 3-functions applied to the known construction of recurrent synthesis of S-boxes of length N = 3k, whereby their algebraic degrees of nonlinearity are computed. The results could be the basis for further theoretical research and practical applications such as: the development of new cryptographic primitives, error-correcting codes, algorithms of data compression, signal structures, and algorithms of block and stream encryption, all based on the perspective principles of many-valued logic. In addition, the fast method of synthesis of algebraic normal form of many-valued logic functions is the basis for their software and hardware implementation.
Effects of ultraviolet radiation on the immune system in humans

International Nuclear Information System (INIS)

Morison, W.L.

1989-01-01

In experimental animals, exposure to UV-B radiation produces selective alterations of immune function which are mainly in the form of suppression of normal immune responses. This immune suppression is important in the development of nonmelanoma skin cancer, may influence the development and course of infectious disease and possibly protects against autoimmune reactions. The evidence that this form of immune suppression occurs in humans is less compelling and very incomplete. The wavelengths of radiation most affected by a depletion of the stratospheric ozone layer are those known to be most immunosuppressive in animals and it is likely that such depletion will increase any suppressive effect of sunlight on immunity in humans. In addition to establishing whether or not UV-B radiation can cause suppression of immune function in humans, studies are required to determine if melanin can provide protection against such suppression, the role of this suppression in the pathogenesis of skin cancer, the development of infectious disease and vaccine effectiveness, and the capacity for humans to develop adaptive, protective mechanisms which may limit damage from continued exposure to UV-B radiation. (author)
Food supplementation and testosterone interact to influence reproductive behavior and immune function in Sceloporus graciosus.

Science.gov (United States)

Ruiz, Mayté; French, Susannah S; Demas, Gregory E; Martins, Emília P

2010-02-01

The energetic resources in an organism's environment are essential for executing a wide range of life-history functions, including immunity and reproduction. Most energetic budgets, however, are limited, which can lead to trade-offs among competing functions. Increasing reproductive effort tends to decrease immunity in many cases, and increasing total energy via supplemental feedings can eliminate this effect. Testosterone (T), an important regulator of reproduction, and food availability are thus both potential factors regulating life-history processes, yet they are often tested in isolation of each other. In this study, we considered the effect of both food availability and elevated T on immune function and reproductive behavior in sagebrush lizards, Sceloporus graciosus, to assess how T and energy availability affect these trade-offs. We experimentally manipulated diet (via supplemental feedings) and T (via dermal patches) in males from a natural population. We determined innate immune response by calculating the bacterial killing capability of collected plasma exposed to Escherichia coli ex vivo. We measured reproductive behavior by counting the number of courtship displays produced in a 20-min sampling period. We observed an interactive effect of food availability and T-patch on immune function, with food supplementation increasing immunity in T-patch lizards. Additionally, T increased courtship displays in control food lizards. Lizards with supplemental food had higher circulating T than controls. Collectively, this study shows that the energetic state of the animal plays a critical role in modulating the interactions among T, behavior and immunity in sagebrush lizards and likely other species. Copyright 2009 Elsevier Inc. All rights reserved.
Development and function of human innate immune cells in a humanized mouse model.

Science.gov (United States)

Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

2014-04-01

Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.
The immune modifying effects of amino acids on gut-associated lymphoid tissue.

Science.gov (United States)

Ruth, Megan R; Field, Catherine J

2013-07-30

The intestine and the gut-associated lymphoid tissue (GALT) are essential components of whole body immune defense, protecting the body from foreign antigens and pathogens, while allowing tolerance to commensal bacteria and dietary antigens. The requirement for protein to support the immune system is well established. Less is known regarding the immune modifying properties of individual amino acids, particularly on the GALT. Both oral and parenteral feeding studies have established convincing evidence that not only the total protein intake, but the availability of specific dietary amino acids (in particular glutamine, glutamate, and arginine, and perhaps methionine, cysteine and threonine) are essential to optimizing the immune functions of the intestine and the proximal resident immune cells. These amino acids each have unique properties that include, maintaining the integrity, growth and function of the intestine, as well as normalizing inflammatory cytokine secretion and improving T-lymphocyte numbers, specific T cell functions, and the secretion of IgA by lamina propria cells. Our understanding of this area has come from studies that have supplemented single amino acids to a mixed protein diet and measuring the effect on specific immune parameters. Future studies should be designed using amino acid mixtures that target a number of specific functions of GALT in order to optimize immune function in domestic animals and humans during critical periods of development and various disease states.
Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

Directory of Open Access Journals (Sweden)

Iole Macchia

2013-01-01

Full Text Available The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs and tumor-associated antigens (TAAs and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM- based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma.
Normalization methods in time series of platelet function assays

Science.gov (United States)

Van Poucke, Sven; Zhang, Zhongheng; Roest, Mark; Vukicevic, Milan; Beran, Maud; Lauwereins, Bart; Zheng, Ming-Hua; Henskens, Yvonne; Lancé, Marcus; Marcus, Abraham

2016-01-01

Abstract Platelet function can be quantitatively assessed by specific assays such as light-transmission aggregometry, multiple-electrode aggregometry measuring the response to adenosine diphosphate (ADP), arachidonic acid, collagen, and thrombin-receptor activating peptide and viscoelastic tests such as rotational thromboelastometry (ROTEM). The task of extracting meaningful statistical and clinical information from high-dimensional data spaces in temporal multivariate clinical data represented in multivariate time series is complex. Building insightful visualizations for multivariate time series demands adequate usage of normalization techniques. In this article, various methods for data normalization (z-transformation, range transformation, proportion transformation, and interquartile range) are presented and visualized discussing the most suited approach for platelet function data series. Normalization was calculated per assay (test) for all time points and per time point for all tests. Interquartile range, range transformation, and z-transformation demonstrated the correlation as calculated by the Spearman correlation test, when normalized per assay (test) for all time points. When normalizing per time point for all tests, no correlation could be abstracted from the charts as was the case when using all data as 1 dataset for normalization. PMID:27428217
Normalization of voltage-sensitive dye signal with functional activity measures.

Directory of Open Access Journals (Sweden)

Kentaroh Takagaki

Full Text Available In general, signal amplitude in optical imaging is normalized using the well-established DeltaF/F method, where functional activity is divided by the total fluorescent light flux. This measure is used both directly, as a measure of population activity, and indirectly, to quantify spatial and spatiotemporal activity patterns. Despite its ubiquitous use, the stability and accuracy of this measure has not been validated for voltage-sensitive dye imaging of mammalian neocortex in vivo. In this report, we find that this normalization can introduce dynamic biases. In particular, the DeltaF/F is influenced by dye staining quality, and the ratio is also unstable over the course of experiments. As methods to record and analyze optical imaging signals become more precise, such biases can have an increasingly pernicious impact on the accuracy of findings, especially in the comparison of cytoarchitechtonic areas, in area-of-activation measurements, and in plasticity or developmental experiments. These dynamic biases of the DeltaF/F method may, to an extent, be mitigated by a novel method of normalization, DeltaF/DeltaF(epileptiform. This normalization uses as a reference the measured activity of epileptiform spikes elicited by global disinhibition with bicuculline methiodide. Since this normalization is based on a functional measure, i.e. the signal amplitude of "hypersynchronized" bursts of activity in the cortical network, it is less influenced by staining of non-functional elements. We demonstrate that such a functional measure can better represent the amplitude of population mass action, and discuss alternative functional normalizations based on the amplitude of synchronized spontaneous sleep-like activity. These findings demonstrate that the traditional DeltaF/F normalization of voltage-sensitive dye signals can introduce pernicious inaccuracies in the quantification of neural population activity. They further suggest that normalization
Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus

Directory of Open Access Journals (Sweden)

Joanna Durrant

2015-07-01

Full Text Available Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO activity were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested.
How (and why) the immune system makes us sleep.

Science.gov (United States)

Imeri, Luca; Opp, Mark R

2009-03-01

Good sleep is necessary for physical and mental health. For example, sleep loss impairs immune function, and sleep is altered during infection. Immune signalling molecules are present in the healthy brain, where they interact with neurochemical systems to contribute to the regulation of normal sleep. Animal studies have shown that interactions between immune signalling molecules (such as the cytokine interleukin 1) and brain neurochemical systems (such as the serotonin system) are amplified during infection, indicating that these interactions might underlie the changes in sleep that occur during infection. Why should the immune system cause us to sleep differently when we are sick? We propose that the alterations in sleep architecture during infection are exquisitely tailored to support the generation of fever, which in turn imparts survival value.
Clinical evaluation of immune-promoting functions of the developed product (HemoHIM)

Energy Technology Data Exchange (ETDEWEB)

Kim, Kyoung Soo; Lee, Ill Kyoo; Kwon, Soon Gil [The Catholic University of Korea, Seoul (Korea, Republic of)

2007-07-15

We performed a clinical study to evaluate the immune promotion and antioxidant effects of the developed product (HemoHIM) in healthy or subhealthy people. Volunteers with white blood cell numbers between 5000 and 10000/ul were recruited and the subjects were selected by appropriate inclusion and exclusion rules. The subjects were randomly assigned to 3 groups (HemoHIM 6g/day, HemoHIM 12g/day, Placebo). HemoHIM or placebo were adminstered for 2 months and the blood were collected and analyzed at 1 month and 2 month after the intake. The collected blood was analyzed for blood cell number, serum biochemical values (liver and kidney function), immunological activity of blood cells, antioxidant activity of blood plasma, and stress hormone level in the saliva. Finally the data of 88 subjects were analyzed for the immune promoting and antioxidant effects of HemoHIM. In results, no significant changes in blood cell numbers (white blood cell, lymphocyte, red blood cell) were observed in HemoHIM intake groups. However, NK cell activity were increased in HemoHIM intake groups and also IFN-gamma and IL-12, the biomarkers of immune cell functions, were increased in proportion to the dose and intake periode of HemoHIM. The antioxidant biomarker (TAS) was not significantly changed by HemoHIM intake. Besides, the serum biochemical analysis for liver and kidney functions, and the general medical examination showed the HemoHIM showed no side-effects, thus reconfirming its safety in humans. In conclusion, this study showed HemoHIM has a significant effects on the promotion of immune functions, while it has neither side-effects nor toxicity in humans. The results of this study may be utilized for the scientific data to acquire the Health Functional Food Certification of HemoHIM from Korea FDA
Studies on the control mechanism and the degenerative immune function of dendritic cells using radiation

Energy Technology Data Exchange (ETDEWEB)

Yee, Sung Tae; Kim, Jong Jin; Choi, Ji Na; Park, Jung Eun; Jeong, Young Ran [Sunchon National University, Sunchon (Korea, Republic of)

2010-05-15

Dendritic cells are actively used as cellular adjuvant in cancer immunotherapy. However, although DC immunotherapies primarily target the elderly population, little is known about the effect of aging on DC functions. Here, we compared the T-cell stimulation, cytokine production, and costimulatory molecule expression of spleen or bone marrow-derived CD11c{sup +} DCs of C57BL/6 mice. In the first year, we compared various function of dendritic cells isolated from young and gamma-irradiated 57BL/6 mice(5 weeks after {gamma}-radiation) for the development of aging models using radiation. In the second year, we also compared the function of spleen- and bone marrow-derived dendritic cells of young(2-3 months) and old(23-24 months) 57BL/6 mice. And we studied the differences of spleen- and bone marrow-derived dendritic cells of young and gamma-irradiated 57BL/6 mice(2, 4, 6 months after {gamma}-radiation) for the development of aging models in third year. And we obtained various differences between spleen- and bone marrow-derived dendritic cells of normal and old(23-24 months) or {gamma}-irradiated 57BL/6 mice. It is possible to use our results as age-associated model for modulation of the declined immunity and hematopoiesis for treatment of cancer, adult diseases and stress in aging. Such studies on the mechanism of aging model would further lead to new avenues for the development of functional foods which effect such as pathogenesis, inflammatory and autoimmune disorders. It will contributed to activation of related industry conforming quality and diversity of radiation industry. The techniques developed in our research may provide novel therapeutic modalities for age-associated immune dysfunctions
Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

Directory of Open Access Journals (Sweden)

Harmit S. Ranhotra

2016-07-01

Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.
The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

Science.gov (United States)

Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

2017-12-01

The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging.

Science.gov (United States)

Palmer, Clovis S; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M

2018-01-01

An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of "inflammaging", a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV + individuals.
Obligate brood parasites show more functionally effective innate immune responses: an eco-immunological hypothesis

Science.gov (United States)

Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.

2013-01-01

Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.
Gut Mesenchymal Stromal Cells in Immunity

Directory of Open Access Journals (Sweden)

Valeria Messina

2017-01-01

Full Text Available Mesenchymal stromal cells (MSCs, first found in bone marrow (BM, are the structural architects of all organs, participating in most biological functions. MSCs possess tissue-specific signatures that allow their discrimination according to their origin and location. Among their multiple functions, MSCs closely interact with immune cells, orchestrating their activity to maintain overall homeostasis. The phenotype of tissue MSCs residing in the bowel overlaps with myofibroblasts, lining the bottom walls of intestinal crypts (pericryptal or interspersed within intestinal submucosa (intercryptal. In Crohn’s disease, intestinal MSCs are tightly stacked in a chronic inflammatory milieu, which causes their enforced expression of Class II major histocompatibility complex (MHC. The absence of Class II MHC is a hallmark for immune-modulator and tolerogenic properties of normal MSCs and, vice versa, the expression of HLA-DR is peculiar to antigen presenting cells, that is, immune-activator cells. Interferon gamma (IFNγ is responsible for induction of Class II MHC expression on intestinal MSCs. The reversal of myofibroblasts/MSCs from an immune-modulator to an activator phenotype in Crohn’s disease results in the formation of a fibrotic tube subverting the intestinal structure. Epithelial metaplastic areas in this context can progress to dysplasia and cancer.
T cell immunity

OpenAIRE

Emel Bülbül Başkan

2013-01-01

Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...
Enhanced disease characterization through multi network functional normalization in fMRI.

Science.gov (United States)

Çetin, Mustafa S; Khullar, Siddharth; Damaraju, Eswar; Michael, Andrew M; Baum, Stefi A; Calhoun, Vince D

2015-01-01

Conventionally, structural topology is used for spatial normalization during the pre-processing of fMRI. The co-existence of multiple intrinsic networks which can be detected in the resting brain are well-studied. Also, these networks exhibit temporal and spatial modulation during cognitive task vs. rest which shows the existence of common spatial excitation patterns between these identified networks. Previous work (Khullar et al., 2011) has shown that structural and functional data may not have direct one-to-one correspondence and functional activation patterns in a well-defined structural region can vary across subjects even for a well-defined functional task. The results of this study and the existence of the neural activity patterns in multiple networks motivates us to investigate multiple resting-state networks as a single fusion template for functional normalization for multi groups of subjects. We extend the previous approach (Khullar et al., 2011) by co-registering multi group of subjects (healthy control and schizophrenia patients) and by utilizing multiple resting-state networks (instead of just one) as a single fusion template for functional normalization. In this paper we describe the initial steps toward using multiple resting-state networks as a single fusion template for functional normalization. A simple wavelet-based image fusion approach is presented in order to evaluate the feasibility of combining multiple functional networks. Our results showed improvements in both the significance of group statistics (healthy control and schizophrenia patients) and the spatial extent of activation when a multiple resting-state network applied as a single fusion template for functional normalization after the conventional structural normalization. Also, our results provided evidence that the improvement in significance of group statistics lead to better accuracy results for classification of healthy controls and schizophrenia patients.
Effects of stress on immune function: the good, the bad, and the beautiful.

Science.gov (United States)

Dhabhar, Firdaus S

2014-05-01

Although the concept of stress has earned a bad reputation, it is important to recognize that the adaptive purpose of a physiological stress response is to promote survival during fight or flight. While long-term stress is generally harmful, short-term stress can be protective as it prepares the organism to deal with challenges. This review discusses the immune effects of biological stress responses that can be induced by psychological, physiological, or physical (including exercise) stressors. We have proposed that short-term stress is one of the nature's fundamental but under-appreciated survival mechanisms that could be clinically harnessed to enhance immunoprotection. Short-term (i.e., lasting for minutes to hours) stress experienced during immune activation enhances innate/primary and adaptive/secondary immune responses. Mechanisms of immuno-enhancement include changes in dendritic cell, neutrophil, macrophage, and lymphocyte trafficking, maturation, and function as well as local and systemic production of cytokines. In contrast, long-term stress suppresses or dysregulates innate and adaptive immune responses by altering the Type 1-Type 2 cytokine balance, inducing low-grade chronic inflammation, and suppressing numbers, trafficking, and function of immunoprotective cells. Chronic stress may also increase susceptibility to some types of cancer by suppressing Type 1 cytokines and protective T cells and increasing regulatory/suppressor T cell function. Here, we classify immune responses as being protective, pathological, or regulatory, and discuss "good" versus "bad" effects of stress on health. Thus, short-term stress can enhance the acquisition and/or expression of immunoprotective (wound healing, vaccination, anti-infectious agent, anti-tumor) or immuno-pathological (pro-inflammatory, autoimmune) responses. In contrast, chronic stress can suppress protective immune responses and/or exacerbate pathological immune responses. Studies such as the ones discussed
Coexistence of Cushing syndrome from functional adrenal adenoma and Addison disease from immune-mediated adrenalitis.

Science.gov (United States)

Colucci, Randall; Jimenez, Rafael E; Farrar, William; Malgor, Ramiro; Kohn, Leonard; Schwartz, Frank L

2012-06-01

A 56-year-old woman presented with an incidental adrenal adenoma and physical examination findings that included moderate obesity, a slight cervicothoracic fat pad ("buffalo hump"), increased supraclavicular fat pads, and white abdominal striae. Biochemical workup revealed elevated levels of 24-hour urinary free cortisol but normal serum morning cortisol and suppressed levels of corticotropin, suggestive of adrenal-dependent Cushing syndrome. The resected adrenal gland revealed macronodular cortical hyperplasia with a dominant nodule. Other findings included an absent cortisol response to corticotropin stimulation, presence of serum anti-21-hydroxylase antibodies, and mononuclear cell infiltration--consistent with adrenalitis. The findings represent, to the authors' knowledge, the first known case of a patient with coexistent functional cortisol-secreting macronodular adrenal tumor resulting in Cushing syndrome and immune-mediated adrenalitis resulting in Addison disease.
Effects of water extract of Curcuma longa (L.) roots on immunity and telomerase function.

Science.gov (United States)

Pan, Min-Hsiung; Wu, Jia-Ching; Ho, Chi-Tang; Badmaev, Vladimir

2017-05-12

Background Immunity and Longevity Methods A water extract of Curcuma longa (L.) [vern. Turmeric] roots (TurmericImmune™) standardized for a minimum 20 % of turmeric polysaccharides ukonan A, B, C and D was evaluated for its biological properties in in vitro tissue culture studies. Results The water extract of turmeric (TurP) exhibited induced-nitric oxide (NO) production in RAW264.7 macrophages. These results suggested the immunomodulatory effects of TurP. In addition, the polysaccharides up-regulated function of telomerase reverse transcriptase (TERT) equally to the phenolic compound from turmeric, curcumin. Conclusions The ukonan family of polysaccharides may assist in promoting cellular immune responses, tissue repair and lifespan by enhancing immune response and telomere function.
The effect of elevated reproductive effort onhumoral immune function in collared flycatcher females

Science.gov (United States)

Cichoń, Mariusz; Dubiec, Anna; Chadzińska, Magdalena

2001-02-01

In order to test whether high reproductive investments impair immune function in naturally breeding collared flycatchers, we performed a brood manipulation experiment and simultaneously induced an immune response by challenging birds with a non-pathogenic antigen - sheep red blood cells (SRBC). Females rearing experimentally enlarged number of nestlings showed significantly lower level of specific anti-SRBC antibodies than control females attending unaltered broods, but only in one of the two study years. The haemoconcentration of leukocytes did not differ between the two groups in both study years. The significant difference in immunological responsiveness between control and enlarged group coincided with differences in survival probability to the next breeding season: females attending enlarged broods showed lower probability of survival than control females, but there was no relationship between the level of immune response and survival probability. Our results indicate that reproduction may indeed trade for resources with immune functions at least in terms of specific antibody production. However, as in the other studies on reproductive costs, these costs seem not always to be pronounced.
The Notch Signaling Pathway Is Balancing Type 1 Innate Lymphoid Cell Immune Functions

Directory of Open Access Journals (Sweden)

Thibaut Perchet

2018-06-01

Full Text Available The Notch pathway is one of the canonical signaling pathways implicated in the development of various solid tumors. During carcinogenesis, the Notch pathway dysregulation induces tumor expression of Notch receptor ligands participating to escape the immune surveillance. The Notch pathway conditions both the development and the functional regulation of lymphoid subsets. Its importance on T cell subset polarization has been documented contrary to its action on innate lymphoid cells (ILC. We aim to analyze the effect of the Notch pathway on type 1 ILC polarization and functions after disruption of the RBPJk-dependent Notch signaling cascade. Indeed, type 1 ILC comprises conventional NK (cNK cells and type 1 helper innate lymphoid cells (ILC1 that share Notch-related functional characteristics such as the IFNg secretion downstream of T-bet expression. cNK cells have strong antitumor properties. However, data are controversial concerning ILC1 functions during carcinogenesis with models showing antitumoral capacities and others reporting ILC1 inability to control tumor growth. Using various mouse models of Notch signaling pathway depletion, we analyze the effects of its absence on type 1 ILC differentiation and cytotoxic functions. We also provide clues into its role in the maintenance of immune homeostasis in tissues. We show that modulating the Notch pathway is not only acting on tumor-specific T cell activity but also on ILC immune subset functions. Hence, our study uncovers the intrinsic Notch signaling pathway in ILC1/cNK populations and their response in case of abnormal Notch ligand expression. This study help evaluating the possible side effects mediated by immune cells different from T cells, in case of multivalent forms of the Notch receptor ligand delta 1 treatments. In definitive, it should help determining the best novel combination of therapeutic strategies in case of solid tumors.
The Phagocytic Function of Macrophage-Enforcing Innate Immunity and Tissue Homeostasis

Directory of Open Access Journals (Sweden)

Daisuke Hirayama

2017-12-01

Full Text Available Macrophages are effector cells of the innate immune system that phagocytose bacteria and secrete both pro-inflammatory and antimicrobial mediators. In addition, macrophages play an important role in eliminating diseased and damaged cells through their programmed cell death. Generally, macrophages ingest and degrade dead cells, debris, tumor cells, and foreign materials. They promote homeostasis by responding to internal and external changes within the body, not only as phagocytes, but also through trophic, regulatory, and repair functions. Recent studies demonstrated that macrophages differentiate from hematopoietic stem cell-derived monocytes and embryonic yolk sac macrophages. The latter mainly give rise to tissue macrophages. Macrophages exist in all vertebrate tissues and have dual functions in host protection and tissue injury, which are maintained at a fine balance. Tissue macrophages have heterogeneous phenotypes in different tissue environments. In this review, we focused on the phagocytic function of macrophage-enforcing innate immunity and tissue homeostasis for a better understanding of the role of tissue macrophages in several pathological conditions.
Effects of antiretroviral therapy on immunity in patients infected with HIV.

Science.gov (United States)

Feola, D J; Thornton, A C; Garvy, B A

2006-01-01

Drug therapy for human immunodeficiency virus (HIV) is highly effective in suppressing viral replication and restoring immune function in patients with HIV. However, this same treatment can also be associated with immunotoxicity. For example, zidovudine and various other antiretroviral agents are capable of causing bone marrow suppression. Agents used to treat opportunistic infections in these individuals, including ganciclovir, foscarnet, and sulfamethoxazole-trimethoprim, can cause additional hematotoxicity. Drug-drug interactions must also be considered and managed in order to control iatrogenic causes of immunotoxicity. In this review, we examine the normal immune response to HIV, and the benefits of antiretroviral therapy in prolonging immune function. We then discuss immune-related adverse effects of drugs used to treat HIV and the opportunistic infections that are common among these patients. Finally, we address in vitro, animal, and clinical evidence of toxicity associated with various combination use of these agents.
Modulation of immune cell functions by the E3 ligase CBL-b

Directory of Open Access Journals (Sweden)

Christina eLutz-Nicoladoni

2015-03-01

Full Text Available Maintenance of immunological tolerance is a critical hallmark of the immune system. Several signaling checkpoints necessary to balance activating and inhibitory input to immune cells have been described so far, among which the E3 ligase Cbl-b appears to be a central player. Cbl-b is expressed in all leukocyte subsets and regulates several signaling pathways in T cells, NK cells, B cells and different types of myeloid cells. In most cases Cbl-b negatively regulates activation signals through antigen or pattern recognition receptors and co-stimulatory molecules. In line with this function, cblb-deficient immune cells display lower activation thresholds and cblb knockout mice spontaneously develop autoimmunity and are highly susceptible to experimental autoimmunity. Interestingly, genetic association studies link cblb-polymorphisms with autoimmunity also in humans. Vice versa, the increased activation potential of cblb-deficient cells renders them more potent to fight against malignancies or infections. Accordingly, several reports have shown that cblb knockout mice reject tumors, which mainly depends on cytotoxic T and NK cells. Thus targeting Cbl-b may be an interesting strategy to enhance anti-cancer immunity. In this review we summarize the findings on the molecular function of Cbl-b in different cell types and illustrate the potential of Cbl-b as target for immunomodulatory therapies.
A novel algorithm of artificial immune system for high-dimensional function numerical optimization

Institute of Scientific and Technical Information of China (English)

DU Haifeng; GONG Maoguo; JIAO Licheng; LIU Ruochen

2005-01-01

Based on the clonal selection theory and immune memory theory, a novel artificial immune system algorithm, immune memory clonal programming algorithm (IMCPA), is put forward. Using the theorem of Markov chain, it is proved that IMCPA is convergent. Compared with some other evolutionary programming algorithms (like Breeder genetic algorithm), IMCPA is shown to be an evolutionary strategy capable of solving complex machine learning tasks, like high-dimensional function optimization, which maintains the diversity of the population and avoids prematurity to some extent, and has a higher convergence speed.
Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

DEFF Research Database (Denmark)

Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several s...
Dissociative Functions in the Normal Mourning Process.

Science.gov (United States)

Kauffman, Jeffrey

1994-01-01

Sees dissociative functions in mourning process as occurring in conjunction with integrative trends. Considers initial shock reaction in mourning as model of normal dissociation in mourning process. Dissociation is understood to be related to traumatic significance of death in human consciousness. Discerns four psychological categories of…
Characteristic functions of scale mixtures of multivariate skew-normal distributions

KAUST Repository

Kim, Hyoung-Moon; Genton, Marc G.

2011-01-01

We obtain the characteristic function of scale mixtures of skew-normal distributions both in the univariate and multivariate cases. The derivation uses the simple stochastic relationship between skew-normal distributions and scale mixtures of skew
The Influence of histamine H1-receptor on liver functions in immunized rabbits.

Science.gov (United States)

Tripathi, Trivendra; Shahid, Mohammad; Khan, Haris M; Khan, Rahat Ali; Siddiqui, Mashiatullah; Mahdi, Abbas Ali

2011-10-01

This study was designed to investigate the functional roles of histamine and histamine H1-receptor agonist and antagonist in the development of liver function impairment in immunized rabbits. The study comprised of six groups containing 18 rabbits each. Group III-VI received histamine (100 μg/kg, s.c.), H1R-agonist (HTMT, 10 μg/kg, s.c.), H1R-antagonist (pheniramine, 10 mg/kg, i.m.), and H1R-antagonist (pheniramine, 10 mg/kg, i.m.) plus histamine (100 μg/kg, s.c.), respectively, b.i.d. for 10 days. Group I (negative control) and group II (positive control) received sterile distilled water intramuscularly b.i.d. for 10 days. Groups II-VI were immunized on day 3 with intravenous injection of SRBC (1 × 10(9) cells/ml). Blood samples were collected on pre-immunization day 0, as well as on days 7-, 14-, 21-, 28-, and 58-post-immunization. Biochemical parameters AST, ALT, alkaline phosphatase and bilirubin [total bilirubin (TB), direct bilirubin (DB), and indirect bilirubin (IB)] were determined. On each experimental day, the mean values of serum enzymes and bilirubin in group I and group II showed no significant changes while in group III, IV, V, and VI, these enzymes and bilirubin levels showed significant changes (p pheniramine, and combination of histamine + pheniramine cause hepatic function impairment in terms of altered serum enzymes and bilirubin levels. The present findings suggest that HTMT causes moderate liver function impairment while others show mild impairment.
Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

DEFF Research Database (Denmark)

Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

2011-01-01

Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function......). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...
Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

DEFF Research Database (Denmark)

Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

2011-01-01

). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially......Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

A role of the adaptive immune system in glucose homeostasis.

Science.gov (United States)

Bronsart, Laura L; Contag, Christopher H

2016-01-01

The immune system, including the adaptive immune response, has recently been recognized as having a significant role in diet-induced insulin resistance. In this study, we aimed to determine if the adaptive immune system also functions in maintaining physiological glucose homeostasis in the absence of diet-induced disease. SCID mice and immunocompetent control animals were phenotypically assessed for variations in metabolic parameters and cytokine profiles. Additionally, the glucose tolerance of SCID and immunocompetent control animals was assessed following introduction of a high-fat diet. SCID mice on a normal chow diet were significantly insulin resistant relative to control animals despite having less fat mass. This was associated with a significant increase in the innate immunity-stimulating cytokines granulocyte colony-stimulating factor, monocyte chemoattractant protein 1 (MCP1), and MCP3. Additionally, the SCID mouse phenotype was exacerbated in response to a high-fat diet as evidenced by the further significant progression of glucose intolerance. These results support the notion that the adaptive immune system plays a fundamental biological role in glucose homeostasis, and that the absence of functional B and T cells results in disruption in the concentrations of various cytokines associated with macrophage proliferation and recruitment. Additionally, the absence of functional B and T cells is not protective against diet-induced pathology.
The effects of low dose radiation (LDR) on mice of immune function

International Nuclear Information System (INIS)

Feng Li; Deng Daping

2007-01-01

Objective: To find out the Effects of Low Dose Radiation(LDR) on mice of immune function. Methods: Through flow cytometry to observe and analyse the effects of the leukomonocyte. Through immunohistochemistry to study IL-2, TNF-α. Results: At dose of 100mGy the stimulative effect on CD 4 + cells, CD 8 + cells and NK activity was higher than that at other doses. At dose of 500mGy leukomonocyte activity was lower. At dose of 100mGy, the colorations about IL-2, TNF-α deepen. Conclusion: LDR could stimulate immune function, especially at dose of 100mGy. while at dose of 500mGy, radiation could restrain the leukomonocyte activity. (authors)
Renal function maturation in children: is normalization to surface area valid?

International Nuclear Information System (INIS)

Rutland, M.D.; Hassan, I.M.; Que, L.

1999-01-01

Full text: Gamma camera DTPA renograms were analysed to measure renal function by the rate at which the kidneys took up tracer from the blood. This was expressed either directly as the fractional uptake rate (FUR), which is not related to body size, or it was converted to a camera-based GFR by the formula GFR blood volume x FUR, and this GFR was normalized to a body surface area of 1.73 m2. Most of the patients studied had one completely normal kidney, and one kidney with reflux but normal function and no large scars. The completely normal kidneys contributed, on average, 50% of the total renal function. The results were considered in age bands, to display the effect of age on renal function. The camera-GFR measurements showed the conventional results of poor renal function in early childhood, with a slow rise to near-adult values by the age of 2 years, and somewhat low values throughout childhood. The uptake values showed a different pattern, with renal function rising to adult equivalent values by the age of 4 months, and with children having better renal function than adults throughout most of their childhood. The standard deviations expressed as coefficients of variation (CV) were smaller for the FUR technique than the GFR (Wilcoxon rank test, P < 0.01). These results resemble recent published measurements of absolute DMSA uptake, which are also unrelated to body size and show early renal maturation. The results also suggest that the reason children have lower serum creatinine levels than adults is that they have better renal function. If this were confirmed, it would raise doubts about the usefulness of normalizing renal function to body surface area in children
Hygiene and other early childhood influences on the subsequent function of the immune system.

Science.gov (United States)

Rook, Graham A W; Lowry, Christopher A; Raison, Charles L

2015-08-18

The immune system influences brain development and function. Hygiene and other early childhood influences impact the subsequent function of the immune system during adulthood, with consequences for vulnerability to neurodevelopmental and psychiatric disorders. Inflammatory events during pregnancy can act directly to cause developmental problems in the central nervous system (CNS) that have been implicated in schizophrenia and autism. The immune system also acts indirectly by "farming" the intestinal microbiota, which then influences brain development and function via the multiple pathways that constitute the gut-brain axis. The gut microbiota also regulates the immune system. Regulation of the immune system is crucial because inflammatory states in pregnancy need to be limited, and throughout life inflammation needs to be terminated completely when not required; for example, persistently raised levels of background inflammation during adulthood (in the presence or absence of a clinically apparent inflammatory stimulus) correlate with an increased risk of depression. A number of factors in the perinatal period, notably immigration from rural low-income to rich developed settings, caesarean delivery, breastfeeding and antibiotic abuse have profound effects on the microbiota and on immunoregulation during early life that persist into adulthood. Many aspects of the modern western environment deprive the infant of the immunoregulatory organisms with which humans co-evolved, while encouraging exposure to non-immunoregulatory organisms, associated with more recently evolved "crowd" infections. Finally, there are complex interactions between perinatal psychosocial stressors, the microbiota, and the immune system that have significant additional effects on both physical and psychiatric wellbeing in subsequent adulthood. This article is part of a Special Issue entitled Neuroimmunology in Health And Disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights
Seasonal Redistribution of Immune Function in a Migrant Shorebird : Annual-Cycle Effects Override Adjustments to Thermal Regime

NARCIS (Netherlands)

Buehler, Deborah M.; Piersma, Theunis; Matson, Kevin D.; Tieleman, B. Irene; Demas, Greg (associate); Geber, Monica A.

2008-01-01

Throughout the annual cycle, demands on competing physiological systems change, and animals must allocate resources to maximize fitness. Immune function is one such system and is important for survival. Yet detailed empirical data tracking immune function over the entire annual cycle are lacking for
Effects of microbial aerosol in poultry house on meat ducks’ immune function

Directory of Open Access Journals (Sweden)

Guanliu YU

2016-08-01

Full Text Available The aim of this study was to evaluate effects of microbial aerosols on immune function of ducks and shed light on the establishment of microbial aerosol concentration standards for poultry. A total of 1800 1-d-old Cherry Valley ducks were randomly divided into 5 groups (A, B, C, D and E with 360 ducks in each. To obtain objective data, each group had three replications. Concentrations of airborne bacteria, fungi, endotoxin in different groups were created by controlling ventilation and bedding cleaning frequency. Group A was the control group and hygienic conditions deteriorated progressively from group B to E. A 6-stage Andersen impactor was used to detect the aerosol concentration of aerobes, gram-negative bacteria, fungi and AGI-30 microbial air sampler detect the endotoxin, and Composite Gas Detector detect the noxious gas. In order to assess the immune function of meat ducks, immune indicators including H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes were evaluated. Correlation coefficients were also calculated to evaluate the relationships among airborne bacteria, fungi, endotoxin and immune indicators. The results showed that the concentration of airborne aerobe, gram-negative bacteria, fungi, endotoxin have a strong correlation to H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes, respectively. In addition, when the concentration of microbial aerosol reach the level of group D, serum IgG (6 - 8 weeks, lysozyme (4 week were significantly higher than in group A (P < 0.05; serum IL-2 (7 and 8 weeks , T-lymphocyte transformation rate, lysozyme (7 and 8 weeks, spleen index (6 and 8 weeks and bursa index (8 week were significantly lower than in group A(P < 0.05 or P < 0.01. The results indicated that a high level of microbial aerosol adversely affected the immune level of meat ducks. The microbial aerosol values in group D provide a basis
Immune Regulator MCPIP1 Modulates TET Expression during Early Neocortical Development

Directory of Open Access Journals (Sweden)

Huihui Jiang

2016-09-01

Full Text Available MCPIP1 is a recently identified immune regulator that plays critical roles in preventing immune disorders, and is also present in the brain. Currently an unresolved question remains as to how MCPIP1 performs its non-immune functions in normal brain development. Here, we report that MCPIP1 is abundant in neural progenitor cells (NPCs and newborn neurons during the early stages of neurogenesis. The suppression of MCPIP1 expression impairs normal neuronal differentiation, cell-cycle exit, and concomitant NPC proliferation. MCPIP1 is important for maintenance of the NPC pool. Notably, we demonstrate that MCPIP1 reduces TET (TET1/TET2/TET3 levels and then decreases 5-hydroxymethylcytosine levels. Furthermore, the MCPIP1 interaction with TETs is involved in neurogenesis and in establishing the proper number of NPCs in vivo. Collectively, our findings not only demonstrate that MCPIP1 plays an important role in early cortical neurogenesis but also reveal an unexpected link between neocortical development, immune regulators, and epigenetic modification.
Maternal stress, nutrition and physical activity: Impact on immune function, CNS development and psychopathology.

Science.gov (United States)

Marques, Andrea Horvath; Bjørke-Monsen, Anne-Lise; Teixeira, Antônio L; Silverman, Marni N

2015-08-18

Evidence suggests that maternal and fetal immune dysfunction may impact fetal brain development and could play a role in neurodevelopmental disorders, although the definitive pathophysiological mechanisms are still not completely understood. Stress, malnutrition and physical inactivity are three maternal behavioral lifestyle factors that can influence immune and central nervous system (CNS) functions in both the mother and fetus, and may therefore, increase risk for neurodevelopmental/psychiatric disorders. First, we will briefly review some aspects of maternal-fetal immune system interactions and development of immune tolerance. Second, we will discuss the bidirectional communication between the immune system and CNS and the pathways by which immune dysfunction could contribute to neurodevelopmental disorders. Third, we will discuss the effects of prenatal stress and malnutrition (over and undernutrition) on perinatal programming of the CNS and immune system, and how this might influence neurodevelopment. Finally, we will discuss the beneficial impact of physical fitness during pregnancy on the maternal-fetal unit and infant and how regular physical activity and exercise can be an effective buffer against stress- and inflammatory-related disorders. Although regular physical activity has been shown to promote neuroplasticity and an anti-inflammatory state in the adult, there is a paucity of studies evaluating its impact on CNS and immune function during pregnancy. Implementing stress reduction, proper nutrition and ample physical activity during pregnancy and the childbearing period may be an efficient strategy to counteract the impact of maternal stress and malnutrition/obesity on the developing fetus. Such behavioral interventions could have an impact on early development of the CNS and immune system and contribute to the prevention of neurodevelopmental and psychiatric disorders. Further research is needed to elucidate this relationship and the underlying
Frank A. Beach award: programming of neuroendocrine function by early-life experience: a critical role for the immune system.

Science.gov (United States)

Bilbo, Staci D

2013-05-01

Many neuropsychiatric disorders are associated with a strong dysregulation of the immune system, and several have a striking etiology in development as well. Our recent evidence using a rodent model of neonatal Escherichia coli infection has revealed novel insight into the mechanisms underlying cognitive deficits in adulthood, and suggests that the early-life immune history of an individual may be critical to understanding the relative risk of developing later-life mental health disorders in humans. A single neonatal infection programs the function of immune cells within the brain, called microglia, for the life of the rodent such that an adult immune challenge results in exaggerated cytokine production within the brain and associated cognitive deficits. I describe the important role of the immune system, notably microglia, during brain development, and discuss some of the many ways in which immune activation during early brain development can affect the later-life outcomes of neural function, immune function, and cognition. Copyright © 2013 Elsevier Inc. All rights reserved.
Effects of γ-rays on Th1 and Th2 immune function of mice

International Nuclear Information System (INIS)

Jin Wei; Cui Yufang; An Xiaoxia; Xu Han; Dong Bo; Liu Xiaolan; Luo Qingliang

2007-01-01

Objective: To observe the effects of 6 Gy whole body γ-irradiation on immune function of Th1 and Th2 in mouse, and to investigate the cellular and molecular mechanism of immune system injury induced by irradiation. Methods: Surface marker and intracellular cytokines of lymphocytes were stained with fluorescence-labeled monoclonal antibodies, then the changes of lymphocyte subpopulations, especially the Th1 and Th2 in mouse peripheral blood and spleen were analyzed by flow cytometry. Results: (1) 1 d after 6 Gy y- irradiation, lymphocytic subsets of CD 19 + and CD 8 + in spleen decreased apparently and the percentages of them were only 30% and 41% of control groups respectively (P 19 + and 14 d for CD 8 + respectively, however, up to 21 d post-irradiation they still did not return to control level. (2) Th1 subpopulations in mouse peripheral blood and spleen were significantly reduced at 1 d after irradiation and were only 2.6% and 7.6% of control groups (P 4 + / CD 8 + were significantly increased at 1 d post-irradiation in mouse spleen because of swift reduction of CD 8 + cells. Interestingly, either in peripheral blood or in spleen in irradiated mice, the ratio of Th1/Th2 were evidently raised because of the decrement of Th1 cells, exhibited obviously a phenomenon of predominant immune response of Th2 cells. Conclusions: It is suggested that the depression of mouse immune function induced by 6 Gy γ-irradiation might be caused by changes of CD 4 + /CD 8 + ratio, especially the imbalance of Th1/Th2 function subpopulations. It is shown that the imbalance of Th1/Th2 function subpopulations plays an important role in radiation-induced immune injury, thus providing a better insight into the molecular mechanism and new strategies for prevent and treatment measures of immune injury by irradiation. (authors)
Temperament affects sympathetic nervous function in a normal population.

Science.gov (United States)

Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

2012-09-01

Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.
Mapping the Fetomaternal Peripheral Immune System at Term Pregnancy.

Science.gov (United States)

Fragiadakis, Gabriela K; Baca, Quentin J; Gherardini, Pier Federico; Ganio, Edward A; Gaudilliere, Dyani K; Tingle, Martha; Lancero, Hope L; McNeil, Leslie S; Spitzer, Matthew H; Wong, Ronald J; Shaw, Gary M; Darmstadt, Gary L; Sylvester, Karl G; Winn, Virginia D; Carvalho, Brendan; Lewis, David B; Stevenson, David K; Nolan, Garry P; Aghaeepour, Nima; Angst, Martin S; Gaudilliere, Brice L

2016-12-01

Preterm labor and infections are the leading causes of neonatal deaths worldwide. During pregnancy, immunological cross talk between the mother and her fetus is critical for the maintenance of pregnancy and the delivery of an immunocompetent neonate. A precise understanding of healthy fetomaternal immunity is the important first step to identifying dysregulated immune mechanisms driving adverse maternal or neonatal outcomes. This study combined single-cell mass cytometry of paired peripheral and umbilical cord blood samples from mothers and their neonates with a graphical approach developed for the visualization of high-dimensional data to provide a high-resolution reference map of the cellular composition and functional organization of the healthy fetal and maternal immune systems at birth. The approach enabled mapping of known phenotypical and functional characteristics of fetal immunity (including the functional hyperresponsiveness of CD4 + and CD8 + T cells and the global blunting of innate immune responses). It also allowed discovery of new properties that distinguish the fetal and maternal immune systems. For example, examination of paired samples revealed differences in endogenous signaling tone that are unique to a mother and her offspring, including increased ERK1/2, MAPK-activated protein kinase 2, rpS6, and CREB phosphorylation in fetal Tbet + CD4 + T cells, CD8 + T cells, B cells, and CD56 lo CD16 + NK cells and decreased ERK1/2, MAPK-activated protein kinase 2, and STAT1 phosphorylation in fetal intermediate and nonclassical monocytes. This highly interactive functional map of healthy fetomaternal immunity builds the core reference for a growing data repository that will allow inferring deviations from normal associated with adverse maternal and neonatal outcomes. Copyright © 2016 by The American Association of Immunologists, Inc.
Impact of age and sex on normal left heart structure and function.

Science.gov (United States)

Hagström, Linn; Henein, Michael Y; Karp, Kjell; Waldenström, Anders; Lindqvist, Per

2017-11-01

Accurate age- and sex-related normal reference values of ventricular structure and function are important to determine the level of dysfunction in patients. The aim of this study therefore was to document normal age range sex-related measurements of LV structural and functional measurements to serve such purpose. We evaluated left ventricular structure and function in 293 healthy subjects between 20 and 90 years with equally distributed gender. Doppler echocardiography was used including measure of both systolic and diastolic functions. Due to systolic LV function, only long axis function correlated with age (r = 0·55, P<0·01) and the correlation was stronger in females. Concerning diastolic function, there was a strong age correlation in all parameters used (r = 0·40-0·74, P<0·001). Due to LV structural changes over age, females showed a larger reduction in end-diastolic volumes, but no or trivial difference in wall thickness after the age of 60 years. Age is associated with significant normal changes in left ventricular structure and function, which should be considered when deciding on normality. These changes are related to systemic arterial changes as well as body stature, thus reflecting overall body ageing process. Furthermore, normal cardiac ageing in females might partly explain the higher prevalence of heart failure with preserved ejection in females. © 2016 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.
Cell-mediated immunity during syphilis. A review

Science.gov (United States)

Pavia, Charles S.; Folds, James D.; Baseman, Joel B.

1978-01-01

Evidence is presented which reinforces the complexity of the host-parasite interaction during the course of syphilis. Infection with Treponema pallidum evokes a complicated antibody response and an assortment of cell-mediated immune reactions in the host. It appears that humoral immunity plays a minor role towards the complete elimination of syphilitic infection while the cellular limb of the immune response may be an important host defence mechanism. Information now available indicates that a state of anergy, or immunosuppression, exists in the early stages of human and experimental rabbit syphilis based upon negative skin reactions to T. pallidum antigen(s), the abnormal histological appearance of lymphoid organs, and impaired in vitro lymphocyte reactivity. It is also evident that in the later stages of the disease cellular immunity becomes activated as delayed type skin reactions can normally be elicited in tertiary syphilitics and lymphocyte behaviour in cell culture appears normal. Several mechanisms have been invoked to explain the delay in an effective immune response against syphilitic infection and the duration of the disease: (1) a capsule-like substance on the outer surface of virulant T. pallidum may act as a barrier against treponemicidal antibody; (2) this material and other biological properties of virulent treponemes could enable spirochaetes to escape being engulfed by macrophages and other phagocytic cells; (3) antigenic competition among different treponemal antigens causing partial tolerance; (4) T. pallidum infection may bring about the elaboration of immunosuppressive substances of host or treponemal origin which inhibit the proper function of lymphocytes, macrophages, and other cell types. PMID:350348
Advances in the quantification of mitochondrial function in primary human immune cells through extracellular flux analysis.

Directory of Open Access Journals (Sweden)

Dequina Nicholas

Full Text Available Numerous studies show that mitochondrial energy generation determines the effectiveness of immune responses. Furthermore, changes in mitochondrial function may regulate lymphocyte function in inflammatory diseases like type 2 diabetes. Analysis of lymphocyte mitochondrial function has been facilitated by introduction of 96-well format extracellular flux (XF96 analyzers, but the technology remains imperfect for analysis of human lymphocytes. Limitations in XF technology include the lack of practical protocols for analysis of archived human cells, and inadequate data analysis tools that require manual quality checks. Current analysis tools for XF outcomes are also unable to automatically assess data quality and delete untenable data from the relatively high number of biological replicates needed to power complex human cell studies. The objectives of work presented herein are to test the impact of common cellular manipulations on XF outcomes, and to develop and validate a new automated tool that objectively analyzes a virtually unlimited number of samples to quantitate mitochondrial function in immune cells. We present significant improvements on previous XF analyses of primary human cells that will be absolutely essential to test the prediction that changes in immune cell mitochondrial function and fuel sources support immune dysfunction in chronic inflammatory diseases like type 2 diabetes.
Comparison of the Functional microRNA Expression in Immune Cell Subsets of Neonates and Adults

Science.gov (United States)

Yu, Hong-Ren; Hsu, Te-Yao; Huang, Hsin-Chun; Kuo, Ho-Chang; Li, Sung-Chou; Yang, Kuender D.; Hsieh, Kai-Sheng

2016-01-01

Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs) are reported to involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte subpopulations is important for understanding immune system regulation. In order to explore the unique miRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells, and myeloid dendritic cells) from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced interleukin (IL)-6 and TNF-α production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-α production. With this functional approach, we provide intact differential miRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies. PMID:28066425
Comparison of the functional microRNA expression in immune cell subsets of neonates and adults

Directory of Open Access Journals (Sweden)

Hong-Ren Yu

2016-12-01

Full Text Available Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs are reported involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte sub-populations is important for understanding immune system regulation. In order to explore the unique microRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells (pDCs, and myeloid dendritic cells (mDCs from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced IL-6 and TNF-alpha production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-alpha production. With this functional approach, we provide intact differential microRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies.
Effects of intensified training and taper on immune function

Directory of Open Access Journals (Sweden)

Elena Papacosta

2013-03-01

Full Text Available Although resting immune function is not very different in athletes compared with non-athletes periods of intensified training (overreaching in already well trained athletes can result in a depression of immunity in the resting state. Illness-prone athletes appear to have an altered cytokine response to antigen stimulation and exercise. Having low levels of salivary IgA secretion also makes athletes more susceptible to upper respiratory tract infections. Overtraining is associated with recurrent infections and immunodepression is common, but immune functions do not seem to be reliable markers of impending overtraining. There are several possible causes of the diminution of immune function associated with periods of heavy training. One mechanism may simply be the cumulative effects of repeated bouts of intense exercise (with or without tissue damage with the consequent elevation of stress hormones, particularly glucocorticoids such as cortisol, causing temporary inhibition of TH-1 cytokines with a relative dampening of the cell-mediated response. When exercise is repeated frequently there may not be sufficient time for the immune system to recover fully. Tapering has been described as a gradual reduction in the training load which allows the recovery of physiological capacities that were impaired by previous intensive training and permits further training-induced adaptations to occur accompanied by competition performance enhancements. The majority of the studies that have examined the recovery of immunoendocrine responses during 1-3 week tapers in trained athletes have mainly reported enhanced performance, often accompanied by increased anabolic activity, reduced physiological stress and restoration of mucosal immunity and immune function.Quando se compara a função imune, em repouso, de atletas e não atletas, não se verificam grandes diferenças. Porém, períodos de treinamento intensificado ("overreaching" em atletas bem treinados podem
Nanoparticle-based B-cell targeting vaccines: Tailoring of humoral immune responses by functionalization with different TLR-ligands.

Science.gov (United States)

Zilker, Claudia; Kozlova, Diana; Sokolova, Viktoriya; Yan, Huimin; Epple, Matthias; Überla, Klaus; Temchura, Vladimir

2017-01-01

Induction of an appropriate type of humoral immune response during vaccination is essential for protection against viral and bacterial infections. We recently observed that biodegradable calcium phosphate (CaP) nanoparticles coated with proteins efficiently targeted and activated naïve antigen-specific B-cells in vitro. We now compared different administration routes for CaP-nanoparticles and demonstrated that intramuscular immunization with such CaP-nanoparticles induced stronger immune responses than immunization with monovalent antigen. Additional functionalization of the CaP-nanoparticles with TRL-ligands allowed modulating the IgG subtype response and the level of mucosal IgA antibodies. CpG-containing CaP-nanoparticles were as immunogenic as a virus-like particle vaccine. Functionalization of CaP-nanoparticles with T-helper cell epitopes or CpG also allowed overcoming lack of T-cell help. Thus, our results indicate that CaP-nanoparticle-based B-cell targeting vaccines functionalized with TLR-ligands can serve as a versatile platform for efficient induction and modulation of humoral immune responses in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
Cow's Milk and Immune Function in the Respiratory Tract: Potential Mechanisms.

Science.gov (United States)

Perdijk, Olaf; van Splunter, Marloes; Savelkoul, Huub F J; Brugman, Sylvia; van Neerven, R J Joost

2018-01-01

During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow's milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow's milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow's milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow's milk components in the gut must recirculate into the blood and home to the (upper and lower) respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present in milk, we speculate that raw

Microbial-immune cross-talk and regulation of the immune system.

Science.gov (United States)

Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

2013-01-01

We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.
Effects of 12-Week’s Tai Chi Chuan Practice on the Immune Function of Female College Students Who Lack Physical Exercise

Directory of Open Access Journals (Sweden)

M-Y. Wang

2011-03-01

Full Text Available Objective: The present study investigated the effects of 12 weeks’ tai chi chuan (TCC practice on the immune function of female college students. Method: 60 female college students (19.3 ± 1.8 years were recruited and were randomly assigned to either the TCC training (n=30 or the control group (n=30. In the TCC group, the exercise duration was 45 minutes per day and 5 days a week for 12 weeks. The TCC group performed TCC under the teaching of a TCC master. Immunoglobulin G (IgG, IgA, IgM, Cluster of differentiation 3 (CD3, CD4 , CD8 , interferon γ (IFN-γ, interleukin 4 (IL-4 and IL-12 were measured before and after 12 weeks of TCC practice. Results: The TCC group had significantly higher plasma levels of IgG (P=0.000, IgM (P=0.05 and CD4 (P=0.032 after practice compared with their respective pre-practice levels. There were no significant differences in IgA, CD3, IFN-γ, IL-4 or IL-12, but IgA and IFN-γ levels increased and IL-12 decreased within the normal range. Conclusion: The results suggest that regular long-term TCC practice might be a potential method to improve the cellular immune function (anti-virus and anti-infection of people who lack physical exercise. Further studies concerning other immune aspects are needed.
Interactions between Temperament, Stress, and Immune Function in Cattle

Directory of Open Access Journals (Sweden)

N. C. Burdick

2011-01-01

Full Text Available The detrimental effects caused by stressors encountered by animals during routine handling can pose economic problems for the livestock industry due to increased costs ultimately borne by the producer and the consumer. Stress adversely affects key physiological processes of the reproductive and immune systems. In recent years stress responsiveness has been associated with cattle behavior, specifically temperament. Cattle with more excitable temperaments, as measured by chute score, pen score, and exit velocity (flight speed, exhibit greater basal concentrations of glucocorticoids and catecholamines. Similar to stressed cattle, more temperamental cattle (i.e., cattle exhibiting greater exit velocity or pen and chute scores have poorer growth performance, carcass characteristics, and immune responses. Thus, understanding the interrelationship of stress and temperament can help in the development of selection and management practices that reduce the negative influence of temperament on growth and productivity of cattle. This paper discusses the relationship between stress and temperament and the developing evidence of an effect of temperament on immune function of cattle that have been handled or restrained. Specifically, the paper discusses different methodologies used to measure temperament, including chute score, pen score, and exit velocity, and discusses the reaction of cattle to different stressors including handling and restraint.
Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka)

Science.gov (United States)

Alcorn, S.W.; Murray, A.L.; Pascho, R.J.

2002-01-01

To determine if the defences of sockeye salmon (Oncorhynchus nerka) raised in captivity are affected by the rearing temperature or their life-cycle stage, various indices of the humoral and cellular immune functions were measured in fish reared at either 8 or 12??C for their entire life-cycle. Measures of humoral immunity included the commonly used haematological parameters, as well as measurements of complement, and lysozyme activity. Cellular assays quantified the ability of macrophages from the anterior kidney to phagocytise Staphylococcus aureus cells, or the activities of certain bactericidal systems of those cells. The T-dependent antibody response to a recombinant 57 kDa protein of Renibacterium salmoninarum was used to quantify the specific immune response. Fish were sampled during the spring and fall of their second, third and fourth years, corresponding to a period that began just before smolting and ended at sexual maturation. Fish reared at 8??C tended to have a greater percentage of phagocytic kidney macrophages during the first 2 years of sampling than the fish reared at 12??C. During the last half of the study the complement activity of the fish reared at 8??C was greater than that of the 12??C fish. Conversely, a greater proportion of the blood leucocytes were lymphocytes in fish reared at 12??C compared to the fish reared at 8??C. Fish reared at 12??C also produced a greater antibody response than those reared at 8??C. Results suggested that the immune apparatus of sockeye salmon reared at 8??C relied more heavily on the non-specific immune response, while the specific immune response was used to a greater extent when the fish were reared at 12??C. Although a seasonal effect was not detected in any of the indices measured, varying effects were observed in some measurements during sexual maturation of fish in both temperature groups. At that time there were dramatic decreases in complement activity and lymphocyte numbers. This study was unique in
A prospective study of long-term results and the red blood cell immune adherence function following 131I treatment of Graves' disease

International Nuclear Information System (INIS)

Sun Zengjun; Ma Yuqin; Liu Junqing; Zhang Xia

2003-01-01

Objective: To observe the long-term curative effect and red blood cell immune function in patients with Graves' Disease (GD) after radioactive iodine ( 131 I) treatment. Methods: To observe the hyperthyroid symptoms, physical signs and to measure the concentration of FT3, FT4, FSH by radioimmunoassay, the percent of RBC-C 3b R-YR(%), RBC-IC-YR(%). Results: Patients with GD treated by 131 I after three month, these hyperthyroid symptoms, Physical signs are alleviated and even vanished in patients who were treated by 131 I after 1.5 years, RBC-C 3b R-YR(%) are normal in all patients, but RBC-IC-YR(%) are higher than before treatment with 131 I, then become lower after three months, treatment by 131 I but they were higher than those in normal group, when treated with 131 I after 1.5 years, RBC-IC-YR(%) are normal, the relationship between RBC-C 3b R-YR(%) and RBC-IC-YR(%) are positively interacted. Conclusion: The 131 I treatment produces a good rapid curative effect for GD patients, the disorder state of the red cell immune adherence system is rapidly corrected and this effect is unidirectional. So RBC-C 3b R-YR(%), RBC-IC-YR(%) are the useful predictors of GD remission and their relationship, RBC-IC-YR(%) are helpful in explaining the mechanism of radioactive iodine therapy and are the predictors of GD remission after 131 I treatment
Use of the local lymph node assay in assessment of immune function

International Nuclear Information System (INIS)

Berg, Femke A. van den; Baken, Kirsten A.; Vermeulen, Jolanda P.; Gremmer, Eric R.; Steeg, Harry van; Loveren, Henk van

2005-01-01

The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene (B[a]P). Subsequently, cell proliferation and interferon-γ (IFN-γ) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse
Use of the local lymph node assay in assessment of immune function.

Science.gov (United States)

van den Berg, Femke A; Baken, Kirsten A; Vermeulen, Jolanda P; Gremmer, Eric R; van Steeg, Harry; van Loveren, Henk

2005-07-01

The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene, (B[a]P). Subsequently, cell proliferation and interferon-gamma (IFN-gamma) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse.
Does partial occlusion promote normal binocular function?

Science.gov (United States)

Li, Jingrong; Thompson, Benjamin; Ding, Zhaofeng; Chan, Lily Y L; Chen, Xiang; Yu, Minbin; Deng, Daming; Hess, Robert F

2012-10-03

There is growing evidence that abnormal binocular interactions play a key role in the amblyopia syndrome and represent a viable target for treatment interventions. In this context the use of partial occlusion using optical devices such as Bangerter filters as an alternative to complete occlusion is of particular interest. The aims of this study were to understand why Bangerter filters do not result in improved binocular outcomes compared to complete occlusion, and to compare the effects of Bangerter filters, optical blur and neutral density (ND) filters on normal binocular function. The effects of four strengths of Bangerter filters (0.8, 0.6, 0.4, 0.2) on letter and vernier acuity, contrast sensitivity, stereoacuity, and interocular suppression were measured in 21 observers with normal vision. In a subset of 14 observers, the partial occlusion effects of Bangerter filters, ND filters and plus lenses on stereopsis and interocular suppression were compared. Bangerter filters did not have graded effect on vision and induced significant disruption to binocular function. This disruption was greater than that of monocular defocus but weaker than that of ND filters. The effect of the Bangerter filters on stereopsis was more pronounced than their effect on monocular acuity, and the induced monocular acuity deficits did not predict the induced deficits in stereopsis. Bangerter filters appear to be particularly disruptive to binocular function. Other interventions, such as optical defocus and those employing computer generated dichoptic stimulus presentation, may be more appropriate than partial occlusion for targeting binocular function during amblyopia treatment.
Effects of fenbendazole on routine immune response parameters of BALB/c mice.

Science.gov (United States)

Cray, Carolyn; Villar, David; Zaias, Julia; Altman, Norman H

2008-11-01

Fenbendazole (FBZ) is an anthelmintic drug widely used to treat and prevent pinworm outbreaks in laboratory rodents. Although data in nonrodent species indicate possible effects of fenbendazole on the bone marrow and lymphocyte proliferation and function, little has been reported regarding possible effects on the rodent immune system. The purpose of the current study was to determine the effects of a therapeutic regimen of FBZ on immune parameters in BALB/c mice. Both 9-wk on-off and 5-wk continuous medicated feed protocols were assessed. No significant differences between normal and FBZ diet treated mice were observed in the following parameters: complete blood count, blood chemistry, quantitation of major T and B cell markers in spleen, quantitation of T cell markers in the thymus, spleen cell proliferation to T and B cell mitogens, bone marrow colony-forming cell assays, skin graft rejection, and primary and secondary humoral immune responses. These data indicate that FBZ treatment does not affect many standard broad measures of immune function.
Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

International Nuclear Information System (INIS)

Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

2013-01-01

Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions
Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

Energy Technology Data Exchange (ETDEWEB)

Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

2013-11-01

Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.
Peptide pool immunization and CD8+ T cell reactivity

DEFF Research Database (Denmark)

Rasmussen, Susanne B; Harndahl, Mikkel N; Buus, Anette Stryhn

2013-01-01

Mice were immunized twice with a pool of five peptides selected among twenty 8-9-mer peptides for their ability to form stable complexes at 37°C with recombinant H-2K(b) (half-lives 10-15h). Vaccine-induced immunity of splenic CD8(+) T cells was studied in a 24h IFNγ Elispot assay. Surprisingly...... peptides induced normal peptide immunity i.e. the specific T cell reactivity in the Elispot culture was strictly dependent on exposure to the immunizing peptide ex vivo. However, immunization with two of the peptides, a VSV- and a Mycobacterium-derived peptide, resulted in IFNγ spot formation without...... peptide in the Elispot culture. Immunization with a mixture of the VSV-peptide and a "normal" peptide also resulted in IFNγ spot formation without addition of peptide to the assay culture. Peptide-tetramer staining of CD8(+) T cells from mice immunized with a mixture of VSV-peptide and "normal" peptide...
Nonischemic changes in right ventricular function on exercise. Do normal volunteers differ from patients with normal coronary arteries

International Nuclear Information System (INIS)

Caplin, J.L.; Maltz, M.B.; Flatman, W.D.; Dymond, D.S.

1988-01-01

Factors other than ischemia may alter right ventricular function both at rest and on exercise. Normal volunteers differ from cardiac patients with normal coronary arteries with regard to their left ventricular response to exercise. This study examined changes in right ventricular function on exercise in 21 normal volunteers and 13 patients with normal coronary arteries, using first-pass radionuclide angiography. There were large ranges of right ventricular ejection fraction in the two groups, both at rest and on exercise. Resting right ventricular ejection fraction was 40.2 +/- 10.6% (mean +/- SD) in the volunteers and 38.6 +/- 9.7% in the patients, p = not significant, and on exercise rose significantly in both groups to 46.1 +/- 9.9% and 45.8 +/- 9.7%, respectively. The difference between the groups was not significant. In both groups some subjects with high resting values showed large decreases in ejection fraction on exercise, and there were significant negative correlations between resting ejection fraction and the change on exercise, r = -0.59 (p less than 0.01) in volunteers, and r = -0.66 (p less than 0.05) in patients. Older volunteers tended to have lower rest and exercise ejection fractions, but there was no difference between normotensive and hypertensive patients in their rest or exercise values. In conclusion, changes in right ventricular function on exercise are similar in normal volunteers and in patients with normal coronary arteries. Some subjects show decreases in right ventricular ejection fraction on exercise which do not appear to be related to ischemia
Normal pancreatic exocrine function does not exclude MRI/MRCP chronic pancreatitis findings.

Science.gov (United States)

Alkaade, Samer; Cem Balci, Numan; Momtahen, Amir Javad; Burton, Frank

2008-09-01

Abnormal pancreatic function tests have been reported to precede the imaging findings of chronic pancreatitis. Magnetic resonance imaging (MRI) with magnetic resonance cholangiopancreatography (MRCP) is increasingly accepted as the primary imaging modality for the detection of structural changes of early mild chronic pancreatitis. The aim of this study was to evaluate MRI/MRCP findings in patients with symptoms consistent with chronic pancreatitis who have normal Secretin Endoscopic Pancreatic Function test. A retrospective study of 32 patients referred for evaluation of chronic abdominal pain consistent with chronic pancreatitis and reported normal standard abdominal imaging (ultrasound, computed tomography, or MRI). All patients underwent Secretin Endoscopic Pancreatic Function testing and pancreatic MRI/MRCP at our institution. We reviewed the MRI/MRCP images in patients who had normal Secretin Endoscopic Pancreatic Function testing. MRI/MRCP images were assessed for pancreatic duct morphology, gland size, parenchymal signal and morphology, and arterial contrast enhancement. Of the 32 patients, 23 had normal Secretin Endoscopic Pancreatic Function testing, and 8 of them had mild to marked spectrum of abnormal MRI/MRCP findings that were predominantly focal. Frequencies of the findings were as follows: pancreatic duct stricture (n=3), pancreatic duct dilatation (n=3), side branch ectasia (n=4), atrophy (n=5), decreased arterial enhancement (n=5), decreased parenchymal signal (n=1), and cavity formation (n=1). The remaining15 patients had normal pancreatic structure on MRI/MRCP. Normal pancreatic function testing cannot exclude abnormal MRI/MRCP especially focal findings of chronic pancreatitis. Further studies needed to verify significance of these findings and establish MRI/MRCP imaging criteria for the diagnosis of chronic pancreatitis.
The kinase TBK1 functions in dendritic cells to regulate T cell homeostasis, autoimmunity, and antitumor immunity.

Science.gov (United States)

Xiao, Yichuan; Zou, Qiang; Xie, Xiaoping; Liu, Ting; Li, Haiyan S; Jie, Zuliang; Jin, Jin; Hu, Hongbo; Manyam, Ganiraju; Zhang, Li; Cheng, Xuhong; Wang, Hui; Marie, Isabelle; Levy, David E; Watowich, Stephanie S; Sun, Shao-Cong

2017-05-01

Dendritic cells (DCs) are crucial for mediating immune responses but, when deregulated, also contribute to immunological disorders, such as autoimmunity. The molecular mechanism underlying the function of DCs is incompletely understood. In this study, we have identified TANK-binding kinase 1 (TBK1), a master innate immune kinase, as an important regulator of DC function. DC-specific deletion of Tbk1 causes T cell activation and autoimmune symptoms and also enhances antitumor immunity in animal models of cancer immunotherapy. The TBK1-deficient DCs have up-regulated expression of co-stimulatory molecules and increased T cell-priming activity. We further demonstrate that TBK1 negatively regulates the induction of a subset of genes by type I interferon receptor (IFNAR). Deletion of IFNAR1 could largely prevent aberrant T cell activation and autoimmunity in DC-conditional Tbk1 knockout mice. These findings identify a DC-specific function of TBK1 in the maintenance of immune homeostasis and tolerance. © 2017 Xiao et al.
Immune response is required for the control of in vivo translocation and chronic toxicity of graphene oxide

Science.gov (United States)

Wu, Qiuli; Zhao, Yunli; Fang, Jianpeng; Wang, Dayong

2014-05-01

Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO toxicity and accumulation in the intestine and maintained the relatively normal immune response of animals. The severe accumulation of OP50 in the intestine might be partially due to the damage by GO on the development and function of AVL and DVB neurons controlling defecation behavior. Reduction of chronic GO toxicity by PEG surface modification largely resulted from the inhibition of OP50 accumulation in the intestine and the maintenance of normal immune response. Our results highlight the key role of innate immunity in regulating in vivo chronic GO toxicity, which will be helpful for our understanding of the interactions between nanomaterials and biological systems during the long-term development of animals.Graphene oxide (GO) shows great promise as a nanomaterial for medical applications; however, the mechanism for its long-term adverse effects is still largely unclear. Here, we show that chronic GO exposure not only caused damage on the function of both primary and secondary targeted organs but also induced severe accumulation of pathogenic microbial food (OP50) in the intestine of Caenorhabditis elegans, a non-mammalian alternative toxicity assay system. GO accumulated in the intestine could be largely co-localized with OP50 and induced decreased immune response of animals. In contrast, feeding with UV-treated OP50 suppressed GO
Suppression of adaptive immunity to heterologous antigens during Plasmodium infection through hemozoin-induced failure of dendritic cell function

Directory of Open Access Journals (Sweden)

Phillips R

2006-04-01

Full Text Available Abstract Background Dendritic cells (DCs are central to the initiation and regulation of the adaptive immune response during infection. Modulation of DC function may therefore allow evasion of the immune system by pathogens. Significant depression of the host's systemic immune response to both concurrent infections and heterologous vaccines has been observed during malaria infection, but the mechanisms underlying this immune hyporesponsiveness are controversial. Results Here, we demonstrate that the blood stages of malaria infection induce a failure of DC function in vitro and in vivo, causing suboptimal activation of T cells involved in heterologous immune responses. This effect on T-cell activation can be transferred to uninfected recipients by DCs isolated from infected mice. Significantly, T cells activated by these DCs subsequently lack effector function, as demonstrated by a failure to migrate to lymphoid-organ follicles, resulting in an absence of B-cell responses to heterologous antigens. Fractionation studies show that hemozoin, rather than infected erythrocyte (red blood cell membranes, reproduces the effect of intact infected red blood cells on DCs. Furthermore, hemozoin-containing DCs could be identified in T-cell areas of the spleen in vivo. Conclusion Plasmodium infection inhibits the induction of adaptive immunity to heterologous antigens by modulating DC function, providing a potential explanation for epidemiological studies linking endemic malaria with secondary infections and reduced vaccine efficacy.
Pomegranate extract and exercise provide additive benefits on improvement of immune function by inhibiting inflammation and oxidative stress in high-fat-diet-induced obesity in rats.

Science.gov (United States)

Zhao, Fei; Pang, Wentao; Zhang, Ziyi; Zhao, Jialong; Wang, Xin; Liu, Ye; Wang, Xun; Feng, Zhihui; Zhang, Yong; Sun, Wenyan; Liu, Jiankang

2016-06-01

Obesity is reported to be associated with immune dysfunction and a state of low-grade, chronic inflammation. Either pomegranate extract (PomE) or exercise (Ex) has been shown to have antiobesity, anti-inflammatory and antioxidant effects. Nevertheless, no study has addressed the additive benefits of PomE and Ex on the restoration of obesity-induced immune defects. The present work aims to study the effect of PomE and Ex as a combined intervention on immune function and the underlying mechanism involved in inflammation and oxidative stress in rats with high-fat-diet (HFD)-induced obesity. Our results demonstrate that the combination of PomE and Ex showed additive benefits on inhibition of HFD-induced body weight increase and improvement of HFD-induced immune dysfunction, including (a) attenuating the abnormality of histomorphology of the spleen, (b) increasing the ratio of the CD4+:CD8+ T cell subpopulations in splenocytes and peripheral blood mononuclear cells (PBMC), (c) inhibition of apoptosis in splenocytes and PBMC, (d) normalizing peritoneal macrophage phenotypes and (e) restoring immunomodulating factors in serum. We also find that immune dysfunction in HFD-fed rats was associated with increased inflammatory cytokine secretion and oxidative stress biomarkers, and that the combination of PomE and Ex effectively inhibited the inflammatory response and decreased oxidative damage. The effect of PomE and Ex as a combined intervention is greater than the effect of either PomE or Ex alone, showing that PomE and Ex may be additively effective in improving immune function in HFD-fed rats by inhibiting inflammation and decreasing oxidative stress. Copyright © 2016 Elsevier Inc. All rights reserved.
Hydrogen-rich Water Exerting a Protective Effect on Ovarian Reserve Function in a Mouse Model of Immune Premature Ovarian Failure Induced by Zona Pellucida 3

Science.gov (United States)

He, Xin; Wang, Shu-Yu; Yin, Cheng-Hong; Wang, Tong; Jia, Chan-Wei; Ma, Yan-Min

2016-01-01

Background: Premature ovarian failure (POF) is a disease that affects female fertility but has few effective treatments. Ovarian reserve function plays an important role in female fertility. Recent studies have reported that hydrogen can protect male fertility. Therefore, we explored the potential protective effect of hydrogen-rich water on ovarian reserve function through a mouse immune POF model. Methods: To set up immune POF model, fifty female BALB/c mice were randomly divided into four groups: Control (mice consumed normal water, n = 10), hydrogen (mice consumed hydrogen-rich water, n = 10), model (mice were immunized with zona pellucida glycoprotein 3 [ZP3] and consumed normal water, n = 15), and model-hydrogen (mice were immunized with ZP3 and consumed hydrogen-rich water, n = 15) groups. After 5 weeks, mice were sacrificed. Serum anti-Müllerian hormone (AMH) levels, granulosa cell (GC) apoptotic index (AI), B-cell leukemia/lymphoma 2 (Bcl-2), and BCL2-associated X protein (Bax) expression were examined. Analyses were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA) software. Results: Immune POF model, model group exhibited markedly reduced serum AMH levels compared with those of the control group (5.41 ± 0.91 ng/ml vs. 16.23 ± 1.97 ng/ml, P = 0.033) and the hydrogen group (19.65 ± 7.82 ng/ml, P = 0.006). The model-hydrogen group displayed significantly higher AMH concentrations compared with that of the model group (15.03 ± 2.75 ng/ml vs. 5.41 ± 0.91 ng/ml, P = 0.021). The GC AI was significantly higher in the model group (21.30 ± 1.74%) than those in the control (7.06 ± 0.27%), hydrogen (5.17 ± 0.41%), and model-hydrogen groups (11.24 ± 0.58%) (all P hydrogen group compared with that of the hydrogen group (11.24 ± 0.58% vs. 5.17 ± 0.41%, P = 0.021). Compared with those of the model group, ovarian tissue Bcl-2 levels increased (2.18 ± 0.30 vs. 3.01 ± 0.33, P = 0.045) and the Bax/Bcl-2 ratio decreased in the model-hydrogen group
The sweet side of a long pentraxin: how glycosylation affects PTX3 functions in innate immunity and inflammation

Directory of Open Access Journals (Sweden)

Antonio eInforzato

2013-01-01

Full Text Available Innate immunity represents the first line of defence against pathogens and plays key roles in activation and orientation of the adaptive immune response. The innate immune system comprises both a cellular and a humoral arm. Components of the humoral arm include soluble pattern recognition molecules (PRMs that recognise pathogen associated molecular patterns (PAMPs and initiate the immune response in coordination with the cellular arm, therefore acting as functional ancestors of antibodies. The long pentraxin PTX3 is a prototypic soluble PRM that is produced at sites of infection and inflammation by both somatic and immune cells. Gene targeting of this evolutionarily conserved protein has revealed a non-redundant role in resistance to selected pathogens. Moreover, PTX3 exerts important functions at the crossroad between innate immunity, inflammation and female fertility. The human PTX3 protein contains a single N-glycosylation site that is fully occupied by complex type oligosaccharides, mainly fucosylated and sialylated biantennary glycans. Glycosylation has been implicated in a number of PTX3 activities, including neutralization of influenza viruses, modulation of the complement system, and attenuation of leukocyte recruitment. Therefore, this post translational modification might act as a fine tuner of PTX3 functions in native immunity and inflammation.Here we review the studies on PTX3, with emphasis on the glycan-dependent mechanisms underlying pathogen recognition and crosstalk with other components of the innate immune system.

The innate immune signaling in cancer and cardiometabolic diseases: Friends or foes?

Science.gov (United States)

Wang, Weijun; Zhang, Yaxing; Yang, Ling; Li, Hongliang

2017-02-28

The innate immune system is responsible for sensing pathogen-associated molecular patterns (PAMPs) or danger-associated molecular patterns (DAMPs) by several types of germline-encoded pattern-recognition receptors (PRRs). It has the capacity to help the human body maintain homeostasis under normal conditions. However, in pathological conditions, PAMPs or DAMPs trigger aberrant innate immune and inflammatory responses and thus negatively or positively influence the progression of cancer and cardiometabolic diseases. Interestingly, we found that some elements of innate immune signaling are involved in these diseases partially via immune-independent manners, indicating a deeper understanding of the function of innate immune signaling in these diseases is urgent. In this review, we summarize the primary innate immune signaling pathways and their association with cancer and cardiometabolic diseases, with the aim of providing effective therapies for these diseases. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Abnormal immune system development and function in schizophrenia helps reconcile diverse findings and suggests new treatment and prevention strategies.

Science.gov (United States)

Anders, Sherry; Kinney, Dennis K

2015-08-18

Extensive research implicates disturbed immune function and development in the etiology and pathology of schizophrenia. In addition to reviewing evidence for immunological factors in schizophrenia, this paper discusses how an emerging model of atypical immune function and development helps explain a wide variety of well-established - but puzzling - findings about schizophrenia. A number of theorists have presented hypotheses that early immune system programming, disrupted by pre- and perinatal adversity, often combines with abnormal brain development to produce schizophrenia. The present paper focuses on the hypothesis that disruption of early immune system development produces a latent immune vulnerability that manifests more fully after puberty, when changes in immune function and the thymus leave individuals more susceptible to infections and immune dysfunctions that contribute to schizophrenia. Complementing neurodevelopmental models, this hypothesis integrates findings on many contributing factors to schizophrenia, including prenatal adversity, genes, climate, migration, infections, and stress, among others. It helps explain, for example, why (a) schizophrenia onset is typically delayed until years after prenatal adversity, (b) individual risk factors alone often do not lead to schizophrenia, and (c) schizophrenia prevalence rates actually tend to be higher in economically advantaged countries. Here we discuss how the hypothesis explains 10 key findings, and suggests new, potentially highly cost-effective, strategies for treatment and prevention of schizophrenia. Moreover, while most human research linking immune factors to schizophrenia has been correlational, these strategies provide ethical ways to experimentally test in humans theories about immune function and schizophrenia. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2015 Elsevier B.V. All rights reserved.
T helper cell 2 immune skewing in pregnancy/early life

DEFF Research Database (Denmark)

McFadden, J P; Thyssen, J P; Basketter, D A

2015-01-01

During the last 50 years there has been a significant increase in Western societies of atopic disease and associated allergy. The balance between functional subpopulations of T helper cells (Th) determines the quality of the immune response provoked by antigen. One such subpopulation - Th2 cells...... that in Westernized societies reduced exposure during early childhood to pathogenic microorganisms favours the development of atopic allergy. Pregnancy is normally associated with Th2 skewing, which persists for some months in the neonate before Th1/Th2 realignment occurs. In this review, we consider...... the immunophysiology of Th2 immune skewing during pregnancy. In particular, we explore the possibility that altered and increased patterns of exposure to certain chemicals have served to accentuate this normal Th2 skewing and therefore further promote the persistence of a Th2 bias in neonates. Furthermore, we propose...
Changes of some immune functions in combined radiation-burn injury in rats

International Nuclear Information System (INIS)

Yan Yongtang; Ran Xinze; Wei Shuqing

1991-01-01

The characteristics of some immune functions in radiation injury (6 Gy), burn injury (15%, III deg) and combined radiation-burn injury (CRBI) were studied in rats. The results showed that the functions of splenocytes and thymocytes in radiation injury group (RIG) were depressed more markedly 24-72 h after injury. The degree of thymocyte depression in burn injury group (BIG) was significantly lower than that in RIG and recovered more easily. The characteristics of the CRBI effects were as follows: (1) The combined depression effect on thymocytes in CRBI as compared with that in RIG was deeper and the recovery was slower. (2) The depression course of splenocytes was similar to that in RIG, but the depression degree in the early stage was significantly more heavy than that in RIG. (3) In the later stage of CRBI the level of recovery of T H cells was significantly lower than that in RIG. (4) Eschar-excision plus skin grafting at 24 h after combined injury was helpful for the recovery of thymocyte and splenocytes function. The results showed that the depression and recovery of immune functions in combined injury were closely related to the wound of burn
The effect of anti-depressant Amitriptyline on the immune system

Directory of Open Access Journals (Sweden)

Dukan J

1994-04-01

Full Text Available We have studied the effect of amitriptyline, a tricyclic anti-depressant drug on several immune parameters of the Balb/c mice in order to evaluate its immunomodulatory effects. Results showed that amitriptyline will potentiates all of the immunocytes functions except for the production of PGE2 by LPS stimulated monocytes. We have also showed that amitriptyline can normalize the immunosuppressive effect of dexamethasone on mice (experimental stress. These results suggest that one of the mechanisms of action of the tricyclic anti-depressant drugs might be through the modulation of the immune system which has been suppressed by stress or distress
Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

Directory of Open Access Journals (Sweden)

Kathryn M. Lenz

2018-04-01

Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.
Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

Science.gov (United States)

Lenz, Kathryn M; Nelson, Lars H

2018-01-01

Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.
Immunization Information System and Informatics to Promote Immunizations: Perspective From Minnesota Immunization Information Connection.

Science.gov (United States)

Muscoplat, Miriam Halstead; Rajamani, Sripriya

2017-01-01

The vision for management of immunization information is availability of real-time consolidated data and services for all ages, to clinical, public health, and other stakeholders. This is being executed through Immunization Information Systems (IISs), which are population-based and confidential computerized systems present in most US states and territories. Immunization Information Systems offer many functionalities, such as immunization assessment reports, client follow-up, reminder/recall feature, vaccine management tools, state-supplied vaccine ordering, comprehensive immunization history, clinical decision support/vaccine forecasting and recommendations, data processing, and data exchange. This perspective article will present various informatics tools in an IIS, in the context of the Minnesota Immunization Information Connection.
In immune defense: redefining the role of the immune system in chronic disease.

Science.gov (United States)

Rubinow, Katya B; Rubinow, David R

2017-03-01

The recognition of altered immune system function in many chronic disease states has proven to be a pivotal advance in biomedical research over the past decade. For many metabolic and mood disorders, this altered immune activity has been characterized as inflammation, with the attendant assumption that the immune response is aberrant. However, accumulating evidence challenges this assumption and suggests that the immune system may be mounting adaptive responses to chronic stressors. Further, the inordinate complexity of immune function renders a simplistic, binary model incapable of capturing critical mechanistic insights. In this perspective article, we propose alternative paradigms for understanding the role of the immune system in chronic disease. By invoking allostasis or systems biology rather than inflammation, we can ascribe greater functional significance to immune mediators, gain newfound appreciation of the adaptive facets of altered immune activity, and better avoid the potentially disastrous effects of translating erroneous assumptions into novel therapeutic strategies.
Chronic Lymphocytic Leukemia B-Cell Normal Cellular Counterpart: Clues From a Functional Perspective.

Science.gov (United States)

Darwiche, Walaa; Gubler, Brigitte; Marolleau, Jean-Pierre; Ghamlouch, Hussein

2018-01-01

Chronic lymphocytic leukemia (CLL) is characterized by the clonal expansion of small mature-looking CD19+ CD23+ CD5+ B-cells that accumulate in the blood, bone marrow, and lymphoid organs. To date, no consensus has been reached concerning the normal cellular counterpart of CLL B-cells and several B-cell types have been proposed. CLL B-cells have remarkable phenotypic and gene expression profile homogeneity. In recent years, the molecular and cellular biology of CLL has been enriched by seminal insights that are leading to a better understanding of the natural history of the disease. Immunophenotypic and molecular approaches (including immunoglobulin heavy-chain variable gene mutational status, transcriptional and epigenetic profiling) comparing the normal B-cell subset and CLL B-cells provide some new insights into the normal cellular counterpart. Functional characteristics (including activation requirements and propensity for plasma cell differentiation) of CLL B-cells have now been investigated for 50 years. B-cell subsets differ substantially in terms of their functional features. Analysis of shared functional characteristics may reveal similarities between normal B-cell subsets and CLL B-cells, allowing speculative assignment of a normal cellular counterpart for CLL B-cells. In this review, we summarize current data regarding peripheral B-cell differentiation and human B-cell subsets and suggest possibilities for a normal cellular counterpart based on the functional characteristics of CLL B-cells. However, a definitive normal cellular counterpart cannot be attributed on the basis of the available data. We discuss the functional characteristics required for a cell to be logically considered to be the normal counterpart of CLL B-cells.
Immune evasion in cancer: Mechanistic basis and therapeutic strategies.

Science.gov (United States)

Vinay, Dass S; Ryan, Elizabeth P; Pawelec, Graham; Talib, Wamidh H; Stagg, John; Elkord, Eyad; Lichtor, Terry; Decker, William K; Whelan, Richard L; Kumara, H M C Shantha; Signori, Emanuela; Honoki, Kanya; Georgakilas, Alexandros G; Amin, Amr; Helferich, William G; Boosani, Chandra S; Guha, Gunjan; Ciriolo, Maria Rosa; Chen, Sophie; Mohammed, Sulma I; Azmi, Asfar S; Keith, W Nicol; Bilsland, Alan; Bhakta, Dipita; Halicka, Dorota; Fujii, Hiromasa; Aquilano, Katia; Ashraf, S Salman; Nowsheen, Somaira; Yang, Xujuan; Choi, Beom K; Kwon, Byoung S

2015-12-01

Cancer immune evasion is a major stumbling block in designing effective anticancer therapeutic strategies. Although considerable progress has been made in understanding how cancers evade destructive immunity, measures to counteract tumor escape have not kept pace. There are a number of factors that contribute to tumor persistence despite having a normal host immune system. Immune editing is one of the key aspects why tumors evade surveillance causing the tumors to lie dormant in patients for years through "equilibrium" and "senescence" before re-emerging. In addition, tumors exploit several immunological processes such as targeting the regulatory T cell function or their secretions, antigen presentation, modifying the production of immune suppressive mediators, tolerance and immune deviation. Besides these, tumor heterogeneity and metastasis also play a critical role in tumor growth. A number of potential targets like promoting Th1, NK cell, γδ T cell responses, inhibiting Treg functionality, induction of IL-12, use of drugs including phytochemicals have been designed to counter tumor progression with much success. Some natural agents and phytochemicals merit further study. For example, use of certain key polysaccharide components from mushrooms and plants have shown to possess therapeutic impact on tumor-imposed genetic instability, anti-growth signaling, replicative immortality, dysregulated metabolism etc. In this review, we will discuss the advances made toward understanding the basis of cancer immune evasion and summarize the efficacy of various therapeutic measures and targets that have been developed or are being investigated to enhance tumor rejection. Copyright © 2015 Elsevier Ltd. All rights reserved.
Immune surveillance properties of human NK cell-derived exosomes.

Science.gov (United States)

Lugini, Luana; Cecchetti, Serena; Huber, Veronica; Luciani, Francesca; Macchia, Gianfranco; Spadaro, Francesca; Paris, Luisa; Abalsamo, Laura; Colone, Marisa; Molinari, Agnese; Podo, Franca; Rivoltini, Licia; Ramoni, Carlo; Fais, Stefano

2012-09-15

Exosomes are nanovesicles released by normal and tumor cells, which are detectable in cell culture supernatant and human biological fluids, such as plasma. Functions of exosomes released by "normal" cells are not well understood. In fact, several studies have been carried out on exosomes derived from hematopoietic cells, but very little is known about NK cell exosomes, despite the importance of these cells in innate and adaptive immunity. In this paper, we report that resting and activated NK cells, freshly isolated from blood of healthy donors, release exosomes expressing typical protein markers of NK cells and containing killer proteins (i.e., Fas ligand and perforin molecules). These nanovesicles display cytotoxic activity against several tumor cell lines and activated, but not resting, immune cells. We also show that NK-derived exosomes undergo uptake by tumor target cells but not by resting PBMC. Exosomes purified from plasma of healthy donors express NK cell markers, including CD56+ and perforin, and exert cytotoxic activity against different human tumor target cells and activated immune cells as well. The results of this study propose an important role of NK cell-derived exosomes in immune surveillance and homeostasis. Moreover, this study supports the use of exosomes as an almost perfect example of biomimetic nanovesicles possibly useful in future therapeutic approaches against various diseases, including tumors.
Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

International Nuclear Information System (INIS)

Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas

2011-01-01

Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses
Carbohydrate Mimetic Peptides Augment Carbohydrate-Reactive Immune Responses in the Absence of Immune Pathology

Energy Technology Data Exchange (ETDEWEB)

Hennings, Leah; Artaud, Cecile; Jousheghany, Fariba; Monzavi-Karbassi, Behjatolah; Pashov, Anastas; Kieber-Emmons, Thomas, E-mail: tke@uams.edu [Winthrop P. Rockefeller Cancer Institute and Department of Pathology, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

2011-11-11

Among the most challenging of clinical targets for cancer immunotherapy are Tumor Associated Carbohydrate Antigens (TACAs). To augment immune responses to TACA we are developing carbohydrate mimetic peptides (CMPs) that are sufficiently potent to activate broad-spectrum anti-tumor reactivity. However, the activation of immune responses against terminal mono- and disaccharide constituents of TACA raises concerns regarding the balance between “tumor destruction” and “tissue damage”, as mono- and disaccharides are also expressed on normal tissue. To support the development of CMPs for clinical trial testing, we demonstrate in preclinical safety assessment studies in mice that vaccination with CMPs can enhance responses to TACAs without mediating tissue damage to normal cells expressing TACA. BALB/c mice were immunized with CMPs that mimic TACAs reactive with Griffonia simplicifolia lectin 1 (GS-I), and tissue reactivity of serum antibodies were compared with the tissue staining profile of GS-I. Tissues from CMP immunized mice were analyzed using hematoxylin and eosin stain, and Luxol-fast blue staining for myelination. Western blots of membranes from murine mammary 4T1 cells, syngeneic with BALB/c mice, were also compared using GS-I, immunized serum antibodies, and naive serum antibodies. CMP immunization enhanced glycan reactivities with no evidence of pathological autoimmunity in any immunized mice demonstrating that tissue damage is not an inevitable consequence of TACA reactive responses.
MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

Science.gov (United States)

Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

2016-01-01

Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.
Dim light at night increases immune function in Nile grass rats, a diurnal rodent.

Science.gov (United States)

Fonken, Laura K; Haim, Achikam; Nelson, Randy J

2012-02-01

With the widespread adoption of electrical lighting during the 20th century, human and nonhuman animals became exposed to high levels of light at night for the first time in evolutionary history. This divergence from the natural environment may have significant implications for certain ecological niches because of the important influence light exerts on the circadian system. For example, circadian disruption and nighttime light exposure are linked to changes in immune function. The majority of studies investigating the effects of light exposure and circadian disruption on the immune system use nocturnal rodents. In diurnal species, many hormones and immune parameters vary with secretion patterns 180° out of phase to those of nocturnal rodents. Thus, the authors investigated the effects of nighttime light exposure on immunocompetence in diurnal Nile grass rats (Arvicanthis niloticus). Rats were housed in either standard 14-h light (L):10-h dark (D) cycles with L ∼150 lux and D 0 lux or dim light at night (dLAN) cycles of LD 14:10 with L ∼150 lux and D 5 lux for 3 wks, then tested for plasma bactericidal capacity, as well as humoral and cell-mediated immune responses. Rats exposed to dLAN showed increased delayed-type hypersensitivity pinna swelling, which is consistent with enhanced cell-mediated immune function. dLAN rats similarly showed increased antibody production following inoculation with keyhole lymphocyte hemocyanin (KLH) and increased bactericidal capacity. Daytime corticosterone concentrations were elevated in grass rats exposed to nighttime dim light, which may have influenced immunological measures. Overall, these results indicate nighttime light affects immune parameters in a diurnal rodent.
Neuronal Function in Male Sprague Dawley Rats During Normal ...

African Journals Online (AJOL)

olayemitoyin

Summary: During normal ageing, there are physiological changes especially in high energy ... science and technology (U.S. Bureau of the Census ... strategies that can be applied to preserve function with ..... Intelligent Technology for an.
Integrated Circuit Immunity

Science.gov (United States)

Sketoe, J. G.; Clark, Anthony

2000-01-01

This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.
Immune function genes CD99L2, JARID2 and TPO show association with autism spectrum disorder

Directory of Open Access Journals (Sweden)

Ramos Paula S

2012-06-01

Full Text Available Abstract Background A growing number of clinical and basic research studies have implicated immunological abnormalities as being associated with and potentially responsible for the cognitive and behavioral deficits seen in autism spectrum disorder (ASD children. Here we test the hypothesis that immune-related gene loci are associated with ASD. Findings We identified 2,012 genes of known immune-function via Ingenuity Pathway Analysis. Family-based tests of association were computed on the 22,904 single nucleotide polymorphisms (SNPs from the 2,012 immune-related genes on 1,510 trios available at the Autism Genetic Resource Exchange (AGRE repository. Several SNPs in immune-related genes remained statistically significantly associated with ASD after adjusting for multiple comparisons. Specifically, we observed significant associations in the CD99 molecule-like 2 region (CD99L2, rs11796490, P = 4.01 × 10-06, OR = 0.68 (0.58-0.80, in the jumonji AT rich interactive domain 2 (JARID2 gene (rs13193457, P = 2.71 × 10-06, OR = 0.61 (0.49-0.75, and in the thyroid peroxidase gene (TPO (rs1514687, P = 5.72 × 10-06, OR = 1.46 (1.24-1.72. Conclusions This study suggests that despite the lack of a general enrichment of SNPs in immune function genes in ASD children, several novel genes with known immune functions are associated with ASD.
Liver X receptor and peroxisome proliferator-activated receptor as integrators of lipid homeostasis and immunity.

Science.gov (United States)

Kidani, Yoko; Bensinger, Steven J

2012-09-01

Lipid metabolism has emerged as an important modulator of innate and adaptive immune cell fate and function. The lipid-activated transcription factors peroxisome proliferator-activated receptor (PPAR) α, β/δ, γ and liver X receptor (LXR) are members of the nuclear receptor superfamily that have a well-defined role in regulating lipid homeostasis and metabolic diseases. Accumulated evidence over the last decade indicates that PPAR and LXR signaling also influence multiple facets of inflammation and immunity, thereby providing important crosstalk between metabolism and immune system. Herein, we provide a brief introduction to LXR and PPAR biology and review recent discoveries highlighting the importance of PPAR and LXR signaling in the modulation of normal and pathologic states of immunity. We also examine advances in our mechanistic understanding of how nuclear receptors impact immune system function and homeostasis. Finally, we discuss whether LXRs and PPARs could be pharmacologically manipulated to provide novel therapeutic approaches for modulation of the immune system under pathologic inflammation or in the context of allergic and autoimmune disease. © 2012 John Wiley & Sons A/S.

Reproduction Alters Hydration State but Does Not Impact the Positive Effects of Dehydration on Innate Immune Function in Children's Pythons (Antaresia childreni).

Science.gov (United States)

Brusch, George A; Billy, Gopal; Blattman, Joseph N; DeNardo, Dale F

Resource availability can impact immune function, with the majority of studies of such influences focusing on the allocation of energy investment into immune versus other physiological functions. When energy is a limited resource, performance trade-offs can result, compromising immunity. Dehydration is also considered a physiological challenge resulting from the limitation of a vital resource, yet previous research has found a positive relationship between dehydration and innate immune performance. However, these studies did not examine the effects of dehydration on immunity when there was another concurrent, substantial physiological challenge. Thus, we examined the impact of reproduction and water deprivation, individually and in combination, on immune performance in Children's pythons (Antaresia childreni). We collected blood samples from free-ranging A. childreni to evaluate osmolality and innate immune function (lysis, agglutination, bacterial growth inhibition) during the austral dry season, when water availability is limited and this species is typically reproducing. To examine how reproduction and water imbalance, both separately and combined, impact immune function, we used a laboratory-based 2 × 2 experiment. Our results demonstrate that A. childreni experience significant dehydration during the dry season and that, overall, osmolality, regardless of the underlying cause (seasonal rainfall, water deprivation, or reproduction), is positively correlated with increased innate immune performance.
Gap junctions in cells of the immune system: structure, regulation and possible functional roles

Directory of Open Access Journals (Sweden)

J.C. Sáez

2000-04-01

Full Text Available Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.
Postnatal Innate Immune Development: From Birth to Adulthood

Directory of Open Access Journals (Sweden)

Anastasia Georgountzou

2017-08-01

Full Text Available It is well established that adaptive immune responses are deficient in early life, contributing to increased mortality and morbidity. The developmental trajectories of different components of innate immunity are only recently being explored. Individual molecules, cells, or pathways of innate recognition and signaling, within different compartments/anatomical sites, demonstrate variable maturation patterns. Despite some discrepancies among published data, valuable information is emerging, showing that the developmental pattern of cytokine responses during early life is age and toll-like receptor specific, and may be modified by genetic and environmental factors. Interestingly, specific environmental exposures have been linked both to innate function modifications and the occurrence of chronic inflammatory disorders, such as respiratory allergies. As these conditions are on the rise, our knowledge on innate immune development and its modulating factors needs to be expanded. Improved understanding of the sequence of events associated with disease onset and persistence will lead toward meaningful interventions. This review describes the state-of-the-art on normal postnatal innate immune ontogeny and highlights research areas that are currently explored or should be further addressed.
Intestinal bacteria and the regulation of immune cell homeostasis.

Science.gov (United States)

Hill, David A; Artis, David

2010-01-01

The human intestine is colonized by an estimated 100 trillion bacteria. Some of these bacteria are essential for normal physiology, whereas others have been implicated in the pathogenesis of multiple inflammatory diseases including IBD and asthma. This review examines the influence of signals from intestinal bacteria on the homeostasis of the mammalian immune system in the context of health and disease. We review the bacterial composition of the mammalian intestine, known bacterial-derived immunoregulatory molecules, and the mammalian innate immune receptors that recognize them. We discuss the influence of bacterial-derived signals on immune cell function and the mechanisms by which these signals modulate the development and progression of inflammatory disease. We conclude with an examination of successes and future challenges in using bacterial communities or their products in the prevention or treatment of human disease.
The Potential Role of circRNA in Tumor Immunity Regulation and Immunotherapy

OpenAIRE

Xu, Zihao; Li, Peiyao; Fan, Li; Wu, Minghua

2018-01-01

Non-coding RNAs (ncRNAs) can be divided into circular non-coding RNAs (circRNAs) and linear ncRNAs. ncRNAs exist in different cell types, including normal cells, tumor cells and immunocytes. Linear ncRNAs, such as long ncRNAs and microRNAs, have been found to play important roles in the regulation of tumor immunity and immunotherapy; however, the functions of circRNAs in tumor immunity and immunotherapy are less known. Here, we review the current status of ncRNAs in the regulation of tumor im...
In vivo functional requirement of the mouse Ifitm1 gene for germ cell development, interferon mediated immune response and somitogenesis.

Directory of Open Access Journals (Sweden)

Ingeborg Klymiuk

Full Text Available The mammalian Interferon induced transmembrane protein 1 (Ifitm1 gene was originally identified as a member of a gene family highly inducible by type I and type II interferons. Based on expression analyses, it was suggested to be required for normal primordial germ cell migration. The knockdown of Ifitm1 in mouse embryos provided evidence for a role in somitogenesis. We generated the first targeted knockin allele of the Ifitm1 gene to systematically reassess all inferred functions. Sperm motility and the fertility of male and female mutant mice are as in wild type littermates. Embryonic somites and the adult vertebral column appear normal in homozygous Ifitm1 knockout mice, demonstrating that Ifitm1 is not essential for normal segmentation of the paraxial mesoderm. Proportions of leucocyte subsets, including granulocytes, monocytes, B-cells, T-cells, NK-cells, and NKT-cells, are unchanged in mutant mice. Based on a normal immune response to Listeria monocytogenes infection, there is no evidence for a dysfunction in downstream IFNγ signaling in Ifitm1 mutant mice. Expression from the Ifitm1 locus from E8.5 to E14.5 is highly dynamic. In contrast, in adult mice, Ifitm1 expression is highly restricted and strong in the bronchial epithelium. Intriguingly, IFITM1 is highly overexpressed in tumor epithelia cells of human squamous cell carcinomas and in adenocarcinomas of NSCLC patients. These analyses underline the general importance of targeted in vivo studies for the functional annotation of the mammalian genome. The first comprehensive description of the Ifitm1 expression pattern provides a rational basis for the further examination of Ifitm1 gene functions. Based on our data, the fact that IFITM1 can function as a negative regulator of cell proliferation, and because the gene maps to chromosome band 11p15.5, previously associated with NSCLC, it is likely that IFITM1 in man has a key role in tumor formation.
Asymptotic normality of kernel estimator of $\\psi$-regression function for functional ergodic data

OpenAIRE

Laksaci ALI; Benziadi Fatima; Gheriballak Abdelkader

2016-01-01

In this paper we consider the problem of the estimation of the $\\psi$-regression function when the covariates take values in an infinite dimensional space. Our main aim is to establish, under a stationary ergodic process assumption, the asymptotic normality of this estimate.
Immune functions in crustaceans: lessons from flies

NARCIS (Netherlands)

Stet, R.J.M.; Arts, J.A.J.

2005-01-01

In recent years insects, notably Drosophila, have emerged as a popular model for studying immune responses to bacterial and fungal pathogens. Due to the availability of the complete genome sequence, genome-wide scans of immune responses have been performed using microarray analyses. These analyses
Biliary Innate Immunity: Function and Modulation

Directory of Open Access Journals (Sweden)

Kenichi Harada

2010-01-01

Full Text Available Biliary innate immunity is involved in the pathogenesis of cholangiopathies in patients with primary biliary cirrhosis (PBC and biliary atresia. Biliary epithelial cells possess an innate immune system consisting of the Toll-like receptor (TLR family and recognize pathogen-associated molecular patterns (PAMPs. Tolerance to bacterial PAMPs such as lipopolysaccharides is also important to maintain homeostasis in the biliary tree, but tolerance to double-stranded RNA (dsRNA is not found. In PBC, CD4-positive Th17 cells characterized by the secretion of IL-17 are implicated in the chronic inflammation of bile ducts and the presence of Th17 cells around bile ducts is causally associated with the biliary innate immune responses to PAMPs. Moreover, a negative regulator of intracellular TLR signaling, peroxisome proliferator-activated receptor-γ (PPARγ, is involved in the pathogenesis of cholangitis. Immunosuppression using PPARγ ligands may help to attenuate the bile duct damage in PBC patients. In biliary atresia characterized by a progressive, inflammatory, and sclerosing cholangiopathy, dsRNA viruses are speculated to be an etiological agent and to directly induce enhanced biliary apoptosis via the expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL. Moreover, the epithelial-mesenchymal transition (EMT of biliary epithelial cells is also evoked by the biliary innate immune response to dsRNA.
Novel immune-modulator identified by a rapid, functional screen of the parapoxvirus ovis (Orf virus genome

Directory of Open Access Journals (Sweden)

McGuire Michael J

2012-01-01

Full Text Available Abstract Background The success of new sequencing technologies and informatic methods for identifying genes has made establishing gene product function a critical rate limiting step in progressing the molecular sciences. We present a method to functionally mine genomes for useful activities in vivo, using an unusual property of a member of the poxvirus family to demonstrate this screening approach. Results The genome of Parapoxvirus ovis (Orf virus was sequenced, annotated, and then used to PCR-amplify its open-reading-frames. Employing a cloning-independent protocol, a viral expression-library was rapidly built and arrayed into sub-library pools. These were directly delivered into mice as expressible cassettes and assayed for an immune-modulating activity associated with parapoxvirus infection. The product of the B2L gene, a homolog of vaccinia F13L, was identified as the factor eliciting immune cell accumulation at sites of skin inoculation. Administration of purified B2 protein also elicited immune cell accumulation activity, and additionally was found to serve as an adjuvant for antigen-specific responses. Co-delivery of the B2L gene with an influenza gene-vaccine significantly improved protection in mice. Furthermore, delivery of the B2L expression construct, without antigen, non-specifically reduced tumor growth in murine models of cancer. Conclusion A streamlined, functional approach to genome-wide screening of a biological activity in vivo is presented. Its application to screening in mice for an immune activity elicited by the pathogen genome of Parapoxvirus ovis yielded a novel immunomodulator. In this inverted discovery method, it was possible to identify the adjuvant responsible for a function of interest prior to a mechanistic study of the adjuvant. The non-specific immune activity of this modulator, B2, is similar to that associated with administration of inactivated particles to a host or to a live viral infection. Administration
Molecular Mechanisms Underlying β-Adrenergic Receptor-Mediated Cross-Talk between Sympathetic Neurons and Immune Cells

Directory of Open Access Journals (Sweden)

Dianne Lorton

2015-03-01

Full Text Available Cross-talk between the sympathetic nervous system (SNS and immune system is vital for health and well-being. Infection, tissue injury and inflammation raise firing rates of sympathetic nerves, increasing their release of norepinephrine (NE in lymphoid organs and tissues. NE stimulation of β2-adrenergic receptors (ARs in immune cells activates the cAMP-protein kinase A (PKA intracellular signaling pathway, a pathway that interfaces with other signaling pathways that regulate proliferation, differentiation, maturation and effector functions in immune cells. Immune–SNS cross-talk is required to maintain homeostasis under normal conditions, to develop an immune response of appropriate magnitude after injury or immune challenge, and subsequently restore homeostasis. Typically, β2-AR-induced cAMP is immunosuppressive. However, many studies report actions of β2-AR stimulation in immune cells that are inconsistent with typical cAMP–PKA signal transduction. Research during the last decade in non-immune organs, has unveiled novel alternative signaling mechanisms induced by β2-AR activation, such as a signaling switch from cAMP–PKA to mitogen-activated protein kinase (MAPK pathways. If alternative signaling occurs in immune cells, it may explain inconsistent findings of sympathetic regulation of immune function. Here, we review β2-AR signaling, assess the available evidence for alternative signaling in immune cells, and provide insight into the circumstances necessary for “signal switching” in immune cells.
Immune complexes, gallium lung scans, and bronchoalveolar lavage in idiopathic interstitial pneumonitis-fibrosis

International Nuclear Information System (INIS)

Gelb, A.F.; Dreisen, R.B.; Epstein, J.D.; Silverthorne, J.D.; Bickel, Y.; Fields, M.; Border, W.A.; Taylor, C.R.

1983-01-01

We obtained results of lung immune complexes (LIC), circulating immune complexes (CIC), 48-hour gallium lung scans (scans), bronchoalveolar lavage (BAL), and pulmonary function tests in 20 patients with idiopathic interstitial pneumonitis-fibrosis. Sixteen patients had predominantly interstitial (13 cases UIP) and/or intraalveolar (3 cases DIP) cellular disease (group 1). Prior to corticosteroid therapy in group 1, scans were positive in 75 percent, CIC were elevated in 86 percent, LIC were present in 64 percent, and BAL was abnormal in 90 percent. Duration of follow-up after treatment was 3.5 +/- 1.0 year. In group 1 after treatment with corticosteroids in 13 patients and corticosteroids and penicillamine (three patients) and plasmapheresis (one patient), only four patients remain stable or improved. After corticosteroid therapy, elevated CIC returned to normal values despite progressive patient deterioration. In three patients, lung immune complexes were still detected after circulating immune complexes had returned to normal after corticosteroid therapy. In group 2 were four patients with fibrotic disease; scans and CIC were uniformly negative, LIC were weakly present in only one patient, and BAL was abnormal in all. Despite corticosteroid therapy, all have died or deteriorated. These results suggest that positive gallium lung scans, BAL, circulating immune complexes, and to a lesser extent, lung immune complexes are associated with the cellular phase of interstitial pneumonia, but do not reliably identify a corticosteroid-responsive group
Cognitive functions in methamphetamine induced psychosis compared to schizophrenia and normal subjects.

Directory of Open Access Journals (Sweden)

Zahra Ezzatpanah

2014-09-01

Full Text Available The purpose of this research was to study the cognitive functions in patients with methamphetamine-induced psychosis (MIP in comparison with schizophrenia patients and normal subjects.This was a cross-sectional study, 30 patients with MIP, 30 patients with schizophrenia and 30 normal individuals were selected via convenient sampling and were matched on age, sex and education. Wisconsin Cards Sorting, Stroop, Visual Search and Attention and Wechsler Memory Tests were used to assess the subjects.The study showed that patients with MIP and schizophrenia have more deficits in executive functions, selective attention, sustained attention and memory than normal subjects. There were no significant differences in cognitive functions between patients with MIP and schizophrenia except for visual search and attention that showed more impairment in patients with schizophrenia.Although, cognitive dysfunctions of patients with MIP are mostly similar to patients with schizophrenia, some differences seem to exist, especially in those functions that are not primarily dependent on frontal lobe.
ACL-RSI and KOOS Measures Predict Normal Knee Function after ACL-SPORTS Training

OpenAIRE

White, Kathleen; Zeni, Joseph; Snyder-Mackler, Lynn

2014-01-01

Objectives: After anterior cruciate ligament reconstruction (ACLR) athletes commonly report increased fear of re-injury and below normal knee function. Implementing a post-operative training protocol (ACL-SPORTS Training) to improve patient perceived knee function, may improve short term outcomes after surgery. Identifying pre-training measures that predict normal knee function after training may allow us to determine who may respond to the treatment intervention. The purpose of this study wa...
Development of immune organs and functioning in humans and test animals: Implications for immune intervention studies.

Science.gov (United States)

Kuper, C Frieke; van Bilsen, Jolanda; Cnossen, Hilde; Houben, Geert; Garthoff, Jossie; Wolterbeek, Andre

2016-09-01

A healthy immune status is mostly determined during early life stages and many immune-related diseases may find their origin in utero and the first years of life. Therefore, immune health optimization may be most effective during early life. This review is an inventory of immune organ maturation events in relation to developmental timeframes in minipig, rat, mouse and human. It is concluded that time windows of immune organ development in rodents can be translated to human, but minipig reflects the human timeframes better; however the lack of prenatal maternal-fetal immune interaction in minipig may cause less responsiveness to prenatal intervention. It is too early to conclude which immune parameters are most appropriate, because there are not enough comparative immune parameters. Filling these gaps will increase the predictability of results observed in experimental animals, and guide future intervention studies by assessing relevant parameters in the right corresponding developmental time frames. Copyright © 2016 Elsevier Inc. All rights reserved.
big bang gene modulates gut immune tolerance in Drosophila.

Science.gov (United States)

Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

2013-02-19

Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.
Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity.

Science.gov (United States)

Park, Chang-Jin; Seo, Young-Su

2015-12-01

As sessile organisms, plants are exposed to persistently changing stresses and have to be able to interpret and respond to them. The stresses, drought, salinity, chemicals, cold and hot temperatures, and various pathogen attacks have interconnected effects on plants, resulting in the disruption of protein homeostasis. Maintenance of proteins in their functional native conformations and preventing aggregation of non-native proteins are important for cell survival under stress. Heat shock proteins (HSPs) functioning as molecular chaperones are the key components responsible for protein folding, assembly, translocation, and degradation under stress conditions and in many normal cellular processes. Plants respond to pathogen invasion using two different innate immune responses mediated by pattern recognition receptors (PRRs) or resistance (R) proteins. HSPs play an indispensable role as molecular chaperones in the quality control of plasma membrane-resident PRRs and intracellular R proteins against potential invaders. Here, we specifically discuss the functional involvement of cytosolic and endoplasmic reticulum (ER) HSPs/chaperones in plant immunity to obtain an integrated understanding of the immune responses in plant cells.
Heat Shock Proteins: A Review of the Molecular Chaperones for Plant Immunity

Directory of Open Access Journals (Sweden)

Chang-Jin Park

2015-12-01

Full Text Available As sessile organisms, plants are exposed to persistently changing stresses and have to be able to interpret and respond to them. The stresses, drought, salinity, chemicals, cold and hot temperatures, and various pathogen attacks have interconnected effects on plants, resulting in the disruption of protein homeostasis. Maintenance of proteins in their functional native conformations and preventing aggregation of non-native proteins are important for cell survival under stress. Heat shock proteins (HSPs functioning as molecular chaperones are the key components responsible for protein folding, assembly, translocation, and degradation under stress conditions and in many normal cellular processes. Plants respond to pathogen invasion using two different innate immune responses mediated by pattern recognition receptors (PRRs or resistance (R proteins. HSPs play an indispensable role as molecular chaperones in the quality control of plasma membrane-resident PRRs and intracellular R proteins against potential invaders. Here, we specifically discuss the functional involvement of cytosolic and endoplasmic reticulum (ER HSPs/chaperones in plant immunity to obtain an integrated understanding of the immune responses in plant cells.
Laser Therapy Inhibits Tumor Growth in Mice by Promoting Immune Surveillance and Vessel Normalization

Directory of Open Access Journals (Sweden)

Giulia Ottaviani

2016-09-01

Full Text Available Laser therapy, recently renamed as photobiomodulation, stands as a promising supportive treatment for oral mucositis induced by oncological therapies. However, its mechanisms of action and, more importantly, its safety in cancer patients, are still unclear. Here we explored the anti-cancer effect of 3 laser protocols, set at the most commonly used wavelengths, in B16F10 melanoma and oral carcinogenesis mouse models. While laser light increased cell metabolism in cultured cells, the in vivo outcome was reduced tumor progression. This striking, unexpected result, was paralleled by the recruitment of immune cells, in particular T lymphocytes and dendritic cells, which secreted type I interferons. Laser light also reduced the number of highly angiogenic macrophages within the tumor mass and promoted vessel normalization, an emerging strategy to control tumor progression. Collectively, these results set photobiomodulation as a safety procedure in oncological patients and open the way to its innovative use for cancer therapy.
A Functional Toll-Interacting Protein Variant Is Associated with Bacillus Calmette-Guérin-Specific Immune Responses and Tuberculosis.

Science.gov (United States)

Shah, Javeed A; Musvosvi, Munyaradzi; Shey, Muki; Horne, David J; Wells, Richard D; Peterson, Glenna J; Cox, Jeffery S; Daya, Michelle; Hoal, Eileen G; Lin, Lin; Gottardo, Raphael; Hanekom, Willem A; Scriba, Thomas J; Hatherill, Mark; Hawn, Thomas R

2017-08-15

The molecular mechanisms that regulate tuberculosis susceptibility and bacillus Calmette-Guérin (BCG)-induced immunity are mostly unknown. However, induction of the adaptive immune response is a critical step in host control of Mycobacterium tuberculosis. Toll-interacting protein (TOLLIP) is a ubiquitin-binding protein that regulates innate immune responses, including Toll-like receptor signaling, which initiate adaptive immunity. TOLLIP variation is associated with susceptibility to tuberculosis, but the mechanism by which it regulates tuberculosis immunity is poorly understood. To identify functional TOLLIP variants and evaluate the role of TOLLIP variation on innate and adaptive immune responses to mycobacteria and susceptibility to tuberculosis. We used human cellular immunology approaches to characterize the role of a functional TOLLIP variant on monocyte mRNA expression and M. tuberculosis-induced monocyte immune functions. We also examined the association of TOLLIP variation with BCG-induced T-cell responses and susceptibility to latent tuberculosis infection. We identified a functional TOLLIP promoter region single-nucleotide polymorphism, rs5743854, which was associated with decreased TOLLIP mRNA expression in infant monocytes. After M. tuberculosis infection, TOLLIP-deficient monocytes demonstrated increased IL-6, increased nitrite, and decreased bacterial replication. The TOLLIP-deficiency G/G genotype was associated with decreased BCG-specific IL-2 + CD4 + T-cell frequency and proliferation. This genotype was also associated with increased susceptibility to latent tuberculosis infection. TOLLIP deficiency is associated with decreased BCG-specific T-cell responses and increased susceptibility to tuberculosis. We hypothesize that the heightened antibacterial monocyte responses after vaccination of TOLLIP-deficient infants are responsible for decreased BCG-specific T-cell responses. Activating TOLLIP may provide a novel adjuvant strategy for BCG

A biocultural perspective on fictive kinship in the Andes: social support and women's immune function in El Alto, Bolivia.

Science.gov (United States)

Hicks, Kathryn

2014-09-01

This article examines the influence of emotional and instrumental support on women's immune function, a biomarker of stress, in the city of El Alto, Bolivia. It tests the prediction that instrumental support is protective of immune function for women living in this marginal environment. Qualitative and quantitative ethnographic methods were employed to assess perceived emotional and instrumental support and common sources of support; multiple linear regression analysis was used to model the relationship between social support and antibodies to the Epstein-Barr virus. These analyses provided no evidence that instrumental social support is related to women's health, but there is some evidence that emotional support from compadres helps protect immune function. © 2014 by the American Anthropological Association.
Immune System Dysfunction in the Elderly.

Science.gov (United States)

Fuentes, Eduardo; Fuentes, Manuel; Alarcón, Marcelo; Palomo, Iván

2017-01-01

Human aging is characterized by both physical and physiological frailty that profoundly affects the immune system. In this context aging is associated with declines in adaptive and innate immunity established as immunosenescence. Immunosenescence is a new concept that reflects the age-associated restructuring changes of innate and adaptive immune functions. Thus elderly individuals usually present chronic low-level inflammation, higher infection rates and chronic diseases. A study of alterations in the immune system during aging could provide a potentially useful biomarker for the evaluation of immune senescence treatment. The immune system is the result of the interplay between innate and adaptive immunity, yet the impact of aging on this function is unclear. In this article the function of the immune system during aging is explored.
Effect of liniment levamisole on cellular immune functions of patients with chronic hepatitis B.

Science.gov (United States)

Wang, Ke-Xia; Zhang, Li-Hua; Peng, Jiang-Long; Liang, Yong; Wang, Xue-Feng; Zhi, Hui; Wang, Xiang-Xia; Geng, Huan-Xiong

2005-12-07

To explore the effects of liniment levamisole on cellular immune functions of patients with chronic hepatitis B. The levels of T lymphocyte subsets and mIL-2R in peripheral blood mononuclear cells (PBMCs) were measured by biotin-streptavidin (BSA) technique in patients with chronic hepatitis B before and after the treatment with liniment levamisole. After one course of treatment with liniment levamisole, the levels of CD3(+), CD4(+), and the ratio of CD4(+)/CD8(+) increased as compared to those before the treatment but the level of CD8(+) decreased. The total expression level of mIL-2R in PBMCs increased before and after the treatment with liniment levamisole. Liniment levamisole may reinforce cellular immune functions of patients with chronic hepatitis B.
Immune response to Sarcocystis neurona infection in naturally infected horses with equine protozoal myeloencephalitis.

Science.gov (United States)

Yang, Jibing; Ellison, Siobhan; Gogal, Robert; Norton, Heather; Lindsay, David S; Andrews, Frank; Ward, Daniel; Witonsky, Sharon

2006-06-15

Equine protozoal myeloencephalitis (EPM) is one of the most common neurologic diseases of horses in the United States. The primary etiologic agent is Sarcocystis neurona. Currently, there is limited knowledge regarding the protective or pathophysiologic immune response to S. neurona infection or the subsequent development of EPM. The objectives of this study were to determine whether S. neurona infected horses with clinical signs of EPM had altered or suppressed immune responses compared to neurologically normal horses and if blood sample storage would influence these findings. Twenty clinically normal horses and 22 horses with EPM, diagnosed by the presence of S. neurona specific antibodies in the serum and/or cerebrospinal (CSF) and clinical signs, were evaluated for differences in the immune cell subsets and function. Our results demonstrated that naturally infected horses had significantly (Pneurona in horses, as well as to determine the mechanism associated with suppressed in vitro proliferation responses. Finally, overnight storage of blood samples appears to alter T lymphocyte phenotypes and viability among leukocytes.
PERSPECTIVES OF PRODUCTS FOR FUNCTIONAL NUTRITION IN CHILDREN

Directory of Open Access Journals (Sweden)

I.N. Zakharova

2011-01-01

Full Text Available Normal microflora of gastrointestinal tract provides colonization resistance of intestine, takes part in digestion, synthesis of vitamins and systemic stimulation of immune reactions. Prophylaxis of intestinal microbiocenosis disorders, their timely diagnostics and proper correction are significant for normalization of gastrointestinal function, formation of immune system and harmonious development of a child. There are several approaches to the regulation of intestinal micro biocenosis; the perspective one is diet with functional food containing prebiotic microorganisms. The article analyses data on physiological role of intestinal biocenosis, presents main standards of prebiotic strains. Modern studies show high clinical efficacy of Lactobacillus GG strain. This probiotic can be recommended in production of functional food for infants’ nutrition.Key words: children, intestinal micro flora, probiotics, Lactobacillus GG.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 150–154
Impact of enteral nutrition on postoperative immune function and nutritional status.

Science.gov (United States)

Wang, F; Hou, M X; Wu, X L; Bao, L D; Dong, P D

2015-06-10

We studied the effects of enteral nutrition (EN) support initiated 1 week before surgery on postoperative nutritional status, immune function, and inflammatory response in gastric cancer patients. A total of 200 gastric cancer patients were randomly divided into two groups: EN starting 1 week before surgery (study group) and EN starting early after surgery (control group). The two groups received EN support, following different therapeutic schedules, until the 9th day after operation. In the patients, body weight, skinfold thickness, upper-arm circumference, white blood cell count, albumin, prealbumin, C-reactive protein, peripheral immunoglobulins (IgA, IgG, and IgM), T lymphocyte subsets, interleukin-6, and tumor necrosis factor-α were measured 10 days before and after surgery and on the first day after surgery. There was no statistically significant difference in the results of recovery time of passage of gas by anus, abdominal distension, stomachache, blood glucose, hepatic and renal functions, and electrolytes between the two groups of patients (P > 0. 05). Adverse reactions occurred to both groups at 1 and 2 days after operation. Such conditions was improved after the intravenous drip rate was adjusted. The albumin and prealbumin levels of the patients in both groups decreased at 1 day after operation (P gastric cancer patients can improve their postoperative nutritional status and immune function, can reduce inflammatory response, and is more conducive to the recovery of patients.
Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms

Directory of Open Access Journals (Sweden)

Olaf Perdijk

2018-02-01

Full Text Available During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow’s milk. Indeed, recent studies show inverse associations between raw cow’s milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow’s milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow’s milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow’s milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow’s milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow’s milk components in the gut must recirculate into the blood and home to the (upper and lower respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present
Heat and immunity: an experimental heat wave alters immune functions in three-spined sticklebacks (Gasterosteus aculeatus).

Science.gov (United States)

Dittmar, Janine; Janssen, Hannah; Kuske, Andra; Kurtz, Joachim; Scharsack, Jörn P

2014-07-01

Global climate change is predicted to lead to increased temperatures and more extreme climatic events. This may influence host-parasite interactions, immunity and therefore the impact of infectious diseases on ecosystems. However, little is known about the effects of rising temperatures on immune defence, in particular in ectothermic animals, where the immune system is directly exposed to external temperature change. Fish are ideal models for studying the effect of temperature on immunity, because they are poikilothermic, but possess a complete vertebrate immune system with both innate and adaptive immunity. We used three-spined sticklebacks ( Gasterosteus aculeatus) originating from a stream and a pond, whereby the latter supposedly were adapted to higher temperature variation. We studied the effect of increasing and decreasing temperatures and a simulated heat wave with subsequent recovery on body condition and immune parameters. We hypothesized that the immune system might be less active at low temperatures, but will be even more suppressed at temperatures towards the upper tolerable temperature range. Contrary to our expectation, we found innate and adaptive immune activity to be highest at a temperature as low as 13 °C. Exposure to a simulated heat wave induced long-lasting immune disorders, in particular in a stickleback population that might be less adapted to temperature variation in its natural environment. The results show that the activity of the immune system of an ectothermic animal species is temperature dependent and suggest that heat waves associated with global warming may immunocompromise host species, thereby potentially facilitating the spread of infectious diseases. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.
Complex multicellular functions at a unicellular eukaryote level: Learning, memory, and immunity.

Science.gov (United States)

Csaba, György

2017-06-01

According to experimental data, eukaryote unicellulars are able to learn, have immunity and memory. Learning is carried out in a very primitive form, and the memory is not neural but an epigenetic one. However, this epigenetic memory, which is well justified by the presence and manifestation of hormonal imprinting, is strong and permanent in the life of cell and also in its progenies. This memory is epigenetically executed by the alteration and fixation of methylation pattern of genes without changes in base sequences. The immunity of unicellulars is based on self/non-self discrimination, which leads to the destruction of non-self invaders and utilization of them as nourishment (by phagocytosis). The tools of learning, memory, and immunity of unicellulars are uniformly found in plasma membrane receptors, which formed under the effect of dynamic receptor pattern generation, suggested by Koch et al., and this is the basis of hormonal imprinting, by which the encounter between a chemical substance and the cell is specifically memorized. The receptors and imprinting are also used in the later steps of evolution up to mammals (including man) in each mentioned functions. This means that learning, memory, and immunity can be deduced to a unicellular eukaryote level.
Adaptive Linear and Normalized Combination of Radial Basis Function Networks for Function Approximation and Regression

Directory of Open Access Journals (Sweden)

Yunfeng Wu

2014-01-01

Full Text Available This paper presents a novel adaptive linear and normalized combination (ALNC method that can be used to combine the component radial basis function networks (RBFNs to implement better function approximation and regression tasks. The optimization of the fusion weights is obtained by solving a constrained quadratic programming problem. According to the instantaneous errors generated by the component RBFNs, the ALNC is able to perform the selective ensemble of multiple leaners by adaptively adjusting the fusion weights from one instance to another. The results of the experiments on eight synthetic function approximation and six benchmark regression data sets show that the ALNC method can effectively help the ensemble system achieve a higher accuracy (measured in terms of mean-squared error and the better fidelity (characterized by normalized correlation coefficient of approximation, in relation to the popular simple average, weighted average, and the Bagging methods.
Functional and Transcriptomic Characterization of Peritoneal Immune-Modulation by Addition of Alanyl-Glutamine to Dialysis Fluid.

Science.gov (United States)

Herzog, Rebecca; Kuster, Lilian; Becker, Julia; Gluexam, Tobias; Pils, Dietmar; Spittler, Andreas; Bhasin, Manoj K; Alper, Seth L; Vychytil, Andreas; Aufricht, Christoph; Kratochwill, Klaus

2017-07-24

Peritonitis remains a major cause of morbidity and mortality during chronic peritoneal dialysis (PD). Glucose-based PD fluids reduce immunological defenses in the peritoneal cavity. Low concentrations of peritoneal extracellular glutamine during PD may contribute to this immune deficit. For these reasons we have developed a clinical assay to measure the function of the immune-competent cells in PD effluent from PD patients. We then applied this assay to test the impact on peritoneal immune-competence of PD fluid supplementation with alanyl-glutamine (AlaGln) in 6 patients in an open-label, randomized, crossover pilot trial (EudraCT 2012-004004-36), and related the functional results to transcriptome changes in PD effluent cells. Ex-vivo stimulation of PD effluent peritoneal cells increased release of interleukin (IL) 6 and tumor necrosis factor (TNF) α. Both IL-6 and TNF-α were lower at 1 h than at 4 h of the peritoneal equilibration test but the reductions in cytokine release were attenuated in AlaGln-supplemented samples. AlaGln-supplemented samples exhibited priming of IL-6-related pathways and downregulation of TNF-α upstream elements. Results from measurement of cytokine release and transcriptome analysis in this pilot clinical study support the conclusion that suppression of PD effluent cell immune function in human subjects by standard PD fluid is attenuated by AlaGln supplementation.
Evaluation of Traditional Medicines III: The Mechanism of Immune ...

African Journals Online (AJOL)

These results show that PHELA did not stimulate Th1 cytokines of a normal immune system but stimulated them when the immune system was suppressed by cyclosporine-A. In conclusion, PHELA is an immune-stimulant to a compromised immune system. Key words: PHELA, traditional medicine, cyclosporine-A, cytokines, ...
Nutritional components regulate the gut immune system and its association with intestinal immune disease development.

Science.gov (United States)

Lamichhane, Aayam; Kiyono, Hiroshi; Kunisawa, Jun

2013-12-01

The gut is equipped with a unique immune system for maintaining immunological homeostasis, and its functional immune disruption can result in the development of immune diseases such as food allergy and intestinal inflammation. Accumulating evidence has demonstrated that nutritional components play an important role in the regulation of gut immune responses and also in the development of intestinal immune diseases. In this review, we focus on the immunological functions of lipids, vitamins, and nucleotides in the regulation of the intestinal immune system and as potential targets for the control of intestinal immune diseases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.
Comprehensive proteome analysis of lysosomes reveals the diverse function of macrophages in immune responses.

Science.gov (United States)

Gao, Yanpan; Chen, Yanyu; Zhan, Shaohua; Zhang, Wenhao; Xiong, Feng; Ge, Wei

2017-01-31

Phagocytosis and autophagy in macrophages have been shown to be essential to both innate and adaptive immunity. Lysosomes are the main catabolic subcellular organelles responsible for degradation and recycling of both extracellular and intracellular material, which are the final steps in phagocytosis and autophagy. However, the molecular mechanisms underlying lysosomal functions after infection remain obscure. In this study, we conducted a quantitative proteomics analysis of the changes in constitution and glycosylation of proteins in lysosomes derived from murine RAW 264.7 macrophage cells treated with different types of pathogens comprising examples of bacteria (Listeria monocytogenes, L. m), DNA viruses (herpes simplex virus type-1, HSV-1) and RNA viruses (vesicular stomatitis virus, VSV). In total, 3,704 lysosome-related proteins and 300 potential glycosylation sites on 193 proteins were identified. Comparative analysis showed that the aforementioned pathogens induced distinct alterations in the proteome of the lysosome, which is closely associated with the immune functions of macrophages, such as toll-like receptor activation, inflammation and antigen-presentation. The most significant changes in proteins and fluctuations in glycosylation were also determined. Furthermore, Western blot analysis showed that the changes in expression of these proteins were undetectable at the whole cell level. Thus, our study provides unique insights into the function of lysosomes in macrophage activation and immune responses.
Leptin as immune mediator: Interaction between neuroendocrine and immune system.

Science.gov (United States)

Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

2017-01-01

Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.
Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

OpenAIRE

Clovis S. Palmer; Riya Palchaudhuri; Hassan Albargy; Mohamed Abdel-Mohsen; Suzanne M. Crowe

2018-01-01

An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...
Indices of immune function used by ecologists are mostly unaffected by repeated freeze-thaw cycles and methodological deviations

NARCIS (Netherlands)

Hegemann, Arne; Pardal, Sara; Matson, Kevin D.

2017-01-01

Background
Over the past couple of decades, measuring immunological parameters has become widespread in studies of ecology and evolution. A combination of different immunological indices is useful for quantifying different parts of the immune system and comprehensively assessing immune function.
Immune function surveillance: association with rejection, infection and cardiac allograft vasculopathy.

Science.gov (United States)

Heikal, N M; Bader, F M; Martins, T B; Pavlov, I Y; Wilson, A R; Barakat, M; Stehlik, J; Kfoury, A G; Gilbert, E M; Delgado, J C; Hill, H R

2013-01-01

Rejection, cardiac allograft vasculopathy (CAV), and infection are significant causes of mortality in heart transplantation recipients. Assessing the immune status of a particular patient remains challenging. Although endomyocardial biopsy (EMB) and angiography are effective for the identification of rejection and CAV, respectively, these are expensive, invasive, and may have numerous complications. The aim of this study was to evaluate the immune function and assess its utility in predicting rejection, CAV, and infection in heart transplantation recipients. We prospectively obtained samples at the time of routine EMB and when clinically indicated for measurement of the ImmuKnow assay (IM), 12 cytokines and soluble CD30 (sCD30). EMB specimens were evaluated for acute cellular rejection, and antibody-mediated rejection (AMR). CAV was diagnosed by the development of angiographic coronary artery disease. Infectious episodes occurring during the next 30 days after testing were identified by the presence of positive bacterial or fungal cultures and/or viremia that prompted treatment with antimicrobials. We collected 162 samples from 56 cardiac transplant recipients. There were 31 infection episodes, 7 AMR, and 4 CAV cases. The average IM value was significantly lower during infection, (P = .04). Soluble CD30 concentrations showed significantly positive correlation with infection episodes, (P = .001). Significant positive correlation was observed between interleukin-5(IL-5) and AMR episodes (P = .008). Tumor necrosis factor-α and IL-8 showed significant positive correlation with CAV (P = .001). Immune function monitoring appears promising in predicting rejection, CAV, and infection in cardiac transplantation recipients. This approach may help in more individualized immunosuppression and it may also minimize unnecessary EMBs and cardiac angiographies. Published by Elsevier Inc.
A cascade reaction network mimicking the basic functional steps of acquired immune response

Science.gov (United States)

Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

2015-01-01

Biological systems use complex ‘information processing cores’ composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS which we call Adaptive Immune Response Simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system which responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner which is superficially similar to the most basic responses of the vertebrate acquired immune system, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices. PMID:26391084
Immune System

Science.gov (United States)

A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

Starvation stress affects the interplay among shrimp gut microbiota, digestion and immune activities.

Science.gov (United States)

Dai, Wen-Fang; Zhang, Jin-Jie; Qiu, Qiong-Fen; Chen, Jiong; Yang, Wen; Ni, Sui; Xiong, Jin-Bo

2018-05-24

Aquatic animals are frequently suffered from starvation due to restricted food availability or deprivation. It is currently known that gut microbiota assists host in nutrient acquisition. Thus, exploring the gut microbiota responses would improve our understanding on physiological adaptation to starvation. To achieve this, we investigated how the gut microbiota and shrimp digestion and immune activities were affected under starvation stress. The results showed that the measured digestion activities in starved shrimp were significantly lower than in normal cohorts; while the measured immune activities exhibited an opposite trend. A structural equation modeling (SEM) revealed that changes in the gut bacterial community were directly related to digestive and immune enzyme activities, which in turn markedly affected shrimp growth traits. Notably, several gut bacterial indicators that characterized the shrimp nutrient status were identified, with more abundant opportunistic pathogens in starved shrimp, although there were no statistical differences in the overall diversity and the structures of gut bacterial communities between starved and normal shrimp. Starved shrimp exhibited less connected and cooperative interspecies interaction as compared with normal cohorts. Additionally, the functional pathways involved in carbohydrate and protein digestion, glycan biosynthesis, lipid and enzyme metabolism remarkably decreased in starved shrimp. These attenuations could increase the susceptibility of starved shrimp to pathogens infection. In summary, this study provides novel insights into the interplay among shrimp digestion, immune activities and gut microbiota in response to starvation stress. Copyright © 2018. Published by Elsevier Ltd.
The normal function of a speciation gene, Odysseus, and its hybrid sterility effect.

Science.gov (United States)

Sun, Sha; Ting, Chau-Ti; Wu, Chung-I

2004-07-02

To understand how postmating isolation is connected to the normal process of species divergence and why hybrid male sterility is often the first sign of speciation, we analyzed the Odysseus (OdsH) gene of hybrid male sterility in Drosophila. We carried out expression analysis, transgenic study, and gene knockout. The combined evidence suggests that the sterility phenotype represents a novel manifestation of the gene function rather than the reduction or loss of the normal one. The gene knockout experiment identified the normal function of OdsH as a modest enhancement of sperm production in young males. The implication of a weak effect of OdsH on the normal phenotype but a strong influence on hybrid male sterility is discussed in light of Haldane's rule of postmating isolation.
Future targets for immune therapy in colitis?

DEFF Research Database (Denmark)

Kristensen, Nanna Ny; Claesson, M H

2008-01-01

Crohn's disease and Ulcerative Colitis, collectively termed inflammatory bowel disease (IBD), are chronic inflammatory disorders of the bowel. It is generally accepted that the pathology associated with IBD is characterized by a hyper-reactive immune response in the gut wall directed against...... the commensal intestinal bacterial flora, and that the CD4+ T cells dominate the adaptive immune response. Chemokines are small proteins involved in the guidance of migration of immune cells during normal homeostasis and inflammation. Chemokines have been shown to play a central role in recruiting inflammatory...... cells from congenic normal mice are transplanted into immune deficient mice, which in turn develop a chronic lethal colitis within 1-2 months. By simultaneous transplantation of CD4+CD25+ regulatory T cells (Tregs) it is possible to hinder development of colitis. Thus the model is well suited...
Restoration of the immune functions in aged mice by supplementation with a new herbal composition, HemoHIM.

Science.gov (United States)

Park, Hae-Ran; Jo, Sung-Kee; Jung, Uhee; Yee, Sung-Tae

2008-01-01

The effect of a new herbal composition, HemoHIM, on immune functions was examined in aged mice, in which various immune responses had been impaired. The composition HemoHIM was prepared by adding the ethanol-insoluble fraction to the total water extract of a mixture of three edible herbs, Angelica Radix, Cnidium Rhizoma and Paeonia Radix. Supplementation to the aged mice with HemoHIM restored the proliferative response and cytokine production of splenocytes with a response to ConA. Also, HemoHIM recovered the NK cell activity which had been impaired in the aged mice. Meanwhile aging is known to reduce the Th1-like function, but not the Th2-like function, resulting in a Th1/Th2 imbalance. HemoHIM restored the Th1/Th2 balance in the aged mice through enhanced IFN-gamma and IgG2a production, and conversely a reduced IL-4 and IgG1 production. It was found that one factor for the Th1/Th2 imbalance in the aged mice was a lower production of IL-12p70. However, HemoHIM restored the IL-12p70 production in the aged mice. These results suggested that HemoHIM was effective for the restoration of impaired immune functions of the aged mice and therefore could be a good recommendation for immune restoration in elderly humans. Copyright (c) 2007 John Wiley & Sons, Ltd.
Associations between immune function and air pollution among postmenopausal women living in the Puget Sound airshed

Science.gov (United States)

Williams, Lori A.

Air pollution is associated with adverse health outcomes, and changes in the immune system may be intermediate steps between exposure and a clinically relevant adverse health outcome. We analyzed the associations between three different types of measures of air pollution exposure and five biomarkers of immune function among 115 overweight and obese postmenopausal women whose immunity was assessed as part of a year-long moderate exercise intervention trial. For air pollution metrics, we assessed: (1) residential proximity to major roads (freeways, major arterials and truck routes), (2) fine particulate matter(PM2.5) at the nearest monitor to the residence averaged over three time windows (3-days, 30-days and 60-days), and (3) nitrogen dioxide (NO2) modeled based on land use characteristics. Our immune biomarkers included three measures of inflammation---C-reactive protein, serum amyloid A and interleukin-6---and two measures of cellular immunity---natural killer cell cytotoxicity and T lymphocyte proliferation. We hypothesized that living near a major road, increased exposure to PM2.5 and increased exposure to NO2 would each be independently associated with increased inflammation and decreased immune function. We observed a 21% lower average natural killer cell cytotoxicity among women living within 150 meters of a major arterial road compared to other women. For PM2.5 , we observed changes in 3 of 4 indicators of lymphocyte proliferation stimulated by anti-CD3---an antibody to the T cell receptor associated with increases in 3-day averaged PM2.5. For 30-day averaged PM 2.5 and 60-day averaged PM2.5 we did not observe any statistically significant associations. We observed an increase in lymphocyte proliferation index stimulated by the plant protein phytohemagglutinin (PHA) at 1 of 2 PHA concentrations in association with modeled NO2. For the three inflammatory markers, we observed no notable associations with any of our measures of air pollution. If confirmed, our
Contribution of neuroinflammation and immunity to brain aging and the mitigating effects of physical and cognitive interventions.

Science.gov (United States)

Di Benedetto, Svetlana; Müller, Ludmila; Wenger, Elisabeth; Düzel, Sandra; Pawelec, Graham

2017-04-01

It is widely accepted that the brain and the immune system continuously interact during normal as well as pathological functioning. Human aging is commonly accompanied by low-grade inflammation in both the immune and central nervous systems, thought to contribute to many age-related diseases. This review of the current literature focuses first on the normal neuroimmune interactions occurring in the brain, which promote learning, memory and neuroplasticity. Further, we discuss the protective and dynamic role of barriers to neuroimmune interactions, which have become clearer with the recent discovery of the meningeal lymphatic system. Next, we consider age-related changes of the immune system and possible deleterious influences of immunosenescence and low-grade inflammation (inflammaging) on neurodegenerative processes in the normally aging brain. We survey the major immunomodulators and neuroregulators in the aging brain and their highly tuned dynamic and reciprocal interactions. Finally, we consider our current understanding of how physical activity, as well as a combination of physical and cognitive interventions, may mediate anti-inflammatory effects and thus positively impact brain aging. Copyright © 2017 Elsevier Ltd. All rights reserved.
Normal left ventricular function does not protect against propafenone ...

African Journals Online (AJOL)

Normal left ventricular function does not protect against propafenone-induced incessant ventricular tachycardia. R. N. Scott Millar, J. B. Lawrenson, D.A. Milne. Abstract. Propafenone is a class Ic anti-arrhythmic agent with mild B-blocking properties which has recently become available in South Africa. We have used the ...
TNF signaling inhibition in the CNS: implications for normal brain function and neurodegenerative disease

Directory of Open Access Journals (Sweden)

Tansey Malú G

2008-10-01

Full Text Available Abstract The role of tumor necrosis factor (TNF as an immune mediator has long been appreciated but its function in the brain is still unclear. TNF receptor 1 (TNFR1 is expressed in most cell types, and can be activated by binding of either soluble TNF (solTNF or transmembrane TNF (tmTNF, with a preference for solTNF; whereas TNFR2 is expressed primarily by microglia and endothelial cells and is preferentially activated by tmTNF. Elevation of solTNF is a hallmark of acute and chronic neuroinflammation as well as a number of neurodegenerative conditions including ischemic stroke, Alzheimer's (AD, Parkinson's (PD, amyotrophic lateral sclerosis (ALS, and multiple sclerosis (MS. The presence of this potent inflammatory factor at sites of injury implicates it as a mediator of neuronal damage and disease pathogenesis, making TNF an attractive target for therapeutic development to treat acute and chronic neurodegenerative conditions. However, new and old observations from animal models and clinical trials reviewed here suggest solTNF and tmTNF exert different functions under normal and pathological conditions in the CNS. A potential role for TNF in synaptic scaling and hippocampal neurogenesis demonstrated by recent studies suggest additional in-depth mechanistic studies are warranted to delineate the distinct functions of the two TNF ligands in different parts of the brain prior to large-scale development of anti-TNF therapies in the CNS. If inactivation of TNF-dependent inflammation in the brain is warranted by additional pre-clinical studies, selective targeting of TNFR1-mediated signaling while sparing TNFR2 activation may lessen adverse effects of anti-TNF therapies in the CNS.
Immune Regulation by Self-Recognition

DEFF Research Database (Denmark)

Andersen, Mads Hald

2015-01-01

Circulating T cells that specifically target normal self-proteins expressed by regulatory immune cells were first described in patients with cancer, but can also be detected in healthy individuals. The adaptive immune system is distinguished for its ability to differentiate between self......-antigens and foreign antigens. Thus, it was remarkable to discover T cells that apparently lacked tolerance to important self-proteins, eg, IDO, PD-L1, and FoxP3, expressed in regulatory immune cells. The ability of self-reactive T cells to react to and eliminate regulatory immune cells can influence general immune...... reactions. This suggests that they may be involved in immune homeostasis. It is here proposed that these T cells should be termed antiregulatory T cells (anti-Tregs). The role of anti-Tregs in immune-regulatory networks may be diverse. For example, pro-inflammatory self-reactive T cells that react...
Toxicity of cadmium in Japanese quail: Evaluation of body weight, hepatic and renal function, and cellular immune response

International Nuclear Information System (INIS)

Sant'Ana, M.G.; Moraes, R.; Bernardi, M.M.

2005-01-01

Cadmium (Cd) is an environmental pollutant that is able to alter the immune function. Previous studies have shown that, in mammals, chronic exposure to Cd decreases the release of macrophagic cytokines such as IL1 and TNα and decreases phagocytosis activity. On the other hand contradictory results showed an increase in the humoral response. The cellular response could be decreased by exposure to Cd. These alterations were observed in mammals. The present study aimed to investigate some of the toxic effects of Cd exposure in birds. In particular, the main objective of this work was to elucidate the effects of exposure to this pollutant on the cellular immune function of the Japanese quail as a model for the study of toxicity in animals exposed in nature. The animals were exposed to the metal (100 ppm, per os) during development, i.e., from 1 to 28 days old. Body weight, biochemical parameters, and cellular immune response were measured during and at the end of treatment. The results showed that the exposure to Cd for 28 days significantly reduced the body weight and induced hepatic toxicity. The kidney function and cellular immune response were not affected by the Cd exposure
The intestinal flora is required to support antibody responses to systemic immunization in infant and germ free mice.

Science.gov (United States)

Lamousé-Smith, Esi S; Tzeng, Alice; Starnbach, Michael N

2011-01-01

The presence of a complex and diverse intestinal flora is functionally important for regulating intestinal mucosal immune responses. However, the extent to which a balanced intestinal flora regulates systemic immune responses is still being defined. In order to specifically examine whether the acquisition of a less complex flora influences responses to immunization in the pre-weaning stages of life, we utilize a model in which infant mice acquire an intestinal flora from their mothers that has been altered by broad-spectrum antibiotics. In this model, pregnant dams are treated with a cocktail of antibiotics that alters both the density and microbial diversity of the intestinal flora. After challenge with a subcutaneous immunization, the antibiotic altered flora infant mice have lower antigen specific antibody titers compared to control age-matched mice. In a second model, we examined germ free (GF) mice to analyze how the complete lack of flora influences the ability to mount normal antibody responses following subcutaneous immunization. GF mice do not respond well to immunization and introduction of a normal flora into GF mice restores the capacity of these mice to respond. These results indicate that a gastrointestinal flora reduced in density and complexity at critical time points during development adversely impacts immune responses to systemic antigens.
Dynamics of immune system vulnerabilities

Science.gov (United States)

Stromberg, Sean P.

The adaptive immune system can be viewed as a complex system, which adapts, over time, to reflect the history of infections experienced by the organism. Understanding its operation requires viewing it in terms of tradeoffs under constraints and evolutionary history. It typically displays "robust, yet fragile" behavior, meaning common tasks are robust to small changes but novel threats or changes in environment can have dire consequences. In this dissertation we use mechanistic models to study several biological processes: the immune response, the homeostasis of cells in the lymphatic system, and the process that normally prevents autoreactive cells from entering the lymphatic system. Using these models we then study the effects of these processes interacting. We show that the mechanisms that regulate the numbers of cells in the immune system, in conjunction with the immune response, can act to suppress autoreactive cells from proliferating, thus showing quantitatively how pathogenic infections can suppress autoimmune disease. We also show that over long periods of time this same effect can thin the repertoire of cells that defend against novel threats, leading to an age correlated vulnerability. This vulnerability is shown to be a consequence of system dynamics, not due to degradation of immune system components with age. Finally, modeling a specific tolerance mechanism that normally prevents autoimmune disease, in conjunction with models of the immune response and homeostasis we look at the consequences of the immune system mistakenly incorporating pathogenic molecules into its tolerizing mechanisms. The signature of this dynamic matches closely that of the dengue virus system.
Normal hematopoiesis and lack of β-catenin activation in osteoblasts of patients and mice harboring Lrp5 gain-of-function mutations.

Science.gov (United States)

Galán-Díez, Marta; Isa, Adiba; Ponzetti, Marco; Nielsen, Morten Frost; Kassem, Moustapha; Kousteni, Stavroula

2016-03-01

Osteoblasts are emerging regulators of myeloid malignancies since genetic alterations in them, such as constitutive activation of β-catenin, instigate their appearance. The LDL receptor-related protein 5 (LRP5), initially proposed to be a co-receptor for Wnt proteins, in fact favors bone formation by suppressing gut-serotonin synthesis. This function of Lrp5 occurring in the gut is independent of β-catenin activation in osteoblasts. However, it is unknown whether Lrp5 can act directly in osteoblast to influence other functions that require β-catenin signaling, particularly, the deregulation of hematopoiesis and leukemogenic properties of β-catenin activation in osteoblasts, that lead to development of acute myeloid leukemia (AML). Using mice with gain-of-function (GOF) Lrp5 alleles (Lrp5(A214V)) that recapitulate the human high bone mass (HBM) phenotype, as well as patients with the T253I HBM Lrp5 mutation, we show here that Lrp5 GOF mutations in both humans and mice do not activate β-catenin signaling in osteoblasts. Consistent with a lack of β-catenin activation in their osteoblasts, Lrp5(A214V) mice have normal trilinear hematopoiesis. In contrast to leukemic mice with constitutive activation of β-catenin in osteoblasts (Ctnnb1(CAosb)), accumulation of early myeloid progenitors, a characteristic of AML, myeloid-blasts in blood, and segmented neutrophils or dysplastic megakaryocytes in the bone marrow, are not observed in Lrp5(A214V) mice. Likewise, peripheral blood count analysis in HBM patients showed normal hematopoiesis, normal percentage of myeloid cells, and lack of anemia. We conclude that Lrp5 GOF mutations do not activate β-catenin signaling in osteoblasts. As a result, myeloid lineage differentiation is normal in HBM patients and mice. This article is part of a Special Issue entitled: Tumor Microenvironment Regulation of Cancer Cell Survival, Metastasis, Inflammation, and Immune Surveillance edited by Peter Ruvolo and Gregg L. Semenza. Published
Functional aspects of the adaptive immune system in arthritis

NARCIS (Netherlands)

Jansen, D.T.S.L.

2017-01-01

The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,
Cytokine regulation of immune tolerance

OpenAIRE

Wu, Jie; Xie, Aini; Chen, Wenhao

2014-01-01

The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...
Pore size determination using normalized J-function for different hydraulic flow units

Directory of Open Access Journals (Sweden)

Ali Abedini

2015-06-01

Full Text Available Pore size determination of hydrocarbon reservoirs is one of the main challenging areas in reservoir studies. Precise estimation of this parameter leads to enhance the reservoir simulation, process evaluation, and further forecasting of reservoir behavior. Hence, it is of great importance to estimate the pore size of reservoir rocks with an appropriate accuracy. In the present study, a modified J-function was developed and applied to determine the pore radius in one of the hydrocarbon reservoir rocks located in the Middle East. The capillary pressure data vs. water saturation (Pc–Sw as well as routine reservoir core analysis include porosity (φ and permeability (k were used to develop the J-function. First, the normalized porosity (φz, the rock quality index (RQI, and the flow zone indicator (FZI concepts were used to categorize all data into discrete hydraulic flow units (HFU containing unique pore geometry and bedding characteristics. Thereafter, the modified J-function was used to normalize all capillary pressure curves corresponding to each of predetermined HFU. The results showed that the reservoir rock was classified into five separate rock types with the definite HFU and reservoir pore geometry. Eventually, the pore radius for each of these HFUs was determined using a developed equation obtained by normalized J-function corresponding to each HFU. The proposed equation is a function of reservoir rock characteristics including φz, FZI, lithology index (J*, and pore size distribution index (ɛ. This methodology used, the reservoir under study was classified into five discrete HFU with unique equations for permeability, normalized J-function and pore size. The proposed technique is able to apply on any reservoir to determine the pore size of the reservoir rock, specially the one with high range of heterogeneity in the reservoir rock properties.
[Induction of glutathione and activation of immune functions by low-dose, whole-body irradiation with gamma-rays].

Science.gov (United States)

Kojima, Shuji

2006-10-01

We first examined the relation between the induction of glutathione and immune functions in mice after low-dose gamma-ray irradiation. Thereafter, inhibition of tumor growth by radiation was confirmed in Ehrlich solid tumor (EST)-bearing mice. The total glutathione level of the splenocytes transiently increased soon after irradiation and reached a maximum at around 4 h postirradiation. Thereafter, the level reverted to the 0 h value by 24 h postirradiation. A significantly high splenocyte proliferative response was also recognized 4 h postirradiation. Natural killer (NK) activity was also increased significantly in a similar manner. The time at which the response reached the maximum coincided well with that of maximum total glutathione levels of the splenocytes in the gamma-ray-irradiated mice. Reduced glutathione exogenously added to splenocytes obtained from normal mice enhanced the proliferative response and NK activity in a dose-dependent manner. The inhibitory effects of radiation on tumor growth was then examined in EST-bearing mice. Repeated low-dose irradiation (0.5 Gy, four times, before and within an early time after inoculation) significantly delayed the tumor growth. Finally, the effect of single low-dose (0.5 Gy), whole-body gamma-ray irradiation on immune balance was examined to elucidate the mechanism underlying the antitumor immunity. The percentage of B cells in blood lymphocytes was selectively decreased after radiation, concomitant with an increase in that of the helper T cell population. The IFN-gamma level in splenocyte culture prepared from EST-bearing mice was significantly increased 48 h after radiation, although the level of IL-4 was unchanged. IL-12 secretion from macrophages was also enhanced by radiation. These results suggest that low-dose gamma-rays induce Th1 polarization and enhance the activities of tumoricidal effector cells, leading to an inhibition of tumor growth.
Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis

Science.gov (United States)

Rynes, Jan; Donohoe, Colin D.; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek

2012-01-01

Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins. PMID:22851689
Activating transcription factor 3 regulates immune and metabolic homeostasis.

Science.gov (United States)

Rynes, Jan; Donohoe, Colin D; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek; Uhlirova, Mirka

2012-10-01

Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins.
Arabidopsis MKS1 is involved in basal immunity and requires an intact N-terminal domain for proper function

DEFF Research Database (Denmark)

Petersen, Klaus; Qiu, Jin-Long; Lütje, Juri

2010-01-01

Innate immune signaling pathways in animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. MAP kinase 4 (MPK4) functions downstream of innate immune receptors via a nuclear substrate MKS1 to regulate the activity of the WRKY33 transcription factor, which in turn...

Neuronal Function in Male Sprague Dawley Rats During Normal Ageing.

Science.gov (United States)

Idowu, A J; Olatunji-Bello, I I; Olagunju, J A

2017-03-06

During normal ageing, there are physiological changes especially in high energy demanding tissues including the brain and skeletal muscles. Ageing may disrupt homeostasis and allow tissue vulnerability to disease. To establish an appropriate animal model which is readily available and will be useful to test therapeutic strategies during normal ageing, we applied behavioral approaches to study age-related changes in memory and motor function as a basis for neuronal function in ageing in male Sprague Dawley rats. 3 months, n=5; 6 months, n=5 and 18 months, n=5 male Sprague Dawley Rats were tested using the Novel Object Recognition Task (NORT) and the Elevated plus Maze (EPM) Test. Data was analyzed by ANOVA and the Newman-Keuls post hoc test. The results showed an age-related gradual decline in exploratory behavior and locomotor activity with increasing age in 3 months, 6 months and 18 months old rats, although the values were not statistically significant, but grooming activity significantly increased with increasing age. Importantly, we established a novel finding that the minimum distance from the novel object was statistically significant between 3 months and 18 months old rats and this may be an index for age-related memory impairment in the NORT. Altogether, we conclude that the male Sprague Dawley rat show age-related changes in neuronal function and may be a useful model for carrying out investigations into the mechanisms involved in normal ageing.
Anxiety and beta-adrenergic receptor function in a normal population.

Science.gov (United States)

Kang, Eun-Ho; Yu, Bum-Hee

2005-06-01

Many studies have shown a close relationship between anxiety and beta-adrenergic receptor function in patients with anxiety disorders. This study examined the relationship between beta-adrenergic receptor function and anxiety levels in a normal population. Subjects for this study included 36 men and 44 women between the ages of 20 and 40 years whose Body Mass Index (BMI) was between 18 and 26. All of them were healthy subjects who had no previous history of medical or psychiatric illnesses. The authors measured the Spielberger State-Trait Anxiety Inventory (STAI), Beck Depression Inventory (BDI), and Chronotropic 25 Dose (CD25) of isoproterenol, previously developed to assess in vivo beta-adrenergic receptor sensitivity. We also examined correlations between log normalized CD25 and mood states. The mean of CD25 was 2.64+/-1.37 mug and the mean of CD25 in men was significantly higher (i.e., lower beta-adrenergic receptor sensitivity) than that of women (3.26+/-1.35 vs. 2.14+/-1.17 microg; t = 3.99, p anxiety (r = -0.344, p = 0.002), trait anxiety (r = -0.331, p = 0.003), and BDI (r = -0.283, p = 0.011). CD25 was positively correlated with BMI (r = 0.423, p anxiety, and BMI. The sensitivity of beta-adrenergic receptors increased as anxiety levels became higher in a normal population. Thus, the relationship between anxiety and beta-adrenergic receptor function in healthy subjects may be different from that of patients with anxiety disorders.
Multifaceted Role of Neuropilins in the Immune System: Potential Targets for Immunotherapy.

Science.gov (United States)

Roy, Sohini; Bag, Arup K; Singh, Rakesh K; Talmadge, James E; Batra, Surinder K; Datta, Kaustubh

2017-01-01

Neuropilins (NRPs) are non-tyrosine kinase cell surface glycoproteins expressed in all vertebrates and widely conserved across species. The two isoforms, such as neuropilin-1 (NRP1) and neuropilin-2 (NRP2), mainly act as coreceptors for class III Semaphorins and for members of the vascular endothelial growth factor family of molecules and are widely known for their role in a wide array of physiological processes, such as cardiovascular, neuronal development and patterning, angiogenesis, lymphangiogenesis, as well as various clinical disorders. Intriguingly, additional roles for NRPs occur with myeloid and lymphoid cells, in normal physiological as well as different pathological conditions, including cancer, immunological disorders, and bone diseases. However, little is known concerning the molecular pathways that govern these functions. In addition, NRP1 expression has been characterized in different immune cellular phenotypes including macrophages, dendritic cells, and T cell subsets, especially regulatory T cell populations. By contrast, the functions of NRP2 in immune cells are less well known. In this review, we briefly summarize the genomic organization, structure, and binding partners of the NRPs and extensively discuss the recent advances in their role and function in different immune cell subsets and their clinical implications.
Changes in proHB-EGF expression after functional activation of the immune system cells

Directory of Open Access Journals (Sweden)

T. O. Chudina

2017-12-01

Full Text Available The level of proHB-EGF expression on J774, Raji, KG-1 cells derived from different types of human and mouse immune system cells under the standard in vitro culture conditions and during functional activation of these cells was investigated. Changes in the proHB-EGF expression on the cell surface were found to depend on the density of cell population, the content of fetal bovine serum in the culture medium, the effect of mitogenic factors – bacterial lipopolysaccharide, an inactive full-size form of diphtheria toxin (CRM197 and recombinant soluble HB-EGF – rsHB-EGF. The results obtained are important for the understanding of the functional role of proHB-EGF receptor on the surface of macrophage-like cells and B lymphocytes and indicate the involvement of this receptor in immune response regulation in an organism.
Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

Directory of Open Access Journals (Sweden)

Alessandra Cardoso Pereira

2005-06-01

Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.
PCSK9 at the crossroad of cholesterol metabolism and immune function during infections.

Science.gov (United States)

Paciullo, Francesco; Fallarino, Francesca; Bianconi, Vanessa; Mannarino, Massimo R; Sahebkar, Amirhossein; Pirro, Matteo

2017-09-01

Sepsis, a complex and dynamic syndrome resulting from microbial invasion and immune system dysregulation, is associated with an increased mortality, reaching up to 35% worldwide. Cholesterol metabolism is often disturbed during sepsis, with low plasma cholesterol levels being associated with poor prognosis. Proprotein convertase subtilisin/kexin type 9 (PCSK9) promotes degradation of the low-density lipoprotein receptor (LDLR), thus regulating intracellular and plasma cholesterol levels. PCSK9 is often upregulated during sepsis and might have a detrimental effect on immune host response and survival. Accordingly, PCSK9 reduces lipopolysaccharide uptake and clearance by human hepatocytes. Moreover, PCSK9 upregulation exacerbates organ dysfunction and tissue inflammation during sepsis, whereas a protective effect of PCSK9 deficiency has been documented in septic patients. Although a possible detrimental impact of PCSK9 on survival has been described, some beneficial effects of PCSK9 on immune response may be hypothesized. First, PCSK9 is associated with increased plasma cholesterol levels, which might be protective during sepsis. Second, PCSK9, by stimulating LDLR degradation and inhibiting reverse cholesterol transport (RCT), might promote preferential cholesterol accumulation in macrophages and other immune cells; these events might improve lipid raft composition and augment toll-like receptor function thus supporting inflammatory response. Hence, a more clear definition of the role of PCSK9 in septic states might provide additional insight in the understanding of the sepsis-associated immune dysregulation and enhance therapeutic outcomes. © 2017 Wiley Periodicals, Inc.
An extracellular subtilase switch for immune priming in Arabidopsis.

Directory of Open Access Journals (Sweden)

Vicente Ramírez

Full Text Available In higher eukaryotes, induced resistance associates with acquisition of a priming state of the cells for a more effective activation of innate immunity; however, the nature of the components for mounting this type of immunological memory is not well known. We identified an extracellular subtilase from Arabidopsis, SBT3.3, the overexpression of which enhances innate immune responses while the loss of function compromises them. SBT3.3 expression initiates a durable autoinduction mechanism that promotes chromatin remodeling and activates a salicylic acid(SA-dependent mechanism of priming of defense genes for amplified response. Moreover, SBT3.3 expression-sensitized plants for enhanced expression of the OXI1 kinase gene and activation of MAP kinases following pathogen attack, providing additional clues for the regulation of immune priming by SBT3.3. Conversely, in sbt3.3 mutant plants pathogen-mediated induction of SA-related defense gene expression is drastically reduced and activation of MAP kinases inhibited. Moreover, chromatin remodeling of defense-related genes normally associated with activation of an immune priming response appear inhibited in sbt3.3 plants, further indicating the importance of the extracellular SBT3.3 subtilase in the establishment of immune priming. Our results also point to an epigenetic control in the regulation of plant immunity, since SBT3.3 is up-regulated and priming activated when epigenetic control is impeded. SBT3.3 represents a new regulator of primed immunity.
Understanding how commensal obligate anaerobic bacteria regulate immune functions in the large intestine.

Science.gov (United States)

Maier, Eva; Anderson, Rachel C; Roy, Nicole C

2014-12-24

The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases.
Understanding How Commensal Obligate Anaerobic Bacteria Regulate Immune Functions in the Large Intestine

Science.gov (United States)

Maier, Eva; Anderson, Rachel C.; Roy, Nicole C.

2014-01-01

The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases. PMID:25545102
Normal Parathyroid Function with Decreased Bone Mineral Density in Treated Celiac Disease

Directory of Open Access Journals (Sweden)

Bernard Lemieux

2001-01-01

Full Text Available Decreased bone mineral density (BMD has been reported in patients with celiac disease in association with secondary hyperparathyroidism. The present study investigated whether basal parathyroid hormone (PTH remained elevated and whether abnormalities of parathyroid function were still present in celiac disease patients treated with a gluten-free diet. Basal seric measurements of calcium and phosphate homeostasis and BMD were obtained in 17 biopsy-proven patients under treatment for a mean period of 5.7±3.7 years (range 1.1 to 15.9. In addition, parathyroid function was studied with calcium chloride and sodium citrate infusions in seven patients. Basal measurements of patients were compared with those of 26 normal individuals, while parathyroid function results were compared with those of seven sex- and age-matched controls. Basal results were similar in patients and controls except for intact PTH (I-PTH (3.77±0.88 pmol/L versus 2.28±0.63 pmol/L, P<0.001, which was higher in the former group but still within normal limits. Mean 25-hydroxy vitamin D and 1,25-dihydroxy vitamin D values were normal in patients. Parathyroid function results were also found to be similar in both groups. Compared with a reference population of the same age (Z score, patients had significantly lower BMDs of the hip (-0.60±0.96 SDs, P<0.05 and lumbar spine (-0.76±1.15 SDs, P<0.05. T scores were also decreased for the hip (-1.3±0.9 SDs, P<0.0001 and lumbar spine (-1.4±1.35 SDs, P<0.0001, with two to three patients being osteoporotic (T score less than -2.5 SDs and seven to eight osteopenic (T score less than -1 SDs but greater than or equal to -2.5 SDs in at least one site. Height and weight were the only important determinants of BMD values by multivariate or logistical regression analysis in these patients. The results show higher basal I-PTH values with normal parathyroid function in treated celiac disease. Height and weight values are, but I-PTH values are not
Antiviral immunity in fish – functional analysis using DNA vaccination as a tool

DEFF Research Database (Denmark)

Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

2013-01-01

fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...... and cellular components both play a role in the long lasting protection. The similarity of the functional immune response profile to that induced by a natural virus infection is striking and is most likely one of the major reasons for the efficacy of the rhabdovirus DNA vaccines. Although other elements like...... protein gene suggest that the structural requirements for antigenicity are different from the requirements for immunogenicity....
The taktivine immune correction influence on the immune status of an irradiated organism

International Nuclear Information System (INIS)

Zhetpisbaev, B.A.; Mynzhanov, M.P.

1996-01-01

The taktivin immune correction action on irradiated organism immune system is studied. There were two series of experiments with 50 animals in each serial. The intacted and irradiated animals served as control ones. Irradiated animals have got the taktivin course 1,5-2,0 μg each 1 kg of mass intraperitoneally, during 3 days. Under tactivin action the immunity's T-sells quality and quantitative ability has been increased, and the lymphoid cells in the bone morrow and thymus have been normalized, and its quantity in spleen and small intestine's lymph nodes have been rise. The activation of energetic exchange within spleen has being carried out
Neural circuitry and immunity

Science.gov (United States)

Pavlov, Valentin A.; Tracey, Kevin J.

2015-01-01

Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000
Pretransplant Immune- and Apoptosis-Related Gene Expression Is Associated with Kidney Allograft Function

Directory of Open Access Journals (Sweden)

Dorota Kamińska

2016-01-01

Full Text Available Renal transplant candidates present immune dysregulation, caused by chronic uremia. The aim of the study was to investigate whether pretransplant peripheral blood gene expression of immune factors affects clinical outcome of renal allograft recipients. Methods. In a prospective study, we analyzed pretransplant peripheral blood gene expression in87 renal transplant candidates with real-time PCR on custom-designed low density arrays (TaqMan. Results. Immediate posttransplant graft function (14-day GFR was influenced negatively by TGFB1 (P=0.039 and positively by IL-2 gene expression (P=0.040. Pretransplant blood mRNA expression of apoptosis-related genes (CASP3, FAS, and IL-18 and Th1-derived cytokine gene IFNG correlated positively with short- (6-month GFR CASP3: P=0.027, FAS: P=0.021, and IFNG: P=0.029 and long-term graft function (24-month GFR CASP3: P=0.003, FAS: P=0.033, IL-18: P=0.044, and IFNG: P=0.04. Conclusion. Lowered pretransplant Th1-derived cytokine and apoptosis-related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. The pretransplant IFNG and CASP3 and FAS and IL-18 genes’ expression in the recipients’ peripheral blood is the possible candidate for novel biomarker of short- and long-term allograft function.
Shingles Immunity and Health Functioning in the Elderly: Tai Chi Chih as a Behavioral Treatment

Directory of Open Access Journals (Sweden)

Michael Irwin

2004-01-01

Full Text Available Both the incidence and severity of herpes zoster (HZ or shingles increase markedly with increasing age in association with a decline in varicella zoster virus (VZV-specific immunity. Considerable evidence shows that behavioral stressors, prevalent in older adults, correlate with impairments of cellular immunity. Moreover, the presence of depressive symptoms in older adults is associated with declines in VZV-responder cell frequency (VZV-RCF, an immunological marker of shingles risk. In this review, we discuss recent findings that administration of a relaxation response-based intervention, tai chi chih (TCC, results in improvements in health functioning and immunity to VZV in older adults as compared with a control group. TCC is a slow moving meditation consisting of 20 separate standardized movements which can be readily used in elderly and medically compromised individuals. TCC offers standardized training and practice schedules, lending an important advantage over prior relaxation response-based therapies. Focus on older adults at increased risk for HZ and assay of VZV-specific immunity have implications for understanding the impact of behavioral factors and a behavioral intervention on a clinically relevant end-point and on the response of the immune system to infectious pathogens.
Natural material adsorbed onto a polymer to enhance immune function

Directory of Open Access Journals (Sweden)

Reinaque AP

2012-08-01

Full Text Available Ana Paula Barcelos Reinaque,1 Eduardo Luzía França,2 Edson Fredulin Scherer,3 Mayra Aparecida Côrtes,1 Francisco José Dutra Souto,4 Adenilda Cristina Honorio-França51Post Graduate Program in Material Science, 2Institute of Biological and Health Science, Federal University of Mato Grosso, Barra do Garças, 3Post Graduate Program in Material Science, Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, 4Faculty of Medical Sciences, Federal University of Mato Grosso, Cuiabá, 5Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, MT, BrazilBackground: In this study, we produced poly(ethylene glycol (PEG microspheres of different sizes and adsorbing a medicinal plant mixture, and verified their effect in vitro on the viability, superoxide production, and bactericidal activity of phagocytes in the blood.Methods: The medicinal plant mixture was adsorbed onto PEG microspheres and its effects were evaluated by flow cytometry and fluorescence microscopy.Results: Adsorption of the herbal mixture onto the PEG microspheres was achieved and the particles were internalized by phagocytes. PEG microspheres bearing the adsorbed herbal mixture stimulated superoxide release, and activated scavenging and microbicidal activity in phagocytes. No differences in functional activity were observed when the phagocytes were not incubated with PEG microspheres bearing the adsorbed herbal mixture.Conclusion: This system may be useful for the delivery of a variety of medicinal plants and can confer additional protection against infection. The data reported here suggest that a polymer adsorbed with a natural product is a treatment alternative for enhancing immune function.Keywords: natural product, polymer, adsorption, immune function, phagocytes
Effects of radiotherapy on immunity in patients with localized carcinoma of the cervix uteri

International Nuclear Information System (INIS)

Hancock, B.W.; Bruce, L.; Heath, J.; Sugden, P.; Ward, A.M.

1979-01-01

To assess the effects of radiotherapy on immune status, a wide range of assessments have been performed on patients with localized carcinoma of the cervix uteri undergoing and initially responding clinically to radical pelvic radiotherapy. neutrophil function was essentially unchanged by treatment. Absolute neutrophil and lymphocyte counts fell after treatment and remained depressed 3 and 12 months following treatment. The proportions of T and B cells dropped with treatment but recovered to near-presentation levels during the follow-up period even though absolute counts remained depressed. In vitro tests of cellular immunity were depressed by treatment and remained so 3 and 12 months following treatment whereas skin test responses remained normal throughout the assessments. Inhibitory plasma effects were observed in photohaemagglutinin lymphocyte transformation studies on 4 untreated patients; at follow-up these effects were not evident. A variable response in immune indices has therefore been observed in patients in remission after treatment of localized carcinoma cervix stressing the importance of assessing several aspects of immune function and implying that persistent depression of certain indices does not adversely affect the host tumor response. In two patients relapsing after apparently good initial response, all aspects of immunological assessment (except serum immunoglobulin levels and neutrophil function) deteriorated
Coronary flow reserve/diastolic function relationship in angina-suffering patients with normal coronary angiography.

Science.gov (United States)

Anchisi, Chiara; Marti, Giuliano; Bellacosa, Ilaria; Mary, David; Vacca, Giovanni; Marino, Paolo; Grossini, Elena

2017-05-01

Coronary blood flow and diastolic function are well known to interfere with each other through mechanical and metabolic mechanisms. We aimed to assess the relationship between coronary flow reserve (CFR) and diastolic dysfunction in patients suffering from angina but with normal coronary angiography. In 16 patients with chest pain and angiographically normal coronary arteries, CFR was measured using transthoracic echo-Doppler by inducing hyperemia through dipyridamole infusion. Diastolic function (E/A, deceleration time, isovolumetric relaxation time [IVRT], propagation velocity [Vp]) and left ventricular mass were evaluated by means of two-dimensional transthoracic echocardiography. The patients were initially divided into two groups on the grounds of CFR only (ACFR: altered CFR, n = 9; NACFR: unaltered CFR, n = 7). Thereafter they were divided into four groups on the grounds of CFR and diastolic function (NN: normal; AA: altered CFR/diastole; AN: altered CFR/normal diastole; NA: normal CFR/altered diastole). Most of the subjects were scheduled in AA (n = 8) or NA (n = 5) groups, which were taken into consideration for further analysis. Patients were not different regarding various risk factors. ACFR and AA patients were older with normal body weight in comparison with NACFR and NA patients (P relationship between altered CFR and diastole.
Thermal sensitivity of immune function: evidence against a generalist-specialist trade-off among endothermic and ectothermic vertebrates

Science.gov (United States)

Butler, Michael W.; Stahlschmidt, Zachary R.; Ardia, Daniel R.; Davies, Scott; Davis, Jon; Guillette, Louis J.; Johnson, Nicholas; McCormick, Stephen D.; McGraw, Kevin J.; DeNardo, Dale F.

2013-01-01

Animal body temperature (Tbody) varies over daily and annual cycles, affecting multiple aspects of biological performance in both endothermic and ectothermic animals. Yet a comprehensive comparison of thermal performance among animals varying in Tbody (mean and variance) and heat production is lacking. Thus, we examined the thermal sensitivity of immune function (a crucial fitness determinant) in Vertebrata, a group encompassing species of varying thermal biology. Specifically, we investigated temperature-related variation in two innate immune performance metrics, hemagglutination and hemolysis, for 13 species across all seven major vertebrate clades. Agglutination and lysis were temperature dependent and were more strongly related to the thermal biology of species (e.g., mean Tbody) than to the phylogenetic relatedness of species, although these relationships were complex and frequently surprising (e.g., heterotherms did not exhibit broader thermal performance curves than homeotherms). Agglutination and lysis performance were positively correlated within species, except in taxa that produce squalamine, a steroidal antibiotic that does not lyse red blood cells. Interestingly, we found the antithesis of a generalist-specialist trade-off: species with broader temperature ranges of immune performance also had higher peak performance levels. In sum, we have uncovered thermal sensitivity of immune performance in both endotherms and ectotherms, highlighting the role that temperature and life history play in immune function across Vertebrata.
Regulatory immune cells and functions in autoimmunity and transplantation immunology.

Science.gov (United States)

Papp, Gabor; Boros, Peter; Nakken, Britt; Szodoray, Peter; Zeher, Margit

2017-05-01

In physiological circumstances, various tolerogenic mechanisms support the protection of self-structures during immune responses. However, quantitative and/or qualitative changes in regulatory immune cells and mediators can evoke auto-reactive immune responses, and upon susceptible genetic background, along with the presence of other concomitant etiological factors, autoimmune disease may develop. In transplant immunology, tolerogenic mechanisms are also critical, since the balance between of alloantigen-reactive effector cells and the regulatory immune cells will ultimately determine whether a graft is accepted or rejected. Better understanding of the immunological tolerance and the potential modulations of immune regulatory processes are crucial for developing effective therapies in autoimmune diseases as well as in organ transplantation. In this review, we focus on the novel insights regarding the impaired immune regulation and other relevant factors contributing to the development of auto-reactive and graft-reactive immune responses in autoimmune diseases and transplant rejection, respectively. We also address some promising approaches for modification of immune-regulatory processes and tolerogenic mechanisms in autoimmunity and solid organ transplantation, which may be beneficial in future therapeutic strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

Gastrointestinal immune responses in HIV infected subjects

Directory of Open Access Journals (Sweden)

LRR Castello-Branco

1996-06-01

Full Text Available The gut associated lymphoid tissue is responsible for specific responses to intestinal antigens. During HIV infection, mucosal immune deficiency may account for the gastrointestinal infections. In this review we describe the humoral and cellular mucosal immune responses in normal and HIV-infected subjects.
Exercise protects from cancer through regulation of immune function and inflammation

DEFF Research Database (Denmark)

Hojman, Pernille

2017-01-01

Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...
Poly-functional and long-lasting anticancer immune response elicited by a safe attenuated Pseudomonas aeruginosa vector for antigens delivery

Directory of Open Access Journals (Sweden)

Xavier Chauchet

2016-01-01

Full Text Available Live-attenuated bacterial vectors for antigens delivery have aroused growing interest in the field of cancer immunotherapy. Their potency to stimulate innate immunity and to promote intracellular antigen delivery into antigen-presenting cells could be exploited to elicit a strong and specific cellular immune response against tumor cells. We previously described genetically-modified and attenuated Pseudomonas aeruginosa vectors able to deliver in vivo protein antigens into antigen-presenting cells, through Type 3 secretion system of the bacteria. Using this approach, we managed to protect immunized mice against aggressive B16 melanoma development in both a prophylactic and therapeutic setting. In this study, we further investigated the antigen-specific CD8+ T cell response, in terms of phenotypic and functional aspects, obtained after immunizations with a killed but metabolically active P. aeruginosa attenuated vector. We demonstrated that P. aeruginosa vaccine induces a highly functional pool of antigen-specific CD8+ T cell able to infiltrate the tumor. Furthermore, multiple immunizations allowed the development of a long-lasting immune response, represented by a pool of predominantly effector memory cells which protected mice against late tumor challenge. Overall, killed but metabolically active P. aeruginosa vector is a safe and promising approach for active and specific antitumor immunotherapy.
Respiratory functions in asthmatic and normal women during different phases of menstrual cycle

International Nuclear Information System (INIS)

Arora, D.B.; Sandhu, P.K.; Dhillon, S.; Arora, A.

2015-01-01

Menstrual cycle is an integral part of life of women. There is widespread agreement that changes in the levels of oestrogen and progesterone associated with menstrual cycle also affect different systems of the body besides reproductive system. Levels of oestrogen and progesterone are maximum in the secretory phase and minimum just before the menstruation .Bronchial asthma is one of the commonest chronic respiratory diseases. Premenstrual worsening of asthma symptoms has been reported to affect 33-40% of asthmatic women. This exacerbation of asthma symptoms has been correlated with the oestrogen and progesterone levels. The association between menstrual cycle and lung functions in normal females has also been recognised. The pathophysiology of this process is still not proved. The purpose of our study was to confirm the probable effects of the female hormones on lung functions in normal and asthmatic women in different phases of menstrual cycle and to compare them. Methods: The study was done on 40 normal and 40 asthmatic females in the age group of 15-45 years. Pulmonary function tests were done in three phases of menstrual cycle i.e. follicular, secretory and menstrual in all the subjects. Results: The mean value of lung functions, i.e., FVC, FEV, PEFR, FEF25-75%, FEF 200-1200 were significantly lower in asthmatic females than normal ones (p<0.01) in all three phases. The lung functions of both asthmatic and non-asthmatic females in secretory phase were significantly higher than in menstrual phase (p<0.005). The PFTs in menstrual phase were even lower than the follicular phase (p<0.04). Conclusion: Respiratory parameters of both asthmatic and non-asthmatic women in reproductive age group show significant variation in different phases of menstrual cycle. The smooth muscle relaxant effect of progesterone and probably oestrogen might have contributed to it. The lung function parameters in asthmatics were of lower value compared to normal women. (author)
Functional relationship between the cerebrum and cerebellum in normal subjects

International Nuclear Information System (INIS)

Hanyu, Haruo; Arai, Hisayuki; Hatano, Nobuyoshi; Abe, Shinei; Katsunuma, Hideyo

1991-01-01

To determine whether a functional relationship between the cerebrum and cerebellum exists in normal subjects, the correlation between asymmetry in cerebral blood flow and asymmetry in cerebellar blood flow was investigated. Twenty-one healthy right-handed subjects were studied using SPECT with N-isopropyl-p-( 123 I)iodoamphetamine while in a resting state. The asymmetry index (AI) for both the cerebral and cerebellar hemisphere was calculated as follows. AI=right side - left side/right side + left side/200 (%). A negative correlation was found between AI in the cerebellum and AI in the cerebrum. Especially, AI in the cerebellar hemisphere was significantly correlated with AIs in the upper frontal cortex (r=-0.58, p<0.01), middle frontal cortex (r=-0.55, p<0.02), lower frontal cortex (r=-0.49, p<0.05), and mean cerebral hemisphere (r=-0.52, p<0.02). These results suggest the existence of a functional relationship between the cerebral hemisphere and the contralateral cerebellar hemisphere in the resting state of normal subjects. We strongly suspect that the frontal cortex exert an influence on the function in the contralateral cerebellum, probably due to a transneuronal mechanism, mainly through the corticopontocerebellar pathway. (author)
Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

Directory of Open Access Journals (Sweden)

Clovis S. Palmer

2018-01-01

Full Text Available An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of “inflammaging”, a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV+ individuals.
Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

Science.gov (United States)

Kato, Kazuki; Ishii, Ryohei; Goto, Eiji; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

2013-01-01

The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS) is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING), resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.
Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

Directory of Open Access Journals (Sweden)

Kazuki Kato

Full Text Available The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING, resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.
The twilight of immunity: emerging concepts in aging of the immune system.

Science.gov (United States)

Nikolich-Žugich, Janko

2018-01-01

Immunosenescence is a series of age-related changes that affect the immune system and, with time, lead to increased vulnerability to infectious diseases. This Review addresses recent developments in the understanding of age-related changes that affect key components of immunity, including the effect of aging on cells of the (mostly adaptive) immune system, on soluble molecules that guide the maintenance and function of the immune system and on lymphoid organs that coordinate both the maintenance of lymphocytes and the initiation of immune responses. I further address the effect of the metagenome and exposome as key modifiers of immune-system aging and discuss a conceptual framework in which age-related changes in immunity might also affect the basic rules by which the immune system operates.
The Role of TAM Family Receptors in Immune Cell Function: Implications for Cancer Therapy.

Science.gov (United States)

Paolino, Magdalena; Penninger, Josef M

2016-10-21

The TAM receptor protein tyrosine kinases-Tyro3, Axl, and Mer-are essential regulators of immune homeostasis. Guided by their cognate ligands Growth arrest-specific gene 6 (Gas6) and Protein S (Pros1), these receptors ensure the resolution of inflammation by dampening the activation of innate cells as well as by restoring tissue function through promotion of tissue repair and clearance of apoptotic cells. Their central role as negative immune regulators is highlighted by the fact that deregulation of TAM signaling has been linked to the pathogenesis of autoimmune, inflammatory, and infectious diseases. Importantly, TAM receptors have also been associated with cancer development and progression. In a cancer setting, TAM receptors have a dual regulatory role, controlling the initiation and progression of tumor development and, at the same time, the associated anti-tumor responses of diverse immune cells. Thus, modulation of TAM receptors has emerged as a potential novel strategy for cancer treatment. In this review, we discuss our current understanding of how TAM receptors control immunity, with a particular focus on the regulation of anti-tumor responses and its implications for cancer immunotherapy.
Sculpting humoral immunity through dengue vaccination to enhance protective immunity

Directory of Open Access Journals (Sweden)

Wayne eCrill

2012-11-01

Full Text Available Dengue viruses (DENV are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF. Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1 DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT with this cross-reactivity reduced (CRR vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naïve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine induced immune
Coelomocytes: Biology and Possible Immune Functions in Invertebrates with Special Remarks on Nematodes

Directory of Open Access Journals (Sweden)

Qudsia Tahseen

2009-01-01

Full Text Available All metazoans are exposed to a wide range of microbes and have evolved complex immune defenses used to repel infectious agents. Coelomocytes play a key role in the defense reactions of most invertebrates. They are involved in important immune functions, such as phagocytosis, encapsulation, graft rejection, and inflammation, as well as the synthesis and secretion of several humoral factors especially in annelids and echinoderms. Coelomocytes in nematodes are variable in shapes from round, ovoid, cuboidal, and spindle-shaped to stellate or branched cells that are found usually at fixed positions in the pseudocoelom. Their number usually varies from 2 to 6. The model nematode, C. elegans lacks an adaptive immune system and the coelomocytes are capable of endocytosis, but their involvement in phagocytosis of bacteria seems unlikely. The aim of this review is to evaluate current knowledge on coelomocytes of invertebrates with special reference to nematodes. The morphology and structure of these coelomocytes are discussed along with their origin. Their relative positions and diversity in different nematode groups have also been discussed and illustrated.
Skin Immunization Obviates Alcohol-Related Immune Dysfunction

Directory of Open Access Journals (Sweden)

Rhonda M. Brand

2015-11-01

Full Text Available Alcoholics suffer from immune dysfunction that can impede vaccine efficacy. If ethanol (EtOH-induced immune impairment is in part a result of direct exposure of immune cells to EtOH, then reduced levels of exposure could result in less immune dysfunction. As alcohol ingestion results in lower alcohol levels in skin than blood, we hypothesized that the skin immune network may be relatively preserved, enabling skin-targeted immunizations to obviate the immune inhibitory effects of alcohol consumption on conventional vaccines. We employed the two most common chronic EtOH mouse feeding models, the liver-damaging Lieber-DeCarli (LD and liver-sparing Meadows-Cook (MC diets, to examine the roles of EtOH and/or EtOH-induced liver dysfunction on alcohol related immunosuppression. Pair-fed mice were immunized against the model antigen ovalbumin (OVA by DNA immunization or against flu by administering the protein-based influenza vaccine either systemically (IV, IM, directly to liver (hydrodynamic, or cutaneously (biolistic, ID. We measured resulting tissue EtOH levels, liver stress, regulatory T cell (Treg, and myeloid-derived suppressor cell (MDSC populations. We compared immune responsiveness by measuring delayed-type hypersensitivity (DTH, antigen-specific cytotoxic T lymphocyte (CTL, and antibody induction as a function of delivery route and feeding model. We found that, as expected, and independent of the feeding model, EtOH ingestion inhibits DTH, CTL lysis, and antigen-specific total IgG induced by traditional systemic vaccines. On the other hand, skin-targeted vaccines were equally immunogenic in alcohol-exposed and non-exposed subjects, suggesting that cutaneous immunization may result in more efficacious vaccination in alcohol-ingesting subjects.
Melatonin: Buffering the Immune System

Directory of Open Access Journals (Sweden)

Juan M. Guerrero

2013-04-01

Full Text Available Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed.
Melatonin: Buffering the Immune System

Science.gov (United States)

Carrillo-Vico, Antonio; Lardone, Patricia J.; Álvarez-Sánchez, Nuria; Rodríguez-Rodríguez, Ana; Guerrero, Juan M.

2013-01-01

Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed. PMID:23609496
Functions of innate immune cells and commensal bacteria in gut homeostasis.

Science.gov (United States)

Kayama, Hisako; Takeda, Kiyoshi

2016-02-01

The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Maintenance of systemic immune functions prevents accelerated presbycusis.

Science.gov (United States)

Iwai, Hiroshi; Baba, Susumu; Omae, Mariko; Lee, Shinryu; Yamashita, Toshio; Ikehara, Susumu

2008-05-07

There is no effective therapy for progressive hearing loss such as presbycusis, the causes of which remain poorly understood because of the difficulty of separating genetic and environmental contributions. In the present study, we show that the age-related dysfunctions of the systemic immune system in an animal model of accelerated presbycusis (SAMP1, senescence-accelerated mouse P1) can be corrected by allogeneic bone marrow transplantation (BMT). We also demonstrate that this presbycusis can be prevented; BMT protects the recipients from age-related hearing impairment and the degeneration of spiral ganglion cells (SGCs) as well as the dysfunctions of T lymphocytes, which have a close relation to immune senescence. No donor cells are infiltrated to the spiral ganglia, confirming that this experimental system using BMT is connected to the systemic immune system and does not contribute to transdifferentiation or fusion by donor hematopoietic stem cells (HSCs), or to the direct maintenance of ganglion cells by locally infiltrated donor immunocompetent cells. Therefore, another procedure which attempts to prevent the age-related dysfunctions of the recipient immune system is the inoculation of syngeneic splenocytes from young donors. These mice show no development of hearing loss, compared with the recipient mice with inoculation of saline or splenocytes from old donors. Our studies on the relationship between age-related systemic immune dysfunctions and neurodegeneration mechanisms open up new avenues of treatment for presbycusis, for which there is no effective therapy.
Functionalized iron oxide nanoparticles for controlling the movement of immune cells

Science.gov (United States)

White, Ethan E.; Pai, Alex; Weng, Yiming; Suresh, Anil K.; van Haute, Desiree; Pailevanian, Torkom; Alizadeh, Darya; Hajimiri, Ali; Badie, Behnam; Berlin, Jacob M.

2015-04-01

Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were generated by loading the cells with iron oxide nanoparticles functionalized with CpG oligonucleotides, serving as a proof of principle that nanoparticles can be used to both deliver an immunostimulatory cargo to cells and to control the movement of the cells. The nanoparticle-oligonucleotide conjugates are efficiently internalized, non-toxic, and immunostimulatory. We demonstrate that the in vitro migration of the adherent, loaded microglia can be controlled by an external magnetic field and that magnetically-induced migration is non-cytotoxic. In order to capture video of this magnetically-induced migration of loaded cells, a novel 3D-printed ``cell box'' was designed to facilitate our imaging application. Analysis of cell movement velocities clearly demonstrate increased cell velocities toward the magnet. These studies represent the initial step towards our final goal of using nanoparticles to both activate immune cells and to control their trafficking within the diseased brain.Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were
Effects of psycho-behavioral interventions on immune functioning in cancer patients: a systematic review.

Science.gov (United States)

Tong, Guixian; Geng, Qingqing; Cheng, Jing; Chai, Jing; Xia, Yi; Feng, Rui; Zhang, Lu; Wang, Debin

2014-01-01

This study aimed at summarizing evidence about effects of psycho-behavioral interventions (PBIs) on immune responses among cancer patients and analyzing quality of published studies so as to inform future researches. Literature retrieval utilized both highly inclusive algorithms searching randomized controlled studies published in English and Chinese and manual searching of eligible studies from references of relevant review papers. Two researchers examined the articles selected separately and extracted the information using a pre-designed form for soliciting data about the trials (e.g., sample size, disease status, intervention, immune responses) and quality ratings of the studies. Both narrative descriptions and meta-analysis (via Review manager 5) were used synthesizing the effects of PBIs on immune responses among cancer patients and state of art of the researches in this area. Seventy-six RCTs met inclusion criteria. PBIs implemented were divided into three major categories including psychological state adjustment, physical activity and dietary modification. Immune indicators measured included CD4+ cells, CD8+ cells, CD4/CDC8+ ratio, CD3+ cells, NK cell activity, etc. Effects of PBIs on immune responses documented in individual papers were mixed and pooled analysis of CD4+ cells, CD4+/CD8+ ratio, CD3+ cells, NKCA, IgG, IgM and IL-2 showed modest effects. However, there were huge discrepancies in intervention effects between studies published in English and Chinese and the results should be interpreted with caution. Besides, most studies suffer from some quality flaws concerning blinding, randomization procedures, compliance, attrition and intention-to-treat analyses, etc. Although there are considerable evidences of PBI effects on some immune indicators, the effect sizes are modest and it is still premature to conclude whether PBIs have effects on immune functions among cancer patients. There is a clear need for much more rigorous efforts in this area
Correlation of STATs family expression in oral lichen planus tissue with peripheral blood PD-1 and PD-L1 expression as well as immune function

Directory of Open Access Journals (Sweden)

Hong Zhang

2016-12-01

Full Text Available Objective: To study the correlation of STATs family expression in oral lichen planus tissue with peripheral blood PD-1 and PD-L1 expression as well as immune function. Methods: A total of 47 patients diagnosed with oral lichen planus in our hospital between May 2015 and March 2016 were selected as the oral lichen planus group (OLP group of the study, and healthy volunteers receiving physical examination during the same period were selected as the control group of the study. Peripheral blood mononuclear cells were collected to detect the expression of PD-1, PD-L1 and immune cell surface marker molecules, serum was collected to detect the content of Th1 and Th2 cytokines as well as immunoglobulin, and oral lichen planus lesion tissue and adjacent normal tissue were collected to determine STATs family expression. Results: p-STAT1, p-STAT3 and p-STAT5a expression in lesion tissue were significantly higher than those in normal tissue while p-STAT2, p-STAT4 and p-STAT5b expression were not significantly different from those in normal tissue; PD-1 and PD-L1 mRNA expression as well as the mean fluorescence intensity of CD19+ in peripheral blood mononuclear cells of OLP group were significantly higher than those of control group and positively correlated with p-STAT1, p-STAT3 and p-STAT5a expression while the mean fluorescence intensity of CD3+, CD4+, CD8+ and CD16+CD56+ were significantly lower than those of control group and negatively correlated with p-STAT1, p-STAT3 and p-STAT5a expression; serum IFN-γ and IL-2 content of OLP group were significantly lower than those of control group and negatively correlated with p-STAT1, p-STAT3 and p-STAT5a expression while IL-4, IL-10, IgG, IgM and IgA content were significantly higher than those of control group and positively correlated with p-STAT1, p-STAT3 and p-STAT5a expression. Conclusion: p-STAT1, p-STAT3 and p-STAT5a expression abnormally increase in oral lichen planus tissues, and the Th1/Th2 cellular

Impact of exogenous lipase supplementation on growth, intestinal function, mucosal immune and physical barrier, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella).

Science.gov (United States)

Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

2016-08-01

This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.
Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

Directory of Open Access Journals (Sweden)

Xiquan Gao

2014-03-01

Full Text Available An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP, which is called PAMP-triggered immunity (PTI. The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI. Calcium (Ca2+ signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response.
Functions of Calcium-Dependent Protein Kinases in Plant Innate Immunity

Science.gov (United States)

Gao, Xiquan; Cox, Kevin L.; He, Ping

2014-01-01

An increase of cytosolic Ca2+ is generated by diverse physiological stimuli and stresses, including pathogen attack. Plants have evolved two branches of the immune system to defend against pathogen infections. The primary innate immune response is triggered by the detection of evolutionarily conserved pathogen-associated molecular pattern (PAMP), which is called PAMP-triggered immunity (PTI). The second branch of plant innate immunity is triggered by the recognition of specific pathogen effector proteins and known as effector-triggered immunity (ETI). Calcium (Ca2+) signaling is essential in both plant PTI and ETI responses. Calcium-dependent protein kinases (CDPKs) have emerged as important Ca2+ sensor proteins in transducing differential Ca2+ signatures, triggered by PAMPs or effectors and activating complex downstream responses. CDPKs directly transmit calcium signals by calcium binding to the elongation factor (EF)-hand domain at the C-terminus and substrate phosphorylation by the catalytic kinase domain at the N-terminus. Emerging evidence suggests that specific and overlapping CDPKs phosphorylate distinct substrates in PTI and ETI to regulate diverse plant immune responses, including production of reactive oxygen species, transcriptional reprogramming of immune genes, and the hypersensitive response. PMID:27135498
Pseudoachondroplasia with immune deficiency

International Nuclear Information System (INIS)

Kultursay, N.; Taneli, B.; Cavusoglu, A.

1988-01-01

A 5-year old boy was admitted to the hospital with failure to thrive since he was 2 years old, with weakness in his legs and a waddling gait. He has normal mental development. His parents are normal phenotypically and are unrelated. In analysing his pedigree only a grandfather is described to have waddling gait. He has a normal craniofacial appearance but a disproportionate body with normal trunk and short extremities with height below the 3rd percentile. The diagnosis of pseudoachondroplasia was made on clinical, radiological and laboratory findings. He also had immune deficiency characterised by low T-lymphocyte populations and a low level of serum immunoglobulin A. (orig.)
Functional similarities between pigeon 'milk' and mammalian milk: induction of immune gene expression and modification of the microbiota.

Directory of Open Access Journals (Sweden)

Meagan J Gillespie

Full Text Available Pigeon 'milk' and mammalian milk have functional similarities in terms of nutritional benefit and delivery of immunoglobulins to the young. Mammalian milk has been clearly shown to aid in the development of the immune system and microbiota of the young, but similar effects have not yet been attributed to pigeon 'milk'. Therefore, using a chicken model, we investigated the effect of pigeon 'milk' on immune gene expression in the Gut Associated Lymphoid Tissue (GALT and on the composition of the caecal microbiota. Chickens fed pigeon 'milk' had a faster rate of growth and a better feed conversion ratio than control chickens. There was significantly enhanced expression of immune-related gene pathways and interferon-stimulated genes in the GALT of pigeon 'milk'-fed chickens. These pathways include the innate immune response, regulation of cytokine production and regulation of B cell activation and proliferation. The caecal microbiota of pigeon 'milk'-fed chickens was significantly more diverse than control chickens, and appears to be affected by prebiotics in pigeon 'milk', as well as being directly seeded by bacteria present in pigeon 'milk'. Our results demonstrate that pigeon 'milk' has further modes of action which make it functionally similar to mammalian milk. We hypothesise that pigeon 'lactation' and mammalian lactation evolved independently but resulted in similarly functional products.
Fibroblast activation protein is dispensable in the anti-influenza immune response in mice.

Directory of Open Access Journals (Sweden)

Sioh-Yang Tan

Full Text Available Fibroblast activation protein alpha (FAP is a unique dual peptidase of the S9B serine protease family, being capable of both dipeptidyl peptidase and endopeptidase activities. FAP is expressed at low level in healthy adult organs including the pancreas, cervix, uterus, submaxillary gland and the skin, and highly upregulated in embryogenesis, chronic inflammation and tissue remodelling. It is also expressed by cancer-associated stromal fibroblasts in more than 90% of epithelial tumours. FAP has enzymatic and non-enzymatic functions in the growth, immunosuppression, invasion and cell signalling of tumour cells. FAP deficient mice are fertile and viable with no gross abnormality, but little data exist on the role of FAP in the immune system. FAP is upregulated in association with microbial stimulation and chronic inflammation, but its function in infection remains unknown. We showed that major populations of immune cells including CD4+ and CD8+ T cells, B cells, dendritic cells and neutrophils are generated and maintained normally in FAP knockout mice. Upon intranasal challenge with influenza virus, FAP mRNA was increased in the lungs and lung-draining lymph nodes. Nonetheless, FAP deficient mice showed similar pathologic kinetics to wildtype controls, and were capable of supporting normal anti-influenza T and B cell responses. There was no evidence of compensatory upregulation of other DPP4 family members in influenza-infected FAP-deficient mice. FAP appears to be dispensable in anti-influenza adaptive immunity.
Normal thyroid function values in Ethiopians

International Nuclear Information System (INIS)

Wassie, Emnetu; Abdulkadir, Jemal

1990-01-01

Thyroid function values were determined in 56 healthy nongoitrous adult Ethiopians. The mean triiodothyronine (T3) values for 20 males and 36 females were 1.42+-0.32 nmol/L and 1.51+-0.25 nmol/L, and thyroxine (T4) values were 119 22 nmol/L and 116+21 nmol/L respectively. The mean thyrotropin (TSH) values for males and females were identical at 1.86+-0.94 mu/L. Radioactive iodine uptake (RAIU) at 2 hours was 8.6+-4.4% in males and 11.3+-4.3% in females, and at 24 hours 31.7+-11.7% and 38.9+-11.1% respectively. The difference between males and females were significant at both 2 and 24 hours (P<0.05). The ranges for the 3 hormones derived from the mean 2SD values are close to these supplied with the kits but the Ethiopian RAIU values are higher than the values currently applicable in developed countries, probably indicative of the lower level of dietary iodine available to the population here. The values obtained in this study are offered to serve as normal reference for the interpretation of thyroid function results in Ethiopian patients. A strategy for the rational utilization of the available in vitro tests is suggested
Cesarean section and disease associated with immune function

DEFF Research Database (Denmark)

Kristensen, Kim; Henriksen, Lonny

2016-01-01

colitis and celiac disease, whereas children delivered by elective CS had an increased risk of lower respiratory tract infection and juvenile idiopathic arthritis. The effect of elective CS was higher than the effect of acute CS on the risk of asthma. CONCLUSION: Children delivered by CS are at increased......BACKGROUND: Earlier studies have shown that delivery by cesarean section (CS) is associated with an increased risk of disease associated with immune function in the offspring, but these studies have generally not discriminated between the effect of acute and elective CS. OBJECTIVE: We sought...... to further explore these associations using discrimination between the effects of acute versus elective CS. METHODS: We performed a population- and national register-based cohort study including all children born in Denmark from January 1997 through December 2012. Hazard ratios for diseases associated...
Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases

DEFF Research Database (Denmark)

Xanthoulea, Sofia; Pasparakis, Manolis; Kousteni, Stavroula

2004-01-01

Tumor necrosis factor (TNF) is a potent cytokine exerting critical functions in the activation and regulation of immune and inflammatory responses. Due to its pleiotropic activities, the amplitude and duration of TNF function must be tightly regulated. One of the mechanisms that may have evolved...... to modulate TNF function is the proteolytic cleavage of its cell surface receptors. In humans, mutations affecting shedding of the p55TNF receptor (R) have been linked with the development of the TNFR-associated periodic syndromes, disorders characterized by recurrent fever attacks and localized inflammation....... Here we show that knock-in mice expressing a mutated nonsheddable p55TNFR develop Toll-like receptor-dependent innate immune hyperreactivity, which renders their immune system more efficient at controlling intracellular bacterial infections. Notably, gain of function for antibacterial host defenses...
Novel Approach to Design Ultra Wideband Microwave Amplifiers: Normalized Gain Function Method

Directory of Open Access Journals (Sweden)

R. Kopru

2013-09-01

Full Text Available In this work, we propose a novel approach called as “Normalized Gain Function (NGF method” to design low/medium power single stage ultra wide band microwave amplifiers based on linear S parameters of the active device. Normalized Gain Function TNGF is defined as the ratio of T and |S21|^2, desired shape or frequency response of the gain function of the amplifier to be designed and the shape of the transistor forward gain function, respectively. Synthesis of input/output matching networks (IMN/OMN of the amplifier requires mathematically generated target gain functions to be tracked in two different nonlinear optimization processes. In this manner, NGF not only facilitates a mathematical base to share the amplifier gain function into such two distinct target gain functions, but also allows their precise computation in terms of TNGF=T/|S21|^2 at the very beginning of the design. The particular amplifier presented as the design example operates over 800-5200 MHz to target GSM, UMTS, Wi-Fi and WiMAX applications. An SRFT (Simplified Real Frequency Technique based design example supported by simulations in MWO (MicroWave Office from AWR Corporation is given using a 1400mW pHEMT transistor, TGF2021-01 from TriQuint Semiconductor.
Proportional and functional analogical reasoning in normal and language-impaired children.

Science.gov (United States)

Nippold, M A; Erskine, B J; Freed, D B

1988-11-01

Teachers often use analogies in classroom settings to clarify new concepts for their students. However, analogies may inadvertently confuse the youngster who has difficulty identifying the one-to-one comparisons underlying them. Although analogical reasoning has been studied extensively in normal children, no information was available concerning this construct in children having a specific language impairment. Thus, it was unknown to what extent they might be deficient in analogical reasoning. Therefore, in the present study, 20 children ages 6-8 years (mean age = 7:6) having normal nonverbal intelligence but deficits in language comprehension were administered tasks of verbal and perceptual proportional analogical reasoning and a problem-solving task of functional analogical reasoning. Compared to a normal-language control group matched on the basis of chronological age and sex, the language-impaired group was deficient in all three tasks of analogical reasoning. However, when the factor of nonverbal intelligence was controlled statistically, the differences between the groups on each of the tasks were removed. Additional findings were that verbal proportional analogical reasoning was significantly correlated to perceptual proportional analogical reasoning and to functional analogical reasoning. Implications for assessment and intervention with young school-age language-impaired children are discussed.
Bifidobacterium breve alters immune function and ameliorates DSS-induced inflammation in weanling rats.

Science.gov (United States)

Izumi, Hirohisa; Minegishi, Mario; Sato, Yohei; Shimizu, Takashi; Sekine, Kazunori; Takase, Mitsunori

2015-10-01

Bifidobacterium breve M-16V (M16V) is a probiotic bacterial strain with a long tradition of use in neonatal intensive care units in some countries. Previous study showed that the effects of M16V administration on gene expression were greater during the weaning period than in the neonatal period and were greater in the colon than in the small intestine and spleen, suggesting that M16V has anti-inflammatory effects. In this study, we evaluated the effects of inflammation during the weaning period and the effects of M16V on normal and inflammatory conditions. From postnatal day (PD) 21 to 34, weanling rats were administered of 2.5 × 10(9) of M16V daily, and colitis was induced by administration of 2% dextran sulfate sodium from PD28 to 35. Colitis severity, immune function, and microbiota were investigated. Colitis caused a reduction in body weight gain, colon shortening, poor nutritional status, anemia, changes in blood and spleen lymphocyte populations, spleen T-cell malfunctions, and alterations in colon microbiota. M16V administration improved some but not all of the changes induced by colitis. M16V could suppress inflammation and, therefore, can be considered a safe strain to use not only during the neonatal period but also the weaning period.
Cost of reproduction in a long-lived bird: incubation effort reduces immune function and future reproduction.

Science.gov (United States)

Hanssen, Sveinn Are; Hasselquist, Dennis; Folstad, Ivar; Erikstad, Kjell Einar

2005-05-22

Life-history theory predicts that increased current reproductive effort should lead to a fitness cost. This cost of reproduction may be observed as reduced survival or future reproduction, and may be caused by temporal suppression of immune function in stressed or hard-working individuals. In birds, consideration of the costs of incubating eggs has largely been neglected in favour of the costs of brood rearing. We manipulated incubation demand in two breeding seasons (2000 and 2001) in female common eiders (Somateria mollissima) by creating clutches of three and six eggs (natural range 3-6 eggs). The common eider is a long-lived sea-duck where females do not eat during the incubation period. Mass loss increased and immune function (lymphocyte levels and specific antibody response to the non-pathogenic antigens diphtheria and tetanus toxoid) was reduced in females incubating large clutches. The increased incubation effort among females assigned to large incubation demand did not lead to adverse effects on current reproduction or return rate in the next breeding season. However, large incubation demand resulted in long-term fitness costs through reduced fecundity the year after manipulation. Our data show that in eiders, a long-lived species, the cost of high incubation demand is paid in the currency of reduced future fecundity, possibly mediated by reduced immune function.
Effects of ration level on immune functions in chinook salmon (Oncorhynchus tshawytscha)

Science.gov (United States)

Alcorn, S.W.; Pascho, R.J.; Murray, A.L.; Shearer, K.D.

2003-01-01

The relationship between nutritional status and disease resistance in cultured salmonids can be affected by dietary manipulations. Careful attention to feeding levels may be important to avoid imbalances in nutrient levels that could ultimately impair a fish's ability to resist infectious microorganisms. In the current study, fish in three feed-level groups were fed an experimental diet either to satiation, 64% of satiation or 40% of satiation. A fourth group of fish were fed a commercial diet at the 64% of satiation level and served as controls. To evaluate certain indices of disease resistance in the test and control fish, a panel of assays was employed to measure humoral and cellular immune functions 30, 39 and 54 weeks after starting the dietary treatments. The panel included measures of blood hematocrit and leucocrit levels, plasma protein concentration and serum lysozyme and complement activity. Cellular analyses included differential blood leucocyte counts, NBT reduction and phagocytosis by pronephros macrophages and myeloperoxidase activity of pronephros neutrophils. No differences were observed in those indices between fish tested from the control-diet group (commercial diet fed at the 64% rate) and fish tested from the 64% feed-level group, except that fish fed the commercial diet had a greater concentration of plasma protein. Leucocrit values and plasma protein concentrations tended to increase among the experimental feed groups as the ration increased from 40% to satiation. More importantly, phagocytic activity by anterior kidney leucocytes was found to be inversely proportional to the feed level. Whereas the results of this study provide evidence that the salmonid immune system may be fairly robust with regard to available metabolic energy, the significant changes observed in phagocytic cell activity suggest that some cellular immune functions may be affected by the feed level.
Relationship between ways of nutritional support and immune function in patients with malignant obstructive jaundice after PTCD

Directory of Open Access Journals (Sweden)

YANG Shenghua

2014-11-01

Full Text Available ObjectiveTo investigate the clinical effect of different nutritional therapies on the immune function of patients with malignant obstructive jaundice after percutaneous transhepatic cholangiodrainage (PTCD. MethodsA total of 50 patients with malignant obstructive jaundice who were admitted to our hospital from January 2009 to March 2013 were randomly divided into two groups according to the admission order. The patients in group A (n=25 received enteral nutritional support after PTCD, and those in group B (n=25 received total parenteral nutritional support after PTCD. Intra-group and inter-group comparisons were made in terms of jaundice clearance, nutritional indices, and body’s immune function on preoperative day 1 and postoperative day 7; comparison between the two groups was made by t test. ResultsAmong the 50 patients who underwent PTCD, 39 (78% had good drainage, while 11 (22% did not reach the expectation, of which, 5 (10% were in group A and 6 (12% in group B. In both groups, the nutritional indices on postoperative day 7 were significantly higher than those on preoperative day 1(P＜0.05, but no significant difference in these indices was observed between group A and group B on postoperative day 7 (P＞0.05. The immune function of patients in both groups was significantly improved following PTCD and nutritional support (P＜0.05, but there was no significant difference between the two groups (P＞0.05. Although the same scheme of nutritional support was used, there were 11 patients who did not achieve the expected jaundice clearance after PTCD and had limited improvement in immune function compared with those who had complete jaundice clearance (all P＜0.05. ConclusionJaundice clearance is closely related to PTCD in patients with malignant obstructive jaundice, but not markedly associated with the ways of nutritional support.
Induction of antitumor immunity through xenoplacental immunization

Directory of Open Access Journals (Sweden)

Agadjanyan Michael G

2006-05-01

Full Text Available Abstract Historically cancer vaccines have yielded suboptimal clinical results. We have developed a novel strategy for eliciting antitumor immunity based upon homology between neoplastic tissue and the developing placenta. Placenta formation shares several key processes with neoplasia, namely: angiogenesis, activation of matrix metalloproteases, and active suppression of immune function. Immune responses against xenoantigens are well known to break self-tolerance. Utilizing xenogeneic placental protein extracts as a vaccine, we have successfully induced anti-tumor immunity against B16 melanoma in C57/BL6 mice, whereas control xenogeneic extracts and B16 tumor extracts where ineffective, or actually promoted tumor growth, respectively. Furthermore, dendritic cells were able to prime tumor immunity when pulsed with the placental xenoantigens. While vaccination-induced tumor regression was abolished in mice depleted of CD4 T cells, both CD4 and CD8 cells were needed to adoptively transfer immunity to naïve mice. Supporting the role of CD8 cells in controlling tumor growth are findings that only freshly isolated CD8 cells from immunized mice were capable of inducing tumor cell caspases-3 activation ex vivo. These data suggest feasibility of using xenogeneic placental preparations as a multivalent vaccine potently targeting not just tumor antigens, but processes that are essential for tumor maintenance of malignant potential.
Immune system handling time may alter the outcome of competition between pathogens and the immune system.

Science.gov (United States)

Greenspoon, Philip B; Banton, Sydney; Mideo, Nicole

2018-06-14

Predators may be limited in their ability to kill prey (i.e., have type II or III functional responses), an insight that has had far-reaching consequences in the ecological literature. With few exceptions, however, this possibility has not been extended to the behaviour of immune cells, which kill pathogens much as predators kill their prey. Rather, models of the within-host environment have tended to tacitly assume that immune cells have an unlimited ability to target and kill pathogens (i.e., a type I functional response). Here we explore the effects of changing this assumption on infection outcomes (i.e., pathogen loads). We incorporate immune cell handling time into an ecological model of the within-host environment that considers both the predatory nature of the pathogen-immune cell interaction as well as competition between immune cells and pathogens for host resources. Unless pathogens can preempt immune cells for host resources, adding an immune cell handling time increases equilibrium pathogen load. We find that the shape of the relationship between energy intake and pathogen load can change: with a type I functional response, pathogen load is maximised at intermediate inputs, while for a type II or III functional response, pathogen load is solely increasing. With a type II functional response, pathogen load can fluctuate rather than settling to an equilibrium, a phenomenon unobserved with type I or III functional responses. Our work adds to a growing literature highlighting the role of resource availability in host-parasite interactions. Implications of our results for adaptive anorexia are discussed. Copyright © 2018 Elsevier Ltd. All rights reserved.
The Application of Normal Stress Reduction Function in Tilt Tests for Different Block Shapes

Science.gov (United States)

Kim, Dong Hyun; Gratchev, Ivan; Hein, Maw; Balasubramaniam, Arumugam

2016-08-01

This paper focuses on the influence of the shapes of rock cores, which control the sliding or toppling behaviours in tilt tests for the estimation of rock joint roughness coefficients (JRC). When the JRC values are estimated by performing tilt tests, the values are directly proportional to the basic friction of the rock material and the applied normal stress on the sliding planes. Normal stress obviously varies with the shape of the sliding block, and the basic friction angle is also affected by the sample shapes in tilt tests. In this study, the shapes of core blocks are classified into three representative shapes and those are created using plaster. Using the various shaped artificial cores, a set of tilt tests is carried out to identify the shape influences on the normal stress and the basic friction angle in tilt tests. The test results propose a normal stress reduction function to estimate the normal stress for tilt tests according to the sample shapes based on Barton's empirical equation. The proposed normal stress reduction functions are verified by tilt tests using artificial plaster joints and real rock joint sets. The plaster joint sets are well matched and cast in detailed printed moulds using a 3D printing technique. With the application of the functions, the obtained JRC values from the tilt tests using the plaster samples and the natural rock samples are distributed within a reasonable JRC range when compared with the measured values.
Sex differences in normal age trajectories of functional brain networks.

Science.gov (United States)

Scheinost, Dustin; Finn, Emily S; Tokoglu, Fuyuze; Shen, Xilin; Papademetris, Xenophon; Hampson, Michelle; Constable, R Todd

2015-04-01

Resting-state functional magnetic resonance image (rs-fMRI) is increasingly used to study functional brain networks. Nevertheless, variability in these networks due to factors such as sex and aging is not fully understood. This study explored sex differences in normal age trajectories of resting-state networks (RSNs) using a novel voxel-wise measure of functional connectivity, the intrinsic connectivity distribution (ICD). Males and females showed differential patterns of changing connectivity in large-scale RSNs during normal aging from early adulthood to late middle-age. In some networks, such as the default-mode network, males and females both showed decreases in connectivity with age, albeit at different rates. In other networks, such as the fronto-parietal network, males and females showed divergent connectivity trajectories with age. Main effects of sex and age were found in many of the same regions showing sex-related differences in aging. Finally, these sex differences in aging trajectories were robust to choice of preprocessing strategy, such as global signal regression. Our findings resolve some discrepancies in the literature, especially with respect to the trajectory of connectivity in the default mode, which can be explained by our observed interactions between sex and aging. Overall, results indicate that RSNs show different aging trajectories for males and females. Characterizing effects of sex and age on RSNs are critical first steps in understanding the functional organization of the human brain. © 2014 Wiley Periodicals, Inc.
Effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer

Directory of Open Access Journals (Sweden)

Qi Pan

2017-09-01

Full Text Available Objective: To investigate the effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer. Methods: A total of 90 breast cancer patients in our hospital were randomly divided into control group (45 cases and observation group (45 cases. The two groups received CAF chemotherapy, and the observation group was additionally given Kanglaite injection (200 mL/d for 2 weeks continuously. Both groups had chemotherapy for 6 courses. The effect on myelosuppression, immune function and tumor markers levels was detected and compared before and after treatment in two groups. Results: After treatment, myelosuppression was found in both groups, and the levels of leukocyte, hemoglobin and platelet decreased significantly compared with before treatment (P0.05, and the levels of immune function indexes (CD3+, CD4+, CD4+/ CD8+ of the observation group were significantly higher than those in the control group （P<0.05） . After treatment, the levels of two tumor markers (CEA, CA15-3 decreased significantly than before treatment in both groups (P<0.05, and the decrease amplitude in the observation group was higher than that in the control group (P<0.05. Conclusions: Kanglaite combined with chemotherapy has evident therapeutic effect on breast cancer. It can alleviate the myelosuppression caused by chemotherapy, improve immune function, and reduce the concentration of tumor markers in patients with breast cancer.

Toxic effects of dietary methylmercury on immune function and hematology in American kestrels (Falco sparverius)

Science.gov (United States)

Fallacara, Dawn M.; Halbrook, Richard S.; French, John B.

2011-01-01

Fifty-nine adult male American kestrels (Falco sparverius) were assigned to one of three diet formulations including 0 (control), 0.6, and 3.9 μg/g (dry wt) methylmercury (MeHg). Kestrels received their diets daily for 13 weeks to assess the effects of dietary MeHg on immunocompetence. Immunotoxic endpoints included assessment of cell-mediated immunity (CMI) using the phytohemagglutinin (PHA) skin-swelling assay and primary and secondary antibody-mediated immune responses (IR) via the sheep red blood cell (SRBC) hemagglutination assay. Select hematology and histology parameters were evaluated to corroborate the results of functional assays and to assess immunosuppression of T and B cell-dependent components in spleen tissue. Kestrels in the 0.6 and 3.9 μg/g MeHg groups exhibited suppression of CMI, including lower PHA stimulation indexes (p = 0.019) and a 42 to 45% depletion of T cell-dependent splenic lymphoid tissue (p = 0.006). Kestrels in the 0.6 μg/g group exhibited suppression of the primary IR to SRBCs (p = 0.014). MeHg did not have a noticeable effect on the secondary IR (p = 0.166). Elevation of absolute heterophil counts (p p p = 0.003) was apparent in the 3.9 μg/g group at week 12. Heterophilia, or the excess of heterophils in peripheral blood above normal ranges, was apparent in seven of 17 (41%) kestrels in the 3.9 μg/g group and was indicative of an acute inflammatory response or physiological stress. This study revealed that adult kestrels were more sensitive to immunotoxic effects of MeHg at environmentally relevant dietary concentrations than they were to reproductive effects as previously reported.
Role of endothelial function in coronary slow-flow phenomenon with angiographically normal coronaries

Directory of Open Access Journals (Sweden)

Srikanth Nathani

2016-01-01

Conclusion: Coronary slow flow phenomenon is a marker of atherosclerosis (as documented by carotid intima media thickness and our study has also shown that endothelial function is significantly impaired in patients with coronary slow flow (as documented by impaired endothelial dependent vasodilatation than that of patients with normal epicardial coronaries with normal flow.
Gemfibrozil-induced myositis in a patient with normal renal function.

Science.gov (United States)

Hahn, Martin; Sriharan, Kalavally; McFarland, M Shawn

2010-01-01

To describe a case of gemfibrozil monotherapy-induced myositis in a patient with normal renal function A 68-year-old white man presented to his primary care clinic complaining of a 6-month history of total body pain. His past medical history was significant for hypertension, diabetes mellitus, hyperlipidemia, gastroesophageal reflux disease, benign prostatic hypertrophy, arthritis, impotence, and pancreatic cancer that required excision of part of his pancreas. His home drug regimen included bupropion 75 mg twice daily, gemfibrozil 600 mg twice daily for the past 8 months, glimiperide 1 mg daily, insulin glargine 5 units at bedtime, insulin aspart 5 units in the evening, lisinopril 10 mg daily, omeprazole 40 mg daily, pregabalin 100 mg daily, and sildenafil 100 mg as needed. Laboratory test results were significant for elevated aspartate aminotransferase (AST) 78 U/L (reference range 15-46 U/L), alanine aminotransferase (ALT) 83 U/L (13-69 U/L), and creatine kinase (CK) 3495 U/L (55-170 U/L). Serum creatinine was normal at 1.19 mg/dL. The physician determined that the elevated CK indicated myositis secondary to gemfibrozil use, and gemfibrozil was subsequently discontinued. The patient returned 1 week later to repeat the laboratory tests. Results were CK 220 U/L, AST 26 U/L, ALT 43 U/L, and serum creatinine 1.28 mg/dL. The patient was asked to return in 3 weeks to repeat the laboratory tests. At that time, CK had continued to decrease to 142 U/L, and the AST and ALT had returned to normal, at 22 and 29 U/L, respectively. The patient reported complete resolution of total body pain 3 weeks after discontinuation of gemfibrozil. Follow-up 5 weeks after discontinuation revealed no change compared to the 3-week follow-up. Myositis most often produces weakness and elevated CK levels more than 10 times the upper limit of normal. The risk of developing myositis, myopathy, or rhabdomyolysis is low (1%) when fibrates such as gemfibrozil are used as monotherapy. Evaluation of
Zinc and immunity: An essential interrelation.

Science.gov (United States)

Maares, Maria; Haase, Hajo

2016-12-01

The significance of the essential trace element zinc for immune function has been known for several decades. Zinc deficiency affects immune cells, resulting in altered host defense, increased risk of inflammation, and even death. The micronutrient zinc is important for maintenance and development of immune cells of both the innate and adaptive immune system. A disrupted zinc homeostasis affects these cells, leading to impaired formation, activation, and maturation of lymphocytes, disturbed intercellular communication via cytokines, and weakened innate host defense via phagocytosis and oxidative burst. This review outlines the connection between zinc and immunity by giving a survey on the major roles of zinc in immune cell function, and their potential consequences in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.
Widespread immunological functions of mast cells: fact or fiction?

Science.gov (United States)

Rodewald, Hans-Reimer; Feyerabend, Thorsten B

2012-07-27

Immunological functions of mast cells are currently considered to be much broader than the original role of mast cells in IgE-driven allergic disease. The spectrum of proposed mast cell functions includes areas as diverse as the regulation of innate and adaptive immune responses, protective immunity against viral, microbial, and parasitic pathogens, autoimmunity, tolerance to graft rejection, promotion of or protection from cancer, wound healing, angiogenesis, cardiovascular diseases, diabetes, obesity, and others. The vast majority of in vivo mast cell data have been based on mast cell-deficient Kit mutant mice. However, work in new mouse mutants with unperturbed Kit function, which have a surprisingly normal immune system, has failed to corroborate some key immunological aspects, formerly attributed to mast cells. Here, we consider the implications of these recent developments for the state of the field as well as for future work, aiming at deciphering the physiological functions of mast cells. Copyright © 2012 Elsevier Inc. All rights reserved.
Quality and Timing of Stressors Differentially Impact on Brain Plasticity and Neuroendocrine-Immune Function in Mice

Directory of Open Access Journals (Sweden)

Sara Capoccia

2013-01-01

Full Text Available A growing body of evidence suggests that psychological stress is a major risk factor for psychiatric disorders. The basic mechanisms are still under investigation but involve changes in neuroendocrine-immune interactions, ultimately affecting brain plasticity. In this study we characterized central and peripheral effects of different stressors, applied for different time lengths, in adult male C57BL/6J mice. We compared the effects of repeated (7 versus 21 days restraint stress (RS and chronic disruption of social hierarchy (SS on neuroendocrine (corticosterone and immune function (cytokines and splenic apoptosis and on a marker of brain plasticity (brain-derived neurotrophic factor, BDNF . Neuroendocrine activation did not differ between SS and control subjects; by contrast, the RS group showed a strong neuroendocrine response characterized by a specific time-dependent profile. Immune function and hippocampal BDNF levels were inversely related to hypothalamic-pituitary-adrenal axis activation. These data show a fine modulation of the crosstalk between central and peripheral pathways of adaptation and plasticity and suggest that the length of stress exposure is crucial to determine its final outcome on health or disease.
Structural and functional perspectives on classification and seriation in psychotic and normal children.

Science.gov (United States)

Breslow, L; Cowan, P A

1984-02-01

This study describes a strategy for examining cognitive functioning in psychotic and normal children without the usual confounding effects of marked differences in cognitive structure that occur when children of the same age are compared. Participants were 14 psychotic children, 12 males and 2 females, mean age 9-2, matched with normal children at preoperational and concrete operational stage levels on a set of Piagetian classification tasks. The mean age of the normal children was 6-4, replicating the usually found developmental delay in psychotic samples. Participants were then compared on both structural level and functional abilities on a set of tasks involving seriation of sticks; the higher-level children were also administered a seriation drawing task. Analysis of children's processes of seriating and seriation drawings indicated that over and above the structural retardation, psychotic children at all levels showed functional deficits, especially in the use of anticipatory imagery. The implications for general developmental theory are that progress in structural development is not sufficient for imaginal development, and that structural development of logical concepts is relatively independent of the development of imagery. It was suggested that "thought disorder" may not be a disordered structure of thinking or a retardation in psychotic populations but rather a mismatch between higher-level logical structures and lower-level functions.
In vitro immune functions in thiamine-replete and -depleted lake trout (Salvelinus namaycush)

Science.gov (United States)

Ottinger, Christopher A.; Honeyfield, Dale C.; Densmore, Christine L.; Iwanowicz, Luke R.

2014-01-01

In this study we examined the impacts of in vivo thiamine deficiency on lake trout leukocyte function measured in vitro. When compared outside the context of individual-specific thiamine concentrations no significant differences were observed in leukocyte bactericidal activity or in concanavalin A (Con A), and phytohemagglutinin-P (PHA-P) stimulated leukocyte proliferation. Placing immune functions into context with the ratio of in vivo liver thiamine monophosphate (TMP – biologically inactive form) to thiamine pyrophosphate (TPP – biologically active form) proved to be the best indicator of thiamine depletion impacts as determined using regression modeling. These observed relationships indicated differential effects on the immune measures with bactericidal activity exhibiting an inverse relationship with TMP to TPP ratios, Con A stimulated mitogenesis exhibiting a positive relationship with TMP to TPP ratios and PHA-P stimulated mitogenesis exhibiting no significant relationships. In addition, these relationships showed considerable complexity which included the consistent observation of a thiamine-replete subgroup with characteristics similar to those seen in the leukocytes from thiamine-depleted fish. When considered together, our observations indicate that lake trout leukocytes experience cell-type specific impacts as well as an altered physiologic environment when confronted with a thiamine-limited state.
Anti-Tribbles Pseudokinase 2 (TRIB2)-Immunization Modulates Hypocretin/Orexin Neuronal Functions.

Science.gov (United States)

Tanaka, Susumu; Honda, Yoshiko; Honda, Makoto; Yamada, Hisao; Honda, Kazuki; Kodama, Tohru

2017-01-01

Recent findings showed that 16%-26% of narcolepsy patients were positive for anti-tribbles pseudokinase 2 (TRIB2) antibody, and the intracerebroventricular administration of immunoglobulin-G purified from anti-TRIB2 positive narcolepsy patients caused hypocretin/orexin neuron loss. We investigated the pathophysiological role of TRIB2 antibody using TRIB2-immunized rats and hypocretin/ataxin-3 transgenic (ataxin-3) mice. Plasma, cerebrospinal fluid (CSF), and hypothalamic tissues from TRIB2-immunized rats were collected. Anti-TRIB2 titers, hypocretin contents, mRNA expressions, the cell count of hypocretin neurons, and immunoreactivity of anti-TRIB2 antibodies on hypocretin neurons were investigated. The plasma from ataxin-3 mice was also used to determine the anti-TRIB2 antibody titer changes following the loss of hypocretin neurons. TRIB2 antibody titers increased in the plasma and CSF of TRIB2-immunized rats. The hypothalamic tissue immunostained with the sera from TRIB2-immunized rats revealed positive signals in the cytoplasm of hypcretin neurons. While no changes were found regarding hypothalamic hypocretin contents or cell counts, but there were significant decreases of the hypocretin mRNA level and release into the CSF. The plasma from over 26-week-old ataxin-3 mice, at the advanced stage of hypocretin cell destruction, showed positive reactions against TRIB2 antigen, and positive plasma also reacted with murine hypothalamic hypocretin neurons. Our results suggest that the general activation of the immune system modulates the functions of hypocretin neurons. The absence of a change in hypocretin cell populations suggested that factors other than anti-TRIB2 antibody play a part in the loss of hypocretin neurons in narcolepsy. The increased anti-TRIB2 antibody after the destruction of hypocretin neurons suggest that anti-TRIB2 antibody in narcolepsy patients is the consequence rather than the inciting cause of hypocretin cell destruction. © Sleep Research
Normalization of the collage regions of iterated function systems

Science.gov (United States)

Zhang, Zhengbing; Zhang, Wei

2012-11-01

Fractal graphics, generated with iterated function systems (IFS), have been applied in broad areas. Since the collage regions of different IFS may be different, it is difficult to respectively show the attractors of iterated function systems in a same region on a computer screen using one program without modifying the display parameters. An algorithm is proposed in this paper to solve this problem. A set of transforms are repeatedly applied to modify the coefficients of the IFS so that the collage region of the resulted IFS changes toward the unit square. Experimental results demonstrate that the collage region of any IFS can be normalized to the unit square with the proposed method.
Studies on the protection effects of functional foods for skin immune system from radiation damage

International Nuclear Information System (INIS)

Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In

2007-07-01

We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. · Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment · Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice · Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells · Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-α, GM-CSF) - Inhibition of c-kit, tryptase, FcεRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery
Immune Abnormalities in Fontan Protein-Losing Enteropathy: A Case-Control Study.

Science.gov (United States)

Magdo, H Sonali; Stillwell, Terri L; Greenhawt, Matthew J; Stringer, Kathleen A; Yu, Sunkyung; Fifer, Carlen G; Russell, Mark W; Schumacher, Kurt R

2015-08-01

To comprehensively characterize the immunologic characteristics of patients with protein-losing enteropathy (PLE) post-Fontan and compare them with patients without PLE post-Fontan. Patients with PLE post-Fontan and age-matched controls post-Fontan were prospectively studied with laboratory markers of immune function. Infectious history was obtained by interview and chart review. The groups' demographics, cardiac history, immune characteristics, and infection history were compared using appropriate 2-group statistics. A total of 16 patients enrolled (8 patients with PLE and 8 controls). All patients with PLE had lymphopenia compared with 25% of controls (P = .01). All patients with PLE had markedly depressed CD4 T cell counts (median 58 cells/μL) compared with controls (median 450 cells/μL, P = .0002); CD4% was also low in the PLE group (12.3%) and normal in control (36.9%, P = .004). Both groups had mildly depressed CD8 T cells and normal to slightly elevated natural killer and B-cell subsets. A majority of patients with PLE (62.5%) had negative titers to measles, mumps, and rubella vaccination, compared with no control Fontan with a negative titer (P = .03). Despite profoundly low CD4 counts, the frequency of infection was not different between groups with no reported opportunistic infections. Patients with Fontan-associated PLE have extensive quantitative immune abnormalities, particularly CD4 deficiency. These immune abnormalities are similar to those found in non-Fontan patients with PLE caused by intestinal lymphangiectasia. Copyright © 2015 Elsevier Inc. All rights reserved.
Closed-form confidence intervals for functions of the normal mean and standard deviation.

Science.gov (United States)

Donner, Allan; Zou, G Y

2012-08-01

Confidence interval methods for a normal mean and standard deviation are well known and simple to apply. However, the same cannot be said for important functions of these parameters. These functions include the normal distribution percentiles, the Bland-Altman limits of agreement, the coefficient of variation and Cohen's effect size. We present a simple approach to this problem by using variance estimates recovered from confidence limits computed for the mean and standard deviation separately. All resulting confidence intervals have closed forms. Simulation results demonstrate that this approach performs very well for limits of agreement, coefficients of variation and their differences.
A pro-inflammatory effect of foot and mouth disease vírus on immune and non immune guinea pigs

Directory of Open Access Journals (Sweden)

Helio José Montassier

1992-12-01

Full Text Available The O1Campos strain of foot and mouth disease virus (FMDV used as inducing agent in the pleurisy model was able to trigger a pro-inflammatory effect on normal and immune guinea pigs. The proinflammatory activity which was detected at two times of the pleurisy (24 and 48 hours on normal guinea pigs was characterized only by mononuclear (MN cell influx, during the first interval of the reaction and by edematogenic effect, MN and polimorphonuclcar (PMN leucocyte migration, at the last time of the reaction. The inflammatory reaction profiles recorded on immune guinea pigs (vaccinated with anti-O1Campos oil adjuvanted vaccine, both after 7 and 30 days post vaccination (pv have showed, in both interval, lower intensities than that observed in normal guinea pigs, although in the 7 days PV guinea pigs the accumulations of total leucocytes and PMN were similar to that displayed by normal animals, after 48 hours of the reaction. Besides, on thirty days PV guinea pigs the FMDV induced a significant increase in volume of exudate and MN cell infiltration, after 24 hours, and all of the inflammatory parameters values dropped to normal levels, during the second interval of the reaction. It was found a negative association between the increase in serum neutralizing antibody titer, from 7 to 30 days PV and the intensities of pleural inflammatory parameters on the immune guinea pigs. The pleurisy test revealed itself feasible to evaluate the pro-inflammatory activity of FMDV.
Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

Science.gov (United States)

Simi, S; Peter, Valsa S; Peter, M C Subhash

2017-09-15

Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential
The multifaceted functions of C/EBPα in normal and malignant haematopoiesis.

Science.gov (United States)

Ohlsson, E; Schuster, M B; Hasemann, M; Porse, B T

2016-04-01

The process of blood formation, haematopoiesis, depends upon a small number of haematopoietic stem cells (HSCs) that reside in the bone marrow. Differentiation of HSCs is characterised by decreased expression of genes associated with self-renewal accompanied by a stepwise activation of genes promoting differentiation. Lineage branching is further directed by groups of cooperating and counteracting genes forming complex networks of lineage-specific transcription factors. Imbalances in such networks can result in blockage of differentiation, lineage reprogramming and malignant transformation. CCAAT/enhancer-binding protein-α (C/EBPα) was originally identified 30 years ago as a transcription factor that binds both promoter and enhancer regions. Most of the early work focused on the role of C/EBPα in regulating transcriptional processes as well as on its functions in key differentiation processes during liver, adipogenic and haematopoietic development. Specifically, C/EBPα was shown to control differentiation by its ability to coordinate transcriptional output with cell cycle progression. Later, its role as an important tumour suppressor, mainly in acute myeloid leukaemia (AML), was recognised and has been the focus of intense studies by a number of investigators. More recent work has revisited the role of C/EBPα in normal haematopoiesis, especially its function in HSCs, and also started to provide more mechanistic insights into its role in normal and malignant haematopoiesis. In particular, the differential actions of C/EBPα isoforms, as well as its importance in chromatin remodelling and cellular reprogramming, are beginning to be elucidated. Finally, recent work has also shed light on the dichotomous function of C/EBPα in AML by demonstrating its ability to act as both a tumour suppressor and promoter. In the present review, we will summarise the current knowledge on the functions of C/EBPα during normal and malignant haematopoiesis with special emphasis on
Hepatitis B virus surface antigen impairs myeloid dendritic cell function: a possible immune escape mechanism of hepatitis B virus

Science.gov (United States)

Op den Brouw, Marjoleine L; Binda, Rekha S; van Roosmalen, Mark H; Protzer, Ulrike; Janssen, Harry L A; van der Molen, Renate G; Woltman, Andrea M

2009-01-01

Chronic hepatitis B virus (HBV) infection is the result of an inadequate immune response towards the virus. Myeloid dendritic cells (mDC) of patients with chronic HBV are impaired in their maturation and function, resulting in more tolerogenic rather than immunogenic responses, which may contribute to viral persistence. The mechanism responsible for altered mDC function remains unclear. The HBV-infected patients display large amounts of HBV particles and viral proteins in their circulation, especially the surface antigen HBsAg, which allows multiple interactions between the virus, its viral proteins and DC. To assess whether HBV directly influences mDC function, the effects of HBV and HBsAg on human mDC maturation and function were investigated in vitro. As already described for internalization of HBV by DC, the present study shows that peripheral blood-derived mDC of healthy controls also actively take up HBsAg in a time-dependent manner. Cytokine-induced maturation in the presence of HBV or HBsAg resulted in a significantly more tolerogenic mDC phenotype as demonstrated by a diminished up-regulation of costimulatory molecules and a decreased T-cell stimulatory capacity, as assessed by T-cell proliferation and interferon-γ production. In addition, the presence of HBV significantly reduced interleukin-12 production by mDC. These results show that both HBV particles and purified HBsAg have an immune modulatory capacity and may directly contribute to the dysfunction of mDC in patients with chronic HBV. The direct immune regulatory effect of HBV and circulating HBsAg particles on the function of DC can be considered as part of the mechanism by which HBV escapes immunity. PMID:18624732
[Changes in serum YKL-40 level and humoral immune function and their significance in children with recurrent pneumonia].

Science.gov (United States)

Ma, Wei-Yin; Peng, Shao; Zhang, Ting

2017-04-01

To investigate the changes in serum YKL-40 level and humoral immune function and their significance in children with recurrent pneumonia. Blood samples were collected from 30 children with recurrent pneumonia (recurrent pneumonia group), 30 children with acute pneumonia (acute pneumonia group), and 30 healthy children (control group). Serum YKL-40 levels were measured by enzyme-linked immunosorbent assay. The correlation between serum YKL-40 level and laboratory indices related to humoral immune function was analyzed. The receiver operating characteristic (ROC) curve was used to analyze the diagnostic value of serum YKL-40 level for recurrent pneumonia. The recurrent pneumonia group had a significantly higher serum YKL-40 level than the acute pneumonia and control groups (Ppneumonia group had a significantly higher serum YKL-40 level than the control group (Ppneumonia group were significantly lower than in the acute pneumonia group (Ppneumonia was 0.958 (95%CI: 0.921-0.994). Humoral immune function is low in children with recurrent pneumonia. Serum YKL-40 may be involved in the occurrence of recurrent pneumonia and can be used as a reference index for diagnosing recurrent pneumonia.
CMV immune evasion and manipulation of the immune system with aging.

Science.gov (United States)

Jackson, Sarah E; Redeker, Anke; Arens, Ramon; van Baarle, Debbie; van den Berg, Sara P H; Benedict, Chris A; Čičin-Šain, Luka; Hill, Ann B; Wills, Mark R

2017-06-01

Human cytomegalovirus (HCMV) encodes numerous proteins and microRNAs that function to evade the immune response and allow the virus to replicate and disseminate in the face of a competent innate and acquired immune system. The establishment of a latent infection by CMV, which if completely quiescent at the level of viral gene expression would represent an ultimate in immune evasion strategies, is not sufficient for lifelong persistence and dissemination of the virus. CMV needs to reactivate and replicate in a lytic cycle of infection in order to disseminate further, which occurs in the face of a fully primed secondary immune response. Without reactivation, latency itself would be redundant for the virus. It is also becoming clear that latency is not a totally quiescent state, but is characterized by limited viral gene expression. Therefore, the virus also needs immune evasion strategies during latency. An effective immune response to CMV is required or viral replication will cause morbidity and ultimately mortality in the host. There is clearly a complex balance between virus immune evasion and host immune recognition over a lifetime. This poses the important question of whether long-term evasion or manipulation of the immune response driven by CMV is detrimental to health. In this meeting report, three groups used the murine model of CMV (MCMV) to examine if the contribution of the virus to immune senescence is set by the (i) initial viral inoculum, (ii) inflation of T cell responses, (iii) or the balance between functionally distinct effector CD4+ T cells. The work of other groups studying the CMV response in humans is discussed. Their work asks whether the ability to make immune responses to new antigens is compromised by (i) age and HCMV carriage, (ii) long-term exposure to HCMV giving rise to an overall immunosuppressive environment and increased levels of latent virus, or (iii) adapted virus mutants (used as potential vaccines) that have the capacity to
Neutron importance and the generalized Green function for the conventionally critical reactor with normalized neutron distribution

International Nuclear Information System (INIS)

Khromov, V.V.

1978-01-01

The notion of neutron importance when applied to nuclear reactor statics problems described by time-independent homogeneous equations of neutron transport with provision for normalization of neutron distribution is considered. An equation has been obtained for the function of neutron importance in a conditionally critical reactor with respect to an arbitrary nons linear functional determined for the normalized neutron distribution. Relation between this function and the generalized Green function of the selfconjugated operator of the reactor equation is determined and the formula of small perturbations for the functionals of a conditionally critical reactor is deduced

The relationship of theory of mind and executive functions in normal, deaf and cochlear-implanted children

Directory of Open Access Journals (Sweden)

Farideh Nazarzadeh

2014-08-01

Full Text Available Background and Aim : Theory of mind refers to the ability to understand the others have mental states that can be different from one's own mental states or facts. This study aimed to investigate the relationship of theory of mind and executive functions in normal hearing, deaf, and cochlear-implanted children.Methods: The study population consisted of normal, deaf and cochlear-implanted girl students in Mashhad city, Iran. Using random sampling, 30 children (10 normal, 10 deaf and 10 cochlear-implanted in age groups of 8-12 years old were selected. To measure the theoty of mind, theory of mind 38-item scale and to assess executive function, Coolidge neuropsychological and personality test was used. Research data were analyzed using the Spearman correlation coefficient, analysis of variance and Kruskal-Wallis tests.Results: There was a significant difference between the groups in the theory of mind and executive function subscales, organization, planning-decision-making, and inhibition. Between normal and deaf groups (p=0.01, as well as cochlear-implanted and deaf groups (p=0.01, there was significant difference in planning decision-making subscale. There was not any significant relationship between the theory of mind and executive functions generally or the theory of mind and executive function subscales in these three groups independently.Conclusion: Based on our findings, cochlear-implanted and deaf children have lower performance in theory of mind and executive function compared with normal hearing children.
A preliminary evaluation of immune stimulation following exposure to metal particles and ions using the mouse popliteal lymph node assay

Energy Technology Data Exchange (ETDEWEB)

Tvermoes, Brooke E., E-mail: brooke.tvermoes@cardno.com [Cardno ChemRisk, LLC., 4940 Pearl East Circle Suite 100, Boulder, CO 80301 (United States); Unice, Kenneth M. [Cardno ChemRisk, LLC., 20 Stanwix St. Suite 505, Pittsburgh, PA 15222 (United States); Winans, Bethany [Cardno ChemRisk, LLC., 101 2nd St. Suite 700, San Francisco, CA 94105 (United States); Kovochich, Michael [Cardno ChemRisk, LLC., 130 Vantis Suite 170, Aliso Viejo, CA 92656 (United States); Christian, Whitney V. [Cardno ChemRisk, LLC., 20 Stanwix St. Suite 505, Pittsburgh, PA 15222 (United States); Donovan, Ellen [Cardno ChemRisk, LLC., 101 2nd St. Suite 700, San Francisco, CA 94105 (United States); Fung, Ernest S. [Cardno ChemRisk, LLC., 130 Vantis Suite 170, Aliso Viejo, CA 92656 (United States); Finley, Brent L. [Cardno ChemRisk, LLC., 101 2nd St. Suite 700, San Francisco, CA 94105 (United States); Kimber, Ian [University of Manchester, Faculty of Life Sciences, Oxford Road, Manchester M13 9PT (United Kingdom); Paustenbach, Dennis J. [Cardno ChemRisk, LLC., 101 2nd St. Suite 700, San Francisco, CA 94105 (United States)

2016-10-01

The objective of this preliminary study was to evaluate the threshold for immune stimulation in mice following local exposure to metal particles and ions representative of normal-functioning cobalt-chromium (CoCr) metal-on-metal (MoM) hip implants. The popliteal lymph node assay (PLNA) was used in this study to assess immune responses in BALB/c mice following treatment with chromium-oxide (Cr{sub 2}O{sub 3}) particles, metal salts (CoCl{sub 2}, CrCl{sub 3} and NiCl{sub 2}), or Cr{sub 2}O{sub 3} particles together with metal salts using single-dose exposures representing approximately 10 days (0.000114 mg), 19 years (0.0800 mg), and 40 years (0.171 mg) of normal implant wear. The immune response elicited following treatment with Cr{sub 2}O{sub 3} particles together with metal salts was also assessed at four additional doses equivalent to approximately 1.5 months (0.0005 mg), 0.6 years (0.0025 mg), 2.3 years (0.01 mg), and 9.3 years (0.04 mg) of normal implant wear. Mice were injected subcutaneously (50 μL) into the right hind foot with the test article, or with the relevant vehicle control. The proliferative response of the draining lymph node cells (LNC) was measured four days after treatment, and stimulation indices (SI) were derived relative to vehicle controls. The PLNA was negative (SI < 3) for all Cr{sub 2}O{sub 3} particle doses, and was also negative at the lowest dose of the metal salt mixture, and the lowest four doses of the Cr{sub 2}O{sub 3} particles with metal salt mixture. The PLNA was positive (SI > 3) at the highest two doses of the metal salt mixture and the highest three doses of the Cr{sub 2}O{sub 3} particles with the metal salt mixture. The provisional NOAEL and LOAEL values identified in this study for immune activation corresponds to Co and Cr concentrations in the synovial fluid approximately 500 and 2000 times higher than that reported for normal-functioning MoM hip implants, respectively. Overall, these results indicate that normal wear
Stimulatory effect of low dose radiation on the immune function in tumor-bearing mice

International Nuclear Information System (INIS)

Zhang Ying; Li Xiujuan; Li Xiuyi; Liu Shuzheng

1999-01-01

Objective: The author aims at investigating the effect of whole body irradiation (WBI) with low dose radiation on immune function in tumor-bearing mice. Methods: C57BL/6J mine implanted with Lewis lung carcinoma cells in the right thighs were used as an experimental animal model. WBI with 75 mGy X-rays was given at the 10 th day after implantation and immunological parameters were detected 18 hours after irradiation. The immunological parameters included the spontaneous incorporation of 3 H-TdR into thymocytes, the number of splenocytes, the reaction of splenocytes to ConA and LPS, the splenic production of IL-2, the cytotoxic activities of natural killer (NK) and lymphokine activated killer cells (LAK) as well as specific cytotoxic T lymphocytes (CTL). Results: The immunological parameters of irradiated tumor-bearing mice were significantly increased compared with those of sham-irradiated tumor-bearing mice (P<0.05∼0.01). Conclusion: Low dose radiation could significantly increase the immune function of tumor-bearing mice, and this stimulatory effect may be of some potential significance in tumor therapy
Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

International Nuclear Information System (INIS)

Foley, P. T.; Kavnoudias, H.; Cameron, P. U.; Czarnecki, C.; Paul, E.; Lyon, S. M.

2015-01-01

PurposeTo compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels.Materials and MethodsPatients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population.ResultsOf the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation—a difference that could not be attributed to differences in age, grade of injury or residual splenic volume.ConclusionIgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function
Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

Energy Technology Data Exchange (ETDEWEB)

Foley, P. T., E-mail: pfoley@doctors.org.uk [The Canberra Hospital, Department of Medical Imaging (Australia); Kavnoudias, H., E-mail: h.kavnoudias@alfred.org.au [The Alfred Hospital, Radiology Research Unit, Radiology Department (Australia); Cameron, P. U., E-mail: paul.cameron@unimelb.edu.au [The Alfred Hospital, Infectious Diseases Unit (Australia); Czarnecki, C., E-mail: caroline.czarnecki@gmail.com [Royal Melbourne Hospital, Radiology Department (Australia); Paul, E., E-mail: eldho.paul@monash.edu [Monash University, Department of Epidemiology & Preventive Medicine, School of Public Health and Preventive Medicine, Alfred Hospital (Australia); Lyon, S. M., E-mail: lyonsey@optusnet.com.au [Melbourne Endovascular (Australia)

2015-10-15

PurposeTo compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels.Materials and MethodsPatients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population.ResultsOf the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation—a difference that could not be attributed to differences in age, grade of injury or residual splenic volume.ConclusionIgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function.
Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

Science.gov (United States)

Foley, P T; Kavnoudias, H; Cameron, P U; Czarnecki, C; Paul, E; Lyon, S M

2015-10-01

To compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels. Patients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population. Of the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation-a difference that could not be attributed to differences in age, grade of injury or residual splenic volume. IgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function.
Stressor Controllability and Immune Function

Science.gov (United States)

1986-10-17

susceptibility to infectious disease . In E. Kurstak, P. V. Morozov, & Z. P. Lipowski (Eds.), Viruses , immunity, and mental health. Plenum Press, in press. w...following inmunization . a. ELISA Procedure. We-Tsof a flat bottomed microtiter plate (NUNC, certified Immunopla.e I) were coated with KLH (0.2 mi/well, 0.5 mg...because the, rats were being infected with viruses and other agents tnat could alter proliferation. We thus began to purchase pathogen-free animals and
Good news-bad news: the Yin and Yang of immune privilege in the eye.

Science.gov (United States)

Forrester, John V; Xu, Heping

2012-01-01

The eye and the brain are prototypical tissues manifesting immune privilege (IP) in which immune responses to foreign antigens, particularly alloantigens are suppressed, and even completely inhibited. Explanations for this phenomenon are numerous and mostly reflect our evolving understanding of the molecular and cellular processes underpinning immunological responses generally. IP is now viewed as a property of many tissues and the level of expression of IP varies not only with the tissue but with the nature of the foreign antigen and changes in the limited conditions under which privilege can operate as a mechanism of immunological tolerance. As a result, IP functions normally as a homeostatic mechanism preserving normal function in tissues, particularly those with highly specialized function and limited capacity for renewal such as the eye and brain. However, IP is relatively easily bypassed in the face of a sufficiently strong immunological response, and the privileged tissues may be at greater risk of collateral damage because its natural defenses are more easily breached than in a fully immunocompetent tissue which rapidly rejects foreign antigen and restores integrity. This two-edged sword cuts its swathe through the eye: under most circumstances, IP mechanisms such as blood-ocular barriers, intraocular immune modulators, induction of T regulatory cells, lack of lymphatics, and other properties maintain tissue integrity; however, when these are breached, various degrees of tissue damage occur from severe tissue destruction in retinal viral infections and other forms of uveoretinal inflammation, to less severe inflammatory responses in conditions such as macular degeneration. Conversely, ocular IP and tumor-related IP can combine to permit extensive tumor growth and increased risk of metastasis thus threatening the survival of the host.
A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

Science.gov (United States)

Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

2012-09-21

Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.
Auto-immune hepatitis following delivery.

Science.gov (United States)

Saini, Vandana; Gupta, Mamta; Mishra, S K

2013-05-01

Auto-immune hepatitis first presenting in the early postpartum period is rare. Immunosuppressive effects of pregnancy result in delayed manifestation of auto-immune hepatitis, and in established cases, the spontaneous improvements are there. Auto-immune hepatitis should be considered in the differential diagnosis of liver dysfunction first presenting in the early postpartum period. A case of postpartum hepatitis of auto-immune aetiology is being presented here. It is disease of unknown aetiology, characterised by inflammation of liver (as evidenced by raised serum transaminases, presence of interface hepatitis on histological examination), hypergammaglobulinaemia (> 1.5 times normal), presence of auto-antibodies [(antinuclear antibodies (ANA)], smooth muscle antibody (SMA) and antibody to liver-kidney microsome type 1 (LKM1) in the absence of viral markers ie, hepatitis B (HBsAg) and C (AntiHCV) and excellent response to corticosteroid therapy.
Immune-Modulating Perspectives for Low Frequency Electromagnetic Fields in Innate Immunity

Directory of Open Access Journals (Sweden)

Maria Manuela Rosado

2018-03-01

Full Text Available In recent years, the effects of electromagnetic fields (EMFs on the immune system have received a considerable interest, not only to investigate possible negative health impact but also to explore the possibility to favorably modulate immune responses. To generate beneficial responses, the immune system should eradicate pathogens while “respecting” the organism and tolerating irrelevant antigens. According to the current view, damage-associated molecules released by infected or injured cells, or secreted by innate immune cells generate danger signals activating an immune response. These signals are also relevant to the subsequent activation of homeostatic mechanisms that control the immune response in pro- or anti-inflammatory reactions, a feature that allows modulation by therapeutic treatments. In the present review, we describe and discuss the effects of extremely low frequency (ELF-EMF and pulsed EMF on cell signals and factors relevant to the activation of danger signals and innate immunity cells. By discussing the EMF modulating effects on cell functions, we envisage the use of EMF as a therapeutic agent to regulate immune responses associated with wound healing.
Glioblastoma-infiltrated innate immune cells resemble M0 macrophage phenotype

Science.gov (United States)

Gabrusiewicz, Konrad; Rodriguez, Benjamin; Wei, Jun; Hashimoto, Yuuri; Healy, Luke M.; Maiti, Sourindra N.; Wang, Qianghu; Elakkad, Ahmed; Liebelt, Brandon D.; Yaghi, Nasser K.; Ezhilarasan, Ravesanker; Huang, Neal; Weinberg, Jeffrey S.; Prabhu, Sujit S.; Rao, Ganesh; Sawaya, Raymond; Langford, Lauren A.; Bruner, Janet M.; Fuller, Gregory N.; Bar-Or, Amit; Li, Wei; Colen, Rivka R.; Curran, Michael A.; Bhat, Krishna P.; Antel, Jack P.; Cooper, Laurence J.; Sulman, Erik P.; Heimberger, Amy B.

2016-01-01

Glioblastomas are highly infiltrated by diverse immune cells, including microglia, macrophages, and myeloid-derived suppressor cells (MDSCs). Understanding the mechanisms by which glioblastoma-associated myeloid cells (GAMs) undergo metamorphosis into tumor-supportive cells, characterizing the heterogeneity of immune cell phenotypes within glioblastoma subtypes, and discovering new targets can help the design of new efficient immunotherapies. In this study, we performed a comprehensive battery of immune phenotyping, whole-genome microarray analysis, and microRNA expression profiling of GAMs with matched blood monocytes, healthy donor monocytes, normal brain microglia, nonpolarized M0 macrophages, and polarized M1, M2a, M2c macrophages. Glioblastoma patients had an elevated number of monocytes relative to healthy donors. Among CD11b+ cells, microglia and MDSCs constituted a higher percentage of GAMs than did macrophages. GAM profiling using flow cytometry studies revealed a continuum between the M1- and M2-like phenotype. Contrary to current dogma, GAMs exhibited distinct immunological functions, with the former aligned close to nonpolarized M0 macrophages. PMID:26973881
Evidence of functional cell-mediated immune responses to nontypeable Haemophilus influenzae in otitis-prone children

Science.gov (United States)

Seppanen, Elke; Tan, Dino; Corscadden, Karli J.; Currie, Andrew J.; Richmond, Peter C.; Thornton, Ruth B.

2018-01-01

Otitis media (OM) remains a common paediatric disease, despite advances in vaccinology. Susceptibility to recurrent acute OM (rAOM) has been postulated to involve defective cell-mediated immune responses to common otopathogenic bacteria. We compared the composition of peripheral blood mononuclear cells (PBMC) from 20 children with a history of rAOM (otitis-prone) and 20 healthy non-otitis-prone controls, and assessed innate and cell-mediated immune responses to the major otopathogen nontypeable Haemophilus influenzae (NTHi). NTHi was a potent stimulator of inflammatory cytokine secretion from PBMC within 4 hours, with no difference in cytokine levels produced between PBMC from cases or controls. In the absence of antigen stimulation, otitis-prone children had more circulating Natural Killer (NK) cells (potitis-prone and non-otitis-prone children (potitis-prone children are functional and respond to NTHi. CD8+ T cells and NK cells from both cases and controls produced IFNγ in response to polyclonal stimulus (Staphylococcal enterotoxin B; SEB), with more IFNγ+ CD8+ T cells present in cases than controls (pOtitis-prone children had more circulating IFNγ-producing NK cells (potitis-prone children mounted innate and T cell-mediated responses to NTHi challenge that were comparable to healthy children. These data provide evidence that otitis-prone children do not have impaired functional cell mediated immunity. PMID:29621281
Functions of innate and acquired immune system are reduced in domestic pigeons (Columba livia domestica) given a low protein diet

Science.gov (United States)

Mabuchi, Yuko; Frankel, Theresa L.

2016-01-01

Racing pigeons are exposed to and act as carriers of diseases. Dietary protein requirement for their maintenance has not been determined experimentally despite their being domesticated for over 7000 years. A maintenance nitrogen (protein) requirement (MNR) for pigeons was determined in a balance study using diets containing 6, 10 and 14% crude protein (CP). Then, the effects of feeding the diets were investigated to determine whether they were adequate to sustain innate and acquired immune functions. Nitrogen intake from the 6% CP diet was sufficient to maintain nitrogen balance and body weight in pigeons. However, the immune functions of phagocytosis, oxidative burst and lymphocyte proliferation in pigeons fed this diet were reduced compared with those fed 10 and 14% CP diets. Pigeons given the 6 and 10% CP diets had lower antibody titres following inoculation against Newcastle disease (ND) than those on the 14% CP diet. A confounding factor found on autopsy was the presence of intestinal parasites in some of the pigeons given the 6 and 10% CP diets; however, none of the pigeons used to measure MNR or acquired immunity to ND were infested with parasites. In conclusion, neither the 6 nor 10% CP diets adequately sustained acquired immune function of pigeons. PMID:27069640
Role of the Ca2+-Calcineurin-Nuclear Factor of Activated T cell Pathway in Mitofusin-2-Mediated Immune Function of Jurkat Cells

Directory of Open Access Journals (Sweden)

Xiu-Ping Xu

2018-01-01

Conclusions: Our findings suggest that MFN2 may regulate T cell immune functions primarily through the Ca2+-calcineurin-NFAT pathway. MFN2 may represent a potential therapeutic target for T cell immune dysfunction-related diseases.
Loss of function JAK1 mutations occur at high frequency in cancers with microsatellite instability and are suggestive of immune evasion.

Science.gov (United States)

Albacker, Lee A; Wu, Jeremy; Smith, Peter; Warmuth, Markus; Stephens, Philip J; Zhu, Ping; Yu, Lihua; Chmielecki, Juliann

2017-01-01

Immune evasion is a well-recognized hallmark of cancer and recent studies with immunotherapy agents have suggested that tumors with increased numbers of neoantigens elicit greater immune responses. We hypothesized that the immune system presents a common selective pressure on high mutation burden tumors and therefore immune evasion mutations would be enriched in high mutation burden tumors. The JAK family of kinases is required for the signaling of a host of immune modulators in tumor, stromal, and immune cells. Therefore, we analyzed alterations in this family for the hypothesized signature of an immune evasion mutation. Here, we searched a database of 61,704 unique solid tumors for alterations in the JAK family kinases (JAK1/2/3, TYK2). We used The Cancer Genome Atlas and Cancer Cell Line Encyclopedia data to confirm and extend our findings by analyzing gene expression patterns. Recurrent frameshift mutations in JAK1 were associated with high mutation burden and microsatellite instability. These mutations occurred in multiple tumor types including endometrial, colorectal, stomach, and prostate carcinomas. Analyzing gene expression signatures in endometrial and stomach adenocarcinomas revealed that tumors with a JAK1 frameshift exhibited reduced expression of interferon response signatures and multiple anti-tumor immune signatures. Importantly, endometrial cancer cell lines exhibited similar gene expression changes that were expected to be tumor cell intrinsic (e.g. interferon response) but not those expected to be tumor cell extrinsic (e.g. NK cells). From these data, we derive two primary conclusions: 1) JAK1 frameshifts are loss of function alterations that represent a potential pan-cancer adaptation to immune responses against tumors with microsatellite instability; 2) The mechanism by which JAK1 loss of function contributes to tumor immune evasion is likely associated with loss of the JAK1-mediated interferon response.
Role of oxidants/inflammation in declining renal function in chronic kidney disease and normal aging.

Science.gov (United States)

Vlassara, Helen; Torreggiani, Massimo; Post, James B; Zheng, Feng; Uribarri, Jaime; Striker, Gary E

2009-12-01

Oxidant stress (OS) and inflammation increase in normal aging and in chronic kidney disease (CKD), as observed in human and animal studies. In cross-sectional studies of the US population, these changes are associated with a decrease in renal function, which is exhibited by a significant proportion of the population. However, since many normal adults have intact renal function, and longitudinal studies show that some persons maintain normal renal function with age, the link between OS, inflammation, and renal decline is not clear. In aging mice, greater oxidant intake is associated with increased age-related CKD and mortality, which suggests that interventions that reduce OS and inflammation may be beneficial for older individuals. Both OS and inflammation can be readily lowered in normal subjects and patients with CKD stage 3-4 by a simple dietary modification that lowers intake and results in reduced serum and tissue levels of advanced glycation end products. Diabetic patients, including those with microalbuminuria, have a decreased ability to metabolize and excrete oxidants prior to observable changes in serum creatinine. Thus, OS and inflammation may occur in the diabetic kidney at an early time. We review the evidence that oxidants in the diet directly lead to increased serum levels of OS and inflammatory mediators in normal aging and in CKD. We also discuss a simple dietary intervention that helps reduce OS and inflammation, an important and achievable therapeutic goal for patients with CKD and aging individuals with reduced renal function.
Efficacy of screening immune system function in at-risk newborns

OpenAIRE

Pavlovski, Christopher J

2014-01-01

This paper explores the introduction of a screening test to highlight impaired immune system status for newborn infants and its efficacy as a preventative clinical measure. Moreover, it is suggested that screening of the infantile immune system has the potential to highlight susceptibility to a range of infant and childhood diseases, bestowing an opportunity to introduce early intervention to reduce the incidence of these diseases. Development of the neonatal immune system is an important hea...
CT Densitometry of the Lung in Healthy Nonsmokers with Normal Pulmonary Function

Energy Technology Data Exchange (ETDEWEB)

Oh, Tack Sun; Chae, Eun Jin; Seo, Joon Beom; Jung, Young Ju; Oh, Yeon Mok; Lee, Sang Do [University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of)

2012-09-15

To investigate the upper normal limit of low attenuation area in healthy nonsmokers. A total of 36 nonsmokers with normal pulmonary function test underwent a CT scan. Six thresholds (-980 --930 HU) on inspiration CT and two thresholds (-950 and -910 HU) on expiration CT were used for obtaining low attenuation area. The mean lung density was obtained on both inspiration CT and expiration CT. Descriptive statistics of low attenuation area and the mean lung density, evaluation of difference of low attenuation area and the mean lung density in both sex and age groups, analysis of the relationship between demographic information and CT parameters were performed. Upper normal limit for low attenuation area was 12.96% on inspiration CT (-950 HU) and 9.48% on expiration CT (-910 HU). Upper normal limit for the mean lung density was -837.58 HU on inspiration CT and 686.82 HU on expiration CT. Low attenuation area and the mean lung density showed no significant differences in both sex and age groups. Body mass index (BMI) was negatively correlated with low attenuation area on inspiration CT (-950 HU, r = -0.398, p = 0.016) and positively correlated with the mean lung density on inspiration CT (r 0.539, p = 0.001) and expiration CT (r = 0.432, p = 0.009). Age and body surface area were not correlated with low attenuation area or the mean lung density. Low attenuation area on CT densitometry of the lung could be found in healthy nonsmokers with normal pulmonary function, and showed negative association with BMI. Reference values, such as range and upper normal limit for low attenuation area in healthy subjects could be helpful in quantitative analysis and follow up of early emphysema, using CT densitometry of the lung.
Effects of in ovo exposure to PCBs (coplanar congener, kanechlor mixture, hydroxylated metabolite) on the developing cell-mediated immunity in chickens

Energy Technology Data Exchange (ETDEWEB)

Hasegawa, J.; Matsuda, M.; Kawano, M.; Wakimoto, T. [Faculty of Agriculture, Ehime Univ., Matsuyama, Ehime (Japan); Kashima, Y. [Dept. of Hygiene, Yokohama City Univ. School of Medicine, Yokohama (Japan)

2004-09-15

Polychlorinated biphenyls (PCBs) are wide spread environmental contaminants and known to cause various adverse effects on health of human and wildlife. Immune system is one of the several targets for toxic effects of PCBs and its normal balance is often disrupted by the exposure of the compounds. For example, PCBs may induce immune suppression and result in increased susceptibility to bacterial and viral infections, or conversely, excessive immune enhancement may cause adverse outcomes including as autoimmune disease and anergy. Therefore immune function is regarded as one of an important endpoint in toxicological risk assessment. There are a number of studies shown that neonatal organisms perinatally exposed to polyhalogenated aromatic hydrocarbons (PHAHs) such as PCBs have severer effects on their immune system than adult. Dioxins and coplanar PCB congeners, structurally planar PHAHs are known to have high affinity for aryl hydrocarbon receptor (AhR). 2,3,7,8-tetrachlorinated dibenzo-p-dioxin (TCDD) have the strongest affinity among such compounds and these are considered to act on immune system through AhR. On the other hand, such as non-planar PCB congeners with low affinity for AhR, which are abundantly contained in commercial PCB preparations have non-additive (antagonistic) effects on immune function. Prenatal exposure of TCDD to rodent induced abnormal lymphoid development in the thymus and thymus-dependent immune functions were remarkably disturbed. Although several experimental studies in mammals have been carried out on the developmental immunotoxicity of PCBs, there are still limited information available on avian species. Thus in this study, prenatal exposure to low level of PCBs and the effects on the developing immune system were investigated with chicken as a model animal of avian species, especially it is focused on the cell-mediated immune function.

Functional Analysis of the Tomato Immune Receptor Ve1 through Domain Swaps with Its Non-Functional Homolog Ve2

Science.gov (United States)

Rovenich, Hanna; Song, Yin; Liebrand, Thomas W. H.; Masini, Laura; van den Berg, Grardy C. M.; Joosten, Matthieu H. A. J.; Thomma, Bart P. H. J.

2014-01-01

Resistance in tomato against race 1 strains of the fungal vascular wilt pathogens Verticillium dahliae and V. albo-atrum is mediated by the Ve locus. This locus comprises two closely linked inversely oriented genes, Ve1 and Ve2, which encode cell surface receptors of the extracellular leucine-rich repeat receptor-like protein (eLRR-RLP) type. While Ve1 mediates Verticillium resistance through monitoring the presence of the recently identified V. dahliae Ave1 effector, no functionality for Ve2 has been demonstrated in tomato. Ve1 and Ve2 contain 37 eLRRs and share 84% amino acid identity, facilitating investigation of Ve protein functionality through domain swapping. In this study it is shown that Ve chimeras in which the first thirty eLRRs of Ve1 were replaced by those of Ve2 remain able to induce HR and activate Verticillium resistance, and that deletion of these thirty eLRRs from Ve1 resulted in loss of functionality. Also the region between eLRR30 and eLRR35 is required for Ve1-mediated resistance, and cannot be replaced by the region between eLRR30 and eLRR35 of Ve2. We furthermore show that the cytoplasmic tail of Ve1 is required for functionality, as truncation of this tail results in loss of functionality. Moreover, the C-terminus of Ve2 fails to activate immune signaling as chimeras containing the C-terminus of Ve2 do not provide Verticillium resistance. Furthermore, Ve1 was found to interact through its C-terminus with the eLRR-containing receptor-like kinase (eLRR-RLK) interactor SOBIR1 that was recently identified as an interactor of eLRR-RLP (immune) receptors. Intriguingly, also Ve2 was found to interact with SOBIR1. PMID:24505431
Photoperiod history differentially impacts reproduction and immune function in adult Siberian hamsters.

Science.gov (United States)

Prendergast, Brian J; Pyter, Leah M

2009-12-01

Seasonal changes in numerous aspects of mammalian immune function arise as a result of the annual variation in environmental day length (photoperiod), but it is not known if absolute photoperiod or relative change in photoperiod drives these changes. This experiment tested the hypothesis that an individual's history of exposure to day length determines immune responses to ambiguous, intermediate-duration day lengths. Immunological (blood leukocytes, delayed-type hypersensitivity reactions [DTH]), reproductive, and adrenocortical responses were assessed in adult Siberian hamsters (Phodopus sungorus) that had been raised initially in categorically long (15-h light/day; 15L) or short (9L) photoperiods and were subsequently transferred to 1 of 7 cardinal experimental photoperiods between 9L and 15L, inclusive. Initial photoperiod history interacted with contemporary experimental photoperiods to determine reproductive responses: 11L, 12L, and 13L caused gonadal regression in hamsters previously exposed to 15L, but elicited growth in hamsters previously in 9L. In hamsters with a 15L photoperiod history, photoperiods history, DTH responses were largely unaffected by increases in day length. Enhancement and suppression of blood leukocyte concentrations occurred at 13L in hamsters with photoperiod histories of 15L and 9L, respectively; however, prior exposure to 9L imparted marked hysteresis effects, which suppressed baseline leukocyte concentrations. Cortisol concentrations were only enhanced in 15L hamsters transferred to 9L and, in common with DTH, were unaffected by photoperiod treatments in hamsters with a 9L photoperiod history. Photoperiod history acquired in adulthood impacts immune responses to photoperiod, but manifests in a markedly dissimilar fashion as compared to the reproductive system. Prior photoperiod exposure has an enduring impact on the ability of the immune system to respond to subsequent changes in day length.
Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin.

Science.gov (United States)

Li, Zhi; Gothard, Elizabeth; Coles, Mark C; Ambler, Carrie A

2018-01-01

In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s), by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.
A Simulated Heat Wave Has Diverse Effects on Immune Function and Oxidative Physiology in the Corn Snake (Pantherophis guttatus).

Science.gov (United States)

Stahlschmidt, Z R; French, S S; Ahn, A; Webb, A; Butler, M W

Animals will continue to encounter increasingly warm environments, including more frequent and intense heat waves. Yet the physiological consequences of heat waves remain equivocal, potentially because of variation in adaptive plasticity (reversible acclimation) and/or aspects of experimental design. Thus, we measured a suite of physiological variables in the corn snake (Pantherophis guttatus) after exposure to field-parameterized, fluctuating temperature regimes (moderate temperature and heat wave treatments) to address two hypotheses: (1) a heat wave causes physiological stress, and (2) thermal performance of immune function exhibits adaptive plasticity in response to a heat wave. We found little support for our first hypothesis because a simulated heat wave had a negative effect on body mass, but it also reduced oxidative damage and did not affect peak performance of three immune metrics. Likewise, we found only partial support for our second hypothesis. After exposure to a simulated heat wave, P. guttatus exhibited greater performance breadth and reduced temperature specialization (the standardized difference between peak performance and performance breadth) for only one of three immune metrics and did so in a sex-dependent manner. Further, a simulated heat wave did not elicit greater performance of any immune metric at higher temperatures. Yet a heat wave likely reduced innate immune function in P. guttatus because each metric of innate immune performance in this species (as in most vertebrates) was lower at elevated temperatures. Together with previous research, our study indicates that a heat wave may have complex, modest, and even positive physiological effects in some taxa.
Studies on the protection effects of functional foods for skin immune system from radiation damage

Energy Technology Data Exchange (ETDEWEB)

Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In [Sunchon National University, Sunchon (Korea, Republic of)

2007-07-15

We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. centre dot Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment centre dot Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice centre dot Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells centre dot Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-alpha, GM-CSF) - Inhibition of c-kit, tryptase, FcepsilonRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery
Immune regulation by microbiome metabolites.

Science.gov (United States)

Kim, Chang H

2018-03-22

Commensal microbes and the host immune system have been co-evolved for mutual regulation. Microbes regulate the host immune system, in part, by producing metabolites. A mounting body of evidence indicates that diverse microbial metabolites profoundly regulate the immune system via host receptors and other target molecules. Immune cells express metabolite-specific receptors such as P2X 7 , GPR41, GPR43, GPR109A, aryl hydrocarbon receptor precursor (AhR), pregnane X receptor (PXR), farnesoid X receptor (FXR), TGR5 and other molecular targets. Microbial metabolites and their receptors form an extensive array of signals to respond to changes in nutrition, health and immunological status. As a consequence, microbial metabolite signals contribute to nutrient harvest from diet, and regulate host metabolism and the immune system. Importantly, microbial metabolites bidirectionally function to promote both tolerance and immunity to effectively fight infection without developing inflammatory diseases. In pathogenic conditions, adverse effects of microbial metabolites have been observed as well. Key immune-regulatory functions of the metabolites, generated from carbohydrates, proteins and bile acids, are reviewed in this article. © 2018 John Wiley & Sons Ltd.
Therapeutic immunization with HIV-1 Tat reduces immune activation and loss of regulatory T-cells and improves immune function in subjects on HAART.

Directory of Open Access Journals (Sweden)

Barbara Ensoli

2010-11-01

Full Text Available Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4(+ T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002. Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002, served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4(+ and CD8(+ cellular activation (CD38 and HLA-DR together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4(+ T cells and B cells with reduction of CD8(+ T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4(+ and CD8(+ T cells were accompanied by increases of CD4(+ and CD8(+ T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite
ImprimatinC1, a novel plant immune-priming compound, functions as a partial agonist of salicylic acid.

Science.gov (United States)

Noutoshi, Yoshiteru; Jikumaru, Yusuke; Kamiya, Yuji; Shirasu, Ken

2012-01-01

Plant activators are agrochemicals that protect crops from pathogens. They confer durable resistance to a broad range of diseases by activating intrinsic immune mechanisms in plants. To obtain leads regarding useful compounds, we have screened a chemical library using an established method that allows selective identification of immune-priming compounds. Here, we report the characterisation of one of the isolated chemicals, imprimatinC1, and its structural derivative imprimatinC2. ImprimatinC1 functions as a weak analogue of salicylic acid (SA) and activates the expression of defence-related genes. However, it lacks antagonistic activity toward jasmonic acid. Structure-activity relationship analysis suggests that imprimatinC1 and C2 can be metabolised to 4-chlorobenzoic acid and 3,4-chlorobenzoic acid, respectively, to function in Arabidopsis. We also found that imprimatinC1 and C2 and their potential functional metabolites acted as partial agonists of SA. Thus, imprimatinC compounds could be useful tools for dissecting SA-dependent signal transduction pathways.
Placental immune editing switch (PIES): learning about immunomodulatory pathways from a unique case report

Science.gov (United States)

Bronchud, Miguel H.; Tresserra, Francesc; Xu, Wenjie; Warren, Sarah; Cusido, Maite; Zantop, Bernat; Zenclussen, Ana Claudia; Cesano, Alessandra

2016-01-01

The hypothesis of this work is that, in order to escape the natural immune surveillance mechanisms, cancer cells and the surrounding microenvironment might express ectopically genes that are physiologically present in the placenta to mediate fetal immune-tolerance. These natural “placental immune-editing switch” mechanisms (PIES) may represent the result of millions of years of mammalian evolution developed to allow materno-fetal tolerance. Here, we introduce genes of the immune regulatory pathways that are either similarly over- or under-expressed in tumor vs normal tissue. Our analysis was carried out in primary breast cancer with metastatic homolateral axillary lymph nodes as well as placenta tissue (both uterine decidual tissue and term placenta tissue) from a pregnant woman. Gene expression profiling of paired non-self and self tissues (i.e. placenta/uterus; breast cancer/normal breast tissue; metastatic lymphnode/normal lymphnode tissue) was performed using the PanCancer Immune gene panel, a 770 Nanostring gene expression panel. Our findings reveal overlapping in specific immune gene expression in placenta and cancer tissue, suggesting that these genes might play an important role in maintaining immune tolerance both physiologically (in the placenta) and pathologically (in the cancer setting). PMID:27852037
Functional pulmonary atresia in newborn with normal intracardiac anatomy: Successful treatment with inhaled nitric oxide and pulmonary vasodilators

Directory of Open Access Journals (Sweden)

Gürkan Altun

2013-01-01

Full Text Available Functional pulmonary atresia is characterized by a structurally normal pulmonary valve that does not open during right ventricular ejection. It is usually associated with Ebstein′s anomaly, Uhl′s anomaly, neonatal Marfan syndrome and tricuspid valve dysplasia. However, functional pulmonary atresia is rarely reported in newborn with anatomically normal heart. We report a newborn with functional pulmonary atresia who had normal intracardiac anatomy, who responded to treatment with nitric oxide and other vasodilator therapy successfully.
ASSOCIATION BETWEEN VISUAL FUNCTION AND SUBRETINAL DRUSENOID DEPOSITS IN NORMAL AND EARLY AGE-RELATED MACULAR DEGENERATION EYES.

Science.gov (United States)

Neely, David; Zarubina, Anna V; Clark, Mark E; Huisingh, Carrie E; Jackson, Gregory R; Zhang, Yuhua; McGwin, Gerald; Curcio, Christine A; Owsley, Cynthia

2017-07-01

To examine the association between subretinal drusenoid deposits (SDDs) identified by multimodal retinal imaging and visual function in older eyes with normal macular health or in the earliest phases of age-related macular degeneration (AMD). Age-related macular degeneration status for each eye was defined according to the Age-Related Eye Disease Study (AREDS) 9-step classification system (normal = Step 1, early AMD = Steps 2-4) based on color fundus photographs. Visual functions measured were best-corrected photopic visual acuity, contrast and light sensitivity, mesopic visual acuity, low-luminance deficit, and rod-mediated dark adaptation. Subretinal drusenoid deposits were identified through multimodal imaging (color fundus photographs, infrared reflectance and fundus autofluorescence images, and spectral domain optical coherence tomography). The sample included 1,202 eyes (958 eyes with normal health and 244 eyes with early AMD). In normal eyes, SDDs were not associated with any visual function evaluated. In eyes with early AMD, dark adaptation was markedly delayed in eyes with SDDs versus no SDD (a 4-minute delay on average), P = 0.0213. However, this association diminished after age adjustment, P = 0.2645. Other visual functions in early AMD eyes were not associated with SDDs. In a study specifically focused on eyes in normal macular health and in the earliest phases of AMD, early AMD eyes with SDDs have slower dark adaptation, largely attributable to the older ages of eyes with SDD; they did not exhibit deficits in other visual functions. Subretinal drusenoid deposits in older eyes in normal macular health are not associated with any visual functions evaluated.
Gut immunity in Lepidopteran insects.

Science.gov (United States)

Wu, Kai; Yang, Bing; Huang, Wuren; Dobens, Leonard; Song, Hongsheng; Ling, Erjun

2016-11-01

Lepidopteran insects constitute one of the largest fractions of animals on earth, but are considered pests in their relationship with man. Key to the success of this order of insects is its ability to digest food and absorb nutrition, which takes place in the midgut. Because environmental microorganisms can easily enter Lepidopteran guts during feeding, the innate immune response guards against pathogenic bacteria, virus and microsporidia that can be devoured with food. Gut immune responses are complicated by both resident gut microbiota and the surrounding peritrophic membrane and are distinct from immune responses in the body cavity, which depend on the function of the fat body and hemocytes. Due to their relevance to agricultural production, studies of Lepidopteran insect midgut and immunity are receiving more attention, and here we summarize gut structures and functions, and discuss how these confer immunity against different microorganisms. It is expected that increased knowledge of Lepidopteran gut immunity may be utilized for pest biological control in the future. Copyright © 2016 Elsevier Ltd. All rights reserved.
In vitro immune functions in thiamine-replete and -depleted lake trout (Salvelinus namaycush).

Science.gov (United States)

Ottinger, Christopher A; Honeyfield, Dale C; Densmore, Christine L; Iwanowicz, Luke R

2014-05-01

In this study we examined the impacts of in vivo thiamine deficiency on lake trout leukocyte function measured in vitro. When compared outside the context of individual-specific thiamine concentrations no significant differences were observed in leukocyte bactericidal activity or in concanavalin A (Con A), and phytohemagglutinin-P (PHA-P) stimulated leukocyte proliferation. Placing immune functions into context with the ratio of in vivo liver thiamine monophosphate (TMP--biologically inactive form) to thiamine pyrophosphate (TPP--biologically active form) proved to be the best indicator of thiamine depletion impacts as determined using regression modeling. These observed relationships indicated differential effects on the immune measures with bactericidal activity exhibiting an inverse relationship with TMP to TPP ratios, Con A stimulated mitogenesis exhibiting a positive relationship with TMP to TPP ratios and PHA-P stimulated mitogenesis exhibiting no significant relationships. In addition, these relationships showed considerable complexity which included the consistent observation of a thiamine-replete subgroup with characteristics similar to those seen in the leukocytes from thiamine-depleted fish. When considered together, our observations indicate that lake trout leukocytes experience cell-type specific impacts as well as an altered physiologic environment when confronted with a thiamine-limited state. Published by Elsevier Ltd.
Tissue microenvironments in the nasal epithelium of rainbow trout (Oncorhynchus mykiss) define two distinct CD8α+ cell populations and establish regional immunity

Science.gov (United States)

Sepahi, Ali; Casadei, Elisa; Tacchi, Luca; Muñoz, Pilar; LaPatra, Scott E.; Salinas, Irene

2016-01-01

Mucosal surfaces require balancing different physiological roles and immune functions. In order to effectively achieve multifunctionality, mucosal epithelia have evolved unique microenvironments that create unique regional immune responses without impairing other normal physiological functions. Whereas examples of regional immunity are known in other mucosal epithelia, to date, no immune microenvironments have been described in the nasal mucosa, a site where the complex functions of olfaction and immunity need to be orchestrated. In this study we identified for the first time the presence of CD8α+ cells in the rainbow trout (Oncorhynchus mykiss) nasal epithelium. Nasal CD8α+ cells display a distinct phenotype suggestive of CD8+ T cells with high integrin β2 expression. Importantly, nasal CD8α+ cells are located in clusters at the mucosal tip of each olfactory lamella but scattered in the neuroepithelial region. The grouping of CD8α+ cells may be explained by the greater expression of CCL19, ICAM-1, and VCAM-1 in the mucosal tip compared to the neuroepithelium. Whilst viral antigen uptake occurred via both tip and lateral routes, tip resident MHC-II+ cells are located significantly closer to the lumen of the nasal cavity than their neuroepithelial counterparts, therefore having quicker access to invading pathogens. Our studies reveal for the first time compartmentalized mucosal immune responses within the nasal mucosa of a vertebrate species, a strategy that likely optimizes local immune responses while protecting olfactory sensory functions. PMID:27798156
A cascade reaction network mimicking the basic functional steps of adaptive immune response.

Science.gov (United States)

Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

2015-10-01

Biological systems use complex 'information-processing cores' composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS that we call an adaptive immune response simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system that responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner that is superficially similar to the most basic responses of the vertebrate AIS, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices.
Effects of blood transportation on human peripheral mononuclear cell yield, phenotype and function: implications for immune cell biobanking.

Directory of Open Access Journals (Sweden)

Anita Posevitz-Fejfár

Full Text Available Human biospecimen collection, processing and preservation are rapidly emerging subjects providing essential support to clinical as well as basic researchers. Unlike collection of other biospecimens (e.g. DNA and serum, biobanking of viable immune cells, such as peripheral blood mononuclear cells (PBMC and/or isolated immune cell subsets is still in its infancy. While certain aspects of processing and freezing conditions have been studied in the past years, little is known about the effect of blood transportation on immune cell survival, phenotype and specific functions. However, especially for multicentric and cooperative projects it is vital to precisely know those effects. In this study we investigated the effect of blood shipping and pre-processing delay on immune cell phenotype and function both on cellular and subcellular levels. Peripheral blood was collected from healthy volunteers (n = 9: at a distal location (shipped overnight and in the central laboratory (processed immediately. PBMC were processed in the central laboratory and analyzed post-cryopreservation. We analyzed yield, major immune subset distribution, proliferative capacity of T cells, cytokine pattern and T-cell receptor signal transduction. Results show that overnight transportation of blood samples does not globally compromise T- cell subsets as they largely retain their phenotype and proliferative capacity. However, NK and B cell frequencies, the production of certain PBMC-derived cytokines and IL-6 mediated cytokine signaling pathway are altered due to transportation. Various control experiments have been carried out to compare issues related to shipping versus pre-processing delay on site. Our results suggest the implementation of appropriate controls when using multicenter logistics for blood transportation aiming at subsequent isolation of viable immune cells, e.g. in multicenter clinical trials or studies analyzing immune cells/subsets. One important conclusion might
Development of Functional Foods for Body Protection Using Radiation

Energy Technology Data Exchange (ETDEWEB)

Jo, S. K.; Jung, U. H.; Park, H. R.

2007-07-15

We have previously developed two herbal compositions(HemoHIM, HemoTonic) that protects immune/hematopoietic system and self-renewal tissues against radiation and enhances immune/hematopoietic functions. In this study, we tried to expand its usability by verifying its protective activity against various harmful stimuli as well as radiation. HemoHIM was shown to be highly effective in reducing immune/hematopoietic damage, particularly, normalizing the Th1/Th2 imbalance, which seemed to be a result of increased production of IL-12p70 by APC and enhanced NK cell activity. Also HemoHIM was shown to have protective activities against UV-induced skin damage, immune system damage by an anticancer drug (CP), immune depression by old age and stress, and inflammation. Finally it was confirmed in a human study that HemoHIM improves the immune cell functions and cytokine production. Based on these results, HemoHIM has been approved as a health functional food for immunomodulation by Korea FDA and succeeded in its industrialization. Meanwhile, to develop functional foods for the reduction of chronic radiation damage (carcinogenesis), we have screened natural products for inhibitory activities against carcinogenesis-related factors, and developed two anti-carcinogenic compositions. Also 6 single compounds were isolated and identified from radioprotective natural products and elucidated some synergistic protection by several single compounds and established a basis for the development of advanced technology for radioprotection. Also, to obtain the applicability of radiation technology for the safe sanitatation and distribution of functional food materials, we verified the toxicological safety, stability of activity and active components of irradiated medicinal herbs
Development of Functional Foods for Body Protection Using Radiation

International Nuclear Information System (INIS)

Jo, S. K.; Jung, U. H.; Park, H. R.

2007-07-01

We have previously developed two herbal compositions(HemoHIM, HemoTonic) that protects immune/hematopoietic system and self-renewal tissues against radiation and enhances immune/hematopoietic functions. In this study, we tried to expand its usability by verifying its protective activity against various harmful stimuli as well as radiation. HemoHIM was shown to be highly effective in reducing immune/hematopoietic damage, particularly, normalizing the Th1/Th2 imbalance, which seemed to be a result of increased production of IL-12p70 by APC and enhanced NK cell activity. Also HemoHIM was shown to have protective activities against UV-induced skin damage, immune system damage by an anticancer drug (CP), immune depression by old age and stress, and inflammation. Finally it was confirmed in a human study that HemoHIM improves the immune cell functions and cytokine production. Based on these results, HemoHIM has been approved as a health functional food for immunomodulation by Korea FDA and succeeded in its industrialization. Meanwhile, to develop functional foods for the reduction of chronic radiation damage (carcinogenesis), we have screened natural products for inhibitory activities against carcinogenesis-related factors, and developed two anti-carcinogenic compositions. Also 6 single compounds were isolated and identified from radioprotective natural products and elucidated some synergistic protection by several single compounds and established a basis for the development of advanced technology for radioprotection. Also, to obtain the applicability of radiation technology for the safe sanitatation and distribution of functional food materials, we verified the toxicological safety, stability of activity and active components of irradiated medicinal herbs
Francisella tularensis Catalase Restricts Immune Function by Impairing TRPM2 Channel Activity.

Science.gov (United States)

Shakerley, Nicole L; Chandrasekaran, Akshaya; Trebak, Mohamed; Miller, Barbara A; Melendez, J Andrés

2016-02-19

As an innate defense mechanism, macrophages produce reactive oxygen species that weaken pathogens and serve as secondary messengers involved in immune function. The Gram-negative bacterium Francisella tularensis utilizes its antioxidant armature to limit the host immune response, but the mechanism behind this suppression is not defined. Here we establish that F. tularensis limits Ca(2+) entry in macrophages, thereby limiting actin reorganization and IL-6 production in a redox-dependent fashion. Wild type (live vaccine strain) or catalase-deficient F. tularensis (ΔkatG) show distinct profiles in their H2O2 scavenging rates, 1 and 0.015 pm/s, respectively. Murine alveolar macrophages infected with ΔkatG display abnormally high basal intracellular Ca(2+) concentration that did not increase further in response to H2O2. Additionally, ΔkatG-infected macrophages displayed limited Ca(2+) influx in response to ionomycin, as a result of ionophore H2O2 sensitivity. Exogenously added H2O2 or H2O2 generated by ΔkatG likely oxidizes ionomycin and alters its ability to transport Ca(2+). Basal increases in cytosolic Ca(2+) and insensitivity to H2O2-mediated Ca(2+) entry in ΔkatG-infected cells are reversed by the Ca(2+) channel inhibitors 2-aminoethyl diphenylborinate and SKF-96365. 2-Aminoethyl diphenylborinate but not SKF-96365 abrogated ΔkatG-dependent increases in macrophage actin remodeling and IL-6 secretion, suggesting a role for H2O2-mediated Ca(2+) entry through the transient receptor potential melastatin 2 (TRPM2) channel in macrophages. Indeed, increases in basal Ca(2+), actin polymerization, and IL-6 production are reversed in TRPM2-null macrophages infected with ΔkatG. Together, our findings provide compelling evidence that F. tularensis catalase restricts reactive oxygen species to temper macrophage TRPM2-mediated Ca(2+) signaling and limit host immune function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
[Effect of Supportan on nutritional status and immune function of late-staged gastric cancer patients undergoing chemotherapy].

Science.gov (United States)

Zhong, Hai-jun; Ying, Jie-er; Ma, Sheng-lin

2006-09-01

To evaluate the effect of Supportan, an enteral nutrition (EN) specific for tumor patients, on the nutritional status and immune function of late-staged gastric cancer patients undergoing chemotherapy. Sixty-six late-staged gastric cancer patients undergoing chemotherapy were randomly divided into EN group (n=33) and control group (n=33). During chemotherapy, the patients in EN group received Supportan and the patients in the control group received basic diet. On the 14th day before chemotherapy and after chemotherapy, nutritional status and cell immune indicators were evaluated. As for nutrition indicators, there were no significant differences in EN group before and after chemotherapy (P > 0.05). Total protein, hemoglobin, prealbumin and transferrin significantly decreased after chemotherapy compared with those before chemotherapy in the control group (Pnutrition in EN group were superior to that in the control group, however, the differences were not statistically significant. The incidences of nausea, vomiting and marrow inhibition in Supportan group was lower compared with those in the control group, but with no significant difference. Supportan can prevent malnutrition of the late-staged gastric cancer patients undergoing chemotherapy, and improve immune function and alleviate adverse effects of chemotherapy.

Ejaculate economics: testing the effects of male sexual history on the trade-off between sperm and immune function in Australian crickets.

Directory of Open Access Journals (Sweden)

Damian K Dowling

Full Text Available Trade-offs between investment into male sexual traits and immune function provide the foundation for some of the most prominent models of sexual selection. Post-copulatory sexual selection on the male ejaculate is intense, and therefore trade-offs should occur between investment into the ejaculate and the immune system. Examples of such trade-offs exist, including that between sperm quality and immunity in the Australian cricket, Teleogryllus oceanicus. Here, we explore the dynamics of this trade-off, examining the effects that increased levels of sexual interaction have on the viability of a male's sperm across time, and the concomitant effects on immune function. Males were assigned to a treatment, whereby they cohabited with females that were sexually immature, sexually mature but incapable of copulation, or sexually mature and capable of copulation. Sperm viability of each male was then assessed at two time points: six and 13 days into the treatment, and immune function at day 13. Sperm viability decreased across the time points, but only for males exposed to treatment classes involving sexually mature females. This decrease was similar in magnitude across both sexually mature classes, indicating that costs to the expression of high sperm viability are incurred largely through levels of pre-copulatory investment. Males exposed to immature females produced sperm of low viability at both time points. Although we confirmed a weak negative association between sperm viability and lytic activity (a measure of immune response to bacterial infection at day 13, this relationship was not altered across the mating treatment. Our results highlight that sperm viability is a labile trait, costly to produce, and subject to strategic allocation in these crickets.
Pivotal advance: CTLA-4+ T cells exhibit normal antiviral functions during acute viral infection.

Science.gov (United States)

Raué, Hans-Peter; Slifka, Mark K

2007-05-01

Previous studies have shown that T cells, which are genetically deficient in CTLA-4/CD152 expression, will proliferate uncontrollably, resulting in lethal autoimmune disease. This and other evidence indicate that CTLA-4 plays a critical role in the negative regulation of effector T cell function. In contrast to expectations, BrdU incorporation experiments demonstrated that CTLA-4 expression was associated with normal or even enhanced in vivo proliferation of virus-specific CD4+ and CD8+ T cells following acute lymphocytic choriomeningitis virus or vaccinia virus infection. When compared with CTLA-4- T cells directly ex vivo, CTLA-4+ T cells also exhibited normal antiviral effector functions following stimulation with peptide-coated cells, virus-infected cells, plate-bound anti-CD3/anti-CTLA-4, or the cytokines IL-12 and IL-18. Together, this indicates that CTLA-4 does not directly inhibit antiviral T cell expansion or T cell effector functions, at least not under the normal physiological conditions associated with either of these two acute viral infections.
Role of levamisole immunotherapy as an adjuvant to radiotherapy in oral cancer - Immune responses

International Nuclear Information System (INIS)

Balaram, P.; Remani, P.; Padmanabhan, T.K.

1988-01-01

Investigations were carried out to assess the effect of levamisole immunotherapy as an adjuvant to radiotherapy, on the immune response of patients with squamous cell carcinoma of the oral cavity. Parameters assessed were leukocyte migration inhibition, response to PPD and oral cancer extract (OCA), lymphocyte transformation to PHA, circulating antibodies to OCA and circulating immune complexes (CIC). Comparisons were made between groups receiving levamisole, those receiving placebo and normal controls. The results of a thirty-month follow-up are presented. Radiotherapy resulted in a depression of cell-mediated functions, reduction in antibody titre also showed a gradual increase with time of follow-up. Levamisole, however, appeared to reduce the levels of CIC. (author). 2 figs., 1 tab., 38 refs
Reversible changes in brain glucose metabolism following thyroid function normalization in hyperthyroidism.

Science.gov (United States)

Miao, Q; Zhang, S; Guan, Y H; Ye, H Y; Zhang, Z Y; Zhang, Q Y; Xue, R D; Zeng, M F; Zuo, C T; Li, Y M

2011-01-01

Patients with hyperthyroidism frequently present with regional cerebral metabolic changes, but the consequences of endocrine-induced brain changes after thyroid function normalization are unclear. We hypothesized that the changes of regional cerebral glucose metabolism are related to thyroid hormone levels in patients with hyperthyroid, and some of these changes can be reversed with antithyroid therapy. Relative regional cerebral glucose metabolism was compared between 10 new-onset untreated patients with hyperthyroidism and 20 healthy control participants by using brain FDG-PET scans. Levels of emotional distress were evaluated by using the SAS and SDS. Patients were treated with methimazole. A follow-up PET scan was performed to assess metabolic changes of the brain when thyroid functions normalized. Compared with controls, patients exhibited lower activity in the limbic system, frontal lobes, and temporal lobes before antithyroid treatment. There were positive correlations between scores of depression and regional metabolism in the cingulate and paracentral lobule. The severity of depression and anxiety covaried negatively with pretreatment activity in the inferior temporal and inferior parietal gyri respectively. Compared with the hyperthyroid status, patients with normalized thyroid functions showed an increased metabolism in the left parahippocampal, fusiform, and right superior frontal gyri. The decrease in both FT3 and FT4 was associated with increased activity in the left parahippocampal and right superior frontal gyri. The changes of regional cerebral glucose metabolism are related to thyroid hormone levels in patients with hyperthyroidism, and some cerebral hypometabolism can be improved after antithyroid therapy.
Complement anaphylatoxins as immune regulators in cancer.

Science.gov (United States)

Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

2014-08-01

The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Immune System and Kidney Transplantation.

Science.gov (United States)

Shrestha, Badri Man

2017-01-01

The immune system recognises a transplanted kidney as foreign body and mounts immune response through cellular and humoral mechanisms leading to acute or chronic rejection, which ultimately results in graft loss. Over the last five decades, there have been significant advances in the understanding of the immune responses to transplanted organs in both experimental and clinical transplant settings. Modulation of the immune response by using immunosuppressive agents has led to successful outcomes after kidney transplantation. The paper provides an overview of the general organisation and function of human immune system, immune response to kidney transplantation, and the current practice of immunosuppressive therapy in kidney transplantation in the United Kingdom.
Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

Science.gov (United States)

Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

2015-01-01

Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458
Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

Energy Technology Data Exchange (ETDEWEB)

Ross, P.S. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Swart, R.L. de [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands); Timmerman, H.H.; Loveren, H. van [National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands); Osterhaus, A.D.M.E. [Seal Rehabilitation and Research Centre, Pieterburen (Netherlands)]|[National Inst. of Public Health and Environmental Protection, Bilthoven (Netherlands)]|[Erasmus Univ., Rotterdam (Netherlands)

1995-12-31

Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoid organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.
Antitumor Immunity Is Controlled by Tetraspanin Proteins

Directory of Open Access Journals (Sweden)

Fleur Schaper

2018-05-01

Full Text Available Antitumor immunity is shaped by the different types of immune cells that are present in the tumor microenvironment (TME. In particular, environmental signals (for instance, soluble factors or cell–cell contact transmitted through the plasma membrane determine whether immune cells are activated or inhibited. Tetraspanin proteins are emerging as central building blocks of the plasma membrane by their capacity to cluster immune receptors, enzymes, and signaling molecules into the tetraspanin web. Whereas some tetraspanins (CD81, CD151, CD9 are widely and broadly expressed, others (CD53, CD37, Tssc6 have an expression pattern restricted to hematopoietic cells. Studies using genetic mouse models have identified important immunological functions of these tetraspanins on different leukocyte subsets, and as such, may be involved in the immune response against tumors. While multiple studies have been performed with regards to deciphering the function of tetraspanins on cancer cells, the effect of tetraspanins on immune cells in the antitumor response remains understudied. In this review, we will focus on tetraspanins expressed by immune cells and discuss their potential role in antitumor immunity. New insights in tetraspanin function in the TME and possible prognostic and therapeutic roles of tetraspanins will be discussed.
Immune Checkpoint Function of CD85j in CD8 T Cell Differentiation and Aging

Directory of Open Access Journals (Sweden)

Claire E. Gustafson

2017-06-01

Full Text Available Aging is associated with an increased susceptibility to infection and a failure to control latent viruses thought to be driven, at least in part, by alterations in CD8 T cell function. The aging T cell repertoire is characterized by an accumulation of effector CD8 T cells, many of which express the negative regulatory receptor CD85j. To define the biological significance of CD85j expression on CD8 T cells and to address the question whether presence of CD85j in older individuals is beneficial or detrimental for immune function, we examined the specific attributes of CD8 T cells expressing CD85j as well as the functional role of CD85j in antigen-specific CD8 T cell responses during immune aging. Here, we show that CD85j is mainly expressed by terminally differentiated effector (TEMRAs CD8 T cells, which increase with age, in cytomegalovirus (CMV infection and in males. CD85j+ CMV-specific cells demonstrate clonal expansion. However, TCR diversity is similar between CD85j+ and CD85j− compartments, suggesting that CD85j does not directly impact the repertoire of antigen-specific cells. Further phenotypic and functional analyses revealed that CD85j identifies a specific subset of CMV-responsive CD8 T cells that coexpress a marker of senescence (CD57 but retain polyfunctional cytokine production and expression of cytotoxic mediators. Blocking CD85j binding enhanced proliferation of CMV-specific CD8 T cells upon antigen stimulation but did not alter polyfunctional cytokine production. Taken together, these data demonstrate that CD85j characterizes a population of “senescent,” but not exhausted antigen-specific effector CD8 T cells and indicates that CD85j is an important checkpoint regulator controlling expansion of virus-specific T cells during aging. Inhibition of CD85j activity may be a mechanism to promote stronger CD8 T cell effector responses during immune aging.
Infusion of Sibling Marrow in a Patient with Purine Nucleoside Phosphorylase Deficiency Leads to Split Mixed Donor Chimerism and Normal Immunity

Directory of Open Access Journals (Sweden)

Laura Yeates

2017-06-01

Full Text Available Purine nucleoside phosphorylase (PNP deficiency, a rare autosomal recessive metabolic disease causes combined immunodeficiency and developmental delay, hypotonia, and spasticity. Patients present with recurrent infections associated with T-lymphocytopenia, characteristically presenting later than patients with classical severe combined immunodeficiency (SCID. PNP, with adenosine deaminase (ADA, is part of the purine salvage pathway. The only curative therapy is hematopoietic stem cell transplantation. Myeloablative conditioning is recommended to prevent rejection caused by residual immune function. However, HLA-identical sibling stem cell infusions in ADA-SCID result in some donor stem cell engraftment and long-term thymopoiesis. We report a patient with PNP deficiency, who received HLA-identical sibling marrow without chemotherapy because of disseminated cytomegalovirus (CMV infection. The patient presented at 14 months of age following recurrent infections, from early infancy, with persistent irritability, developmental delay, and hypotonia. She had neutropenia, pan-lymphocytopenia, and hypogammaglobulinemia with low plasma urate and erythrocyte PNP activity. Diagnosis was confirmed with a homozygous mutation in PNP. The patient was viremic with CMV detected in blood and CSF by PCR. Dual antiviral therapy improved the clinical condition and reduced the viral load. In view of the disseminated CMV infection, the decision was made to infuse stem cells without any pre-conditioning chemotherapy. She received a matched sibling donor unconditioned stem cell infusion at 16 months of age. The post-transplant course was uneventful. Blood PCR became negative for CMV. Global hypotonia persisted, although with significant improvement in irritability. At 4 years of age and 29 months post-transplant, the patient demonstrated normal T-lymphocyte and natural killer cell numbers. Recent thymic emigrants represented 12% of the total T
Systematic identification of anti-interferon function on hepatitis C virus genome reveals p7 as an immune evasion protein.

Science.gov (United States)

Qi, Hangfei; Chu, Virginia; Wu, Nicholas C; Chen, Zugen; Truong, Shawna; Brar, Gurpreet; Su, Sheng-Yao; Du, Yushen; Arumugaswami, Vaithilingaraja; Olson, C Anders; Chen, Shu-Hua; Lin, Chung-Yen; Wu, Ting-Ting; Sun, Ren

2017-02-21

Hepatitis C virus (HCV) encodes mechanisms to evade the multilayered antiviral actions of the host immune system. Great progress has been made in elucidating the strategies HCV employs to down-regulate interferon (IFN) production, impede IFN signaling transduction, and impair IFN-stimulated gene (ISG) expression. However, there is a limited understanding of the mechanisms governing how viral proteins counteract the antiviral functions of downstream IFN effectors due to the lack of an efficient approach to identify such interactions systematically. To study the mechanisms by which HCV antagonizes the IFN responses, we have developed a high-throughput profiling platform that enables mapping of HCV sequences critical for anti-IFN function at high resolution. Genome-wide profiling performed with a 15-nt insertion mutant library of HCV showed that mutations in the p7 region conferred high levels of IFN sensitivity, which could be alleviated by the expression of WT p7 protein. This finding suggests that p7 protein of HCV has an immune evasion function. By screening a liver-specific ISG library, we identified that IFI6-16 significantly inhibits the replication of p7 mutant viruses without affecting WT virus replication. In contrast, knockout of IFI6-16 reversed the IFN hypersensitivity of p7 mutant virus. In addition, p7 was found to be coimmunoprecipitated with IFI6-16 and to counteract the function of IFI6-16 by depolarizing the mitochondria potential. Our data suggest that p7 is a critical immune evasion protein that suppresses the antiviral IFN function by counteracting the function of IFI6-16.
Effect of Xiao Chaihu Tang combined with intravenous chemotherapy on tumor markers and immune function in patients with advanced breast cancer

Directory of Open Access Journals (Sweden)

Jian-Ping Zhong

2017-05-01

Full Text Available Objective: To study the effect of Xiao Chaihu Tang combined with intravenous chemotherapy on tumor markers and immune function in patients with advanced breast cancer. Methods: 76 patients with advanced breast cancer treated in our hospital between May 2012 and November 2015 were collected and divided into the combined treatment group (n=34 who accepted Xiao Chaihu Tang combined with intravenous chemotherapy and the control group (n=42 who accepted intravenous chemotherapy alone according to different treatment, and the treatment cycle was 3 months for both groups. Before treatment and 3 months after treatment, ELISA method was used to detect serum levels of broad-spectrum tumor markers and breast cancerspecific tumor markers; flow cytometer was used to detect cellular immune function index levels, and turbidimetric immunoassay was used to detect humoral immune function index levels in peripheral blood. Results: Before treatment, differences in serum tumor marker levels as well as cellular immunity and humoral immunity index levels in peripheral blood were not statistically significant between two groups of patients (P>0.05; after 3 months of treatment, broad-spectrum tumor markers carcinoembryonic antigen (CEA, carbohydrate antigen 153 (CA153 and carbohydrate antigen 125 (CA125 levels in serum of combined treatment group were lower than those of control group, and breast cancer-specific tumor markers insulin-like growth factor-1 (IGF-1, midkine (MK, soluble E-cadherin (sEC and thymidine kinase 1 (TK1 levels were lower than those of control group (P<0.05; CD3+ and CD4+ T lymphocyte levels as well as CD4+/CD8+ ratio in peripheral blood of combined treatment group were higher than those of control group while CD8+ T lymphocyte level was lower than that of control group, and immunoglobulin G (IgG, immunoglobulin A (IgA and immunoglobulin M (IgM levels in peripheral blood were higher than those of control group (P<0.05. Conclusions: Xiao Chaihu Tang
Regulatory T cells as suppressors of anti-tumor immunity: Role of metabolism.

Science.gov (United States)

De Rosa, Veronica; Di Rella, Francesca; Di Giacomo, Antonio; Matarese, Giuseppe

2017-06-01

Novel concepts in immunometabolism support the hypothesis that glucose consumption is also used to modulate anti-tumor immune responses, favoring growth and expansion of specific cellular subsets defined in the past as suppressor T cells and currently reborn as regulatory T (Treg) cells. During the 1920s, Otto Warburg and colleagues observed that tumors consumed high amounts of glucose compared to normal tissues, even in the presence of oxygen and completely functioning mitochondria. However, the role of the Warburg Effect is still not completely understood, particularly in the context of an ongoing anti-tumor immune response. Current experimental evidence suggests that tumor-derived metabolic restrictions can drive T cell hyporesponsiveness and immune tolerance. For example, several glycolytic enzymes, deregulated in cancer, contribute to tumor progression independently from their canonical metabolic activity. Indeed, they can control apoptosis, gene expression and activation of specific intracellular pathways, thus suggesting a direct link between metabolic switches and pro-tumorigenic transcriptional programs. Focus of this review is to define the specific metabolic pathways controlling Treg cell immunobiology in the context of anti-tumor immunity and tumor progression. Copyright © 2017 Elsevier Ltd. All rights reserved.
Effect of Scoparia dulcis on noise stress induced adaptive immunity and cytokine response in immunized Wistar rats

Directory of Open Access Journals (Sweden)

Loganathan Sundareswaran

2017-01-01

Conclusion: S. dulcis (SD has normalized and prevented the noise induced changes in cell-mediated and humoral immunity and it could be the presence of anti-stressor and immuno stimulant activity of the plant.
Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

Science.gov (United States)

Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

2015-01-01

A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly
Effect of gavage of rhubarb preparation on immune function in patients with sepsis

Directory of Open Access Journals (Sweden)

Chao YIN

2016-01-01

Full Text Available Objectives 　To study the effect of nasointestinal infusion of rhubarb preparation on general inflammatory reaction and immune function in sepsis patients. Methods 　The patients with sepsis admitted to our hospital from August 2012 to November 2014 was randomized to placebo group (n=36 and treatment group (n=32. The placebo group was treated conventionally, while the treatment group received the rhubarb preparation through nasal tube. The differences in the clinical symptoms, inflammatory cytokines, immunological indexes were compared between two groups. Results 　There was no significant difference in clinical indexes between two groups before the treatment (P>0.05. The time of gastric retention, first defecation, bowel sounds recovery, abdominal pain, and abdominal distension relief were shortened (P<0.05. The contents of TNF-α, IL-1β, and IL-6 were reduced significantly on day 8 and 28 after therapy (P<0.01 in the treatment group, but the level of IL-10 was elevated obviously on days 3 and 8 after therapy (P<0.01. Significant improvements in CD3+, CD4+, CD4+/CD8+ and HLA-DR/ CD14+ were observed at days 3, 8 and 28 after therapy (P<0.05, though the improvement of HLA-DR/CD14+ was seen only on day 8 after therapy (P<0.05. Conclusion 　Rhubarb can improve the gastrointestinal function and immune function, and reduce release of inflammatory cytokines in sepsis patients, thus producing the positive role in the treatment of sepsis. DOI: 10.11855/j.issn.0577-7402.2015.12.15
Chloroplastic protein NRIP1 mediates innate immune receptor recognition of a viral effector

Science.gov (United States)

Caplan, Jeffrey L.; Mamillapalli, Padmavathi; Burch-Smith, Tessa M.; Czymmek, Kirk; Dinesh-Kumar, S.P.

2008-01-01

Summary Plant innate immunity relies on the recognition of pathogen effector molecules by nucleotide-binding-leucine-rich repeat (NB-LRR) immune receptor families. Previously we have shown the N immune receptor, a member of TIR-NB-LRR family, indirectly recognizes the 50-kDa helicase (p50) domain of Tobacco mosaic virus (TMV) through its TIR domain. We have identified an N receptor-interacting protein, NRIP1, that directly interacts with both N's TIR domain and p50. NRIP1 is a functional rhodanese sulfurtransferase and is required for N to provide complete resistance to TMV. Interestingly, NRIP1 that normally localizes to the chloroplasts is recruited to the cytoplasm and nucleus by the p50 effector. As a consequence, NRIP1 interacts with N only in the presence of the p50 effector. Our findings show that a chloroplastic protein is intimately involved in pathogen recognition. We propose that N's activation requires a pre-recognition complex containing the p50 effector and NRIP1. PMID:18267075
Seasonality influences cuticle melanization and immune defense in a cricket: support for a temperature-dependent immune investment hypothesis in insects

Energy Technology Data Exchange (ETDEWEB)

Fedorka, K. M. [Univ. of Central Florida, Orlando, FL (United States); Copeland, E. K. [Univ. of Central Florida, Orlando, FL (United States); Winterhalter, W. E. [Univ. of Central Florida, Orlando, FL (United States)

2013-07-18

To improve thermoregulation in colder environments, insects are expected to darken their cuticles with melanin via the phenoloxidase cascade, a phenomenon predicted by the thermal melanin hypothesis. However, the phenoloxidase cascade also plays a significant role in insect immunity, leading to the additional hypothesis that the thermal environment indirectly shapes immune function via direct selection on cuticle color. Support for the latter hypothesis comes from the cricket Allonemobius socius, where cuticle darkness and immune-related phenoloxidase activity increase with latitude. However, thermal environments vary seasonally as well as geographically, suggesting that seasonal plasticity in immunity may also exist. Although seasonal fluctuations in vertebrate immune function are common (because of flux in breeding or resource abundance), seasonality in invertebrate immunity has not been widely explored. We addressed this possibility by rearing crickets in simulated summer and fall environments and assayed their cuticle color and immune function. Prior to estimating immunity, crickets were placed in a common environment to minimize metabolic rate differences. Individuals reared under fall-like conditions exhibited darker cuticles, greater phenoloxidase activity and greater resistance to the bacteria Serratia marcescens. These data support the hypothesis that changes in the thermal environment modify cuticle color, which indirectly shapes immune investment through pleiotropy. This hypothesis may represent a widespread mechanism governing immunity in numerous systems, considering that most insects operate in seasonally and geographically variable thermal environments.
EFFECT OF POLYPHENOLIC COMPOUNDS ISOLATED FROM CARTHAMUS TINCTORIUS AND CALENDULA OFFICINALIS L., ON FUNCTIONAL ACTIVITY OF IMMUNE CELLS UNDER CONDITIONS OF CYTOSTATIC IMMUNOSUPPRESSION

Directory of Open Access Journals (Sweden)

N. V. Masnaya

2013-01-01

Full Text Available The purpose of the study – to study the effect of polyphenolic compounds extracted from the flowers of safflower oil and calendula, the functional activity of immune cells in cytotoxic immune suppression.Conventional methods determined the total number of splenocytes, relative (% and absolute (106, the number of antibody-forming cells (AFC in the spleen of mice by local hemolysis by Cunningham.Evaluated the effect of compounds of natural origin on the cellular immune response in the delayed-type hypersensitivity (DTH. Phagocytic activity of peritoneal macrophages was determined by the method based on the intensity of their capture ink particles. We studied the functional activity of peritoneal macrophages by NBT test (spontaneous and stimulated. Studies were conducted on male mice Category 1 (conventional linear mouse line CBA/CaLac aged 2–2.5 months, weighing 20–22 g. After the introduction mice line CBA/CaLac of polyphenolic compounds derived from flowers of Carthamus tinctorius and flowers of Calendula officinalis L. during the 5-day course in dose 50 mg/kg was observed stimulation of the humoral immune response (total number of splenocytes, the number of antibodies in the spleen cells and the functional activity of macrophages and Immunomodulating effect on the humoral immunity and the functional activity of macrophages after a single injection of cyclophosphamide in dose 250 mg/kg. Immunotropic activity of polyphenolic compounds is higher than that those of the reference product of tincture of Echinacea purpurea.

Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints.

Science.gov (United States)

Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

2015-06-01

Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system-with its capacity for memory, exquisite specificity and central and universal role in human biology-immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer.
Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints

International Nuclear Information System (INIS)

Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

2015-01-01

Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system—with its capacity for memory, exquisite specificity and central and universal role in human biology—immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer
Stromal cell contributions to the homeostasis and functionality of the immune system.

Science.gov (United States)

Mueller, Scott N; Germain, Ronald N

2009-09-01

A defining characteristic of the immune system is the constant movement of many of its constituent cells through the secondary lymphoid tissues, mainly the spleen and lymph nodes, where crucial interactions that underlie homeostatic regulation, peripheral tolerance and the effective development of adaptive immune responses take place. What has only recently been recognized is the role that non-haematopoietic stromal elements have in many aspects of immune cell migration, activation and survival. In this Review, we summarize our current understanding of lymphoid compartment stromal cells, examine their possible heterogeneity, discuss how these cells contribute to immune homeostasis and the efficient initiation of adaptive immune responses, and highlight how targeting of these elements by some pathogens can influence the host immune response.
Restoring Ovarian Endocrine Function with Encapsulated Ovarian Allograft in Immune Competent Mice.

Science.gov (United States)

David, Anu; Day, James Ronald; Cichon, Alexa Leigh; Lefferts, Adam; Cascalho, Marilia; Shikanov, Ariella

2017-07-01

Premature ovarian insufficiency (POI) is a major complication of cytotoxic treatments due to extreme ovarian sensitivity to chemotherapy and radiation. In pediatric cancer patients modern therapy has improved the long-term survival to over 80% in the United States. However, these cancer survivors face long-term health problems related to treatment toxicity. In female cancer survivors POI leads to sterility, along with the consequences of estrogen deficiency such as premature osteopenia, muscle wasting, accelerated cardiovascular diseases and a vast array of other health and developmental problems. These long-lasting effects are particularly significant for young girls reaching puberty. As such, restoring ovarian endocrine function is paramount in this population. In the present study, we evaluated the feasibility of restoring ovarian endocrine function in ovariectomized mice by transplanting syngeneic and allogeneic ovarian tissue encapsulated in alginate capsules or TheraCyte ® . Histological analysis of the implants retrieved after 7 and 30 days' post implantation showed follicular development up to the secondary and antral stages in both syngeneic and allogeneic implants. Implantation of syngeneic and allogeneic ovarian grafts encapsulated in TheraCyte devices restored ovarian endocrine function, which was confirmed by decreased serum FSH levels from 60 to 70 ng/mL in ovariectomized mice to 30-40 ng/mL 30 days after implantation. Absence of allo-MHC-specific IgG and IgM antibodies in the sera of implanted mice with allogeneic ovarian tissue encapsulated in TheraCyte indicate that the implants did not evoke an allo-immune response, while the allogeneic controls were rejected 21 days after implantation. Our results show that TheraCyte effectively isolates the graft from immune recognition but also supports follicular growth.
Immune defense and host life history.

Science.gov (United States)

Zuk, Marlene; Stoehr, Andrew M

2002-10-01

Recent interest has focused on immune response in an evolutionary context, with particular attention to disease resistance as a life-history trait, subject to trade-offs against other traits such as reproductive effort. Immune defense has several characteristics that complicate this approach, however; for example, because of the risk of autoimmunity, optimal immune defense is not necessarily maximum immune defense. Two important types of cost associated with immunity in the context of life history are resource costs, those related to the allocation of essential but limited resources, such as energy or nutrients, and option costs, those paid not in the currency of resources but in functional or structural components of the organism. Resource and option costs are likely to apply to different aspects of resistance. Recent investigations into possible trade-offs between reproductive effort, particularly sexual displays, and immunity have suggested interesting functional links between the two. Although all organisms balance the costs of immune defense against the requirements of reproduction, this balance works out differently for males than it does for females, creating sex differences in immune response that in turn are related to ecological factors such as the mating system. We conclude that immune response is indeed costly and that future work would do well to include invertebrates, which have sometimes been neglected in studies of the ecology of immune defense.
Distinctive cellular immunity in genetically susceptible BALB/c mice recovered from Leishmania major infection or after subcutaneous immunization with killed parasites

International Nuclear Information System (INIS)

Liew, F.Y.; Dhaliwal, J.S.

1987-01-01

Genetically susceptible BALB/c mice are refractory to further infection after recovery from Leishmania major infection after a sublethal dose of gamma-irradiation. In contrast, mice immunized with killed promastigotes s.c. develop exacerbated lesions after infection. Both groups of mice produce only a low level of specific antibody and no detectable cytotoxic T cells, but do have a strong antigen-specific DTH, which is adoptively transferable with Lyt-1+2-, L3T4+ T cells. Kinetic and histological studies revealed that mice immunized s.c. developed Jones-Mote hypersensitivity, peaking at 15 hr. with little mononuclear cell infiltration at the site of antigen administration; whereas mice that had recovered from infection developed tuberculin-type of reactivity, peaking at 24 to 48 hr, with intense mononuclear cell infiltration. Splenic T cells from recovered mice, when injected into the footpads of normal recipients together with live promastigotes, were able to retard lesion development; whereas T cells from s.c. immunized mice, when similarly transferred, accelerated disease progression. Antigen-specific culture supernatant of spleen cells from recovered mice also activated normal resident peritoneal macrophages to kill intracellular L. major amastigotes and tumor cells. Culture supernatants of spleen cells from s.c. immunized or normal mice were devoid of such activities. Part of the macrophage-activating potential can be inhibited by antibody specific for IFN-gamma. These results therefore demonstrate that whereas the Jones-Mote reaction is correlated with disease exacerbation, the tuberculin-type of DTH may be protective. Furthermore, in vivo immunity is directly related to the capacity of T cells to produce macrophage-activating factor
Effect of Probiotic Bacteria on Microbial Host Defense, Growth, and Immune Function in Human Immunodeficiency Virus Type-1 Infection

Directory of Open Access Journals (Sweden)

Stig Bengmark

2011-12-01

Full Text Available The hypothesis that probiotic administration protects the gut surface and could delay progression of Human Immunodeficiency Virus type1 (HIV-1 infection to the Acquired Immunodeficiency Syndrome (AIDS was proposed in 1995. Over the last five years, new studies have clarified the significance of HIV-1 infection of the gut associated lymphoid tissue (GALT for subsequent alterations in the microflora and breakdown of the gut mucosal barrier leading to pathogenesis and development of AIDS. Current studies show that loss of gut CD4+ Th17 cells, which differentiate in response to normal microflora, occurs early in HIV-1 disease. Microbial translocation and suppression of the T regulatory (Treg cell response is associated with chronic immune activation and inflammation. Combinations of probiotic bacteria which upregulate Treg activation have shown promise in suppressing pro inflammatory immune response in models of autoimmunity including inflammatory bowel disease and provide a rationale for use of probiotics in HIV-1/AIDS. Disturbance of the microbiota early in HIV-1 infection leads to greater dominance of potential pathogens, reducing levels of bifidobacteria and lactobacillus species and increasing mucosal inflammation. The interaction of chronic or recurrent infections, and immune activation contributes to nutritional deficiencies that have lasting consequences especially in the HIV-1 infected child. While effective anti-retroviral therapy (ART has enhanced survival, wasting is still an independent predictor of survival and a major presenting symptom. Congenital exposure to HIV-1 is a risk factor for growth delay in both infected and non-infected infants. Nutritional intervention after 6 months of age appears to be largely ineffective. A meta analysis of randomized, controlled clinical trials of infant formulae supplemented with Bifidobacterium lactis showed that weight gain was significantly greater in infants who received B. lactis compared to
Analysis of the toxicity of gold nano particles on the immune system: effect on dendritic cell functions

International Nuclear Information System (INIS)

Villiers, Christian L.; Freitas, Heidi; Couderc, Rachel; Villiers, Marie-Bernadette; Marche, Patrice N.

2010-01-01

The effect of manufactured gold nanoparticles (NPs) on the immune system was analysed through their ability to perturb the functions of dendritic cells (DCs), a major actor of both innate and acquired immune responses. For this purpose, DCs were produced in culture from mouse bone marrow progenitors. The analysis of the viability of the cells after their incubation in the presence of gold NPs shows that these NPs are not cytotoxics even at high concentration. Furthermore, the phenotype of the DC is unchanged after the addition of NPs, indicating that there is no activation of the DC. However, the analysis of the cells at the intracellular level reveals important amounts of gold NPs amassing in endocytic compartments. Furthermore, the secretion of cytokines is significantly modified after such internalisation indicating a potential perturbation of the immune response.
Asian and Siberian ginseng as a potential modulator of immune function: an in vitro cytokine study using mouse macrophages.

Science.gov (United States)

Wang, Huamin; Actor, Jeffrey K; Indrigo, Jessica; Olsen, Margaret; Dasgupta, Amitava

2003-01-01

Ginseng is a widely used herbal product in China, other Asian countries, and in the Unites States. There is a traditional belief that ginseng stimulates immune functions. In this study, the innate effects of Asian and Siberian ginsengs on cytokines and chemokines produced by cultured macrophages were examined. The effects of Asian and Siberian ginseng on cytokines and chemokines produced by cultured macrophages were examined. Mouse macrophages (J774A.1) were incubated with Asian or Siberian ginseng at varying concentrations (1, 10, 100, and 1000 microg/ml) for 24 h and then harvested for RNA isolation. The expression levels of IL-1beta, IL-12, TNF-alpha, MIP-1 alpha, and MIP-2 mRNA were measured by quantitative PCR. Our data showed that Asian ginseng induced a statistically significant increase in IL-12 expression at both mRNA and protein levels. However, the minor twofold increase is probably biologically insignificant. No significant increase of IL-12 by Siberian ginseng was observed at any dose level studied. No significant change in IL-1beta, IL-15, TNF-alpha, or MIP-1alpha mRNA was observed by either Asian or Siberian ginseng treatment. Our data showed statistically significant differential regulation of IL-12 by Asian ginseng. Siberian ginseng did not show a statistically significant increase. We conclude that both Asian ginseng and Siberian ginseng cannot significantly stimulate innate macrophage immune functions that influence cellular immune responses. Therefore, contrary to the popular belief, Asian and Siberian ginseng may not stimulate immune function.
Effects of methotrexate combined with hydroxychloroquine sulfate and prednisone acetate on inflammatory response, immune function and liver and renal function in patients with systemic lupus erythematosus

Directory of Open Access Journals (Sweden)

Jiang-Li Xia

2017-11-01

Full Text Available Objective: To investigate the effects of methotrexate and hydroxychloroquine sulfate and prednisone on inflammatory response, immune function, liver and renal function in patients with systemic lupus erythematosus (SLE. Methods: A total of 80 cases of SLE patients according to the random data table were divided into the control group (n=40 and observation group (n=40, the control group were treated with hydroxychloroquine sulfate and prednisone treatment, on the basis of treatment of the control group, patients in the observation group in the control group were treated with methotrexate, the levels of inflammatory factors, immune function, liver and kidney function indexes in the two groups between the before treatment and after treatment were compared. Results: Comparison of the levels before treatment, the difference of the CRP, WBC, ESR, IgA, IgG, complement C3, complement C4, ALT, AST, SCr and BUN levels were not statistically significant. After treatment, the levels of CRP, ESR, IgA, IgG, ALT, AST, SCr and BUN in the observation group were significantly lower than those in the control group, and the difference was statistically significant. The levels of WBC and complement C4 in the observation group [(5.18±1.08伊10 9 /L, (0.22±0.05 g/L] were significantly higher than those in the control group [(4.51±0.52伊10 9 /L, (0.18±0.03 g/L], and there was no significant difference in the level of complement C3 between the two groups after treatment. Conclusion: Methotrexate combined with hydroxychloroquine sulfate and prednisone for the treatment of SLE can effectively reduce inflammation, improve immune function, has little effect on kidney function, high safety, which has an important clinical value.
Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin

Directory of Open Access Journals (Sweden)

Zhi Li

2018-02-01

Full Text Available In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s, by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.
Ageing and the immune system: focus on macrophages.

Science.gov (United States)

Linehan, E; Fitzgerald, D C

2015-03-01

A fully functioning immune system is essential in order to maintain good health. However, the immune system deteriorates with advancing age, and this contributes to increased susceptibility to infection, autoimmunity, and cancer in the older population. Progress has been made in identifying age-related defects in the adaptive immune system. In contrast, relatively little research has been carried out on the impact of ageing on the innate immune response. This area requires further research as the innate immune system plays a crucial role in protection against infection and represents a first line of defence. Macrophages are central effector cells of the innate immune system and have many diverse functions. As a result, age-related impairments in macrophage function are likely to have important consequences for the health of the older population. It has been reported that ageing in macrophages impacts on many processes including toll-like receptor signalling, polarisation, phagocytosis, and wound repair. A detailed understanding of the impact of ageing on macrophages is required in order to develop therapeutics that will boost immune responses in the older population.
Study of immune function in children with thalassanemia major after partial splenic embolization

International Nuclear Information System (INIS)

Mei Quelin; Liu Pengcheng; Chen Yong; Li Yanhao

2006-01-01

Objective: To evaluate the changes of immunologic function in children with thalassanemia major after partial splenic embolization (PSE). Methods: Immunoglobulins, T cell subsets were detected by immunologic turbidimetry and APAAP with monoclonal antibody respectively in 40 children with thalassanemia major and also in 20 healthy persons before and after PSE. These immunologic indexes were compared before and after PSE. Results: The levels of IgG in serum were significantly lower one week after PSE than that before PSE. It turned to normal three weeks after PSE. The IgM, IgA levels remained unchanged during PSE. The levels of CD 3 , CD 4 ,CD 4 /CD 8 ratio in children with thalassanemia major were decreased (P<0.01) significantly in comparision with the normal controls. But , all of them were significantly increased after PSE than those before PSE (P<0.01), and returned to normal levels at the 3rd week. Conclusions: PSE is helpful for improving immunologic function of children with thalassanemia major. (authors)
Role of vascular normalization in benefit from metronomic chemotherapy.

Science.gov (United States)

Mpekris, Fotios; Baish, James W; Stylianopoulos, Triantafyllos; Jain, Rakesh K

2017-02-21

Metronomic dosing of chemotherapy-defined as frequent administration at lower doses-has been shown to be more efficacious than maximum tolerated dose treatment in preclinical studies, and is currently being tested in the clinic. Although multiple mechanisms of benefit from metronomic chemotherapy have been proposed, how these mechanisms are related to one another and which one is dominant for a given tumor-drug combination is not known. To this end, we have developed a mathematical model that incorporates various proposed mechanisms, and report here that improved function of tumor vessels is a key determinant of benefit from metronomic chemotherapy. In our analysis, we used multiple dosage schedules and incorporated interactions among cancer cells, stem-like cancer cells, immune cells, and the tumor vasculature. We found that metronomic chemotherapy induces functional normalization of tumor blood vessels, resulting in improved tumor perfusion. Improved perfusion alleviates hypoxia, which reprograms the immunosuppressive tumor microenvironment toward immunostimulation and improves drug delivery and therapeutic outcomes. Indeed, in our model, improved vessel function enhanced the delivery of oxygen and drugs, increased the number of effector immune cells, and decreased the number of regulatory T cells, which in turn killed a larger number of cancer cells, including cancer stem-like cells. Vessel function was further improved owing to decompression of intratumoral vessels as a result of increased killing of cancer cells, setting up a positive feedback loop. Our model enables evaluation of the relative importance of these mechanisms, and suggests guidelines for the optimal use of metronomic therapy.
Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

International Nuclear Information System (INIS)

Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.

1986-01-01

Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway
Dendritic cells in peripheral tolerance and immunity

DEFF Research Database (Denmark)

Gad, Monika; Claesson, Mogens Helweg; Pedersen, Anders Elm

2003-01-01

Dendritic cells capable of influencing immunity exist as functionally distinct subsets, T cell-tolerizing and T cell-immunizing subsets. The present paper reviews how these subsets of DCs develop, differentiate and function in vivo and in vitro at the cellular and molecular level. In particular...
Tsetse immune system maturation requires the presence of obligate symbionts in larvae.

Directory of Open Access Journals (Sweden)

Brian L Weiss

2011-05-01

Full Text Available Beneficial microbial symbionts serve important functions within their hosts, including dietary supplementation and maintenance of immune system homeostasis. Little is known about the mechanisms that enable these bacteria to induce specific host phenotypes during development and into adulthood. Here we used the tsetse fly, Glossina morsitans, and its obligate mutualist, Wigglesworthia glossinidia, to investigate the co-evolutionary adaptations that influence the development of host physiological processes. Wigglesworthia is maternally transmitted to tsetse's intrauterine larvae through milk gland secretions. We can produce flies that lack Wigglesworthia (Gmm(Wgm- yet retain their other symbiotic microbes. Such offspring give rise to adults that exhibit a largely normal phenotype, with the exception being that they are reproductively sterile. Our results indicate that when reared under normal environmental conditions Gmm(Wgm- adults are also immuno-compromised and highly susceptible to hemocoelic E. coli infections while age-matched wild-type individuals are refractory. Adults that lack Wigglesworthia during larval development exhibit exceptionally compromised cellular and humoral immune responses following microbial challenge, including reduced expression of genes that encode antimicrobial peptides (cecropin and attacin, hemocyte-mediated processes (thioester-containing proteins 2 and 4 and prophenoloxidase, and signal-mediating molecules (inducible nitric oxide synthase. Furthermore, Gmm(Wgm- adults harbor a reduced population of sessile and circulating hemocytes, a phenomenon that likely results from a significant decrease in larval expression of serpent and lozenge, both of which are associated with the process of early hemocyte differentiation. Our results demonstrate that Wigglesworthia must be present during the development of immature progeny in order for the immune system to function properly in adult tsetse. This phenomenon provides
Functional analysis of PGRP-LA in Drosophila immunity.

Directory of Open Access Journals (Sweden)

Mathilde Gendrin

Full Text Available PeptidoGlycan Recognition Proteins (PGRPs are key regulators of the insect innate antibacterial response. Even if they have been intensively studied, some of them have yet unknown functions. Here, we present a functional analysis of PGRP-LA, an as yet uncharacterized Drosophila PGRP. The PGRP-LA gene is located in cluster with PGRP-LC and PGRP-LF, which encode a receptor and a negative regulator of the Imd pathway, respectively. Structure predictions indicate that PGRP-LA would not bind to peptidoglycan, pointing to a regulatory role of this PGRP. PGRP-LA expression was enriched in barrier epithelia, but low in the fat body. Use of a newly generated PGRP-LA deficient mutant indicates that PGRP-LA is not required for the production of antimicrobial peptides by the fat body in response to a systemic infection. Focusing on the respiratory tract, where PGRP-LA is strongly expressed, we conducted a genome-wide microarray analysis of the tracheal immune response of wild-type, Relish, and PGRP-LA mutant larvae. Comparing our data to previous microarray studies, we report that a majority of genes regulated in the trachea upon infection differ from those induced in the gut or the fat body. Importantly, antimicrobial peptide gene expression was reduced in the tracheae of larvae and in the adult gut of PGRP-LA-deficient Drosophila upon oral bacterial infection. Together, our results suggest that PGRP-LA positively regulates the Imd pathway in barrier epithelia.
Carcinogenesis: alterations in reciprocal interactions of normal functional structure of biologic systems.

Science.gov (United States)

Davydyan, Garri

2015-12-01

The evolution of biologic systems (BS) includes functional mechanisms that in some conditions may lead to the development of cancer. Using mathematical group theory and matrix analysis, previously, it was shown that normally functioning BS are steady functional structures regulated by three basis regulatory components: reciprocal links (RL), negative feedback (NFB) and positive feedback (PFB). Together, they form an integrative unit maintaining system's autonomy and functional stability. It is proposed that phylogenetic development of different species is implemented by the splitting of "rudimentary" characters into two relatively independent functional parts that become encoded in chromosomes. The functional correlate of splitting mechanisms is RL. Inversion of phylogenetic mechanisms during ontogenetic development leads cell differentiation until cells reach mature states. Deterioration of reciprocal structure in the genome during ontogenesis gives rise of pathological conditions characterized by unsteadiness of the system. Uncontrollable cell proliferation and invasive cell growth are the leading features of the functional outcomes of malfunctioning systems. The regulatory element responsible for these changes is RL. In matrix language, pathological regulation is represented by matrices having positive values of diagonal elements ( TrA > 0) and also positive values of matrix determinant ( detA > 0). Regulatory structures of that kind can be obtained if the negative entry of the matrix corresponding to RL is replaced with the positive one. To describe not only normal but also pathological states of BS, a unit matrix should be added to the basis matrices representing RL, NFB and PFB. A mathematical structure corresponding to the set of these four basis functional patterns (matrices) is a split quaternion (coquaternion). The structure and specific role of basis elements comprising four-dimensional linear space of split quaternions help to understand what
3,3′-Diindolylmethane Stimulates Murine Immune Function In Vitro and In Vivo*

OpenAIRE

Xue, Ling; Pestka, James J.; Li, Maoxiang; Firestone, Gary L; Bjeldanes, Leonard F.

2007-01-01

3,3′-Diindolylmethane (DIM), a major condensation product of indole-3-carbinol (I3C), exhibits chemopreventive properties in animal models of cancer. Recent studies have shown that DIM stimulates interferon-gamma (IFN-γ) production and potentiates the IFN-γ signaling pathway in human breast cancer cells via a mechanism that includes increased expression of the IFN-γ receptor. The goal of this study was to test the hypothesis that DIM modulates the murine immune function. Specifically, the eff...

Functional characterization of Foxp3-specific spontaneous immune responses

DEFF Research Database (Denmark)

Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

2013-01-01

Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....
Left ventricular functional, structural and energetic effects of normal aging: Comparison with hypertension.

Directory of Open Access Journals (Sweden)

Jehill D Parikh

Full Text Available Both aging and hypertension are significant risk factors for heart failure in the elderly. The purpose of this study was to determine how aging, with and without hypertension, affects left ventricular function.Cross-sectional study of magnetic resonance imaging and 31P spectroscopy-based measurements of left ventricular structure, global function, strains, pulse wave velocity, high energy phosphate metabolism in 48 normal subjects and 40 treated hypertensive patients (though no other cardiovascular disease or diabetes stratified into 3 age deciles from 50-79 years.Normal aging was associated with significant increases in systolic blood pressure, vascular stiffness, torsion, and impaired diastolic function (all P<0.05. Age-matched hypertension exacerbated the effects of aging on systolic pressure, and diastolic function. Hypertension alone, and not aging, was associated with increased left ventricular mass index, reduced energetic reserve, reduced longitudinal shortening and increased endocardial circumferential shortening (all P<0.05. Multiple linear regression analysis showed that these unique hypertensive features were significantly related to systolic blood pressure (P<0.05.1 Hypertension adds to the age-related changes in systolic blood pressure and diastolic function; 2 hypertension is uniquely associated with changes in several aspects of left ventricular structure, function, systolic strains, and energetics; and 3 these uniquely hypertensive-associated parameters are related to the level of systolic blood pressure and so are potentially modifiable.
CD8(+)NKT-like cells regulate the immune response by killing antigen-bearing DCs.

Science.gov (United States)

Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

2015-09-15

CD1d-dependent NKT cells have been extensively studied; however, the function of CD8(+)NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8(+)NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8(+)NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8(+)NKT-like cell development is normal in CD1d(-/-) mice, which suggests that CD8(+)NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8(+)NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8(+)NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8(+)NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens.
CD8+NKT-like cells regulate the immune response by killing antigen-bearing DCs

Science.gov (United States)

Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

2015-01-01

CD1d-dependent NKT cells have been extensively studied; however, the function of CD8+NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8+NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8+NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8+NKT-like cell development is normal in CD1d−/− mice, which suggests that CD8+NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8+NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8+NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8+NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens. PMID:26369936
Connection between Dynamically Derived Initial Mass Function Normalization and Stellar Population Parameters

NARCIS (Netherlands)

McDermid, Richard M.; Cappellari, Michele; Alatalo, Katherine; Bayet, Estelle; Blitz, Leo; Bois, Maxime; Bournaud, Frédéric; Bureau, Martin; Crocker, Alison F.; Davies, Roger L.; Davis, Timothy A.; de Zeeuw, P. T.; Duc, Pierre-Alain; Emsellem, Eric; Khochfar, Sadegh; Krajnović, Davor; Kuntschner, Harald; Morganti, Raffaella; Naab, Thorsten; Oosterloo, Tom; Sarzi, Marc; Scott, Nicholas; Serra, Paolo; Weijmans, Anne-Marie; Young, Lisa M.

We report on empirical trends between the dynamically determined stellar initial mass function (IMF) and stellar population properties for a complete, volume-limited sample of 260 early-type galaxies from the ATLAS3D project. We study trends between our dynamically derived IMF normalization αdyn ≡
Immune Evasion, Immunopathology and the Regulation of the Immune System

Directory of Open Access Journals (Sweden)

Bruno Faivre

2013-02-01

Full Text Available Costs and benefits of the immune response have attracted considerable attention in the last years among evolutionary biologists. Given the cost of parasitism, natural selection should favor individuals with the most effective immune defenses. Nevertheless, there exists huge variation in the expression of immune effectors among individuals. To explain this apparent paradox, it has been suggested that an over-reactive immune system might be too costly, both in terms of metabolic resources and risks of immune-mediated diseases, setting a limit to the investment into immune defenses. Here, we argue that this view neglects one important aspect of the interaction: the role played by evolving pathogens. We suggest that taking into account the co-evolutionary interactions between the host immune system and the parasitic strategies to overcome the immune response might provide a better picture of the selective pressures that shape the evolution of immune functioning. Integrating parasitic strategies of host exploitation can also contribute to understand the seemingly contradictory results that infection can enhance, but also protect from, autoimmune diseases. In the last decades, the incidence of autoimmune disorders has dramatically increased in wealthy countries of the northern hemisphere with a concomitant decrease of most parasitic infections. Experimental work on model organisms has shown that this pattern may be due to the protective role of certain parasites (i.e., helminths that rely on the immunosuppression of hosts for their persistence. Interestingly, although parasite-induced immunosuppression can protect against autoimmunity, it can obviously favor the spread of other infections. Therefore, we need to think about the evolution of the immune system using a multidimensional trade-off involving immunoprotection, immunopathology and the parasitic strategies to escape the immune response.
Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.

Science.gov (United States)

Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit

2016-01-01

Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.
Development of immune functionality in larval and juvenile crimson snapper Lutjanus erythropterus (Bloch 1790

Directory of Open Access Journals (Sweden)

Ke Cui

2018-05-01

Full Text Available Ontogenetic development of the immune system in crimson snapper (Lutjanus erythropterus Bloch 1790 larvae was histologically and enzymatically studied from hatch to 36 days post-hatch (DPH. Primitive hepatopancreas appeared on 2 DPH and renal tubules started hematopoiesis on 4 DPH. The spleen anlage appeared on 6 DPH and the thymus formed on 14 DPH. Total activities of superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPX and sodium-potassium adenosine triphosphatase (Na+ K+-ATPase gradually increased after hatch, and showed a sharp increase after 29 DPH during the transitional feeding period from Artemia to inert feed. The specific activities of SOD, CAT, and GPX showed a trend of sharp increase and reached the maximum level on 4 DPH when exogenous feeding started, except for Na+ K+-ATPase where the peak occurred on10 DPH. The specific activities of these five enzymes reached the peak during the food transition from rotifers to Artemia, but the total activity of enzymes showed an increasing trend as fish grew. The present study provides new knowledge of the development of functional enzymes relevant to fish larvae immunity, sheds light on the understanding of the change of larval health, and improves hatchery management of crimson snapper. Keywords: Immune system, Enzyme activity, Ontogenetic development, Crimson snapper Lutjanus erythropterus
Innate immune reconstitution with suppression of HIV-1.

Science.gov (United States)

Scully, Eileen P; Lockhart, Ainsley; Garcia-Beltran, Wilfredo; Palmer, Christine D; Musante, Chelsey; Rosenberg, Eric; Allen, Todd M; Chang, J Judy; Bosch, Ronald J; Altfeld, Marcus

2016-03-17

Progressive HIV-1 infection leads to both profound immune suppression and pathologic inflammation in the majority of infected individuals. While adaptive immune dysfunction, as evidenced by CD4 + T cell depletion and exhaustion, has been extensively studied, less is known about the functional capacity of innate immune cell populations in the context of HIV-1 infection. Given the broad susceptibility to opportunistic infections and the dysregulated inflammation observed in progressive disease, we hypothesized that there would be significant changes in the innate cellular responses. Using a cohort of patients with multiple samplings before and after antiretroviral therapy (ART) initiation, we demonstrated increased responses to innate immune stimuli following viral suppression, as measured by the production of inflammatory cytokines. Plasma viral load itself had the strongest association with this change in innate functional capacity. We further identified epigenetic modifications in the TNFA promoter locus in monocytes that are associated with viremia, suggesting a molecular mechanism for the observed changes in innate immune function following initiation of ART. These data indicate that suppression of HIV-1 viremia is associated with changes in innate cellular function that may in part determine the restoration of protective immune responses.
Good news – bad news: the Yin and Yang of immune privilege in the eye

Directory of Open Access Journals (Sweden)

John Vincent Forrester

2012-11-01

Full Text Available The eye and the brain are prototypical tissues manifesting immune privilege (IP in which immune responses to foreign antigens, particularly alloantigens are suppressed, and even completely inhibited. Explanations for this phenomenon are numerous and mostly reflect our evolving understanding of the molecular and cellular processes underpinning immunological responses generally. IP is now viewed as a property of many tissues and the level of expression of IP varies not only with the tissue but with the nature of the foreign antigen and changes in the limited conditions under which privilege can operate as a mechanism of immunological tolerance. As a result, IP functions normally as a homeostatic mechanism preserving normal function in tissues, particularly those with highly specialised function and limited capacity for renewal such as the eye and brain. However, IP is relatively easily bypassed in the face of a sufficiently strong immunological response, and the privileged tissues may be at greater risk of collateral damage because of its natural defences are more easily breached than in a fully immunocompetent tissue which rapidly rejects foreign antigen and can restores integrity. This two-edged sword cuts its swathe through the eye: under most circumstances, IP mechanisms such as blood ocular barriers, intraocular immune modulators, induction of T regulatory cells, lack of lymphatics and other properties maintain tissue integrity; however, when these are breached, various degrees of tissue damage occur from severe tissue destruction in retinal viral infections and other forms of uveoretinal inflammation, to less severe inflammatory responses in conditions such as macular degeneration. Conversely, ocular IP and tumour-related IP can combine to permit extensive tumour growth and increased risk of metastasis thus threatening the survival of the host.
Normal Forms for Retarded Functional Differential Equations and Applications to Bogdanov-Takens Singularity

Science.gov (United States)

Faria, T.; Magalhaes, L. T.

The paper addresses, for retarded functional differential equations (FDEs), the computation of normal forms associated with the flow on a finite-dimensional invariant manifold tangent to invariant spaces for the infinitesimal generator of the linearized equation at a singularity. A phase space appropriate to the computation of these normal forms is introduced, and adequate nonresonance conditions for the computation of the normal forms are derived. As an application, the general situation of Bogdanov-Takens singularity and its versal unfolding for scalar retarded FDEs with nondegeneracy at second order is considered, both in the general case and in the case of differential-delay equations of the form ẋ( t) = ƒ( x( t), x( t-1)).
Plasmodium falciparum erythrocyte invasion: combining function with immune evasion.

Directory of Open Access Journals (Sweden)

Gavin J Wright

2014-03-01

Full Text Available All the symptoms and pathology of malaria are caused by the intraerythrocytic stages of the Plasmodium parasite life cycle. Because Plasmodium parasites cannot replicate outside a host cell, their ability to recognize and invade erythrocytes is an essential step for both parasite survival and malaria pathogenesis. This makes invasion a conceptually attractive vaccine target, especially because it is one of the few stages when the parasite is directly exposed to the host humoral immune system. This apparent vulnerability, however, has been countered by the parasite, which has evolved sophisticated molecular mechanisms to evade the host immune response so that parasites asymptomatically replicate within immune individuals. These mechanisms include the expansion of parasite invasion ligands, resulting in multiple and apparently redundant invasion "pathways", highly polymorphic parasite surface proteins that are immunologically distinct, and parasite proteins which are poorly immunogenic. These formidable defences have so far thwarted attempts to develop an effective blood-stage vaccine, leading many to question whether there really is an exploitable chink in the parasite's immune evasion defences. Here, we review recent advances in the molecular understanding of the P. falciparum erythrocyte invasion field, discuss some of the challenges that have so far prevented the development of blood-stage vaccines, and conclude that the parasite invasion ligand RH5 represents an essential pinch point that might be vulnerable to vaccination.
Mucosal immunity in HIV infection: what can be done to restore gastrointestinal-associated lymphoid tissue function?

Science.gov (United States)

George, Michael D; Asmuth, David M

2014-06-01

This review describes the impact of HIV infection on gut-associated lymphoid tissue, the mechanisms for persistent gut-associated lymphoid tissue dysfunction despite effective antiretroviral therapy, and potential strategies to restore gut-associated lymphoid tissue function and promote immune reconstitution. Recent studies indicate that unresolved microbial translocation and intestinal dysbiosis may continue to promote enteropathy as well as HIV-associated and non-HIV-associated conditions in many HIV patients who otherwise maintain therapeutic control of systemic viral replication. Several novel therapeutic approaches to reduce intestinal inflammation and mitigate microbial translocation may hold promise for restoring gastrointestinal health and thereby increasing the efficacy of immune reconstitution in HIV-infected patients undergoing antiretroviral therapy.
AMP-activated protein kinase regulates lymphocyte responses to metabolic stress but is largely dispensable for immune cell development and function.

Science.gov (United States)

Mayer, Alice; Denanglaire, Sébastien; Viollet, Benoit; Leo, Oberdan; Andris, Fabienne

2008-04-01

AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, represents an energy sensor able to adapt cellular metabolism in response to nutritional environmental variations. TCR stimulation activates AMPK, a regulatory event that is known to stimulate ATP-producing processes, possibly in anticipation of the increased energetic needs associated with cell division and expression of effector function. Taking advantage of the selective expression of the AMPKalpha1 catalytic subunit in lymphoid cells, we have analyzed the in vitro and in vivo capacity of lymphocytes lacking AMPK activity (AMPKalpha1-KO cells) to respond to metabolic stress and to initiate and sustain an immune response. AMPKalpha1-KO cells displayed increasing sensitivity to energetic stress in vitro, and were found unable to maintain adequate ATP levels in response to ATP synthase inhibition. These cells were, however, able to respond to antigen stimulation in vitro, as shown by optimal proliferation and cytokine production. Similarly, AMPKalpha1-KO mice were fully immunocompetent in vivo and displayed normal cell proliferation, humoral, cytotoxic and delayed-type hypersensitivity (DTH) responses following antigen injection. In conclusion, AMPK represents an important enzyme allowing lymphocytes to resist a mild energy crisis in vitro, but is largely dispensable for activation and expression of effector function in response to antigen stimulation.
Immune regulation and CNS autoimmune disease

DEFF Research Database (Denmark)

Antel, J P; Owens, T

1999-01-01

The central nervous system is a demonstrated target of both clinical and experimental immune mediated disorders. Immune regulatory mechanisms operative at the levels of the systemic immune system, the blood brain barrier, and within the CNS parenchyma are important determinants of the intensity...... and duration of the tissue directed injury. Convergence of research, involving direct manipulation of specific cells and molecular mediators in animal models and in vitro analysis of human immune and neural cells and tissues, is providing increasing insight into the role of these immune regulatory functions...
Intestinal dendritic cells in the regulation of mucosal immunity

DEFF Research Database (Denmark)

Bekiaris, Vasileios; Persson, Emma K.; Agace, William Winston

2014-01-01

immune cells within the mucosa must suitably respond to maintain intestinal integrity, while also providing the ability to mount effective immune responses to potential pathogens. Dendritic cells (DCs) are sentinel immune cells that play a central role in the initiation and differentiation of adaptive....... The recognition that dietary nutrients and microbial communities in the intestine influence both mucosal and systemic immune cell development and function as well as immune-mediated disease has led to an explosion of literature in mucosal immunology in recent years and a growing interest in the functionality...
Immunity to VHS virus in rainbow trout

DEFF Research Database (Denmark)

Lorenzen, Niels; Olesen, Niels Jørgen; Koch, C.

1999-01-01

Viral hemorrhagic septicemia virus (VHSV) is the rhabdovirus that causes most disease problems in farmed rainbow trout in Europe. Survivors of infection are usually immune to reinfection but as with other fish viruses, development of a modern recombinant vaccine has been complicated by the limited...... knowledge of the immune mechanisms and antigens involved in induction of immunity. Neutralizing and protective monoclonal antibodies recognize the envelope glycoprotein (G protein) which is the only viral protein known to be present on the surface of the virus particle. Immunoblotting analyses...... with monoclonal antibodies as well as with sera from immunized trout have indicated that protein conformation plays an important role in neutralization epitopes. The virus neutralizing activity often found in sera from convalescent trout is highly dependent on a poorly defined complementing activity in normal...
Targeting CD28, CTLA-4 and PD-L1 costimulation differentially controls immune synapses and function of human regulatory and conventional T-cells.

Directory of Open Access Journals (Sweden)

Nahzli Dilek

Full Text Available CD28, CTLA-4 and PD-L1, the three identified ligands for CD80/86, are pivotal positive and negative costimulatory molecules that, among other functions, control T cell motility and formation of immune synapse between T cells and antigen-presenting cells (APCs. What remains incompletely understood is how CD28 leads to the activation of effector T cells (Teff but inhibition of suppression by regulatory T cells (Tregs, while CTLA-4 and PD-L1 inhibit Teff function but are crucial for the suppressive function of Tregs. Using alloreactive human T cells and blocking antibodies, we show here by live cell dynamic microscopy that CD28, CTLA-4, and PD-L1 differentially control velocity, motility and immune synapse formation in activated Teff versus Tregs. Selectively antagonizing CD28 costimulation increased Treg dwell time with APCs and induced calcium mobilization which translated in increased Treg suppressive activity, in contrast with the dampening effect on Teff responses. The increase in Treg suppressive activity after CD28 blockade was also confirmed with polyclonal Tregs. Whereas CTLA-4 played a critical role in Teff by reversing TCR-induced STOP signals, it failed to affect motility in Tregs but was essential for formation of the Treg immune synapse. Furthermore, we identified a novel role for PD-L1-CD80 interactions in suppressing motility specifically in Tregs. Thus, our findings reveal that the three identified ligands of CD80/86, CD28, CTLA-4 and PD-L1, differentially control immune synapse formation and function of the human Teff and Treg cells analyzed here. Individually targeting CD28, CTLA-4 and PD-L1 might therefore represent a valuable therapeutic strategy to treat immune disorders where effector and regulatory T cell functions need to be differentially targeted.
Plasma-mediated immune suppression : a neonatal perspective

NARCIS (Netherlands)

Belderbos, Mirjam E.; Levy, Ofer; Meyaard, Linde; Bont, Louis

Plasma is a rich mixture of immune regulatory factors that shape immune cell function. This immunomodulatory role of plasma is especially important in neonates. To maintain in utero feto-maternal tolerance and to allow for microbial colonization after birth, the neonatal immune system is biased
Effects of prenatal yoga on women's stress and immune function across pregnancy: A randomized controlled trial.

Science.gov (United States)

Chen, Pao-Ju; Yang, Luke; Chou, Cheng-Chen; Li, Chia-Chi; Chang, Yu-Cune; Liaw, Jen-Jiuan

2017-04-01

The effects of prenatal yoga on biological indicators have not been widely studied. Thus, we compared changes in stress and immunity salivary biomarkers from 16 to 36 weeks' gestation between women receiving prenatal yoga and those receiving routine prenatal care. For this longitudinal, prospective, randomized controlled trial, we recruited 94 healthy pregnant women at 16 weeks' gestation through convenience sampling from a prenatal clinic in Taipei. Participants were randomly assigned to intervention (n=48) or control (n=46) groups using Clinstat block randomization. The 20-week intervention comprised two weekly 70-min yoga sessions led by a midwife certified as a yoga instructor; the control group received only routine prenatal care. In both groups, participants' salivary cortisol and immunoglobulin A levels were collected before and after yoga every 4 weeks from 16 to 36 weeks' gestation. The intervention group had lower salivary cortisol (pcontrol group. Specifically, the intervention group had significantly higher long-term salivary immunoglobulin A levels than the control group (p=0.018), and infants born to women in the intervention group weighed more than those born to the control group (pPrenatal yoga significantly reduced pregnant women's stress and enhanced their immune function. Clinicians should learn the mechanisms of yoga and its effects on pregnant women. Our findings can guide clinicians to help pregnant women alleviate their stress and enhance their immune function. Copyright © 2017. Published by Elsevier Ltd.

Adaptive immunity and histopathology in frog virus 3-infected Xenopus

International Nuclear Information System (INIS)

Robert, Jacques; Morales, Heidi; Buck, Wayne; Cohen, Nicholas; Marr, Shauna; Gantress, Jennifer

2005-01-01

Xenopus has been used as an experimental model to evaluate the contribution of adaptive cellular immunity in amphibian host susceptibility to the emerging ranavirus FV3. Conventional histology and immunohistochemistry reveal that FV3 has a strong tropism for the proximal tubular epithelium of the kidney and is rarely disseminated elsewhere in Xenopus hosts unless their immune defenses are impaired or developmentally immature as in larvae. In such cases, virus is found widespread in most tissues. Adults, immunocompromised by depletion of CD8 + T cells or by sub-lethal γ-irradiation, show increased susceptibility to FV3 infection. Larvae and irradiated (but not normal) adults can be cross-infected through water by infected adult conspecifics (irradiated or not). The natural MHC class I deficiency and the absence of effect of anti-CD8 treatment on both larval CD8 + T cells and larval susceptibility to FV3 are consistent with an inefficient CD8 + T cell effector function during this developmental period
Lysozyme's lectin-like characteristics facilitates its immune defense function

KAUST Repository

Zhang, Ruiyan

2017-06-06

Interactions between human lysozyme (HL) and the lipopolysaccharide (LPS) of Klebsiella pneumoniae O1, a causative agent of lung infection, were identified by surface plasmon resonance. To characterize the molecular mechanism of this interaction, HL binding to synthetic disaccharides and tetrasaccharides representing one and two repeating units, respectively, of the O-chain of this LPS were studied. pH-dependent structural rearrangements of HL after interaction with the disaccharide were observed through nuclear magnetic resonance. The crystal structure of the HL-tetrasaccharide complex revealed carbohydrate chain packing into the A, B, C, and D binding sites of HL, which primarily occurred through residue-specific, direct or water-mediated hydrogen bonds and hydrophobic contacts. Overall, these results support a crucial role of the Glu35/Asp53/Trp63/Asp102 residues in HL binding to the tetrasaccharide. These observations suggest an unknown glycan-guided mechanism that underlies recognition of the bacterial cell wall by lysozyme and may complement the HL immune defense function.
Lysozyme's lectin-like characteristics facilitates its immune defense function

KAUST Repository

Zhang, Ruiyan; Wu, Lisha; Eckert, Thomas; Burg-Roderfeld, Monika; Rojas-Macias, Miguel A.; Lü tteke, Thomas; Krylov, Vadim B.; Argunov, Dmitry A.; Datta, Aritreyee; Markart, Philipp; Guenther, Andreas; Norden, Bengt; Schauer, Roland; Bhunia, Anirban; Enani, Mushira Abdelaziz; Billeter, Martin; Scheidig, Axel J.; Nifantiev, Nikolay E.; Siebert, Hans-Christian

2017-01-01

Interactions between human lysozyme (HL) and the lipopolysaccharide (LPS) of Klebsiella pneumoniae O1, a causative agent of lung infection, were identified by surface plasmon resonance. To characterize the molecular mechanism of this interaction, HL binding to synthetic disaccharides and tetrasaccharides representing one and two repeating units, respectively, of the O-chain of this LPS were studied. pH-dependent structural rearrangements of HL after interaction with the disaccharide were observed through nuclear magnetic resonance. The crystal structure of the HL-tetrasaccharide complex revealed carbohydrate chain packing into the A, B, C, and D binding sites of HL, which primarily occurred through residue-specific, direct or water-mediated hydrogen bonds and hydrophobic contacts. Overall, these results support a crucial role of the Glu35/Asp53/Trp63/Asp102 residues in HL binding to the tetrasaccharide. These observations suggest an unknown glycan-guided mechanism that underlies recognition of the bacterial cell wall by lysozyme and may complement the HL immune defense function.
Antineutrophil cytoplasmic antibody–negative pauci-immune glomerulonephritis with massive intestinal bleeding

Directory of Open Access Journals (Sweden)

Miyeon Kim

2015-09-01

Full Text Available A 61-year-old woman was admitted to hospital because of generalized edema and proteinuria. Her renal function deteriorated rapidly. Serum immunoglobulin and complement levels were within normal ranges. An autoantibody examination showed negative for antinuclear antibody and antineutrophil cytoplasmic antibody. Histologic examination of a renal biopsy specimen revealed that all of the glomeruli had severe crescent formations with no immune deposits. The patient was treated with steroid pulse therapy with cyclophosphamide followed by oral prednisolone. Fifteen days later, she experienced massive recurrent hematochezia. Angiography revealed an active contrast extravasation in a branch of the distal ileal artery. We selectively embolized with a permanent embolic agent. On the 45th hospital day, the patient suddenly lost consciousness. Brain computed tomography showed intracerebral hemorrhage. We report a case of antineutrophil cytoplasmic antibody–negative pauci-immune glomerulonephritis with massive intestinal bleeding and cerebral hemorrhage.
The cell-mediated immunity of Drosophila melanogaster: hemocyte lineages, immune compartments, microanatomy and regulation.

Science.gov (United States)

Honti, Viktor; Csordás, Gábor; Kurucz, Éva; Márkus, Róbert; Andó, István

2014-01-01

In the animal kingdom, innate immunity is the first line of defense against invading pathogens. The dangers of microbial and parasitic attacks are countered by similar mechanisms, involving the prototypes of the cell-mediated immune responses, the phagocytosis and encapsulation. Work on Drosophila has played an important role in promoting an understanding of the basic mechanisms of phylogenetically conserved modules of innate immunity. The aim of this review is to survey the developments in the identification and functional definition of immune cell types and the immunological compartments of Drosophila melanogaster. We focus on the molecular and developmental aspects of the blood cell types and compartments, as well as the dynamics of blood cell development and the immune response. Further advances in the characterization of the innate immune mechanisms in Drosophila will provide basic clues to the understanding of the importance of the evolutionary conserved mechanisms of innate immune defenses in the animal kingdom. Copyright © 2013 Elsevier Ltd. All rights reserved.
Comparing Executive Function and Behavioral Inhibition in Schizophrenia, Bipolar Mood Disorder Type I and Normal Groups

Directory of Open Access Journals (Sweden)

Marziye Khodaee

2015-11-01

Full Text Available Introduction: Cognitive performance in patients with schizophrenia and Bipolar I disorder seems to be different from the normal individuals, that these defects affect their treatment results. Therefore, this study aimed to compare executive function and behavioral inhibition within patients suffering from schizophrenia, bipolar type I as well as a normal group. Methods: In this descriptive-comparative study, out of all patients hospitalized in daily psychiatric clinic in Najafabad in 2014 due to these disorders, 20 schizophrenia and 20 bipolar type I as well as 20 normal individuals were selected via the convinience sampling. All the study participants completed the computerizing tests including Tower of London and Go-No Go. The study data were analyzed utilizing SPSS software (ver 22 via MANOVA. Results: The study findings revealed a significant difference between the two patient groups and the normal group in regard with executive function and behavioral inhibition (p<0.05, whereas no differences were detected between schizophrenics and bipolar patient groups. Furthermore, patients suffering from schizophrenia and bipolar I mood disorder demonstrated significantly poor performance in cognitive function and behavioral inhibition compared to the normal group. Conclusion: The present study results can be significantly applied in pathology and therapy of these disorders, so as recognizing the inability of such patients can be effective in developing cognitive rehabilitation programs in these patients.
[The role of the innate immune system in atopic dermatitis].

Science.gov (United States)

Volz, T; Kaesler, S; Skabytska, Y; Biedermann, T

2015-02-01

The mechanisms how the innate immune system detects microbes and mounts a rapid immune response have been more and more elucidated in the past years. Subsequently it has been shown that innate immunity also shapes adaptive immune responses and determines their quality that can be either inflammatory or tolerogenic. As atopic dermatitis is characterized by disturbances of innate and adaptive immune responses, colonization with pathogens and defects in skin barrier function, insight into mechanisms of innate immunity has helped to understand the vicious circle of ongoing skin inflammation seen in atopic dermatitis patients. Elucidating general mechanisms of the innate immune system and its functions in atopic dermatitis paves the way for developing new therapies. Especially the novel insights into the human microbiome and potential functional consequences make the innate immune system a very fundamental and promising target. As a result atopic dermatitis manifestations can be attenuated or even resolved. These currently developed strategies will be introduced in the current review.
Intestinal stromal cells in mucosal immunity and homeostasis.

Science.gov (United States)

Owens, B M J; Simmons, A

2013-03-01

A growing body of evidence suggests that non-hematopoietic stromal cells of the intestine have multiple roles in immune responses and inflammation at this mucosal site. Despite this, many still consider gut stromal cells as passive structural entities, with past research focused heavily on their roles in fibrosis, tumor progression, and wound healing, rather than their contributions to immune function. In this review, we discuss our current knowledge of stromal cells in intestinal immunity, highlighting the many immunological axes in which stromal cells have a functional role. We also consider emerging data that broaden the potential scope of their contribution to immunity in the gut and argue that these so-called "non-immune" cells are reclassified in light of their diverse contributions to intestinal innate immunity and the maintenance of mucosal homeostasis.
EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

DEFF Research Database (Denmark)

Tetens, Inge

claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...
Modulation of immune homeostasis by commensal bacteria

Science.gov (United States)

Ivanov, Ivaylo I.; Littman, Dan R.

2011-01-01

Intestinal bacteria form a resident community that has co-evolved with the mammalian host. In addition to playing important roles in digestion and harvesting energy, commensal bacteria are crucial for the proper functioning of mucosal immune defenses. Most of these functions have been attributed to the presence of large numbers of “innocuous” resident bacteria that dilute or occupy niches for intestinal pathogens or induce innate immune responses that sequester bacteria in the lumen, thus quenching excessive activation of the mucosal immune system. However it has recently become obvious that commensal bacteria are not simply beneficial bystanders, but are important modulators of intestinal immune homeostasis and that the composition of the microbiota is a major factor in pre-determining the type and robustness of mucosal immune responses. Here we review specific examples of individual members of the microbiota that modify innate and adaptive immune responses, and we focus on potential mechanisms by which such species-specific signals are generated and transmitted to the host immune system. PMID:21215684
The middle ear immune defense changes with age

DEFF Research Database (Denmark)

Nielsen, Michelle Christine; Friis, Morten; Martin-Bertelsen, Tomas

2016-01-01

of this study was to analyze the relationship between age and the mucosal immune system in the middle ear. It is hypothesized that genes involved in the middle ear immune system will change with age. A comprehensive assessment of these genetic differences using the techniques of complementary DNA has not been...... performed. Complementary DNA microarray technology was used to identify immune-related genes differentially expressed between the normal middle ear mucosa of young (10 days old) and adult rats (80 days old). Data were analyzed using tools of bioinformatics. A total of 260 age-related genes were identified...
Necroptotic signaling in adaptive and innate immunity.

Science.gov (United States)

Lu, Jennifer V; Chen, Helen C; Walsh, Craig M

2014-11-01

The vertebrate immune system is highly dependent on cell death for efficient responsiveness to microbial pathogens and oncogenically transformed cells. Cell death pathways are vital to the function of many immune cell types during innate, humoral and cellular immune responses. In addition, cell death regulation is imperative for proper adaptive immune self-tolerance and homeostasis. While apoptosis has been found to be involved in several of these roles in immunity, recent data demonstrate that alternative cell death pathways are required. Here, we describe the involvement of a programmed form of cellular necrosis called "necroptosis" in immunity. We consider the signaling pathways that promote necroptosis downstream of death receptors, type I transmembrane proteins of the tumor necrosis factor (TNF) receptor family. The involvement of necroptotic signaling through a "RIPoptosome" assembled in response to innate immune stimuli or genotoxic stress is described. We also characterize the induction of necroptosis following antigenic stimulation in T cells lacking caspase-8 or FADD function. While necroptotic signaling remains poorly understood, it is clear that this pathway is an essential component to effective vertebrate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.
Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation

Science.gov (United States)

Ogonek, Justyna; Kralj Juric, Mateja; Ghimire, Sakhila; Varanasi, Pavankumar Reddy; Holler, Ernst; Greinix, Hildegard; Weissinger, Eva

2016-01-01

The timely reconstitution and regain of function of a donor-derived immune system is of utmost importance for the recovery and long-term survival of patients after allogeneic hematopoietic stem cell transplantation (HSCT). Of note, new developments such as umbilical cord blood or haploidentical grafts were associated with prolonged immunodeficiency due to delayed immune reconstitution, raising the need for better understanding and enhancing the process of immune reconstitution and finding strategies to further optimize these transplant procedures. Immune reconstitution post-HSCT occurs in several phases, innate immunity being the first to regain function. The slow T cell reconstitution is regarded as primarily responsible for deleterious infections with latent viruses or fungi, occurrence of graft-versus-host disease, and relapse. Here we aim to summarize the major steps of the adaptive immune reconstitution and will discuss the importance of immune balance in patients after HSCT. PMID:27909435
Model systems to analyze the role of miRNAs and commensal microflora in bovine mucosal immune system development.

Science.gov (United States)

Liang, Guanxiang; Malmuthuge, Nilusha; Guan, Le Luo; Griebel, Philip

2015-07-01

Information is rapidly accumulating regarding the role of miRNAs as key regulators of immune system development and function. It is also increasingly evident that miRNAs play an important role in host-pathogen interactions through regulation of both innate and acquired immune responses. Little is known, however, about the specific role of miRNAs in regulating normal development of the mucosal immune system, especially during the neonatal period. Furthermore, there is limited knowledge regarding the possible role the commensal microbiome may play in regulating mucosal miRNAs expression, although evidence is emerging that a variety of enteric pathogens influence miRNA expression. The current review focuses on recent information that miRNAs play an important role in regulating early development of the bovine mucosal immune system. A possible role for the commensal microbiome in regulating mucosal development by altering miRNA expression is also discussed. Finally, we explore the potential advantages of using the newborn calf as a model to determine how interactions between developmental programming, maternal factors in colostrum, and colonization of the gastrointestinal tract by commensal bacteria may alter mucosal miRNA expression and immune development. Identifying the key factors that regulate mucosal miRNA expression is critical for understanding how the balance between protective immunity and inflammation is maintained to ensure optimal gastrointestinal tract function and health of the whole organism. Copyright © 2014 Elsevier Ltd. All rights reserved.
IMMUNE SYSTEM MATURITY AND SENSITIVITY TO CHEMICAL EXPOSURE

Science.gov (United States)

It is well established that human diseases associated with abnormal immune function, including some common infectious diseases and asthma, are considerably more prevalent at younger ages. The immune system continues to mature after birth, and functional immaturity accounts for m...
Are there differences in immune function between continental and insular birds?

NARCIS (Netherlands)

Matson, K.D.

2006-01-01

Generally, immune system architecture varies with different environments, which presumably reflect different pathogen pressures. Specifically, populations from relatively disease-free, oceanic islands are expected to exhibit reorganized immune systems, which might be characterized by attenuated
Effect of nutrition support on immunity in paediatric patients with beta-thalassaemia major.

Science.gov (United States)

Tienboon, Prasong

2003-01-01

Nutritional deficiencies have been variably observed in thalassaemia and the aetiology of many of the immune abnormalities in thalassaemic children are poorly defined. Therefore, we tested the hypothesis that certain immune abnormalities have a nutritional basis. Nutritional status, selective quantitative and functional indices of immunity were studied in twelve children (7 females, 5 males; mean age 28 months, SD 5 and range 19.8-35.5), with thalassaemia major before and after a one month period of intensive nutrition support (the study diet consisted of 'Enfapro' liquid formula (Mead Johnson) with added dextrose and corn oil to achieve a caloric density of 1.1 kcal/cc in addition to vitamins and minerals). Each child was provided approximately 150 kcal/day and 4 g of protein/day. Lymphocyte proliferation to Concanavalin A (Con A) (P = 0.008) and Purified Protein Derivative (PPD) (P = 0.002) was depressed upon entry into the study, however the response to Con A attained normal values by the end of the intervention. Compared to baselines, the proliferative response to Con A (P = 0.005) and Phytohemagglutinin A (PHA) (P = 0.031) both improved after the nutrition support. Although there was no general correlation of zinc status with lymphocyte proliferation, normal baseline zinc status was associated with improvement of proliferation. The %CD4 increased (P = 0.036), primarily because of a decrease in total lymphocytes and to lesser extent a decrease in CD8 lymphocytes. Serum immunoglobulin concentrations were found to be elevated on admission but were not significantly affected by the nutrition intervention. C3 concentrations were uniformly depressed on admission but increased by the end of the study protocol (P = 0.037). C4 and CH50 activity were not significantly influenced by the intervention. In conclusion, children with beta thalassaemia have abnormalities of lymphocyte function as well as key complement components that are responsive to nutrition support. In
Epitope-based vaccines with the Anaplasma marginale MSP1a functional motif induce a balanced humoral and cellular immune response in mice.

Directory of Open Access Journals (Sweden)

Paula S Santos

Full Text Available Bovine anaplasmosis is a hemoparasitic disease that causes considerable economic loss to the dairy and beef industries. Cattle immunized with the Anaplasma marginale MSP1 outer membrane protein complex presents a protective humoral immune response; however, its efficacy is variable. Immunodominant epitopes seem to be a key-limiting factor for the adaptive immunity. We have successfully demonstrated that critical motifs of the MSP1a functional epitope are essential for antibody recognition of infected animal sera, but its protective immunity is yet to be tested. We have evaluated two synthetic vaccine formulations against A. marginale, using epitope-based approach in mice. Mice infection with bovine anaplasmosis was demonstrated by qPCR analysis of erythrocytes after 15-day exposure. A proof-of-concept was obtained in this murine model, in which peptides conjugated to bovine serum albumin were used for immunization in three 15-day intervals by intraperitoneal injections before challenging with live bacteria. Blood samples were analyzed for the presence of specific IgG2a and IgG1 antibodies, as well as for the rickettsemia analysis. A panel containing the cytokines' transcriptional profile for innate and adaptive immune responses was carried out through qPCR. Immunized BALB/c mice challenged with A. marginale presented stable body weight, reduced number of infected erythrocytes, and no mortality; and among control groups mortality rates ranged from 15% to 29%. Additionally, vaccines have significantly induced higher IgG2a than IgG1 response, followed by increased expression of pro-inflammatory cytokines. This is a successful demonstration of epitope-based vaccines, and protection against anaplasmosis may be associated with elicitation of effector functions of humoral and cellular immune responses in murine model.
A novel hybrid stress-function finite element method immune to severe mesh distortion

International Nuclear Information System (INIS)

Cen Song; Zhou Mingjue; Fu Xiangrong

2010-01-01

This paper introduces a hybrid stress-function finite element method proposed recently for developing 2D finite element models immune to element shapes. Deferent from the first version of the hybrid-stress element constructed by Pian, the stress function φ of 2D elastic or fracture problem is regarded as the functional variable of the complementary energy functional. Then, the basic analytical solutions of φ are taken as the trial functions for finite element models, and meanwhile, the corresponding unknown stress-function constants are introduced. By using the principle of minimum complementary energy, these unknown stress-function constants can be expressed in terms of the displacements along element edges. Finally, the complementary energy functional can be rewritten in terms of element nodal displacement vector, and thus, the element stiffness matrix of such hybrid-function element can be obtained. As examples, two (8- and 12-node) quadrilateral plane elements and an arbitrary polygonal crack element are constructed by employing different basic analytical solutions of different stress functions. Numerical results show that, the 8- and 12-node plane models can produce the exact solutions for pure bending and linear bending problems, respectively, even the element shape degenerates into triangle and concave quadrangle; and the crack element can also predict accurate results with very low computational cost in analysis of stress-singularity problems.
Combined acupuncture and general anesthesia on immune and cognitive function in elderly patients following subtotal gastrectomy for gastric cancer.

Science.gov (United States)

Wang, Ningke; Ou, Yangwen; Qing, Wenxiang

2018-01-01

This study investigated the effects of acupuncture combined with general anesthesia on postoperative immune and cognitive functions in elderly patients undergoing subtotal gastrectomy. We recruited 96 elderly patients who received anesthesia for subtotal gastrectomy and randomly divided them into control (n=48) and experimental (n=48) groups. The control group received general anesthesia and the experimental group received combined acupuncture and general anesthesia. We measured hemodynamic immediately before and after anesthesia induction, and immune observations before and after surgery. We found no significant differences in mean heart rate (HR), mean oxygen saturation (SpO2), and partial pressure of end-tidal carbon dioxide (PETCO2) in the perioperative period between the two groups. Mean arterial pressure (MAP) was lower in the experimental group than that in the control group (P0.05), but the incidence of delayed recovery and postoperative agitation were significantly lower in the experimental group compared with those in the control group (P<0.05). One day after surgery, the experimental group showed better protection of cognitive function than the control group (P<0.05). Overall, combined acupuncture and general anesthesia in elderly gastric cancer patients receiving subtotal gastrectomy showed more stable hemodynamics and fewer stress responses during surgery. Thus, combined acupuncture and general anesthesia can shorten the recovery time from anesthesia, have less negative effects on immune function and decrease the incidence of postoperative cognitive impairment.

Does exposure to UV radiation induce a shift to a Th-2-like immune reaction?

International Nuclear Information System (INIS)

Ullrich, S.E.

1996-01-01

In addition to being the primary cause of skin cancer, UV radiation is immune suppressive and there appears to be a link between the ability of UV to suppress the immune response and induce skin cancer. Cytokines made by UV-irradiated keratinocytes play an essential role in activating immune suppression. In particular, we have found that keratinocyte-derived interleukin (IL)-10 is responsible for the systemic impairment of antigen presenting cell function and the UV-induced suppression of delayed-type hypersenstivity (DTH). Antigen presentation by splenic adherent cells isolated from UV-irradiated mice to T helper-1 type T (Th1) cells is suppressed, whereas antigen presentation to T helper-2 type T (Th2) cells is enhanced. The enhanced antigen presentation to Th2 cells and the impaired presentation to Th1 cells can be reversed in vivo by injecting the UV-irradiated mice with monoclonal anti-IL-10 antibody. Furthermore, immune suppression can be transferred from UV-irradiated mice to normal recipients by adoptive transfer of T cells. Injecting the recipient mice with anti-IL-4 or anti-IL-10 prevents the transfer of immune suppression, suggesting the suppressor cells are Th2 cells. In addition, injecting UV-irradiated mice with IL-12, a cytokine that has been shown to be the primary inducer of Th1 cells, and one that prevents the differentiation of Th2 cells in vivo, reverses UV-induced immune suppression. These findings support the hypothesis that UV exposure activates IL-10 secretion, which depresses the function of Th1 cells, while enhancing the activity of Th2 cells. (Author)
The influence of recovery and training phases on body composition, peripheral vascular function and immune system of professional soccer players.

Directory of Open Access Journals (Sweden)

Simon Reinke

Full Text Available Professional soccer players have a lengthy playing season, throughout which high levels of physical stress are maintained. The following recuperation period, before starting the next pre-season training phase, is generally considered short but sufficient to allow a decrease in these stress levels and therefore a reduction in the propensity for injury or musculoskeletal tissue damage. We hypothesised that these physical extremes influence the body composition, blood flow, and endothelial/immune function, but that the recuperation may be insufficient to allow a reduction of tissue stress damage. Ten professional football players were examined at the end of the playing season, at the end of the season intermission, and after the next pre-season endurance training. Peripheral blood flow and body composition were assessed using venous occlusion plethysmography and DEXA scanning respectively. In addition, selected inflammatory and immune parameters were analysed from blood samples. Following the recuperation period a significant decrease of lean body mass from 74.4+/-4.2 kg to 72.2+/-3.9 kg was observed, but an increase of fat mass from 10.3+/-5.6 kg to 11.1+/-5.4 kg, almost completely reversed the changes seen in the pre-season training phase. Remarkably, both resting and post-ischemic blood flow (7.3+/-3.4 and 26.0+/-6.3 ml/100 ml/min respectively, were strongly reduced during the playing and training stress phases, but both parameters increased to normal levels (9.0+/-2.7 and 33.9+/-7.6 ml/100 ml/min during the season intermission. Recovery was also characterized by rising levels of serum creatinine, granulocytes count, total IL-8, serum nitrate, ferritin, and bilirubin. These data suggest a compensated hypo-perfusion of muscle during the playing season, followed by an intramuscular ischemia/reperfusion syndrome during the recovery phase that is associated with muscle protein turnover and inflammatory endothelial reaction, as demonstrated by i
Retinoic Acid-Related Orphan Receptors (RORs): Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism

Science.gov (United States)

Cook, Donald N.; Kang, Hong Soon; Jetten, Anton M.

2015-01-01

In this overview, we provide an update on recent progress made in understanding the mechanisms of action, physiological functions, and roles in disease of retinoic acid related orphan receptors (RORs). We are particularly focusing on their roles in the regulation of adaptive and innate immunity, brain function, retinal development, cancer, glucose and lipid metabolism, circadian rhythm, metabolic and inflammatory diseases and neuropsychiatric disorders. We also summarize the current status of ROR agonists and inverse agonists, including their regulation of ROR activity and their therapeutic potential for management of various diseases in which RORs have been implicated. PMID:26878025
Retinoic Acid-Related Orphan Receptors (RORs: Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism

Directory of Open Access Journals (Sweden)

Donald N. Cook

2015-12-01

Full Text Available In this overview, we provide an update on recent progress made in understanding the mechanisms of action, physiological functions, and roles in disease of retinoic acid related orphan receptors (RORs. We are particularly focusing on their roles in the regulation of adaptive and innate immunity, brain function, retinal development, cancer, glucose and lipid metabolism, circadian rhythm, metabolic and inflammatory diseases and neuropsychiatric disorders. We also summarize the current status of ROR agonists and inverse agonists, including their regulation of ROR activity and their therapeutic potential for management of various diseases in which RORs have been implicated.
Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

Science.gov (United States)

Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

2018-01-01

The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.
The role of immune system exhaustion on cancer cell escape and anti-tumor immune induction after irradiation.

Science.gov (United States)

Mendes, Fernando; Domingues, Cátia; Rodrigues-Santos, Paulo; Abrantes, Ana Margarida; Gonçalves, Ana Cristina; Estrela, Jéssica; Encarnação, João; Pires, Ana Salomé; Laranjo, Mafalda; Alves, Vera; Teixo, Ricardo; Sarmento, Ana Bela; Botelho, Maria Filomena; Rosa, Manuel Santos

2016-04-01

Immune surveillance seems to represent an effective tumor suppressor mechanism. However, some cancer cells survive and become variants, being poorly immunogenic and able to enter a steady-state phase. These cells become functionally dormant or remain hidden clinically throughout. Neoplastic cells seem to be able to instruct immune cells to undergo changes promoting malignancy. Radiotherapy may act as a trigger of the immune response. After radiotherapy a sequence of reactions occurs, starting in the damage of oncogenic cells by multiple mechanisms, leading to the immune system positive feedback against the tumor. The link between radiotherapy and the immune system is evident. T cells, macrophages, Natural Killer cells and other immune cells seem to have a key role in controlling the tumor. T cells may be dysfunctional and remain in a state of T cell exhaustion, nonetheless, they often retain a high potential for successful defense against cancer, being able to be mobilized to become highly functional. The lack of clinical trials on a large scale makes data a little robust, in spite of promising information, there are still many variables in the studies relating to radiation and immune system. The clarification of the mechanisms underlying immune response to radiation exposure may contribute to treatment improvement, gain of life quality and span of patients. Copyright © 2016 Elsevier B.V. All rights reserved.
Functional analysis of the human cytomegalovirus immune evasion protein, pUS322kDa

International Nuclear Information System (INIS)

Zhao Yiqiang; Biegalke, Bonita J.

2003-01-01

Human cytomegalovirus (HCMV) is an important opportunistic pathogen that infrequently causes disease in individuals with mature immune systems. The HCMV US3 gene encodes a 22-kDa protein that interferes with immune recognition of virally infected cells. The 22-kDa US3 protein binds to major histocompatibility complex (MHC) class I complexes, retaining them in the endoplasmic reticulum (ER), thereby decreasing the presentation of viral antigen to cytotoxic T cells. Our studies demonstrate that correct folding of the ER lumenal domain of the US3 protein is essential, but insufficient for interactions with MHC class I complexes. We demonstrate a requirement for the transmembrane domain of the 22-kDa US3 protein, confirming the results of others, and also show that the cytosolic carboxyl-terminal tail influences the function of the protein. Anchoring of the ER-lumenal immunoglobulin-like fold of the US3 protein to the membrane of the endoplasmic reticulum is critical for the binding and retention of MHC class I complexes
Nubbin isoform antagonism governs Drosophila intestinal immune homeostasis.

Directory of Open Access Journals (Sweden)

Bo G Lindberg

2018-03-01

Full Text Available Gut immunity is regulated by intricate and dynamic mechanisms to ensure homeostasis despite a constantly changing microbial environment. Several regulatory factors have been described to participate in feedback responses to prevent aberrant immune activity. Little is, however, known about how transcriptional programs are directly tuned to efficiently adapt host gut tissues to the current microbiome. Here we show that the POU/Oct gene nubbin (nub encodes two transcription factor isoforms, Nub-PB and Nub-PD, which antagonistically regulate immune gene expression in Drosophila. Global transcriptional profiling of adult flies overexpressing Nub-PB in immunocompetent tissues revealed that this form is a strong transcriptional activator of a large set of immune genes. Further genetic analyses showed that Nub-PB is sufficient to drive expression both independently and in conjunction with nuclear factor kappa B (NF-κB, JNK and JAK/STAT pathways. Similar overexpression of Nub-PD did, conversely, repress expression of the same targets. Strikingly, isoform co-overexpression normalized immune gene transcription, suggesting antagonistic activities. RNAi-mediated knockdown of individual nub transcripts in enterocytes confirmed antagonistic regulation by the two isoforms and that both are necessary for normal immune gene transcription in the midgut. Furthermore, enterocyte-specific Nub-PB expression levels had a strong impact on gut bacterial load as well as host lifespan. Overexpression of Nub-PB enhanced bacterial clearance of ingested Erwinia carotovora carotovora 15. Nevertheless, flies quickly succumbed to the infection, suggesting a deleterious immune response. In line with this, prolonged overexpression promoted a proinflammatory signature in the gut with induction of JNK and JAK/STAT pathways, increased apoptosis and stem cell proliferation. These findings highlight a novel regulatory mechanism of host-microbe interactions mediated by antagonistic
NKT cell self-reactivity: evolutionary master key of immune homeostasis?

Science.gov (United States)

Issazadeh-Navikas, Shohreh

2012-04-01

Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune systems, have evolved for quick, non-specific immune responses to pathogens and more efficient, long-lasting ones upon specific recognition of recurrent pathogens. Specialized cells have arisen as the sentinels of these functions, including macrophages, natural killer (NK), and T and B-lymphocytes. Interestingly, a population of immune cells that can exert both of these complex functions, NKT cells, not only share common functions but also exhibit shared cell surface markers of cells of both arms of the immune system. These features, in combination with sophisticated maintenance of immune homeostasis, will be discussed. The recent finding of self-peptide reactivity of NKT cells in the context of CD1d, with capacity to regulate multiple autoimmune and inflammatory conditions, motivates the current proposal that self-reactive NKT cells might be the ancestral link between present NK and T cells. Their parallel selection through evolution by higher vertebrates could be related to their central function as master regulators of immune homeostasis that in part is shared with regulatory T cells. Hypothetical views on how self-reactive NKT cells secure such a central role will also be proposed.
Guidance on the scientific requirements for health claims related to gut and immune function

DEFF Research Database (Denmark)

Tetens, Inge

2011-01-01

The European Food Safety Authority (EFSA) asked the Panel on Dietetic Products Nutrition and Allergies (NDA) to draft guidance on scientific requirements for health claims related to gut and immune function. This guidance has been drawn from scientific opinions of the NDA Panel on such health......, was subjected to public consultation (28 September 2010 to 22 October 2010), and was also discussed at a technical meeting with experts in the field on 2 December 2010 in Amsterdam....
The adaptor molecule RIAM integrates signaling events critical for integrin-mediated control of immune function and cancer progression.

Science.gov (United States)

Patsoukis, Nikolaos; Bardhan, Kankana; Weaver, Jessica D; Sari, Duygu; Torres-Gomez, Alvaro; Li, Lequn; Strauss, Laura; Lafuente, Esther M; Boussiotis, Vassiliki A

2017-08-22

Lymphocyte activation requires adhesion to antigen-presenting cells. This is a critical event linking innate and adaptive immunity. Lymphocyte adhesion is accomplished through LFA-1, which must be activated by a process referred to as inside-out integrin signaling. Among the few signaling molecules that have been implicated in inside-out integrin activation in hematopoietic cells are the small guanosine triphosphatase (GTPase) Rap1 and its downstream effector Rap1-interacting molecule (RIAM), a multidomain protein that defined the Mig10-RIAM-lamellipodin (MRL) class of adaptor molecules. Through its various domains, RIAM is a critical node of signal integration for activation of T cells, recruits monomeric and polymerized actin to drive actin remodeling and cytoskeletal reorganization, and promotes inside-out integrin signaling in T cells. As a regulator of inside-out integrin activation, RIAM affects multiple functions of innate and adaptive immunity. The effects of RIAM on cytoskeletal reorganization and integrin activation have implications in cell migration and trafficking of cancer cells. We provide an overview of the structure and interactions of RIAM, and we discuss the implications of RIAM functions in innate and adaptive immunity and cancer. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Effects of preoperative and postoperative enteral nutrition on postoperative nutritional status and immune function of gastric cancer patients.

Science.gov (United States)

Ding, Dayong; Feng, Ye; Song, Bin; Gao, Shuohui; Zhao, Jisheng

2015-03-01

Effects of preoperative one week enteral nutrition (EN) support on the postoperative nutritional status, immune function and inflammatory response of gastric cancer patients were investigated. 106 cases of gastric cancer patients were randomly divided into preoperative one week EN group (trial group) and early postoperative EN group (control group), which were continuously treated with EN support until the postoperative 9th day according to different treatment protocols. All the patients were checked for their body weight, skinfold thickness, upper arm circumference, white blood cell count (WBC), albumin (ALB), prealbumin (PA), C-reactive protein (CRP), humoral immunity (IgA, IgG), T cell subsets (CD4, CD8 and CD4/CD8), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), etc. on the preoperative and the postoperative 1st and 10th day, respectively. PA and IgG levels of the experimental group were higher than those of the control group on the postoperative 10th day, whereas IL-6 level of the experimental group was lower than that of the control group. EN support for preoperative gastric cancer patients will improve the postoperative nutritional status and immune function, alleviate inflammatory response, and facilitate the recovery of patients.
Neuroendocrine-Immune Support of Diuretic Effect of Balneotherapy on Truskavets Resort

Directory of Open Access Journals (Sweden)

Yu.S. Lukovych

2015-04-01

Full Text Available Objective: to identify concomitant changes in parameters of neuroendocrine-immune complex and colon microbiocenosis, which accompany diuretic effect of balneotherapy on Truskavets resort. Results. The study included 22 male patients with chronic pyelonephritis associated with cholecystitis, it is found that 10–12-day course of balneotherapy (drinking bioactive water Naftusia, ozokerit applications, mineral baths increases daily urine output by 28 % (p 0.05, in a greater degree due to increased PSD HF than LF. The basal level of plasma cortisol decreased by 20 % (p < 0.01, testosterone — by 15 % (p = 0.01, whereas levels of triiodothyronine increases by 4 % (p < 0.05 and especially calcitonin activity — by 92 % (p < 0.001, calculated by urinary excretion of phosphates and calcium. Leukocytic adaptation index of Popovich increases by 46 % (p < 0.02. As for the parameters of neutrophil phagocytic function, an increase of reduced killing index of Staphylococcus aureus by 19 % (p < 0.001 and Escherichia coli by 18 % (p < 0.01 was stated in the absence of changes in initially normal phagocytic index. Microbial count in relation to Staphylococcus aureus is normal, and intensity of phagocytosis of Escherichia coli, initially increased by 15 %, reduced by 8 % (p < 0.05. Regarding immunity parameters, it was revealed a significant increase in the blood of CD16+ lymphocytes only (+17 %, p < 0.01 in the absence of changes in levels of CD3+CD4+ and CD3+CD8+ T-lymphocytes and CD19+ B-lymphocytes. Neither serum Ig G, M, A or circulating immune complexes levels change significantly. Immunotropic effect is accompanied by a reduction of dysbiosis manifestations: Bifidumbacter content increases by 19 % (p < 0.02, Lactobacter — by 20 % (p < 0.05, and Escherichia coli — by 48 % (p < 0.01, while the part of strains with reduced enzymatic properties is decreased by 47 % (p < 0.001, with hemolytic properties — by 77 % (p < 0.01. Conclusion
The CD47-SIRPα signaling axis as an innate immune checkpoint in cancer.

Science.gov (United States)

Matlung, Hanke L; Szilagyi, Katka; Barclay, Neil A; van den Berg, Timo K

2017-03-01

Immune checkpoint inhibitors, including those targeting CTLA-4/B7 and the PD-1/PD-L1 inhibitory pathways, are now available for clinical use in cancer patients, with other interesting checkpoint inhibitors being currently in development. Most of these have the purpose to promote adaptive T cell-mediated immunity against cancer. Here, we review another checkpoint acting to potentiate the activity of innate immune cells towards cancer. This innate immune checkpoint is composed of what has become known as the 'don't-eat me' signal CD47, which is a protein broadly expressed on normal cells and often overexpressed on cancer cells, and its counter-receptor, the myeloid inhibitory immunoreceptor SIRPα. Blocking CD47-SIRPα interactions has been shown to promote the destruction of cancer cells by phagocytes, including macrophages and neutrophils. Furthermore, there is growing evidence that targeting of the CD47-SIRPα axis may also promote antigen-presenting cell function and thereby stimulate adaptive T cell-mediated anti-cancer immunity. The development of CD47-SIRPα checkpoint inhibitors and the potential side effects that these may have are discussed. Collectively, this identifies the CD47-SIRPα axis as a promising innate immune checkpoint in cancer, and with data of the first clinical studies with CD47-SIRPα checkpoint inhibitors expected within the coming years, this is an exciting and rapidly developing field. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Universal immunity to influenza must outwit immune evasion

Directory of Open Access Journals (Sweden)

Sergio Manuel Quinones-Parra

2014-06-01

Full Text Available Although an influenza vaccine has been available for 70 years, influenza virus still causes seasonal epidemics and worldwide pandemics. Currently available vaccines elicit strain-specific antibody responses to the surface haemagglutinin (HA and neuraminidase (NA proteins, but these can be ineffective against serologically-distinct viral variants and novel subtypes. Thus, there is a need for cross-protective or universal influenza vaccines to overcome the necessity for annual immunisation against seasonal influenza and to provide immunity to reduce the severity of infection with pandemic or outbreak viruses. It is well established that natural influenza infection can provide cross-reactive immunity that can reduce the impact of infection with distinct influenza type A strains and subtypes, including H1N1, H3N2, H2N2, H5N1 and H7N9. The key to generating universal influenza immunity via vaccination is to target functionally-conserved regions of the virus, which include epitopes on the internal proteins for cross-reactive T cell immunity or on the HA stem for broadly reactive antibody responses. In the wake of the 2009 H1N1 pandemic, broadly neutralizing antibodies have been characterized and isolated from convalescent and vaccinated individuals, inspiring development of new vaccination techniques to elicit such responses. Induction of influenza-specific T cell responses through vaccination has also been examined in clinical trials. Strong evidence is available from human and animal models of influenza to show that established influenza-specific T cell memory can reduce viral shedding and symptom severity. However, the published evidence also shows that CD8+ T cells can efficiently select immune escape mutants early after influenza virus infection. Here, we discuss universal immunity to influenza viruses mediated by both cross-reactive T cells and antibodies, the mechanisms of immune evasion in influenza, and how to counteract commonly occurring
Chronic social stress induces peripheral and central immune activation, blunted mesolimbic dopamine function, and reduced reward-directed behaviour in mice

Directory of Open Access Journals (Sweden)

Giorgio Bergamini

2018-02-01

Full Text Available Psychosocial stress is a major risk factor for depression, stress leads to peripheral and central immune activation, immune activation is associated with blunted dopamine (DA neural function, DA function underlies reward interest, and reduced reward interest is a core symptom of depression. These states might be inter-independent in a complex causal pathway. Whilst animal-model evidence exists for some specific steps in the pathway, there is currently no animal model in which it has been demonstrated that social stress leads to each of these immune, neural and behavioural states. Such a model would provide important existential evidence for the complex pathway and would enable the study of causality and mediating mechanisms at specific steps in the pathway. Therefore, in the present mouse study we investigated for effects of 15-day resident-intruder chronic social stress (CSS on each of these states. Relative to controls, CSS mice exhibited higher spleen levels of granulocytes, inflammatory monocytes and T helper 17 cells; plasma levels of inducible nitric oxide synthase; and liver expression of genes encoding kynurenine pathway enzymes. CSS led in the ventral tegmental area to higher levels of kynurenine and the microglia markers Iba1 and Cd11b and higher binding activity of DA D1 receptor; and in the nucleus accumbens (NAcc to higher kynurenine, lower DA turnover and lower c-fos expression. Pharmacological challenge with DA reuptake inhibitor identified attenuation of DA stimulatory effects on locomotor activity and NAcc c-fos expression in CSS mice. In behavioural tests of operant responding for sucrose reward validated as sensitive assays for NAcc DA function, CSS mice exhibited less reward-directed behaviour. Therefore, this mouse study demonstrates that a chronic social stressor leads to changes in each of the immune, neural and behavioural states proposed to mediate between stress and disruption of DA-dependent reward processing. The
Investigation of Immune Function in Naval Marine Mammals

National Research Council Canada - National Science Library

Romano, Tracy

2000-01-01

... (dolphins, whales, and porpoises). This is due in part to obtaining access to animals and tissue samples as well as the lack of cetacean-specific reagents to carry out investigations of the immune system...
Comparative genomic analysis of buffalo (Bubalus bubalis NOD1 and NOD2 receptors and their functional role in in-vitro cellular immune response.

Directory of Open Access Journals (Sweden)

Biswajit Brahma

Full Text Available Nucleotide binding and oligomerization domain (NOD-like receptors (NLRs are innate immune receptors that recognize bacterial cell wall components and initiate host immune response. Structure and function of NLRs have been well studied in human and mice, but little information exists on genetic composition and role of these receptors in innate immune system of water buffalo--a species known for its exceptional disease resistance. Here, a comparative study on the functional domains of NOD1 and NOD2 was performed across different species. The NOD mediated in-vitro cellular responses were studied in buffalo peripheral blood mononuclear cells, resident macrophages, mammary epithelial, and fibroblast cells. Buffalo NOD1 (buNOD1 and buNOD2 showed conserved domain architectures as found in other mammals. The domains of buNOD1 and buNOD2 showed analogy in secondary and tertiary conformations. Constitutive expressions of NODs were ubiquitous in different tissues. Following treatment with NOD agonists, peripheral lymphocytes showed an IFN-γ response along-with production of pro-inflammatory cytokines. Alveolar macrophages and mammary epithelial cells showed NOD mediated in-vitro immune response through NF-κB dependent pathway. Fibroblasts showed pro-inflammatory cytokine response following agonist treatment. Our study demonstrates that both immune and non-immune cells could generate NOD-mediated responses to pathogens though the type and magnitude of response depend on the cell types. The structural basis of ligand recognition by buffalo NODs and knowledge of immune response by different cell types could be useful for development of non-infective innate immune modulators and next generation anti-inflammatory compounds.
[Therapeutic effect of double fill nine tastes soup in treating recurrent respiratory infection (RRI) and change of immune function in children].

Science.gov (United States)

Wang, Youcheng; Zhang, Lijuan; Hu, Guohua; Wang, Menghe; Tang, Xiaoyuan; Guo, Hui; Shi, Yimei; Chen, Shufang; Shi, Changchun

2012-04-01

To investigate the therapeutic effect of double fill nine tastes soup in treating children recurrent respiratory infection (RRTI) and the change of immune function. 77 RRTI patients were randomly selected into observation and control groups. The observation group was treated with Chinese medicine- double fill nine tastes soup,water frying points 2 times oral. The control was treated with transfer factor oral liquid,every 10 mL,2 times daily oral. Treatment periods were both two months. IgA, IgG, IgM and IL-12, TNF-alpha, INF-gamma were detected before and after treatment to assess the clinical effects and the changes of immune factors, meanwhile, a health group was established. Before treatment, compared with the health group, the serum IgA, IgG, IgM, IgE, IL-12, TNF-alpha, IFN-gamma in both groups were significantly different (P soup has significant effects in treating recurrent respiratory infection (RRI) and enhance the immune function in children.
siRNA and innate immunity.

Science.gov (United States)

Robbins, Marjorie; Judge, Adam; MacLachlan, Ian

2009-06-01

Canonical small interfering RNA (siRNA) duplexes are potent activators of the mammalian innate immune system. The induction of innate immunity by siRNA is dependent on siRNA structure and sequence, method of delivery, and cell type. Synthetic siRNA in delivery vehicles that facilitate cellular uptake can induce high levels of inflammatory cytokines and interferons after systemic administration in mammals and in primary human blood cell cultures. This activation is predominantly mediated by immune cells, normally via a Toll-like receptor (TLR) pathway. The siRNA sequence dependency of these pathways varies with the type and location of the TLR involved. Alternatively nonimmune cell activation may also occur, typically resulting from siRNA interaction with cytoplasmic RNA sensors such as RIG1. As immune activation by siRNA-based drugs represents an undesirable side effect due to the considerable toxicities associated with excessive cytokine release in humans, understanding and abrogating this activity will be a critical component in the development of safe and effective therapeutics. This review describes the intracellular mechanisms of innate immune activation by siRNA, the design of appropriate sequences and chemical modification approaches, and suitable experimental methods for studying their effects, with a view toward reducing siRNA-mediated off-target effects.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.