WorldWideScience

Sample records for normal immune function

  1. Clinical Dosing Regimen of Selinexor Maintains Normal Immune Homeostasis and T-cell Effector Function in Mice: Implications for Combination with Immunotherapy.

    Science.gov (United States)

    Tyler, Paul M; Servos, Mariah M; de Vries, Romy C; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K

    2017-03-01

    Selinexor (KPT-330) is a first-in-class nuclear transport inhibitor currently in clinical trials as an anticancer agent. To determine how selinexor might affect antitumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T-cell development, a progressive loss of CD8 T cells, and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T-cell development and function. We determined the minimum concentration of selinexor required to block T-cell activation and showed that T-cell-inhibitory effects of selinexor occur at levels above 100 nmol/L, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 4-day drug holiday led to intratumoral IFNγ + , granzyme B + cytotoxic CD8 T cells that were comparable with vehicle-treated mice. Overall, selinexor treatment leads to transient inhibition of T-cell activation, but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T-cell functioning and development of antitumor immunity. Mol Cancer Ther; 16(3); 428-39. ©2017 AACR See related article by Farren et al., p. 417 . ©2017 American Association for Cancer Research.

  2. Clinical dosing regimen of selinexor maintains normal immune homeostasis and T cell effector function in mice: implications for combination with immunotherapy

    Science.gov (United States)

    Tyler, Paul M.; Servos, Mariah M.; de Vries, Romy C.; Klebanov, Boris; Kashyap, Trinayan; Sacham, Sharon; Landesman, Yosef; Dougan, Michael; Dougan, Stephanie K.

    2017-01-01

    Selinexor (KPT-330) is a first in class nuclear transport inhibitor currently in clinical trials as an anti-cancer agent. To determine how selinexor might impact anti-tumor immunity, we analyzed immune homeostasis in mice treated with selinexor and found disruptions in T cell development, a progressive loss of CD8 T cells and increases in inflammatory monocytes. Antibody production in response to immunization was mostly normal. Precursor populations in bone marrow and thymus were unaffected by selinexor, suggesting that normal immune homeostasis could recover. We found that a high dose of selinexor given once per week preserved nearly normal immune functioning, whereas a lower dose given 3 times per week did not restore immune homeostasis. Both naïve and effector CD8 T cells cultured in vitro showed impaired activation in the presence of selinexor. These experiments suggest that nuclear exportins are required for T cell development and function. We determined the minimum concentration of selinexor required to block T cell activation, and showed that T cell inhibitory effects of selinexor occur at levels above 100nM, corresponding to the first 24 hours post-oral dosing. In a model of implantable melanoma, selinexor treatment at 10 mg/kg with a 5 day drug holiday led to intratumoral IFNγ+, granzyme B+ cytotoxic CD8 T cells that were comparable to vehicle treated mice. Overall, selinexor treatment leads to transient inhibition of T cell activation but clinically relevant once and twice weekly dosing schedules that incorporate sufficient drug holidays allow for normal CD8 T cell functioning and development of anti-tumor immunity. PMID:28148714

  3. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  5. Effect of psychological intervention in the form of relaxation and guided imagery on cellular immune function in normal healthy subjects. An overview

    DEFF Research Database (Denmark)

    Zachariae, R; Kristensen, J S; Hokland, P

    1991-01-01

    The present study measured the effects of relaxation and guided imagery on cellular immune function. During a period of 10 days 10 healthy subjects were given one 1-hour relaxation procedure and one combined relaxation and guided imagery procedure, instructing the subjects to imagine their immune...... on the immune defense and could form the basis of further studies on psychological intervention and immunological status. Udgivelsesdato: 1990-null...

  6. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2014 . Scientific Opinion on the substantiation of a health claim related to zinc and normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    substantiation of a health claim related to zinc and normal function of the immune system. The food constituent, zinc, which is the subject of the health claim is sufficiently characterised. Normal function of the immune system is a beneficial physiological effect for infants and young children. A claim on zinc...... and function of the immune system in the general population has already been assessed with a favourable outcome. The Panel considers that the role of zinc in normal function of the immune system applies to all ages, including infants and young children (from birth to three years). The Panel concludes...... that a cause and effect relationship has been established between the dietary intake of zinc and normal function of the immune system. The following wording reflects the scientific evidence: “zinc contributes to normal function of the immune system”....

  7. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2015. Scientific Opinion on the substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    2015-01-01

    on the scientific substantiation of a health claim related to vitamin D and contribution to the normal function of the immune system. The Panel considers that vitamin D is sufficiently characterised. Contribution to the normal function of the immune system is a beneficial physiological effect for children....... The Panel had previously assessed a claim on vitamin D and contribution to the normal function of the immune system with a favourable outcome. The target population was the general population. The Panel considered that vitamin D plays a regulatory role in the functioning of the immune system. The Panel...... considers that the role of vitamin D in the functioning of the immune system applies to all ages, including children. The Panel concludes that a cause and effect relationship has been established between the dietary intake of vitamin D and contribution to the normal function of the immune system...

  8. Semigroups of data normalization functions

    NARCIS (Netherlands)

    Warrens, Matthijs J.

    2016-01-01

    Variable centering and scaling are functions that are typically used in data normalization. Various properties of centering and scaling functions are presented. It is shown that if we use two centering functions (or scaling functions) successively, the result depends on the order in which the

  9. Modulation of Immune Functions by Foods

    Directory of Open Access Journals (Sweden)

    Shuichi Kaminogawa

    2004-01-01

    Full Text Available Evidence is rapidly accumulating as to the beneficial effects of foods. However, it is not always clear whether the information is based on data evaluated impartially in a scientific fashion. Human research into whether foods modulate immune functions in either intervention studies or randomized controlled trials can be classified into three categories according to the physical state of subjects enrolled for investigation: (i studies examining the effect of foods in healthy individuals; (ii studies analyzing the effect of foods on patients with hypersensitivity; and (iii studies checking the effect of foods on immunocompromized subjects, including patients who had undergone surgical resection of cancer and newborns. The systematization of reported studies has made it reasonable to conclude that foods are able to modulate immune functions manifesting as either innate immunity (phagocytic activity, NK cell activity or acquired immunity (T cell response, antibody production. Moreover, improvement of immune functions by foods can normalize the physical state of allergic patients or cancer patients, and may reduce the risk of diseases in healthy individuals. Therefore, it is valuable to assess the immune-modulating abilities of foods by measuring at least one parameter of either innate or acquired immunity.

  10. Immune function in arctic mammals

    DEFF Research Database (Denmark)

    Desforges, Jean-Pierre; Jasperse, Lindsay; Jensen, Trine Hammer

    2018-01-01

    Natural killer (NK) cells are a vital part of the rapid and non-specific immune defense against invading pathogens and tumor cells. This study evaluated NK cell-like activity by flow cytometry for the first time in three ecologically and culturally important Arctic mammal species: polar bear (Ursus...... the effector:target cell ratio increased. Comparing NK activity between fresh and cryopreserved mouse lymphocytes revealed little to no difference in function, highlighting the applicability of cryopreserving cells in field studies. The evaluation of this important innate immune function in Arctic mammals can...... contribute to future population health assessments, especially as pollution-induced suppression of immune function may increase infectious disease susceptibility....

  11. Monounsaturated fats and immune function

    Directory of Open Access Journals (Sweden)

    P. Yaqoob

    1998-04-01

    Full Text Available Animal studies suggest that olive oil is capable of modulating functions of cells of the immune system in a manner similar to, albeit weaker than, fish oils. There is some evidence that the effects of olive oil on immune function in animal studies are due to oleic acid rather than to trace elements or antioxidants. Importantly, several studies have demonstrated effects of oleic acid-containing diets on in vivo immune responses. In contrast, consumption of a monounsaturated fatty acid (MUFA-rich diet by humans does not appear to bring about a general suppression of immune cell functions. The effects of this diet in humans are limited to decreasing aspects of adhesion of peripheral blood mononuclear cells, although there are trends towards decreases in natural killer cell activity and proliferation. The lack of a clear effect of MUFA in humans may be attributable to the higher level of monounsaturated fat used in the animal studies, although it is ultimately of importance to examine the effects of intakes which are in no way extreme. The effects of MUFA on adhesion molecules are potentially important, since these molecules appear to have a role in the pathology of a number of diseases involving the immune system. This area clearly deserves further exploration

  12. Suppression of adoptive antituberculosis immunity by normal recipient animals

    International Nuclear Information System (INIS)

    Lefford, M.J.

    1983-01-01

    Adoptive immunity is poorly expressed in normal syngeneic mice. This phenomenon was studied by using experimental antituberculosis immunity as a model system representing pure cell-mediated immunity. Expression of adoptive immunity was facilitated by pretreating recipients with sublethal ionizing radiation (500 rads) or high doses (200 mg/kg) of cyclophosphamide or by using adult thymectomized, lethally irradiated, bone-marrow-reconstituted (TXB) mice. Adult thymectomy was less effective, and a low dose of cyclophosphamide (20 mg/kg) was completely ineffective. The beneficial effect of sublethal irradiation was reduced over time; it persisted for 4 weeks and was absent after 8 weeks. Attempts to restore the suppressed state of normal mice to sublethally irradiated mice by using normal spleen or thymus cells did not succeed. Even in rats, which express adoptive antituberculosis immunity without immunosuppressive treatment, the use of sublethally irradiated or TXB recipients potentiated adoptive immunity. It was concluded that suppression of adoptive immunization in normal recipient mice is mediated predominantly, if not exclusively, by T lymphocytes that are sensitive to a number of immunosuppressive agents. The suppressor cells are long-lived and can be regenerated from precursors that are resistant to 500 but not to 900 rads of ionizing radiation

  13. Role of Polyamines in Immune Cell Functions

    Directory of Open Access Journals (Sweden)

    Rebecca S. Hesterberg

    2018-03-01

    Full Text Available The immune system is remarkably responsive to a myriad of invading microorganisms and provides continuous surveillance against tissue damage and developing tumor cells. To achieve these diverse functions, multiple soluble and cellular components must react in an orchestrated cascade of events to control the specificity, magnitude and persistence of the immune response. Numerous catabolic and anabolic processes are involved in this process, and prominent roles for l-arginine and l-glutamine catabolism have been described, as these amino acids serve as precursors of nitric oxide, creatine, agmatine, tricarboxylic acid cycle intermediates, nucleotides and other amino acids, as well as for ornithine, which is used to synthesize putrescine and the polyamines spermidine and spermine. Polyamines have several purported roles and high levels of polyamines are manifest in tumor cells as well in autoreactive B- and T-cells in autoimmune diseases. In the tumor microenvironment, l-arginine catabolism by both tumor cells and suppressive myeloid cells is known to dampen cytotoxic T-cell functions suggesting there might be links between polyamines and T-cell suppression. Here, we review studies suggesting roles of polyamines in normal immune cell function and highlight their connections to autoimmunity and anti-tumor immune cell function.

  14. EFSA NDA Panel (EFSA Panel on Dietetic Product s, Nutrition and Allergies), 2013 . Scientific Opinion on the substantiation of a health claim related to vitamin A and contribution to normal development and function of the immune system pursuant to Article 14 of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    of infants and young children (from birth to three years). The Panel concludes that a cause and effect relationship has been established between dietary intake of vitamin A and contribution to normal development and function of the immune system. The following wording reflects the scientific evidence......: “Vitamin A contributes to the normal function of the immune system”. The target population is infants and children up to three years. © European Food Safety Authority, 2013...

  15. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  16. Vitamin C and Immune Function

    Directory of Open Access Journals (Sweden)

    Anitra C. Carr

    2017-11-01

    Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.

  17. Season of birth shapes neonatal immune function

    DEFF Research Database (Denmark)

    Thysen, Anna Hammerich; Rasmussen, Morten Arendt; Kreiner-Møller, Eskil

    2016-01-01

    Birth season has been reported to be a risk factor for several immune-mediated diseases. We hypothesized that this association is mediated by differential changes in neonatal immune phenotype and function with birth season. We sought to investigate the influence of season of birth on cord blood...... immune cell subsets and inflammatory mediators in neonatal airways. Cord blood was phenotyped for 26 different immune cell subsets, and at 1 month of age, 20 cytokines and chemokines were quantified in airway mucosal lining fluid. Multivariate partial least squares discriminant analyses were applied...... to determine whether certain immune profiles dominate by birth season, and correlations between individual cord blood immune cells and early airway immune mediators were defined. We found a birth season-related fluctuation in neonatal immune cell subsets and in early-life airway mucosal immune function...

  18. Molecular and Functional Neuroscience in Immunity.

    Science.gov (United States)

    Pavlov, Valentin A; Chavan, Sangeeta S; Tracey, Kevin J

    2018-04-26

    The nervous system regulates immunity and inflammation. The molecular detection of pathogen fragments, cytokines, and other immune molecules by sensory neurons generates immunoregulatory responses through efferent autonomic neuron signaling. The functional organization of this neural control is based on principles of reflex regulation. Reflexes involving the vagus nerve and other nerves have been therapeutically explored in models of inflammatory and autoimmune conditions, and recently in clinical settings. The brain integrates neuro-immune communication, and brain function is altered in diseases characterized by peripheral immune dysregulation and inflammation. Here we review the anatomical and molecular basis of the neural interface with immunity, focusing on peripheral neural control of immune functions and the role of the brain in the model of the immunological homunculus. Clinical advances stemming from this knowledge within the framework of bioelectronic medicine are also briefly outlined.

  19. Stressor Controllability and Immune Function

    Science.gov (United States)

    1986-10-17

    susceptibility to infectious disease . In E. Kurstak, P. V. Morozov, & Z. P. Lipowski (Eds.), Viruses , immunity, and mental health. Plenum Press, in press. w...following inmunization . a. ELISA Procedure. We-Tsof a flat bottomed microtiter plate (NUNC, certified Immunopla.e I) were coated with KLH (0.2 mi/well, 0.5 mg...because the, rats were being infected with viruses and other agents tnat could alter proliferation. We thus began to purchase pathogen-free animals and

  20. Innate immune functions of microglia isolated from human glioma patients

    Directory of Open Access Journals (Sweden)

    Grimm Elizabeth

    2006-03-01

    Full Text Available Abstract Background Innate immunity is considered the first line of host defense and microglia presumably play a critical role in mediating potent innate immune responses to traumatic and infectious challenges in the human brain. Fundamental impairments of the adaptive immune system in glioma patients have been investigated; however, it is unknown whether microglia are capable of innate immunity and subsequent adaptive anti-tumor immune responses within the immunosuppressive tumor micro-environment of human glioma patients. We therefore undertook a novel characterization of the innate immune phenotype and function of freshly isolated human glioma-infiltrating microglia (GIM. Methods GIM were isolated by sequential Percoll purification from patient tumors immediately after surgical resection. Flow cytometry, phagocytosis and tumor cytotoxicity assays were used to analyze the phenotype and function of these cells. Results GIM expressed significant levels of Toll-like receptors (TLRs, however they do not secrete any of the cytokines (IL-1β, IL-6, TNF-α critical in developing effective innate immune responses. Similar to innate macrophage functions, GIM can mediate phagocytosis and non-MHC restricted cytotoxicity. However, they were statistically less able to mediate tumor cytotoxicity compared to microglia isolated from normal brain. In addition, the expression of Fas ligand (FasL was low to absent, indicating that apoptosis of the incoming lymphocyte population may not be a predominant mode of immunosuppression by microglia. Conclusion We show for the first time that despite the immunosuppressive environment of human gliomas, GIM are capable of innate immune responses such as phagocytosis, cytotoxicity and TLR expression but yet are not competent in secreting key cytokines. Further understanding of these innate immune functions could play a critical role in understanding and developing effective immunotherapies to malignant human gliomas.

  1. Normal Functions As A New Way Of Defining Computable Functions

    Directory of Open Access Journals (Sweden)

    Leszek Dubiel

    2004-01-01

    Full Text Available Report sets new method of defining computable functions. This is formalization of traditional function descriptions, so it allows to define functions in very intuitive way. Discovery of Ackermann function proved that not all functions that can be easily computed can be so easily described with Hilbert’s system of recursive functions. Normal functions lack this disadvantage.

  2. Normal Functions as a New Way of Defining Computable Functions

    Directory of Open Access Journals (Sweden)

    Leszek Dubiel

    2004-01-01

    Full Text Available Report sets new method of defining computable functions. This is formalization of traditional function descriptions, so it allows to define functions in very intuitive way. Discovery of Ackermann function proved that not all functions that can be easily computed can be so easily described with Hilbert's system of recursive functions. Normal functions lack this disadvantage.

  3. Problematic Internet Usage and Immune Function.

    Science.gov (United States)

    Reed, Phil; Vile, Rebecca; Osborne, Lisa A; Romano, Michela; Truzoli, Roberto

    2015-01-01

    Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health - General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.

  4. Problematic Internet Usage and Immune Function.

    Directory of Open Access Journals (Sweden)

    Phil Reed

    Full Text Available Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test, depression and anxiety (Hospital Anxiety and Depression Scales, social isolation (UCLA Loneliness Questionnaire, sleep problems (Pittsburgh Sleep Quality Index, and their current health - General Health Questionnaire (GHQ-28, and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28. This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol.

  5. Problematic Internet Usage and Immune Function

    Science.gov (United States)

    Reed, Phil; Vile, Rebecca; Osborne, Lisa A.; Romano, Michela; Truzoli, Roberto

    2015-01-01

    Problematic internet use has been associated with a variety of psychological comorbidities, but it relationship with physical illness has not received the same degree of investigation. The current study surveyed 505 participants online, and asked about their levels of problematic internet usage (Internet Addiction Test), depression and anxiety (Hospital Anxiety and Depression Scales), social isolation (UCLA Loneliness Questionnaire), sleep problems (Pittsburgh Sleep Quality Index), and their current health – General Health Questionnaire (GHQ-28), and the Immune Function Questionnaire. The results demonstrated that around 30% of the sample displayed mild or worse levels of internet addiction, as measured by the IAT. Although there were differences in the purposes for which males and females used the internet, there were no differences in terms of levels of problematic usage between genders. The internet problems were strongly related to all of the other psychological variables such as depression, anxiety, social-isolation, and sleep problems. Internet addiction was also associated with reduced self-reported immune function, but not with the measure of general health (GHQ-28). This relationship between problematic internet use and reduced immune function was found to be independent of the impact of the co-morbidities. It is suggested that the negative relationship between level of problematic internet use and immune function may be mediated by levels of stress produced by such internet use, and subsequent sympathetic nervous activity, which related to immune-supressants, such as cortisol. PMID:26244339

  6. Mental resilience, perceived immune functioning, and health

    Directory of Open Access Journals (Sweden)

    Van Schrojenstein Lantman M

    2017-03-01

    Full Text Available Marith Van Schrojenstein Lantman,1 Marlou Mackus,1 Leila S Otten,1 Deborah de Kruijff,1 Aurora JAE van de Loo,1,2 Aletta D Kraneveld,1,2 Johan Garssen,1,3 Joris C Verster1,2,4 1Division of Pharmacology, Utrecht University, Utrecht, the Netherlands; 2Institute for Risk Assessment Sciences, Utrecht University, Utrecht, the Netherlands; 3Nutricia Research, Utrecht, the Netherlands; 4Centre for Human Psychopharmacology, Swinburne University, Melbourne, Australia Background: Mental resilience can be seen as a trait that enables an individual to recover from stress and to face the next stressor with optimism. People with resilient traits are considered to have a better mental and physical health. However, there are limited data available assessing the relationship between resilient individuals and their perspective of their health and immune status. Therefore, this study was conducted to examine the relationship between mental resilience, perceived health, and perceived immune status. Methods: A total of 779 participants recruited at Utrecht University completed a questionnaire consisting of demographic characteristics, the brief resilience scale for the assessment of mental resilience, the immune function questionnaire (IFQ, and questions regarding their perceived health and immune status. Results: When correcting for gender, age, height, weight, smoker status, amount of cigarettes smoked per week, alcohol consumption status, amount of drinks consumed per week, drug use, and frequency of past year drug use, mental resilience was significantly correlated with perceived health (r=0.233, p=0.0001, perceived immune functioning (r=0.124, p=0.002, and IFQ score (r=−0.185, p=0.0001. Conclusion: A significant, albeit modest, relationship was found between mental resilience and perceived immune functioning and health. Keywords: mental resilience, immune functioning, health, vitality, quality of life

  7. Position statement. Part one: Immune function and exercise

    DEFF Research Database (Denmark)

    Walsh, Neil P; Gleeson, Michael; Shephard, Roy J

    2011-01-01

    responses and falls in stimulated B cell Ig synthesis. The cause of this apparent depression in acquired immunity appears to be related to elevated circulating stress hormones, and alterations in the pro/anti-inflammatory cytokine balance in response to exercise. The clinical significance of these changes...... and immediately after exercise, proportional to exercise intensity and duration, with numbers of cells (T cells and to a lesser extent B cells) falling below pre-exercise levels during the early stages of recovery, before returning to resting values normally within 24 h. Mobilization of T and B cell subsets...... risk of URTI during heavy training. An important question for exercise immunologists remains: how does one measure immune function in a meaningful way? One approach to assessing immune function that extends beyond blood or salivary measures involves challenging study participants with antigenic stimuli...

  8. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  9. Dissociative Functions in the Normal Mourning Process.

    Science.gov (United States)

    Kauffman, Jeffrey

    1994-01-01

    Sees dissociative functions in mourning process as occurring in conjunction with integrative trends. Considers initial shock reaction in mourning as model of normal dissociation in mourning process. Dissociation is understood to be related to traumatic significance of death in human consciousness. Discerns four psychological categories of…

  10. Vitamin D and neonatal immune function.

    LENUS (Irish Health Repository)

    Clancy, N

    2013-05-01

    Vitamin D deficiency is widespread in the neonatal and paediatric population of northern latitudes, particularly in children of African, Middle Eastern and Asian ethnicity. This is associated with diminished immune function and increases the risk of Th1 autoimmune diseases like type 1 diabetes. Epidermiological studies have also shown a link between vitamin D deficiency in children and a more severe course of illness with lower respiratory tract infection or Respiratory Syncitial Virus (RSV) bronchiolitis. The mechanism by which vitamin D enhances immunity is complex. It acts through the innate immune system by inducing antimicrobial peptides in epithelial cells, neutrophils and macrophages. The role of Vitamin D in neonatal and paediatric immunomodulation requires further study.

  11. Zinc as a Gatekeeper of Immune Function

    Directory of Open Access Journals (Sweden)

    Inga Wessels

    2017-11-01

    Full Text Available After the discovery of zinc deficiency in the 1960s, it soon became clear that zinc is essential for the function of the immune system. Zinc ions are involved in regulating intracellular signaling pathways in innate and adaptive immune cells. Zinc homeostasis is largely controlled via the expression and action of zinc “importers” (ZIP 1–14, zinc “exporters” (ZnT 1–10, and zinc-binding proteins. Anti-inflammatory and anti-oxidant properties of zinc have long been documented, however, underlying mechanisms are still not entirely clear. Here, we report molecular mechanisms underlying the development of a pro-inflammatory phenotype during zinc deficiency. Furthermore, we describe links between altered zinc homeostasis and disease development. Consequently, the benefits of zinc supplementation for a malfunctioning immune system become clear. This article will focus on underlying mechanisms responsible for the regulation of cellular signaling by alterations in zinc homeostasis. Effects of fast zinc flux, intermediate “zinc waves”, and late homeostatic zinc signals will be discriminated. Description of zinc homeostasis-related effects on the activation of key signaling molecules, as well as on epigenetic modifications, are included to emphasize the role of zinc as a gatekeeper of immune function.

  12. Immune functions of the garment workers.

    Science.gov (United States)

    Sultana, R; Ferdous, K J; Hossain, M; Zahid, M S H; Islam, L N

    2012-10-01

    Occupational exposure to cotton dust, fibers, metal fumes and different chemicals used in the aparrel manufacturing industries cause a wide range of physical and psychological health problems in the garment workers that may also affect their immune function. To assess the immune system function in garment workers. A total of 45 workers of a garment factory, and 41 control subjects, not exposed to the garment working environment were enrolled in this study. In the study subjects, the complement system function was assessed as bactericidal activity on Escherichia coli DH5α cells using the standard plate count method. Serum complement components C3 and C4 were measured by immunoprecipitation, and IgG was measured by immunonephelometry. The bactericidal activity of serum complement in the garment workers (range: 93.5%-99.9%) was significantly (pgarment workers, the mean levels of complement C3, and C4 were 1.75 and 0.26 g/L, respectively that were close to those of the controls. The mean IgG level in the garment workers was 13.5 g/L that was significantly (pgarment factory may affect the immune system.

  13. Does partial occlusion promote normal binocular function?

    Science.gov (United States)

    Li, Jingrong; Thompson, Benjamin; Ding, Zhaofeng; Chan, Lily Y L; Chen, Xiang; Yu, Minbin; Deng, Daming; Hess, Robert F

    2012-10-03

    There is growing evidence that abnormal binocular interactions play a key role in the amblyopia syndrome and represent a viable target for treatment interventions. In this context the use of partial occlusion using optical devices such as Bangerter filters as an alternative to complete occlusion is of particular interest. The aims of this study were to understand why Bangerter filters do not result in improved binocular outcomes compared to complete occlusion, and to compare the effects of Bangerter filters, optical blur and neutral density (ND) filters on normal binocular function. The effects of four strengths of Bangerter filters (0.8, 0.6, 0.4, 0.2) on letter and vernier acuity, contrast sensitivity, stereoacuity, and interocular suppression were measured in 21 observers with normal vision. In a subset of 14 observers, the partial occlusion effects of Bangerter filters, ND filters and plus lenses on stereopsis and interocular suppression were compared. Bangerter filters did not have graded effect on vision and induced significant disruption to binocular function. This disruption was greater than that of monocular defocus but weaker than that of ND filters. The effect of the Bangerter filters on stereopsis was more pronounced than their effect on monocular acuity, and the induced monocular acuity deficits did not predict the induced deficits in stereopsis. Bangerter filters appear to be particularly disruptive to binocular function. Other interventions, such as optical defocus and those employing computer generated dichoptic stimulus presentation, may be more appropriate than partial occlusion for targeting binocular function during amblyopia treatment.

  14. Low Dose Ionizing Radiation Modulates Immune Function

    International Nuclear Information System (INIS)

    Nelson, Gregory A.

    2016-01-01

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a 'Th2 polarized' immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in

  15. Low Dose Ionizing Radiation Modulates Immune Function

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, Gregory A. [Loma Linda Univ., CA (United States)

    2016-01-12

    In order to examine the effects of low dose ionizing radiation on the immune system we chose to examine an amplified adaptive cellular immunity response. This response is Type IV delayed-type hypersensitivity also called contact hypersensitivity. The agent fluorescein isothiocyanate (FITC) is a low molecular weight, lipophilic, reactive, fluorescent molecule that can be applied to the skin where it (hapten) reacts with proteins (carriers) to become a complete antigen. Exposure to FITC leads to sensitization which is easily measured as a hypersensitivity inflammatory reaction following a subsequent exposure to the ear. Ear swelling, eosinophil infiltration, immunoglobulin E production and cytokine secretion patterns characteristic of a “Th2 polarized” immune response are the components of the reaction. The reaction requires successful implementation of antigen processing and presentation by antigen presenting Langerhans cells, communication with naïve T lymphocytes in draining lymph nodes, expansion of activated T cell clones, migration of activated T cells to the circulation, and recruitment of memory T cells, macrophages and eosinophils to the site of the secondary challenge. Using this model our approach was to quantify system function rather than relying only on indirect biomarkers of cell. We measured the FITC-induced hypersensitivity reaction over a range of doses from 2 cGy to 2 Gy. Irradiations were performed during key events or prior to key events to deplete critical cell populations. In addition to quantifying the final inflammatory response, we assessed cell populations in peripheral blood and spleen, cytokine signatures, IgE levels and expression of genes associated with key processes in sensitization and elicitation/recall. We hypothesized that ionizing radiation would produce a biphasic effect on immune system function resulting in an enhancement at low doses and a depression at higher doses and suggested that this transition would occur in the

  16. Normal families and isolated singularities of meromorphic functions

    International Nuclear Information System (INIS)

    Chee, P.S.; Subramaniam, A.

    1985-06-01

    Based on the criterion of Zalcman for normal families, a generalization of a well-known result relating normal families and isolated essential singularities of meromorphic functions is proved, using a theorem of Lehto and Virtanen on normal functions. (author)

  17. The function of the Mediator complex in plant immunity.

    Science.gov (United States)

    An, Chuanfu; Mou, Zhonglin

    2013-03-01

    Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

  18. Normal thyroid function values in Ethiopians

    International Nuclear Information System (INIS)

    Wassie, Emnetu; Abdulkadir, Jemal

    1990-01-01

    Thyroid function values were determined in 56 healthy nongoitrous adult Ethiopians. The mean triiodothyronine (T3) values for 20 males and 36 females were 1.42+-0.32 nmol/L and 1.51+-0.25 nmol/L, and thyroxine (T4) values were 119 22 nmol/L and 116+21 nmol/L respectively. The mean thyrotropin (TSH) values for males and females were identical at 1.86+-0.94 mu/L. Radioactive iodine uptake (RAIU) at 2 hours was 8.6+-4.4% in males and 11.3+-4.3% in females, and at 24 hours 31.7+-11.7% and 38.9+-11.1% respectively. The difference between males and females were significant at both 2 and 24 hours (P<0.05). The ranges for the 3 hormones derived from the mean 2SD values are close to these supplied with the kits but the Ethiopian RAIU values are higher than the values currently applicable in developed countries, probably indicative of the lower level of dietary iodine available to the population here. The values obtained in this study are offered to serve as normal reference for the interpretation of thyroid function results in Ethiopian patients. A strategy for the rational utilization of the available in vitro tests is suggested

  19. Impaired immune function in children and adults with Fanconi anemia.

    Science.gov (United States)

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  20. Normal Function of the Colon and Anorectal Area

    Science.gov (United States)

    ... What is Constipation Introduction: What is Constipation? Normal Function Common Questions & Mistaken Beliefs Signs & Symptoms Symptoms Overview ... What is Constipation Introduction: What is Constipation? Normal Function Common Questions & Mistaken Beliefs Signs & Symptoms Symptoms Overview ...

  1. Measuring the immune system: a comprehensive approach for the analysis of immune functions in humans.

    Science.gov (United States)

    Claus, Maren; Dychus, Nicole; Ebel, Melanie; Damaschke, Jürgen; Maydych, Viktoriya; Wolf, Oliver T; Kleinsorge, Thomas; Watzl, Carsten

    2016-10-01

    The immune system is essential to provide protection from infections and cancer. Disturbances in immune function can therefore directly affect the health of the affected individual. Many extrinsic and intrinsic factors such as exposure to chemicals, stress, nutrition and age have been reported to influence the immune system. These influences can affect various components of the immune system, and we are just beginning to understand the causalities of these changes. To investigate such disturbances, it is therefore essential to analyze the different components of the immune system in a comprehensive fashion. Here, we demonstrate such an approach which provides information about total number of leukocytes, detailed quantitative and qualitative changes in the composition of lymphocyte subsets, cytokine levels in serum and functional properties of T cells, NK cells and monocytes. Using samples from a cohort of 24 healthy volunteers, we demonstrate the feasibility of our approach to detect changes in immune functions.

  2. Nutrition, immune function and health of dairy cattle

    DEFF Research Database (Denmark)

    Ingvartsen, Klaus Lønne; Moyes, Kasey

    2013-01-01

    not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our......) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where...... the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response...

  3. Immune functions in crustaceans: lessons from flies

    NARCIS (Netherlands)

    Stet, R.J.M.; Arts, J.A.J.

    2005-01-01

    In recent years insects, notably Drosophila, have emerged as a popular model for studying immune responses to bacterial and fungal pathogens. Due to the availability of the complete genome sequence, genome-wide scans of immune responses have been performed using microarray analyses. These analyses

  4. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  5. Ex vivo cytosolic delivery of functional macromolecules to immune cells.

    Directory of Open Access Journals (Sweden)

    Armon Sharei

    Full Text Available Intracellular delivery of biomolecules, such as proteins and siRNAs, into primary immune cells, especially resting lymphocytes, is a challenge. Here we describe the design and testing of microfluidic intracellular delivery systems that cause temporary membrane disruption by rapid mechanical deformation of human and mouse immune cells. Dextran, antibody and siRNA delivery performance is measured in multiple immune cell types and the approach's potential to engineer cell function is demonstrated in HIV infection studies.

  6. Environmental exposure to lead induces oxidative stress and modulates the function of the antioxidant defense system and the immune system in the semen of males with normal semen profile

    Energy Technology Data Exchange (ETDEWEB)

    Kasperczyk, Aleksandra; Dobrakowski, Michał [Dept. of Biochemistry, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Jordana 19, 41-808 Zabrze (Poland); Czuba, Zenon P. [Dept. of Microbiology and Immunology, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Jordana 19, 41-808 Zabrze (Poland); Horak, Stanisław [I-st Chair and Clin. Dept. of Gynecology, Obstetrics and Gynecological Oncology, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Batorego 15, 41-902 Bytom (Poland); Kasperczyk, Sławomir, E-mail: kaslav@mp.pl [Dept. of Biochemistry, School of Medicine with the Division of Dentistry, Medical University of Silesia, Katowice, Jordana 19, 41-808 Zabrze (Poland)

    2015-05-01

    We investigated the associations between environmental exposure to lead and a repertoire of cytokines in seminal plasma of males with normal semen profile according to the WHO criteria. Based on the median lead concentration in seminal plasma, 65 samples were divided into two groups: low (LE) and high exposure to lead (HE). Differences in semen volume and the pH, count, motility and morphology of sperm cells were not observed between the examined groups. The total oxidant status value and the level of protein sulfhydryl groups as well as the activities of manganese superoxide dismutase and catalase were significantly higher in the HE group, whereas the total antioxidant capacity value and the activities of glutathione reductase and glutathione-S-transferase were depressed. IL-7, IL-10, IL-12, and TNF-α levels were significantly higher in the HE group compared with the LE group. Environmental exposure to lead is sufficient to induce oxidative stress in seminal plasma and to modulate antioxidant defense system. - Highlights: • Lead induces oxidative stress in seminal plasma in human. • Lead modulates antioxidant defense system in seminal plasma in human. • Lead does not change a Th1/Th2 imbalance in seminal plasma in human.

  7. Heme oxygenase and the immune system in normal and pathological pregnancies

    Directory of Open Access Journals (Sweden)

    Maide eOzen

    2015-04-01

    Full Text Available Normal pregnancy is an immunotolerant state. Many factors, including environmental, socioeconomic, genetic, and immunologic changes by infection and/or other causes of inflammation, may contribute to inter-individual differences resulting in a normal or pathologic pregnancy. In particular, imbalances in the immune system can cause many pregnancy-related diseases, such as infertility, abortions, pre-eclampsia, and preterm labor, which result in maternal/fetal death, prematurity, or small-for-gestational age newborns. New findings imply that myeloid regulatory cells and regulatory T cells (Tregs may mediate immunotolerance during normal pregnancy. Effector T cells (Teffs have, in contrast, been implicated to cause adverse pregnancy outcomes. Furthermore, feto-maternal tolerance affects the developing fetus. It has been shown that the Treg/Teff balance affects litter size and adoptive transfer of pregnancy-induced Tregs can prevent fetal rejection in the mouse. Heme oxygenase-1 (HO-1 has a protective role in many conditions through its anti-inflammatory, anti-apoptotic, antioxidative, and anti-proliferative actions. HO-1 is highly expressed in the placenta and plays a role in angiogenesis and placental vascular development and in regulating vascular tone in pregnancy. In addition, HO-1 is a major regulator of immune homeostasis by mediating crosstalk between innate and adaptive immune systems. Moreover, HO-1 can inhibit inflammation-induced phenotypic maturation of immune effector cells and pro-inflammatory cytokine secretion and promote anti-inflammatory cytokine production. HO-1 may also be associated with T-cell activation and can limit immune-based tissue injury by promoting Treg suppression of effector responses. Thus, HO-1 and its byproducts may protect against pregnancy complications by its immunomodulatory effects, and the regulation of HO-1 or its downstream effects has the potential to prevent or treat pregnancy complications and

  8. Does Exercise Alter Immune Function and Respiratory Infections?

    Science.gov (United States)

    Nieman, David C.

    2001-01-01

    This paper examines whether physical activity influences immune function as a consequence risk of infection from the common cold and other upper respiratory tract infections (URTI) and whether the immune system responds differently to moderate versus intense physical exertion. Research indicates that people who participate in regular moderate…

  9. Biliary Innate Immunity: Function and Modulation

    Directory of Open Access Journals (Sweden)

    Kenichi Harada

    2010-01-01

    Full Text Available Biliary innate immunity is involved in the pathogenesis of cholangiopathies in patients with primary biliary cirrhosis (PBC and biliary atresia. Biliary epithelial cells possess an innate immune system consisting of the Toll-like receptor (TLR family and recognize pathogen-associated molecular patterns (PAMPs. Tolerance to bacterial PAMPs such as lipopolysaccharides is also important to maintain homeostasis in the biliary tree, but tolerance to double-stranded RNA (dsRNA is not found. In PBC, CD4-positive Th17 cells characterized by the secretion of IL-17 are implicated in the chronic inflammation of bile ducts and the presence of Th17 cells around bile ducts is causally associated with the biliary innate immune responses to PAMPs. Moreover, a negative regulator of intracellular TLR signaling, peroxisome proliferator-activated receptor-γ (PPARγ, is involved in the pathogenesis of cholangitis. Immunosuppression using PPARγ ligands may help to attenuate the bile duct damage in PBC patients. In biliary atresia characterized by a progressive, inflammatory, and sclerosing cholangiopathy, dsRNA viruses are speculated to be an etiological agent and to directly induce enhanced biliary apoptosis via the expression of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL. Moreover, the epithelial-mesenchymal transition (EMT of biliary epithelial cells is also evoked by the biliary innate immune response to dsRNA.

  10. In-Situ Monitoring of Immune Function, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Monitoring the health and wellness of mission pilots is a critically important function. Space flight has an adverse effect on the human immune response. During...

  11. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    International Nuclear Information System (INIS)

    Spector, June T.; De Roos, Anneclaire J.; Ulrich, Cornelia M.; Sheppard, Lianne; Sjoedin, Andreas; Wener, Mark H.; Wood, Brent

    2014-01-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  12. Plasma polychlorinated biphenyl concentrations and immune function in postmenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Spector, June T., E-mail: spectj@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); De Roos, Anneclaire J., E-mail: ajd335@drexel.edu [Epidemiology Program, Public Health Sciences Division, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Ulrich, Cornelia M., E-mail: neli.ulrich@nct-heidelberg.de [Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Cancer Prevention Program, Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N, P.O. Box 19024, Seattle, WA 98109 (United States); National Center for Tumor Diseases and German Cancer Research Center, Heidelberg (Germany); Sheppard, Lianne, E-mail: sheppard@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way NE, Seattle, WA 98105 (United States); Department of Biostatistics, School of Public Health, University of Washington, Seattle, WA (United States); Sjoedin, Andreas, E-mail: asjodin@cdc.gov [National Center for Environmental Health, CDC, 4770 Buford Highway NE, Atlanta, GA 30341 (United States); Wener, Mark H., E-mail: wener@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); Wood, Brent, E-mail: woodbl@u.washington.edu [Department of Medicine, School of Medicine, University of Washington, Seattle, WA (United States); and others

    2014-05-01

    Background: Polychlorinated biphenyl (PCB) exposure has been associated with non-Hodgkin lymphoma in several studies, and the immune system is a potential mediator. Objectives: We analyzed associations of plasma PCBs with immune function measures. We hypothesized that higher plasma PCB concentrations are associated with lower immune function cross-sectionally, and that increases in PCB concentrations over a one year period are associated with decreases in immune function. Methods: Plasma PCB concentrations and immune function [natural killer (NK) cell cytotoxicity and PHA-induced T-lymphocyte proliferation (PHA-TLP)] were measured at baseline and one year in 109 postmenopausal overweight women participating in an exercise intervention study in the Seattle, Washington (USA) area. Mixed models, with adjustment for body mass index and other potential confounders, were used to estimate associations of PCBs with immune function cross-sectionally and longitudinally. Results: Associations of PCBs with immune function measures differed across groups of PCBs (e.g., medium- and high-chlorinated and dioxin-like [mono-ortho-substituted]) and by the time frame for the comparison (cross-sectional vs. longitudinal). Higher concentrations of medium- and high-chlorinated PCBs were associated with higher PHA-TLP cross-sectionally but not longitudinally. The mean decrease in 0.5 µg/mL PHA-TLP/50.0 pmol/g-lipid increase in dioxin-like PCBs over one year was 51.6 (95% confidence interval 2.7, 100.5; P=0.039). There was no association between plasma PCBs and NK cytotoxicity. Conclusions: These results do not provide strong evidence of impaired cellular immunity from PCB exposure. Larger longitudinal studies with greater variability in PCB exposures are needed to further examine temporal associations of PCBs with immune function. - Highlights: • Plasma PCBs and immune function were measured in 109 women at baseline and one year. • Immune measures included T lymphocyte proliferation

  13. Normal macrophage function in copper deficient mice

    International Nuclear Information System (INIS)

    Lukasewycz, O.A.; Kolquist, K.L.; Prohaska, J.R.

    1986-01-01

    Copper deficiency (-Cu) was produced in C57 BL and C58 mice by feeding a low copper diet (modified AIN-76A) from birth. Mice given supplemental copper in the drinking water (+Cu) served as controls. Copper status was monitored by assay of ceruloplasmin (CP) activity. Macrophages (M0) were obtained from matched +Cu and -Cu male 7 week-old mice by peritoneal lavage 3 days after thioglycollate stimulation. M0 were assayed in terms of lipopolysaccharide-induced hexose monophosphate shunt activity by monitoring 14 CO 2 production from [1- 14 C]-glucose and by the determination of phagocytic index using fluorescein labelled latex bead ingestion. M0 from -Cu mice were equivalent to those of +Cu mice in both these parameters. However, superoxide dismutase and cytochrome oxidase activities were both significantly lower in -Cu M0, confirming a functional copper deficiency. Previous results from this laboratory have shown that -Cu mice have a decreased antibody response to sheep erythrocyte antigens and a diminished reactivity to B and T cell mitogens. These immunological insufficiencies appear to be proportional to the severity of copper depletion as determined by CP levels. Furthermore, -Cu lymphocytes exhibit depressed mixed lymphocyte reactivity consistent with alterations at the membrane surface. The present results suggest that M0/monocytes are less severely affected than lymphocytes in copper deficiency states

  14. Maternal immunization increases nestling energy expenditure, immune function, and fledging success in a passerine bird

    Directory of Open Access Journals (Sweden)

    Gary Burness

    2018-04-01

    Full Text Available Female birds transfer maternally derived antibodies (matAb to their nestlings, via the egg yolk. These antibodies are thought to provide passive protection, and allow nestlings to avoid the costs associated with mounting an innate immune response. To test whether there is an energetic benefit to nestlings from receiving matAb, we challenged adult female tree swallows (Tachycineta bicolor prior to clutch initiation with either lipopolysaccharide (LPS or saline (Control. Following hatching, one half of each female's nestlings were immunized on day 8 post-hatch with LPS or saline, and the 4-h post-immunization nestling metabolic rate (MR was measured. There was no difference in either LPS-reactive antibodies or total Ig levels between offspring of immunized and non-immunized mothers on day 6 or 14 post-hatch, possibly reflecting a relatively short half-life of matAbs in altricial birds. Additionally, we found no evidence that nestlings from LPS-immunized mothers could avoid the growth suppression that may result from activation of an inflammatory response. Unexpectedly, we found that control nestlings from LPS mothers had higher resting MR than control nestlings of control mothers. We attribute the increased MR to the costs associated with a general non-specific enhancement of immune function in nestlings from LPS-immunized mothers. Consistent with enhanced immune function, nestlings of immunized mothers had a more robust inflammatory response to phytohaemagglutinin and higher fledging success. Our results suggest that maternal antigen exposure pre-laying can result in increased fitness for both mothers and offspring, depending on food availability.

  15. Staphylococcal Immune Evasion Proteins: Structure, Function, and Host Adaptation.

    Science.gov (United States)

    Koymans, Kirsten J; Vrieling, Manouk; Gorham, Ronald D; van Strijp, Jos A G

    2017-01-01

    Staphylococcus aureus is a successful human and animal pathogen. Its pathogenicity is linked to its ability to secrete a large amount of virulence factors. These secreted proteins interfere with many critical components of the immune system, both innate and adaptive, and hamper proper immune functioning. In recent years, numerous studies have been conducted in order to understand the molecular mechanism underlying the interaction of evasion molecules with the host immune system. Structural studies have fundamentally contributed to our understanding of the mechanisms of action of the individual factors. Furthermore, such studies revealed one of the most striking characteristics of the secreted immune evasion molecules: their conserved structure. Despite high-sequence variability, most immune evasion molecules belong to a small number of structural categories. Another remarkable characteristic is that S. aureus carries most of these virulence factors on mobile genetic elements (MGE) or ex-MGE in its accessory genome. Coevolution of pathogen and host has resulted in immune evasion molecules with a highly host-specific function and prevalence. In this review, we explore how these shared structures and genomic locations relate to function and host specificity. This is discussed in the context of therapeutic options for these immune evasion molecules in infectious as well as in inflammatory diseases.

  16. Sleep and immune function: glial contributions and consequences of aging.

    Science.gov (United States)

    Ingiosi, Ashley M; Opp, Mark R; Krueger, James M

    2013-10-01

    The reciprocal interactions between sleep and immune function are well-studied. Insufficient sleep induces innate immune responses as evidenced by increased expression of pro-inflammatory mediators in the brain and periphery. Conversely, immune challenges upregulate immunomodulator expression, which alters central nervous system-mediated processes and behaviors, including sleep. Recent studies indicate that glial cells, namely microglia and astrocytes, are active contributors to sleep and immune system interactions. Evidence suggests glial regulation of these interactions is mediated, in part, by adenosine and adenosine 5'-triphosphate actions at purinergic type 1 and type 2 receptors. Furthermore, microglia and astrocytes may modulate declines in sleep-wake behavior and immunity observed in aging. Copyright © 2013. Published by Elsevier Ltd.

  17. Temperament Affects Sympathetic Nervous Function in a Normal Population

    OpenAIRE

    Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

    2012-01-01

    Objective Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Methods Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean vers...

  18. Functional comparison of innate immune signaling pathways in primates.

    Directory of Open Access Journals (Sweden)

    Luis B Barreiro

    2010-12-01

    Full Text Available Humans respond differently than other primates to a large number of infections. Differences in susceptibility to infectious agents between humans and other primates are probably due to inter-species differences in immune response to infection. Consistent with that notion, genes involved in immunity-related processes are strongly enriched among recent targets of positive selection in primates, suggesting that immune responses evolve rapidly, yet providing only indirect evidence for possible inter-species functional differences. To directly compare immune responses among primates, we stimulated primary monocytes from humans, chimpanzees, and rhesus macaques with lipopolysaccharide (LPS and studied the ensuing time-course regulatory responses. We find that, while the universal Toll-like receptor response is mostly conserved across primates, the regulatory response associated with viral infections is often lineage-specific, probably reflecting rapid host-virus mutual adaptation cycles. Additionally, human-specific immune responses are enriched for genes involved in apoptosis, as well as for genes associated with cancer and with susceptibility to infectious diseases or immune-related disorders. Finally, we find that chimpanzee-specific immune signaling pathways are enriched for HIV-interacting genes. Put together, our observations lend strong support to the notion that lineage-specific immune responses may help explain known inter-species differences in susceptibility to infectious diseases.

  19. Diverse novel functions of neutrophils in immunity, inflammation, and beyond

    OpenAIRE

    Mocsai, A.

    2013-01-01

    Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10–20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellu...

  20. [Impact of thymic function in age-related immune deterioration].

    Science.gov (United States)

    Ferrando-Martínez, Sara; de la Fuente, Mónica; Guerrero, Juan Miguel; Leal, Manuel; Muñoz-Fernández, M Ángeles

    2013-01-01

    Age-related biological deterioration also includes immune system deterioration and, in consequence, a rise in the incidence and prevalence of infections and cancers, as well as low responses to vaccination strategies. Out of all immune cell subsets, T-lymphocytes seem to be involved in most of the age-related defects. Since T-lymphocytes mature during their passage through the thymus, and the thymus shows an age-related process of atrophy, thymic regression has been proposed as the triggering event of this immune deterioration in elderly people. Historically, it has been accepted that the young thymus sets the T-lymphocyte repertoire during the childhood, whereupon atrophy begins until the elderly thymus is a non-functional evolutionary trace. However, a rising body of knowledge points toward the thymus functioning during adulthood. In the elderly, higher thymic function is associated with a younger immune system, while thymic function failure is associated with all-cause mortality. Therefore, any new strategy focused on the improvement of the elderly quality of life, especially those trying to influence the immune system, should take into account, together with peripheral homeostasis, thymus function as a key element in slowing down age-related decline. Copyright © 2012 SEGG. Published by Elsevier Espana. All rights reserved.

  1. Neuronal Function in Male Sprague Dawley Rats During Normal ...

    African Journals Online (AJOL)

    olayemitoyin

    Summary: During normal ageing, there are physiological changes especially in high energy ... science and technology (U.S. Bureau of the Census ... strategies that can be applied to preserve function with ..... Intelligent Technology for an.

  2. Endometrial immune markers are potential predictors of normal fertility and pregnancy after in vitro fertilization.

    Science.gov (United States)

    Kofod, Louise; Lindhard, Anette; Bzorek, Michael; Eriksen, Jens Ole; Larsen, Lise Grupe; Hviid, Thomas Vauvert F

    2017-09-01

    Elucidating immune mechanisms in the endometrium, which lead to the success of implantation and pregnancy, is important in reproductive medicine. Studies of immune cell abundance have shown conflicting results, and the expression and importance of HLA class Ib proteins in pre-implantation endometrium have not yet been investigated. The study population consisted of four subgroups: a hydrosalpinx, a salpingectomy, an unexplained infertility, and a fertile control group. Endometrial samples were collected during the implantation window. Immune markers (CD56 + and CD16 + cells, FoxP3 + Tregs, HLA-G, HLA-F) were quantified in the samples. The outcome of the subsequent IVF treatment was recorded. Increased CD56 + uNK cells and high HLA-G expression served as predictor for successful pregnancy outcome. HLA-F expression was positively correlated with uNK cells, being indirectly predictive for achieving pregnancy. Endometrial uNK cell abundance in the pre-implantation endometrium seems to be important for normal fertility and pregnancy success, and they may be used as clinical markers to predict implantation success in IVF. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Immune activation is associated with decreased thymic function in ...

    African Journals Online (AJOL)

    Background: Reduced thymic function causes poor immunological reconstitution in human immunodeficiency virus (HIV)-positive patients on combined antiretroviral therapy (cART). The association between immune activation and thymic function in asymptomatic HIVpositive treatment-naive individuals has thus far not been ...

  4. Normal central retinal function and structure preserved in retinitis pigmentosa.

    Science.gov (United States)

    Jacobson, Samuel G; Roman, Alejandro J; Aleman, Tomas S; Sumaroka, Alexander; Herrera, Waldo; Windsor, Elizabeth A M; Atkinson, Lori A; Schwartz, Sharon B; Steinberg, Janet D; Cideciyan, Artur V

    2010-02-01

    To determine whether normal function and structure, as recently found in forms of Usher syndrome, also occur in a population of patients with nonsyndromic retinitis pigmentosa (RP). Patients with simplex, multiplex, or autosomal recessive RP (n = 238; ages 9-82 years) were studied with static chromatic perimetry. A subset was evaluated with optical coherence tomography (OCT). Co-localized visual sensitivity and photoreceptor nuclear layer thickness were measured across the central retina to establish the relationship of function and structure. Comparisons were made to patients with Usher syndrome (n = 83, ages 10-69 years). Cross-sectional psychophysical data identified patients with RP who had normal rod- and cone-mediated function in the central retina. There were two other patterns with greater dysfunction, and longitudinal data confirmed that progression can occur from normal rod and cone function to cone-only central islands. The retinal extent of normal laminar architecture by OCT corresponded to the extent of normal visual function in patients with RP. Central retinal preservation of normal function and structure did not show a relationship with age or retained peripheral function. Usher syndrome results were like those in nonsyndromic RP. Regional disease variation is a well-known finding in RP. Unexpected was the observation that patients with presumed recessive RP can have regions with functionally and structurally normal retina. Such patients will require special consideration in future clinical trials of either focal or systemic treatment. Whether there is a common molecular mechanism shared by forms of RP with normal regions of retina warrants further study.

  5. The multitasking organ: recent insights into skin immune function.

    Science.gov (United States)

    Di Meglio, Paola; Perera, Gayathri K; Nestle, Frank O

    2011-12-23

    The skin provides the first line defense of the human body against injury and infection. By integrating recent findings in cutaneous immunology with fundamental concepts of skin biology, we portray the skin as a multitasking organ ensuring body homeostasis. Crosstalk between the skin and its microbial environment is also highlighted as influencing the response to injury, infection, and autoimmunity. The importance of the skin immune network is emphasized by the identification of several skin-resident cell subsets, each with its unique functions. Lessons learned from targeted therapy in inflammatory skin conditions, such as psoriasis, provide further insights into skin immune function. Finally, we look at the skin as an interacting network of immune signaling pathways exemplified by the development of a disease interactome for psoriasis. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Humoral Immunity to AAV-6, 8, and 9 in Normal and Dystrophic Dogs

    Science.gov (United States)

    Shin, Jin-Hong; Yue, Yongping; Smith, Bruce

    2012-01-01

    Abstract Adeno-associated virus (AAV)-6, 8, and 9 are promising gene-delivery vectors for testing novel Duchenne muscular dystrophy gene therapy in the canine model. Humoral immunity greatly influences in vivo AAV transduction. However, neutralizing antibodies to AAV-6, 8, and 9 have not been systemically examined in normal and dystrophic dogs. To gain information on the seroprevalence of antibodies to AAV-6, 8, and 9, we measured neutralizing antibody titers using an in vitro transduction inhibition assay. We examined 72 naive serum samples and 26 serum samples obtained from dogs that had received AAV gene transfer. Our data demonstrated that AAV-6 neutralizing antibody was the most prevalent antibody in dogs irrespective of age, gender, disease status (dystrophic or not), and prior parvovirus vaccination history. Surprisingly, high-level anti-AAV-6 antibody was detected at birth in newborn puppies. Further, a robust antibody response was induced in affected, but not normal newborn dogs following systemic AAV gene transfer. Taken together, our data have provided an important baseline on the seroprevalence of AAV-6, 8, and 9 neutralizing antibodies in normal and Duchenne muscular dystrophy dogs. These results will help guide translational AAV gene-therapy studies in dog models of muscular dystrophy. PMID:22040468

  7. Nutrition, immune function and health of dairy cattle.

    Science.gov (United States)

    Ingvartsen, K L; Moyes, K

    2013-03-01

    The large increase in milk yield and the structural changes in the dairy industry have caused major changes in the housing, feeding and management of the dairy cow. However, while large improvements have occurred in production and efficiency, the disease incidence, based on veterinary records, does not seem to be improved. Earlier reviews have covered critical periods such as the transition period in the cow and its influence on health and immune function, the interplay between the endocrine system and the immune system and nutrition and immune function. Knowledge on these topics is crucial for our understanding of disease risk and our effort to develop health and welfare improving strategies, including proactive management for preventing diseases and reducing the severity of diseases. To build onto this the main purpose of this review will therefore be on the effect of physiological imbalance (PI) on immune function, and to give perspectives for prevention of diseases in the dairy cow through nutrition. To a large extent, the health problems during the periparturient period relate to cows having difficulty in adapting to the nutrient needs for lactation. This may result in PI, a situation where the regulatory mechanisms are insufficient for the animals to function optimally leading to a high risk of a complex of digestive, metabolic and infectious problems. The risk of infectious diseases will be increased if the immune competence is reduced. Nutrition plays a pivotal role in the immune response and the effect of nutrition may be directly through nutrients or indirectly by metabolites, for example, in situations with PI. This review discusses the complex relationships between metabolic status and immune function and how these complex interactions increase the risk of disease during early lactation. A special focus will be placed on the major energetic fuels currently known to be used by immune cells (i.e. glucose, non-esterified fatty acids, beta

  8. Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several s...

  9. Laser Therapy Inhibits Tumor Growth in Mice by Promoting Immune Surveillance and Vessel Normalization

    Directory of Open Access Journals (Sweden)

    Giulia Ottaviani

    2016-09-01

    Full Text Available Laser therapy, recently renamed as photobiomodulation, stands as a promising supportive treatment for oral mucositis induced by oncological therapies. However, its mechanisms of action and, more importantly, its safety in cancer patients, are still unclear. Here we explored the anti-cancer effect of 3 laser protocols, set at the most commonly used wavelengths, in B16F10 melanoma and oral carcinogenesis mouse models. While laser light increased cell metabolism in cultured cells, the in vivo outcome was reduced tumor progression. This striking, unexpected result, was paralleled by the recruitment of immune cells, in particular T lymphocytes and dendritic cells, which secreted type I interferons. Laser light also reduced the number of highly angiogenic macrophages within the tumor mass and promoted vessel normalization, an emerging strategy to control tumor progression. Collectively, these results set photobiomodulation as a safety procedure in oncological patients and open the way to its innovative use for cancer therapy.

  10. Chromatin versus pathogens: the function of epigenetics in plant immunity

    Science.gov (United States)

    Ding, Bo; Wang, Guo-Liang

    2015-01-01

    To defend against pathogens, plants have developed a sophisticated innate immunity that includes effector recognition, signal transduction, and rapid defense responses. Recent evidence has demonstrated that plants utilize the epigenetic control of gene expression to fine-tune their defense when challenged by pathogens. In this review, we highlight the current understanding of the molecular mechanisms of histone modifications (i.e., methylation, acetylation, and ubiquitination) and chromatin remodeling that contribute to plant immunity against pathogens. Functions of key histone-modifying and chromatin remodeling enzymes are discussed. PMID:26388882

  11. Diverse novel functions of neutrophils in immunity, inflammation, and beyond.

    Science.gov (United States)

    Mócsai, Attila

    2013-07-01

    Neutrophils have long been considered simple suicide killers at the bottom of the hierarchy of the immune response. That view began to change 10-20 yr ago, when the sophisticated mechanisms behind how neutrophils locate and eliminate pathogens and regulate immunity and inflammation were discovered. The last few years witnessed a new wave of discoveries about additional novel and unexpected functions of these cells. Neutrophils have been proposed to participate in protection against intracellular pathogens such as viruses and mycobacteria. They have been shown to intimately shape the adaptive immune response at various levels, including marginal zone B cells, plasmacytoid dendritic cells and T cell populations, and even to control NK cell homeostasis. Neutrophils have been shown to mediate an alternative pathway of systemic anaphylaxis and to participate in allergic skin reactions. Finally, neutrophils were found to be involved in physiological and pathological processes beyond the immune system, such as diabetes, atherosclerosis, and thrombus formation. Many of those functions appear to be related to their unique ability to release neutrophil extracellular traps even in the absence of pathogens. This review summarizes those novel findings on versatile functions of neutrophils and how they change our view of neutrophil biology in health and disease.

  12. Normalization methods in time series of platelet function assays

    Science.gov (United States)

    Van Poucke, Sven; Zhang, Zhongheng; Roest, Mark; Vukicevic, Milan; Beran, Maud; Lauwereins, Bart; Zheng, Ming-Hua; Henskens, Yvonne; Lancé, Marcus; Marcus, Abraham

    2016-01-01

    Abstract Platelet function can be quantitatively assessed by specific assays such as light-transmission aggregometry, multiple-electrode aggregometry measuring the response to adenosine diphosphate (ADP), arachidonic acid, collagen, and thrombin-receptor activating peptide and viscoelastic tests such as rotational thromboelastometry (ROTEM). The task of extracting meaningful statistical and clinical information from high-dimensional data spaces in temporal multivariate clinical data represented in multivariate time series is complex. Building insightful visualizations for multivariate time series demands adequate usage of normalization techniques. In this article, various methods for data normalization (z-transformation, range transformation, proportion transformation, and interquartile range) are presented and visualized discussing the most suited approach for platelet function data series. Normalization was calculated per assay (test) for all time points and per time point for all tests. Interquartile range, range transformation, and z-transformation demonstrated the correlation as calculated by the Spearman correlation test, when normalized per assay (test) for all time points. When normalizing per time point for all tests, no correlation could be abstracted from the charts as was the case when using all data as 1 dataset for normalization. PMID:27428217

  13. Normal function of immunologic stem cells from aged mice

    International Nuclear Information System (INIS)

    Harrison, D.E.; Doubleday, J.W.

    1975-01-01

    Marrow or spleen grafts from aged donor mice produced antibody-forming cells as effectively as did grafts from younger controls in recipients tested 3 to 10 months after the transplantation. All recipients were lethally irradiated, and the T6 chromosome marker was used to demonstrate that they were populated by donor cell lines. Recipients of aged or younger control grafts gave similar responses when stimulated with varying doses of antigen and when tested at different times after the transplantation except in two cases. Recipients of aged spleen grafts gave significantly lower responses than younger controls for the first few weeks after the transplantation. If recipients had been thymectomized before lethal irradiation, aged cell lines (pooled marrow and spleen cells) gave only 37 percent of the responses of younger controls. Given sufficient time and intact young recipients, immunologic stem cell lines from old donors populated recipients with cells having normal immune responses. These results suggest that age-related immunologic defects are not intrinsically timed in the precursor cell lines that populate the immune system. (U.S.)

  14. Normal left ventricular function does not protect against propafenone ...

    African Journals Online (AJOL)

    Normal left ventricular function does not protect against propafenone-induced incessant ventricular tachycardia. R. N. Scott Millar, J. B. Lawrenson, D.A. Milne. Abstract. Propafenone is a class Ic anti-arrhythmic agent with mild B-blocking properties which has recently become available in South Africa. We have used the ...

  15. Loss of renal function causes premature aging of the immune system.

    Science.gov (United States)

    Betjes, Michiel G H; Meijers, Ruud W J; Litjens, Nicolle H R

    2013-01-01

    Uremia-associated immune deficiency is a well-known complication of loss of renal function and contributes significantly to the overall mortality and morbidity of patients with end-stage renal disease. Chronic inflammation and increased oxidative stress are underlying the uremia-associated immune deficiency. In this review, the differential impact of uremia on the cellular immune system is summarized. Virtually all immune cells studied show a combination of an activated status and loss of function. However, uremia preferentially decreases the number and function of lymphoid cells while myeloid cells show normal and/or elevated cell numbers with increased production of inflammatory cytokines and reactive oxygen species. These particular changes are compatible with immunological aging, which is characterized by loss of thymic function, attrition of telomeres and an expanded memory T cell population. Similar to aging in healthy individuals, the proinflammatory and potential cardiotoxic subsets of CD28(null) T cells and CD16(+) monocytes are increased. Epigenetically changed hematopoietic stem cells may be involved in immunological aging as specific DNA regions become hypermethylated. Proinflammatory T cells and monocytes persist after kidney transplantation, which constitutes a persistent cardiovascular risk factor. Possible therapeutic options to reverse or halt uremia-associated immunological aging are discussed. Premature aging of the immune system is a dominant feature in patients with end-stage renal failure, which corresponds to immunological aging in elderly healthy individuals, which is characterized by preferential loss of cells belonging to the lymphoid cell lineage, inflammation and expansion of proinflammatory immune cells. © 2013 S. Karger AG, Basel.

  16. Behavioural conditioning of immune functions: how the central nervous system controls peripheral immune responses by evoking associative learning processes.

    Science.gov (United States)

    Riether, Carsten; Doenlen, Raphaël; Pacheco-López, Gustavo; Niemi, Maj-Britt; Engler, Andrea; Engler, Harald; Schedlowski, Manfred

    2008-01-01

    During the last 30 years of psychoneuroimmunology research the intense bi-directional communication between the central nervous system (CNS) and the immune system has been demonstrated in studies on the interaction between the nervous-endocrine-immune systems. One of the most intriguing examples of such interaction is the capability of the CNS to associate an immune status with specific environmental stimuli. In this review, we systematically summarize experimental evidence demonstrating the behavioural conditioning of peripheral immune functions. In particular, we focus on the mechanisms underlying the behavioural conditioning process and provide a theoretical framework that indicates the potential feasibility of behaviourally conditioned immune changes in clinical situations.

  17. Angiogenesis for tumor vascular normalization of Endostar on hepatoma 22 tumor-bearing mice is involved in the immune response.

    Science.gov (United States)

    Xu, Qingyu; Gu, Junfei; Lv, You; Yuan, Jiarui; Yang, Nan; Chen, Juan; Wang, Chunfei; Hou, Xuefeng; Jia, Xiaobin; Feng, Liang; Yin, Guowen

    2018-03-01

    Tumor vascular normalization involved in immune response is beneficial to the chemotherapy of tumors. Recombinant human endostatin (Endostar), an angiogenesis inhibitor, has been demonstrated to be effective in hepatocellular cancer (HCC). However, its vascular normalization in HCC and the role of the immune response in angiogenesis were unclear. In the present study, effects of Endostar on tumor vascular normalization were evaluated in hepatoma 22 (H22) tumor-bearing mice. Endostar was able to inhibit the proliferation and infiltration of tumor cells and improve α-fetoprotein, tumor necrosis factor-α and cyclic adenosine 5'-phosphate levels in the serum of H22-bearing mice, as well as the protein expression levels of the immune factors interferon-γ and cluster of differentiation (CD)86 in liver tissue. Endostar also exhibited more marked downregulation of the levels of vascular endothelial growth factor, CD31, matrix metalloproteinase (MMP)-2, MMP-9 and interleukin-17 during day 3-9 treatment, resulting in short-term normalization of tumor blood vessels. The period of vascular normalization was 3-9 days. The results of the present study demonstrated that Endostar was able to induce the period of vascular normalization, contributing to a more efficacious means of HCC treatment combined with other chemotherapy, and this effect was associated with the immune response. It may be concluded that Endostar inhibited immunity-associated angiogenesis behaviors of vascular endothelial cells in response to HCC. The results of the present study provided more reasonable possibility for the combination therapy of Endostar for the treatment of HCC.

  18. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Science.gov (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

    2017-01-01

    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365

  19. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2017-06-01

    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.

  20. Temperament affects sympathetic nervous function in a normal population.

    Science.gov (United States)

    Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee

    2012-09-01

    Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.

  1. Neuronal Function in Male Sprague Dawley Rats During Normal Ageing.

    Science.gov (United States)

    Idowu, A J; Olatunji-Bello, I I; Olagunju, J A

    2017-03-06

    During normal ageing, there are physiological changes especially in high energy demanding tissues including the brain and skeletal muscles. Ageing may disrupt homeostasis and allow tissue vulnerability to disease. To establish an appropriate animal model which is readily available and will be useful to test therapeutic strategies during normal ageing, we applied behavioral approaches to study age-related changes in memory and motor function as a basis for neuronal function in ageing in male Sprague Dawley rats. 3 months, n=5; 6 months, n=5 and 18 months, n=5 male Sprague Dawley Rats were tested using the Novel Object Recognition Task (NORT) and the Elevated plus Maze (EPM) Test. Data was analyzed by ANOVA and the Newman-Keuls post hoc test. The results showed an age-related gradual decline in exploratory behavior and locomotor activity with increasing age in 3 months, 6 months and 18 months old rats, although the values were not statistically significant, but grooming activity significantly increased with increasing age. Importantly, we established a novel finding that the minimum distance from the novel object was statistically significant between 3 months and 18 months old rats and this may be an index for age-related memory impairment in the NORT. Altogether, we conclude that the male Sprague Dawley rat show age-related changes in neuronal function and may be a useful model for carrying out investigations into the mechanisms involved in normal ageing.

  2. Normalization of the collage regions of iterated function systems

    Science.gov (United States)

    Zhang, Zhengbing; Zhang, Wei

    2012-11-01

    Fractal graphics, generated with iterated function systems (IFS), have been applied in broad areas. Since the collage regions of different IFS may be different, it is difficult to respectively show the attractors of iterated function systems in a same region on a computer screen using one program without modifying the display parameters. An algorithm is proposed in this paper to solve this problem. A set of transforms are repeatedly applied to modify the coefficients of the IFS so that the collage region of the resulted IFS changes toward the unit square. Experimental results demonstrate that the collage region of any IFS can be normalized to the unit square with the proposed method.

  3. Jungle Honey Enhances Immune Function and Antitumor Activity

    Directory of Open Access Journals (Sweden)

    Miki Fukuda

    2011-01-01

    Full Text Available Jungle honey (JH is collected from timber and blossom by wild honey bees that live in the tropical forest of Nigeria. JH is used as a traditional medicine for colds, skin inflammation and burn wounds as well as general health care. However, the effects of JH on immune functions are not clearly known. Therefore, we investigated the effects of JH on immune functions and antitumor activity in mice. Female C57BL/6 mice were injected with JH (1 mg/mouse/day, seven times intra-peritoneal. After seven injections, peritoneal cells (PC were obtained. Antitumor activity was assessed by growth of Lewis Lung Carcinoma/2 (LL/2 cells. PC numbers were increased in JH-injected mice compared to control mice. In Dot Plot analysis by FACS, a new cell population appeared in JH-injected mice. The percent of Gr-1 surface antigen and the intensity of Gr-1 antigen expression of PC were increased in JH-injected mice. The new cell population was neutrophils. JH possessed chemotactic activity for neutrophils. Tumor incidence and weight were decreased in JH-injected mice. The ratio of reactive oxygen species (ROS producing cells was increased in JH-injected mice. The effective component in JH was fractionized by gel filtration using HPLC and had an approximate molecular weight (MW of 261. These results suggest that neutrophils induced by JH possess potent antitumor activity mediated by ROS and the effective immune component of JH is substrate of MW 261.

  4. Analysis and comparison of immune reactivity in guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni

    International Nuclear Information System (INIS)

    Rogers, M.V.; McLaren, D.J.

    1987-01-01

    Guinea-pigs immunized with equivalent numbers of normal or radiation-attenuated cercariae of Schistosoma mansoni develop close to complete resistance to reinfection at weeks 12 and 4.5 respectively. We here analyse and compare the immune responses induced by the two populations of cercariae. Both radiation-attenuated and normal parasites of S. mansoni elicited an extensive germinal centre response in guinea-pigs by week 4.5 post-immunization. The anti-parasite antibody titre and cytotoxic activity of serum from 4.5-week-vaccinated, or 4.5-week-infected guinea-pigs were approximately equal, but sera from 12-week-infected individuals had high titres of anti-parasite antibody, which promoted significant larvicidal activity in vitro. In all cases, larvicidal activity was mediated by the IgG 2 fraction of the immune serum. Lymphocyte transformation tests conducted on splenic lymphocytes from 4.5-week vaccinated guinea-pigs revealed maximal stimulation against cercarial, 2-week and 3-week worm antigens, whereas spleen cells from 4.5-week-infected guinea-pigs were maximally stimulated by cercarial and 6-week worm antigens. The splenic lymphocyte responses of 12-week infected animals were dramatic against antigens prepared from all life-stages of the parasite. (author)

  5. MenTORing Immunity: mTOR Signaling in the Development and Function of Tissue-Resident Immune Cells.

    Science.gov (United States)

    Jones, Russell G; Pearce, Edward J

    2017-05-16

    Tissue-resident immune cells must balance survival in peripheral tissues with the capacity to respond rapidly upon infection or tissue damage, and in turn couple these responses with intrinsic metabolic control and conditions in the tissue microenvironment. The serine/threonine kinase mammalian/mechanistic target of rapamycin (mTOR) is a central integrator of extracellular and intracellular growth signals and cellular metabolism and plays important roles in both innate and adaptive immune responses. This review discusses the function of mTOR signaling in the differentiation and function of tissue-resident immune cells, with focus on the role of mTOR as a metabolic sensor and its impact on metabolic regulation in innate and adaptive immune cells. We also discuss the impact of metabolic constraints in tissues on immune homeostasis and disease, and how manipulating mTOR activity with drugs such as rapamycin can modulate immunity in these contexts. Copyright © 2017. Published by Elsevier Inc.

  6. Strategies to enhance immune function for marathon runners : what can be done?

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Pedersen, Bente K

    2007-01-01

    immune cells. During this period of immune suppression, by some referred to as an 'open window' in immune function, it has been hypothesised that viruses and bacteria might gain a foothold, which would increase the risk of infections. In light of this, nutritional interventions that can enhance immune...

  7. Sex differences in normal age trajectories of functional brain networks.

    Science.gov (United States)

    Scheinost, Dustin; Finn, Emily S; Tokoglu, Fuyuze; Shen, Xilin; Papademetris, Xenophon; Hampson, Michelle; Constable, R Todd

    2015-04-01

    Resting-state functional magnetic resonance image (rs-fMRI) is increasingly used to study functional brain networks. Nevertheless, variability in these networks due to factors such as sex and aging is not fully understood. This study explored sex differences in normal age trajectories of resting-state networks (RSNs) using a novel voxel-wise measure of functional connectivity, the intrinsic connectivity distribution (ICD). Males and females showed differential patterns of changing connectivity in large-scale RSNs during normal aging from early adulthood to late middle-age. In some networks, such as the default-mode network, males and females both showed decreases in connectivity with age, albeit at different rates. In other networks, such as the fronto-parietal network, males and females showed divergent connectivity trajectories with age. Main effects of sex and age were found in many of the same regions showing sex-related differences in aging. Finally, these sex differences in aging trajectories were robust to choice of preprocessing strategy, such as global signal regression. Our findings resolve some discrepancies in the literature, especially with respect to the trajectory of connectivity in the default mode, which can be explained by our observed interactions between sex and aging. Overall, results indicate that RSNs show different aging trajectories for males and females. Characterizing effects of sex and age on RSNs are critical first steps in understanding the functional organization of the human brain. © 2014 Wiley Periodicals, Inc.

  8. Olive oil and immune system functions: potential involvement in immunonutrition

    Directory of Open Access Journals (Sweden)

    Álvarez de Cienfuegos, Gerardo

    2004-03-01

    Full Text Available Olive oil plays a crucial role as a main component of the Mediterranean diet, which has shown important benefits for the human health. According to the current knowledge, the administration of diets containing olive oil exerts some beneficial effects on the immune system functions due likely to the action of oleic acid rather than other substances contained in this fat. In the last few years, epidemiological, clinical and experimental studies have evidenced the potential of certain dietary lipids (containing polyunsaturated or monounsaturated fatty acids as modulators of immune system functions due to their ability to suppress several functions of immune system in both humans and animals. As a result, these fats have been applied in the reduction of symptoms from diseases characterized by an overactivation of the immune system (autoimmune diseases or in the reduction of cancer risk. Here, we review several relevant experimental and clinical data associated with the beneficial effects of olive oil upon the health, the mechanisms of action and the immune function susceptible of being be altered by the administration of dietary lipids and particularly of olive oil. In addition, we will also discuss the detrimental effects on the immune system functions caused by the administration of certain dietary lipids attributed mainly to a reduction of host natural resistance against infectious microorganisms as well as the involvement of olive oil diets in the regulation of immune resistance.El aceite de oliva tiene un papel crucial como componente de la dieta Mediterránea, con importantes beneficios sobre la salud humana. Dietas conteniendo aceite de oliva actúan de manera favorable en las funciones del sistema inmune por la acción sobretodo del ácido oleico. Los estudios epidemiológicos, clínicos y experimentales publicados en los últimos años demuestran que ciertos lípidos de la dieta [ácidos grasos monoinsaturados (MUFA y poliinsaturados (PUFA

  9. Interactions between Temperament, Stress, and Immune Function in Cattle

    Directory of Open Access Journals (Sweden)

    N. C. Burdick

    2011-01-01

    Full Text Available The detrimental effects caused by stressors encountered by animals during routine handling can pose economic problems for the livestock industry due to increased costs ultimately borne by the producer and the consumer. Stress adversely affects key physiological processes of the reproductive and immune systems. In recent years stress responsiveness has been associated with cattle behavior, specifically temperament. Cattle with more excitable temperaments, as measured by chute score, pen score, and exit velocity (flight speed, exhibit greater basal concentrations of glucocorticoids and catecholamines. Similar to stressed cattle, more temperamental cattle (i.e., cattle exhibiting greater exit velocity or pen and chute scores have poorer growth performance, carcass characteristics, and immune responses. Thus, understanding the interrelationship of stress and temperament can help in the development of selection and management practices that reduce the negative influence of temperament on growth and productivity of cattle. This paper discusses the relationship between stress and temperament and the developing evidence of an effect of temperament on immune function of cattle that have been handled or restrained. Specifically, the paper discusses different methodologies used to measure temperament, including chute score, pen score, and exit velocity, and discusses the reaction of cattle to different stressors including handling and restraint.

  10. Functional evaluation of transplanted kidneys in normal function and acute rejection using BOLD MR imaging

    International Nuclear Information System (INIS)

    Xiao Wenbo; Xu Jingjing; Wang Qindong; Xu Ying; Zhang Minming

    2012-01-01

    In this study, we evaluated a large number of subjects using BOLD MRI to provide more information about oxygen metabolism in the normal function of transplanted kidneys and to distinguish acute graft rejection from normal function kidneys. This study included 122 subjects (20 volunteers, 72 patients with normal functioning transplants, and 21 patients with acute rejection), and 9 patients had normal function grafts received examination while grafts dysfunction occurred within 6 months during the follow-up. The R2* (1/s) values in the cortex and medulla as well as the R2* ratio of the medulla to cortex (R2* ratio of M/C) were recorded. The R2* values of the medulla were higher than those of the cortex in the normal function group and the volunteers which have a steep R2* ratio of M/C. All the R2* values in the acute rejection group were lower than those in the normal function grafts group (P 1.1) is an important reason for keeping clinical normal function.

  11. Functional relationship between the cerebrum and cerebellum in normal subjects

    International Nuclear Information System (INIS)

    Hanyu, Haruo; Arai, Hisayuki; Hatano, Nobuyoshi; Abe, Shinei; Katsunuma, Hideyo

    1991-01-01

    To determine whether a functional relationship between the cerebrum and cerebellum exists in normal subjects, the correlation between asymmetry in cerebral blood flow and asymmetry in cerebellar blood flow was investigated. Twenty-one healthy right-handed subjects were studied using SPECT with N-isopropyl-p-( 123 I)iodoamphetamine while in a resting state. The asymmetry index (AI) for both the cerebral and cerebellar hemisphere was calculated as follows. AI=right side - left side/right side + left side/200 (%). A negative correlation was found between AI in the cerebellum and AI in the cerebrum. Especially, AI in the cerebellar hemisphere was significantly correlated with AIs in the upper frontal cortex (r=-0.58, p<0.01), middle frontal cortex (r=-0.55, p<0.02), lower frontal cortex (r=-0.49, p<0.05), and mean cerebral hemisphere (r=-0.52, p<0.02). These results suggest the existence of a functional relationship between the cerebral hemisphere and the contralateral cerebellar hemisphere in the resting state of normal subjects. We strongly suspect that the frontal cortex exert an influence on the function in the contralateral cerebellum, probably due to a transneuronal mechanism, mainly through the corticopontocerebellar pathway. (author)

  12. Validation of Procedures for Monitoring Crewmember Immune Function

    Science.gov (United States)

    Crucian, Brian; Stowe, Raymond; Mehta, Satish; Uchakin, Peter; Quiriarte, Heather; Pierson, Duane; Sams, Clarence

    2009-01-01

    There is ample evidence to suggest that space flight leads to immune system dysregulation, however the nature of the phenomenon as it equilibrates over longer flights has not been determined. This dysregulation may be a result of microgravity, confinement, physiological stress, radiation, environment or other mission-associated factors. The clinical risk (if any) for exploration-class space flight is unknown, but may include increased incidence of infection, allergy, hypersensitivity, hematological malignancy or altered wound healing. The objective of this Supplemental Medical Objective (SMO) is to determine the status of the immune system, physiological stress and latent viral reactivation (a clinical outcome that can be measured) during both short and long-duration spaceflight. In addition, this study will develop and validate an immune monitoring strategy consistent with operational flight requirements and constraints. Pre-mission, in-flight and post-flight blood and saliva samples will be obtained from participating crewmembers. Assays included peripheral immunophenotype, T cell function, cytokine profiles (RNA, intracellular, secreted), viral-specific immunity, latent viral reactivation (EBV, CMV, VZV), and stress hormone measurements. This study is currently ongoing. To date, 10 short duration and 5 long-duration crewmembers have completed the study. Technically, the study is progressing well. In-flight blood samples are being collected, and returned for analysis, including functional assays that require live cells. For all in-flight samples to date, sample viability has been acceptable. Preliminary data (n = 4/7; long/short duration, respectively) indicate that distribution of most peripheral leukocyte subsets is largely unaltered during flight. Exceptions include elevated T cells, reduced B/NK cells, increased memory T cells and increased central memory CD8+ T cells. General T cell function, early blastogenesis response to mitogenic stimulation, is markedly

  13. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  14. Differential Gender Effects in the Relationship between Perceived Immune Functioning and Autistic Traits.

    Science.gov (United States)

    Mackus, Marlou; Kruijff, Deborah de; Otten, Leila S; Kraneveld, Aletta D; Garssen, Johan; Verster, Joris C

    2017-04-12

    Altered immune functioning has been demonstrated in individuals with autism spectrum disorder (ASD). The current study explores the relationship between perceived immune functioning and experiencing ASD traits in healthy young adults. N = 410 students from Utrecht University completed a survey on immune functioning and autistic traits. In addition to a 1-item perceived immune functioning rating, the Immune Function Questionnaire (IFQ) was completed to assess perceived immune functioning. The Dutch translation of the Autism-Spectrum Quotient (AQ) was completed to examine variation in autistic traits, including the domains "social insights and behavior", "difficulties with change", "communication", "phantasy and imagination", and "detail orientation". The 1-item perceived immune functioning score did not significantly correlate with the total AQ score. However, a significant negative correlation was found between perceived immune functioning and the AQ subscale "difficulties with change" (r = -0.119, p = 0.019). In women, 1-item perceived immune functioning correlated significantly with the AQ subscales "difficulties with change" (r = -0.149, p = 0.029) and "communication" (r = -0.145, p = 0.032). In men, none of the AQ subscales significantly correlated with 1-item perceived immune functioning. In conclusion, a modest relationship between perceived immune functioning and several autistic traits was found.

  15. Trade-off between growth and immune function : a meta-analysis of selection experiments

    NARCIS (Netherlands)

    van der Most, Peter; de Jong, Berber; Parmentier, Henk K.; Verhulst, Simon

    P>1. Evidence suggests that developing and maintaining an effective immune system may be costly and that an organism has to make a trade-off between immune function and other fitness-enhancing traits. To test for a trade-off between growth and immune function we carried out a meta-analysis of data

  16. Development of immune organs and functioning in humans and test animals: Implications for immune intervention studies.

    Science.gov (United States)

    Kuper, C Frieke; van Bilsen, Jolanda; Cnossen, Hilde; Houben, Geert; Garthoff, Jossie; Wolterbeek, Andre

    2016-09-01

    A healthy immune status is mostly determined during early life stages and many immune-related diseases may find their origin in utero and the first years of life. Therefore, immune health optimization may be most effective during early life. This review is an inventory of immune organ maturation events in relation to developmental timeframes in minipig, rat, mouse and human. It is concluded that time windows of immune organ development in rodents can be translated to human, but minipig reflects the human timeframes better; however the lack of prenatal maternal-fetal immune interaction in minipig may cause less responsiveness to prenatal intervention. It is too early to conclude which immune parameters are most appropriate, because there are not enough comparative immune parameters. Filling these gaps will increase the predictability of results observed in experimental animals, and guide future intervention studies by assessing relevant parameters in the right corresponding developmental time frames. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Effect of radiotherapy on immunity function of cancer patients receiving radiotherapy

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Shentao; Xu Jiuhong

    2003-01-01

    Objective: In order to observe the effect of radiotherapy on immunity function of cancer patients receiving radiotherapy. Methods: Cellular immunity is determined by APAAP; Humoral immunity is determined by transmission method. Results: The items of cellular immunity is lower than the control after radiotherapy. These items decrease continually. The difference between before and after radiotherapy has statistic significance. Of all Humoral immunity items, IgA, IgM decreased after radiotherapy and the difference has statistic significance. Conclusions: Radiotherapy can damage patients' immunity function

  18. Functional neuroimaging of normal aging: Declining brain, adapting brain.

    Science.gov (United States)

    Sugiura, Motoaki

    2016-09-01

    Early functional neuroimaging research on normal aging brain has been dominated by the interest in cognitive decline. In this framework the age-related compensatory recruitment of prefrontal cortex, in terms of executive system or reduced lateralization, has been established. Further details on these compensatory mechanisms and the findings reflecting cognitive decline, however, remain the matter of intensive investigations. Studies in another framework where age-related neural alteration is considered adaptation to the environmental change are recently burgeoning and appear largely categorized into three domains. The age-related increase in activation of the sensorimotor network may reflect the alteration of the peripheral sensorimotor systems. The increased susceptibility of the network for the mental-state inference to the socioemotional significance may be explained by the age-related motivational shift due to the altered social perception. The age-related change in activation of the self-referential network may be relevant to the focused positive self-concept of elderly driven by a similar motivational shift. Across the domains, the concept of the self and internal model may provide the theoretical bases of this adaptation framework. These two frameworks complement each other to provide a comprehensive view of the normal aging brain. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Natural material adsorbed onto a polymer to enhance immune function

    Directory of Open Access Journals (Sweden)

    Reinaque AP

    2012-08-01

    Full Text Available Ana Paula Barcelos Reinaque,1 Eduardo Luzía França,2 Edson Fredulin Scherer,3 Mayra Aparecida Côrtes,1 Francisco José Dutra Souto,4 Adenilda Cristina Honorio-França51Post Graduate Program in Material Science, 2Institute of Biological and Health Science, Federal University of Mato Grosso, Barra do Garças, 3Post Graduate Program in Material Science, Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, 4Faculty of Medical Sciences, Federal University of Mato Grosso, Cuiabá, 5Institute of Biological and Health Science, Federal University of Mato Grosso, Pontal do Araguaia, MT, BrazilBackground: In this study, we produced poly(ethylene glycol (PEG microspheres of different sizes and adsorbing a medicinal plant mixture, and verified their effect in vitro on the viability, superoxide production, and bactericidal activity of phagocytes in the blood.Methods: The medicinal plant mixture was adsorbed onto PEG microspheres and its effects were evaluated by flow cytometry and fluorescence microscopy.Results: Adsorption of the herbal mixture onto the PEG microspheres was achieved and the particles were internalized by phagocytes. PEG microspheres bearing the adsorbed herbal mixture stimulated superoxide release, and activated scavenging and microbicidal activity in phagocytes. No differences in functional activity were observed when the phagocytes were not incubated with PEG microspheres bearing the adsorbed herbal mixture.Conclusion: This system may be useful for the delivery of a variety of medicinal plants and can confer additional protection against infection. The data reported here suggest that a polymer adsorbed with a natural product is a treatment alternative for enhancing immune function.Keywords: natural product, polymer, adsorption, immune function, phagocytes

  20. A non-canonical function of Ezh2 preserves immune homeostasis.

    Science.gov (United States)

    Vasanthakumar, Ajithkumar; Xu, Dakang; Lun, Aaron Tl; Kueh, Andrew J; van Gisbergen, Klaas Pjm; Iannarella, Nadia; Li, Xiaofang; Yu, Liang; Wang, Die; Williams, Bryan Rg; Lee, Stanley Cw; Majewski, Ian J; Godfrey, Dale I; Smyth, Gordon K; Alexander, Warren S; Herold, Marco J; Kallies, Axel; Nutt, Stephen L; Allan, Rhys S

    2017-04-01

    Enhancer of zeste 2 (Ezh2) mainly methylates lysine 27 of histone-H3 (H3K27me3) as part of the polycomb repressive complex 2 (PRC2) together with Suz12 and Eed. However, Ezh2 can also modify non-histone substrates, although it is unclear whether this mechanism has a role during development. Here, we present evidence for a chromatin-independent role of Ezh2 during T-cell development and immune homeostasis. T-cell-specific depletion of Ezh2 induces a pronounced expansion of natural killer T (NKT) cells, although Ezh2-deficient T cells maintain normal levels of H3K27me3. In contrast, removal of Suz12 or Eed destabilizes canonical PRC2 function and ablates NKT cell development completely. We further show that Ezh2 directly methylates the NKT cell lineage defining transcription factor PLZF, leading to its ubiquitination and subsequent degradation. Sustained PLZF expression in Ezh2-deficient mice is associated with the expansion of a subset of NKT cells that cause immune perturbation. Taken together, we have identified a chromatin-independent function of Ezh2 that impacts on the development of the immune system. © 2017 The Authors.

  1. Occupational (? constrictive bronchiolitis with normal physical, functional and image findings

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2009-07-01

    Full Text Available Constrictive bronchiolitis is characterized by alterations in the walls of membranous and respiratory bronchioles. These changes lead to concentric narrowing or complete obliteration of the airway lumen. Suspicion of possible bronchiolar disorders may arise from clinical, funcional, and radiologic findings. However, constrictive bronchiolitis may be present even with normal physical, functional and image findings, which turns the diagnosis difficult. A high index of suspicion is necessary to justify invasive tests that lead to pulmonary biopsy. In this report, we describe a patient with cough and dyspnoea, with normal physical, functional and image findings, whose work-up leaded to the diagnosis of constrictive bronchiolitis. Resumo: A bronquiolite constritiva é caracterizada por alterações das paredes dos bronquíolos membranosos e respiratórios. Estas alterações incluem um espectro de alterações que podem variar, desde a inflamação à fibrose concêntrica progressiva, com obstrução completa do lúmen bronquiolar. O diagnóstico pode ser sugerido pela história clínica e por alterações radiológicas e funcionais. No entanto, o exame físico e os exames complementares de diagnóstico podem ser normais, o que dificulta o diagnóstico, sendo necessário um elevado índice de suspeita para se sujeitar o doente a exames invasivos, tal como a biópsia pulmonar cirúrgica. Os autores apresentam um caso clínico de uma doente com quadro arrastado de tosse e dispneia, com exame físico, funcional e imagiológico normais, cujo estudo exaustivo veio a revelar o diagnóstico de bronquiolite constritiva. Key-words: Constrictive bronchiolitis, iron oxide, Palavras-chave: Bronquiolite constritiva, óxido de ferro

  2. A Protocol for the Comprehensive Flow Cytometric Analysis of Immune Cells in Normal and Inflamed Murine Non-Lymphoid Tissues

    Science.gov (United States)

    Yu, Yen-Rei A.; O’Koren, Emily G.; Hotten, Danielle F.; Kan, Matthew J.; Kopin, David; Nelson, Erik R.; Que, Loretta; Gunn, Michael D.

    2016-01-01

    Flow cytometry is used extensively to examine immune cells in non-lymphoid tissues. However, a method of flow cytometric analysis that is both comprehensive and widely applicable has not been described. We developed a protocol for the flow cytometric analysis of non-lymphoid tissues, including methods of tissue preparation, a 10-fluorochrome panel for cell staining, and a standardized gating strategy, that allows the simultaneous identification and quantification of all major immune cell types in a variety of normal and inflamed non-lymphoid tissues. We demonstrate that our basic protocol minimizes cell loss, reliably distinguishes macrophages from dendritic cells (DC), and identifies all major granulocytic and mononuclear phagocytic cell types. This protocol is able to accurately quantify 11 distinct immune cell types, including T cells, B cells, NK cells, neutrophils, eosinophils, inflammatory monocytes, resident monocytes, alveolar macrophages, resident/interstitial macrophages, CD11b- DC, and CD11b+ DC, in normal lung, heart, liver, kidney, intestine, skin, eyes, and mammary gland. We also characterized the expression patterns of several commonly used myeloid and macrophage markers. This basic protocol can be expanded to identify additional cell types such as mast cells, basophils, and plasmacytoid DC, or perform detailed phenotyping of specific cell types. In examining models of primary and metastatic mammary tumors, this protocol allowed the identification of several distinct tumor associated macrophage phenotypes, the appearance of which was highly specific to individual tumor cell lines. This protocol provides a valuable tool to examine immune cell repertoires and follow immune responses in a wide variety of tissues and experimental conditions. PMID:26938654

  3. Functional aspects of the adaptive immune system in arthritis

    NARCIS (Netherlands)

    Jansen, D.T.S.L.

    2017-01-01

    The adaptive immune system is the part of the immune system that is highly specific and generates memory resulting in a fast and specific immune response upon a second infection with the same pathogen. However, when this response is specific for a part of the body itself instead of a pathogen,

  4. Cesarean section and disease associated with immune function

    DEFF Research Database (Denmark)

    Kristensen, Kim; Henriksen, Lonny

    2016-01-01

    colitis and celiac disease, whereas children delivered by elective CS had an increased risk of lower respiratory tract infection and juvenile idiopathic arthritis. The effect of elective CS was higher than the effect of acute CS on the risk of asthma. CONCLUSION: Children delivered by CS are at increased......BACKGROUND: Earlier studies have shown that delivery by cesarean section (CS) is associated with an increased risk of disease associated with immune function in the offspring, but these studies have generally not discriminated between the effect of acute and elective CS. OBJECTIVE: We sought...... to further explore these associations using discrimination between the effects of acute versus elective CS. METHODS: We performed a population- and national register-based cohort study including all children born in Denmark from January 1997 through December 2012. Hazard ratios for diseases associated...

  5. Effects of intensified training and taper on immune function

    Directory of Open Access Journals (Sweden)

    Elena Papacosta

    2013-03-01

    Full Text Available Although resting immune function is not very different in athletes compared with non-athletes periods of intensified training (overreaching in already well trained athletes can result in a depression of immunity in the resting state. Illness-prone athletes appear to have an altered cytokine response to antigen stimulation and exercise. Having low levels of salivary IgA secretion also makes athletes more susceptible to upper respiratory tract infections. Overtraining is associated with recurrent infections and immunodepression is common, but immune functions do not seem to be reliable markers of impending overtraining. There are several possible causes of the diminution of immune function associated with periods of heavy training. One mechanism may simply be the cumulative effects of repeated bouts of intense exercise (with or without tissue damage with the consequent elevation of stress hormones, particularly glucocorticoids such as cortisol, causing temporary inhibition of TH-1 cytokines with a relative dampening of the cell-mediated response. When exercise is repeated frequently there may not be sufficient time for the immune system to recover fully. Tapering has been described as a gradual reduction in the training load which allows the recovery of physiological capacities that were impaired by previous intensive training and permits further training-induced adaptations to occur accompanied by competition performance enhancements. The majority of the studies that have examined the recovery of immunoendocrine responses during 1-3 week tapers in trained athletes have mainly reported enhanced performance, often accompanied by increased anabolic activity, reduced physiological stress and restoration of mucosal immunity and immune function.Quando se compara a função imune, em repouso, de atletas e não atletas, não se verificam grandes diferenças. Porém, períodos de treinamento intensificado ("overreaching" em atletas bem treinados podem

  6. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging

    OpenAIRE

    Palmer, Clovis S.; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M.

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...

  7. Mitogen-stimulated phospholipid synthesis in normal and immune-deficient human B cells

    International Nuclear Information System (INIS)

    Chien, M.M.; Yokoyama, W.M.; Ashman, R.F.

    1986-01-01

    Eight patients with common variable panhypogammaglobulinemia were shown in the in vitro Ig biosynthesis assay to have defective B cell responses to pokeweed mitogen (PWM). Phospholipid synthesis was assessed in the B cell plus monocyte fraction (MB) and irradiated T cells (T*) of patients and paired normal controls. Cell populations were studied separately and in the four possible combinations (1:1), with and without PWM, to reveal the effect of cell interactions. At 16 to 20 hr the mean stimulation index (SI) +/- standard error for MB cells alone was 1.01 +/- 0.02 for eight patients and 0.99 +/- 0.02 for the paired normals; the T* cell SI was 1.25 +/- 0.04 for patients and 1.28 +/- 0.05 for normals. Combinations of normal MB cells with normal T* cells showed significantly higher SI when compared with the combinations of normal MB cells with patient T* cells (p less than 0.005). However, the combination of patient MB cells with patient T* cells and the combination of patient MB cells with normal T* cells were not significantly different in SI (0.05 less than p less than 0.1). Isolation of patient and normal B cells, T* cells, and monocytes after the choline pulse showed that patient B cells gave a higher SI with normal T* help than with patient T* help. Of greatest interest is the finding that patient B cells that were defective in PWM-stimulated Ig production nevertheless showed a phospholipid synthesis response to PWM in the normal range, suggesting that the maturation defect in these B cells occurs later than the phospholipid synthesis acceleration step, or on a different pathway

  8. Immune Modulation in Normal Human Peripheral Blood Mononuclear Cells (PBMCs) (Lymphocytes) in Response to Benzofuran-2-Carboxylic Acid Derivative KMEG during Spaceflight

    Science.gov (United States)

    Okoro, Elvis; Mann, Vivek; Ellis, Ivory; Mansoor, Elvedina; Olamigoke, Loretta; Marriott, Karla Sue; Denkins, Pamela; Williams, Willie; Sundaresan, Alamelu

    2017-08-01

    Microgravity and radiation exposure during space flight have been widely reported to induce the suppression of normal immune system function, and increase the risk of cancer development in humans. These findings pose a serious risk to manned space missions. Interestingly, recent studies have shown that benzofuran-2-carboxylic acid derivatives can inhibit the progression of some of these devastating effects on earth and in modeled microgravity. However, these studies had not assessed the impacts of benzofuran-2- carboxylic acid and its derivatives on global gene expression under spaceflight conditions. In this study, the ability of a specific benzofuran-2-carboxylic acid derivative (KMEG) to confer protection from radiation and restore normal immune function was investigated following exposure to space flight conditions on the ISS. Normal human peripheral blood mononuclear cells (lymphocytes) treated with 10 µ g/ml of KMEG together with untreated control samples were flown on Nanoracks hardware on Spacex-3 flight. The Samples were returned one month later and gene expression was analyzed. A 1g-ground control experiment was performed in parallel at the Kennedy spaceflight center. The first overall subtractive unrestricted analysis revealed 78 genes, which were differentially expressed in space flight KMEG, untreated lymphocytes as compared to the corresponding ground controls. However, in KMEG-treated space flight lymphocytes, there was an increased expression of a group of genes that mediate increased transcription, translation and innate immune system mediating functions of lymphocytes as compared to KMEG-untreated samples. Analysis of genes related to T cell proliferation in spaceflight KMEG-treated lymphocytes compared to 1g-ground KMEG- treated lymphocytes revealed six T cell proliferation and signaling genes to be significantly upregulated (p trafficking, promote early response, mediating C-myc related proliferation, promote antiapoptotic activity and protects

  9. Subclinical atherosclerosis in obese adolescents with normal left ventricular function.

    Science.gov (United States)

    Abdel-Wahab, Amina M; Atwa, Hoda A; El-Eraky, Azza Z; El-Aziz, Mohamed A

    2011-09-01

    To assess the impact of obesity on carotid intima media thickness and left ventricular (LV) mass in obese adolescents. The study included 52 obese adolescents (mean age 14.16+/-2.64 years) and 52 healthy adolescents who served as a control group (mean age 12+/-2.3 years), who were attended the outpatient clinic at Suez Canal University Hospital, Ismailia, Egypt. The study population was submitted for medical history, clinical examination, laboratory investigations (fasting blood sugar and lipid profile), and echocardiographic examination of LV mass and dimensions. Assessment of carotid intima-media thickness was carried out by using carotid duplex. All children had normal LV function. Obese adolescents had a significant increase in total cholesterol, triglyceride, LDL-C, and low HDL-C compared to the control group. Also, there was a significant increase in blood pressure, carotid intima media thickness, LV mass, and LV mass index. There was a significant correlation between BMI and dyslipidemia, blood pressure, carotid intima/media thickness, LV mass, and posterior wall thickness. Carotid intima-media thickness had a significant correlation with increased LDL-C and low HDL-C, blood pressure, LV mass, and posterior wall thickness. Obesity in childhood and adolescents is associated with subclinical atherosclerosis. Although obese children had no LV dysfunction, yet there are LV structure changes.

  10. Characteristic functions of scale mixtures of multivariate skew-normal distributions

    KAUST Repository

    Kim, Hyoung-Moon

    2011-08-01

    We obtain the characteristic function of scale mixtures of skew-normal distributions both in the univariate and multivariate cases. The derivation uses the simple stochastic relationship between skew-normal distributions and scale mixtures of skew-normal distributions. In particular, we describe the characteristic function of skew-normal, skew-t, and other related distributions. © 2011 Elsevier Inc.

  11. The effects of probiotics, prebiotics and synbiotics on gut flora, immune function and blood characteristics of broilers

    OpenAIRE

    Akoy, Rebin Aswad Mirza

    2015-01-01

    Abstract The microbial populations in the gastrointestinal tracts of poultry play an important role in normal digestive processes and in maintaining animal health. The purpose of this study was to evaluate the effects of probiotics, prebiotics and synbiotics on the growth parameters, gut ecosystem, histology and immune function. In this study, four experiments one in vitro and three in vivo were conducted using specific pathogen free (SPF) and Hubbard broiler chickens. The first exper...

  12. Asymptotic normality of kernel estimator of $\\psi$-regression function for functional ergodic data

    OpenAIRE

    Laksaci ALI; Benziadi Fatima; Gheriballak Abdelkader

    2016-01-01

    In this paper we consider the problem of the estimation of the $\\psi$-regression function when the covariates take values in an infinite dimensional space. Our main aim is to establish, under a stationary ergodic process assumption, the asymptotic normality of this estimate.

  13. Regulatory immune cells and functions in autoimmunity and transplantation immunology.

    Science.gov (United States)

    Papp, Gabor; Boros, Peter; Nakken, Britt; Szodoray, Peter; Zeher, Margit

    2017-05-01

    In physiological circumstances, various tolerogenic mechanisms support the protection of self-structures during immune responses. However, quantitative and/or qualitative changes in regulatory immune cells and mediators can evoke auto-reactive immune responses, and upon susceptible genetic background, along with the presence of other concomitant etiological factors, autoimmune disease may develop. In transplant immunology, tolerogenic mechanisms are also critical, since the balance between of alloantigen-reactive effector cells and the regulatory immune cells will ultimately determine whether a graft is accepted or rejected. Better understanding of the immunological tolerance and the potential modulations of immune regulatory processes are crucial for developing effective therapies in autoimmune diseases as well as in organ transplantation. In this review, we focus on the novel insights regarding the impaired immune regulation and other relevant factors contributing to the development of auto-reactive and graft-reactive immune responses in autoimmune diseases and transplant rejection, respectively. We also address some promising approaches for modification of immune-regulatory processes and tolerogenic mechanisms in autoimmunity and solid organ transplantation, which may be beneficial in future therapeutic strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Trade-offs between sexual advertisement and immune function in the pied flycatcher (Ficedula hypoleuca).

    OpenAIRE

    Kilpimaa, Janne; Alatalo, Rauno V.; Siitari, Heli

    2004-01-01

    Good genes models of sexual selection assume that sexual advertisement is costly and thus the level of advertisement honestly reveals heritable viability. Recently it has been suggested that an important cost of sexual advertisement might be impairment of the functioning of the immune system. In this field experiment we investigated the possible trade-offs between immune function and sexual advertisement by manipulating both mating effort and activity of immune defence in male pied flycatcher...

  15. Lysozyme's lectin-like characteristics facilitates its immune defense function

    KAUST Repository

    Zhang, Ruiyan

    2017-06-06

    Interactions between human lysozyme (HL) and the lipopolysaccharide (LPS) of Klebsiella pneumoniae O1, a causative agent of lung infection, were identified by surface plasmon resonance. To characterize the molecular mechanism of this interaction, HL binding to synthetic disaccharides and tetrasaccharides representing one and two repeating units, respectively, of the O-chain of this LPS were studied. pH-dependent structural rearrangements of HL after interaction with the disaccharide were observed through nuclear magnetic resonance. The crystal structure of the HL-tetrasaccharide complex revealed carbohydrate chain packing into the A, B, C, and D binding sites of HL, which primarily occurred through residue-specific, direct or water-mediated hydrogen bonds and hydrophobic contacts. Overall, these results support a crucial role of the Glu35/Asp53/Trp63/Asp102 residues in HL binding to the tetrasaccharide. These observations suggest an unknown glycan-guided mechanism that underlies recognition of the bacterial cell wall by lysozyme and may complement the HL immune defense function.

  16. Functional Bowel Disorders Are Associated with a Central Immune Activation

    Directory of Open Access Journals (Sweden)

    Per G. Farup

    2017-01-01

    Full Text Available Background. Subjects with depression and unexplained neurological symptoms have a high prevalence of gastrointestinal comorbidity probably related to the brain-gut communication. This study explored associations between functional gastrointestinal disorders (FGID and inflammatory markers in subjects with these disorders. Methods. The FGID, including irritable bowel syndrome (IBS, were classified according to the Rome III criteria, and degree of symptoms was assessed with IBS symptom severity score (IBS-SSS. A range of interleukins (IL, chemokines and growth factors, tryptophan, and kynurenine were analysed in serum and the cerebrospinal fluid (CSF, and short-chain fatty acids (SCFA were analysed in the faeces. The results are reported as partial correlation (pc and p values. Results. Sixty-six subjects were included. IBS was associated with high levels of tryptophan (p=0.048 and kynurenine (p=0.019 and low level of IL-10 (p=0.047 in the CSF. IBS-SSS was associated with high tumor necrosis factor and low IL-10 in the CSF; pc=0.341 and p=0.009 and pc=−0.299 and p=0.023, respectively. Propionic minus butyric acid in faeces was negatively associated with IL-10 in the CSF (pc=−0.416, p=0.005. Conclusions. FGID were associated with a proinflammatory immune activation in the central nervous system and a disturbed tryptophan metabolism that could have been mediated by the faecal microbiota.

  17. Lysozyme's lectin-like characteristics facilitates its immune defense function

    KAUST Repository

    Zhang, Ruiyan; Wu, Lisha; Eckert, Thomas; Burg-Roderfeld, Monika; Rojas-Macias, Miguel A.; Lü tteke, Thomas; Krylov, Vadim B.; Argunov, Dmitry A.; Datta, Aritreyee; Markart, Philipp; Guenther, Andreas; Norden, Bengt; Schauer, Roland; Bhunia, Anirban; Enani, Mushira Abdelaziz; Billeter, Martin; Scheidig, Axel J.; Nifantiev, Nikolay E.; Siebert, Hans-Christian

    2017-01-01

    Interactions between human lysozyme (HL) and the lipopolysaccharide (LPS) of Klebsiella pneumoniae O1, a causative agent of lung infection, were identified by surface plasmon resonance. To characterize the molecular mechanism of this interaction, HL binding to synthetic disaccharides and tetrasaccharides representing one and two repeating units, respectively, of the O-chain of this LPS were studied. pH-dependent structural rearrangements of HL after interaction with the disaccharide were observed through nuclear magnetic resonance. The crystal structure of the HL-tetrasaccharide complex revealed carbohydrate chain packing into the A, B, C, and D binding sites of HL, which primarily occurred through residue-specific, direct or water-mediated hydrogen bonds and hydrophobic contacts. Overall, these results support a crucial role of the Glu35/Asp53/Trp63/Asp102 residues in HL binding to the tetrasaccharide. These observations suggest an unknown glycan-guided mechanism that underlies recognition of the bacterial cell wall by lysozyme and may complement the HL immune defense function.

  18. Adaptive Linear and Normalized Combination of Radial Basis Function Networks for Function Approximation and Regression

    Directory of Open Access Journals (Sweden)

    Yunfeng Wu

    2014-01-01

    Full Text Available This paper presents a novel adaptive linear and normalized combination (ALNC method that can be used to combine the component radial basis function networks (RBFNs to implement better function approximation and regression tasks. The optimization of the fusion weights is obtained by solving a constrained quadratic programming problem. According to the instantaneous errors generated by the component RBFNs, the ALNC is able to perform the selective ensemble of multiple leaners by adaptively adjusting the fusion weights from one instance to another. The results of the experiments on eight synthetic function approximation and six benchmark regression data sets show that the ALNC method can effectively help the ensemble system achieve a higher accuracy (measured in terms of mean-squared error and the better fidelity (characterized by normalized correlation coefficient of approximation, in relation to the popular simple average, weighted average, and the Bagging methods.

  19. Functional analysis of PGRP-LA in Drosophila immunity.

    Directory of Open Access Journals (Sweden)

    Mathilde Gendrin

    Full Text Available PeptidoGlycan Recognition Proteins (PGRPs are key regulators of the insect innate antibacterial response. Even if they have been intensively studied, some of them have yet unknown functions. Here, we present a functional analysis of PGRP-LA, an as yet uncharacterized Drosophila PGRP. The PGRP-LA gene is located in cluster with PGRP-LC and PGRP-LF, which encode a receptor and a negative regulator of the Imd pathway, respectively. Structure predictions indicate that PGRP-LA would not bind to peptidoglycan, pointing to a regulatory role of this PGRP. PGRP-LA expression was enriched in barrier epithelia, but low in the fat body. Use of a newly generated PGRP-LA deficient mutant indicates that PGRP-LA is not required for the production of antimicrobial peptides by the fat body in response to a systemic infection. Focusing on the respiratory tract, where PGRP-LA is strongly expressed, we conducted a genome-wide microarray analysis of the tracheal immune response of wild-type, Relish, and PGRP-LA mutant larvae. Comparing our data to previous microarray studies, we report that a majority of genes regulated in the trachea upon infection differ from those induced in the gut or the fat body. Importantly, antimicrobial peptide gene expression was reduced in the tracheae of larvae and in the adult gut of PGRP-LA-deficient Drosophila upon oral bacterial infection. Together, our results suggest that PGRP-LA positively regulates the Imd pathway in barrier epithelia.

  20. Normal forms for characteristic functions on n-ary relations

    NARCIS (Netherlands)

    D.J.N. van Eijck (Jan)

    2004-01-01

    textabstractFunctions of type (n) are characteristic functions on n-ary relations. Keenan established their importance for natural language semantics, by showing that natural language has many examples of irreducible type (n) functions, i.e., functions of type (n) that cannot be represented as

  1. Effects of methylmercury exposure on the immune function of juvenile common loons (Gavia immer)

    Science.gov (United States)

    Kenow, K.P.; Grasman, K.A.; Hines, R.K.; Meyer, M.W.; Gendron-Fitzpatrick, A.; Spalding, M.G.; Gray, B.R.

    2007-01-01

    We conducted a dose-response laboratory study to quantify the level of exposure to dietary Hg, delivered as methylmercury chloride (CH3HgCl), that is associated with suppressed immune function in captive-reared common loon (Gavia immer) chicks. We used the phytohemagglutinin (PHA) skin test to assess T-lymphocyte function and the sheep red blood cell (SRBC) hemagglutination test to measure antibody-mediated immunity. The PHA stimulation index among chicks receiving dietary Hg treatment did not differ significantly from those of chicks on the control diet (p = 0.15). Total antibody (immunoglobulin [Ig] M [primary antibody] + IgG [secondary response]) production to the SRBC antigen in chicks treated with dietary methylmercury (MeHg), however, was suppressed (p = 0.04) relative to chicks on control diets. Analysis indicated suppression of total Ig production (p = 0.025 with comparisonwise ?? level = 0.017) between control and 0.4 ??g Hg/g wet food intake treatment groups. Furthermore, the control group exhibited a higher degree of variability in antibody response compared to the Hg groups, suggesting that in addition to reducing the mean response, Hg treatment reduced the normal variation attributable to other biological factors. We observed bursal lymphoid depletion in chicks receiving the 1.2 ??g Hg/g treatment (p = 0.017) and a marginally significant effect (p = 0.025) in chicks receiving the 0.4 ??g Hg/g diet. These findings suggest that common loon chick immune systems may be compromised at an ecologically relevant dietary exposure concentration (0.4 ??g Hg/g wet wt food intake). We also found that chicks hatched from eggs collected from low-pH lakes exhibited higher levels of lymphoid depletion in bursa tissue relative to chicks hatched from eggs collected from neutral-pH lakes. ?? 2007 SETAC.

  2. Investigation of Immune Function in Naval Marine Mammals

    National Research Council Canada - National Science Library

    Romano, Tracy

    2000-01-01

    ... (dolphins, whales, and porpoises). This is due in part to obtaining access to animals and tissue samples as well as the lack of cetacean-specific reagents to carry out investigations of the immune system...

  3. Gut microbiome can control antitumor immune function in liver

    Science.gov (United States)

    An NCI study in mice that found a connection between gut bacteria and antitumor immune responses in the liver has implications for understanding mechanisms that lead to liver cancer and for potential treatments. The study was published in Science.

  4. Functional characterization of Foxp3-specific spontaneous immune responses

    DEFF Research Database (Denmark)

    Larsen, Susanne Købke; Munir, S; Andersen, Anders Woetmann

    2013-01-01

    Tumor-infiltrating CD4+CD25+ regulatory T cells (Tregs) are associated with an impaired prognosis in several cancers. The transcription factor forkhead box P3 (Foxp3) is generally expressed in Tregs. Here, we identify and characterize spontaneous cytotoxic immune responses to Foxp3-expressing cel....... Consequently, induction of Foxp3-specific cytotoxic T-cell responses appears as an attractive tool to boost spontaneous or therapeutically provoked immune responses, for example, for the therapy of cancer....

  5. Effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer

    Directory of Open Access Journals (Sweden)

    Hua-Jia Dai

    2016-05-01

    Full Text Available Objective: To investigate the effect of immune nutritional support on immune function and inflammatory factor in postoperative patients with gastric cancer. Methods: A total of 100 patients with gastric cancer were selected and randomly divided into the observation group and the control group with 50 cases in each group. The control group received routine perioperative enteral and parenteral nutrition, on the basis of conventional nutritional support, and the observation group was given enteral nutrition emulsion immune support. Then, the immune function and the inflammatory factor of postoperative day 1 and day 7 were compared between the two groups. Results: (1 With the preoperative data as the basis, the levels of serum IgG, IgA, C3 and C4 decreased at the postoperative day 1 and then increased at the postoperative day 7, while the level of IgM showed an increasing trend and then a decreasing trend in the two groups, and the corresponding figures for the postoperative day 1 and day 7 were statistically different between the two groups. In the observation group, the levels of IgG, IgA, C3 and C4 were higher, while the level of IgM was lower at the postoperative day 1 and day 7 than that in the control group, and the differences were statistically significant; (2 With the preoperative data as the basis, the levels of serum TNF-α, IL-6 and CRP significantly increased at the postoperative day 1 and then decreased at the postoperative day 7 in the two groups, and the corresponding figures for the postoperative day 1 and day 7 in the observation group were lower than those in the control group, and the differences were statistically significant. Conclusion: Immune nutritional support can help to reduce the damage of immune function and the inflammatory response induced by surgery in patients with gastric cancer, which is worthy of clinical application.

  6. Coexistence of Cushing syndrome from functional adrenal adenoma and Addison disease from immune-mediated adrenalitis.

    Science.gov (United States)

    Colucci, Randall; Jimenez, Rafael E; Farrar, William; Malgor, Ramiro; Kohn, Leonard; Schwartz, Frank L

    2012-06-01

    A 56-year-old woman presented with an incidental adrenal adenoma and physical examination findings that included moderate obesity, a slight cervicothoracic fat pad ("buffalo hump"), increased supraclavicular fat pads, and white abdominal striae. Biochemical workup revealed elevated levels of 24-hour urinary free cortisol but normal serum morning cortisol and suppressed levels of corticotropin, suggestive of adrenal-dependent Cushing syndrome. The resected adrenal gland revealed macronodular cortical hyperplasia with a dominant nodule. Other findings included an absent cortisol response to corticotropin stimulation, presence of serum anti-21-hydroxylase antibodies, and mononuclear cell infiltration--consistent with adrenalitis. The findings represent, to the authors' knowledge, the first known case of a patient with coexistent functional cortisol-secreting macronodular adrenal tumor resulting in Cushing syndrome and immune-mediated adrenalitis resulting in Addison disease.

  7. Localized Sympathectomy Reduces Mechanical Hypersensitivity by Restoring Normal Immune Homeostasis in Rat Models of Inflammatory Pain.

    Science.gov (United States)

    Xie, Wenrui; Chen, Sisi; Strong, Judith A; Li, Ai-Ling; Lewkowich, Ian P; Zhang, Jun-Ming

    2016-08-17

    Some forms of chronic pain are maintained or enhanced by activity in the sympathetic nervous system (SNS), but attempts to model this have yielded conflicting findings. The SNS has both pro- and anti-inflammatory effects on immunity, confounding the interpretation of experiments using global sympathectomy methods. We performed a "microsympathectomy" by cutting the ipsilateral gray rami where they entered the spinal nerves near the L4 and L5 DRG. This led to profound sustained reductions in pain behaviors induced by local DRG inflammation (a rat model of low back pain) and by a peripheral paw inflammation model. Effects of microsympathectomy were evident within one day, making it unlikely that blocking sympathetic sprouting in the local DRGs or hindpaw was the sole mechanism. Prior microsympathectomy greatly reduced hyperexcitability of sensory neurons induced by local DRG inflammation observed 4 d later. Microsympathectomy reduced local inflammation and macrophage density in the affected tissues (as indicated by paw swelling and histochemical staining). Cytokine profiling in locally inflamed DRG showed increases in pro-inflammatory Type 1 cytokines and decreases in the Type 2 cytokines present at baseline, changes that were mitigated by microsympathectomy. Microsympathectomy was also effective in reducing established pain behaviors in the local DRG inflammation model. We conclude that the effect of sympathetic fibers in the L4/L5 gray rami in these models is pro-inflammatory. This raises the possibility that therapeutic interventions targeting gray rami might be useful in some chronic inflammatory pain conditions. Sympathetic blockade is used for many pain conditions, but preclinical studies show both pro- and anti-nociceptive effects. The sympathetic nervous system also has both pro- and anti-inflammatory effects on immune tissues and cells. We examined effects of a very localized sympathectomy. By cutting the gray rami to the spinal nerves near the lumbar sensory

  8. The immune cell composition in Barrett's metaplastic tissue resembles that in normal duodenal tissue.

    Directory of Open Access Journals (Sweden)

    Alexandra Lind

    Full Text Available BACKGROUND AND OBJECTIVE: Barrett's esophagus (BE is characterized by the transition of squamous epithelium into columnar epithelium with intestinal metaplasia. The increased number and types of immune cells in BE have been indicated to be due to a Th2-type inflammatory process. We tested the alternative hypothesis that the abundance of T-cells in BE is caused by a homing mechanism that is found in the duodenum. PATIENTS AND METHODS: Biopsies from BE and duodenal tissue from 30 BE patients and duodenal tissue from 18 controls were characterized by immmunohistochemistry for the presence of T-cells and eosinophils(eos. Ex vivo expanded T-cells were further phenotyped by multicolor analysis using flowcytometry. RESULTS: The high percentage of CD4(+-T cells (69±3% (mean±SEM/n = 17, by flowcytometry, measured by flowcytometry and immunohistochemistry, and the presence of non-activated eosinophils found in BE by immunohistochemical staining, were not different from that found in duodenal tissue. Expanded lymphocytes from these tissues had a similar phenotype, characterized by a comparable but low percentage of αE(CD103 positive CD4(+cells (44±5% in BE, 43±4% in duodenum of BE and 34±7% in duodenum of controls and a similar percentage of granzyme-B(+CD8(+ cells(44±5% in BE, 33±6% in duodenum of BE and 36±7% in duodenum of controls. In addition, a similar percentage of α4β7(+ T-lymphocytes (63±5% in BE, 58±5% in duodenum of BE and 62±8% in duodenum of controls was found. Finally, mRNA expression of the ligand for α4β7, MAdCAM-1, was also similar in BE and duodenal tissue. No evidence for a Th2-response was found as almost no IL-4(+-T-cells were seen. CONCLUSION: The immune cell composition (lymphocytes and eosinophils and expression of intestinal adhesion molecule MAdCAM-1 is similar in BE and duodenum. This supports the hypothesis that homing of lymphocytes to BE tissue is mainly caused by intestinal homing signals rather than to an

  9. Vitamin E, immunity, and infection

    Science.gov (United States)

    A normally functioning immune system is critical for the body to fight and eliminate invading pathogens from the environment. On the other hand, the immune system also protects the body from internal risks such as neoplasia growing within and autoimmune responses that attack self. The immune system ...

  10. Studies on the control mechanism and the degenerative immune function of dendritic cells using radiation

    International Nuclear Information System (INIS)

    Yee, Sung Tae; Kim, Jong Jin; Choi, Ji Na; Park, Jung Eun; Jeong, Young Ran

    2010-05-01

    Dendritic cells are actively used as cellular adjuvant in cancer immunotherapy. However, although DC immunotherapies primarily target the elderly population, little is known about the effect of aging on DC functions. Here, we compared the T-cell stimulation, cytokine production, and costimulatory molecule expression of spleen or bone marrow-derived CD11c + DCs of C57BL/6 mice. In the first year, we compared various function of dendritic cells isolated from young and gamma-irradiated 57BL/6 mice(5 weeks after γ-radiation) for the development of aging models using radiation. In the second year, we also compared the function of spleen- and bone marrow-derived dendritic cells of young(2-3 months) and old(23-24 months) 57BL/6 mice. And we studied the differences of spleen- and bone marrow-derived dendritic cells of young and gamma-irradiated 57BL/6 mice(2, 4, 6 months after γ-radiation) for the development of aging models in third year. And we obtained various differences between spleen- and bone marrow-derived dendritic cells of normal and old(23-24 months) or γ-irradiated 57BL/6 mice. It is possible to use our results as age-associated model for modulation of the declined immunity and hematopoiesis for treatment of cancer, adult diseases and stress in aging. Such studies on the mechanism of aging model would further lead to new avenues for the development of functional foods which effect such as pathogenesis, inflammatory and autoimmune disorders. It will contributed to activation of related industry conforming quality and diversity of radiation industry. The techniques developed in our research may provide novel therapeutic modalities for age-associated immune dysfunctions

  11. Studies on the control mechanism and the degenerative immune function of dendritic cells using radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yee, Sung Tae; Kim, Jong Jin; Choi, Ji Na; Park, Jung Eun; Jeong, Young Ran [Sunchon National University, Sunchon (Korea, Republic of)

    2010-05-15

    Dendritic cells are actively used as cellular adjuvant in cancer immunotherapy. However, although DC immunotherapies primarily target the elderly population, little is known about the effect of aging on DC functions. Here, we compared the T-cell stimulation, cytokine production, and costimulatory molecule expression of spleen or bone marrow-derived CD11c{sup +} DCs of C57BL/6 mice. In the first year, we compared various function of dendritic cells isolated from young and gamma-irradiated 57BL/6 mice(5 weeks after {gamma}-radiation) for the development of aging models using radiation. In the second year, we also compared the function of spleen- and bone marrow-derived dendritic cells of young(2-3 months) and old(23-24 months) 57BL/6 mice. And we studied the differences of spleen- and bone marrow-derived dendritic cells of young and gamma-irradiated 57BL/6 mice(2, 4, 6 months after {gamma}-radiation) for the development of aging models in third year. And we obtained various differences between spleen- and bone marrow-derived dendritic cells of normal and old(23-24 months) or {gamma}-irradiated 57BL/6 mice. It is possible to use our results as age-associated model for modulation of the declined immunity and hematopoiesis for treatment of cancer, adult diseases and stress in aging. Such studies on the mechanism of aging model would further lead to new avenues for the development of functional foods which effect such as pathogenesis, inflammatory and autoimmune disorders. It will contributed to activation of related industry conforming quality and diversity of radiation industry. The techniques developed in our research may provide novel therapeutic modalities for age-associated immune dysfunctions

  12. Maintenance of systemic immune functions prevents accelerated presbycusis.

    Science.gov (United States)

    Iwai, Hiroshi; Baba, Susumu; Omae, Mariko; Lee, Shinryu; Yamashita, Toshio; Ikehara, Susumu

    2008-05-07

    There is no effective therapy for progressive hearing loss such as presbycusis, the causes of which remain poorly understood because of the difficulty of separating genetic and environmental contributions. In the present study, we show that the age-related dysfunctions of the systemic immune system in an animal model of accelerated presbycusis (SAMP1, senescence-accelerated mouse P1) can be corrected by allogeneic bone marrow transplantation (BMT). We also demonstrate that this presbycusis can be prevented; BMT protects the recipients from age-related hearing impairment and the degeneration of spiral ganglion cells (SGCs) as well as the dysfunctions of T lymphocytes, which have a close relation to immune senescence. No donor cells are infiltrated to the spiral ganglia, confirming that this experimental system using BMT is connected to the systemic immune system and does not contribute to transdifferentiation or fusion by donor hematopoietic stem cells (HSCs), or to the direct maintenance of ganglion cells by locally infiltrated donor immunocompetent cells. Therefore, another procedure which attempts to prevent the age-related dysfunctions of the recipient immune system is the inoculation of syngeneic splenocytes from young donors. These mice show no development of hearing loss, compared with the recipient mice with inoculation of saline or splenocytes from old donors. Our studies on the relationship between age-related systemic immune dysfunctions and neurodegeneration mechanisms open up new avenues of treatment for presbycusis, for which there is no effective therapy.

  13. Early enteral immune nutrition support after radical operation for gastric cancer on promoting the recovery of gastrointestinal function and immune function

    Directory of Open Access Journals (Sweden)

    Zhi-Gang Li

    2016-05-01

    Full Text Available Objective: To analyze the effect of early enteral immune nutrition support after radical operation for gastric cancer on the recovery of gastrointestinal function and immune function. Methods: A total of 106 cases of patients received radical operation for gastric cancer in our hospital were selected as research subjects, and according to different ways of postoperative nutrition intervention, all patients were divided into observation group (n=50 and control group (n=56. Control group received conventional enteral nutrition intervention, observation group received postoperative early enteral immune nutrition support, and then differences in postoperative intestinal mucosa barrier function, gastrointestinal hormone levels, immune function levels and nutrition-related indicator values were compared between two groups. Results: After observation group received enteral immune nutrition intervention, serum DAO, PS and D-lactate levels as well as urine L/M ratio were lower than those of control group; serum GAS, CCK, MTL and SP values of observation group after intervention were higher than those of control group, and GLU, VIP, GIP and SS values were lower than those of control group; CD4, IgG, NK cell, C3, C4, CH50 and S-IgA levels of observation group after intervention were higher than those of control group; serum ALB, PRE, TRF and RBP levels of observation group after intervention were higher than those of control group. Conclusion: Early enteral immune nutrition support after radical operation for gastric cancer is conducive to the recovery of gastrointestinal function and the promotion of immune state, eventually promotes patients’ postoperative overall recovery and has active clinical significance.

  14. Characteristic functions of scale mixtures of multivariate skew-normal distributions

    KAUST Repository

    Kim, Hyoung-Moon; Genton, Marc G.

    2011-01-01

    We obtain the characteristic function of scale mixtures of skew-normal distributions both in the univariate and multivariate cases. The derivation uses the simple stochastic relationship between skew-normal distributions and scale mixtures of skew

  15. Internodal function in normal and regenerated mammalian axons

    DEFF Research Database (Denmark)

    Moldovan, M; Krarup, C

    2007-01-01

    AIM: Following Wallerian degeneration, peripheral myelinated axons have the ability to regenerate and, given a proper pathway, establish functional connections with targets. In spite of this capacity, the clinical outcome of nerve regeneration remains unsatisfactory. Early studies have found...... that regenerated internodes remain persistently short though this abnormality did not seem to influence recovery in conduction. It remains unclear to which extent abnormalities in axonal function itself may contribute to the poor outcome of nerve regeneration. METHODS: We review experimental evidence indicating...... that internodes play an active role in axonal function. RESULTS: By investigating internodal contribution to axonal excitability we have found evidence that axonal function may be permanently compromised in regenerated nerves. Furthermore, we illustrate that internodal function is also abnormal in regenerated...

  16. Effects of early-life adversity on immune function are mediated by prenatal environment: Role of prenatal alcohol exposure.

    Science.gov (United States)

    Raineki, Charlis; Bodnar, Tamara S; Holman, Parker J; Baglot, Samantha L; Lan, Ni; Weinberg, Joanne

    2017-11-01

    The contribution of the early postnatal environment to the pervasive effects of prenatal alcohol exposure (PAE) is poorly understood. Moreover, PAE often carries increased risk of exposure to adversity/stress during early life. Dysregulation of immune function may play a role in how pre- and/or postnatal adversity/stress alters brain development. Here, we combine two animal models to examine whether PAE differentially increases vulnerability to immune dysregulation in response to early-life adversity. PAE and control litters were exposed to either limited bedding (postnatal day [PN] 8-12) to model early-life adversity or normal bedding, and maternal behavior and pup vocalizations were recorded. Peripheral (serum) and central (amygdala) immune (cytokines and C-reactive protein - CRP) responses of PAE animals to early-life adversity were evaluated at PN12. Insufficient bedding increased negative maternal behavior in both groups. Early-life adversity increased vocalization in all animals; however, PAE pups vocalized less than controls. Early-life adversity reduced serum TNF-α, KC/GRO, and IL-10 levels in control but not PAE animals. PAE increased serum CRP, and levels were even higher in pups exposed to adversity. Finally, PAE reduced KC/GRO and increased IL-10 levels in the amygdala. Our results indicate that PAE alters immune system development and both behavioral and immune responses to early-life adversity, which could have subsequent consequences for brain development and later life health. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Wheat homologs of yeast ATG6 function in autophagy and are implicated in powdery mildew immunity.

    Science.gov (United States)

    Yue, Jieyu; Sun, Hong; Zhang, Wei; Pei, Dan; He, Yang; Wang, Huazhong

    2015-04-01

    Autophagy-related ATG6 proteins are pleiotropic proteins functioning in autophagy and the phosphatidylinositol 3-phosphate-signaling pathways. Arabidopsis ATG6 regulates normal plant growth, pollen development and germination, and plant responses to biotic/abiotic stresses. However, the ATG6 functions in wheat (Triticum aestivum L.), an important food crop, are lacking. We identified three members, TaATG6a-6c, of the ATG6 family from common wheat. TaATG6a, 6b and 6c were localized on homeologous chromosomes 3DL, 3BL and 3AL, respectively, of the allo-hexaploid wheat genome, and evidence was provided for their essential role in autophagy. The TaATG6a-GFP fusion protein was found in punctate pre-autophagosomal structures. The expression of each TaATG6 gene restored the accumulation of autophagic bodies in atg6-mutant yeast. Additionally, TaATG6 knockdown plants showed impaired constitutive and pathogen-induced autophagy and growth abnormalities under normal conditions. We also examined the expression patterns of wheat ATG6s for clues to their physiological roles, and found that their expression was induced by the fungus Blumeria graminis f. sp. tritici (Bgt), the causal agent of powdery mildew, and by abiotic stress factors. A role for TaATG6s in wheat immunity to powdery mildew was further implied when knockdowns of TaATG6s weakly compromised the broad-spectrum powdery mildew resistance gene Pm21-triggered resistance response and, conversely and significantly, enhanced the basal resistance of susceptible plants. In addition, leaf cell death was sometimes induced by growth-retarded small Bgt mycelia on susceptible TaATG6 knockdown plants after a long period of interaction. Thus, we provide an important extension of the previous characterization of plant ATG6 genes in wheat, and observed a role for autophagy genes in wheat immune responses to fungal pathogens. Three wheat ATG6s were identified and shown to be essential for autophagy biogenesis. Wheat ATG6s are

  18. Plasmodium falciparum erythrocyte invasion: combining function with immune evasion.

    Directory of Open Access Journals (Sweden)

    Gavin J Wright

    2014-03-01

    Full Text Available All the symptoms and pathology of malaria are caused by the intraerythrocytic stages of the Plasmodium parasite life cycle. Because Plasmodium parasites cannot replicate outside a host cell, their ability to recognize and invade erythrocytes is an essential step for both parasite survival and malaria pathogenesis. This makes invasion a conceptually attractive vaccine target, especially because it is one of the few stages when the parasite is directly exposed to the host humoral immune system. This apparent vulnerability, however, has been countered by the parasite, which has evolved sophisticated molecular mechanisms to evade the host immune response so that parasites asymptomatically replicate within immune individuals. These mechanisms include the expansion of parasite invasion ligands, resulting in multiple and apparently redundant invasion "pathways", highly polymorphic parasite surface proteins that are immunologically distinct, and parasite proteins which are poorly immunogenic. These formidable defences have so far thwarted attempts to develop an effective blood-stage vaccine, leading many to question whether there really is an exploitable chink in the parasite's immune evasion defences. Here, we review recent advances in the molecular understanding of the P. falciparum erythrocyte invasion field, discuss some of the challenges that have so far prevented the development of blood-stage vaccines, and conclude that the parasite invasion ligand RH5 represents an essential pinch point that might be vulnerable to vaccination.

  19. Nonischemic changes in right ventricular function on exercise. Do normal volunteers differ from patients with normal coronary arteries

    International Nuclear Information System (INIS)

    Caplin, J.L.; Maltz, M.B.; Flatman, W.D.; Dymond, D.S.

    1988-01-01

    Factors other than ischemia may alter right ventricular function both at rest and on exercise. Normal volunteers differ from cardiac patients with normal coronary arteries with regard to their left ventricular response to exercise. This study examined changes in right ventricular function on exercise in 21 normal volunteers and 13 patients with normal coronary arteries, using first-pass radionuclide angiography. There were large ranges of right ventricular ejection fraction in the two groups, both at rest and on exercise. Resting right ventricular ejection fraction was 40.2 +/- 10.6% (mean +/- SD) in the volunteers and 38.6 +/- 9.7% in the patients, p = not significant, and on exercise rose significantly in both groups to 46.1 +/- 9.9% and 45.8 +/- 9.7%, respectively. The difference between the groups was not significant. In both groups some subjects with high resting values showed large decreases in ejection fraction on exercise, and there were significant negative correlations between resting ejection fraction and the change on exercise, r = -0.59 (p less than 0.01) in volunteers, and r = -0.66 (p less than 0.05) in patients. Older volunteers tended to have lower rest and exercise ejection fractions, but there was no difference between normotensive and hypertensive patients in their rest or exercise values. In conclusion, changes in right ventricular function on exercise are similar in normal volunteers and in patients with normal coronary arteries. Some subjects show decreases in right ventricular ejection fraction on exercise which do not appear to be related to ischemia

  20. [Effects of Early Enteral Immunonutrition on Postoperative Immune Function and Rehabilitation of Patients with Gastric Cancer and Nutritional Risk].

    Science.gov (United States)

    Peng, Chang-Bing; Li, Wen-Zhong; Xu, Rui; Zhuang, Wen

    2017-05-01

    To investigate the effects of early enteral immunonutrition on postoperative immune function and rehabilitation of gastric cancer patients with nutritional risk. New hospitalized patients with gastric cancer were evaluated the nutrient status based on NRS 2002. The patients who scored between 3 to 5 points were randomized into two groups(30 cases for each group), and those in experimental group were given 7-d early postoperative enteral immune nutrition, those in control group were given normal nutrition. The immune indexes (CD3 + , CD4 + , CD8 + and CD4 + /CD8 + ) and nutritional indexes(transferrin, pre-albumin, albumin) were measured before operation and at the 3 rd and 7 th day postoperatively. In addition, the first flatus time, gastrointestinal adverse reactions and complications, length of hospital stays were compared between the two groups. The level of CD4 + /CD8 + and transferrin, pre-albumin, albumin in experimental group were significantly higher than those in control group at the third and seventh day postoperatively ( P 0.05). Early enteral immunonutrition can effectively promote the recovery of nutritional status and immune function in gastric cancer patients with nutrition risk.

  1. An Introduction to Normalization and Calibration Methods in Functional MRI

    Science.gov (United States)

    Liu, Thomas T.; Glover, Gary H.; Mueller, Bryon A.; Greve, Douglas N.; Brown, Gregory G.

    2013-01-01

    In functional magnetic resonance imaging (fMRI), the blood oxygenation level dependent (BOLD) signal is often interpreted as a measure of neural activity. However, because the BOLD signal reflects the complex interplay of neural, vascular, and metabolic processes, such an interpretation is not always valid. There is growing evidence that changes…

  2. Control of Immune Cell Homeostasis and Function by lncRNAs.

    Science.gov (United States)

    Mowel, Walter K; Kotzin, Jonathan J; McCright, Sam J; Neal, Vanessa D; Henao-Mejia, Jorge

    2018-01-01

    The immune system is composed of diverse cell types that coordinate responses to infection and maintain tissue homeostasis. In each of these cells, extracellular cues determine highly specific epigenetic landscapes and transcriptional profiles to promote immunity while maintaining homeostasis. New evidence indicates that long non-coding RNAs (lncRNAs) play crucial roles in epigenetic and transcriptional regulation in mammals. Thus, lncRNAs have emerged as key regulatory molecules of immune cell gene expression programs in response to microbial and tissue-derived cues. We review here how lncRNAs control the function and homeostasis of cell populations during immune responses, emphasizing the diverse molecular mechanisms by which lncRNAs tune highly contextualized transcriptional programs. In addition, we discuss the new challenges faced in interrogating lncRNA mechanisms and function in the immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. TNF signaling inhibition in the CNS: implications for normal brain function and neurodegenerative disease

    Directory of Open Access Journals (Sweden)

    Tansey Malú G

    2008-10-01

    Full Text Available Abstract The role of tumor necrosis factor (TNF as an immune mediator has long been appreciated but its function in the brain is still unclear. TNF receptor 1 (TNFR1 is expressed in most cell types, and can be activated by binding of either soluble TNF (solTNF or transmembrane TNF (tmTNF, with a preference for solTNF; whereas TNFR2 is expressed primarily by microglia and endothelial cells and is preferentially activated by tmTNF. Elevation of solTNF is a hallmark of acute and chronic neuroinflammation as well as a number of neurodegenerative conditions including ischemic stroke, Alzheimer's (AD, Parkinson's (PD, amyotrophic lateral sclerosis (ALS, and multiple sclerosis (MS. The presence of this potent inflammatory factor at sites of injury implicates it as a mediator of neuronal damage and disease pathogenesis, making TNF an attractive target for therapeutic development to treat acute and chronic neurodegenerative conditions. However, new and old observations from animal models and clinical trials reviewed here suggest solTNF and tmTNF exert different functions under normal and pathological conditions in the CNS. A potential role for TNF in synaptic scaling and hippocampal neurogenesis demonstrated by recent studies suggest additional in-depth mechanistic studies are warranted to delineate the distinct functions of the two TNF ligands in different parts of the brain prior to large-scale development of anti-TNF therapies in the CNS. If inactivation of TNF-dependent inflammation in the brain is warranted by additional pre-clinical studies, selective targeting of TNFR1-mediated signaling while sparing TNFR2 activation may lessen adverse effects of anti-TNF therapies in the CNS.

  4. Age-dependent changes in innate immune phenotype and function in rhesus macaques (Macaca mulatta

    Directory of Open Access Journals (Sweden)

    Mark Asquith

    2012-06-01

    Full Text Available Aged individuals are more susceptible to infections due to a general decline in immune function broadly referred to as immune senescence. While age-related changes in the adaptive immune system are well documented, aging of the innate immune system remains less well understood, particularly in nonhuman primates. A more robust understanding of age-related changes in innate immune function would provide mechanistic insight into the increased susceptibility of the elderly to infection. Rhesus macaques have proved a critical translational model for aging research, and present a unique opportunity to dissect age-dependent modulation of the innate immune system. We examined age-related changes in: (i innate immune cell frequencies; (ii expression of pattern recognition receptors (PRRs and innate signaling molecules; (iii cytokine responses of monocytes and dendritic cells (DC following stimulation with PRR agonists; and (iv plasma cytokine levels in this model. We found marked changes in both the phenotype and function of innate immune cells. This included an age-associated increased frequency of myeloid DC (mDC. Moreover, we found toll-like receptor (TLR agonists lipopolysaccharide (TLR4, fibroblast stimulating ligand-1 (TLR2/6, and ODN2006 (TLR7/9 induced reduced cytokine responses in aged mDC. Interestingly, with the exception of the monocyte-derived TNFα response to LPS, which increased with age, TNFα, IL-6, and IFNα responses declined with age. We also found that TLR4, TLR5, and innate negative regulator, sterile alpha and TIR motif containing protein (SARM, were all expressed at lower levels in young animals. By contrast, absent in melanoma 2 and retinoic acid-inducible gene I expression was lowest in aged animals. Together, these observations indicate that several parameters of innate immunity are significantly modulated by age and contribute to differential immune function in aged macaques.

  5. Overexpression of neurofilament H disrupts normal cell structure and function

    Science.gov (United States)

    Szebenyi, Gyorgyi; Smith, George M.; Li, Ping; Brady, Scott T.

    2002-01-01

    Studying exogenously expressed tagged proteins in live cells has become a standard technique for evaluating protein distribution and function. Typically, expression levels of experimentally introduced proteins are not regulated, and high levels are often preferred to facilitate detection. However, overexpression of many proteins leads to mislocalization and pathologies. Therefore, for normative studies, moderate levels of expression may be more suitable. To understand better the dynamics of intermediate filament formation, transport, and stability in a healthy, living cell, we inserted neurofilament heavy chain (NFH)-green fluorescent protein (GFP) fusion constructs in adenoviral vectors with tetracycline (tet)-regulated promoters. This system allows for turning on or off the synthesis of NFH-GFP at a selected time, for a defined period, in a dose-dependent manner. We used this inducible system for live cell imaging of changes in filament structure and cell shape, motility, and transport associated with increasing NFH-GFP expression. Cells with low to intermediate levels of NFH-GFP were structurally and functionally similar to neighboring, nonexpressing cells. In contrast, overexpression led to pathological alterations in both filament organization and cell function. Copyright 2002 Wiley-Liss, Inc.

  6. Immune cells in the normal ovary and spontaneous ovarian tumors in the laying hen (Gallus domesticus) model of human ovarian cancer.

    Science.gov (United States)

    Bradaric, Michael J; Penumatsa, Krishna; Barua, Animesh; Edassery, Seby L; Yu, Yi; Abramowicz, Jacques S; Bahr, Janice M; Luborsky, Judith L

    2013-01-01

    Spontaneous ovarian cancer in chickens resembles human tumors both histologically and biochemically. The goal was to determine if there are differences in lymphocyte content between normal ovaries and ovarian tumors in chickens as a basis for further studies to understand the role of immunity in human ovarian cancer progression. Hens were selected using grey scale and color Doppler ultrasound to determine if they had normal or tumor morphology. Cells were isolated from ovaries (n = 6 hens) and lymphocyte numbers were determined by flow cytometry using antibodies to avian CD4 and CD8 T and B (Bu1a) cells. Ovarian sections from another set of hens (n = 26) were assessed to verify tumor type and stage and to count CD4, CD8 and Bu1a immunostained cells by morphometric analysis. T and B cells were more numerous in ovarian tumors than in normal ovaries by flow cytometry and immunohistochemistry. There were less CD4+ cells than CD8+ and Bu1a+ cells in normal ovaries or ovarian tumors. CD8+ cells were the dominant T cell sub-type in both ovarian stroma and in ovarian follicles compared to CD4+ cells. Bu1a+ cells were consistently found in the stroma of normal ovaries and ovarian tumors but were not associated with follicles. The number of immune cells was highest in late stage serous tumors compared to endometrioid and mucinous tumors. The results suggest that similar to human ovarian cancer there are comparatively more immune cells in chicken ovarian tumors than in normal ovaries, and the highest immune cell content occurs in serous tumors. Thus, this study establishes a foundation for further study of tumor immune responses in a spontaneous model of ovarian cancer which will facilitate studies of the role of immunity in early ovarian cancer progression and use of the hen in pre-clinical vaccine trials.

  7. [Changes and the impact on immune function of opioid-dependent subjects by Jitai tabelets during the withdrawal stage].

    Science.gov (United States)

    Li, X X; Fan, H Y; Sun, L; Liang, J C; Deng, Y P

    2017-04-10

    Objective: To detect the changes in the immune function of opioid-dependent subjects during the withdrawal stage through the administration of Jitai tablet. Methods: Subjects were treated as Jitai tablet alone, Jitai tablet plus buprenorphine and placebo, in a randomized,double-blind, placebo-controlled trial. Before and after the 14(th) day of withdrawal, levels of immunoglobulin (IgM, IgA, IgG), T cell subsets (CD(3)(+), CD(4)(+), CD(8)(+), CD(4)(+)/CD(8)(+)) and cytokines (IL-2, IFN-γ, IL-4, IFN-γ/IL-4) were detected. Results: Compared with healthy people, immunity function before withdrawal among the opioid abusers showed higher levels of IgM, IL-2, IFN-γ, IL-4 and lower level of CD(3)(+)T, as (1.67±0.87) g/L, (14.44±13.50) % , (20.23±15.10) % , (1.97±1.59) % , (47.01±13.62) % , respectively, with difference statistically significant ( P 0.05). At the 14(th) day of withdrawal in placebo group, levels of IL-4 returned to normal while IFN-γ/IL-4 ratio increased by 3.43 times ( P 0.05). Compared with placebo group, fluctuation of IgG and IgM decreased in Jitai group during withdrawal period, together with a normal level of IgM at the 14(th) day. Level of IL-4 abnormally rose up by 0.54 times in Jitai tablet plus buprenorphine group, while IFN-γ/IL-4 ratio been switched back at the 14(th) day of withdrawal. Other immune indicators were not affected by medical interventions. Conclusion: We noticed that certain impairment of the immune function might be restored by Jitai tablet during the withdrawal period.

  8. Effects of Ligustilide on Tumor Growth and Immune Function in ...

    African Journals Online (AJOL)

    hemolysin concentration, spleen lymphocyte proliferation and CTL and NK cell activities in normal ICR mice, but ... dysmenorrhoea [14] and Alzheimer's disease. [15]. However, the ..... because phagocytes act as regulator and effector cells in ...

  9. Prenatal cadmium exposure alters postnatal immune cell development and function

    Energy Technology Data Exchange (ETDEWEB)

    Hanson, Miranda L.; Holásková, Ida; Elliott, Meenal; Brundage, Kathleen M.; Schafer, Rosana; Barnett, John B., E-mail: jbarnett@hsc.wvu.edu

    2012-06-01

    Cadmium (Cd) is generally found in low concentrations in the environment due to its widespread and continual use, however, its concentration in some foods and cigarette smoke is high. Although evidence demonstrates that adult exposure to Cd causes changes in the immune system, there are limited reports of immunomodulatory effects of prenatal exposure to Cd. This study was designed to investigate the effects of prenatal exposure to Cd on the immune system of the offspring. Pregnant C57Bl/6 mice were exposed to an environmentally relevant dose of CdCl{sub 2} (10 ppm) and the effects on the immune system of the offspring were assessed at two time points following birth (2 and 7 weeks of age). Thymocyte and splenocyte phenotypes were analyzed by flow cytometry. Prenatal Cd exposure did not affect thymocyte populations at 2 and 7 weeks of age. In the spleen, the only significant effect on phenotype was a decrease in the number of macrophages in male offspring at both time points. Analysis of cytokine production by stimulated splenocytes demonstrated that prenatal Cd exposure decreased IL-2 and IL-4 production by cells from female offspring at 2 weeks of age. At 7 weeks of age, splenocyte IL-2 production was decreased in Cd-exposed males while IFN-γ production was decreased from both male and female Cd-exposed offspring. The ability of the Cd-exposed offspring to respond to immunization with a S. pneumoniae vaccine expressing T-dependent and T-independent streptococcal antigens showed marked increases in the levels of both T-dependent and T-independent serum antibody levels compared to control animals. CD4{sup +}FoxP3{sup +}CD25{sup +} (nTreg) cell percentages were increased in the spleen and thymus in all Cd-exposed offspring except in the female spleen where a decrease was seen. CD8{sup +}CD223{sup +} T cells were markedly decreased in the spleens in all offspring at 7 weeks of age. These findings suggest that even very low levels of Cd exposure during gestation can

  10. Effect of long-term fluticasone treatment on immune function in horses with heaves.

    Science.gov (United States)

    Dauvillier, J; Felippe, M J B; Lunn, D P; Lavoie-Lamoureux, A; Leclère, M; Beauchamp, G; Lavoie, J-P

    2011-01-01

    Corticosteroids currently are the most effective pharmacological treatment available to control heaves in horses. Systemically administered corticosteroids have been shown to alter immune response in horses, humans, and other species. Aerosolized administration theoretically minimizes systemic adverse effects, but the effect of inhaled corticosteroids on immune function has not been evaluated in horses. To evaluate the effects of prolonged administration of inhaled fluticasone on the immune system of heaves-affected horses. Heaves-affected horses were treated with inhaled fluticasone (n = 5) for 11 months or received environmental modifications only (n = 5). Prospective analysis. Clinical parameters and CBC, lymphocyte subpopulations and function, and circulating neutrophil gene expression were sequentially measured. Primary and anamnestic immune responses also were evaluated by measuring antigen-specific antibodies in response to vaccination with bovine viral antigen and tetanus toxoid, respectively. No clinical adverse effects were observed and no differences in immune function were detected between treated and untreated horses. The treatment of heaves-affected horses with inhaled fluticasone at therapeutic dosages for 11 months has no significant detectable effect on innate and adaptive (both humoral and cell-mediated) immune parameters studied. These results suggest that prolonged administration of fluticasone would not compromise the systemic immune response to pathogens nor vaccination in adult horses. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  11. Studying the Impact of Spaceflight Environment on Immune Functions Using New Molecular Diagnostics System

    Science.gov (United States)

    Cohen, Luchino

    Immune functions are altered during space flights. Latent virus reactivation, reduction in the number of immune cells, decreased cell activation and increased sensitivity of astronauts to infections following their return on Earth demonstrate that the immune system is less efficient during space flight. The causes of this immune deficiency are not fully understood and this dysfunction during long-term missions could result in the appearance of opportunistic infections or a decrease in the immuno-surveillance mechanisms that eradicate cancer cells. Therefore, the immune functions of astronauts will have to be monitored continuously during long-term missions in space, using miniature and semi-automated diagnostic systems. The objectives of this project are to study the causes of space-related immunodeficiency, to develop countermeasures to maintain an optimal immune function and to improve our capacity to detect infectious diseases during space missions through the monitoring of astronauts' immune system. In order to achieve these objectives, an Immune Function Diagnostic System (IFDS) will be designed to perform a set of immunological assays on board spacecrafts or on planet-bound bases. Through flow cytometric assays and molecular biology analyses, this diagnostic system could improve medical surveillance of astronauts and could be used to test countermeasures aimed at preventing immune deficiency during space missions. The capacity of the instrument to assess cellular fluorescence and to quantify the presence of soluble molecules in biological samples would support advanced molecular studies in space life sciences. Finally, such diagnostic system could also be used on Earth in remote areas or in mobile hospitals following natural disasters to fight against infectious diseases and other pathologies.

  12. Tumor-altered dendritic cell function: implications for anti-tumor immunity

    Directory of Open Access Journals (Sweden)

    Kristian Michael Hargadon

    2013-07-01

    Full Text Available Dendritic cells are key regulators of both innate and adaptive immunity, and the array of immunoregulatory functions exhibited by these cells is dictated by their differentiation, maturation, and activation status. Although a major role for these cells in the induction of immunity to pathogens has long been appreciated, data accumulated over the last several years has demonstrated that DC are also critical regulators of anti-tumor immune responses. However, despite the potential for stimulation of robust anti-tumor immunity by DC, tumor-altered DC function has been observed in many cancer patients and tumor-bearing animals and is often associated with tumor immune escape. Such dysfunction has significant implications for both the induction of natural anti-tumor immune responses as well as the efficacy of immunotherapeutic strategies that target endogenous DC in situ or that employ exogenous DC as part of anti-cancer immunization maneuvers. In this review, the major types of tumor-altered DC function will be described, with emphasis on recent insights into the mechanistic bases for the inhibition of DC differentiation from hematopoietic precursors, the altered programming of DC precursors to differentiate into myeloid-derived suppressor cells or tumor-associated macrophages, the suppression of DC maturation and activation, and the induction of immunoregulatory DC by tumors, tumor-derived factors, and tumor-associated cells within the milieu of the tumor microenvironment. The impact of these tumor-altered cells on the quality of the overall anti-tumor immune response will also be discussed. Finally, this review will also highlight questions concerning tumor-altered DC function that remain unanswered, and it will address factors that have limited advances in the study of this phenomenon in order to focus future research efforts in the field on identifying strategies for interfering with tumor-associated DC dysfunction and improving DC-mediated anti

  13. Tradeoffs between immune function and childhood growth among Amazonian forager-horticulturalists.

    Science.gov (United States)

    Urlacher, Samuel S; Ellison, Peter T; Sugiyama, Lawrence S; Pontzer, Herman; Eick, Geeta; Liebert, Melissa A; Cepon-Robins, Tara J; Gildner, Theresa E; Snodgrass, J Josh

    2018-04-24

    Immune function is an energetically costly physiological activity that potentially diverts calories away from less immediately essential life tasks. Among developing organisms, the allocation of energy toward immune function may lead to tradeoffs with physical growth, particularly in high-pathogen, low-resource environments. The present study tests this hypothesis across diverse timeframes, branches of immunity, and conditions of energy availability among humans. Using a prospective mixed-longitudinal design, we collected anthropometric and blood immune biomarker data from 261 Amazonian forager-horticulturalist Shuar children (age 4-11 y old). This strategy provided baseline measures of participant stature, s.c. body fat, and humoral and cell-mediated immune activity as well as subsample longitudinal measures of linear growth (1 wk, 3 mo, 20 mo) and acute inflammation. Multilevel analyses demonstrate consistent negative effects of immune function on growth, with children experiencing up to 49% growth reduction during periods of mildly elevated immune activity. The direct energetic nature of these relationships is indicated by ( i ) the manifestation of biomarker-specific negative immune effects only when examining growth over timeframes capturing active competition for energetic resources, ( ii ) the exaggerated impact of particularly costly inflammation on growth, and ( iii ) the ability of children with greater levels of body fat (i.e., energy reserves) to completely avoid the growth-inhibiting effects of acute inflammation. These findings provide evidence for immunologically and temporally diverse body fat-dependent tradeoffs between immune function and growth during childhood. We discuss the implications of this work for understanding human developmental energetics and the biological mechanisms regulating variation in human ontogeny, life history, and health.

  14. Intranasal Oxytocin Normalizes Amygdala Functional Connectivity in Posttraumatic Stress Disorder.

    Science.gov (United States)

    Koch, Saskia B J; van Zuiden, Mirjam; Nawijn, Laura; Frijling, Jessie L; Veltman, Dick J; Olff, Miranda

    2016-07-01

    The neuropeptide oxytocin (OT) has been suggested as a promising pharmacological agent for medication-enhanced psychotherapy in posttraumatic stress disorder (PTSD) because of its anxiolytic and prosocial properties. We therefore investigated the behavioral and neurobiological effects of a single intranasal OT administration (40 IU) in PTSD patients. We conducted a randomized, placebo-controlled, cross-over resting-state fMRI study in male and female police officers with (n=37, 21 males) and without PTSD (n=40, 20 males). We investigated OT administration effects on subjective anxiety and functional connectivity of basolateral (BLA) and centromedial (CeM) amygdala subregions with prefrontal and salience processing areas. In PTSD patients, OT administration resulted in decreased subjective anxiety and nervousness. Under placebo, male PTSD patients showed diminished right CeM to left ventromedial prefrontal cortex (vmPFC) connectivity compared with male trauma-exposed controls, which was reinstated after OT administration. Additionally, female PTSD patients showed enhanced right BLA to bilateral dorsal anterior cingulate cortex (dACC) connectivity compared with female trauma-exposed controls, which was dampened after OT administration. Although caution is warranted, our findings tentatively suggest that OT has the potential to diminish anxiety and fear expression of the amygdala in PTSD, either via increased control of the vmPFC over the CeM (males) or via decreased salience processing of the dACC and BLA (females). Our findings add to accumulating evidence that OT administration could potentially enhance treatment response in PTSD.

  15. Stress, Immune Function and Collegiate Holiday Drinking: A Pilot Study.

    Science.gov (United States)

    Ceballos, Natalie A; Sharma, Shobhit; Patterson, Thomas L; Graham, Reiko; Howard, Krista

    2015-01-01

    Social aspects of collegiate holiday drinking have been studied frequently, but physiological consequences are often overlooked. This study examined self-reported stress, endocrine and immune indicators in students at an American university before and after their week-long spring break (SB) holiday. Participants (n = 27; 9 males) provided saliva samples and completed surveys pre- and post-SB. Based on their cortisol reaction to SB, participants were grouped as cortisol nonresponders (CNR; n = 14) or increasers (CI; n = 13). Groups were matched on demographics, baseline alcohol use, family history of alcoholism, and SB plans. Differences over time and between groups were examined for α-amylase, quantity/frequency of alcohol use (quantity/frequency index, QFI) and the immunoglobulin A (IgA) to albumin ratio (IgA:albumin). α-Amylase decreased over time. A time × group interaction was noted for QFI, in which CNRs increased drinking over SB, but CIs did not. Time and time × group effects occurred for IgA:albumin. CIs decreased IgA:albumin over SB, whereas CNRs did not. Pre-SB QFI and pre-/post-SB QFI changes were correlated with changes in IgA:albumin. These findings support previously published relationships between blunted cortisol responses and risk for problem drinking, as well as elevated cortisol and decreased immune response. These data also highlight the importance of physiological measures in the study of collegiate holiday drinking. © 2015 S. Karger AG, Basel.

  16. Natural functional SNPs in miR-155 alter its expression level, blood cell counts and immune responses

    Directory of Open Access Journals (Sweden)

    Congcong Li

    2016-08-01

    Full Text Available miR-155 has been confirmed to be a key factor in immune responses in humans and other mammals. Therefore, investigation of variations in miR-155 could be useful for understanding the differences in immunity between individuals. In this study, four SNPs in miR-155 were identified in mice (Mus musculus and humans (Homo sapiens. In mice, the four SNPs were closely linked and formed two miR-155 haplotypes (A and B. Ten distinct types of blood parameters were associated with miR-155 expression under normal conditions. Additionally, 4 and 14 blood parameters were significantly different between these two genotypes under normal and lipopolysaccharide (LPS stimulation conditions, respectively. Moreover, the expression levels of miR-155, the inflammatory response to LPS stimulation and the lethal ratio following Salmonella typhimurium infection were significantly increased in mice harboring the AA genotype. Further, two SNPs, one in the loop region and the other near the 3' terminal of pre-miR-155, were confirmed to be responsible for the differential expression of miR-155 in mice. Interestingly, two additional SNPs, one in the loop region and the other in the middle of miR-155*, modulated the function of miR-155 in humans. Predictions of secondary RNA structure using RNAfold showed that these SNPs affected the structure of miR-155 in both mice and humans. Our results provide novel evidence of the natural functional SNPs of miR-155 in both mice and humans, which may affect the expression levels of mature miR-155 by modulating its secondary structure. The SNPs of human miR-155 may be considered as causal mutations for some immune-related diseases in the clinic. The two genotypes of mice could be used as natural models for studying the mechanisms of immune diseases caused by abnormal expression of miR-155 in humans.

  17. Normal values for inspiratory muscle function in children

    International Nuclear Information System (INIS)

    Mellies, Uwe; Stehling, Florian; Dohna-Schwake, Christian

    2014-01-01

    Assessment of inspiratory muscle function (IMF) is limited in children with neuromuscular disorders, because respiratory muscle tests are poorly standardized and valid normative data are unavailable. We investigated maximum inspiratory pressure after exhalation to residual volume (MIP), mouth occlusion pressure (P0.1) and time of inspiration during quiet breathing and derived inspiratory muscle load (P0.1/MIP), and tension time index (TTI) in 301 healthy schoolchildren 6–16 years old. Gender-specific and age-dependent percentile curves for MIP were drawn with the median, 5%, 10%, 25%, 75% and 95% percentile. P0.1 was equal in boys and girls (0.23  ±  0.11 kPa), while MIP was significantly higher in boys (6.8  ±  2.2 versus 5.8  ±  2.4 kPa). Consequently, P0.1/MIP (4.8% ± 3.2% versus 4.0% ± 3.1%) and TTI (0.2  ±  0.14 versus 0.16  ±  0.14) were significantly higher in girls. MIP was 2.90 + 0.36 × age (kPa) and 3.19 + 0.24 × age (kPa) in boys and girls, respectively. The 95% confidence intervals for boys and girls, respectively, were MIP, 6.3–7.3 kPA and 5.4–6.2 kPa; P0.1/MIP, 3.5%–4.5% and 4.3%–5.3%; TTI, 0.14–0.18 and 0.18–0.22; and P0.1, 0.20–0.24 kPa for both. IMF in children has a wide interindividual variability; however percentile curves facilitate a longitudinal assessment of individual patients. Furthermore, narrow confidence intervals allow for comparisons of study populations, making IMF an appropriate endpoint for clinical trials. (paper)

  18. Effects of Ligustilide on Tumor Growth and Immune Function in ...

    African Journals Online (AJOL)

    Results: LIG significantly increased thymus and spleen index, macrophage phagocytosis, serum hemolysin concentration, spleen lymphocyte proliferation and CTL and NK cell activities in normal ICR mice, but inhibited the growth of transplantable H22 hepatoma. The effect was dose-related but not in a linear fashion.

  19. Toxic effects of dietary methylmercury on immune function and hematology in American kestrels (Falco sparverius)

    Science.gov (United States)

    Fallacara, Dawn M.; Halbrook, Richard S.; French, John B.

    2011-01-01

    Fifty-nine adult male American kestrels (Falco sparverius) were assigned to one of three diet formulations including 0 (control), 0.6, and 3.9 μg/g (dry wt) methylmercury (MeHg). Kestrels received their diets daily for 13 weeks to assess the effects of dietary MeHg on immunocompetence. Immunotoxic endpoints included assessment of cell-mediated immunity (CMI) using the phytohemagglutinin (PHA) skin-swelling assay and primary and secondary antibody-mediated immune responses (IR) via the sheep red blood cell (SRBC) hemagglutination assay. Select hematology and histology parameters were evaluated to corroborate the results of functional assays and to assess immunosuppression of T and B cell-dependent components in spleen tissue. Kestrels in the 0.6 and 3.9 μg/g MeHg groups exhibited suppression of CMI, including lower PHA stimulation indexes (p = 0.019) and a 42 to 45% depletion of T cell-dependent splenic lymphoid tissue (p = 0.006). Kestrels in the 0.6 μg/g group exhibited suppression of the primary IR to SRBCs (p = 0.014). MeHg did not have a noticeable effect on the secondary IR (p = 0.166). Elevation of absolute heterophil counts (p p p = 0.003) was apparent in the 3.9 μg/g group at week 12. Heterophilia, or the excess of heterophils in peripheral blood above normal ranges, was apparent in seven of 17 (41%) kestrels in the 3.9 μg/g group and was indicative of an acute inflammatory response or physiological stress. This study revealed that adult kestrels were more sensitive to immunotoxic effects of MeHg at environmentally relevant dietary concentrations than they were to reproductive effects as previously reported.

  20. Incubation period and immune function: A comparative field study among coexisting birds

    Science.gov (United States)

    Palacios, M.G.; Martin, T.E.

    2006-01-01

    Developmental periods are integral components of life history strategies that can have important fitness consequences and vary enormously among organisms. However, the selection pressures and mechanisms causing variation in length of developmental periods are poorly understood. Particularly puzzling are prolonged developmental periods, because their selective advantage is unclear. Here we tested the hypotheses that immune function is stronger in species that are attacked at a higher rate by parasites and that prolonged embryonic development allows the development of this stronger immune system. Through a comparative field study among 12 coexisting passerine bird species, we show that species with higher blood parasite prevalence mounted stronger cellular immune responses than species with lower prevalence. These results provide support for the hypothesis that species facing greater selection pressure from parasites invest more in immune function. However, species with longer incubation periods mounted weaker cellular immune responses than species with shorter periods. Therefore, cellular immune responses do not support the hypothesis that longer development time enhances immunocompentence. Future studies should assess other components of the immune system and test alternative causes of variation in incubation periods among bird species. ?? Springer-Verlag 2005.

  1. Development and function of human innate immune cells in a humanized mouse model.

    Science.gov (United States)

    Rongvaux, Anthony; Willinger, Tim; Martinek, Jan; Strowig, Till; Gearty, Sofia V; Teichmann, Lino L; Saito, Yasuyuki; Marches, Florentina; Halene, Stephanie; Palucka, A Karolina; Manz, Markus G; Flavell, Richard A

    2014-04-01

    Mice repopulated with human hematopoietic cells are a powerful tool for the study of human hematopoiesis and immune function in vivo. However, existing humanized mouse models cannot support development of human innate immune cells, including myeloid cells and natural killer (NK) cells. Here we describe two mouse strains called MITRG and MISTRG, in which human versions of four genes encoding cytokines important for innate immune cell development are knocked into their respective mouse loci. The human cytokines support the development and function of monocytes, macrophages and NK cells derived from human fetal liver or adult CD34(+) progenitor cells injected into the mice. Human macrophages infiltrated a human tumor xenograft in MITRG and MISTRG mice in a manner resembling that observed in tumors obtained from human patients. This humanized mouse model may be used to model the human immune system in scenarios of health and pathology, and may enable evaluation of therapeutic candidates in an in vivo setting relevant to human physiology.

  2. A novel algorithm of artificial immune system for high-dimensional function numerical optimization

    Institute of Scientific and Technical Information of China (English)

    DU Haifeng; GONG Maoguo; JIAO Licheng; LIU Ruochen

    2005-01-01

    Based on the clonal selection theory and immune memory theory, a novel artificial immune system algorithm, immune memory clonal programming algorithm (IMCPA), is put forward. Using the theorem of Markov chain, it is proved that IMCPA is convergent. Compared with some other evolutionary programming algorithms (like Breeder genetic algorithm), IMCPA is shown to be an evolutionary strategy capable of solving complex machine learning tasks, like high-dimensional function optimization, which maintains the diversity of the population and avoids prematurity to some extent, and has a higher convergence speed.

  3. ACL-RSI and KOOS Measures Predict Normal Knee Function after ACL-SPORTS Training

    OpenAIRE

    White, Kathleen; Zeni, Joseph; Snyder-Mackler, Lynn

    2014-01-01

    Objectives: After anterior cruciate ligament reconstruction (ACLR) athletes commonly report increased fear of re-injury and below normal knee function. Implementing a post-operative training protocol (ACL-SPORTS Training) to improve patient perceived knee function, may improve short term outcomes after surgery. Identifying pre-training measures that predict normal knee function after training may allow us to determine who may respond to the treatment intervention. The purpose of this study wa...

  4. CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV

    Directory of Open Access Journals (Sweden)

    Martinez Maria L

    2007-01-01

    Full Text Available Abstract Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0. We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1 had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively. Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a

  5. CD8 apoptosis may be a predictor of T cell number normalization after immune reconstitution in HIV

    Science.gov (United States)

    Lewis, Dorothy E; Gross, Kimber L; Diez, Martine M; Martinez, Maria L; Lukefahr, Helen N; Kozinetz, Claudia A; Arduino, Roberto C

    2007-01-01

    Background As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART) and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy. Methods Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death) were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses. Results Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR) and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% ± 6.0). We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% ± 2.1) had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis (mean CD4 cell counts 1,209 ± 164 vs 754 ± 320 cells/mm3; CD4:CD8 ratios 1.55 vs. 0.70, respectively). Conclusion We postulate that CD8+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a prospective study. PMID:17263884

  6. Maternal stress, nutrition and physical activity: Impact on immune function, CNS development and psychopathology.

    Science.gov (United States)

    Marques, Andrea Horvath; Bjørke-Monsen, Anne-Lise; Teixeira, Antônio L; Silverman, Marni N

    2015-08-18

    Evidence suggests that maternal and fetal immune dysfunction may impact fetal brain development and could play a role in neurodevelopmental disorders, although the definitive pathophysiological mechanisms are still not completely understood. Stress, malnutrition and physical inactivity are three maternal behavioral lifestyle factors that can influence immune and central nervous system (CNS) functions in both the mother and fetus, and may therefore, increase risk for neurodevelopmental/psychiatric disorders. First, we will briefly review some aspects of maternal-fetal immune system interactions and development of immune tolerance. Second, we will discuss the bidirectional communication between the immune system and CNS and the pathways by which immune dysfunction could contribute to neurodevelopmental disorders. Third, we will discuss the effects of prenatal stress and malnutrition (over and undernutrition) on perinatal programming of the CNS and immune system, and how this might influence neurodevelopment. Finally, we will discuss the beneficial impact of physical fitness during pregnancy on the maternal-fetal unit and infant and how regular physical activity and exercise can be an effective buffer against stress- and inflammatory-related disorders. Although regular physical activity has been shown to promote neuroplasticity and an anti-inflammatory state in the adult, there is a paucity of studies evaluating its impact on CNS and immune function during pregnancy. Implementing stress reduction, proper nutrition and ample physical activity during pregnancy and the childbearing period may be an efficient strategy to counteract the impact of maternal stress and malnutrition/obesity on the developing fetus. Such behavioral interventions could have an impact on early development of the CNS and immune system and contribute to the prevention of neurodevelopmental and psychiatric disorders. Further research is needed to elucidate this relationship and the underlying

  7. Obligate brood parasites show more functionally effective innate immune responses: an eco-immunological hypothesis

    Science.gov (United States)

    Hahn, D. Caldwell; Summers, Scott G.; Genovese, Kenneth J.; He, Haiqi; Kogut, Michael H.

    2013-01-01

    Immune adaptations of obligate brood parasites attracted interest when three New World cowbird species (Passeriformes, Icteridae, genus Molothrus) proved unusually resistant to West Nile virus. We have used cowbirds as models to investigate the eco-immunological hypothesis that species in parasite-rich environments characteristically have enhanced immunity as a life history adaptation. As part of an ongoing program to understand the cowbird immune system, in this study we measured degranulation and oxidative burst, two fundamental responses of the innate immune system. Innate immunity provides non-specific, fast-acting defenses against a variety of invading pathogens, and we hypothesized that innate immunity experiences particularly strong selection in cowbirds, because their life history strategy exposes them to diverse novel and unpredictable parasites. We compared the relative effectiveness of degranulation and oxidative burst responses in two cowbird species and one related, non-parasitic species. Both innate immune defenses were significantly more functionally efficient in the two parasitic cowbird species than in the non-parasitic red-winged blackbird (Icteridae, Agelaius phoeniceus). Additionally, both immune defenses were more functionally efficient in the brown-headed cowbird (M. ater), an extreme host-generalist brood parasite, than in the bronzed cowbird (M. aeneus), a moderate host-specialist with lower exposure to other species and their parasites. Thus the relative effectiveness of these two innate immune responses corresponds to the diversity of parasites in the niche of each species and to their relative resistance to WNV. This study is the first use of these two specialized assays in a comparative immunology study of wild avian species.

  8. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging.

    Science.gov (United States)

    Palmer, Clovis S; Palchaudhuri, Riya; Albargy, Hassan; Abdel-Mohsen, Mohamed; Crowe, Suzanne M

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of "inflammaging", a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV + individuals.

  9. Age-related normal structural and functional ventricular values in cardiac function assessed by magnetic resonance

    International Nuclear Information System (INIS)

    Fiechter, Michael; Gaemperli, Oliver; Kaufmann, Philipp A; Fuchs, Tobias A; Gebhard, Catherine; Stehli, Julia; Klaeser, Bernd; Stähli, Barbara E; Manka, Robert; Manes, Costantina; Tanner, Felix C

    2013-01-01

    The heart is subject to structural and functional changes with advancing age. However, the magnitude of cardiac age-dependent transformation has not been conclusively elucidated. This retrospective cardiac magnetic resonance (CMR) study included 183 subjects with normal structural and functional ventricular values. End systolic volume (ESV), end diastolic volume (EDV), and ejection fraction (EF) were obtained from the left and the right ventricle in breath-hold cine CMR. Patients were classified into four age groups (20–29, 30–49, 50–69, and ≥70 years) and cardiac measurements were compared using Pearson’s rank correlation over the four different groups. With advanced age a slight but significant decrease in ESV (r=−0.41 for both ventricles, P<0.001) and EDV (r=−0.39 for left ventricle, r=−0.35 for right ventricle, P<0.001) were observed associated with a significant increase in left (r=0.28, P<0.001) and right (r=0.27, P<0.01) ventricular EF reaching a maximal increase in EF of +8.4% (P<0.001) for the left and +6.1% (P<0.01) for the right ventricle in the oldest compared to the youngest patient group. Left ventricular myocardial mass significantly decreased over the four different age groups (P<0.05). The aging process is associated with significant changes in left and right ventricular EF, ESV and EDV in subjects with no cardiac functional and structural abnormalities. These findings underline the importance of using age adapted values as standard of reference when evaluating CMR studies

  10. Podoplanin: emerging functions in development, the immune system, and cancer

    Directory of Open Access Journals (Sweden)

    Jillian Leigh Astarita

    2012-09-01

    Full Text Available Podoplanin (PDPN is a well-conserved, mucin-type transmembrane protein expressed in multiple tissues during ontogeny and in adult animals, including the brain, heart, kidney, lungs, osteoblasts, and lymphoid organs. Studies of PDPN-deficient mice have demonstrated that this molecule plays a critical role in development of the heart, lungs, and lymphatic system. PDPN is widely used as a marker for lymphatic endothelial cells and fibroblastic reticular cells of lymphoid organs and for lymphatics in the skin and tumor microenvironment. Much of the mechanistic insight into PDPN biology has been gleaned from studies of tumor cells; tumor cells often upregulate PDPN as they undergo epithelial-mesenchymal transition and this upregulation is correlated with increased motility and metastasis. The physiological role of PDPN that has been most studied is its ability to aggregate and activate CLEC-2-expressing platelets, as PDPN is the only known endogenous ligand for CLEC-2. However, more recent studies have revealed that PDPN also plays crucial roles in the biology of immune cells, including T cells and dendritic cells. This review will provide a comprehensive overview of the diverse roles of PDPN in development, immunology, and cancer.

  11. Fish oil supplementation modulates immune function in healthy infants

    DEFF Research Database (Denmark)

    Damsgaard, C.T.; Lauritzen, L.; Kjaer, T.M.R.

    2007-01-01

    Danish infants, who received cow's milk or infant formula alone or with fish oil (FO) (3.4 +/- 1.1 mL/d) from 9 to 12 mo of age. Before and after the intervention, fatty acid composition of erythrocyte membranes, plasma IgE, C-reactive protein, and soluble IL-2 receptor concentrations were measured. TNF......-alpha, INF-gamma, and IL-10 concentrations in whole-blood cultures, stimulated for 22 h with LPS+phytohema-glutinin (PHA) or Lactobacillus paracasei, were also determined. IgA was measured in feces when infants were 10 mo of age. FO supplementation effectively raised erythrocyte (n-3) PUFA (P ....02). Feeding milk rather than formula did not affect cytokine production, but plasma soluble IL-2 receptor concentration was greater in the formula group than in the cow's milk group (P = 0.03). Since the capacity to produce INF-gamma has been proposed as a maturation marker for the immune system in early life...

  12. Neutron importance and the generalized Green function for the conventionally critical reactor with normalized neutron distribution

    International Nuclear Information System (INIS)

    Khromov, V.V.

    1978-01-01

    The notion of neutron importance when applied to nuclear reactor statics problems described by time-independent homogeneous equations of neutron transport with provision for normalization of neutron distribution is considered. An equation has been obtained for the function of neutron importance in a conditionally critical reactor with respect to an arbitrary nons linear functional determined for the normalized neutron distribution. Relation between this function and the generalized Green function of the selfconjugated operator of the reactor equation is determined and the formula of small perturbations for the functionals of a conditionally critical reactor is deduced

  13. Bifidobacterium breve alters immune function and ameliorates DSS-induced inflammation in weanling rats.

    Science.gov (United States)

    Izumi, Hirohisa; Minegishi, Mario; Sato, Yohei; Shimizu, Takashi; Sekine, Kazunori; Takase, Mitsunori

    2015-10-01

    Bifidobacterium breve M-16V (M16V) is a probiotic bacterial strain with a long tradition of use in neonatal intensive care units in some countries. Previous study showed that the effects of M16V administration on gene expression were greater during the weaning period than in the neonatal period and were greater in the colon than in the small intestine and spleen, suggesting that M16V has anti-inflammatory effects. In this study, we evaluated the effects of inflammation during the weaning period and the effects of M16V on normal and inflammatory conditions. From postnatal day (PD) 21 to 34, weanling rats were administered of 2.5 × 10(9) of M16V daily, and colitis was induced by administration of 2% dextran sulfate sodium from PD28 to 35. Colitis severity, immune function, and microbiota were investigated. Colitis caused a reduction in body weight gain, colon shortening, poor nutritional status, anemia, changes in blood and spleen lymphocyte populations, spleen T-cell malfunctions, and alterations in colon microbiota. M16V administration improved some but not all of the changes induced by colitis. M16V could suppress inflammation and, therefore, can be considered a safe strain to use not only during the neonatal period but also the weaning period.

  14. Role of endothelial function in coronary slow-flow phenomenon with angiographically normal coronaries

    Directory of Open Access Journals (Sweden)

    Srikanth Nathani

    2016-01-01

    Conclusion: Coronary slow flow phenomenon is a marker of atherosclerosis (as documented by carotid intima media thickness and our study has also shown that endothelial function is significantly impaired in patients with coronary slow flow (as documented by impaired endothelial dependent vasodilatation than that of patients with normal epicardial coronaries with normal flow.

  15. Constant illumination reduces circulating melatonin and impairs immune function in the cricket Teleogryllus commodus

    Directory of Open Access Journals (Sweden)

    Joanna Durrant

    2015-07-01

    Full Text Available Exposure to constant light has a range of negative effects on behaviour and physiology, including reduced immune function in both vertebrates and invertebrates. It is proposed that the associated suppression of melatonin (a ubiquitous hormone and powerful antioxidant in response to the presence of light at night could be an underlying mechanistic link driving the changes to immune function. Here, we investigated the relationship between constant illumination, melatonin and immune function, using a model invertebrate species, the Australian black field cricket, Teleogryllus commodus. Crickets were reared under either a 12 h light: 12 h dark regimen or a constant 24 h light regimen. Circulating melatonin concentration and immune function (haemocyte concentration, lytic activity and phenoloxidase (PO activity were assessed in individual adult crickets through the analysis of haemolymph. Constant illumination reduced melatonin and had a negative impact on haemocyte concentrations and lytic activity, but its effect on PO activity was less apparent. Our data provide the first evidence, to our knowledge, of a link between exposure to constant illumination and variation in haemocyte concentration in an invertebrate model, while also highlighting the potential complexity of the immune response following exposure to constant illumination. This study provides insight into the possible negative effect of artificial night-time lighting on the physiology of invertebrates, but whether lower and potentially more ecologically relevant levels of light at night produce comparable results, as has been reported in several vertebrate taxa, remains to be tested.

  16. Immune Monitoring in Cancer Vaccine Clinical Trials: Critical Issues of Functional Flow Cytometry-Based Assays

    Directory of Open Access Journals (Sweden)

    Iole Macchia

    2013-01-01

    Full Text Available The development of immune monitoring assays is essential to determine the immune responses against tumor-specific antigens (TSAs and tumor-associated antigens (TAAs and their possible correlation with clinical outcome in cancer patients receiving immunotherapies. Despite the wide range of techniques used, to date these assays have not shown consistent results among clinical trials and failed to define surrogate markers of clinical efficacy to antitumor vaccines. Multiparameter flow cytometry- (FCM- based assays combining different phenotypic and functional markers have been developed in the past decade for informative and longitudinal analysis of polyfunctional T-cells. These technologies were designed to address the complexity and functional heterogeneity of cancer biology and cellular immunity and to define biomarkers predicting clinical response to anticancer treatment. So far, there is still a lack of standardization of some of these immunological tests. The aim of this review is to overview the latest technologies for immune monitoring and to highlight critical steps involved in some of the FCM-based cellular immune assays. In particular, our laboratory is focused on melanoma vaccine research and thus our main goal was the validation of a functional multiparameter test (FMT combining different functional and lineage markers to be applied in clinical trials involving patients with melanoma.

  17. Reversibility of alcohol-induced immune depression

    DEFF Research Database (Denmark)

    Tønnesen, H; Kaiser, A H; Nielsen, B B

    1992-01-01

    Alcohol abusers have suppressed cellular immune function. The aim of the study was to investigate the time of sobriety required to normalize immune function. Delayed hypersensitivity was investigated during disulfiram controlled abstinence in ten heavy alcoholics and in seven moderate drinkers...... months of abstinence. The results suggest that while 2 weeks of abstinence from alcohol will improve the depressed cellular immunity, 2 months of sobriety is necessary to normalize it....

  18. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Joanna Bandoła

    2017-08-01

    Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  19. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

    Science.gov (United States)

    Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

    2017-01-01

    Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  20. Prostaglandin synthesis and catabolism in the gastric mucosa: studies in normal rabbits and rabbits immunized with prostaglandin E2

    International Nuclear Information System (INIS)

    Redfern, J.S.

    1988-01-01

    Antral and fundic mucosal homogenates obtained from prostaglandin E2-immunized rabbits converted 14C-arachidonic acid to prostaglandin E2, 6-keto prostaglandin F1 alpha, prostaglandin F2 alpha, and prostaglandin D2. Percentage conversion of 14C-arachidonic acid to these prostaglandin products was not significantly different in prostaglandin E2-immunized rabbits compared with control rabbits (thyroglobulin-immunized and unimmunized rabbits combined). Synthesis of 6-keto prostaglandin F1 alpha, prostaglandin E2 and 13,14-dihydro 15-keto prostaglandin E2 from endogenous arachidonic acid after vortex mixing fundic mucosal homogenates was similar in prostaglandin E2 immunized rabbits and control rabbits. Both in prostaglandin E2-immunized rabbits and controls, 3H-prostaglandin E2 was catabolized extensively by the fundic mucosa, whereas 3H-6-keto prostaglandin F1 alpha, 3H-prostaglandin F2 alpha, and 3H-prostaglandin D2 were not catabolized to any appreciable extent. The rate of catabolism of PGs was not significantly different in prostaglandin E2-immunized rabbits and control rabbits, with the exception of prostaglandin F2 alpha which was catabolized slightly more rapidly in prostaglandin E2-immunized rabbits. These results indicate that development of gastric ulcers in prostaglandin E2-immunized rabbits is not associated with an alteration in the capacity of the gastric mucosa to synthesize or catabolize prostaglandins

  1. Food supplementation and testosterone interact to influence reproductive behavior and immune function in Sceloporus graciosus.

    Science.gov (United States)

    Ruiz, Mayté; French, Susannah S; Demas, Gregory E; Martins, Emília P

    2010-02-01

    The energetic resources in an organism's environment are essential for executing a wide range of life-history functions, including immunity and reproduction. Most energetic budgets, however, are limited, which can lead to trade-offs among competing functions. Increasing reproductive effort tends to decrease immunity in many cases, and increasing total energy via supplemental feedings can eliminate this effect. Testosterone (T), an important regulator of reproduction, and food availability are thus both potential factors regulating life-history processes, yet they are often tested in isolation of each other. In this study, we considered the effect of both food availability and elevated T on immune function and reproductive behavior in sagebrush lizards, Sceloporus graciosus, to assess how T and energy availability affect these trade-offs. We experimentally manipulated diet (via supplemental feedings) and T (via dermal patches) in males from a natural population. We determined innate immune response by calculating the bacterial killing capability of collected plasma exposed to Escherichia coli ex vivo. We measured reproductive behavior by counting the number of courtship displays produced in a 20-min sampling period. We observed an interactive effect of food availability and T-patch on immune function, with food supplementation increasing immunity in T-patch lizards. Additionally, T increased courtship displays in control food lizards. Lizards with supplemental food had higher circulating T than controls. Collectively, this study shows that the energetic state of the animal plays a critical role in modulating the interactions among T, behavior and immunity in sagebrush lizards and likely other species. Copyright 2009 Elsevier Inc. All rights reserved.

  2. SYNTHESIS METHODS OF ALGEBRAIC NORMAL FORM OF MANY-VALUED LOGIC FUNCTIONS

    Directory of Open Access Journals (Sweden)

    A. V. Sokolov

    2016-01-01

    Full Text Available The rapid development of methods of error-correcting coding, cryptography, and signal synthesis theory based on the principles of many-valued logic determines the need for a more detailed study of the forms of representation of functions of many-valued logic. In particular the algebraic normal form of Boolean functions, also known as Zhegalkin polynomial, that well describe many of the cryptographic properties of Boolean functions is widely used. In this article, we formalized the notion of algebraic normal form for many-valued logic functions. We developed a fast method of synthesis of algebraic normal form of 3-functions and 5-functions that work similarly to the Reed-Muller transform for Boolean functions: on the basis of recurrently synthesized transform matrices. We propose the hypothesis, which determines the rules of the synthesis of these matrices for the transformation from the truth table to the coefficients of the algebraic normal form and the inverse transform for any given number of variables of 3-functions or 5-functions. The article also introduces the definition of algebraic degree of nonlinearity of the functions of many-valued logic and the S-box, based on the principles of many-valued logic. Thus, the methods of synthesis of algebraic normal form of 3-functions applied to the known construction of recurrent synthesis of S-boxes of length N = 3k, whereby their algebraic degrees of nonlinearity are computed. The results could be the basis for further theoretical research and practical applications such as: the development of new cryptographic primitives, error-correcting codes, algorithms of data compression, signal structures, and algorithms of block and stream encryption, all based on the perspective principles of many-valued logic. In addition, the fast method of synthesis of algebraic normal form of many-valued logic functions is the basis for their software and hardware implementation.

  3. Impact of age and sex on normal left heart structure and function.

    Science.gov (United States)

    Hagström, Linn; Henein, Michael Y; Karp, Kjell; Waldenström, Anders; Lindqvist, Per

    2017-11-01

    Accurate age- and sex-related normal reference values of ventricular structure and function are important to determine the level of dysfunction in patients. The aim of this study therefore was to document normal age range sex-related measurements of LV structural and functional measurements to serve such purpose. We evaluated left ventricular structure and function in 293 healthy subjects between 20 and 90 years with equally distributed gender. Doppler echocardiography was used including measure of both systolic and diastolic functions. Due to systolic LV function, only long axis function correlated with age (r = 0·55, P<0·01) and the correlation was stronger in females. Concerning diastolic function, there was a strong age correlation in all parameters used (r = 0·40-0·74, P<0·001). Due to LV structural changes over age, females showed a larger reduction in end-diastolic volumes, but no or trivial difference in wall thickness after the age of 60 years. Age is associated with significant normal changes in left ventricular structure and function, which should be considered when deciding on normality. These changes are related to systemic arterial changes as well as body stature, thus reflecting overall body ageing process. Furthermore, normal cardiac ageing in females might partly explain the higher prevalence of heart failure with preserved ejection in females. © 2016 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.

  4. Effect of spirulina food supplement on blood morphological parameters, biochemical composition and on the immune function of sportsmen

    Directory of Open Access Journals (Sweden)

    K Milasius

    2009-07-01

    Full Text Available Of highest biological value are natural concentrates of optimally combined substances produced by nature. One of food supplements of this kind is dietary Spirulina produced by the Tianshi firm (China. It is a most rationally balanced food supplement of a high biological value; it satisfies the needs of the whole body, including its immune system. The aim of the current work was to assess the effect of the multicomponent natural food supplement Spirulina on the physical development, blood morphological, biochemical picture and immune function of sportsmen. Materials and Methods: The study cohort comprised 12 high performance sportsmen (age 20-22 years. They were using tablets of Spirulina, a dietary product for 14 days. Physical development was determined with the aid of standard methods. The general blood picture was analyzed with the aid of a Micros-60 hematological analyzer (company ABX DIAGNOSTICS, France. Lymphocytes and their subsets were analysed by flow cytometery (FACSCalibur, Becton Dickinson Immunocytometry Systems (BDIS, USA and the absolute and percentage values were calculated. To evaluate immune function lymphocyte blasttransformation response to mitogens was studied. Results: Investigations carried out on endurance-training sportsmen showed that a 14-d administration of Spirulina exerted a positive effect on blood morphological composition indices and its biochemical changes. The results of our study confirm the positive effect of Spirulina food supplement on the quantitative parameters of immune system. Part of the study cohort after weeks showed a tendency of normalizing CD3 , CD3 CD4 lympocite count: positive changes were still present two weeks following the interruption of Spirulina intake

  5. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

    OpenAIRE

    Clovis S. Palmer; Riya Palchaudhuri; Hassan Albargy; Mohamed Abdel-Mohsen; Suzanne M. Crowe

    2018-01-01

    An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impa...

  6. The importance of vitamins D and K for the bone health and immune function in inflammatory bowel disease.

    Science.gov (United States)

    Iijima, Hideki; Shinzaki, Shinichiro; Takehara, Tetsuo

    2012-11-01

    This review summarizes the recent literature about the roles of vitamins D and K in bone metabolism and immunity-mediated inflammatory processes in inflammatory bowel diseases (IBDs). The levels of vitamins D and K are lower than normal in patients with IBD, especially in Crohn's disease. Although vitamins D and K are important for the maintenance of bone mineral density in non-IBD patients, an association between vitamins D or K and bone metabolism is not apparent in IBD patients. Recent studies showed that vitamins D and K are suggested to have immune-suppressive effects, both in animal models of colitis and human trials. In particular, vitamin D suppresses dendritic and T-cell functions by inhibiting the production of proinflammatory cytokines. Insufficiency of vitamin D is associated with the activated phenotype of IBD. Vitamins D and K potentially contribute to the maintenance of bone health in IBD, but this effect may be diminished by other factors such as steroid use, reduced exposure to sunlight, and inflammatory cytokines. Vitamin D and possibly vitamin K are suggested to be involved in the suppression of immune-mediated inflammation and modulation of disease activity.

  7. Advances in the quantification of mitochondrial function in primary human immune cells through extracellular flux analysis.

    Directory of Open Access Journals (Sweden)

    Dequina Nicholas

    Full Text Available Numerous studies show that mitochondrial energy generation determines the effectiveness of immune responses. Furthermore, changes in mitochondrial function may regulate lymphocyte function in inflammatory diseases like type 2 diabetes. Analysis of lymphocyte mitochondrial function has been facilitated by introduction of 96-well format extracellular flux (XF96 analyzers, but the technology remains imperfect for analysis of human lymphocytes. Limitations in XF technology include the lack of practical protocols for analysis of archived human cells, and inadequate data analysis tools that require manual quality checks. Current analysis tools for XF outcomes are also unable to automatically assess data quality and delete untenable data from the relatively high number of biological replicates needed to power complex human cell studies. The objectives of work presented herein are to test the impact of common cellular manipulations on XF outcomes, and to develop and validate a new automated tool that objectively analyzes a virtually unlimited number of samples to quantitate mitochondrial function in immune cells. We present significant improvements on previous XF analyses of primary human cells that will be absolutely essential to test the prediction that changes in immune cell mitochondrial function and fuel sources support immune dysfunction in chronic inflammatory diseases like type 2 diabetes.

  8. Effects of water extract of Curcuma longa (L.) roots on immunity and telomerase function.

    Science.gov (United States)

    Pan, Min-Hsiung; Wu, Jia-Ching; Ho, Chi-Tang; Badmaev, Vladimir

    2017-05-12

    Background Immunity and Longevity Methods A water extract of Curcuma longa (L.) [vern. Turmeric] roots (TurmericImmune™) standardized for a minimum 20 % of turmeric polysaccharides ukonan A, B, C and D was evaluated for its biological properties in in vitro tissue culture studies. Results The water extract of turmeric (TurP) exhibited induced-nitric oxide (NO) production in RAW264.7 macrophages. These results suggested the immunomodulatory effects of TurP. In addition, the polysaccharides up-regulated function of telomerase reverse transcriptase (TERT) equally to the phenolic compound from turmeric, curcumin. Conclusions The ukonan family of polysaccharides may assist in promoting cellular immune responses, tissue repair and lifespan by enhancing immune response and telomere function.

  9. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

    Directory of Open Access Journals (Sweden)

    Kathryn M. Lenz

    2018-04-01

    Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  10. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

    Science.gov (United States)

    Lenz, Kathryn M; Nelson, Lars H

    2018-01-01

    Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  11. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    Science.gov (United States)

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  12. Effects of γ-rays on Th1 and Th2 immune function of mice

    International Nuclear Information System (INIS)

    Jin Wei; Cui Yufang; An Xiaoxia; Xu Han; Dong Bo; Liu Xiaolan; Luo Qingliang

    2007-01-01

    Objective: To observe the effects of 6 Gy whole body γ-irradiation on immune function of Th1 and Th2 in mouse, and to investigate the cellular and molecular mechanism of immune system injury induced by irradiation. Methods: Surface marker and intracellular cytokines of lymphocytes were stained with fluorescence-labeled monoclonal antibodies, then the changes of lymphocyte subpopulations, especially the Th1 and Th2 in mouse peripheral blood and spleen were analyzed by flow cytometry. Results: (1) 1 d after 6 Gy y- irradiation, lymphocytic subsets of CD 19 + and CD 8 + in spleen decreased apparently and the percentages of them were only 30% and 41% of control groups respectively (P 19 + and 14 d for CD 8 + respectively, however, up to 21 d post-irradiation they still did not return to control level. (2) Th1 subpopulations in mouse peripheral blood and spleen were significantly reduced at 1 d after irradiation and were only 2.6% and 7.6% of control groups (P 4 + / CD 8 + were significantly increased at 1 d post-irradiation in mouse spleen because of swift reduction of CD 8 + cells. Interestingly, either in peripheral blood or in spleen in irradiated mice, the ratio of Th1/Th2 were evidently raised because of the decrement of Th1 cells, exhibited obviously a phenomenon of predominant immune response of Th2 cells. Conclusions: It is suggested that the depression of mouse immune function induced by 6 Gy γ-irradiation might be caused by changes of CD 4 + /CD 8 + ratio, especially the imbalance of Th1/Th2 function subpopulations. It is shown that the imbalance of Th1/Th2 function subpopulations plays an important role in radiation-induced immune injury, thus providing a better insight into the molecular mechanism and new strategies for prevent and treatment measures of immune injury by irradiation. (authors)

  13. Function of endoplasmic reticulum calcium ATPase in innate immunity-mediated programmed cell death

    Science.gov (United States)

    Zhu, Xiaohong; Caplan, Jeffrey; Mamillapalli, Padmavathi; Czymmek, Kirk; Dinesh-Kumar, Savithramma P

    2010-01-01

    Programmed cell death (PCD) initiated at the pathogen-infected sites during the plant innate immune response is thought to prevent the development of disease. Here, we describe the identification and characterization of an ER-localized type IIB Ca2+-ATPase (NbCA1) that function as a regulator of PCD. Silencing of NbCA1 accelerates viral immune receptor N- and fungal-immune receptor Cf9-mediated PCD, as well as non-host pathogen Pseudomonas syringae pv. tomato DC3000 and the general elicitor cryptogein-induced cell death. The accelerated PCD rescues loss-of-resistance phenotype of Rar1, HSP90-silenced plants, but not SGT1-silenced plants. Using a genetically encoded calcium sensor, we show that downregulation of NbCA1 results in the modulation of intracellular calcium signalling in response to cryptogein elicitor. We further show that NbCAM1 and NbrbohB function as downstream calcium decoders in N-immune receptor-mediated PCD. Our results indicate that ER-Ca2+-ATPase is a component of the calcium efflux pathway that controls PCD during an innate immune response. PMID:20075858

  14. Influence of Physical Activity and Nutrition on Obesity-Related Immune Function

    Directory of Open Access Journals (Sweden)

    Chun-Jung Huang

    2013-01-01

    Full Text Available Research examining immune function during obesity suggests that excessive adiposity is linked to impaired immune responses leading to pathology. The deleterious effects of obesity on immunity have been associated with the systemic proinflammatory profile generated by the secretory molecules derived from adipose cells. These include inflammatory peptides, such as TNF-α, CRP, and IL-6. Consequently, obesity is now characterized as a state of chronic low-grade systemic inflammation, a condition considerably linked to the development of comorbidity. Given the critical role of adipose tissue in the inflammatory process, especially in obese individuals, it becomes an important clinical objective to identify lifestyle factors that may affect the obesity-immune system relationship. For instance, stress, physical activity, and nutrition have each shown to be a significant lifestyle factor influencing the inflammatory profile associated with the state of obesity. Therefore, the purpose of this review is to comprehensively evaluate the impact of lifestyle factors, in particular psychological stress, physical activity, and nutrition, on obesity-related immune function with specific focus on inflammation.

  15. Chronic Lymphocytic Leukemia B-Cell Normal Cellular Counterpart: Clues From a Functional Perspective.

    Science.gov (United States)

    Darwiche, Walaa; Gubler, Brigitte; Marolleau, Jean-Pierre; Ghamlouch, Hussein

    2018-01-01

    Chronic lymphocytic leukemia (CLL) is characterized by the clonal expansion of small mature-looking CD19+ CD23+ CD5+ B-cells that accumulate in the blood, bone marrow, and lymphoid organs. To date, no consensus has been reached concerning the normal cellular counterpart of CLL B-cells and several B-cell types have been proposed. CLL B-cells have remarkable phenotypic and gene expression profile homogeneity. In recent years, the molecular and cellular biology of CLL has been enriched by seminal insights that are leading to a better understanding of the natural history of the disease. Immunophenotypic and molecular approaches (including immunoglobulin heavy-chain variable gene mutational status, transcriptional and epigenetic profiling) comparing the normal B-cell subset and CLL B-cells provide some new insights into the normal cellular counterpart. Functional characteristics (including activation requirements and propensity for plasma cell differentiation) of CLL B-cells have now been investigated for 50 years. B-cell subsets differ substantially in terms of their functional features. Analysis of shared functional characteristics may reveal similarities between normal B-cell subsets and CLL B-cells, allowing speculative assignment of a normal cellular counterpart for CLL B-cells. In this review, we summarize current data regarding peripheral B-cell differentiation and human B-cell subsets and suggest possibilities for a normal cellular counterpart based on the functional characteristics of CLL B-cells. However, a definitive normal cellular counterpart cannot be attributed on the basis of the available data. We discuss the functional characteristics required for a cell to be logically considered to be the normal counterpart of CLL B-cells.

  16. Enhanced disease characterization through multi network functional normalization in fMRI.

    Science.gov (United States)

    Çetin, Mustafa S; Khullar, Siddharth; Damaraju, Eswar; Michael, Andrew M; Baum, Stefi A; Calhoun, Vince D

    2015-01-01

    Conventionally, structural topology is used for spatial normalization during the pre-processing of fMRI. The co-existence of multiple intrinsic networks which can be detected in the resting brain are well-studied. Also, these networks exhibit temporal and spatial modulation during cognitive task vs. rest which shows the existence of common spatial excitation patterns between these identified networks. Previous work (Khullar et al., 2011) has shown that structural and functional data may not have direct one-to-one correspondence and functional activation patterns in a well-defined structural region can vary across subjects even for a well-defined functional task. The results of this study and the existence of the neural activity patterns in multiple networks motivates us to investigate multiple resting-state networks as a single fusion template for functional normalization for multi groups of subjects. We extend the previous approach (Khullar et al., 2011) by co-registering multi group of subjects (healthy control and schizophrenia patients) and by utilizing multiple resting-state networks (instead of just one) as a single fusion template for functional normalization. In this paper we describe the initial steps toward using multiple resting-state networks as a single fusion template for functional normalization. A simple wavelet-based image fusion approach is presented in order to evaluate the feasibility of combining multiple functional networks. Our results showed improvements in both the significance of group statistics (healthy control and schizophrenia patients) and the spatial extent of activation when a multiple resting-state network applied as a single fusion template for functional normalization after the conventional structural normalization. Also, our results provided evidence that the improvement in significance of group statistics lead to better accuracy results for classification of healthy controls and schizophrenia patients.

  17. Comparison of the Functional microRNA Expression in Immune Cell Subsets of Neonates and Adults

    Science.gov (United States)

    Yu, Hong-Ren; Hsu, Te-Yao; Huang, Hsin-Chun; Kuo, Ho-Chang; Li, Sung-Chou; Yang, Kuender D.; Hsieh, Kai-Sheng

    2016-01-01

    Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs) are reported to involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte subpopulations is important for understanding immune system regulation. In order to explore the unique miRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells, and myeloid dendritic cells) from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced interleukin (IL)-6 and TNF-α production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-α production. With this functional approach, we provide intact differential miRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies. PMID:28066425

  18. Comparison of the functional microRNA expression in immune cell subsets of neonates and adults

    Directory of Open Access Journals (Sweden)

    Hong-Ren Yu

    2016-12-01

    Full Text Available Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs are reported involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte sub-populations is important for understanding immune system regulation. In order to explore the unique microRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells (pDCs, and myeloid dendritic cells (mDCs from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced IL-6 and TNF-alpha production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-alpha production. With this functional approach, we provide intact differential microRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies.

  19. Hygiene and other early childhood influences on the subsequent function of the immune system.

    Science.gov (United States)

    Rook, Graham A W; Lowry, Christopher A; Raison, Charles L

    2015-08-18

    The immune system influences brain development and function. Hygiene and other early childhood influences impact the subsequent function of the immune system during adulthood, with consequences for vulnerability to neurodevelopmental and psychiatric disorders. Inflammatory events during pregnancy can act directly to cause developmental problems in the central nervous system (CNS) that have been implicated in schizophrenia and autism. The immune system also acts indirectly by "farming" the intestinal microbiota, which then influences brain development and function via the multiple pathways that constitute the gut-brain axis. The gut microbiota also regulates the immune system. Regulation of the immune system is crucial because inflammatory states in pregnancy need to be limited, and throughout life inflammation needs to be terminated completely when not required; for example, persistently raised levels of background inflammation during adulthood (in the presence or absence of a clinically apparent inflammatory stimulus) correlate with an increased risk of depression. A number of factors in the perinatal period, notably immigration from rural low-income to rich developed settings, caesarean delivery, breastfeeding and antibiotic abuse have profound effects on the microbiota and on immunoregulation during early life that persist into adulthood. Many aspects of the modern western environment deprive the infant of the immunoregulatory organisms with which humans co-evolved, while encouraging exposure to non-immunoregulatory organisms, associated with more recently evolved "crowd" infections. Finally, there are complex interactions between perinatal psychosocial stressors, the microbiota, and the immune system that have significant additional effects on both physical and psychiatric wellbeing in subsequent adulthood. This article is part of a Special Issue entitled Neuroimmunology in Health And Disease. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights

  20. In vivo functional requirement of the mouse Ifitm1 gene for germ cell development, interferon mediated immune response and somitogenesis.

    Directory of Open Access Journals (Sweden)

    Ingeborg Klymiuk

    Full Text Available The mammalian Interferon induced transmembrane protein 1 (Ifitm1 gene was originally identified as a member of a gene family highly inducible by type I and type II interferons. Based on expression analyses, it was suggested to be required for normal primordial germ cell migration. The knockdown of Ifitm1 in mouse embryos provided evidence for a role in somitogenesis. We generated the first targeted knockin allele of the Ifitm1 gene to systematically reassess all inferred functions. Sperm motility and the fertility of male and female mutant mice are as in wild type littermates. Embryonic somites and the adult vertebral column appear normal in homozygous Ifitm1 knockout mice, demonstrating that Ifitm1 is not essential for normal segmentation of the paraxial mesoderm. Proportions of leucocyte subsets, including granulocytes, monocytes, B-cells, T-cells, NK-cells, and NKT-cells, are unchanged in mutant mice. Based on a normal immune response to Listeria monocytogenes infection, there is no evidence for a dysfunction in downstream IFNγ signaling in Ifitm1 mutant mice. Expression from the Ifitm1 locus from E8.5 to E14.5 is highly dynamic. In contrast, in adult mice, Ifitm1 expression is highly restricted and strong in the bronchial epithelium. Intriguingly, IFITM1 is highly overexpressed in tumor epithelia cells of human squamous cell carcinomas and in adenocarcinomas of NSCLC patients. These analyses underline the general importance of targeted in vivo studies for the functional annotation of the mammalian genome. The first comprehensive description of the Ifitm1 expression pattern provides a rational basis for the further examination of Ifitm1 gene functions. Based on our data, the fact that IFITM1 can function as a negative regulator of cell proliferation, and because the gene maps to chromosome band 11p15.5, previously associated with NSCLC, it is likely that IFITM1 in man has a key role in tumor formation.

  1. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

    DEFF Research Database (Denmark)

    Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

    2011-01-01

    Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function......). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

  2. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils

    DEFF Research Database (Denmark)

    Galli, Stephen J; Borregaard, Niels; Wynn, Thomas A

    2011-01-01

    ). Here we focus on the occurrence of phenotypically distinct subpopulations in three lineages of myeloid cells with important roles in innate and acquired immunity: macrophages, mast cells and neutrophils. Cytokine signals, epigenetic modifications and other microenvironmental factors can substantially......Hematopoietic cells, including lymphoid and myeloid cells, can develop into phenotypically distinct 'subpopulations' with different functions. However, evidence indicates that some of these subpopulations can manifest substantial plasticity (that is, undergo changes in their phenotype and function...... and, in some cases, rapidly and reversibly alter the phenotype of these cells and influence their function. This suggests that regulation of the phenotype and function of differentiated hematopoietic cells by microenvironmental factors, including those generated during immune responses, represents...

  3. The normal function of a speciation gene, Odysseus, and its hybrid sterility effect.

    Science.gov (United States)

    Sun, Sha; Ting, Chau-Ti; Wu, Chung-I

    2004-07-02

    To understand how postmating isolation is connected to the normal process of species divergence and why hybrid male sterility is often the first sign of speciation, we analyzed the Odysseus (OdsH) gene of hybrid male sterility in Drosophila. We carried out expression analysis, transgenic study, and gene knockout. The combined evidence suggests that the sterility phenotype represents a novel manifestation of the gene function rather than the reduction or loss of the normal one. The gene knockout experiment identified the normal function of OdsH as a modest enhancement of sperm production in young males. The implication of a weak effect of OdsH on the normal phenotype but a strong influence on hybrid male sterility is discussed in light of Haldane's rule of postmating isolation.

  4. Infusion of Sibling Marrow in a Patient with Purine Nucleoside Phosphorylase Deficiency Leads to Split Mixed Donor Chimerism and Normal Immunity

    Directory of Open Access Journals (Sweden)

    Laura Yeates

    2017-06-01

    Full Text Available Purine nucleoside phosphorylase (PNP deficiency, a rare autosomal recessive metabolic disease causes combined immunodeficiency and developmental delay, hypotonia, and spasticity. Patients present with recurrent infections associated with T-lymphocytopenia, characteristically presenting later than patients with classical severe combined immunodeficiency (SCID. PNP, with adenosine deaminase (ADA, is part of the purine salvage pathway. The only curative therapy is hematopoietic stem cell transplantation. Myeloablative conditioning is recommended to prevent rejection caused by residual immune function. However, HLA-identical sibling stem cell infusions in ADA-SCID result in some donor stem cell engraftment and long-term thymopoiesis. We report a patient with PNP deficiency, who received HLA-identical sibling marrow without chemotherapy because of disseminated cytomegalovirus (CMV infection. The patient presented at 14 months of age following recurrent infections, from early infancy, with persistent irritability, developmental delay, and hypotonia. She had neutropenia, pan-lymphocytopenia, and hypogammaglobulinemia with low plasma urate and erythrocyte PNP activity. Diagnosis was confirmed with a homozygous mutation in PNP. The patient was viremic with CMV detected in blood and CSF by PCR. Dual antiviral therapy improved the clinical condition and reduced the viral load. In view of the disseminated CMV infection, the decision was made to infuse stem cells without any pre-conditioning chemotherapy. She received a matched sibling donor unconditioned stem cell infusion at 16 months of age. The post-transplant course was uneventful. Blood PCR became negative for CMV. Global hypotonia persisted, although with significant improvement in irritability. At 4 years of age and 29 months post-transplant, the patient demonstrated normal T-lymphocyte and natural killer cell numbers. Recent thymic emigrants represented 12% of the total T

  5. Validation of MCDS by comparison of predicted with experimental velocity distribution functions in rarefied normal shocks

    Science.gov (United States)

    Pham-Van-diep, Gerald C.; Erwin, Daniel A.

    1989-01-01

    Velocity distribution functions in normal shock waves in argon and helium are calculated using Monte Carlo direct simulation. These are compared with experimental results for argon at M = 7.18 and for helium at M = 1.59 and 20. For both argon and helium, the variable-hard-sphere (VHS) model is used for the elastic scattering cross section, with the velocity dependence derived from a viscosity-temperature power-law relationship in the way normally used by Bird (1976).

  6. Renal function maturation in children: is normalization to surface area valid?

    International Nuclear Information System (INIS)

    Rutland, M.D.; Hassan, I.M.; Que, L.

    1999-01-01

    Full text: Gamma camera DTPA renograms were analysed to measure renal function by the rate at which the kidneys took up tracer from the blood. This was expressed either directly as the fractional uptake rate (FUR), which is not related to body size, or it was converted to a camera-based GFR by the formula GFR blood volume x FUR, and this GFR was normalized to a body surface area of 1.73 m2. Most of the patients studied had one completely normal kidney, and one kidney with reflux but normal function and no large scars. The completely normal kidneys contributed, on average, 50% of the total renal function. The results were considered in age bands, to display the effect of age on renal function. The camera-GFR measurements showed the conventional results of poor renal function in early childhood, with a slow rise to near-adult values by the age of 2 years, and somewhat low values throughout childhood. The uptake values showed a different pattern, with renal function rising to adult equivalent values by the age of 4 months, and with children having better renal function than adults throughout most of their childhood. The standard deviations expressed as coefficients of variation (CV) were smaller for the FUR technique than the GFR (Wilcoxon rank test, P < 0.01). These results resemble recent published measurements of absolute DMSA uptake, which are also unrelated to body size and show early renal maturation. The results also suggest that the reason children have lower serum creatinine levels than adults is that they have better renal function. If this were confirmed, it would raise doubts about the usefulness of normalizing renal function to body surface area in children

  7. The Application of Normal Stress Reduction Function in Tilt Tests for Different Block Shapes

    Science.gov (United States)

    Kim, Dong Hyun; Gratchev, Ivan; Hein, Maw; Balasubramaniam, Arumugam

    2016-08-01

    This paper focuses on the influence of the shapes of rock cores, which control the sliding or toppling behaviours in tilt tests for the estimation of rock joint roughness coefficients (JRC). When the JRC values are estimated by performing tilt tests, the values are directly proportional to the basic friction of the rock material and the applied normal stress on the sliding planes. Normal stress obviously varies with the shape of the sliding block, and the basic friction angle is also affected by the sample shapes in tilt tests. In this study, the shapes of core blocks are classified into three representative shapes and those are created using plaster. Using the various shaped artificial cores, a set of tilt tests is carried out to identify the shape influences on the normal stress and the basic friction angle in tilt tests. The test results propose a normal stress reduction function to estimate the normal stress for tilt tests according to the sample shapes based on Barton's empirical equation. The proposed normal stress reduction functions are verified by tilt tests using artificial plaster joints and real rock joint sets. The plaster joint sets are well matched and cast in detailed printed moulds using a 3D printing technique. With the application of the functions, the obtained JRC values from the tilt tests using the plaster samples and the natural rock samples are distributed within a reasonable JRC range when compared with the measured values.

  8. Coronary flow reserve/diastolic function relationship in angina-suffering patients with normal coronary angiography.

    Science.gov (United States)

    Anchisi, Chiara; Marti, Giuliano; Bellacosa, Ilaria; Mary, David; Vacca, Giovanni; Marino, Paolo; Grossini, Elena

    2017-05-01

    Coronary blood flow and diastolic function are well known to interfere with each other through mechanical and metabolic mechanisms. We aimed to assess the relationship between coronary flow reserve (CFR) and diastolic dysfunction in patients suffering from angina but with normal coronary angiography. In 16 patients with chest pain and angiographically normal coronary arteries, CFR was measured using transthoracic echo-Doppler by inducing hyperemia through dipyridamole infusion. Diastolic function (E/A, deceleration time, isovolumetric relaxation time [IVRT], propagation velocity [Vp]) and left ventricular mass were evaluated by means of two-dimensional transthoracic echocardiography. The patients were initially divided into two groups on the grounds of CFR only (ACFR: altered CFR, n = 9; NACFR: unaltered CFR, n = 7). Thereafter they were divided into four groups on the grounds of CFR and diastolic function (NN: normal; AA: altered CFR/diastole; AN: altered CFR/normal diastole; NA: normal CFR/altered diastole). Most of the subjects were scheduled in AA (n = 8) or NA (n = 5) groups, which were taken into consideration for further analysis. Patients were not different regarding various risk factors. ACFR and AA patients were older with normal body weight in comparison with NACFR and NA patients (P relationship between altered CFR and diastole.

  9. Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

    Science.gov (United States)

    Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

    2015-01-01

    Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458

  10. A cascade reaction network mimicking the basic functional steps of acquired immune response

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-01-01

    Biological systems use complex ‘information processing cores’ composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS which we call Adaptive Immune Response Simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system which responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner which is superficially similar to the most basic responses of the vertebrate acquired immune system, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices. PMID:26391084

  11. Neutrophil degranulation and immunosuppression in patients with GBM: restoration of cellular immune function by targeting arginase I.

    Science.gov (United States)

    Sippel, Trisha R; White, Jason; Nag, Kamalika; Tsvankin, Vadim; Klaassen, Marci; Kleinschmidt-DeMasters, B K; Waziri, Allen

    2011-11-15

    The source of glioblastoma (GBM)-associated immunosuppression remains multifactorial. We sought to clarify and therapeutically target myeloid cell-derived peripheral immunosuppression in patients with GBM. Direct ex vivo T-cell function, serum Arginase I (ArgI) levels, and circulating myeloid lineage populations were compared between patients with GBM and normal donors or patients with other intracranial tumors. Immunofunctional assays were conducted using bulk and sorted cell populations to explore the potential transfer of myeloid cell-mediated immunosuppression and to identify a potential mechanism for these effects. ArgI-mediated immunosuppression was therapeutically targeted in vitro through pharmacologic inhibition or arginine supplementation. We identified a significantly expanded population of circulating, degranulated neutrophils associated with elevated levels of serum ArgI and decreased T-cell CD3ζ expression within peripheral blood from patients with GBM. Sorted CD11b(+) cells from patients with GBM were found to markedly suppress normal donor T-cell function in coculture, and media harvested from mitogen-stimulated GBM peripheral blood mononuclear cell (PBMC) or GBM-associated mixed lymphoid reactions showed ArgI levels that were significantly higher than controls. Critically, T-cell suppression in both settings could be completely reversed through pharmacologic ArgI inhibition or with arginine supplementation. These data indicate that peripheral cellular immunosuppression in patients with GBM is associated with neutrophil degranulation and elevated levels of circulating ArgI, and that T-cell function can be restored in these individuals by targeting ArgI. These data identify a novel pathway of GBM-mediated suppression of cellular immunity and offer a potential therapeutic window for improving antitumor immunity in affected patients.

  12. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Science.gov (United States)

    Kato, Kazuki; Ishii, Ryohei; Goto, Eiji; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2013-01-01

    The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS) is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING), resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  13. Structural and functional analyses of DNA-sensing and immune activation by human cGAS.

    Directory of Open Access Journals (Sweden)

    Kazuki Kato

    Full Text Available The detection of cytosolic DNA, derived from pathogens or host cells, by cytosolic receptors is essential for appropriate host immune responses. Cyclic GMP-AMP synthase (cGAS is a newly identified cytosolic DNA receptor that produces cyclic GMP-AMP, which activates stimulator of interferon genes (STING, resulting in TBK1-IRF3 pathway activation followed by the production of type I interferons. Here we report the crystal structure of human cGAS. The structure revealed that a cluster of lysine and arginine residues forms the positively charged DNA binding surface of human cGAS, which is important for the STING-dependent immune activation. A structural comparison with other previously determined cGASs and our functional analyses suggested that a conserved zinc finger motif and a leucine residue on the DNA binding surface are crucial for the DNA-specific immune response of human cGAS, consistent with previous work. These structural features properly orient the DNA binding to cGAS, which is critical for DNA-induced cGAS activation and STING-dependent immune activation. Furthermore, we showed that the cGAS-induced activation of STING also involves the activation of the NF-κB and IRF3 pathways. Our results indicated that cGAS is a DNA sensor that efficiently activates the host immune system by inducing two distinct pathways.

  14. PCSK9 at the crossroad of cholesterol metabolism and immune function during infections.

    Science.gov (United States)

    Paciullo, Francesco; Fallarino, Francesca; Bianconi, Vanessa; Mannarino, Massimo R; Sahebkar, Amirhossein; Pirro, Matteo

    2017-09-01

    Sepsis, a complex and dynamic syndrome resulting from microbial invasion and immune system dysregulation, is associated with an increased mortality, reaching up to 35% worldwide. Cholesterol metabolism is often disturbed during sepsis, with low plasma cholesterol levels being associated with poor prognosis. Proprotein convertase subtilisin/kexin type 9 (PCSK9) promotes degradation of the low-density lipoprotein receptor (LDLR), thus regulating intracellular and plasma cholesterol levels. PCSK9 is often upregulated during sepsis and might have a detrimental effect on immune host response and survival. Accordingly, PCSK9 reduces lipopolysaccharide uptake and clearance by human hepatocytes. Moreover, PCSK9 upregulation exacerbates organ dysfunction and tissue inflammation during sepsis, whereas a protective effect of PCSK9 deficiency has been documented in septic patients. Although a possible detrimental impact of PCSK9 on survival has been described, some beneficial effects of PCSK9 on immune response may be hypothesized. First, PCSK9 is associated with increased plasma cholesterol levels, which might be protective during sepsis. Second, PCSK9, by stimulating LDLR degradation and inhibiting reverse cholesterol transport (RCT), might promote preferential cholesterol accumulation in macrophages and other immune cells; these events might improve lipid raft composition and augment toll-like receptor function thus supporting inflammatory response. Hence, a more clear definition of the role of PCSK9 in septic states might provide additional insight in the understanding of the sepsis-associated immune dysregulation and enhance therapeutic outcomes. © 2017 Wiley Periodicals, Inc.

  15. Shingles Immunity and Health Functioning in the Elderly: Tai Chi Chih as a Behavioral Treatment

    Directory of Open Access Journals (Sweden)

    Michael Irwin

    2004-01-01

    Full Text Available Both the incidence and severity of herpes zoster (HZ or shingles increase markedly with increasing age in association with a decline in varicella zoster virus (VZV-specific immunity. Considerable evidence shows that behavioral stressors, prevalent in older adults, correlate with impairments of cellular immunity. Moreover, the presence of depressive symptoms in older adults is associated with declines in VZV-responder cell frequency (VZV-RCF, an immunological marker of shingles risk. In this review, we discuss recent findings that administration of a relaxation response-based intervention, tai chi chih (TCC, results in improvements in health functioning and immunity to VZV in older adults as compared with a control group. TCC is a slow moving meditation consisting of 20 separate standardized movements which can be readily used in elderly and medically compromised individuals. TCC offers standardized training and practice schedules, lending an important advantage over prior relaxation response-based therapies. Focus on older adults at increased risk for HZ and assay of VZV-specific immunity have implications for understanding the impact of behavioral factors and a behavioral intervention on a clinically relevant end-point and on the response of the immune system to infectious pathogens.

  16. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  17. Dim light at night increases immune function in Nile grass rats, a diurnal rodent.

    Science.gov (United States)

    Fonken, Laura K; Haim, Achikam; Nelson, Randy J

    2012-02-01

    With the widespread adoption of electrical lighting during the 20th century, human and nonhuman animals became exposed to high levels of light at night for the first time in evolutionary history. This divergence from the natural environment may have significant implications for certain ecological niches because of the important influence light exerts on the circadian system. For example, circadian disruption and nighttime light exposure are linked to changes in immune function. The majority of studies investigating the effects of light exposure and circadian disruption on the immune system use nocturnal rodents. In diurnal species, many hormones and immune parameters vary with secretion patterns 180° out of phase to those of nocturnal rodents. Thus, the authors investigated the effects of nighttime light exposure on immunocompetence in diurnal Nile grass rats (Arvicanthis niloticus). Rats were housed in either standard 14-h light (L):10-h dark (D) cycles with L ∼150 lux and D 0 lux or dim light at night (dLAN) cycles of LD 14:10 with L ∼150 lux and D 5 lux for 3 wks, then tested for plasma bactericidal capacity, as well as humoral and cell-mediated immune responses. Rats exposed to dLAN showed increased delayed-type hypersensitivity pinna swelling, which is consistent with enhanced cell-mediated immune function. dLAN rats similarly showed increased antibody production following inoculation with keyhole lymphocyte hemocyanin (KLH) and increased bactericidal capacity. Daytime corticosterone concentrations were elevated in grass rats exposed to nighttime dim light, which may have influenced immunological measures. Overall, these results indicate nighttime light affects immune parameters in a diurnal rodent.

  18. Seasonal Redistribution of Immune Function in a Migrant Shorebird : Annual-Cycle Effects Override Adjustments to Thermal Regime

    NARCIS (Netherlands)

    Buehler, Deborah M.; Piersma, Theunis; Matson, Kevin D.; Tieleman, B. Irene; Demas, Greg (associate); Geber, Monica A.

    2008-01-01

    Throughout the annual cycle, demands on competing physiological systems change, and animals must allocate resources to maximize fitness. Immune function is one such system and is important for survival. Yet detailed empirical data tracking immune function over the entire annual cycle are lacking for

  19. Role of oxidants/inflammation in declining renal function in chronic kidney disease and normal aging.

    Science.gov (United States)

    Vlassara, Helen; Torreggiani, Massimo; Post, James B; Zheng, Feng; Uribarri, Jaime; Striker, Gary E

    2009-12-01

    Oxidant stress (OS) and inflammation increase in normal aging and in chronic kidney disease (CKD), as observed in human and animal studies. In cross-sectional studies of the US population, these changes are associated with a decrease in renal function, which is exhibited by a significant proportion of the population. However, since many normal adults have intact renal function, and longitudinal studies show that some persons maintain normal renal function with age, the link between OS, inflammation, and renal decline is not clear. In aging mice, greater oxidant intake is associated with increased age-related CKD and mortality, which suggests that interventions that reduce OS and inflammation may be beneficial for older individuals. Both OS and inflammation can be readily lowered in normal subjects and patients with CKD stage 3-4 by a simple dietary modification that lowers intake and results in reduced serum and tissue levels of advanced glycation end products. Diabetic patients, including those with microalbuminuria, have a decreased ability to metabolize and excrete oxidants prior to observable changes in serum creatinine. Thus, OS and inflammation may occur in the diabetic kidney at an early time. We review the evidence that oxidants in the diet directly lead to increased serum levels of OS and inflammatory mediators in normal aging and in CKD. We also discuss a simple dietary intervention that helps reduce OS and inflammation, an important and achievable therapeutic goal for patients with CKD and aging individuals with reduced renal function.

  20. Normal pancreatic exocrine function does not exclude MRI/MRCP chronic pancreatitis findings.

    Science.gov (United States)

    Alkaade, Samer; Cem Balci, Numan; Momtahen, Amir Javad; Burton, Frank

    2008-09-01

    Abnormal pancreatic function tests have been reported to precede the imaging findings of chronic pancreatitis. Magnetic resonance imaging (MRI) with magnetic resonance cholangiopancreatography (MRCP) is increasingly accepted as the primary imaging modality for the detection of structural changes of early mild chronic pancreatitis. The aim of this study was to evaluate MRI/MRCP findings in patients with symptoms consistent with chronic pancreatitis who have normal Secretin Endoscopic Pancreatic Function test. A retrospective study of 32 patients referred for evaluation of chronic abdominal pain consistent with chronic pancreatitis and reported normal standard abdominal imaging (ultrasound, computed tomography, or MRI). All patients underwent Secretin Endoscopic Pancreatic Function testing and pancreatic MRI/MRCP at our institution. We reviewed the MRI/MRCP images in patients who had normal Secretin Endoscopic Pancreatic Function testing. MRI/MRCP images were assessed for pancreatic duct morphology, gland size, parenchymal signal and morphology, and arterial contrast enhancement. Of the 32 patients, 23 had normal Secretin Endoscopic Pancreatic Function testing, and 8 of them had mild to marked spectrum of abnormal MRI/MRCP findings that were predominantly focal. Frequencies of the findings were as follows: pancreatic duct stricture (n=3), pancreatic duct dilatation (n=3), side branch ectasia (n=4), atrophy (n=5), decreased arterial enhancement (n=5), decreased parenchymal signal (n=1), and cavity formation (n=1). The remaining15 patients had normal pancreatic structure on MRI/MRCP. Normal pancreatic function testing cannot exclude abnormal MRI/MRCP especially focal findings of chronic pancreatitis. Further studies needed to verify significance of these findings and establish MRI/MRCP imaging criteria for the diagnosis of chronic pancreatitis.

  1. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  2. Closed-form confidence intervals for functions of the normal mean and standard deviation.

    Science.gov (United States)

    Donner, Allan; Zou, G Y

    2012-08-01

    Confidence interval methods for a normal mean and standard deviation are well known and simple to apply. However, the same cannot be said for important functions of these parameters. These functions include the normal distribution percentiles, the Bland-Altman limits of agreement, the coefficient of variation and Cohen's effect size. We present a simple approach to this problem by using variance estimates recovered from confidence limits computed for the mean and standard deviation separately. All resulting confidence intervals have closed forms. Simulation results demonstrate that this approach performs very well for limits of agreement, coefficients of variation and their differences.

  3. Kidney function and size in normal subjects before and during growth hormone administration for one week

    DEFF Research Database (Denmark)

    Gammelgaard, Jens; Orskov, H; Andersen, A R

    1981-01-01

    Kidney function and size were studied in seven normal male subjects before and after administration of highly purified human growth hormone for 1 week. Glomerular filtration rate, renal plasma flow (steady-state infusion technique with urinary collections using 125I-iothalamate and 131I-hippuran)......Kidney function and size were studied in seven normal male subjects before and after administration of highly purified human growth hormone for 1 week. Glomerular filtration rate, renal plasma flow (steady-state infusion technique with urinary collections using 125I-iothalamate and 131I...

  4. The Notch Signaling Pathway Is Balancing Type 1 Innate Lymphoid Cell Immune Functions

    Directory of Open Access Journals (Sweden)

    Thibaut Perchet

    2018-06-01

    Full Text Available The Notch pathway is one of the canonical signaling pathways implicated in the development of various solid tumors. During carcinogenesis, the Notch pathway dysregulation induces tumor expression of Notch receptor ligands participating to escape the immune surveillance. The Notch pathway conditions both the development and the functional regulation of lymphoid subsets. Its importance on T cell subset polarization has been documented contrary to its action on innate lymphoid cells (ILC. We aim to analyze the effect of the Notch pathway on type 1 ILC polarization and functions after disruption of the RBPJk-dependent Notch signaling cascade. Indeed, type 1 ILC comprises conventional NK (cNK cells and type 1 helper innate lymphoid cells (ILC1 that share Notch-related functional characteristics such as the IFNg secretion downstream of T-bet expression. cNK cells have strong antitumor properties. However, data are controversial concerning ILC1 functions during carcinogenesis with models showing antitumoral capacities and others reporting ILC1 inability to control tumor growth. Using various mouse models of Notch signaling pathway depletion, we analyze the effects of its absence on type 1 ILC differentiation and cytotoxic functions. We also provide clues into its role in the maintenance of immune homeostasis in tissues. We show that modulating the Notch pathway is not only acting on tumor-specific T cell activity but also on ILC immune subset functions. Hence, our study uncovers the intrinsic Notch signaling pathway in ILC1/cNK populations and their response in case of abnormal Notch ligand expression. This study help evaluating the possible side effects mediated by immune cells different from T cells, in case of multivalent forms of the Notch receptor ligand delta 1 treatments. In definitive, it should help determining the best novel combination of therapeutic strategies in case of solid tumors.

  5. Heat and immunity: an experimental heat wave alters immune functions in three-spined sticklebacks (Gasterosteus aculeatus).

    Science.gov (United States)

    Dittmar, Janine; Janssen, Hannah; Kuske, Andra; Kurtz, Joachim; Scharsack, Jörn P

    2014-07-01

    Global climate change is predicted to lead to increased temperatures and more extreme climatic events. This may influence host-parasite interactions, immunity and therefore the impact of infectious diseases on ecosystems. However, little is known about the effects of rising temperatures on immune defence, in particular in ectothermic animals, where the immune system is directly exposed to external temperature change. Fish are ideal models for studying the effect of temperature on immunity, because they are poikilothermic, but possess a complete vertebrate immune system with both innate and adaptive immunity. We used three-spined sticklebacks ( Gasterosteus aculeatus) originating from a stream and a pond, whereby the latter supposedly were adapted to higher temperature variation. We studied the effect of increasing and decreasing temperatures and a simulated heat wave with subsequent recovery on body condition and immune parameters. We hypothesized that the immune system might be less active at low temperatures, but will be even more suppressed at temperatures towards the upper tolerable temperature range. Contrary to our expectation, we found innate and adaptive immune activity to be highest at a temperature as low as 13 °C. Exposure to a simulated heat wave induced long-lasting immune disorders, in particular in a stickleback population that might be less adapted to temperature variation in its natural environment. The results show that the activity of the immune system of an ectothermic animal species is temperature dependent and suggest that heat waves associated with global warming may immunocompromise host species, thereby potentially facilitating the spread of infectious diseases. © 2014 The Authors. Journal of Animal Ecology © 2014 British Ecological Society.

  6. The effect of elevated reproductive effort onhumoral immune function in collared flycatcher females

    Science.gov (United States)

    Cichoń, Mariusz; Dubiec, Anna; Chadzińska, Magdalena

    2001-02-01

    In order to test whether high reproductive investments impair immune function in naturally breeding collared flycatchers, we performed a brood manipulation experiment and simultaneously induced an immune response by challenging birds with a non-pathogenic antigen - sheep red blood cells (SRBC). Females rearing experimentally enlarged number of nestlings showed significantly lower level of specific anti-SRBC antibodies than control females attending unaltered broods, but only in one of the two study years. The haemoconcentration of leukocytes did not differ between the two groups in both study years. The significant difference in immunological responsiveness between control and enlarged group coincided with differences in survival probability to the next breeding season: females attending enlarged broods showed lower probability of survival than control females, but there was no relationship between the level of immune response and survival probability. Our results indicate that reproduction may indeed trade for resources with immune functions at least in terms of specific antibody production. However, as in the other studies on reproductive costs, these costs seem not always to be pronounced.

  7. Modulation of immune cell functions by the E3 ligase CBL-b

    Directory of Open Access Journals (Sweden)

    Christina eLutz-Nicoladoni

    2015-03-01

    Full Text Available Maintenance of immunological tolerance is a critical hallmark of the immune system. Several signaling checkpoints necessary to balance activating and inhibitory input to immune cells have been described so far, among which the E3 ligase Cbl-b appears to be a central player. Cbl-b is expressed in all leukocyte subsets and regulates several signaling pathways in T cells, NK cells, B cells and different types of myeloid cells. In most cases Cbl-b negatively regulates activation signals through antigen or pattern recognition receptors and co-stimulatory molecules. In line with this function, cblb-deficient immune cells display lower activation thresholds and cblb knockout mice spontaneously develop autoimmunity and are highly susceptible to experimental autoimmunity. Interestingly, genetic association studies link cblb-polymorphisms with autoimmunity also in humans. Vice versa, the increased activation potential of cblb-deficient cells renders them more potent to fight against malignancies or infections. Accordingly, several reports have shown that cblb knockout mice reject tumors, which mainly depends on cytotoxic T and NK cells. Thus targeting Cbl-b may be an interesting strategy to enhance anti-cancer immunity. In this review we summarize the findings on the molecular function of Cbl-b in different cell types and illustrate the potential of Cbl-b as target for immunomodulatory therapies.

  8. Gap junctions in cells of the immune system: structure, regulation and possible functional roles

    Directory of Open Access Journals (Sweden)

    J.C. Sáez

    2000-04-01

    Full Text Available Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.

  9. The effects of stress hormones on immune function may be vital for the adaptive reconfiguration of the immune system during fight-or-flight behavior.

    Science.gov (United States)

    Adamo, Shelley A

    2014-09-01

    Intense, short-term stress (i.e., robust activation of the fight-or-flight response) typically produces a transient decline in resistance to disease in animals across phyla. Chemical mediators of the stress response (e.g., stress hormones) help induce this decline, suggesting that this transient immunosuppression is an evolved response. However, determining the function of stress hormones on immune function is difficult because of their complexity. Nevertheless, evidence suggests that stress hormones help maintain maximal resistance to disease during the physiological changes needed to optimize the body for intense physical activity. Work on insects demonstrates that stress hormones both shunt resources away from the immune system during fight-or-flight responses as well as reconfigure the immune system. Reconfiguring the immune system minimizes the impact of the loss of these resources and reduces the increased costs of some immune functions due to the physiological changes demanded by the fight-or-flight response. For example, during the stress response of the cricket Gryllus texensis, some molecular resources are shunted away from the immune system and toward lipid transport, resulting in a reduction in resistance to disease. However, insects' immune cells (hemocytes) have receptors for octopamine (the insect stress neurohormone). Octopamine increases many hemocyte functions, such as phagocytosis, and these changes would tend to mitigate the decline in immunity due to the loss of molecular resources. Moreover, because the stress response generates oxidative stress, some immune responses are probably more costly when activated during a stress response (e.g., those that produce reactive molecules). Some of these immune responses are depressed during stress in crickets, while others, whose costs are probably not increased during a stress response, are enhanced. Some effects of stress hormones on immune systems may be better understood as examples of reconfiguration

  10. Echocardiographic reference ranges for normal left atrial function parameters: results from the EACVI NORRE study.

    Science.gov (United States)

    Sugimoto, Tadafumi; Robinet, Sébastien; Dulgheru, Raluca; Bernard, Anne; Ilardi, Federica; Contu, Laura; Addetia, Karima; Caballero, Luis; Kacharava, George; Athanassopoulos, George D; Barone, Daniele; Baroni, Monica; Cardim, Nuno; Hagendorff, Andreas; Hristova, Krasimira; Lopez, Teresa; de la Morena, Gonzalo; Popescu, Bogdan A; Penicka, Martin; Ozyigit, Tolga; Rodrigo Carbonero, Jose David; van de Veire, Nico; Von Bardeleben, Ralph Stephan; Vinereanu, Dragos; Zamorano, Jose Luis; Go, Yun Yun; Marchetta, Stella; Nchimi, Alain; Rosca, Monica; Calin, Andreea; Moonen, Marie; Cimino, Sara; Magne, Julien; Cosyns, Bernard; Galli, Elena; Donal, Erwan; Habib, Gilbert; Esposito, Roberta; Galderisi, Maurizio; Badano, Luigi P; Lang, Roberto M; Lancellotti, Patrizio

    2018-02-23

    To obtain the normal ranges for echocardiographic measurements of left atrial (LA) function from a large group of healthy volunteers accounting for age and gender. A total of 371 (median age 45 years) healthy subjects were enrolled at 22 collaborating institutions collaborating in the Normal Reference Ranges for Echocardiography (NORRE) study of the European Association of Cardiovascular Imaging (EACVI). Left atrial data sets were analysed with a vendor-independent software (VIS) package allowing homogeneous measurements irrespective of the echocardiographic equipment used to acquire data sets. The lowest expected values of LA function were 26.1%, 48.7%, and 41.4% for left atrial strain (LAS), 2D left atrial emptying fraction (LAEF), and 3D LAEF (reservoir function); 7.7%, 24.2%, and -0.53/s for LAS-active, LAEF-active, and LA strain rate during LA contraction (SRa) (pump function) and 12.0% and 21.6% for LAS-passive and LAEF-passive (conduit function). Left atrial reservoir and conduit function were decreased with age while pump function was increased. All indices of reservoir function and all LA strains had no difference in both gender and vendor. However, inter-vendor differences were observed in LA SRa despite the use of VIS. The NORRE study provides contemporary, applicable echocardiographic reference ranges for LA function. Our data highlight the importance of age-specific reference values for LA functions.

  11. Comparing Executive Function and Behavioral Inhibition in Schizophrenia, Bipolar Mood Disorder Type I and Normal Groups

    Directory of Open Access Journals (Sweden)

    Marziye Khodaee

    2015-11-01

    Full Text Available Introduction: Cognitive performance in patients with schizophrenia and Bipolar I disorder seems to be different from the normal individuals, that these defects affect their treatment results. Therefore, this study aimed to compare executive function and behavioral inhibition within patients suffering from schizophrenia, bipolar type I as well as a normal group. Methods: In this descriptive-comparative study, out of all patients hospitalized in daily psychiatric clinic in Najafabad in 2014 due to these disorders, 20 schizophrenia and 20 bipolar type I as well as 20 normal individuals were selected via the convinience sampling. All the study participants completed the computerizing tests including Tower of London and Go-No Go. The study data were analyzed utilizing SPSS software (ver 22 via MANOVA. Results: The study findings revealed a significant difference between the two patient groups and the normal group in regard with executive function and behavioral inhibition (p<0.05, whereas no differences were detected between schizophrenics and bipolar patient groups. Furthermore, patients suffering from schizophrenia and bipolar I mood disorder demonstrated significantly poor performance in cognitive function and behavioral inhibition compared to the normal group. Conclusion: The present study results can be significantly applied in pathology and therapy of these disorders, so as recognizing the inability of such patients can be effective in developing cognitive rehabilitation programs in these patients.

  12. Clinical evaluation of immune-promoting functions of the developed product (HemoHIM)

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kyoung Soo; Lee, Ill Kyoo; Kwon, Soon Gil [The Catholic University of Korea, Seoul (Korea, Republic of)

    2007-07-15

    We performed a clinical study to evaluate the immune promotion and antioxidant effects of the developed product (HemoHIM) in healthy or subhealthy people. Volunteers with white blood cell numbers between 5000 and 10000/ul were recruited and the subjects were selected by appropriate inclusion and exclusion rules. The subjects were randomly assigned to 3 groups (HemoHIM 6g/day, HemoHIM 12g/day, Placebo). HemoHIM or placebo were adminstered for 2 months and the blood were collected and analyzed at 1 month and 2 month after the intake. The collected blood was analyzed for blood cell number, serum biochemical values (liver and kidney function), immunological activity of blood cells, antioxidant activity of blood plasma, and stress hormone level in the saliva. Finally the data of 88 subjects were analyzed for the immune promoting and antioxidant effects of HemoHIM. In results, no significant changes in blood cell numbers (white blood cell, lymphocyte, red blood cell) were observed in HemoHIM intake groups. However, NK cell activity were increased in HemoHIM intake groups and also IFN-gamma and IL-12, the biomarkers of immune cell functions, were increased in proportion to the dose and intake periode of HemoHIM. The antioxidant biomarker (TAS) was not significantly changed by HemoHIM intake. Besides, the serum biochemical analysis for liver and kidney functions, and the general medical examination showed the HemoHIM showed no side-effects, thus reconfirming its safety in humans. In conclusion, this study showed HemoHIM has a significant effects on the promotion of immune functions, while it has neither side-effects nor toxicity in humans. The results of this study may be utilized for the scientific data to acquire the Health Functional Food Certification of HemoHIM from Korea FDA

  13. Streptavidin-functionalized capillary immune microreactor for highly efficient chemiluminescent immunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Yang Zhanjun [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); College of Chemistry and Engineering, Yangzhou University, 88 South University Avenue, Yangzhou 225002 (China); Zong Chen [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Ju Huangxian, E-mail: hxju@nju.edu.cn [State Key Laboratory of Analytical Chemistry for Life Science, Department of Chemistry, Nanjing University, Nanjing 210093 (China); Yan Feng, E-mail: yanfeng2007@sohu.com [Jiangsu Institute of Cancer Prevention and Cure, Nanjing 210009 (China)

    2011-11-07

    Highlights: {yields} A novel capillary immune microreactor was proposed for highly efficient flow-through chemiluminescent immunoassay. {yields} The microreactor was prepared by functionalizing capillary inner wall with streptavidin for capture of biotinylated antibody. {yields} The proposed immunoassay method showed wide dynamic range, good reproducibility, stability and practicality. {yields} The microreactor was low-cost and disposable, and possessed several advantages over the conventional immunoreactors. - Abstract: A streptavidin functionalized capillary immune microreactor was designed for highly efficient flow-through chemiluminescent (CL) immunoassay. The functionalized capillary could be used as both a support for highly efficient immobilization of antibody and a flow cell for flow-through immunoassay. The functionalized inner wall and the capture process were characterized using scanning electron microscopy. Compared to conventional packed tube or thin-layer cell immunoreactor, the proposed microreactor showed remarkable properties such as lower cost, simpler fabrication, better practicality and wider dynamic range for fast CL immunoassay with good reproducibility and stability. Using {alpha}-fetoprotein as model analyte, the highly efficient CL flow-through immunoassay system showed a linear range of 3 orders of magnitude from 0.5 to 200 ng mL{sup -1} and a low detection limit of 0.1 ng mL{sup -1}. The capillary immune microreactor could make up the shortcoming of conventional CL immunoreactors and provided a promising alternative for highly efficient flow-injection immunoassay.

  14. Respiratory functions in asthmatic and normal women during different phases of menstrual cycle

    International Nuclear Information System (INIS)

    Arora, D.B.; Sandhu, P.K.; Dhillon, S.; Arora, A.

    2015-01-01

    Menstrual cycle is an integral part of life of women. There is widespread agreement that changes in the levels of oestrogen and progesterone associated with menstrual cycle also affect different systems of the body besides reproductive system. Levels of oestrogen and progesterone are maximum in the secretory phase and minimum just before the menstruation .Bronchial asthma is one of the commonest chronic respiratory diseases. Premenstrual worsening of asthma symptoms has been reported to affect 33-40% of asthmatic women. This exacerbation of asthma symptoms has been correlated with the oestrogen and progesterone levels. The association between menstrual cycle and lung functions in normal females has also been recognised. The pathophysiology of this process is still not proved. The purpose of our study was to confirm the probable effects of the female hormones on lung functions in normal and asthmatic women in different phases of menstrual cycle and to compare them. Methods: The study was done on 40 normal and 40 asthmatic females in the age group of 15-45 years. Pulmonary function tests were done in three phases of menstrual cycle i.e. follicular, secretory and menstrual in all the subjects. Results: The mean value of lung functions, i.e., FVC, FEV, PEFR, FEF25-75%, FEF 200-1200 were significantly lower in asthmatic females than normal ones (p<0.01) in all three phases. The lung functions of both asthmatic and non-asthmatic females in secretory phase were significantly higher than in menstrual phase (p<0.005). The PFTs in menstrual phase were even lower than the follicular phase (p<0.04). Conclusion: Respiratory parameters of both asthmatic and non-asthmatic women in reproductive age group show significant variation in different phases of menstrual cycle. The smooth muscle relaxant effect of progesterone and probably oestrogen might have contributed to it. The lung function parameters in asthmatics were of lower value compared to normal women. (author)

  15. Effects of stress on immune function: the good, the bad, and the beautiful.

    Science.gov (United States)

    Dhabhar, Firdaus S

    2014-05-01

    Although the concept of stress has earned a bad reputation, it is important to recognize that the adaptive purpose of a physiological stress response is to promote survival during fight or flight. While long-term stress is generally harmful, short-term stress can be protective as it prepares the organism to deal with challenges. This review discusses the immune effects of biological stress responses that can be induced by psychological, physiological, or physical (including exercise) stressors. We have proposed that short-term stress is one of the nature's fundamental but under-appreciated survival mechanisms that could be clinically harnessed to enhance immunoprotection. Short-term (i.e., lasting for minutes to hours) stress experienced during immune activation enhances innate/primary and adaptive/secondary immune responses. Mechanisms of immuno-enhancement include changes in dendritic cell, neutrophil, macrophage, and lymphocyte trafficking, maturation, and function as well as local and systemic production of cytokines. In contrast, long-term stress suppresses or dysregulates innate and adaptive immune responses by altering the Type 1-Type 2 cytokine balance, inducing low-grade chronic inflammation, and suppressing numbers, trafficking, and function of immunoprotective cells. Chronic stress may also increase susceptibility to some types of cancer by suppressing Type 1 cytokines and protective T cells and increasing regulatory/suppressor T cell function. Here, we classify immune responses as being protective, pathological, or regulatory, and discuss "good" versus "bad" effects of stress on health. Thus, short-term stress can enhance the acquisition and/or expression of immunoprotective (wound healing, vaccination, anti-infectious agent, anti-tumor) or immuno-pathological (pro-inflammatory, autoimmune) responses. In contrast, chronic stress can suppress protective immune responses and/or exacerbate pathological immune responses. Studies such as the ones discussed

  16. Associations between immune function and air pollution among postmenopausal women living in the Puget Sound airshed

    Science.gov (United States)

    Williams, Lori A.

    Air pollution is associated with adverse health outcomes, and changes in the immune system may be intermediate steps between exposure and a clinically relevant adverse health outcome. We analyzed the associations between three different types of measures of air pollution exposure and five biomarkers of immune function among 115 overweight and obese postmenopausal women whose immunity was assessed as part of a year-long moderate exercise intervention trial. For air pollution metrics, we assessed: (1) residential proximity to major roads (freeways, major arterials and truck routes), (2) fine particulate matter(PM2.5) at the nearest monitor to the residence averaged over three time windows (3-days, 30-days and 60-days), and (3) nitrogen dioxide (NO2) modeled based on land use characteristics. Our immune biomarkers included three measures of inflammation---C-reactive protein, serum amyloid A and interleukin-6---and two measures of cellular immunity---natural killer cell cytotoxicity and T lymphocyte proliferation. We hypothesized that living near a major road, increased exposure to PM2.5 and increased exposure to NO2 would each be independently associated with increased inflammation and decreased immune function. We observed a 21% lower average natural killer cell cytotoxicity among women living within 150 meters of a major arterial road compared to other women. For PM2.5 , we observed changes in 3 of 4 indicators of lymphocyte proliferation stimulated by anti-CD3---an antibody to the T cell receptor associated with increases in 3-day averaged PM2.5. For 30-day averaged PM 2.5 and 60-day averaged PM2.5 we did not observe any statistically significant associations. We observed an increase in lymphocyte proliferation index stimulated by the plant protein phytohemagglutinin (PHA) at 1 of 2 PHA concentrations in association with modeled NO2. For the three inflammatory markers, we observed no notable associations with any of our measures of air pollution. If confirmed, our

  17. Green's functions for a graphene sheet and quantum dot in a normal magnetic field

    International Nuclear Information System (INIS)

    Horing, Norman J Morgenstern; Liu, S Y

    2009-01-01

    This paper is concerned with the derivation of the retarded Green's function for a two-dimensional graphene layer in a perpendicular magnetic field in two explicit, analytic forms, which we employ in obtaining a closed-form solution for the Green's function of a tightly confined magnetized graphene quantum dot. The dot is represented by a δ (2) (r)-potential well and the system is subject to Landau quantization in the normal magnetic field

  18. Psychosocial Functioning of Adult Epileptic and MS Patients and Adult Normal Controls on the WPSI.

    Science.gov (United States)

    Tan, Siang-Yang

    1986-01-01

    Psychosocial functioning of adult epileptic outpatients as assessed by the Washington Psychosocial Seizure Inventory (WPSI) was compared to that of adult multiple sclerosis (MS) outpatients and normal subjects. When only valid WPSI profiles were considered, the only significant finding was that the epilepsy group and the MS group had more…

  19. A study of the up-and-down method for non-normal distribution functions

    DEFF Research Database (Denmark)

    Vibholm, Svend; Thyregod, Poul

    1988-01-01

    The assessment of breakdown probabilities is examined by the up-and-down method. The exact maximum-likelihood estimates for a number of response patterns are calculated for three different distribution functions and are compared with the estimates corresponding to the normal distribution. Estimates...

  20. Connection between Dynamically Derived Initial Mass Function Normalization and Stellar Population Parameters

    NARCIS (Netherlands)

    McDermid, Richard M.; Cappellari, Michele; Alatalo, Katherine; Bayet, Estelle; Blitz, Leo; Bois, Maxime; Bournaud, Frédéric; Bureau, Martin; Crocker, Alison F.; Davies, Roger L.; Davis, Timothy A.; de Zeeuw, P. T.; Duc, Pierre-Alain; Emsellem, Eric; Khochfar, Sadegh; Krajnović, Davor; Kuntschner, Harald; Morganti, Raffaella; Naab, Thorsten; Oosterloo, Tom; Sarzi, Marc; Scott, Nicholas; Serra, Paolo; Weijmans, Anne-Marie; Young, Lisa M.

    We report on empirical trends between the dynamically determined stellar initial mass function (IMF) and stellar population properties for a complete, volume-limited sample of 260 early-type galaxies from the ATLAS3D project. We study trends between our dynamically derived IMF normalization αdyn ≡

  1. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-01-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions

  2. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  3. Effect of liniment levamisole on cellular immune functions of patients with chronic hepatitis B.

    Science.gov (United States)

    Wang, Ke-Xia; Zhang, Li-Hua; Peng, Jiang-Long; Liang, Yong; Wang, Xue-Feng; Zhi, Hui; Wang, Xiang-Xia; Geng, Huan-Xiong

    2005-12-07

    To explore the effects of liniment levamisole on cellular immune functions of patients with chronic hepatitis B. The levels of T lymphocyte subsets and mIL-2R in peripheral blood mononuclear cells (PBMCs) were measured by biotin-streptavidin (BSA) technique in patients with chronic hepatitis B before and after the treatment with liniment levamisole. After one course of treatment with liniment levamisole, the levels of CD3(+), CD4(+), and the ratio of CD4(+)/CD8(+) increased as compared to those before the treatment but the level of CD8(+) decreased. The total expression level of mIL-2R in PBMCs increased before and after the treatment with liniment levamisole. Liniment levamisole may reinforce cellular immune functions of patients with chronic hepatitis B.

  4. Changes in proHB-EGF expression after functional activation of the immune system cells

    Directory of Open Access Journals (Sweden)

    T. O. Chudina

    2017-12-01

    Full Text Available The level of proHB-EGF expression on J774, Raji, KG-1 cells derived from different types of human and mouse immune system cells under the standard in vitro culture conditions and during functional activation of these cells was investigated. Changes in the proHB-EGF expression on the cell surface were found to depend on the density of cell population, the content of fetal bovine serum in the culture medium, the effect of mitogenic factors – bacterial lipopolysaccharide, an inactive full-size form of diphtheria toxin (CRM197 and recombinant soluble HB-EGF – rsHB-EGF. The results obtained are important for the understanding of the functional role of proHB-EGF receptor on the surface of macrophage-like cells and B lymphocytes and indicate the involvement of this receptor in immune response regulation in an organism.

  5. The effects of low dose radiation (LDR) on mice of immune function

    International Nuclear Information System (INIS)

    Feng Li; Deng Daping

    2007-01-01

    Objective: To find out the Effects of Low Dose Radiation(LDR) on mice of immune function. Methods: Through flow cytometry to observe and analyse the effects of the leukomonocyte. Through immunohistochemistry to study IL-2, TNF-α. Results: At dose of 100mGy the stimulative effect on CD 4 + cells, CD 8 + cells and NK activity was higher than that at other doses. At dose of 500mGy leukomonocyte activity was lower. At dose of 100mGy, the colorations about IL-2, TNF-α deepen. Conclusion: LDR could stimulate immune function, especially at dose of 100mGy. while at dose of 500mGy, radiation could restrain the leukomonocyte activity. (authors)

  6. Normalization of voltage-sensitive dye signal with functional activity measures.

    Directory of Open Access Journals (Sweden)

    Kentaroh Takagaki

    Full Text Available In general, signal amplitude in optical imaging is normalized using the well-established DeltaF/F method, where functional activity is divided by the total fluorescent light flux. This measure is used both directly, as a measure of population activity, and indirectly, to quantify spatial and spatiotemporal activity patterns. Despite its ubiquitous use, the stability and accuracy of this measure has not been validated for voltage-sensitive dye imaging of mammalian neocortex in vivo. In this report, we find that this normalization can introduce dynamic biases. In particular, the DeltaF/F is influenced by dye staining quality, and the ratio is also unstable over the course of experiments. As methods to record and analyze optical imaging signals become more precise, such biases can have an increasingly pernicious impact on the accuracy of findings, especially in the comparison of cytoarchitechtonic areas, in area-of-activation measurements, and in plasticity or developmental experiments. These dynamic biases of the DeltaF/F method may, to an extent, be mitigated by a novel method of normalization, DeltaF/DeltaF(epileptiform. This normalization uses as a reference the measured activity of epileptiform spikes elicited by global disinhibition with bicuculline methiodide. Since this normalization is based on a functional measure, i.e. the signal amplitude of "hypersynchronized" bursts of activity in the cortical network, it is less influenced by staining of non-functional elements. We demonstrate that such a functional measure can better represent the amplitude of population mass action, and discuss alternative functional normalizations based on the amplitude of synchronized spontaneous sleep-like activity. These findings demonstrate that the traditional DeltaF/F normalization of voltage-sensitive dye signals can introduce pernicious inaccuracies in the quantification of neural population activity. They further suggest that normalization

  7. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Exercise Improves Immune Function, Antidepressive Response, and Sleep Quality in Patients with Chronic Primary Insomnia

    OpenAIRE

    Passos, Giselle Soares; Poyares, Dalva; Santana, Marcos Gonçalves; Teixeira, Alexandre Abílio de Souza; Lira, Fábio Santos; Youngstedt, Shawn D.; dos Santos, Ronaldo Vagner Thomatieli; Tufik, Sergio; de Mello, Marco Túlio

    2014-01-01

    The aim of this study was to evaluate the effects of moderate aerobic exercise training on sleep, depression, cortisol, and markers of immune function in patients with chronic primary insomnia. Twenty-one sedentary participants (16 women aged 44.7 +/- 9 years) with chronic primary insomnia completed a 4-month intervention of moderate aerobic exercise. Compared with baseline, polysomnographic data showed improvements following exercise training. Also observed were reductions in depression symp...

  9. Guidance on the scientific requirements for health claims related to gut and immune function

    DEFF Research Database (Denmark)

    Tetens, Inge

    2011-01-01

    The European Food Safety Authority (EFSA) asked the Panel on Dietetic Products Nutrition and Allergies (NDA) to draft guidance on scientific requirements for health claims related to gut and immune function. This guidance has been drawn from scientific opinions of the NDA Panel on such health......, was subjected to public consultation (28 September 2010 to 22 October 2010), and was also discussed at a technical meeting with experts in the field on 2 December 2010 in Amsterdam....

  10. The Influence of histamine H1-receptor on liver functions in immunized rabbits.

    Science.gov (United States)

    Tripathi, Trivendra; Shahid, Mohammad; Khan, Haris M; Khan, Rahat Ali; Siddiqui, Mashiatullah; Mahdi, Abbas Ali

    2011-10-01

    This study was designed to investigate the functional roles of histamine and histamine H1-receptor agonist and antagonist in the development of liver function impairment in immunized rabbits. The study comprised of six groups containing 18 rabbits each. Group III-VI received histamine (100 μg/kg, s.c.), H1R-agonist (HTMT, 10 μg/kg, s.c.), H1R-antagonist (pheniramine, 10 mg/kg, i.m.), and H1R-antagonist (pheniramine, 10 mg/kg, i.m.) plus histamine (100 μg/kg, s.c.), respectively, b.i.d. for 10 days. Group I (negative control) and group II (positive control) received sterile distilled water intramuscularly b.i.d. for 10 days. Groups II-VI were immunized on day 3 with intravenous injection of SRBC (1 × 10(9) cells/ml). Blood samples were collected on pre-immunization day 0, as well as on days 7-, 14-, 21-, 28-, and 58-post-immunization. Biochemical parameters AST, ALT, alkaline phosphatase and bilirubin [total bilirubin (TB), direct bilirubin (DB), and indirect bilirubin (IB)] were determined. On each experimental day, the mean values of serum enzymes and bilirubin in group I and group II showed no significant changes while in group III, IV, V, and VI, these enzymes and bilirubin levels showed significant changes (p pheniramine, and combination of histamine + pheniramine cause hepatic function impairment in terms of altered serum enzymes and bilirubin levels. The present findings suggest that HTMT causes moderate liver function impairment while others show mild impairment.

  11. Functional evaluation of HMGB1 as immune therapeutic effector molecule for cell-based vaccination strategies

    OpenAIRE

    Willenbrock, Saskia

    2013-01-01

    Cancer is a leading cause of death worldwide although extensive research in human cancer medicine is carried out. To develop and improve molecular anticancer therapies, the characterisation of the structure and function of cancer-related genes and proteins is essential. The dog is one of the companion animals being considered as an invaluable model system. The spontaneous development of tumours in the context of an intact immune system in dogs and the striking similarities to human neoplasias...

  12. Effects of psycho-behavioral interventions on immune functioning in cancer patients: a systematic review.

    Science.gov (United States)

    Tong, Guixian; Geng, Qingqing; Cheng, Jing; Chai, Jing; Xia, Yi; Feng, Rui; Zhang, Lu; Wang, Debin

    2014-01-01

    This study aimed at summarizing evidence about effects of psycho-behavioral interventions (PBIs) on immune responses among cancer patients and analyzing quality of published studies so as to inform future researches. Literature retrieval utilized both highly inclusive algorithms searching randomized controlled studies published in English and Chinese and manual searching of eligible studies from references of relevant review papers. Two researchers examined the articles selected separately and extracted the information using a pre-designed form for soliciting data about the trials (e.g., sample size, disease status, intervention, immune responses) and quality ratings of the studies. Both narrative descriptions and meta-analysis (via Review manager 5) were used synthesizing the effects of PBIs on immune responses among cancer patients and state of art of the researches in this area. Seventy-six RCTs met inclusion criteria. PBIs implemented were divided into three major categories including psychological state adjustment, physical activity and dietary modification. Immune indicators measured included CD4+ cells, CD8+ cells, CD4/CDC8+ ratio, CD3+ cells, NK cell activity, etc. Effects of PBIs on immune responses documented in individual papers were mixed and pooled analysis of CD4+ cells, CD4+/CD8+ ratio, CD3+ cells, NKCA, IgG, IgM and IL-2 showed modest effects. However, there were huge discrepancies in intervention effects between studies published in English and Chinese and the results should be interpreted with caution. Besides, most studies suffer from some quality flaws concerning blinding, randomization procedures, compliance, attrition and intention-to-treat analyses, etc. Although there are considerable evidences of PBI effects on some immune indicators, the effect sizes are modest and it is still premature to conclude whether PBIs have effects on immune functions among cancer patients. There is a clear need for much more rigorous efforts in this area

  13. Effects of microbial aerosol in poultry house on meat ducks’ immune function

    Directory of Open Access Journals (Sweden)

    Guanliu YU

    2016-08-01

    Full Text Available The aim of this study was to evaluate effects of microbial aerosols on immune function of ducks and shed light on the establishment of microbial aerosol concentration standards for poultry. A total of 1800 1-d-old Cherry Valley ducks were randomly divided into 5 groups (A, B, C, D and E with 360 ducks in each. To obtain objective data, each group had three replications. Concentrations of airborne bacteria, fungi, endotoxin in different groups were created by controlling ventilation and bedding cleaning frequency. Group A was the control group and hygienic conditions deteriorated progressively from group B to E. A 6-stage Andersen impactor was used to detect the aerosol concentration of aerobes, gram-negative bacteria, fungi and AGI-30 microbial air sampler detect the endotoxin, and Composite Gas Detector detect the noxious gas. In order to assess the immune function of meat ducks, immune indicators including H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes were evaluated. Correlation coefficients were also calculated to evaluate the relationships among airborne bacteria, fungi, endotoxin and immune indicators. The results showed that the concentration of airborne aerobe, gram-negative bacteria, fungi, endotoxin have a strong correlation to H5 AIV antibody titer, IgG, IL-2, T-lymphocyte transformation rate, lysozyme and immune organ indexes, respectively. In addition, when the concentration of microbial aerosol reach the level of group D, serum IgG (6 - 8 weeks, lysozyme (4 week were significantly higher than in group A (P < 0.05; serum IL-2 (7 and 8 weeks , T-lymphocyte transformation rate, lysozyme (7 and 8 weeks, spleen index (6 and 8 weeks and bursa index (8 week were significantly lower than in group A(P < 0.05 or P < 0.01. The results indicated that a high level of microbial aerosol adversely affected the immune level of meat ducks. The microbial aerosol values in group D provide a basis

  14. Effects of rearing temperature on immune functions in sockeye salmon (Oncorhynchus nerka)

    Science.gov (United States)

    Alcorn, S.W.; Murray, A.L.; Pascho, R.J.

    2002-01-01

    To determine if the defences of sockeye salmon (Oncorhynchus nerka) raised in captivity are affected by the rearing temperature or their life-cycle stage, various indices of the humoral and cellular immune functions were measured in fish reared at either 8 or 12??C for their entire life-cycle. Measures of humoral immunity included the commonly used haematological parameters, as well as measurements of complement, and lysozyme activity. Cellular assays quantified the ability of macrophages from the anterior kidney to phagocytise Staphylococcus aureus cells, or the activities of certain bactericidal systems of those cells. The T-dependent antibody response to a recombinant 57 kDa protein of Renibacterium salmoninarum was used to quantify the specific immune response. Fish were sampled during the spring and fall of their second, third and fourth years, corresponding to a period that began just before smolting and ended at sexual maturation. Fish reared at 8??C tended to have a greater percentage of phagocytic kidney macrophages during the first 2 years of sampling than the fish reared at 12??C. During the last half of the study the complement activity of the fish reared at 8??C was greater than that of the 12??C fish. Conversely, a greater proportion of the blood leucocytes were lymphocytes in fish reared at 12??C compared to the fish reared at 8??C. Fish reared at 12??C also produced a greater antibody response than those reared at 8??C. Results suggested that the immune apparatus of sockeye salmon reared at 8??C relied more heavily on the non-specific immune response, while the specific immune response was used to a greater extent when the fish were reared at 12??C. Although a seasonal effect was not detected in any of the indices measured, varying effects were observed in some measurements during sexual maturation of fish in both temperature groups. At that time there were dramatic decreases in complement activity and lymphocyte numbers. This study was unique in

  15. [Effects of electromagnetic radiation on health and immune function of operators].

    Science.gov (United States)

    Li, Yan-zhong; Chen, Shao-hua; Zhao, Ke-fu; Gui, Yun; Fang, Si-xin; Xu, Ying; Ma, Zi-jian

    2013-08-01

    To investigate the effects of electromagnetic radiation on the physiological indices and immune function of operators. The general conditions and electromagnetic radiation awareness rate of 205 operators under electromagnetic radiation were evaluated using a self-designed questionnaire. Physical examination, electrocardiography, and routine urine test were performed in these operators. Peripheral blood was collected from the operators under electromagnetic radiation for blood cell counting and biochemical testing, and their peripheral blood lymphocytes were cultured for determination of chromosomal aberrant frequency and micronucleus frequency. The data from these operators (exposure group) were compared with those of 95 ordinary individuals (control group). The chief complaint of giddiness, tiredness, dizziness, and amnesia showed significant differences between the exposure group and control group (P electromagnetic radiation damage was significantly higher in the exposure group than in the control group. The difference in bradycardia was significant between the two groups (P Electromagnetic radiation may lead to the changes in physiological indices, genetic effects, and immune function and affect the health and immune function in operators. The adverse effects are increased as the working years increase. So it is important to strengthen occupational protection of operators under electromagnetic radiation.

  16. Comprehensive proteome analysis of lysosomes reveals the diverse function of macrophages in immune responses.

    Science.gov (United States)

    Gao, Yanpan; Chen, Yanyu; Zhan, Shaohua; Zhang, Wenhao; Xiong, Feng; Ge, Wei

    2017-01-31

    Phagocytosis and autophagy in macrophages have been shown to be essential to both innate and adaptive immunity. Lysosomes are the main catabolic subcellular organelles responsible for degradation and recycling of both extracellular and intracellular material, which are the final steps in phagocytosis and autophagy. However, the molecular mechanisms underlying lysosomal functions after infection remain obscure. In this study, we conducted a quantitative proteomics analysis of the changes in constitution and glycosylation of proteins in lysosomes derived from murine RAW 264.7 macrophage cells treated with different types of pathogens comprising examples of bacteria (Listeria monocytogenes, L. m), DNA viruses (herpes simplex virus type-1, HSV-1) and RNA viruses (vesicular stomatitis virus, VSV). In total, 3,704 lysosome-related proteins and 300 potential glycosylation sites on 193 proteins were identified. Comparative analysis showed that the aforementioned pathogens induced distinct alterations in the proteome of the lysosome, which is closely associated with the immune functions of macrophages, such as toll-like receptor activation, inflammation and antigen-presentation. The most significant changes in proteins and fluctuations in glycosylation were also determined. Furthermore, Western blot analysis showed that the changes in expression of these proteins were undetectable at the whole cell level. Thus, our study provides unique insights into the function of lysosomes in macrophage activation and immune responses.

  17. Complex multicellular functions at a unicellular eukaryote level: Learning, memory, and immunity.

    Science.gov (United States)

    Csaba, György

    2017-06-01

    According to experimental data, eukaryote unicellulars are able to learn, have immunity and memory. Learning is carried out in a very primitive form, and the memory is not neural but an epigenetic one. However, this epigenetic memory, which is well justified by the presence and manifestation of hormonal imprinting, is strong and permanent in the life of cell and also in its progenies. This memory is epigenetically executed by the alteration and fixation of methylation pattern of genes without changes in base sequences. The immunity of unicellulars is based on self/non-self discrimination, which leads to the destruction of non-self invaders and utilization of them as nourishment (by phagocytosis). The tools of learning, memory, and immunity of unicellulars are uniformly found in plasma membrane receptors, which formed under the effect of dynamic receptor pattern generation, suggested by Koch et al., and this is the basis of hormonal imprinting, by which the encounter between a chemical substance and the cell is specifically memorized. The receptors and imprinting are also used in the later steps of evolution up to mammals (including man) in each mentioned functions. This means that learning, memory, and immunity can be deduced to a unicellular eukaryote level.

  18. The Role of TAM Family Receptors in Immune Cell Function: Implications for Cancer Therapy.

    Science.gov (United States)

    Paolino, Magdalena; Penninger, Josef M

    2016-10-21

    The TAM receptor protein tyrosine kinases-Tyro3, Axl, and Mer-are essential regulators of immune homeostasis. Guided by their cognate ligands Growth arrest-specific gene 6 (Gas6) and Protein S (Pros1), these receptors ensure the resolution of inflammation by dampening the activation of innate cells as well as by restoring tissue function through promotion of tissue repair and clearance of apoptotic cells. Their central role as negative immune regulators is highlighted by the fact that deregulation of TAM signaling has been linked to the pathogenesis of autoimmune, inflammatory, and infectious diseases. Importantly, TAM receptors have also been associated with cancer development and progression. In a cancer setting, TAM receptors have a dual regulatory role, controlling the initiation and progression of tumor development and, at the same time, the associated anti-tumor responses of diverse immune cells. Thus, modulation of TAM receptors has emerged as a potential novel strategy for cancer treatment. In this review, we discuss our current understanding of how TAM receptors control immunity, with a particular focus on the regulation of anti-tumor responses and its implications for cancer immunotherapy.

  19. Understanding how commensal obligate anaerobic bacteria regulate immune functions in the large intestine.

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C; Roy, Nicole C

    2014-12-24

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases.

  20. Understanding How Commensal Obligate Anaerobic Bacteria Regulate Immune Functions in the Large Intestine

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C.; Roy, Nicole C.

    2014-01-01

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases. PMID:25545102

  1. Pore size determination using normalized J-function for different hydraulic flow units

    Directory of Open Access Journals (Sweden)

    Ali Abedini

    2015-06-01

    Full Text Available Pore size determination of hydrocarbon reservoirs is one of the main challenging areas in reservoir studies. Precise estimation of this parameter leads to enhance the reservoir simulation, process evaluation, and further forecasting of reservoir behavior. Hence, it is of great importance to estimate the pore size of reservoir rocks with an appropriate accuracy. In the present study, a modified J-function was developed and applied to determine the pore radius in one of the hydrocarbon reservoir rocks located in the Middle East. The capillary pressure data vs. water saturation (Pc–Sw as well as routine reservoir core analysis include porosity (φ and permeability (k were used to develop the J-function. First, the normalized porosity (φz, the rock quality index (RQI, and the flow zone indicator (FZI concepts were used to categorize all data into discrete hydraulic flow units (HFU containing unique pore geometry and bedding characteristics. Thereafter, the modified J-function was used to normalize all capillary pressure curves corresponding to each of predetermined HFU. The results showed that the reservoir rock was classified into five separate rock types with the definite HFU and reservoir pore geometry. Eventually, the pore radius for each of these HFUs was determined using a developed equation obtained by normalized J-function corresponding to each HFU. The proposed equation is a function of reservoir rock characteristics including φz, FZI, lithology index (J*, and pore size distribution index (ɛ. This methodology used, the reservoir under study was classified into five discrete HFU with unique equations for permeability, normalized J-function and pore size. The proposed technique is able to apply on any reservoir to determine the pore size of the reservoir rock, specially the one with high range of heterogeneity in the reservoir rock properties.

  2. Detection of rheumatoid arthritis by evaluation of normalized variances of fluorescence time correlation functions

    Science.gov (United States)

    Dziekan, Thomas; Weissbach, Carmen; Voigt, Jan; Ebert, Bernd; MacDonald, Rainer; Bahner, Malte L.; Mahler, Marianne; Schirner, Michael; Berliner, Michael; Berliner, Birgitt; Osel, Jens; Osel, Ilka

    2011-07-01

    Fluorescence imaging using the dye indocyanine green as a contrast agent was investigated in a prospective clinical study for the detection of rheumatoid arthritis. Normalized variances of correlated time series of fluorescence intensities describing the bolus kinetics of the contrast agent in certain regions of interest were analyzed to differentiate healthy from inflamed finger joints. These values are determined using a robust, parameter-free algorithm. We found that the normalized variance of correlation functions improves the differentiation between healthy joints of volunteers and joints with rheumatoid arthritis of patients by about 10% compared to, e.g., ratios of areas under the curves of raw data.

  3. Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints.

    Science.gov (United States)

    Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

    2015-06-01

    Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system-with its capacity for memory, exquisite specificity and central and universal role in human biology-immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer.

  4. Understanding the function and dysfunction of the immune system in lung cancer: the role of immune checkpoints

    International Nuclear Information System (INIS)

    Karachaliou, Niki; Cao, Maria Gonzalez; Teixidó, Cristina; Viteri, Santiago; Morales-Espinosa, Daniela; Santarpia, Mariacarmela; Rosell, Rafael

    2015-01-01

    Survival rates for metastatic lung cancer, including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), are poor with 5-year survivals of less than 5%. The immune system has an intricate and complex relationship with tumorigenesis; a groundswell of research on the immune system is leading to greater understanding of how cancer progresses and presenting new ways to halt disease progress. Due to the extraordinary power of the immune system—with its capacity for memory, exquisite specificity and central and universal role in human biology—immunotherapy has the potential to achieve complete, long-lasting remissions and cures, with few side effects for any cancer patient, regardless of cancer type. As a result, a range of cancer therapies are under development that work by turning our own immune cells against tumors. However deeper understanding of the complexity of immunomodulation by tumors is key to the development of effective immunotherapies, especially in lung cancer

  5. Metabolites related to renal function, immune activation, and carbamylation are associated with muscle composition in older adults.

    Science.gov (United States)

    Lustgarten, Michael S; Fielding, Roger A

    2017-12-15

    Reduced skeletal muscle density in older adults is associated with insulin resistance, decreased physical function, and an increased all-cause mortality risk. To elucidate mechanisms that may underlie the maintenance of skeletal muscle density, we conducted a secondary analysis of previously published muscle composition and serum metabolomic data in 73 older adults (average age, 78y). Multivariable-adjusted linear regression was used to examine associations between 321 metabolites with muscle composition, defined as the ratio between normal density (NDM) with low density (LDM) thigh muscle cross sectional area (NDM/LDM). Sixty metabolites were significantly (p≤0.05 and qMetabolites that were significantly associated with muscle composition were then tested for their association with circulating markers of renal function (blood urea nitrogen, creatinine, uric acid), and with the immune response (neutrophils/lymphocytes) and activation (kynurenine/tryptophan). 43 significant NDM/LDM metabolites (including urea) were co-associated with at least 1 marker of renal function; 23 of these metabolites have been previously identified as uremic solutes. The neutrophil/lymphocyte ratio was significantly associated with NDM/LDM (β±SE: -0.3±0.1, p=0.01, q=0.04). 35 significant NDM/LDM metabolites were co-associated with immune activation. Carbamylation (defined as homocitrulline/lysine) was identified as a pathway that may link renal function and immune activation with muscle composition, as 29 significant NDM/LDM metabolites were co-associated with homocitrulline/lysine, with at least 2 markers of renal function, and with kynurenine/tryptophan. When considering that elevated urea and uremic metabolites have been linked with an increased systemic microbial burden, that antimicrobial defense can be reduced in the presence of carbamylation, and that adipocytes can promote host defense, we propose the novel hypothesis that the age-related increase in adipogenesis within muscle

  6. [Induction of glutathione and activation of immune functions by low-dose, whole-body irradiation with gamma-rays].

    Science.gov (United States)

    Kojima, Shuji

    2006-10-01

    We first examined the relation between the induction of glutathione and immune functions in mice after low-dose gamma-ray irradiation. Thereafter, inhibition of tumor growth by radiation was confirmed in Ehrlich solid tumor (EST)-bearing mice. The total glutathione level of the splenocytes transiently increased soon after irradiation and reached a maximum at around 4 h postirradiation. Thereafter, the level reverted to the 0 h value by 24 h postirradiation. A significantly high splenocyte proliferative response was also recognized 4 h postirradiation. Natural killer (NK) activity was also increased significantly in a similar manner. The time at which the response reached the maximum coincided well with that of maximum total glutathione levels of the splenocytes in the gamma-ray-irradiated mice. Reduced glutathione exogenously added to splenocytes obtained from normal mice enhanced the proliferative response and NK activity in a dose-dependent manner. The inhibitory effects of radiation on tumor growth was then examined in EST-bearing mice. Repeated low-dose irradiation (0.5 Gy, four times, before and within an early time after inoculation) significantly delayed the tumor growth. Finally, the effect of single low-dose (0.5 Gy), whole-body gamma-ray irradiation on immune balance was examined to elucidate the mechanism underlying the antitumor immunity. The percentage of B cells in blood lymphocytes was selectively decreased after radiation, concomitant with an increase in that of the helper T cell population. The IFN-gamma level in splenocyte culture prepared from EST-bearing mice was significantly increased 48 h after radiation, although the level of IL-4 was unchanged. IL-12 secretion from macrophages was also enhanced by radiation. These results suggest that low-dose gamma-rays induce Th1 polarization and enhance the activities of tumoricidal effector cells, leading to an inhibition of tumor growth.

  7. Novel Approach to Design Ultra Wideband Microwave Amplifiers: Normalized Gain Function Method

    Directory of Open Access Journals (Sweden)

    R. Kopru

    2013-09-01

    Full Text Available In this work, we propose a novel approach called as “Normalized Gain Function (NGF method” to design low/medium power single stage ultra wide band microwave amplifiers based on linear S parameters of the active device. Normalized Gain Function TNGF is defined as the ratio of T and |S21|^2, desired shape or frequency response of the gain function of the amplifier to be designed and the shape of the transistor forward gain function, respectively. Synthesis of input/output matching networks (IMN/OMN of the amplifier requires mathematically generated target gain functions to be tracked in two different nonlinear optimization processes. In this manner, NGF not only facilitates a mathematical base to share the amplifier gain function into such two distinct target gain functions, but also allows their precise computation in terms of TNGF=T/|S21|^2 at the very beginning of the design. The particular amplifier presented as the design example operates over 800-5200 MHz to target GSM, UMTS, Wi-Fi and WiMAX applications. An SRFT (Simplified Real Frequency Technique based design example supported by simulations in MWO (MicroWave Office from AWR Corporation is given using a 1400mW pHEMT transistor, TGF2021-01 from TriQuint Semiconductor.

  8. Arabidopsis MKS1 is involved in basal immunity and requires an intact N-terminal domain for proper function

    DEFF Research Database (Denmark)

    Petersen, Klaus; Qiu, Jin-Long; Lütje, Juri

    2010-01-01

    Innate immune signaling pathways in animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. MAP kinase 4 (MPK4) functions downstream of innate immune receptors via a nuclear substrate MKS1 to regulate the activity of the WRKY33 transcription factor, which in turn...

  9. Indices of immune function used by ecologists are mostly unaffected by repeated freeze-thaw cycles and methodological deviations

    NARCIS (Netherlands)

    Hegemann, Arne; Pardal, Sara; Matson, Kevin D.

    2017-01-01

    Background
    Over the past couple of decades, measuring immunological parameters has become widespread in studies of ecology and evolution. A combination of different immunological indices is useful for quantifying different parts of the immune system and comprehensively assessing immune function.

  10. Retinoic Acid-Related Orphan Receptors (RORs): Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism

    Science.gov (United States)

    Cook, Donald N.; Kang, Hong Soon; Jetten, Anton M.

    2015-01-01

    In this overview, we provide an update on recent progress made in understanding the mechanisms of action, physiological functions, and roles in disease of retinoic acid related orphan receptors (RORs). We are particularly focusing on their roles in the regulation of adaptive and innate immunity, brain function, retinal development, cancer, glucose and lipid metabolism, circadian rhythm, metabolic and inflammatory diseases and neuropsychiatric disorders. We also summarize the current status of ROR agonists and inverse agonists, including their regulation of ROR activity and their therapeutic potential for management of various diseases in which RORs have been implicated. PMID:26878025

  11. Retinoic Acid-Related Orphan Receptors (RORs: Regulatory Functions in Immunity, Development, Circadian Rhythm, and Metabolism

    Directory of Open Access Journals (Sweden)

    Donald N. Cook

    2015-12-01

    Full Text Available In this overview, we provide an update on recent progress made in understanding the mechanisms of action, physiological functions, and roles in disease of retinoic acid related orphan receptors (RORs. We are particularly focusing on their roles in the regulation of adaptive and innate immunity, brain function, retinal development, cancer, glucose and lipid metabolism, circadian rhythm, metabolic and inflammatory diseases and neuropsychiatric disorders. We also summarize the current status of ROR agonists and inverse agonists, including their regulation of ROR activity and their therapeutic potential for management of various diseases in which RORs have been implicated.

  12. Cognitive functions in methamphetamine induced psychosis compared to schizophrenia and normal subjects.

    Directory of Open Access Journals (Sweden)

    Zahra Ezzatpanah

    2014-09-01

    Full Text Available The purpose of this research was to study the cognitive functions in patients with methamphetamine-induced psychosis (MIP in comparison with schizophrenia patients and normal subjects.This was a cross-sectional study, 30 patients with MIP, 30 patients with schizophrenia and 30 normal individuals were selected via convenient sampling and were matched on age, sex and education. Wisconsin Cards Sorting, Stroop, Visual Search and Attention and Wechsler Memory Tests were used to assess the subjects.The study showed that patients with MIP and schizophrenia have more deficits in executive functions, selective attention, sustained attention and memory than normal subjects. There were no significant differences in cognitive functions between patients with MIP and schizophrenia except for visual search and attention that showed more impairment in patients with schizophrenia.Although, cognitive dysfunctions of patients with MIP are mostly similar to patients with schizophrenia, some differences seem to exist, especially in those functions that are not primarily dependent on frontal lobe.

  13. Structural and functional perspectives on classification and seriation in psychotic and normal children.

    Science.gov (United States)

    Breslow, L; Cowan, P A

    1984-02-01

    This study describes a strategy for examining cognitive functioning in psychotic and normal children without the usual confounding effects of marked differences in cognitive structure that occur when children of the same age are compared. Participants were 14 psychotic children, 12 males and 2 females, mean age 9-2, matched with normal children at preoperational and concrete operational stage levels on a set of Piagetian classification tasks. The mean age of the normal children was 6-4, replicating the usually found developmental delay in psychotic samples. Participants were then compared on both structural level and functional abilities on a set of tasks involving seriation of sticks; the higher-level children were also administered a seriation drawing task. Analysis of children's processes of seriating and seriation drawings indicated that over and above the structural retardation, psychotic children at all levels showed functional deficits, especially in the use of anticipatory imagery. The implications for general developmental theory are that progress in structural development is not sufficient for imaginal development, and that structural development of logical concepts is relatively independent of the development of imagery. It was suggested that "thought disorder" may not be a disordered structure of thinking or a retardation in psychotic populations but rather a mismatch between higher-level logical structures and lower-level functions.

  14. Normal Forms for Retarded Functional Differential Equations and Applications to Bogdanov-Takens Singularity

    Science.gov (United States)

    Faria, T.; Magalhaes, L. T.

    The paper addresses, for retarded functional differential equations (FDEs), the computation of normal forms associated with the flow on a finite-dimensional invariant manifold tangent to invariant spaces for the infinitesimal generator of the linearized equation at a singularity. A phase space appropriate to the computation of these normal forms is introduced, and adequate nonresonance conditions for the computation of the normal forms are derived. As an application, the general situation of Bogdanov-Takens singularity and its versal unfolding for scalar retarded FDEs with nondegeneracy at second order is considered, both in the general case and in the case of differential-delay equations of the form ẋ( t) = ƒ( x( t), x( t-1)).

  15. Imunidade na gestação normal e na paciente com lúpus eritematoso sistêmico (LES Immunity in the normal pregnancy and in the patient with systemic lupus erythematosus (SLE

    Directory of Open Access Journals (Sweden)

    Alessandra Cardoso Pereira

    2005-06-01

    Full Text Available A gravidez é uma condição fisiológica na qual ocorrem várias mudanças imunoendócrinas com a finalidade de facilitar a imunossupressão e a tolerância aos antígenos paternos e fetais. Na gravidez humana normal existe uma relativa supressão de citocinas tipo Th1 na resposta dos linfócitos, levando a uma prevalência na resposta do tipo Th2. No LES, onde prevalece a resposta imune do tipo Th2, a gravidez pode estar relacionada com a ativação da doença. Este artigo é uma revisão dessas alterações relacionadas com a resposta imune durante a gestação normal e na da paciente com LES.Pregnancy is a physiologic condition where several immuno-endocrine changes take place with the aim of facilitating immunosuppression and tolerance towards paternal and fetal antigens. In normal human pregnancy there is a relative suppression of Th1 type cytokines in response to lymphocytes, leading to a Th2 type response. In SLE, where a Th2 type response prevails, pregnancy may exacerbate the disease. This article reviews the alterations related to the immune response during normal pregnancy and in SLE patients.

  16. Brain Energy and Oxygen Metabolism: Emerging Role in Normal Function and Disease

    Directory of Open Access Journals (Sweden)

    Michelle E. Watts

    2018-06-01

    Full Text Available Dynamic metabolic changes occurring in neurons are critically important in directing brain plasticity and cognitive function. In other tissue types, disruptions to metabolism and the resultant changes in cellular oxidative state, such as increased reactive oxygen species (ROS or induction of hypoxia, are associated with cellular stress. In the brain however, where drastic metabolic shifts occur to support physiological processes, subsequent changes to cellular oxidative state and induction of transcriptional sensors of oxidative stress likely play a significant role in regulating physiological neuronal function. Understanding the role of metabolism and metabolically-regulated genes in neuronal function will be critical in elucidating how cognitive functions are disrupted in pathological conditions where neuronal metabolism is affected. Here, we discuss known mechanisms regulating neuronal metabolism as well as the role of hypoxia and oxidative stress during normal and disrupted neuronal function. We also summarize recent studies implicating a role for metabolism in regulating neuronal plasticity as an emerging neuroscience paradigm.

  17. CT Densitometry of the Lung in Healthy Nonsmokers with Normal Pulmonary Function

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Tack Sun; Chae, Eun Jin; Seo, Joon Beom; Jung, Young Ju; Oh, Yeon Mok; Lee, Sang Do [University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of)

    2012-09-15

    To investigate the upper normal limit of low attenuation area in healthy nonsmokers. A total of 36 nonsmokers with normal pulmonary function test underwent a CT scan. Six thresholds (-980 --930 HU) on inspiration CT and two thresholds (-950 and -910 HU) on expiration CT were used for obtaining low attenuation area. The mean lung density was obtained on both inspiration CT and expiration CT. Descriptive statistics of low attenuation area and the mean lung density, evaluation of difference of low attenuation area and the mean lung density in both sex and age groups, analysis of the relationship between demographic information and CT parameters were performed. Upper normal limit for low attenuation area was 12.96% on inspiration CT (-950 HU) and 9.48% on expiration CT (-910 HU). Upper normal limit for the mean lung density was -837.58 HU on inspiration CT and 686.82 HU on expiration CT. Low attenuation area and the mean lung density showed no significant differences in both sex and age groups. Body mass index (BMI) was negatively correlated with low attenuation area on inspiration CT (-950 HU, r = -0.398, p = 0.016) and positively correlated with the mean lung density on inspiration CT (r 0.539, p = 0.001) and expiration CT (r = 0.432, p = 0.009). Age and body surface area were not correlated with low attenuation area or the mean lung density. Low attenuation area on CT densitometry of the lung could be found in healthy nonsmokers with normal pulmonary function, and showed negative association with BMI. Reference values, such as range and upper normal limit for low attenuation area in healthy subjects could be helpful in quantitative analysis and follow up of early emphysema, using CT densitometry of the lung.

  18. Effects of prenatal yoga on women's stress and immune function across pregnancy: A randomized controlled trial.

    Science.gov (United States)

    Chen, Pao-Ju; Yang, Luke; Chou, Cheng-Chen; Li, Chia-Chi; Chang, Yu-Cune; Liaw, Jen-Jiuan

    2017-04-01

    The effects of prenatal yoga on biological indicators have not been widely studied. Thus, we compared changes in stress and immunity salivary biomarkers from 16 to 36 weeks' gestation between women receiving prenatal yoga and those receiving routine prenatal care. For this longitudinal, prospective, randomized controlled trial, we recruited 94 healthy pregnant women at 16 weeks' gestation through convenience sampling from a prenatal clinic in Taipei. Participants were randomly assigned to intervention (n=48) or control (n=46) groups using Clinstat block randomization. The 20-week intervention comprised two weekly 70-min yoga sessions led by a midwife certified as a yoga instructor; the control group received only routine prenatal care. In both groups, participants' salivary cortisol and immunoglobulin A levels were collected before and after yoga every 4 weeks from 16 to 36 weeks' gestation. The intervention group had lower salivary cortisol (pcontrol group. Specifically, the intervention group had significantly higher long-term salivary immunoglobulin A levels than the control group (p=0.018), and infants born to women in the intervention group weighed more than those born to the control group (pPrenatal yoga significantly reduced pregnant women's stress and enhanced their immune function. Clinicians should learn the mechanisms of yoga and its effects on pregnant women. Our findings can guide clinicians to help pregnant women alleviate their stress and enhance their immune function. Copyright © 2017. Published by Elsevier Ltd.

  19. Use of the local lymph node assay in assessment of immune function

    International Nuclear Information System (INIS)

    Berg, Femke A. van den; Baken, Kirsten A.; Vermeulen, Jolanda P.; Gremmer, Eric R.; Steeg, Harry van; Loveren, Henk van

    2005-01-01

    The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene (B[a]P). Subsequently, cell proliferation and interferon-γ (IFN-γ) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse

  20. Use of the local lymph node assay in assessment of immune function.

    Science.gov (United States)

    van den Berg, Femke A; Baken, Kirsten A; Vermeulen, Jolanda P; Gremmer, Eric R; van Steeg, Harry; van Loveren, Henk

    2005-07-01

    The murine local lymph node assay (LLNA) was originally developed as a predictive test method for the identification of chemicals with sensitizing potential. In this study we demonstrated that an adapted LLNA can also be used as an immune function assay by studying the effects of orally administered immunomodulating compounds on the T-cell-dependent immune response induced by the contact sensitizer 2,4-dinitrochlorobenzene (DNCB). C57Bl/6 mice were treated with the immunotoxic compounds cyclosporin A (CsA), bis(tri-n-butyltin)oxide (TBTO) or benzo[a]pyrene, (B[a]P). Subsequently, cell proliferation and interferon-gamma (IFN-gamma) and interleukin (IL)-4 release were determined in the auricular lymph nodes (LNs) after DNCB application on both ears. Immunosuppression induced by CsA, TBTO and B[a]P was clearly detectable in this application of the LLNA. Cytokine release measurements proved valuable to confirm the results of the cell proliferation assay and to obtain an indication of the effect on Th1/Th2 balance. We believe to have demonstrated the applicability of an adapted LLNA as an immune function assay in the mouse.

  1. Left ventricular functional, structural and energetic effects of normal aging: Comparison with hypertension.

    Directory of Open Access Journals (Sweden)

    Jehill D Parikh

    Full Text Available Both aging and hypertension are significant risk factors for heart failure in the elderly. The purpose of this study was to determine how aging, with and without hypertension, affects left ventricular function.Cross-sectional study of magnetic resonance imaging and 31P spectroscopy-based measurements of left ventricular structure, global function, strains, pulse wave velocity, high energy phosphate metabolism in 48 normal subjects and 40 treated hypertensive patients (though no other cardiovascular disease or diabetes stratified into 3 age deciles from 50-79 years.Normal aging was associated with significant increases in systolic blood pressure, vascular stiffness, torsion, and impaired diastolic function (all P<0.05. Age-matched hypertension exacerbated the effects of aging on systolic pressure, and diastolic function. Hypertension alone, and not aging, was associated with increased left ventricular mass index, reduced energetic reserve, reduced longitudinal shortening and increased endocardial circumferential shortening (all P<0.05. Multiple linear regression analysis showed that these unique hypertensive features were significantly related to systolic blood pressure (P<0.05.1 Hypertension adds to the age-related changes in systolic blood pressure and diastolic function; 2 hypertension is uniquely associated with changes in several aspects of left ventricular structure, function, systolic strains, and energetics; and 3 these uniquely hypertensive-associated parameters are related to the level of systolic blood pressure and so are potentially modifiable.

  2. Normal Parathyroid Function with Decreased Bone Mineral Density in Treated Celiac Disease

    Directory of Open Access Journals (Sweden)

    Bernard Lemieux

    2001-01-01

    Full Text Available Decreased bone mineral density (BMD has been reported in patients with celiac disease in association with secondary hyperparathyroidism. The present study investigated whether basal parathyroid hormone (PTH remained elevated and whether abnormalities of parathyroid function were still present in celiac disease patients treated with a gluten-free diet. Basal seric measurements of calcium and phosphate homeostasis and BMD were obtained in 17 biopsy-proven patients under treatment for a mean period of 5.7±3.7 years (range 1.1 to 15.9. In addition, parathyroid function was studied with calcium chloride and sodium citrate infusions in seven patients. Basal measurements of patients were compared with those of 26 normal individuals, while parathyroid function results were compared with those of seven sex- and age-matched controls. Basal results were similar in patients and controls except for intact PTH (I-PTH (3.77±0.88 pmol/L versus 2.28±0.63 pmol/L, P<0.001, which was higher in the former group but still within normal limits. Mean 25-hydroxy vitamin D and 1,25-dihydroxy vitamin D values were normal in patients. Parathyroid function results were also found to be similar in both groups. Compared with a reference population of the same age (Z score, patients had significantly lower BMDs of the hip (-0.60±0.96 SDs, P<0.05 and lumbar spine (-0.76±1.15 SDs, P<0.05. T scores were also decreased for the hip (-1.3±0.9 SDs, P<0.0001 and lumbar spine (-1.4±1.35 SDs, P<0.0001, with two to three patients being osteoporotic (T score less than -2.5 SDs and seven to eight osteopenic (T score less than -1 SDs but greater than or equal to -2.5 SDs in at least one site. Height and weight were the only important determinants of BMD values by multivariate or logistical regression analysis in these patients. The results show higher basal I-PTH values with normal parathyroid function in treated celiac disease. Height and weight values are, but I-PTH values are not

  3. Antiviral immunity in fish – functional analysis using DNA vaccination as a tool

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2013-01-01

    fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...... and cellular components both play a role in the long lasting protection. The similarity of the functional immune response profile to that induced by a natural virus infection is striking and is most likely one of the major reasons for the efficacy of the rhabdovirus DNA vaccines. Although other elements like...... protein gene suggest that the structural requirements for antigenicity are different from the requirements for immunogenicity....

  4. Exercise protects from cancer through regulation of immune function and inflammation

    DEFF Research Database (Denmark)

    Hojman, Pernille

    2017-01-01

    Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...

  5. A cascade reaction network mimicking the basic functional steps of adaptive immune response.

    Science.gov (United States)

    Han, Da; Wu, Cuichen; You, Mingxu; Zhang, Tao; Wan, Shuo; Chen, Tao; Qiu, Liping; Zheng, Zheng; Liang, Hao; Tan, Weihong

    2015-10-01

    Biological systems use complex 'information-processing cores' composed of molecular networks to coordinate their external environment and internal states. An example of this is the acquired, or adaptive, immune system (AIS), which is composed of both humoral and cell-mediated components. Here we report the step-by-step construction of a prototype mimic of the AIS that we call an adaptive immune response simulator (AIRS). DNA and enzymes are used as simple artificial analogues of the components of the AIS to create a system that responds to specific molecular stimuli in vitro. We show that this network of reactions can function in a manner that is superficially similar to the most basic responses of the vertebrate AIS, including reaction sequences that mimic both humoral and cellular responses. As such, AIRS provides guidelines for the design and engineering of artificial reaction networks and molecular devices.

  6. Cow's Milk and Immune Function in the Respiratory Tract: Potential Mechanisms.

    Science.gov (United States)

    Perdijk, Olaf; van Splunter, Marloes; Savelkoul, Huub F J; Brugman, Sylvia; van Neerven, R J Joost

    2018-01-01

    During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow's milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow's milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow's milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow's milk components in the gut must recirculate into the blood and home to the (upper and lower) respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present in milk, we speculate that raw

  7. Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms

    Directory of Open Access Journals (Sweden)

    Olaf Perdijk

    2018-02-01

    Full Text Available During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow’s milk. Indeed, recent studies show inverse associations between raw cow’s milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow’s milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow’s milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow’s milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow’s milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow’s milk components in the gut must recirculate into the blood and home to the (upper and lower respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present

  8. Prevalence of normal TSH value among patients with autonomously functioning thyroid nodule.

    Science.gov (United States)

    Treglia, Giorgio; Trimboli, Pierpaolo; Verburg, Frederik A; Luster, Markus; Giovanella, Luca

    2015-07-01

    International guidelines significantly diverge on the effectiveness of thyroid scintigraphy (TS) in the initial work-up of thyroid nodules. In particular, the role of TS to detect or exclude the presence of autonomously functioning thyroid nodules (AFTN) in patients with normal serum thyrotropin (TSH) is still a matter to debate. Here, we aimed to review the literature on the prevalence of normal TSH value among patients with AFTN and meta-analyse data of the retrieved eligible papers. A comprehensive literature search of studies published from January 2000 to December 2014 on AFTN detected by TS was performed. Records reporting serum TSH values in AFTN were selected. Pooled prevalence of AFTN with normal TSH values was calculated on a per-patient analysis including 95% confidence intervals (95% CI). Eight records including 2761 AFTN were selected for the meta-analysis. Pooled prevalence of AFTN with normal TSH detected by TS was 50% (95% CI: 32-68%). Selection bias in the included studies and heterogeneity among studies were potential limitations of the meta-analysis. Present meta-analysis shows that about one in two patients with AFTN demonstrated by TS has a TSH value within normal references. As a consequence, TSH measurement may not be considered as effective as a single tool to detect or exclude AFTN, and TS remains mandatory. © 2015 Stichting European Society for Clinical Investigation Journal Foundation.

  9. Periodontal disease characterization in dogs with normal renal function or chronic renal failure

    OpenAIRE

    Barbudo-Selmi,Glenda Ramalho; Carvalho,Marileda Bonafim; Selmi,André Luis; Martins,Silvio Emílio Cuevas

    2004-01-01

    The purpose of this study was to evaluate periodontal disease (PD) in dogs with chronic renal failure (CRF) and to compare it to PD in dogs with normal renal function (NRF). Twelve dogs with CRF and 24 dogs with NRF, all presenting dental pocket formation, were compared. In all dogs, serum creatinine, blood urea nitrogen, urine specific gravity and total red and white blood cells were determined. A complete oral examination was also performed including evaluation of bacterial plaque, gingivit...

  10. Age and Gender Effects on Wideband Absorbance in Adults with Normal Outer and Middle Ear Function

    Science.gov (United States)

    Mazlan, Rafidah; Kei, Joseph; Ya, Cheng Li; Yusof, Wan Nur Hanim Mohd; Saim, Lokman; Zhao, Fei

    2015-01-01

    Purpose: This study examined the effects of age and gender on wideband energy absorbance in adults with normal middle ear function. Method: Forty young adults (14 men, 26 women, aged 20-38 years), 31 middle-aged adults (16 men, 15 women, aged 42-64 years), and 30 older adults (20 men, 10 women, aged 65-82 years) were assessed. Energy absorbance…

  11. The sweet side of a long pentraxin: how glycosylation affects PTX3 functions in innate immunity and inflammation

    Directory of Open Access Journals (Sweden)

    Antonio eInforzato

    2013-01-01

    Full Text Available Innate immunity represents the first line of defence against pathogens and plays key roles in activation and orientation of the adaptive immune response. The innate immune system comprises both a cellular and a humoral arm. Components of the humoral arm include soluble pattern recognition molecules (PRMs that recognise pathogen associated molecular patterns (PAMPs and initiate the immune response in coordination with the cellular arm, therefore acting as functional ancestors of antibodies. The long pentraxin PTX3 is a prototypic soluble PRM that is produced at sites of infection and inflammation by both somatic and immune cells. Gene targeting of this evolutionarily conserved protein has revealed a non-redundant role in resistance to selected pathogens. Moreover, PTX3 exerts important functions at the crossroad between innate immunity, inflammation and female fertility. The human PTX3 protein contains a single N-glycosylation site that is fully occupied by complex type oligosaccharides, mainly fucosylated and sialylated biantennary glycans. Glycosylation has been implicated in a number of PTX3 activities, including neutralization of influenza viruses, modulation of the complement system, and attenuation of leukocyte recruitment. Therefore, this post translational modification might act as a fine tuner of PTX3 functions in native immunity and inflammation.Here we review the studies on PTX3, with emphasis on the glycan-dependent mechanisms underlying pathogen recognition and crosstalk with other components of the innate immune system.

  12. Pomegranate extract and exercise provide additive benefits on improvement of immune function by inhibiting inflammation and oxidative stress in high-fat-diet-induced obesity in rats.

    Science.gov (United States)

    Zhao, Fei; Pang, Wentao; Zhang, Ziyi; Zhao, Jialong; Wang, Xin; Liu, Ye; Wang, Xun; Feng, Zhihui; Zhang, Yong; Sun, Wenyan; Liu, Jiankang

    2016-06-01

    Obesity is reported to be associated with immune dysfunction and a state of low-grade, chronic inflammation. Either pomegranate extract (PomE) or exercise (Ex) has been shown to have antiobesity, anti-inflammatory and antioxidant effects. Nevertheless, no study has addressed the additive benefits of PomE and Ex on the restoration of obesity-induced immune defects. The present work aims to study the effect of PomE and Ex as a combined intervention on immune function and the underlying mechanism involved in inflammation and oxidative stress in rats with high-fat-diet (HFD)-induced obesity. Our results demonstrate that the combination of PomE and Ex showed additive benefits on inhibition of HFD-induced body weight increase and improvement of HFD-induced immune dysfunction, including (a) attenuating the abnormality of histomorphology of the spleen, (b) increasing the ratio of the CD4+:CD8+ T cell subpopulations in splenocytes and peripheral blood mononuclear cells (PBMC), (c) inhibition of apoptosis in splenocytes and PBMC, (d) normalizing peritoneal macrophage phenotypes and (e) restoring immunomodulating factors in serum. We also find that immune dysfunction in HFD-fed rats was associated with increased inflammatory cytokine secretion and oxidative stress biomarkers, and that the combination of PomE and Ex effectively inhibited the inflammatory response and decreased oxidative damage. The effect of PomE and Ex as a combined intervention is greater than the effect of either PomE or Ex alone, showing that PomE and Ex may be additively effective in improving immune function in HFD-fed rats by inhibiting inflammation and decreasing oxidative stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Disrupted functional and structural networks in cognitively normal elderly subjects with the APOE ɛ4 allele.

    Science.gov (United States)

    Chen, Yaojing; Chen, Kewei; Zhang, Junying; Li, Xin; Shu, Ni; Wang, Jun; Zhang, Zhanjun; Reiman, Eric M

    2015-03-13

    As the Apolipoprotein E (APOE) ɛ4 allele is a major genetic risk factor for sporadic Alzheimer's disease (AD), which has been suggested as a disconnection syndrome manifested by the disruption of white matter (WM) integrity and functional connectivity (FC), elucidating the subtle brain structural and functional network changes in cognitively normal ɛ4 carriers is essential for identifying sensitive neuroimaging based biomarkers and understanding the preclinical AD-related abnormality development. We first constructed functional network on the basis of resting-state functional magnetic resonance imaging and a structural network on the basis of diffusion tensor image. Using global, local and nodal efficiencies of these two networks, we then examined (i) the differences of functional and WM structural network between cognitively normal ɛ4 carriers and non-carriers simultaneously, (ii) the sensitivity of these indices as biomarkers, and (iii) their relationship to behavior measurements, as well as to cholesterol level. For ɛ4 carriers, we found reduced global efficiency significantly in WM and marginally in FC, regional FC dysfunctions mainly in medial temporal areas, and more widespread for WM network. Importantly, the right parahippocampal gyrus (PHG.R) was the only region with simultaneous functional and structural damage, and the nodal efficiency of PHG.R in WM network mediates the APOE ɛ4 effect on memory function. Finally, the cholesterol level correlated with WM network differently than with the functional network in ɛ4 carriers. Our results demonstrated ɛ4-specific abnormal structural and functional patterns, which may potentially serve as biomarkers for early detection before the onset of the disease.

  14. The Immune System: Basis of so much Health and Disease: 3. Adaptive Immunity.

    Science.gov (United States)

    Scully, Crispian; Georgakopoulou, Eleni A; Hassona, Yazan

    2017-04-01

    The immune system is the body’s primary defence mechanism against infections, and disturbances in the system can cause disease if the system fails in defence functions (in immunocompromised people), or if the activity is detrimental to the host (as in auto-immune and auto-inflammatory states). A healthy immune system is also essential to normal health of dental and oral tissues. This series presents the basics for the understanding of the immune system; this article covers adaptive immunity. Clinical relevance: Dental clinicians need a basic understanding of the immune system as it underlies health and disease.

  15. A f-MRI study on memory function in normal subjects and patients with partial epilepsies

    International Nuclear Information System (INIS)

    Kamoda, Sachiko

    2004-01-01

    To investigate cerebral regions concerning a memory function and presence of memory lateralization, activated areas and the difference between the right and left hemisphere in functional magnetic resonance imaging (f-MRI) during verbal and visual memory tasks were examined in normal subjects and, as its clinical application, in patients with partial epilepsies. Subjects were 39 normal adult subjects and 10 adult patients. Of the 39 normal subjects, 30 were right-handed and 9 were left-handed. Further, of the 10 patients, 9 were right-handed and one was left-handed, and 7, 2 and 1 had temporal lobe, frontal lobe and undetermined partial epilepsies, respectively. Following the three type of memory task were designed; verbal memory tasks consisting of covert and overt recall tests of 10 words given auditory and visual memory task of covert recall tasks of 6 figures given visually. Activated cerebral areas were imaged with f-MRI using 1.5 tesla Magnetom Vision taken repeatedly during these tasks and neutral condition. Most of the 30 right-handed normal subjects showed activated areas over the left hemisphere specifically on the anterior cingulate, superior, middle and inferior frontal gyri during the verbal memory tasks of covert recall tests. Left hemisphere dominant activated areas in the precentral gyri were added during the verbal memory tasks of overt recall tests. On the other hand, 4 of the 9 left-handed normal subjects showed the left side-dominantly activated areas in the above-mentioned regions during the verbal memory tasks of covert and overt tests, in common with the right-handed subjects. However, 3 of the 9 left-handed normal subjects had right hemisphere dominant activation during the verbal memory tasks, while none of the 30 right-handed normal subjects showed such right side-dominancy. Further, the bilateral occipital lobes were activated during visual memory tasks. The reproducibility in this activation during these verbal and visual memory tasks

  16. Pivotal advance: CTLA-4+ T cells exhibit normal antiviral functions during acute viral infection.

    Science.gov (United States)

    Raué, Hans-Peter; Slifka, Mark K

    2007-05-01

    Previous studies have shown that T cells, which are genetically deficient in CTLA-4/CD152 expression, will proliferate uncontrollably, resulting in lethal autoimmune disease. This and other evidence indicate that CTLA-4 plays a critical role in the negative regulation of effector T cell function. In contrast to expectations, BrdU incorporation experiments demonstrated that CTLA-4 expression was associated with normal or even enhanced in vivo proliferation of virus-specific CD4+ and CD8+ T cells following acute lymphocytic choriomeningitis virus or vaccinia virus infection. When compared with CTLA-4- T cells directly ex vivo, CTLA-4+ T cells also exhibited normal antiviral effector functions following stimulation with peptide-coated cells, virus-infected cells, plate-bound anti-CD3/anti-CTLA-4, or the cytokines IL-12 and IL-18. Together, this indicates that CTLA-4 does not directly inhibit antiviral T cell expansion or T cell effector functions, at least not under the normal physiological conditions associated with either of these two acute viral infections.

  17. Reversible changes in brain glucose metabolism following thyroid function normalization in hyperthyroidism.

    Science.gov (United States)

    Miao, Q; Zhang, S; Guan, Y H; Ye, H Y; Zhang, Z Y; Zhang, Q Y; Xue, R D; Zeng, M F; Zuo, C T; Li, Y M

    2011-01-01

    Patients with hyperthyroidism frequently present with regional cerebral metabolic changes, but the consequences of endocrine-induced brain changes after thyroid function normalization are unclear. We hypothesized that the changes of regional cerebral glucose metabolism are related to thyroid hormone levels in patients with hyperthyroid, and some of these changes can be reversed with antithyroid therapy. Relative regional cerebral glucose metabolism was compared between 10 new-onset untreated patients with hyperthyroidism and 20 healthy control participants by using brain FDG-PET scans. Levels of emotional distress were evaluated by using the SAS and SDS. Patients were treated with methimazole. A follow-up PET scan was performed to assess metabolic changes of the brain when thyroid functions normalized. Compared with controls, patients exhibited lower activity in the limbic system, frontal lobes, and temporal lobes before antithyroid treatment. There were positive correlations between scores of depression and regional metabolism in the cingulate and paracentral lobule. The severity of depression and anxiety covaried negatively with pretreatment activity in the inferior temporal and inferior parietal gyri respectively. Compared with the hyperthyroid status, patients with normalized thyroid functions showed an increased metabolism in the left parahippocampal, fusiform, and right superior frontal gyri. The decrease in both FT3 and FT4 was associated with increased activity in the left parahippocampal and right superior frontal gyri. The changes of regional cerebral glucose metabolism are related to thyroid hormone levels in patients with hyperthyroidism, and some cerebral hypometabolism can be improved after antithyroid therapy.

  18. A novel hybrid stress-function finite element method immune to severe mesh distortion

    International Nuclear Information System (INIS)

    Cen Song; Zhou Mingjue; Fu Xiangrong

    2010-01-01

    This paper introduces a hybrid stress-function finite element method proposed recently for developing 2D finite element models immune to element shapes. Deferent from the first version of the hybrid-stress element constructed by Pian, the stress function φ of 2D elastic or fracture problem is regarded as the functional variable of the complementary energy functional. Then, the basic analytical solutions of φ are taken as the trial functions for finite element models, and meanwhile, the corresponding unknown stress-function constants are introduced. By using the principle of minimum complementary energy, these unknown stress-function constants can be expressed in terms of the displacements along element edges. Finally, the complementary energy functional can be rewritten in terms of element nodal displacement vector, and thus, the element stiffness matrix of such hybrid-function element can be obtained. As examples, two (8- and 12-node) quadrilateral plane elements and an arbitrary polygonal crack element are constructed by employing different basic analytical solutions of different stress functions. Numerical results show that, the 8- and 12-node plane models can produce the exact solutions for pure bending and linear bending problems, respectively, even the element shape degenerates into triangle and concave quadrangle; and the crack element can also predict accurate results with very low computational cost in analysis of stress-singularity problems.

  19. Functional pulmonary atresia in newborn with normal intracardiac anatomy: Successful treatment with inhaled nitric oxide and pulmonary vasodilators

    Directory of Open Access Journals (Sweden)

    Gürkan Altun

    2013-01-01

    Full Text Available Functional pulmonary atresia is characterized by a structurally normal pulmonary valve that does not open during right ventricular ejection. It is usually associated with Ebstein′s anomaly, Uhl′s anomaly, neonatal Marfan syndrome and tricuspid valve dysplasia. However, functional pulmonary atresia is rarely reported in newborn with anatomically normal heart. We report a newborn with functional pulmonary atresia who had normal intracardiac anatomy, who responded to treatment with nitric oxide and other vasodilator therapy successfully.

  20. Changes of some immune functions in combined radiation-burn injury in rats

    International Nuclear Information System (INIS)

    Yan Yongtang; Ran Xinze; Wei Shuqing

    1991-01-01

    The characteristics of some immune functions in radiation injury (6 Gy), burn injury (15%, III deg) and combined radiation-burn injury (CRBI) were studied in rats. The results showed that the functions of splenocytes and thymocytes in radiation injury group (RIG) were depressed more markedly 24-72 h after injury. The degree of thymocyte depression in burn injury group (BIG) was significantly lower than that in RIG and recovered more easily. The characteristics of the CRBI effects were as follows: (1) The combined depression effect on thymocytes in CRBI as compared with that in RIG was deeper and the recovery was slower. (2) The depression course of splenocytes was similar to that in RIG, but the depression degree in the early stage was significantly more heavy than that in RIG. (3) In the later stage of CRBI the level of recovery of T H cells was significantly lower than that in RIG. (4) Eschar-excision plus skin grafting at 24 h after combined injury was helpful for the recovery of thymocyte and splenocytes function. The results showed that the depression and recovery of immune functions in combined injury were closely related to the wound of burn

  1. Pretransplant Immune- and Apoptosis-Related Gene Expression Is Associated with Kidney Allograft Function

    Directory of Open Access Journals (Sweden)

    Dorota Kamińska

    2016-01-01

    Full Text Available Renal transplant candidates present immune dysregulation, caused by chronic uremia. The aim of the study was to investigate whether pretransplant peripheral blood gene expression of immune factors affects clinical outcome of renal allograft recipients. Methods. In a prospective study, we analyzed pretransplant peripheral blood gene expression in87 renal transplant candidates with real-time PCR on custom-designed low density arrays (TaqMan. Results. Immediate posttransplant graft function (14-day GFR was influenced negatively by TGFB1 (P=0.039 and positively by IL-2 gene expression (P=0.040. Pretransplant blood mRNA expression of apoptosis-related genes (CASP3, FAS, and IL-18 and Th1-derived cytokine gene IFNG correlated positively with short- (6-month GFR CASP3: P=0.027, FAS: P=0.021, and IFNG: P=0.029 and long-term graft function (24-month GFR CASP3: P=0.003, FAS: P=0.033, IL-18: P=0.044, and IFNG: P=0.04. Conclusion. Lowered pretransplant Th1-derived cytokine and apoptosis-related gene expressions were a hallmark of subsequent worse kidney function but not of acute rejection rate. The pretransplant IFNG and CASP3 and FAS and IL-18 genes’ expression in the recipients’ peripheral blood is the possible candidate for novel biomarker of short- and long-term allograft function.

  2. Carcinogenesis: alterations in reciprocal interactions of normal functional structure of biologic systems.

    Science.gov (United States)

    Davydyan, Garri

    2015-12-01

    The evolution of biologic systems (BS) includes functional mechanisms that in some conditions may lead to the development of cancer. Using mathematical group theory and matrix analysis, previously, it was shown that normally functioning BS are steady functional structures regulated by three basis regulatory components: reciprocal links (RL), negative feedback (NFB) and positive feedback (PFB). Together, they form an integrative unit maintaining system's autonomy and functional stability. It is proposed that phylogenetic development of different species is implemented by the splitting of "rudimentary" characters into two relatively independent functional parts that become encoded in chromosomes. The functional correlate of splitting mechanisms is RL. Inversion of phylogenetic mechanisms during ontogenetic development leads cell differentiation until cells reach mature states. Deterioration of reciprocal structure in the genome during ontogenesis gives rise of pathological conditions characterized by unsteadiness of the system. Uncontrollable cell proliferation and invasive cell growth are the leading features of the functional outcomes of malfunctioning systems. The regulatory element responsible for these changes is RL. In matrix language, pathological regulation is represented by matrices having positive values of diagonal elements ( TrA  > 0) and also positive values of matrix determinant ( detA  > 0). Regulatory structures of that kind can be obtained if the negative entry of the matrix corresponding to RL is replaced with the positive one. To describe not only normal but also pathological states of BS, a unit matrix should be added to the basis matrices representing RL, NFB and PFB. A mathematical structure corresponding to the set of these four basis functional patterns (matrices) is a split quaternion (coquaternion). The structure and specific role of basis elements comprising four-dimensional linear space of split quaternions help to understand what

  3. Longstanding Hyperthyroidism Is Associated with Normal or Enhanced Intrinsic Cardiomyocyte Function despite Decline in Global Cardiac Function

    Science.gov (United States)

    Redetzke, Rebecca A.; Gerdes, A. Martin

    2012-01-01

    Thyroid hormones (THs) play a pivotal role in cardiac homeostasis. TH imbalances alter cardiac performance and ultimately cause cardiac dysfunction. Although short-term hyperthyroidism typically leads to heightened left ventricular (LV) contractility and improved hemodynamic parameters, chronic hyperthyroidism is associated with deleterious cardiac consequences including increased risk of arrhythmia, impaired cardiac reserve and exercise capacity, myocardial remodeling, and occasionally heart failure. To evaluate the long-term consequences of chronic hyperthyroidism on LV remodeling and function, we examined LV isolated myocyte function, chamber function, and whole tissue remodeling in a hamster model. Three-month-old F1b hamsters were randomized to control or 10 months TH treatment (0.1% grade I desiccated TH). LV chamber remodeling and function was assessed by echocardiography at 1, 2, 4, 6, 8, and 10 months of treatment. After 10 months, terminal cardiac function was assessed by echocardiography and LV hemodynamics. Hyperthyroid hamsters exhibited significant cardiac hypertrophy and deleterious cardiac remodeling characterized by myocyte lengthening, chamber dilatation, decreased relative wall thickness, increased wall stress, and increased LV interstitial fibrotic deposition. Importantly, hyperthyroid hamsters demonstrated significant LV systolic and diastolic dysfunction. Despite the aforementioned remodeling and global cardiac decline, individual isolated cardiac myocytes from chronically hyperthyroid hamsters had enhanced function when compared with myocytes from untreated age-matched controls. Thus, it appears that long-term hyperthyroidism may impair global LV function, at least in part by increasing interstitial ventricular fibrosis, in spite of normal or enhanced intrinsic cardiomyocyte function. PMID:23056390

  4. Longstanding hyperthyroidism is associated with normal or enhanced intrinsic cardiomyocyte function despite decline in global cardiac function.

    Directory of Open Access Journals (Sweden)

    Nathan Y Weltman

    Full Text Available Thyroid hormones (THs play a pivotal role in cardiac homeostasis. TH imbalances alter cardiac performance and ultimately cause cardiac dysfunction. Although short-term hyperthyroidism typically leads to heightened left ventricular (LV contractility and improved hemodynamic parameters, chronic hyperthyroidism is associated with deleterious cardiac consequences including increased risk of arrhythmia, impaired cardiac reserve and exercise capacity, myocardial remodeling, and occasionally heart failure. To evaluate the long-term consequences of chronic hyperthyroidism on LV remodeling and function, we examined LV isolated myocyte function, chamber function, and whole tissue remodeling in a hamster model. Three-month-old F1b hamsters were randomized to control or 10 months TH treatment (0.1% grade I desiccated TH. LV chamber remodeling and function was assessed by echocardiography at 1, 2, 4, 6, 8, and 10 months of treatment. After 10 months, terminal cardiac function was assessed by echocardiography and LV hemodynamics. Hyperthyroid hamsters exhibited significant cardiac hypertrophy and deleterious cardiac remodeling characterized by myocyte lengthening, chamber dilatation, decreased relative wall thickness, increased wall stress, and increased LV interstitial fibrotic deposition. Importantly, hyperthyroid hamsters demonstrated significant LV systolic and diastolic dysfunction. Despite the aforementioned remodeling and global cardiac decline, individual isolated cardiac myocytes from chronically hyperthyroid hamsters had enhanced function when compared with myocytes from untreated age-matched controls. Thus, it appears that long-term hyperthyroidism may impair global LV function, at least in part by increasing interstitial ventricular fibrosis, in spite of normal or enhanced intrinsic cardiomyocyte function.

  5. Effect of endotoxin preparations (LPS) with irradiation decreased toxicity on the immune response of normal and irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Elekes, E; Bertok, L [Orszagos Frederic Joliot-Curie Sugarbiologiai es Sugaregeszsegugyi Kutato Intezet, Budapest (Hungary)

    1979-03-01

    A comparison of the immunostimulating effect of parent and radiodetoxified with 50, 100, 150 and 200 kGy (5, 10, 15 and 20 Mrad) /sup 60/Co ..gamma..-rays endotoxin preparations in normal and irradiated rats is given. By increasing the dose of irradiation the immunostimulating effect decreased. The preparations detoxified even with the highest (200 kGy) dose is characterized by a pronounced adjuvant effect in irradiated animals.

  6. Cognitive functioning and its influence on sexual behavior in normal aging and dementia.

    Science.gov (United States)

    Hartmans, Carien; Comijs, Hannie; Jonker, Cees

    2014-05-01

    Motivational aspects, emotional factors, and cognition, all of which require intact cognitive functioning may be essential in sexual functioning. However, little is known about the association between cognitive functioning and sexual behavior. The aim of this article is to review the current evidence for the influence of cognitive functioning on sexual behavior in normal aging and dementia. A systematic literature search was conducted in PubMed, Ovid, Cochrane, and PsycINFO databases. The databases were searched for English language papers focusing on human studies published relating cognitive functioning to sexual behavior in the aging population. Keywords included sexual behavior, sexuality, cognitive functioning, healthy elderly, elderly, aging and dementia. Eight studies fulfilled our inclusion criteria. Of these studies, five included dementia patients and/or their partners, whereas only three studies included healthy older persons. Although not consistently, results indicated a trend that older people who are not demented and continue to engage in sexual activity have better overall cognitive functioning. Cognitive decline and dementia seem to be associated with diminished sexual behavior in older persons. The association between cognitive functioning and sexual behavior in the aging population is understudied. The results found are inconclusive. Copyright © 2013 John Wiley & Sons, Ltd.

  7. Coelomocytes: Biology and Possible Immune Functions in Invertebrates with Special Remarks on Nematodes

    Directory of Open Access Journals (Sweden)

    Qudsia Tahseen

    2009-01-01

    Full Text Available All metazoans are exposed to a wide range of microbes and have evolved complex immune defenses used to repel infectious agents. Coelomocytes play a key role in the defense reactions of most invertebrates. They are involved in important immune functions, such as phagocytosis, encapsulation, graft rejection, and inflammation, as well as the synthesis and secretion of several humoral factors especially in annelids and echinoderms. Coelomocytes in nematodes are variable in shapes from round, ovoid, cuboidal, and spindle-shaped to stellate or branched cells that are found usually at fixed positions in the pseudocoelom. Their number usually varies from 2 to 6. The model nematode, C. elegans lacks an adaptive immune system and the coelomocytes are capable of endocytosis, but their involvement in phagocytosis of bacteria seems unlikely. The aim of this review is to evaluate current knowledge on coelomocytes of invertebrates with special reference to nematodes. The morphology and structure of these coelomocytes are discussed along with their origin. Their relative positions and diversity in different nematode groups have also been discussed and illustrated.

  8. Development of immune functionality in larval and juvenile crimson snapper Lutjanus erythropterus (Bloch 1790

    Directory of Open Access Journals (Sweden)

    Ke Cui

    2018-05-01

    Full Text Available Ontogenetic development of the immune system in crimson snapper (Lutjanus erythropterus Bloch 1790 larvae was histologically and enzymatically studied from hatch to 36 days post-hatch (DPH. Primitive hepatopancreas appeared on 2 DPH and renal tubules started hematopoiesis on 4 DPH. The spleen anlage appeared on 6 DPH and the thymus formed on 14 DPH. Total activities of superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPX and sodium-potassium adenosine triphosphatase (Na+ K+-ATPase gradually increased after hatch, and showed a sharp increase after 29 DPH during the transitional feeding period from Artemia to inert feed. The specific activities of SOD, CAT, and GPX showed a trend of sharp increase and reached the maximum level on 4 DPH when exogenous feeding started, except for Na+ K+-ATPase where the peak occurred on10 DPH. The specific activities of these five enzymes reached the peak during the food transition from rotifers to Artemia, but the total activity of enzymes showed an increasing trend as fish grew. The present study provides new knowledge of the development of functional enzymes relevant to fish larvae immunity, sheds light on the understanding of the change of larval health, and improves hatchery management of crimson snapper. Keywords: Immune system, Enzyme activity, Ontogenetic development, Crimson snapper Lutjanus erythropterus

  9. Therapeutic immunization with HIV-1 Tat reduces immune activation and loss of regulatory T-cells and improves immune function in subjects on HAART.

    Directory of Open Access Journals (Sweden)

    Barbara Ensoli

    2010-11-01

    Full Text Available Although HAART suppresses HIV replication, it is often unable to restore immune homeostasis. Consequently, non-AIDS-defining diseases are increasingly seen in treated individuals. This is attributed to persistent virus expression in reservoirs and to cell activation. Of note, in CD4(+ T cells and monocyte-macrophages of virologically-suppressed individuals, there is continued expression of multi-spliced transcripts encoding HIV regulatory proteins. Among them, Tat is essential for virus gene expression and replication, either in primary infection or for virus reactivation during HAART, when Tat is expressed, released extracellularly and exerts, on both the virus and the immune system, effects that contribute to disease maintenance. Here we report results of an ad hoc exploratory interim analysis (up to 48 weeks on 87 virologically-suppressed HAART-treated individuals enrolled in a phase II randomized open-label multicentric clinical trial of therapeutic immunization with Tat (ISS T-002. Eighty-eight virologically-suppressed HAART-treated individuals, enrolled in a parallel prospective observational study at the same sites (ISS OBS T-002, served for intergroup comparison. Immunization with Tat was safe, induced durable immune responses, and modified the pattern of CD4(+ and CD8(+ cellular activation (CD38 and HLA-DR together with reduction of biochemical activation markers and persistent increases of regulatory T cells. This was accompanied by a progressive increment of CD4(+ T cells and B cells with reduction of CD8(+ T cells and NK cells, which were independent from the type of antiretroviral regimen. Increase in central and effector memory and reduction in terminally-differentiated effector memory CD4(+ and CD8(+ T cells were accompanied by increases of CD4(+ and CD8(+ T cell responses against Env and recall antigens. Of note, more immune-compromised individuals experienced greater therapeutic effects. In contrast, these changes were opposite

  10. Studies on the protection effects of functional foods for skin immune system from radiation damage

    International Nuclear Information System (INIS)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In

    2007-07-01

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. · Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment · Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice · Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells · Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-α, GM-CSF) - Inhibition of c-kit, tryptase, FcεRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  11. Studies on the protection effects of functional foods for skin immune system from radiation damage

    Energy Technology Data Exchange (ETDEWEB)

    Yee, Sung Tae; Shin, Seong Hae; Kim, Do Sun; Heo, Ji Yun; Kang, Hye In [Sunchon National University, Sunchon (Korea, Republic of)

    2007-07-15

    We evaluated the protective effects of pilot products (HemoHIM and HemoTonic) on the UV-induced skin immune damages as the following. centre dot Protective effects of HemoHIM and HemoTonic against UV using contact hypersensitivity model - Protection against depression of contact hypersensitivity by administration and skin application of HemoHIM and HemoTonic - Induction of dendritic cell differentiation and maturation by HemoHIM and HemoTonic treatment - Improvement of antigen-presenting activity of dedritic cells by HemoHIM and HemoTonic treatment centre dot Protective effects of HemoHIM and HemoTonic on skin immune system against UV-irradiation - Protection of antigen-presenting activity of dendritic cells under UV-irradiation - In vivo protection of antigen-presenting activity of Langerhans cells in UV-irradiated mice centre dot Protective effects of HemoHIM on UV-induced apoptosis of dendritic cells - Inhibition of cell membrane change, mitochondrial potential change, SubG1 cell population, nuclear condensation, and DNA fragmentation in UV-irradiated dendritic cells centre dot Anti-allergic effects of HemoHIM and HemoTonic in human adipocyte HMC-1 cells - Inhibition of allergic histamine release from adipocytes - Inhibition of secretion of inflammatory cytokines (IL-6, IL-8, TNF-alpha, GM-CSF) - Inhibition of c-kit, tryptase, FcepsilonRI mRNA expression From these results, the developed functional food products (HemoHIM, HemoTonic) showed the protection and recovery of the immune functions in the UV-irradiated skin. It is suggested that these products may be used as a new functional food or cosmetic material for the protection of skin damage and the promotion of recovery

  12. Neonatal infection produces significant changes in immune function with no associated learning deficits in juvenile rats.

    Science.gov (United States)

    Osborne, Brittany F; Caulfield, Jasmine I; Solomotis, Samantha A; Schwarz, Jaclyn M

    2017-10-01

    The current experiments examined the impact of early-life immune activation and a subsequent mild immune challenge with lipopolysaccharide (LPS; 25µg/kg) on hippocampal-dependent learning, proinflammatory cytokine expression in the brain, and peripheral immune function in juvenile male and female rats at P24, an age when hippocampal-dependent learning and memory first emerges. Our results indicate that neonatal infection did not produce learning deficits in the hippocampal-dependent context pre-exposure facilitation effect paradigm in juvenile males and females, contrary to what has been observed in adults. Neonatal infection produced an increase in baseline IL-1β expression in the hippocampus (HP) and medial prefrontal cortex (mPFC) of juvenile rats. Furthermore, neonatally infected rats showed exaggerated IL-1β expression in the HP following LPS treatment as juveniles; and juvenile females, but not males, showed exaggerated IL-1β expression in the mPFC following LPS treatment. Neonatal infection attenuated the production of IL-6 expression following LPS treatment in both the brain and the spleen, and neonatal infection decreased the numbers of circulating white blood cells in juvenile males and females, an effect that was further exacerbated by subsequent LPS treatment. Together, our data indicate that the consequences of neonatal infection are detectable even early in juvenile development, though we found no concomitant hippocampal-dependent learning deficits at this young age. These findings underscore the need to consider age and associated on-going neurodevelopmental processes as important factors contributing to the emergence of cognitive and behavioral disorders linked to early-life immune activation. © 2017 Wiley Periodicals, Inc. Develop Neurobiol 77: 1221-1236, 2017. © 2017 Wiley Periodicals, Inc.

  13. Photoperiod history differentially impacts reproduction and immune function in adult Siberian hamsters.

    Science.gov (United States)

    Prendergast, Brian J; Pyter, Leah M

    2009-12-01

    Seasonal changes in numerous aspects of mammalian immune function arise as a result of the annual variation in environmental day length (photoperiod), but it is not known if absolute photoperiod or relative change in photoperiod drives these changes. This experiment tested the hypothesis that an individual's history of exposure to day length determines immune responses to ambiguous, intermediate-duration day lengths. Immunological (blood leukocytes, delayed-type hypersensitivity reactions [DTH]), reproductive, and adrenocortical responses were assessed in adult Siberian hamsters (Phodopus sungorus) that had been raised initially in categorically long (15-h light/day; 15L) or short (9L) photoperiods and were subsequently transferred to 1 of 7 cardinal experimental photoperiods between 9L and 15L, inclusive. Initial photoperiod history interacted with contemporary experimental photoperiods to determine reproductive responses: 11L, 12L, and 13L caused gonadal regression in hamsters previously exposed to 15L, but elicited growth in hamsters previously in 9L. In hamsters with a 15L photoperiod history, photoperiods history, DTH responses were largely unaffected by increases in day length. Enhancement and suppression of blood leukocyte concentrations occurred at 13L in hamsters with photoperiod histories of 15L and 9L, respectively; however, prior exposure to 9L imparted marked hysteresis effects, which suppressed baseline leukocyte concentrations. Cortisol concentrations were only enhanced in 15L hamsters transferred to 9L and, in common with DTH, were unaffected by photoperiod treatments in hamsters with a 9L photoperiod history. Photoperiod history acquired in adulthood impacts immune responses to photoperiod, but manifests in a markedly dissimilar fashion as compared to the reproductive system. Prior photoperiod exposure has an enduring impact on the ability of the immune system to respond to subsequent changes in day length.

  14. Human study of the herbal preparation(HemoHIM) on enhancement of immune and hematopoietic functions

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hee-Jeong; Park, Jong-Nam; Jeon, Sun-Hee [Eulji Univ. Hospital, Daejeon (Korea, Republic of)

    2006-01-15

    This study was aimed to evaluate the human efficacy of the herbal preparation(HemoHIM) on the immune and hematopoiesis enhancement in sub-healthy volunteers. It was conducted as a double-blind, placebo-controlled human study. The sub-healthy volunteers with peripheral White Blood Cell (WBC) counts below 5000/μl were recruited and randomly allocated to 3 groups and administered with HemoHIM 6g/day, HemoHIM 12g/day, or placebo throughout the test. Peripheral blood was collected 4 times before or after the administration and analyzed for the hematological and serum biochemical values, immune cell activities, antioxidant status of plasma. The data of 38 volunteers were finally included in the analysis. Although there were no statistical significances, a trend was observed that the dose and duration of HemoHIM administration was correlated to the increased number of immune cells (white blood cells and lymphocytes). NK cell activity was increased significantly in the male group administered with HemoHIM 6g/day. The cytokines involved in immune activation (IL-2, IFN-γ, IL-6) were significantly increased or showed the trends of increases in HemoHIM administered groups, while IL-4 involved in allergy and asthma was not changed or showed the trends of decreases in HemoHIM administered groups. On the other hand, the antioxidant biomarkers such as total GSH, MDA, and TAS, were not affected by HemoHIM administration. The toxicological safety of HemoHIM administration was confirmed by the serum biochemical analysis of liver and kidney function markers and the questionnaire of HemoHIM administration and the consultation with the doctor, which showed no side effects of HemoHIM administration. The results of this study may provide the basic data for further clinical study on HemoHIM.

  15. Effects of treated sewage effluent on immune function in rainbow trout (Oncorhynchus mykiss)

    Energy Technology Data Exchange (ETDEWEB)

    Hoeger, Birgit [Environmental Toxicology, University of Konstanz, P.O. Box X918, D-78457 Constance (Germany); Heuvel, Michael R. van den [Forest Research, Private Bag 3020, Sala St., Rotorua (New Zealand); Hitzfeld, Bettina C. [Swiss Agency for the Environment, Forests and Landscape (SAEFL), Substances, Soil, Biotechnology Division, Section Substances, 3003 Bern (Switzerland); Dietrich, Daniel R. [Environmental Toxicology, University of Konstanz, P.O. Box X918, D-78457 Constance (Germany)]. E-mail: daniel.dietrich@uni-konstanz.de

    2004-12-20

    In this study, the immune reactions of rainbow trout (Oncorhynchus mykiss) were examined, after exposure to 10, 30 and 70% of tertiary-treated municipal sewage effluent for 27 days. Exposures were conducted concurrently with and without an immune challenge using intraperitoneal injections of inactivated Aeromonas salmonicida salmonicida. Due to the time required to prepare and analyse samples, fish sampling was conducted over two consecutive days. There was no trout mortality for any of the experimental treatments. The exposure to effluent increased in vitro lymphocyte proliferation, decreased circulating lymphocytes and increased degrading erythrocytes in peripheral blood samples. Circulating lymphocytes were only decreased in the sham-injected, but not in the A. salmonicida-injected group. In addition to effluent effects, circulating lymphocytes and lymphocyte proliferation were decreased on day 2 of sampling as compared to day 1. Concentration-dependent degradation of erythrocytes was only observed on day 2 of sampling. Capture and removal of trout on day 1 of sampling presumably caused low-level stress that affected some results on day 2. Oxidative burst, phagocytosis, lysozyme, leucocyte populations other than lymphocytes and A. salmonicida-specific IgM production were not affected by exposure to effluent, and of these parameters, only oxidative burst and total leucocytes showed sampling day effects. From these results it can be observed, that with the exception of oxidative burst, those variables affected by effluent exposure were also significantly changed by the low-level sampling stress imposed by staggered sampling. Elevated liver mixed-function oxygenase activity as measured by 7-ethoxyresorufin-O-deethylase activity, and increased bile polycyclic aromatic hydrocarbon (PAH) metabolites were observed in response to sewage effluent exposure. As both PAHs and stress are known immune suppressors, it is difficult to conclude whether or not changes in immune

  16. Effects of treated sewage effluent on immune function in rainbow trout (Oncorhynchus mykiss)

    International Nuclear Information System (INIS)

    Hoeger, Birgit; Heuvel, Michael R. van den; Hitzfeld, Bettina C.; Dietrich, Daniel R.

    2004-01-01

    In this study, the immune reactions of rainbow trout (Oncorhynchus mykiss) were examined, after exposure to 10, 30 and 70% of tertiary-treated municipal sewage effluent for 27 days. Exposures were conducted concurrently with and without an immune challenge using intraperitoneal injections of inactivated Aeromonas salmonicida salmonicida. Due to the time required to prepare and analyse samples, fish sampling was conducted over two consecutive days. There was no trout mortality for any of the experimental treatments. The exposure to effluent increased in vitro lymphocyte proliferation, decreased circulating lymphocytes and increased degrading erythrocytes in peripheral blood samples. Circulating lymphocytes were only decreased in the sham-injected, but not in the A. salmonicida-injected group. In addition to effluent effects, circulating lymphocytes and lymphocyte proliferation were decreased on day 2 of sampling as compared to day 1. Concentration-dependent degradation of erythrocytes was only observed on day 2 of sampling. Capture and removal of trout on day 1 of sampling presumably caused low-level stress that affected some results on day 2. Oxidative burst, phagocytosis, lysozyme, leucocyte populations other than lymphocytes and A. salmonicida-specific IgM production were not affected by exposure to effluent, and of these parameters, only oxidative burst and total leucocytes showed sampling day effects. From these results it can be observed, that with the exception of oxidative burst, those variables affected by effluent exposure were also significantly changed by the low-level sampling stress imposed by staggered sampling. Elevated liver mixed-function oxygenase activity as measured by 7-ethoxyresorufin-O-deethylase activity, and increased bile polycyclic aromatic hydrocarbon (PAH) metabolites were observed in response to sewage effluent exposure. As both PAHs and stress are known immune suppressors, it is difficult to conclude whether or not changes in immune

  17. Percutaneous renal angioplasty and stenting: application of embolic protection device in patients with normal renal function

    International Nuclear Information System (INIS)

    Tong Xiaoqiang; Yang Ming; Wang Jian; Song Li; Wang Chao; Lv Yongxing; Sun Hongliang; Zou Yinghua; Yin Ming

    2007-01-01

    Objective: To investigate the Value of embolic protection device (EPD)in renal artery stenting (RAS)for the patients with normal renal function. Methods: Total 24 patients (26 renal arteries) suffering from renal artery stenosis with normal serum creatinine were divided into two groups: EPD group (n12)and non-EPD group (n=12). Serum creatinine was calculated and analized statistically between the two groups, 1 month and 6months after stenting respectively, and followed by comparisons taking inside of each group and between both groups. Results: Serum creatinine of the EPD and non-EPD groups before, 1 month and 6 month after stenting were(99.18 ± 18.26) μmol/L, (101.73 ± 12.65) μmol/L, (96.82 ± 15.81) μmol/L and (100.18 ± 19.81) μmol/L, (107.36 ± 29.49) μmol/L, (127.64 ± 88.05) μmol/L, respectively; showing no significant difference inside each group individually (P>0.05), and also no statistically significant difference between the two groups (P>0.05). Conclusion: For the patients suffering from renal artery stenosis with normal serum creatinine, application of EPD may have no impact on renal function. Further evaluation is needed. (authors)

  18. Proportional and functional analogical reasoning in normal and language-impaired children.

    Science.gov (United States)

    Nippold, M A; Erskine, B J; Freed, D B

    1988-11-01

    Teachers often use analogies in classroom settings to clarify new concepts for their students. However, analogies may inadvertently confuse the youngster who has difficulty identifying the one-to-one comparisons underlying them. Although analogical reasoning has been studied extensively in normal children, no information was available concerning this construct in children having a specific language impairment. Thus, it was unknown to what extent they might be deficient in analogical reasoning. Therefore, in the present study, 20 children ages 6-8 years (mean age = 7:6) having normal nonverbal intelligence but deficits in language comprehension were administered tasks of verbal and perceptual proportional analogical reasoning and a problem-solving task of functional analogical reasoning. Compared to a normal-language control group matched on the basis of chronological age and sex, the language-impaired group was deficient in all three tasks of analogical reasoning. However, when the factor of nonverbal intelligence was controlled statistically, the differences between the groups on each of the tasks were removed. Additional findings were that verbal proportional analogical reasoning was significantly correlated to perceptual proportional analogical reasoning and to functional analogical reasoning. Implications for assessment and intervention with young school-age language-impaired children are discussed.

  19. Impact of enteral nutrition on postoperative immune function and nutritional status.

    Science.gov (United States)

    Wang, F; Hou, M X; Wu, X L; Bao, L D; Dong, P D

    2015-06-10

    We studied the effects of enteral nutrition (EN) support initiated 1 week before surgery on postoperative nutritional status, immune function, and inflammatory response in gastric cancer patients. A total of 200 gastric cancer patients were randomly divided into two groups: EN starting 1 week before surgery (study group) and EN starting early after surgery (control group). The two groups received EN support, following different therapeutic schedules, until the 9th day after operation. In the patients, body weight, skinfold thickness, upper-arm circumference, white blood cell count, albumin, prealbumin, C-reactive protein, peripheral immunoglobulins (IgA, IgG, and IgM), T lymphocyte subsets, interleukin-6, and tumor necrosis factor-α were measured 10 days before and after surgery and on the first day after surgery. There was no statistically significant difference in the results of recovery time of passage of gas by anus, abdominal distension, stomachache, blood glucose, hepatic and renal functions, and electrolytes between the two groups of patients (P > 0. 05). Adverse reactions occurred to both groups at 1 and 2 days after operation. Such conditions was improved after the intravenous drip rate was adjusted. The albumin and prealbumin levels of the patients in both groups decreased at 1 day after operation (P gastric cancer patients can improve their postoperative nutritional status and immune function, can reduce inflammatory response, and is more conducive to the recovery of patients.

  20. The Phagocytic Function of Macrophage-Enforcing Innate Immunity and Tissue Homeostasis

    Directory of Open Access Journals (Sweden)

    Daisuke Hirayama

    2017-12-01

    Full Text Available Macrophages are effector cells of the innate immune system that phagocytose bacteria and secrete both pro-inflammatory and antimicrobial mediators. In addition, macrophages play an important role in eliminating diseased and damaged cells through their programmed cell death. Generally, macrophages ingest and degrade dead cells, debris, tumor cells, and foreign materials. They promote homeostasis by responding to internal and external changes within the body, not only as phagocytes, but also through trophic, regulatory, and repair functions. Recent studies demonstrated that macrophages differentiate from hematopoietic stem cell-derived monocytes and embryonic yolk sac macrophages. The latter mainly give rise to tissue macrophages. Macrophages exist in all vertebrate tissues and have dual functions in host protection and tissue injury, which are maintained at a fine balance. Tissue macrophages have heterogeneous phenotypes in different tissue environments. In this review, we focused on the phagocytic function of macrophage-enforcing innate immunity and tissue homeostasis for a better understanding of the role of tissue macrophages in several pathological conditions.

  1. Qualitative analysis of a stochastic epidemic model with specific functional response and temporary immunity

    Science.gov (United States)

    Hattaf, Khalid; Mahrouf, Marouane; Adnani, Jihad; Yousfi, Noura

    2018-01-01

    In this paper, we propose a stochastic delayed epidemic model with specific functional response. The time delay represents temporary immunity period, i.e., time from recovery to becoming susceptible again. We first show that the proposed model is mathematically and biologically well-posed. Moreover, the extinction of the disease and the persistence in the mean are established in the terms of a threshold value R0S which is smaller than the basic reproduction number R0 of the corresponding deterministic system.

  2. 3,3′-Diindolylmethane Stimulates Murine Immune Function In Vitro and In Vivo*

    OpenAIRE

    Xue, Ling; Pestka, James J.; Li, Maoxiang; Firestone, Gary L; Bjeldanes, Leonard F.

    2007-01-01

    3,3′-Diindolylmethane (DIM), a major condensation product of indole-3-carbinol (I3C), exhibits chemopreventive properties in animal models of cancer. Recent studies have shown that DIM stimulates interferon-gamma (IFN-γ) production and potentiates the IFN-γ signaling pathway in human breast cancer cells via a mechanism that includes increased expression of the IFN-γ receptor. The goal of this study was to test the hypothesis that DIM modulates the murine immune function. Specifically, the eff...

  3. Inhibition of CXCL12 signaling attenuates the postischemic immune response and improves functional recovery after stroke

    DEFF Research Database (Denmark)

    Ruscher, Karsten; Kuric, Enida; Liu, Yawei

    2013-01-01

    cell-derived factor-1 (CXCL12). To mimic beneficial effects of EE, we studied the impact of inhibiting CXCL12 action on functional recovery after transient MCAO (tMCAO). Rats treated with the specific CXCL12 receptor antagonist 1-[4-(1,4,8,11-tetrazacyclotetradec-1-ylmethyl)phenyl]methyl]-1......After stroke, brain inflammation in the ischemic hemisphere hampers brain tissue reorganization and functional recovery. Housing rats in an enriched environment (EE) dramatically improves recovery of lost neurologic functions after experimental stroke. We show here that rats housed in EE after......,4,8,11-tetrazacyclo-tetradecan (AMD3100) showed improved recovery compared with saline-treated rats after tMCAO, without a concomitant reduction in infarct size. This was accompanied by a reduction of infiltrating immune cells in the ischemic hemisphere, particularly cluster of differentiation 3-positive (CD3...

  4. The multifaceted functions of C/EBPα in normal and malignant haematopoiesis.

    Science.gov (United States)

    Ohlsson, E; Schuster, M B; Hasemann, M; Porse, B T

    2016-04-01

    The process of blood formation, haematopoiesis, depends upon a small number of haematopoietic stem cells (HSCs) that reside in the bone marrow. Differentiation of HSCs is characterised by decreased expression of genes associated with self-renewal accompanied by a stepwise activation of genes promoting differentiation. Lineage branching is further directed by groups of cooperating and counteracting genes forming complex networks of lineage-specific transcription factors. Imbalances in such networks can result in blockage of differentiation, lineage reprogramming and malignant transformation. CCAAT/enhancer-binding protein-α (C/EBPα) was originally identified 30 years ago as a transcription factor that binds both promoter and enhancer regions. Most of the early work focused on the role of C/EBPα in regulating transcriptional processes as well as on its functions in key differentiation processes during liver, adipogenic and haematopoietic development. Specifically, C/EBPα was shown to control differentiation by its ability to coordinate transcriptional output with cell cycle progression. Later, its role as an important tumour suppressor, mainly in acute myeloid leukaemia (AML), was recognised and has been the focus of intense studies by a number of investigators. More recent work has revisited the role of C/EBPα in normal haematopoiesis, especially its function in HSCs, and also started to provide more mechanistic insights into its role in normal and malignant haematopoiesis. In particular, the differential actions of C/EBPα isoforms, as well as its importance in chromatin remodelling and cellular reprogramming, are beginning to be elucidated. Finally, recent work has also shed light on the dichotomous function of C/EBPα in AML by demonstrating its ability to act as both a tumour suppressor and promoter. In the present review, we will summarise the current knowledge on the functions of C/EBPα during normal and malignant haematopoiesis with special emphasis on

  5. Functional Analysis of the Tomato Immune Receptor Ve1 through Domain Swaps with Its Non-Functional Homolog Ve2

    Science.gov (United States)

    Rovenich, Hanna; Song, Yin; Liebrand, Thomas W. H.; Masini, Laura; van den Berg, Grardy C. M.; Joosten, Matthieu H. A. J.; Thomma, Bart P. H. J.

    2014-01-01

    Resistance in tomato against race 1 strains of the fungal vascular wilt pathogens Verticillium dahliae and V. albo-atrum is mediated by the Ve locus. This locus comprises two closely linked inversely oriented genes, Ve1 and Ve2, which encode cell surface receptors of the extracellular leucine-rich repeat receptor-like protein (eLRR-RLP) type. While Ve1 mediates Verticillium resistance through monitoring the presence of the recently identified V. dahliae Ave1 effector, no functionality for Ve2 has been demonstrated in tomato. Ve1 and Ve2 contain 37 eLRRs and share 84% amino acid identity, facilitating investigation of Ve protein functionality through domain swapping. In this study it is shown that Ve chimeras in which the first thirty eLRRs of Ve1 were replaced by those of Ve2 remain able to induce HR and activate Verticillium resistance, and that deletion of these thirty eLRRs from Ve1 resulted in loss of functionality. Also the region between eLRR30 and eLRR35 is required for Ve1-mediated resistance, and cannot be replaced by the region between eLRR30 and eLRR35 of Ve2. We furthermore show that the cytoplasmic tail of Ve1 is required for functionality, as truncation of this tail results in loss of functionality. Moreover, the C-terminus of Ve2 fails to activate immune signaling as chimeras containing the C-terminus of Ve2 do not provide Verticillium resistance. Furthermore, Ve1 was found to interact through its C-terminus with the eLRR-containing receptor-like kinase (eLRR-RLK) interactor SOBIR1 that was recently identified as an interactor of eLRR-RLP (immune) receptors. Intriguingly, also Ve2 was found to interact with SOBIR1. PMID:24505431

  6. Frank A. Beach award: programming of neuroendocrine function by early-life experience: a critical role for the immune system.

    Science.gov (United States)

    Bilbo, Staci D

    2013-05-01

    Many neuropsychiatric disorders are associated with a strong dysregulation of the immune system, and several have a striking etiology in development as well. Our recent evidence using a rodent model of neonatal Escherichia coli infection has revealed novel insight into the mechanisms underlying cognitive deficits in adulthood, and suggests that the early-life immune history of an individual may be critical to understanding the relative risk of developing later-life mental health disorders in humans. A single neonatal infection programs the function of immune cells within the brain, called microglia, for the life of the rodent such that an adult immune challenge results in exaggerated cytokine production within the brain and associated cognitive deficits. I describe the important role of the immune system, notably microglia, during brain development, and discuss some of the many ways in which immune activation during early brain development can affect the later-life outcomes of neural function, immune function, and cognition. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  8. Abnormal immune system development and function in schizophrenia helps reconcile diverse findings and suggests new treatment and prevention strategies.

    Science.gov (United States)

    Anders, Sherry; Kinney, Dennis K

    2015-08-18

    Extensive research implicates disturbed immune function and development in the etiology and pathology of schizophrenia. In addition to reviewing evidence for immunological factors in schizophrenia, this paper discusses how an emerging model of atypical immune function and development helps explain a wide variety of well-established - but puzzling - findings about schizophrenia. A number of theorists have presented hypotheses that early immune system programming, disrupted by pre- and perinatal adversity, often combines with abnormal brain development to produce schizophrenia. The present paper focuses on the hypothesis that disruption of early immune system development produces a latent immune vulnerability that manifests more fully after puberty, when changes in immune function and the thymus leave individuals more susceptible to infections and immune dysfunctions that contribute to schizophrenia. Complementing neurodevelopmental models, this hypothesis integrates findings on many contributing factors to schizophrenia, including prenatal adversity, genes, climate, migration, infections, and stress, among others. It helps explain, for example, why (a) schizophrenia onset is typically delayed until years after prenatal adversity, (b) individual risk factors alone often do not lead to schizophrenia, and (c) schizophrenia prevalence rates actually tend to be higher in economically advantaged countries. Here we discuss how the hypothesis explains 10 key findings, and suggests new, potentially highly cost-effective, strategies for treatment and prevention of schizophrenia. Moreover, while most human research linking immune factors to schizophrenia has been correlational, these strategies provide ethical ways to experimentally test in humans theories about immune function and schizophrenia. This article is part of a Special Issue entitled SI: Neuroimmunology in Health And Disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The influence of recovery and training phases on body composition, peripheral vascular function and immune system of professional soccer players.

    Directory of Open Access Journals (Sweden)

    Simon Reinke

    Full Text Available Professional soccer players have a lengthy playing season, throughout which high levels of physical stress are maintained. The following recuperation period, before starting the next pre-season training phase, is generally considered short but sufficient to allow a decrease in these stress levels and therefore a reduction in the propensity for injury or musculoskeletal tissue damage. We hypothesised that these physical extremes influence the body composition, blood flow, and endothelial/immune function, but that the recuperation may be insufficient to allow a reduction of tissue stress damage. Ten professional football players were examined at the end of the playing season, at the end of the season intermission, and after the next pre-season endurance training. Peripheral blood flow and body composition were assessed using venous occlusion plethysmography and DEXA scanning respectively. In addition, selected inflammatory and immune parameters were analysed from blood samples. Following the recuperation period a significant decrease of lean body mass from 74.4+/-4.2 kg to 72.2+/-3.9 kg was observed, but an increase of fat mass from 10.3+/-5.6 kg to 11.1+/-5.4 kg, almost completely reversed the changes seen in the pre-season training phase. Remarkably, both resting and post-ischemic blood flow (7.3+/-3.4 and 26.0+/-6.3 ml/100 ml/min respectively, were strongly reduced during the playing and training stress phases, but both parameters increased to normal levels (9.0+/-2.7 and 33.9+/-7.6 ml/100 ml/min during the season intermission. Recovery was also characterized by rising levels of serum creatinine, granulocytes count, total IL-8, serum nitrate, ferritin, and bilirubin. These data suggest a compensated hypo-perfusion of muscle during the playing season, followed by an intramuscular ischemia/reperfusion syndrome during the recovery phase that is associated with muscle protein turnover and inflammatory endothelial reaction, as demonstrated by i

  10. RhIL-11 treatment normalized Th1/Th2 and T-bet/GATA-3 imbalance in in human immune thrombocytopenic purpura (ITP).

    Science.gov (United States)

    Lin, Ying; Zhou, Xieming; Guo, Wenjian; Li, Qianqian; Pan, Xiahui; Bao, Yunhua; He, Muqing; Zhu, Baoling; Lin, Xiaoji; Jin, Limin; Yao, Rongxin

    2016-09-01

    Immune thrombocytopenia (ITP) is an autoimmune hemorrhagic disorder characterized by reduction in platelet counts. T helper 1 (Th1) cells polarization with an increased shift of Th1/Th2 ratio has been reported in ITP. This shift is associated with transcription factor T-box expressed in T cells (T-bet) upregulation and GATA-binding protein 3 (GATA-3) downregulation, leading to an increased T-bet/GATA-3 ratio. Our previous in vitro study showed that recombinant human interleukin-11 (rhIL-11) could normalize Th1/Th2 imbalance in the peripheral blood mononuclear cells (PBMCs) isolated from adult ITP patients, which co-occurred with T-bet/GATA-3 ratio restoration. In this report, we investigated whether rhIL-11 had therapeutic effect in clinical ITP patients and whether rhIL-11 treatment could normalize Th1/Th2 and T-bet/GATA-3 levels in vivo. We found rhIL-11 treatment had a response rate of 67.7% and significantly decreased Th1 and T-bet levels but increased Th2 and GATA-3 levels in ITP patients who showed good response, normalizing Th1/Th2 and T-bet/GATA-3 ratios similar to that in healthy controls. Thus our study suggested rhIL-11 was effective with tolerable adverse effects in ITP. The treatment strategy warrants further clinical investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  12. Immune function surveillance: association with rejection, infection and cardiac allograft vasculopathy.

    Science.gov (United States)

    Heikal, N M; Bader, F M; Martins, T B; Pavlov, I Y; Wilson, A R; Barakat, M; Stehlik, J; Kfoury, A G; Gilbert, E M; Delgado, J C; Hill, H R

    2013-01-01

    Rejection, cardiac allograft vasculopathy (CAV), and infection are significant causes of mortality in heart transplantation recipients. Assessing the immune status of a particular patient remains challenging. Although endomyocardial biopsy (EMB) and angiography are effective for the identification of rejection and CAV, respectively, these are expensive, invasive, and may have numerous complications. The aim of this study was to evaluate the immune function and assess its utility in predicting rejection, CAV, and infection in heart transplantation recipients. We prospectively obtained samples at the time of routine EMB and when clinically indicated for measurement of the ImmuKnow assay (IM), 12 cytokines and soluble CD30 (sCD30). EMB specimens were evaluated for acute cellular rejection, and antibody-mediated rejection (AMR). CAV was diagnosed by the development of angiographic coronary artery disease. Infectious episodes occurring during the next 30 days after testing were identified by the presence of positive bacterial or fungal cultures and/or viremia that prompted treatment with antimicrobials. We collected 162 samples from 56 cardiac transplant recipients. There were 31 infection episodes, 7 AMR, and 4 CAV cases. The average IM value was significantly lower during infection, (P = .04). Soluble CD30 concentrations showed significantly positive correlation with infection episodes, (P = .001). Significant positive correlation was observed between interleukin-5(IL-5) and AMR episodes (P = .008). Tumor necrosis factor-α and IL-8 showed significant positive correlation with CAV (P = .001). Immune function monitoring appears promising in predicting rejection, CAV, and infection in cardiac transplantation recipients. This approach may help in more individualized immunosuppression and it may also minimize unnecessary EMBs and cardiac angiographies. Published by Elsevier Inc.

  13. Effects of ration level on immune functions in chinook salmon (Oncorhynchus tshawytscha)

    Science.gov (United States)

    Alcorn, S.W.; Pascho, R.J.; Murray, A.L.; Shearer, K.D.

    2003-01-01

    The relationship between nutritional status and disease resistance in cultured salmonids can be affected by dietary manipulations. Careful attention to feeding levels may be important to avoid imbalances in nutrient levels that could ultimately impair a fish's ability to resist infectious microorganisms. In the current study, fish in three feed-level groups were fed an experimental diet either to satiation, 64% of satiation or 40% of satiation. A fourth group of fish were fed a commercial diet at the 64% of satiation level and served as controls. To evaluate certain indices of disease resistance in the test and control fish, a panel of assays was employed to measure humoral and cellular immune functions 30, 39 and 54 weeks after starting the dietary treatments. The panel included measures of blood hematocrit and leucocrit levels, plasma protein concentration and serum lysozyme and complement activity. Cellular analyses included differential blood leucocyte counts, NBT reduction and phagocytosis by pronephros macrophages and myeloperoxidase activity of pronephros neutrophils. No differences were observed in those indices between fish tested from the control-diet group (commercial diet fed at the 64% rate) and fish tested from the 64% feed-level group, except that fish fed the commercial diet had a greater concentration of plasma protein. Leucocrit values and plasma protein concentrations tended to increase among the experimental feed groups as the ration increased from 40% to satiation. More importantly, phagocytic activity by anterior kidney leucocytes was found to be inversely proportional to the feed level. Whereas the results of this study provide evidence that the salmonid immune system may be fairly robust with regard to available metabolic energy, the significant changes observed in phagocytic cell activity suggest that some cellular immune functions may be affected by the feed level.

  14. Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

    International Nuclear Information System (INIS)

    Foley, P. T.; Kavnoudias, H.; Cameron, P. U.; Czarnecki, C.; Paul, E.; Lyon, S. M.

    2015-01-01

    PurposeTo compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels.Materials and MethodsPatients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population.ResultsOf the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation—a difference that could not be attributed to differences in age, grade of injury or residual splenic volume.ConclusionIgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function

  15. Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

    Energy Technology Data Exchange (ETDEWEB)

    Foley, P. T., E-mail: pfoley@doctors.org.uk [The Canberra Hospital, Department of Medical Imaging (Australia); Kavnoudias, H., E-mail: h.kavnoudias@alfred.org.au [The Alfred Hospital, Radiology Research Unit, Radiology Department (Australia); Cameron, P. U., E-mail: paul.cameron@unimelb.edu.au [The Alfred Hospital, Infectious Diseases Unit (Australia); Czarnecki, C., E-mail: caroline.czarnecki@gmail.com [Royal Melbourne Hospital, Radiology Department (Australia); Paul, E., E-mail: eldho.paul@monash.edu [Monash University, Department of Epidemiology & Preventive Medicine, School of Public Health and Preventive Medicine, Alfred Hospital (Australia); Lyon, S. M., E-mail: lyonsey@optusnet.com.au [Melbourne Endovascular (Australia)

    2015-10-15

    PurposeTo compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels.Materials and MethodsPatients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population.ResultsOf the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation—a difference that could not be attributed to differences in age, grade of injury or residual splenic volume.ConclusionIgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function.

  16. Proximal Versus Distal Splenic Artery Embolisation for Blunt Splenic Trauma: What is the Impact on Splenic Immune Function?

    Science.gov (United States)

    Foley, P T; Kavnoudias, H; Cameron, P U; Czarnecki, C; Paul, E; Lyon, S M

    2015-10-01

    To compare the impact of proximal or distal splenic artery embolisation versus that of splenectomy on splenic immune function as measured by IgM memory B cell levels. Patients with splenic trauma who were treated by splenic artery embolisation (SAE) were enrolled. After 6 months splenic volume was assessed by CT, and IgM memory B cells in peripheral blood were measured and compared to a local normal reference population and to a post-splenectomy population. Of the 71 patients who underwent embolisation, 38 underwent proximal embolisation, 11 underwent distal embolisation, 22 patients were excluded, 1 had both proximal and distal embolisation, 5 did not survive and 16 did not return for evaluation. There was a significant difference between splenectomy and proximal or distal embolisation and a trend towards greater preservation of IgM memory B cell number in those with distal embolisation-a difference that could not be attributed to differences in age, grade of injury or residual splenic volume. IgM memory B cell levels are significantly higher in those treated with SAE compared to splenectomy. Our data provide evidence that splenic embolisation should reduce immunological complications of spleen trauma and suggest that distal embolisation may maintain better function.

  17. Can Functional Cardiac Age be Predicted from ECG in a Normal Healthy Population

    Science.gov (United States)

    Schlegel, Todd; Starc, Vito; Leban, Manja; Sinigoj, Petra; Vrhovec, Milos

    2011-01-01

    In a normal healthy population, we desired to determine the most age-dependent conventional and advanced ECG parameters. We hypothesized that changes in several ECG parameters might correlate with age and together reliably characterize the functional age of the heart. Methods: An initial study population of 313 apparently healthy subjects was ultimately reduced to 148 subjects (74 men, 84 women, in the range from 10 to 75 years of age) after exclusion criteria. In all subjects, ECG recordings (resting 5-minute 12-lead high frequency ECG) were evaluated via custom software programs to calculate up to 85 different conventional and advanced ECG parameters including beat-to-beat QT and RR variability, waveform complexity, and signal-averaged, high-frequency and spatial/spatiotemporal ECG parameters. The prediction of functional age was evaluated by multiple linear regression analysis using the best 5 univariate predictors. Results: Ignoring what were ultimately small differences between males and females, the functional age was found to be predicted (R2= 0.69, P ECGs, functional cardiac age can be estimated by multiple linear regression analysis of mostly advanced ECG results. Because some parameters in the regression formula, such as QTcorr, high frequency QRS amplitude and P-wave width also change with disease in the same direction as with increased age, increased functional age of the heart may reflect subtle age-related pathologies in cardiac electrical function that are usually hidden on conventional ECG.

  18. Decreased IGF-1 concentration during the first trimester of pregnancy in women with normal somatotroph function.

    Science.gov (United States)

    Persechini, Marie-Laure; Gennero, Isabelle; Grunenwald, Solange; Vezzosi, Delphine; Bennet, Antoine; Caron, Philippe

    2015-08-01

    A decrease of insulin-like growth factor-I levels (IGF-I) has been reported during the first trimester of pregnancy in women with acromegaly before the secretion of placental growth hormone (GH) progressively increases IGF-1 concentration. To evaluate variations of concentrations of IGF-1, insulin-like growth factor (IGF)-binding protein-3 (IGF-BP3) and GH during the first trimester of pregnancy in women with normal somatotroph function. Sixteen women (median age 31 years) with as who were followed for benign thyroid disorders (n = 15) or prolactin-secreting microadenoma (n = 1) were evaluated before and in the first trimester of pregnancy. Serum concentrations of GH, IGF-1, IGF-BP3, TSH and estradiol (E2) were measured before and in the first trimester (5.4 ± 2.2 weeks of gestation). Before pregnancy, somatotroph and thyroid functions (median TSH 1.2 mU/L) were normal in all women. At the first trimester IGF-1 levels decreased significantly (before = 210 ng/mL, first trimester = 145 ng/mL, p function, IGF-1 levels decrease in the first trimester of pregnancy without changes in GH or IGF-BP3 levels. These results confirm liver resistance to GH as a consequence of the physiological increase of estrogens during the first trimester.

  19. Disrupted-in-Schizophrenia-1 is essential for normal hypothalamic-pituitary-interrenal (HPI) axis function.

    Science.gov (United States)

    Eachus, Helen; Bright, Charlotte; Cunliffe, Vincent T; Placzek, Marysia; Wood, Jonathan D; Watt, Penelope J

    2017-06-01

    Psychiatric disorders arise due to an interplay of genetic and environmental factors, including stress. Studies in rodents have shown that mutants for Disrupted-In-Schizophrenia-1 (DISC1), a well-accepted genetic risk factor for mental illness, display abnormal behaviours in response to stress, but the mechanisms through which DISC1 affects stress responses remain poorly understood. Using two lines of zebrafish homozygous mutant for disc1, we investigated behaviour and functioning of the hypothalamic-pituitary-interrenal (HPI) axis, the fish equivalent of the hypothalamic-pituitary-adrenal (HPA) axis. Here, we show that the role of DISC1 in stress responses is evolutionarily conserved and that DISC1 is essential for normal functioning of the HPI axis. Adult zebrafish homozygous mutant for disc1 show aberrant behavioural responses to stress. Our studies reveal that in the embryo, disc1 is expressed in neural progenitor cells of the hypothalamus, a conserved region of the vertebrate brain that centrally controls responses to environmental stressors. In disc1 mutant embryos, proliferating rx3+ hypothalamic progenitors are not maintained normally and neuronal differentiation is compromised: rx3-derived ff1b+ neurons, implicated in anxiety-related behaviours, and corticotrophin releasing hormone (crh) neurons, key regulators of the stress axis, develop abnormally, and rx3-derived pomc+ neurons are disorganised. Abnormal hypothalamic development is associated with dysfunctional behavioural and neuroendocrine stress responses. In contrast to wild type siblings, disc1 mutant larvae show altered crh levels, fail to upregulate cortisol levels when under stress and do not modulate shoal cohesion, indicative of abnormal social behaviour. These data indicate that disc1 is essential for normal development of the hypothalamus and for the correct functioning of the HPA/HPI axis. © The Author 2017. Published by Oxford University Press.

  20. Anxiety and beta-adrenergic receptor function in a normal population.

    Science.gov (United States)

    Kang, Eun-Ho; Yu, Bum-Hee

    2005-06-01

    Many studies have shown a close relationship between anxiety and beta-adrenergic receptor function in patients with anxiety disorders. This study examined the relationship between beta-adrenergic receptor function and anxiety levels in a normal population. Subjects for this study included 36 men and 44 women between the ages of 20 and 40 years whose Body Mass Index (BMI) was between 18 and 26. All of them were healthy subjects who had no previous history of medical or psychiatric illnesses. The authors measured the Spielberger State-Trait Anxiety Inventory (STAI), Beck Depression Inventory (BDI), and Chronotropic 25 Dose (CD25) of isoproterenol, previously developed to assess in vivo beta-adrenergic receptor sensitivity. We also examined correlations between log normalized CD25 and mood states. The mean of CD25 was 2.64+/-1.37 mug and the mean of CD25 in men was significantly higher (i.e., lower beta-adrenergic receptor sensitivity) than that of women (3.26+/-1.35 vs. 2.14+/-1.17 microg; t = 3.99, p anxiety (r = -0.344, p = 0.002), trait anxiety (r = -0.331, p = 0.003), and BDI (r = -0.283, p = 0.011). CD25 was positively correlated with BMI (r = 0.423, p anxiety, and BMI. The sensitivity of beta-adrenergic receptors increased as anxiety levels became higher in a normal population. Thus, the relationship between anxiety and beta-adrenergic receptor function in healthy subjects may be different from that of patients with anxiety disorders.

  1. Anti-Tribbles Pseudokinase 2 (TRIB2)-Immunization Modulates Hypocretin/Orexin Neuronal Functions.

    Science.gov (United States)

    Tanaka, Susumu; Honda, Yoshiko; Honda, Makoto; Yamada, Hisao; Honda, Kazuki; Kodama, Tohru

    2017-01-01

    Recent findings showed that 16%-26% of narcolepsy patients were positive for anti-tribbles pseudokinase 2 (TRIB2) antibody, and the intracerebroventricular administration of immunoglobulin-G purified from anti-TRIB2 positive narcolepsy patients caused hypocretin/orexin neuron loss. We investigated the pathophysiological role of TRIB2 antibody using TRIB2-immunized rats and hypocretin/ataxin-3 transgenic (ataxin-3) mice. Plasma, cerebrospinal fluid (CSF), and hypothalamic tissues from TRIB2-immunized rats were collected. Anti-TRIB2 titers, hypocretin contents, mRNA expressions, the cell count of hypocretin neurons, and immunoreactivity of anti-TRIB2 antibodies on hypocretin neurons were investigated. The plasma from ataxin-3 mice was also used to determine the anti-TRIB2 antibody titer changes following the loss of hypocretin neurons. TRIB2 antibody titers increased in the plasma and CSF of TRIB2-immunized rats. The hypothalamic tissue immunostained with the sera from TRIB2-immunized rats revealed positive signals in the cytoplasm of hypcretin neurons. While no changes were found regarding hypothalamic hypocretin contents or cell counts, but there were significant decreases of the hypocretin mRNA level and release into the CSF. The plasma from over 26-week-old ataxin-3 mice, at the advanced stage of hypocretin cell destruction, showed positive reactions against TRIB2 antigen, and positive plasma also reacted with murine hypothalamic hypocretin neurons. Our results suggest that the general activation of the immune system modulates the functions of hypocretin neurons. The absence of a change in hypocretin cell populations suggested that factors other than anti-TRIB2 antibody play a part in the loss of hypocretin neurons in narcolepsy. The increased anti-TRIB2 antibody after the destruction of hypocretin neurons suggest that anti-TRIB2 antibody in narcolepsy patients is the consequence rather than the inciting cause of hypocretin cell destruction. © Sleep Research

  2. Learning and Memory... and the Immune System

    Science.gov (United States)

    Marin, Ioana; Kipnis, Jonathan

    2013-01-01

    The nervous system and the immune system are two main regulators of homeostasis in the body. Communication between them ensures normal functioning of the organism. Immune cells and molecules are required for sculpting the circuitry and determining the activity of the nervous system. Within the parenchyma of the central nervous system (CNS),…

  3. Moment generating functions and Normalized implied volatilities: unification and extension via Fukasawa's pricing formula

    OpenAIRE

    De Marco, Stefano; Martini, Claude

    2017-01-01

    We extend the model-free formula of [Fukasawa 2012] for $\\mathbb E[\\Psi(X_T)]$, where $X_T=\\log S_T/F$ is the log-price of an asset, to functions $\\Psi$ of exponential growth. The resulting integral representation is written in terms of normalized implied volatilities. Just as Fukasawa's work provides rigourous ground for Chriss and Morokoff's (1999) model-free formula for the log-contract (related to the Variance swap implied variance), we prove an expression for the moment generating functi...

  4. Classification of Normal Subjects and Pulmonary Function Disease Patients using Tracheal Respiratory Sound Detection System

    Energy Technology Data Exchange (ETDEWEB)

    Im, Jae Joong; Yi, Young Ju; Jeon, Young Ju [Chonbuk National University (Korea)

    2000-04-01

    A new auscultation system for the detection of breath sound from trachea was developed in house. Small size microphone(panasonic pin microphone) was encapsuled in a housing for resonant effect, and hardware for the sound detection was fabricated. Pulmonary function test results were compared with the parameters extracted from frequency spectrum of breath sound obtained from the developed system. Results showed that the peak frequency and relative ratio of integral values between low(80-400Hz) and high(400-800Hz) frequency ranges revealed the significant differences. Developed system could be used for distinguishing normal subject and the patients who have pulmonary disease. (author). 13 refs., 9 figs.

  5. Predicting above normal wildfire activity in southern Europe as a function of meteorological drought

    International Nuclear Information System (INIS)

    Gudmundsson, L; Seneviratne, S I; Rego, F C; Rocha, M

    2014-01-01

    Wildfires are a recurrent feature of ecosystems in southern Europe, regularly causing large ecological and socio-economic damages. For efficient management of this hazard, long lead time forecasts could be valuable tools. Using logistic regression, we show that the probability of above normal summer wildfire activity in the 1985–2010 time period can be forecasted as a function of meteorological drought with significant predictability (p <0.05) several months in advance. The results show that long lead time forecasts of this natural hazard are feasible in southern Europe, which could potentially aid decision-makers in the design of strategies for forest management. (letter)

  6. The effect of short-term glucagon infusion on kidney function in normal man

    DEFF Research Database (Denmark)

    Parving, H H; Noer, J; Kehlet, H

    1977-01-01

    Kidney function was studied in six normal males before and during a 2 h glucagon (10 ng/kg/min) infusion. The following variables were determined during each 20 min clearance period; glomerular filtration rate (GFR), renal plasma-flow (RPF) , filtration fraction (FF), urinary albumin and beta2......-microglobulin-excretion rates. Glucagon infusion resulted in a fourfold increase in plasma glucagon concentration. The infusion induced a significant increase in GFR (+9%), FF (+9%) and urinary beta2-microglobulin excretion rate (+32%), (p less than 0.01). RPF and urinary albumin excretion rates were...

  7. Ultrasonographic assessment of maternal cardiac function and peripheral circulation during normal gestation in dogs.

    Science.gov (United States)

    Blanco, Paula G; Tórtora, Mariana; Rodríguez, Raúl; Arias, Daniel O; Gobello, Cristina

    2011-10-01

    The aim of this study was to describe changes in cardiac morphology, systolic function and some peripheral hemodynamic parameters during normal pregnancy in dogs. Twenty healthy bitches, 10 pregnant (PG) and 10 non-pregnant controls (CG), were evaluated every 10 days using echocardiography from day 0 of the estrus cycle to parturition or to day 65 for the PG and CG groups, respectively. Systolic blood pressure (SBP) and uterine artery resistance index (RI) were also assessed. Throughout the study, the shortening fraction and cardiac output increased up to 30% vs. 5% (Pdogs. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. Stimulatory effect of low dose radiation on the immune function in tumor-bearing mice

    International Nuclear Information System (INIS)

    Zhang Ying; Li Xiujuan; Li Xiuyi; Liu Shuzheng

    1999-01-01

    Objective: The author aims at investigating the effect of whole body irradiation (WBI) with low dose radiation on immune function in tumor-bearing mice. Methods: C57BL/6J mine implanted with Lewis lung carcinoma cells in the right thighs were used as an experimental animal model. WBI with 75 mGy X-rays was given at the 10 th day after implantation and immunological parameters were detected 18 hours after irradiation. The immunological parameters included the spontaneous incorporation of 3 H-TdR into thymocytes, the number of splenocytes, the reaction of splenocytes to ConA and LPS, the splenic production of IL-2, the cytotoxic activities of natural killer (NK) and lymphokine activated killer cells (LAK) as well as specific cytotoxic T lymphocytes (CTL). Results: The immunological parameters of irradiated tumor-bearing mice were significantly increased compared with those of sham-irradiated tumor-bearing mice (P<0.05∼0.01). Conclusion: Low dose radiation could significantly increase the immune function of tumor-bearing mice, and this stimulatory effect may be of some potential significance in tumor therapy

  9. Impact of perioperative blood transfusion on immune function and prognosis in colorectal cancer patients.

    Science.gov (United States)

    Qiu, Li; Wang, Dao-Rong; Zhang, Xiang-Yun; Gao, Shan; Li, Xiao-Xia; Sun, Gong-Ping; Lu, Xiao-Bo

    2016-04-01

    To investigate the impacts of perioperative blood transfusion on the immune function and prognosis in colorectal cancer (CC) patients. A retrospective analysis was conducted in 1404 CC patients, including 1223 sporadic colorectal cancer (SCC) patients and 181 hereditary colorectal cancer (HCC) patients. Among them, 701 SCC and 102 HCC patients received perioperative blood transfusion. The amount of T lymphocyte subsets and natural killer (NK) cells was measured. All patients received a 10-year follow-up and relapse, metastasis and curative conditions were recorded. In SCC group, mortality, local recurrence and distant metastasis rate of transfused patients were significantly higher than non-transfused patients (all P transfused patients than non-transfused patients (P = 0.002). SCC patients transfused with ≥3 U of blood had significantly higher mortality than patients transfused with blood transfusion in SCC and HCC patients (all P blood transfusion (P blood transfusion had markedly lower 10-year survival rates as compared with those who did not receive (both P transfused with ≥3 U of blood had remarkably lower survival rates compared with SCC patients transfused with blood transfusion could impact immune function, increased postoperative mortality, local recurrence rate and distant metastasis rate in CC patients; and survival rate of CC patients is negatively related to blood transfusion volume. Copyright © 2016. Published by Elsevier Ltd.

  10. Brain immune cell composition and functional outcome after cerebral ischemia: Comparison of two mouse strains

    Directory of Open Access Journals (Sweden)

    Hyun Ah eKim

    2014-11-01

    Full Text Available Inflammatory cells may contribute to secondary brain injury following cerebral ischemia. The C57Bl/6 mouse strain is known to exhibit a T helper 1-prone, pro-inflammatory type response to injury, whereas the FVB strain is relatively T helper 2-prone, or anti-inflammatory, in its immune response. We tested whether stroke outcome is more severe in C57Bl/6 than FVB mice. Male mice of each strain underwent sham surgery or 1 h occlusion of the middle cerebral artery followed by 23 h of reperfusion. Despite no difference in infarct size, C57Bl/6 mice displayed markedly greater functional deficits than FVB mice after stroke, as assessed by neurological scoring and hanging wire test. Total numbers of CD45+ leukocytes tended to be larger in the brains of C57Bl/6 than FVB mice after stroke, but there were marked differences in leukocyte composition between the two mouse strains. The inflammatory response in C57Bl/6 mice primarily involved T and B lymphocytes, whereas neutrophils, monocytes and macrophages were more prominent in FVB mice. Our data are consistent with the concept that functional outcome after stroke is dependent on the immune cell composition which develops following ischemic brain injury.

  11. In vitro immune functions in thiamine-replete and -depleted lake trout (Salvelinus namaycush)

    Science.gov (United States)

    Ottinger, Christopher A.; Honeyfield, Dale C.; Densmore, Christine L.; Iwanowicz, Luke R.

    2014-01-01

    In this study we examined the impacts of in vivo thiamine deficiency on lake trout leukocyte function measured in vitro. When compared outside the context of individual-specific thiamine concentrations no significant differences were observed in leukocyte bactericidal activity or in concanavalin A (Con A), and phytohemagglutinin-P (PHA-P) stimulated leukocyte proliferation. Placing immune functions into context with the ratio of in vivo liver thiamine monophosphate (TMP – biologically inactive form) to thiamine pyrophosphate (TPP – biologically active form) proved to be the best indicator of thiamine depletion impacts as determined using regression modeling. These observed relationships indicated differential effects on the immune measures with bactericidal activity exhibiting an inverse relationship with TMP to TPP ratios, Con A stimulated mitogenesis exhibiting a positive relationship with TMP to TPP ratios and PHA-P stimulated mitogenesis exhibiting no significant relationships. In addition, these relationships showed considerable complexity which included the consistent observation of a thiamine-replete subgroup with characteristics similar to those seen in the leukocytes from thiamine-depleted fish. When considered together, our observations indicate that lake trout leukocytes experience cell-type specific impacts as well as an altered physiologic environment when confronted with a thiamine-limited state.

  12. In vitro immune functions in thiamine-replete and -depleted lake trout (Salvelinus namaycush).

    Science.gov (United States)

    Ottinger, Christopher A; Honeyfield, Dale C; Densmore, Christine L; Iwanowicz, Luke R

    2014-05-01

    In this study we examined the impacts of in vivo thiamine deficiency on lake trout leukocyte function measured in vitro. When compared outside the context of individual-specific thiamine concentrations no significant differences were observed in leukocyte bactericidal activity or in concanavalin A (Con A), and phytohemagglutinin-P (PHA-P) stimulated leukocyte proliferation. Placing immune functions into context with the ratio of in vivo liver thiamine monophosphate (TMP--biologically inactive form) to thiamine pyrophosphate (TPP--biologically active form) proved to be the best indicator of thiamine depletion impacts as determined using regression modeling. These observed relationships indicated differential effects on the immune measures with bactericidal activity exhibiting an inverse relationship with TMP to TPP ratios, Con A stimulated mitogenesis exhibiting a positive relationship with TMP to TPP ratios and PHA-P stimulated mitogenesis exhibiting no significant relationships. In addition, these relationships showed considerable complexity which included the consistent observation of a thiamine-replete subgroup with characteristics similar to those seen in the leukocytes from thiamine-depleted fish. When considered together, our observations indicate that lake trout leukocytes experience cell-type specific impacts as well as an altered physiologic environment when confronted with a thiamine-limited state. Published by Elsevier Ltd.

  13. Pregnancy immunology: decidual immune cells.

    Science.gov (United States)

    Sanguansermsri, Donruedee; Pongcharoen, Sutatip

    2008-01-01

    Human pregnancy is a complex process. Placental development depends on the function of secretory molecules produced by placental trophoblast cells as well as by maternal uterine immune cells within the decidua. These decidual immune cells are T cells, natural killer cells, macrophages and dendritic cells. The interactions between the trophoblast cells and the maternal immune cells have an impact on the outcome of the pregnancy. Knowledge about the phenotypes and functions of the maternal immune cells in normal and pathological pregnancies including recurrent spontaneous abortions, preeclampsia and hydatidiform moles may improve our understanding of the immunobiology of the normal pregnancy as a whole and may provide approaches for improving the treatment of pathological pregnancies.

  14. Suppression of adaptive immunity to heterologous antigens during Plasmodium infection through hemozoin-induced failure of dendritic cell function

    Directory of Open Access Journals (Sweden)

    Phillips R

    2006-04-01

    Full Text Available Abstract Background Dendritic cells (DCs are central to the initiation and regulation of the adaptive immune response during infection. Modulation of DC function may therefore allow evasion of the immune system by pathogens. Significant depression of the host's systemic immune response to both concurrent infections and heterologous vaccines has been observed during malaria infection, but the mechanisms underlying this immune hyporesponsiveness are controversial. Results Here, we demonstrate that the blood stages of malaria infection induce a failure of DC function in vitro and in vivo, causing suboptimal activation of T cells involved in heterologous immune responses. This effect on T-cell activation can be transferred to uninfected recipients by DCs isolated from infected mice. Significantly, T cells activated by these DCs subsequently lack effector function, as demonstrated by a failure to migrate to lymphoid-organ follicles, resulting in an absence of B-cell responses to heterologous antigens. Fractionation studies show that hemozoin, rather than infected erythrocyte (red blood cell membranes, reproduces the effect of intact infected red blood cells on DCs. Furthermore, hemozoin-containing DCs could be identified in T-cell areas of the spleen in vivo. Conclusion Plasmodium infection inhibits the induction of adaptive immunity to heterologous antigens by modulating DC function, providing a potential explanation for epidemiological studies linking endemic malaria with secondary infections and reduced vaccine efficacy.

  15. Role of the Ca2+-Calcineurin-Nuclear Factor of Activated T cell Pathway in Mitofusin-2-Mediated Immune Function of Jurkat Cells

    Directory of Open Access Journals (Sweden)

    Xiu-Ping Xu

    2018-01-01

    Conclusions: Our findings suggest that MFN2 may regulate T cell immune functions primarily through the Ca2+-calcineurin-NFAT pathway. MFN2 may represent a potential therapeutic target for T cell immune dysfunction-related diseases.

  16. Improvement of Intestinal Immune Cell Function by Lactic Acid Bacteria for Dairy Products

    Directory of Open Access Journals (Sweden)

    Tomonori Kamiya

    2016-12-01

    Full Text Available Lactic acid bacteria (LAB form a major component of gut microbiota and are often used as probiotics for fermented foods, such as yoghurt. In this study, we aimed to evaluate immunomodulatory activity of LAB, especially that of Lactobacillus bulgaricus ME-552 (ME552 and Streptococcus thermophilus ME-553 (ME553. In vivo/in vitro assay was performed in order to investigate their effects on T cell function. After oral administration of ME553 to C57BL/6 mice, the amount of both interferon γ (IFN-γ and interleukin 17 (IL-17 produced by cluster of differentiation (CD 4+ T cells from Peyer’s patches (PPs were significantly enhanced. On the other hand, ME552 only up-regulated the production of IL-17 from PP cells. The extent of induction for IFN-γ production differed between ME552 and ME553. These results suggest that LAB modulate T cell effector functions and mucosal immunity.

  17. Improvement of Intestinal Immune Cell Function by Lactic Acid Bacteria for Dairy Products.

    Science.gov (United States)

    Kamiya, Tomonori; Watanabe, Yohei; Makino, Seiya; Kano, Hiroshi; Tsuji, Noriko M

    2016-12-23

    Lactic acid bacteria (LAB) form a major component of gut microbiota and are often used as probiotics for fermented foods, such as yoghurt. In this study, we aimed to evaluate immunomodulatory activity of LAB, especially that of Lactobacillus bulgaricus ME-552 (ME552) and Streptococcus thermophilus ME-553 (ME553). In vivo/in vitro assay was performed in order to investigate their effects on T cell function. After oral administration of ME553 to C57BL/6 mice, the amount of both interferon γ (IFN-γ) and interleukin 17 (IL-17) produced by cluster of differentiation (CD) 4⁺ T cells from Peyer's patches (PPs) were significantly enhanced. On the other hand, ME552 only up-regulated the production of IL-17 from PP cells. The extent of induction for IFN-γ production differed between ME552 and ME553. These results suggest that LAB modulate T cell effector functions and mucosal immunity.

  18. CONNECTION BETWEEN DYNAMICALLY DERIVED INITIAL MASS FUNCTION NORMALIZATION AND STELLAR POPULATION PARAMETERS

    International Nuclear Information System (INIS)

    McDermid, Richard M.; Cappellari, Michele; Bayet, Estelle; Bureau, Martin; Davies, Roger L.; Alatalo, Katherine; Blitz, Leo; Bois, Maxime; Bournaud, Frédéric; Duc, Pierre-Alain; Crocker, Alison F.; Davis, Timothy A.; De Zeeuw, P. T.; Emsellem, Eric; Kuntschner, Harald; Khochfar, Sadegh; Krajnović, Davor; Morganti, Raffaella; Oosterloo, Tom; Naab, Thorsten

    2014-01-01

    We report on empirical trends between the dynamically determined stellar initial mass function (IMF) and stellar population properties for a complete, volume-limited sample of 260 early-type galaxies from the ATLAS 3D project. We study trends between our dynamically derived IMF normalization α dyn ≡ (M/L) stars /(M/L) Salp and absorption line strengths, and interpret these via single stellar population-equivalent ages, abundance ratios (measured as [α/Fe]), and total metallicity, [Z/H]. We find that old and alpha-enhanced galaxies tend to have on average heavier (Salpeter-like) mass normalization of the IMF, but stellar population does not appear to be a good predictor of the IMF, with a large range of α dyn at a given population parameter. As a result, we find weak α dyn -[α/Fe] and α dyn –Age correlations and no significant α dyn –[Z/H] correlation. The observed trends appear significantly weaker than those reported in studies that measure the IMF normalization via the low-mass star demographics inferred through stellar spectral analysis

  19. CONNECTION BETWEEN DYNAMICALLY DERIVED INITIAL MASS FUNCTION NORMALIZATION AND STELLAR POPULATION PARAMETERS

    Energy Technology Data Exchange (ETDEWEB)

    McDermid, Richard M. [Department of Physics and Astronomy, Macquarie University, Sydney NSW 2109 (Australia); Cappellari, Michele; Bayet, Estelle; Bureau, Martin; Davies, Roger L. [Sub-Department of Astrophysics, Department of Physics, University of Oxford, Denys Wilkinson Building, Keble Road, Oxford, OX1 3RH (United Kingdom); Alatalo, Katherine [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Blitz, Leo [Department of Astronomy, Campbell Hall, University of California, Berkeley, CA 94720 (United States); Bois, Maxime [Observatoire de Paris, LERMA and CNRS, 61 Av. de l' Observatoire, F-75014 Paris (France); Bournaud, Frédéric; Duc, Pierre-Alain [Laboratoire AIM Paris-Saclay, CEA/IRFU/SAp- CNRS-Université Paris Diderot, F-91191 Gif-sur-Yvette Cedex (France); Crocker, Alison F. [Ritter Astrophysical Observatory, University of Toledo, Toledo, OH 43606 (United States); Davis, Timothy A.; De Zeeuw, P. T.; Emsellem, Eric; Kuntschner, Harald [European Southern Observatory, Karl-Schwarzschild-Str. 2, D-85748 Garching (Germany); Khochfar, Sadegh [Institute for Astronomy, University of Edinburgh, Royal Observatory, Edinburgh, EH9 3HJ (United Kingdom); Krajnović, Davor [Leibniz-Institut für Astrophysik Potsdam (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany); Morganti, Raffaella; Oosterloo, Tom [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, 7990 AA Dwingeloo (Netherlands); Naab, Thorsten, E-mail: richard.mcdermid@mq.edu.au [Max-Planck-Institut für Astrophysik, Karl-Schwarzschild-Str. 1, D-85741 Garching (Germany); and others

    2014-09-10

    We report on empirical trends between the dynamically determined stellar initial mass function (IMF) and stellar population properties for a complete, volume-limited sample of 260 early-type galaxies from the ATLAS{sup 3D} project. We study trends between our dynamically derived IMF normalization α{sub dyn} ≡ (M/L){sub stars}/(M/L){sub Salp} and absorption line strengths, and interpret these via single stellar population-equivalent ages, abundance ratios (measured as [α/Fe]), and total metallicity, [Z/H]. We find that old and alpha-enhanced galaxies tend to have on average heavier (Salpeter-like) mass normalization of the IMF, but stellar population does not appear to be a good predictor of the IMF, with a large range of α{sub dyn} at a given population parameter. As a result, we find weak α{sub dyn}-[α/Fe] and α{sub dyn} –Age correlations and no significant α{sub dyn} –[Z/H] correlation. The observed trends appear significantly weaker than those reported in studies that measure the IMF normalization via the low-mass star demographics inferred through stellar spectral analysis.

  20. Connection between Dynamically Derived Initial Mass Function Normalization and Stellar Population Parameters

    Science.gov (United States)

    McDermid, Richard M.; Cappellari, Michele; Alatalo, Katherine; Bayet, Estelle; Blitz, Leo; Bois, Maxime; Bournaud, Frédéric; Bureau, Martin; Crocker, Alison F.; Davies, Roger L.; Davis, Timothy A.; de Zeeuw, P. T.; Duc, Pierre-Alain; Emsellem, Eric; Khochfar, Sadegh; Krajnović, Davor; Kuntschner, Harald; Morganti, Raffaella; Naab, Thorsten; Oosterloo, Tom; Sarzi, Marc; Scott, Nicholas; Serra, Paolo; Weijmans, Anne-Marie; Young, Lisa M.

    2014-09-01

    We report on empirical trends between the dynamically determined stellar initial mass function (IMF) and stellar population properties for a complete, volume-limited sample of 260 early-type galaxies from the ATLAS3D project. We study trends between our dynamically derived IMF normalization αdyn ≡ (M/L)stars/(M/L)Salp and absorption line strengths, and interpret these via single stellar population-equivalent ages, abundance ratios (measured as [α/Fe]), and total metallicity, [Z/H]. We find that old and alpha-enhanced galaxies tend to have on average heavier (Salpeter-like) mass normalization of the IMF, but stellar population does not appear to be a good predictor of the IMF, with a large range of αdyn at a given population parameter. As a result, we find weak αdyn-[α/Fe] and αdyn -Age correlations and no significant αdyn -[Z/H] correlation. The observed trends appear significantly weaker than those reported in studies that measure the IMF normalization via the low-mass star demographics inferred through stellar spectral analysis.

  1. Pluripotency Genes and Their Functions in the Normal and Aberrant Breast and Brain

    Directory of Open Access Journals (Sweden)

    Tracy Seymour

    2015-11-01

    Full Text Available Pluripotent stem cells (PSCs attracted considerable interest with the successful isolation of embryonic stem cells (ESCs from the inner cell mass of murine, primate and human embryos. Whilst it was initially thought that the only PSCs were ESCs, in more recent years cells with similar properties have been isolated from organs of the adult, including the breast and brain. Adult PSCs in these organs have been suggested to be remnants of embryonic development that facilitate normal tissue homeostasis during repair and regeneration. They share certain characteristics with ESCs, such as an inherent capacity to self-renew and differentiate into cells of the three germ layers, properties that are regulated by master pluripotency transcription factors (TFs OCT4 (octamer-binding transcription factor 4, SOX2 (sex determining region Y-box 2, and homeobox protein NANOG. Aberrant expression of these TFs can be oncogenic resulting in heterogeneous tumours fueled by cancer stem cells (CSC, which are resistant to conventional treatments and are associated with tumour recurrence post-treatment. Further to enriching our understanding of the role of pluripotency TFs in normal tissue function, research now aims to develop optimized isolation and propagation methods for normal adult PSCs and CSCs for the purposes of regenerative medicine, developmental biology, and disease modeling aimed at targeted personalised cancer therapies.

  2. Relating Memory To Functional Performance In Normal Aging to Dementia Using Hierarchical Bayesian Cognitive Processing Models

    Science.gov (United States)

    Shankle, William R.; Pooley, James P.; Steyvers, Mark; Hara, Junko; Mangrola, Tushar; Reisberg, Barry; Lee, Michael D.

    2012-01-01

    Determining how cognition affects functional abilities is important in Alzheimer’s disease and related disorders (ADRD). 280 patients (normal or ADRD) received a total of 1,514 assessments using the Functional Assessment Staging Test (FAST) procedure and the MCI Screen (MCIS). A hierarchical Bayesian cognitive processing (HBCP) model was created by embedding a signal detection theory (SDT) model of the MCIS delayed recognition memory task into a hierarchical Bayesian framework. The SDT model used latent parameters of discriminability (memory process) and response bias (executive function) to predict, simultaneously, recognition memory performance for each patient and each FAST severity group. The observed recognition memory data did not distinguish the six FAST severity stages, but the latent parameters completely separated them. The latent parameters were also used successfully to transform the ordinal FAST measure into a continuous measure reflecting the underlying continuum of functional severity. HBCP models applied to recognition memory data from clinical practice settings accurately translated a latent measure of cognition to a continuous measure of functional severity for both individuals and FAST groups. Such a translation links two levels of brain information processing, and may enable more accurate correlations with other levels, such as those characterized by biomarkers. PMID:22407225

  3. Importance of circulating IGF-1 for normal cardiac morphology, function and post infarction remodeling.

    Science.gov (United States)

    Scharin Täng, M; Redfors, B; Lindbom, M; Svensson, J; Ramunddal, T; Ohlsson, C; Shao, Y; Omerovic, E

    2012-12-01

    IGF-1 plays an important role in cardiovascular homeostasis, and plasma levels of IGF-1 correlate inversely with systolic function in heart failure. It is not known to what extent circulating IGF-1 secreted by the liver and local autocrine/paracrine IGF-1 expressed in the myocardium contribute to these beneficial effects on cardiac function and morphology. In the present study, we used a mouse model of liver-specific inducible deletion of the IGF-1 gene (LI-IGF-1 -/- mouse) in an attempt to evaluate the importance of circulating IGF-I on cardiac morphology and function under normal and pathological conditions, with an emphasis on its regulatory role in myocardial phosphocreatine metabolism. Echocardiography was performed in LI-IGF-1 -/- and control mice at rest and during dobutamine stress, both at baseline and post myocardial infarction (MI). High-energy phosphate metabolites were compared between LI-IGF-1 -/- and control mice at 4 weeks post MI. We found that LI-IGF-1 -/- mice had significantly greater left ventricular dimensions at baseline and showed a greater relative increase in cardiac dimensions, as well as deterioration of cardiac function, post MI. Myocardial creatine content was 17.9% lower in LI-IGF-1 -/- mice, whereas there was no detectable difference in high-energy nucleotides. These findings indicate an important role of circulating IGF-1 in preserving cardiac structure and function both in physiological settings and post MI. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Mood states, sympathetic activity, and in vivo beta-adrenergic receptor function in a normal population.

    Science.gov (United States)

    Yu, Bum-Hee; Kang, Eun-Ho; Ziegler, Michael G; Mills, Paul J; Dimsdale, Joel E

    2008-01-01

    The purpose of this study was to examine the relationship between mood states and beta-adrenergic receptor function in a normal population. We also examined if sympathetic nervous system activity is related to mood states or beta-adrenergic receptor function. Sixty-two participants aged 25-50 years were enrolled in this study. Mood states were assessed using the Profile of Mood States (POMS). Beta-adrenergic receptor function was determined using the chronotropic 25 dose isoproterenol infusion test. Level of sympathetic nervous system activity was estimated from 24-hr urine norepinephrine excretion. Higher tension-anxiety, depression-dejection, and anger-hostility were related to decreased beta-adrenergic receptor sensitivity (i.e., higher chronotropic 25 dose values), but tension-anxiety was the only remaining independent predictor of beta-adrenergic receptor function after controlling for age, gender, ethnicity, and body mass index (BMI). Urinary norepinephrine excretion was unrelated to either mood states or beta-adrenergic receptor function. These findings replicate previous reports that anxiety is related to decreased (i.e., desensitized) beta-adrenergic receptor sensitivity, even after controlling for age, gender, ethnicity, and body mass index.

  5. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  6. Functionalized iron oxide nanoparticles for controlling the movement of immune cells

    Science.gov (United States)

    White, Ethan E.; Pai, Alex; Weng, Yiming; Suresh, Anil K.; van Haute, Desiree; Pailevanian, Torkom; Alizadeh, Darya; Hajimiri, Ali; Badie, Behnam; Berlin, Jacob M.

    2015-04-01

    Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were generated by loading the cells with iron oxide nanoparticles functionalized with CpG oligonucleotides, serving as a proof of principle that nanoparticles can be used to both deliver an immunostimulatory cargo to cells and to control the movement of the cells. The nanoparticle-oligonucleotide conjugates are efficiently internalized, non-toxic, and immunostimulatory. We demonstrate that the in vitro migration of the adherent, loaded microglia can be controlled by an external magnetic field and that magnetically-induced migration is non-cytotoxic. In order to capture video of this magnetically-induced migration of loaded cells, a novel 3D-printed ``cell box'' was designed to facilitate our imaging application. Analysis of cell movement velocities clearly demonstrate increased cell velocities toward the magnet. These studies represent the initial step towards our final goal of using nanoparticles to both activate immune cells and to control their trafficking within the diseased brain.Immunotherapy is currently being investigated for the treatment of many diseases, including cancer. The ability to control the location of immune cells during or following activation would represent a powerful new technique for this field. Targeted magnetic delivery is emerging as a technique for controlling cell movement and localization. Here we show that this technique can be extended to microglia, the primary phagocytic immune cells in the central nervous system. The magnetized microglia were

  7. Immune Checkpoint Function of CD85j in CD8 T Cell Differentiation and Aging

    Directory of Open Access Journals (Sweden)

    Claire E. Gustafson

    2017-06-01

    Full Text Available Aging is associated with an increased susceptibility to infection and a failure to control latent viruses thought to be driven, at least in part, by alterations in CD8 T cell function. The aging T cell repertoire is characterized by an accumulation of effector CD8 T cells, many of which express the negative regulatory receptor CD85j. To define the biological significance of CD85j expression on CD8 T cells and to address the question whether presence of CD85j in older individuals is beneficial or detrimental for immune function, we examined the specific attributes of CD8 T cells expressing CD85j as well as the functional role of CD85j in antigen-specific CD8 T cell responses during immune aging. Here, we show that CD85j is mainly expressed by terminally differentiated effector (TEMRAs CD8 T cells, which increase with age, in cytomegalovirus (CMV infection and in males. CD85j+ CMV-specific cells demonstrate clonal expansion. However, TCR diversity is similar between CD85j+ and CD85j− compartments, suggesting that CD85j does not directly impact the repertoire of antigen-specific cells. Further phenotypic and functional analyses revealed that CD85j identifies a specific subset of CMV-responsive CD8 T cells that coexpress a marker of senescence (CD57 but retain polyfunctional cytokine production and expression of cytotoxic mediators. Blocking CD85j binding enhanced proliferation of CMV-specific CD8 T cells upon antigen stimulation but did not alter polyfunctional cytokine production. Taken together, these data demonstrate that CD85j characterizes a population of “senescent,” but not exhausted antigen-specific effector CD8 T cells and indicates that CD85j is an important checkpoint regulator controlling expansion of virus-specific T cells during aging. Inhibition of CD85j activity may be a mechanism to promote stronger CD8 T cell effector responses during immune aging.

  8. Normal mitochondrial respiratory function is essential for spatial remote memory in mice

    Directory of Open Access Journals (Sweden)

    Tanaka Daisuke

    2008-12-01

    Full Text Available Abstract Background Mitochondrial DNA (mtDNA with pathogenic mutations has been found in patients with cognitive disorders. However, little is known about whether pathogenic mtDNA mutations and the resultant mitochondrial respiration deficiencies contribute to the expression of cognitive alterations, such as impairments of learning and memory. To address this point, we used two groups of trans-mitochondrial mice (mito-mice with heteroplasmy for wild-type and pathogenically deleted (Δ mtDNA; the "low" group carried 50% or less ΔmtDNA, and the "high" group carried more than 50% ΔmtDNA. Results Both groups had normal phenotypes for not only spatial learning, but also memory at short retention delays, indicating that ΔmtDNA load did not affect learning and temporal memory. The high group, however, showed severe impairment of memory at long retention delays. In the visual cortex and dentate gyrus of these mice, we observed mitochondrial respiration deficiencies, and reduced Ca2+/calmodulin-dependent kinase II-α (α-CaMKII, a protein important for the establishment of spatial remote memory. Conclusion Our results indicated that normal mitochondrial respiratory function is necessary for retention and consolidation of memory trace; deficiencies in this function due to high loads of pathogenically mutated mtDNA are responsible for the preferential impairment of spatial remote memory.

  9. The effect of irradiation on function in self-renewing normal tissues with differing proliferative organisation

    International Nuclear Information System (INIS)

    Wheldon, T.E.; Michalowski, A.S.

    1982-01-01

    The primary effect of irradiation on self-renewing normal tissues is sterilisation of their proliferative cells, but how this translates into failure of tissue function depends on the mode of organisation of the tissue concerned. It has recently been suggested (Michalowski, 1981) that proliferative normal tissues may be classed as ''hierarchical'' (like haemopoietic tissues) or as ''flexible'' (like liver parenchyma) and that radiation injury to tissue function develops by different pathways in these tissues. Mathematical model studies confirm the different radiation responses of differently organized tissues. Tissues of the ''flexible'' or ''F-type'' category display a variety of novel radiobiological properties, different from those of the more familiar ''hierarchical'' or ''H-type'' tissues. The ''F-type'' responses are strongly influenced by radiation-sterilised (''doomed'') cells, and is is suggested that the role of ''doomed'' cells has been undervalued relative to that of clonogenic survivors. Since ''F-type'' tissues have characteristically low rates of cell renewal, it is possible that these tissues are preferentially responsible for late effects of irradiation in clinical radiotherapy. (author)

  10. Acute brief heat stress in late gestation alters neonatal calf innate immune functions.

    Science.gov (United States)

    Strong, R A; Silva, E B; Cheng, H W; Eicher, S D

    2015-11-01

    Heat stress, as one of the environmental stressors affecting the dairy industry, compromises the cow milk production, immune function, and reproductive system. However, few studies have looked at how prenatal heat stress (HS) affects the offspring. The objective of this study was to evaluate the effect of HS during late gestation on calf immunity. Calves were born to cows exposed to evaporative cooling (CT) or HS (cyclic 23-35°C) for 1 wk at 3 wk before calving. Both bull and heifer calves (CT, n=10; HS, n=10) were housed in similar environmental temperatures after birth. Both CT and HS calves received 3.78 L of pooled colostrum within 12 h after birth and were fed the same diet throughout the study. In addition to tumor necrosis factor α, IL-1β, IL-1 receptor antagonist (IL-1RA), and toll-like receptor (TLR)2, and TLR4 mRNA expression, the expression of CD14(+) and CD18(+) cells, and DEC205(+) dendritic cells were determined in whole blood samples at d 0, 3, 7, 14, 21, and 28. The neutrophil to lymphocyte ratio, differential cell counts, and the hematocrit were also determined. During late gestation, the HS cows had greater respiration rates, rectal temperatures, and tended to spend more time standing compared with the CT cows. The HS calves had less expression of tumor necrosis factor-α and TLR2 and greater levels of IL-1β, IL-1RA, and TLR4 compared with CT calves. The HS calves also had a greater percentage of CD18(+) cells compared with the CT calves. Additionally, a greater percentage of neutrophils and lesser percentage of lymphocytes were in the HS calves compared with the CT calves. The results indicate that biomarkers of calves' immunity are affected in the first several weeks after birth by HS in the dam during late gestation. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. HIV Infection Is Associated with Impaired Striatal Function during Inhibition with Normal Cortical Functioning on Functional MRI

    NARCIS (Netherlands)

    du Plessis, Stéfan; Vink, Matthijs; Joska, John A; Koutsilieri, Eleni; Bagadia, Asif; Stein, Dan J; Emsley, Robin

    2015-01-01

    The aim of the present study was to investigate the effect of HIV infection on cortical and subcortical regions of the frontal-striatal system involved in the inhibition of voluntary movement. Functional MRI (fMRI) studies suggest that human immunodeficiency virus (HIV) infection is associated with

  12. Hydrogen-rich Water Exerting a Protective Effect on Ovarian Reserve Function in a Mouse Model of Immune Premature Ovarian Failure Induced by Zona Pellucida 3

    Science.gov (United States)

    He, Xin; Wang, Shu-Yu; Yin, Cheng-Hong; Wang, Tong; Jia, Chan-Wei; Ma, Yan-Min

    2016-01-01

    Background: Premature ovarian failure (POF) is a disease that affects female fertility but has few effective treatments. Ovarian reserve function plays an important role in female fertility. Recent studies have reported that hydrogen can protect male fertility. Therefore, we explored the potential protective effect of hydrogen-rich water on ovarian reserve function through a mouse immune POF model. Methods: To set up immune POF model, fifty female BALB/c mice were randomly divided into four groups: Control (mice consumed normal water, n = 10), hydrogen (mice consumed hydrogen-rich water, n = 10), model (mice were immunized with zona pellucida glycoprotein 3 [ZP3] and consumed normal water, n = 15), and model-hydrogen (mice were immunized with ZP3 and consumed hydrogen-rich water, n = 15) groups. After 5 weeks, mice were sacrificed. Serum anti-Müllerian hormone (AMH) levels, granulosa cell (GC) apoptotic index (AI), B-cell leukemia/lymphoma 2 (Bcl-2), and BCL2-associated X protein (Bax) expression were examined. Analyses were performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA) software. Results: Immune POF model, model group exhibited markedly reduced serum AMH levels compared with those of the control group (5.41 ± 0.91 ng/ml vs. 16.23 ± 1.97 ng/ml, P = 0.033) and the hydrogen group (19.65 ± 7.82 ng/ml, P = 0.006). The model-hydrogen group displayed significantly higher AMH concentrations compared with that of the model group (15.03 ± 2.75 ng/ml vs. 5.41 ± 0.91 ng/ml, P = 0.021). The GC AI was significantly higher in the model group (21.30 ± 1.74%) than those in the control (7.06 ± 0.27%), hydrogen (5.17 ± 0.41%), and model-hydrogen groups (11.24 ± 0.58%) (all P hydrogen group compared with that of the hydrogen group (11.24 ± 0.58% vs. 5.17 ± 0.41%, P = 0.021). Compared with those of the model group, ovarian tissue Bcl-2 levels increased (2.18 ± 0.30 vs. 3.01 ± 0.33, P = 0.045) and the Bax/Bcl-2 ratio decreased in the model-hydrogen group

  13. Exploiting immune cell metabolic machinery for functional HIV cure and the prevention of inflammaging [version 1; referees: 4 approved

    Directory of Open Access Journals (Sweden)

    Clovis S. Palmer

    2018-01-01

    Full Text Available An emerging paradigm in immunology suggests that metabolic reprogramming and immune cell activation and functions are intricately linked. Viral infections, such as HIV infection, as well as cancer force immune cells to undergo major metabolic challenges. Cells must divert energy resources in order to mount an effective immune response. However, the fact that immune cells adopt specific metabolic programs to provide host defense against intracellular pathogens and how this metabolic shift impacts immune cell functions and the natural course of diseases have only recently been appreciated. A clearer insight into how these processes are inter-related will affect our understanding of several fundamental aspects of HIV persistence. Even in patients with long-term use of anti-retroviral therapies, HIV infection persists and continues to cause chronic immune activation and inflammation, ongoing and cumulative damage to multiple organs systems, and a reduction in life expectancy. HIV-associated fundamental changes to the metabolic machinery of the immune system can promote a state of “inflammaging”, a chronic, low-grade inflammation with specific immune changes that characterize aging, and can also contribute to the persistence of HIV in its reservoirs. In this commentary, we will bring into focus evolving concepts on how HIV modulates the metabolic machinery of immune cells in order to persist in reservoirs and how metabolic reprogramming facilitates a chronic state of inflammation that underlies the development of age-related comorbidities. We will discuss how immunometabolism is facilitating the changing paradigms in HIV cure research and outline the novel therapeutic opportunities for preventing inflammaging and premature development of age-related conditions in HIV+ individuals.

  14. Gemfibrozil-induced myositis in a patient with normal renal function.

    Science.gov (United States)

    Hahn, Martin; Sriharan, Kalavally; McFarland, M Shawn

    2010-01-01

    To describe a case of gemfibrozil monotherapy-induced myositis in a patient with normal renal function A 68-year-old white man presented to his primary care clinic complaining of a 6-month history of total body pain. His past medical history was significant for hypertension, diabetes mellitus, hyperlipidemia, gastroesophageal reflux disease, benign prostatic hypertrophy, arthritis, impotence, and pancreatic cancer that required excision of part of his pancreas. His home drug regimen included bupropion 75 mg twice daily, gemfibrozil 600 mg twice daily for the past 8 months, glimiperide 1 mg daily, insulin glargine 5 units at bedtime, insulin aspart 5 units in the evening, lisinopril 10 mg daily, omeprazole 40 mg daily, pregabalin 100 mg daily, and sildenafil 100 mg as needed. Laboratory test results were significant for elevated aspartate aminotransferase (AST) 78 U/L (reference range 15-46 U/L), alanine aminotransferase (ALT) 83 U/L (13-69 U/L), and creatine kinase (CK) 3495 U/L (55-170 U/L). Serum creatinine was normal at 1.19 mg/dL. The physician determined that the elevated CK indicated myositis secondary to gemfibrozil use, and gemfibrozil was subsequently discontinued. The patient returned 1 week later to repeat the laboratory tests. Results were CK 220 U/L, AST 26 U/L, ALT 43 U/L, and serum creatinine 1.28 mg/dL. The patient was asked to return in 3 weeks to repeat the laboratory tests. At that time, CK had continued to decrease to 142 U/L, and the AST and ALT had returned to normal, at 22 and 29 U/L, respectively. The patient reported complete resolution of total body pain 3 weeks after discontinuation of gemfibrozil. Follow-up 5 weeks after discontinuation revealed no change compared to the 3-week follow-up. Myositis most often produces weakness and elevated CK levels more than 10 times the upper limit of normal. The risk of developing myositis, myopathy, or rhabdomyolysis is low (1%) when fibrates such as gemfibrozil are used as monotherapy. Evaluation of

  15. An accurate higher order displacement model with shear and normal deformations effects for functionally graded plates

    International Nuclear Information System (INIS)

    Jha, D.K.; Kant, Tarun; Srinivas, K.; Singh, R.K.

    2013-01-01

    Highlights: • We model through-thickness variation of material properties in functionally graded (FG) plates. • Effect of material grading index on deformations, stresses and natural frequency of FG plates is studied. • Effect of higher order terms in displacement models is studied for plate statics. • The benchmark solutions for the static analysis and free vibration of thick FG plates are presented. -- Abstract: Functionally graded materials (FGMs) are the potential candidates under consideration for designing the first wall of fusion reactors with a view to make best use of potential properties of available materials under severe thermo-mechanical loading conditions. A higher order shear and normal deformations plate theory is employed for stress and free vibration analyses of functionally graded (FG) elastic, rectangular, and simply (diaphragm) supported plates. Although FGMs are highly heterogeneous in nature, they are generally idealized as continua with mechanical properties changing smoothly with respect to spatial coordinates. The material properties of FG plates are assumed here to vary through thickness of plate in a continuous manner. Young's modulii and material densities are considered to be varying continuously in thickness direction according to volume fraction of constituents which are mathematically modeled here as exponential and power law functions. The effects of variation of material properties in terms of material gradation index on deformations, stresses and natural frequency of FG plates are investigated. The accuracy of present numerical solutions has been established with respect to exact three-dimensional (3D) elasticity solutions and the other models’ solutions available in literature

  16. Restoring Ovarian Endocrine Function with Encapsulated Ovarian Allograft in Immune Competent Mice.

    Science.gov (United States)

    David, Anu; Day, James Ronald; Cichon, Alexa Leigh; Lefferts, Adam; Cascalho, Marilia; Shikanov, Ariella

    2017-07-01

    Premature ovarian insufficiency (POI) is a major complication of cytotoxic treatments due to extreme ovarian sensitivity to chemotherapy and radiation. In pediatric cancer patients modern therapy has improved the long-term survival to over 80% in the United States. However, these cancer survivors face long-term health problems related to treatment toxicity. In female cancer survivors POI leads to sterility, along with the consequences of estrogen deficiency such as premature osteopenia, muscle wasting, accelerated cardiovascular diseases and a vast array of other health and developmental problems. These long-lasting effects are particularly significant for young girls reaching puberty. As such, restoring ovarian endocrine function is paramount in this population. In the present study, we evaluated the feasibility of restoring ovarian endocrine function in ovariectomized mice by transplanting syngeneic and allogeneic ovarian tissue encapsulated in alginate capsules or TheraCyte ® . Histological analysis of the implants retrieved after 7 and 30 days' post implantation showed follicular development up to the secondary and antral stages in both syngeneic and allogeneic implants. Implantation of syngeneic and allogeneic ovarian grafts encapsulated in TheraCyte devices restored ovarian endocrine function, which was confirmed by decreased serum FSH levels from 60 to 70 ng/mL in ovariectomized mice to 30-40 ng/mL 30 days after implantation. Absence of allo-MHC-specific IgG and IgM antibodies in the sera of implanted mice with allogeneic ovarian tissue encapsulated in TheraCyte indicate that the implants did not evoke an allo-immune response, while the allogeneic controls were rejected 21 days after implantation. Our results show that TheraCyte effectively isolates the graft from immune recognition but also supports follicular growth.

  17. Effect of gavage of rhubarb preparation on immune function in patients with sepsis

    Directory of Open Access Journals (Sweden)

    Chao YIN

    2016-01-01

    Full Text Available Objectives  To study the effect of nasointestinal infusion of rhubarb preparation on general inflammatory reaction and immune function in sepsis patients. Methods  The patients with sepsis admitted to our hospital from August 2012 to November 2014 was randomized to placebo group (n=36 and treatment group (n=32. The placebo group was treated conventionally, while the treatment group received the rhubarb preparation through nasal tube. The differences in the clinical symptoms, inflammatory cytokines, immunological indexes were compared between two groups. Results  There was no significant difference in clinical indexes between two groups before the treatment (P>0.05. The time of gastric retention, first defecation, bowel sounds recovery, abdominal pain, and abdominal distension relief were shortened (P<0.05. The contents of TNF-α, IL-1β, and IL-6 were reduced significantly on day 8 and 28 after therapy (P<0.01 in the treatment group, but the level of IL-10 was elevated obviously on days 3 and 8 after therapy (P<0.01. Significant improvements in CD3+, CD4+, CD4+/CD8+ and HLA-DR/ CD14+ were observed at days 3, 8 and 28 after therapy (P<0.05, though the improvement of HLA-DR/CD14+ was seen only on day 8 after therapy (P<0.05. Conclusion  Rhubarb can improve the gastrointestinal function and immune function, and reduce release of inflammatory cytokines in sepsis patients, thus producing the positive role in the treatment of sepsis. DOI: 10.11855/j.issn.0577-7402.2015.12.15

  18. The Effects of Opium Addiction on the Immune System Function in Patients with Fungal Infection.

    Science.gov (United States)

    Ayatollahi-Mousavi, Seyyed Amin; Asadikaram, Gholamreza; Nakhaee, Nouzar; Izadi, Alireza; Keikha, Nasser

    2016-01-01

    The use of narcotics such as opium exposes addicts as susceptible targets of different diseases so that they might easily be exposed to different diseases such as fungal infections. The present study aimed to investigate the effects of addiction to opium and fungal infection on plasma levels of certain cytokines including interleukin-4 (IL-4), IL-6, IL-17, Interferon gamma (IFN-γ) and transforming growth factor-β (TGF-β). Present study included 72 individuals who were divided into 4 groups: 1) opium-addicted with fungal infection; 2) opium-addicted without fungal infection; 3) non-opium-addicted with fungal infection; and 4) normal individuals (non-opium-addicted and non-fungal infection). The fungal samples, after being detected and confirmed by a physician, were prepared based on clinical symptoms and then analyzed by direct smear and culture method. The measurement of the plasma level of cytokines was done by enzyme-linked immunosorbent assay (ELISA) method. The comparison of the mean of the plasma level of cytokines showed that addiction to opium and fungal infection had significant effect on the plasma levels of IL-17, IFN-γ, TGF-β cytokines in all studied groups. The interaction of addiction to opium and fungal infection was only significant in the case of plasma level of IL-6. Addiction to opium and fungal infection, either separately or simultaneously, poses significant effect on the immune system and causes disorders in the cytokine network and the immune system and also provides a suitable environment for fungal infection.

  19. Effects of 12-Week’s Tai Chi Chuan Practice on the Immune Function of Female College Students Who Lack Physical Exercise

    Directory of Open Access Journals (Sweden)

    M-Y. Wang

    2011-03-01

    Full Text Available Objective: The present study investigated the effects of 12 weeks’ tai chi chuan (TCC practice on the immune function of female college students. Method: 60 female college students (19.3 ± 1.8 years were recruited and were randomly assigned to either the TCC training (n=30 or the control group (n=30. In the TCC group, the exercise duration was 45 minutes per day and 5 days a week for 12 weeks. The TCC group performed TCC under the teaching of a TCC master. Immunoglobulin G (IgG, IgA, IgM, Cluster of differentiation 3 (CD3, CD4 , CD8 , interferon γ (IFN-γ, interleukin 4 (IL-4 and IL-12 were measured before and after 12 weeks of TCC practice. Results: The TCC group had significantly higher plasma levels of IgG (P=0.000, IgM (P=0.05 and CD4 (P=0.032 after practice compared with their respective pre-practice levels. There were no significant differences in IgA, CD3, IFN-γ, IL-4 or IL-12, but IgA and IFN-γ levels increased and IL-12 decreased within the normal range. Conclusion: The results suggest that regular long-term TCC practice might be a potential method to improve the cellular immune function (anti-virus and anti-infection of people who lack physical exercise. Further studies concerning other immune aspects are needed.

  20. IL-17 suppresses immune effector functions in human papillomavirus-associated epithelial hyperplasia.

    Science.gov (United States)

    Gosmann, Christina; Mattarollo, Stephen R; Bridge, Jennifer A; Frazer, Ian H; Blumenthal, Antje

    2014-09-01

    Persistent infection with high-risk human papillomaviruses (HPV) causes epithelial hyperplasia that can progress to cancer and is thought to depend on immunosuppressive mechanisms that prevent viral clearance by the host. IL-17 is a cytokine with diverse functions in host defense and in the pathology of autoimmune disorders, chronic inflammatory diseases, and cancer. We analyzed biopsies from patients with HPV-associated cervical intraepithelial neoplasia grade 2/3 and murine skin displaying HPV16 E7 protein-induced epithelial hyperplasia, which closely models hyperplasia in chronic HPV lesions. Expression of IL-17 and IL-23, a major inducer of IL-17, was elevated in both human HPV-infected and murine E7-expressing lesions. Using a skin-grafting model, we demonstrated that IL-17 in HPV16 E7 transgenic skin grafts inhibited effective host immune responses against the graft. IL-17 was produced by CD3(+) T cells, predominantly CD4(+) T cells in human, and CD4(+) and γδ T cells in mouse hyperplastic lesions. IL-23 and IL-1β, but not IL-18, induced IL-17 production in E7 transgenic skin. Together, these findings demonstrate an immunosuppressive role for IL-17 in HPV-associated epithelial hyperplasia and suggest that blocking IL-17 in persistent viral infection may promote antiviral immunity and prevent progression to cancer. Copyright © 2014 by The American Association of Immunologists, Inc.

  1. Functional analysis of the human cytomegalovirus immune evasion protein, pUS322kDa

    International Nuclear Information System (INIS)

    Zhao Yiqiang; Biegalke, Bonita J.

    2003-01-01

    Human cytomegalovirus (HCMV) is an important opportunistic pathogen that infrequently causes disease in individuals with mature immune systems. The HCMV US3 gene encodes a 22-kDa protein that interferes with immune recognition of virally infected cells. The 22-kDa US3 protein binds to major histocompatibility complex (MHC) class I complexes, retaining them in the endoplasmic reticulum (ER), thereby decreasing the presentation of viral antigen to cytotoxic T cells. Our studies demonstrate that correct folding of the ER lumenal domain of the US3 protein is essential, but insufficient for interactions with MHC class I complexes. We demonstrate a requirement for the transmembrane domain of the 22-kDa US3 protein, confirming the results of others, and also show that the cytosolic carboxyl-terminal tail influences the function of the protein. Anchoring of the ER-lumenal immunoglobulin-like fold of the US3 protein to the membrane of the endoplasmic reticulum is critical for the binding and retention of MHC class I complexes

  2. Structural Conservation and Functional Diversity of the Poxvirus Immune Evasion (PIE) Domain Superfamily.

    Science.gov (United States)

    Nelson, Christopher A; Epperson, Megan L; Singh, Sukrit; Elliott, Jabari I; Fremont, Daved H

    2015-08-28

    Poxviruses encode a broad array of proteins that serve to undermine host immune defenses. Structural analysis of four of these seemingly unrelated proteins revealed the recurrent use of a conserved beta-sandwich fold that has not been observed in any eukaryotic or prokaryotic protein. Herein we propose to call this unique structural scaffolding the PIE (Poxvirus Immune Evasion) domain. PIE domain containing proteins are abundant in chordopoxvirinae, with our analysis identifying 20 likely PIE subfamilies among 33 representative genomes spanning 7 genera. For example, cowpox strain Brighton Red appears to encode 10 different PIEs: vCCI, A41, C8, M2, T4 (CPVX203), and the SECRET proteins CrmB, CrmD, SCP-1, SCP-2, and SCP-3. Characterized PIE proteins all appear to be nonessential for virus replication, and all contain signal peptides for targeting to the secretory pathway. The PIE subfamilies differ primarily in the number, size, and location of structural embellishments to the beta-sandwich core that confer unique functional specificities. Reported ligands include chemokines, GM-CSF, IL-2, MHC class I, and glycosaminoglycans. We expect that the list of ligands and receptors engaged by the PIE domain will grow as we come to better understand how this versatile structural architecture can be tailored to manipulate host responses to infection.

  3. Association study of functional genetic variants of innate immunity related genes in celiac disease

    Directory of Open Access Journals (Sweden)

    Martín J

    2005-08-01

    Full Text Available Abstract Background Recent evidence suggest that the innate immune system is implicated in the early events of celiac disease (CD pathogenesis. In this work for the first time we have assessed the relevance of different proinflammatory mediators typically related to innate immunity in CD predisposition. Methods We performed a familial study in which 105 celiac families characterized by the presence of an affected child with CD were genotyped for functional polymorphisms located at regulatory regions of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 genes. Familial data was analysed with a transmission disequilibrium test (TDT that revealed no statistically significant differences in the transmission pattern of the different genetic markers considered. Results The TDT analysis for IL-1α, IL-1β, IL-1RN, IL-18, and MCP-1 genes genetic variants did not reveal biased transmission to the affected offspring. Only a borderline association of RANTES promoter genetic variants with CD predisposition was observed. Conclusion Our results suggest that the analysed polymorphisms of IL-1α, IL-1β, IL-1RN, IL-18, RANTES and MCP-1 genes do not seem to play a major role in CD genetic predisposition in our population.

  4. Severe hyposmia and aberrant functional connectivity in cognitively normal Parkinson's disease.

    Directory of Open Access Journals (Sweden)

    Noritaka Yoneyama

    Full Text Available Severe hyposmia is a risk factor of dementia in Parkinson's disease (PD, while the underlying functional connectivity (FC and brain volume alterations in PD patients with severe hyposmia (PD-SH are unclear.We examined voxel-based morphometric and resting state functional magnetic resonance imaging findings in 15 cognitively normal PD-SH, 15 cognitively normal patients with PD with no/mild hyposmia (PD-N/MH, and 15 healthy controls (HCs.Decreased gray matter volume (GMV was observed in the bilateral cuneus, right associative visual area, precuneus, and some areas in anterior temporal lobes in PD-SH group compared to HCs. Both the PD-SH and PD-N/MH groups showed increased GMV in the bilateral posterior insula and its surrounding regions. A widespread significant decrease in amygdala FC beyond the decreased GMV areas and olfactory cortices were found in the PD-SH group compared with the HCs. Above all, decreased amygdala FC with the inferior parietal lobule, lingual gyrus, and fusiform gyrus was significantly correlated with both reduction of Addenbrooke's Cognitive Examination-Revised scores and severity of hyposmia in all participants. Canonical resting state networks exhibited decreased FC in the precuneus and left executive control networks but increased FC in the primary and high visual networks of patients with PD compared with HCs. Canonical network FC to other brain regions was enhanced in the executive control, salience, primary visual, and visuospatial networks of the PD-SH.PD-SH showed extensive decreased amygdala FC. Particularly, decreased FC between the amygdala and inferior parietal lobule, lingual gyrus, and fusiform gyrus were associated with the severity of hyposmia and cognitive performance. In contrast, relatively preserved canonical networks in combination with increased FC to brain regions outside of canonical networks may be related to compensatory mechanisms, and preservation of brain function.

  5. Are there differences in immune function between continental and insular birds?

    NARCIS (Netherlands)

    Matson, K.D.

    2006-01-01

    Generally, immune system architecture varies with different environments, which presumably reflect different pathogen pressures. Specifically, populations from relatively disease-free, oceanic islands are expected to exhibit reorganized immune systems, which might be characterized by attenuated

  6. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    National Research Council Canada - National Science Library

    Ribot, Wilson J; Panchal, Rekha G; Brittingham, Katherine C; Ruthel, Gordon; Kenny, Tara A; Lane, Douglas; Curry, Bob; Hoover, Timothy A; Friedlander, Arthur M; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses...

  7. Fracture transmissivity as a function of normal and shear stress: first results in Opalinus Clay

    International Nuclear Information System (INIS)

    Cuss, R.J.; Milodowski, A.; Noy, D.J.; Harrington, J.F.

    2010-01-01

    Document available in extended abstract form only. Rock-mass failure around openings is usually observed in the form of a highly complex fracture network (EDZ), which is heterogeneous in distribution around a circular tunnel opening because of the heterogeneous stress distribution. The orientation of stress with respect to the fracture network is known to be important. The complex heterogeneous stress trajectory and heterogeneous fracture network results in a broad range of stresses and stress directions acting on the open fracture network. During the open stage of a repository, stress will slowly alter as shear movements occur along the fractures, as well as other time-dependent phenomena. As the repository is back filled, the stress field is further altered as the backfill settles and changes volume because of re-saturation. Therefore, a complex and wide ranging stress regime and stress history will result. In a purely mechanical sense, fracture transmissivity is a function of normal stress, shear stress, and fracture aperture. The Selfrac test from Mont Terri showed the change in transmissivity with effective normal stress. This work showed that fracture transmissivity decreased with increasing normal load and that an effective normal stress of 2.5 MPa is sufficient to yield a transmissivity similar to that seen in intact Opalinus clay (OPA). Therefore fracture closure because of normal stresses has been proven to be a quite efficient mechanism in OPA. A new shear rig was designed to investigate the detail of fracture transmissivity in OPA. The experimental configuration uses two prepared blocks that are 60 x 60 mm in size and approximately 20 mm thick. The first test sample had machine ground surfaces in contact with each other, with pore fluid being delivered through the centre of the top block directly to the fracture surface. The experimental programme included two distinct stages. In the first normal load was altered to investigate fracture transmissivity

  8. Yeast functional genomic screens lead to identification of a role for a bacterial effector in innate immunity regulation.

    Directory of Open Access Journals (Sweden)

    Roger W Kramer

    2007-02-01

    Full Text Available Numerous bacterial pathogens manipulate host cell processes to promote infection and ultimately cause disease through the action of proteins that they directly inject into host cells. Identification of the targets and molecular mechanisms of action used by these bacterial effector proteins is critical to understanding pathogenesis. We have developed a systems biological approach using the yeast Saccharomyces cerevisiae that can expedite the identification of cellular processes targeted by bacterial effector proteins. We systematically screened the viable yeast haploid deletion strain collection for mutants hypersensitive to expression of the Shigella type III effector OspF. Statistical data mining of the results identified several cellular processes, including cell wall biogenesis, which when impaired by a deletion caused yeast to be hypersensitive to OspF expression. Microarray experiments revealed that OspF expression resulted in reversed regulation of genes regulated by the yeast cell wall integrity pathway. The yeast cell wall integrity pathway is a highly conserved mitogen-activated protein kinase (MAPK signaling pathway, normally activated in response to cell wall perturbations. Together these results led us to hypothesize and subsequently demonstrate that OspF inhibited both yeast and mammalian MAPK signaling cascades. Furthermore, inhibition of MAPK signaling by OspF is associated with attenuation of the host innate immune response to Shigella infection in a mouse model. These studies demonstrate how yeast systems biology can facilitate functional characterization of pathogenic bacterial effector proteins.

  9. Partition functions. I. Improved partition functions and thermodynamic quantities for normal, equilibrium, and ortho and para molecular hydrogen

    Science.gov (United States)

    Popovas, A.; Jørgensen, U. G.

    2016-11-01

    Context. Hydrogen is the most abundant molecule in the Universe. Its thermodynamic quantities dominate the physical conditions in molecular clouds, protoplanetary disks, etc. It is also of high interest in plasma physics. Therefore thermodynamic data for molecular hydrogen have to be as accurate as possible in a wide temperature range. Aims: We here rigorously show the shortcomings of various simplifications that are used to calculate the total internal partition function. These shortcomings can lead to errors of up to 40 percent or more in the estimated partition function. These errors carry on to calculations of thermodynamic quantities. Therefore a more complicated approach has to be taken. Methods: Seven possible simplifications of various complexity are described, together with advantages and disadvantages of direct summation of experimental values. These were compared to what we consider the most accurate and most complete treatment (case 8). Dunham coefficients were determined from experimental and theoretical energy levels of a number of electronically excited states of H2. Both equilibrium and normal hydrogen was taken into consideration. Results: Various shortcomings in existing calculations are demonstrated, and the reasons for them are explained. New partition functions for equilibrium, normal, and ortho and para hydrogen are calculated and thermodynamic quantities are reported for the temperature range 1-20 000 K. Our results are compared to previous estimates in the literature. The calculations are not limited to the ground electronic state, but include all bound and quasi-bound levels of excited electronic states. Dunham coefficients of these states of H2 are also reported. Conclusions: For most of the relevant astrophysical cases it is strongly advised to avoid using simplifications, such as a harmonic oscillator and rigid rotor or ad hoc summation limits of the eigenstates to estimate accurate partition functions and to be particularly careful when

  10. Mesiodistal angulation of the lateral teeth to the functional occlusal plane in normal occlusions

    Directory of Open Access Journals (Sweden)

    Hiroshi Ueda

    2016-01-01

    Full Text Available Introduction: Crowding is a malocclusion with irregularly positioned teeth caused by arch length discrepancy (ALD. Its incidence is high compared with the various malocclusions. In a previous study the crowns of the maxillary lateral teeth had erupted mesially in relation to the functional occlusal plane (FOP in patients with Angle Class I malocclusion and highly erupted canines, which had been uprighted by non-extraction orthodontic treatment, yet these results were based on only two cases evaluated by using plaster models. Therefore, the aim of this study was to assess the mesiodistal angulations of both maxillary and mandibular teeth relative to the FOP in normal occlusion by means of cephalograms and identifying the teeth axial factors contributing to the normal dentitions with the least ALD. Materials and Methods: Thirty Japanese young adult patients (6 males, 24 females with normal occlusion were selected to participate in this study; cephalograms were procured from each and the FOP was used as a reference plane for measuring the changes in the axial angulation along with other indicators of vertical growth. Results: Progressive mesial tipping of the maxillary lateral teeth was observed. First premolars tended to express this more than the second premolars but the tipping values were roughly 90° relative to the FOP on the first molars. Conclusion: The maxillary lateral teeth are more mesially angulated compared to the mandibular ones relative to the FOP. Furthermore, progressive mesial tipping of the maxillary lateral teeth was detected, of which axial angulations were significantly correlated to each other, in spite the mandibular premolars and molars being angulated in a similar fashion.

  11. Long-term effect of postoperative irradiation on the immune functions in patients with mammary carcinoma

    International Nuclear Information System (INIS)

    Toivanen, A.; Nordman, E.

    1981-01-01

    The effect of postoperative irradiation on the immune functions of 13 patients with breast carcinoma is reported, using as parameters the peipheral blood lymphocyte count, percentages of E and EAC rosette forming cells, and lymphocyte proliferative responses to PHA, Con A and PPD. After irradiation the number of peripheral blood lymphocytes was reduced during 8 months. The percentages of E and EAC rosette forming cells were not altered during the observation time of 7 to 36 months. In the proliferative responses of lymphocytes to PHA, Con A and PPD, the postoperative irradiation caused a decrease which, regarding PHA and Con A, lasted up to 8 months and then recovered. The decrease in the proliferative responses to PPD was stronger and lasted during the whole observation time. In the mitogenic responses of patients with recurrent or disseminating disease no difference could be demonstrated as compared with the patients living recurrence-free. (Auth.)

  12. Modulation of Immune Function in Rats Using Oligosaccharides Extracted from Palm Kernel Cake.

    Science.gov (United States)

    Faseleh Jahromi, Mohammd; Shokryazdan, Parisa; Idrus, Zulkifli; Ebrahimi, Rohollah; Bashokouh, Fatemeh; Liang, Juan Boo

    2017-01-01

    To investigate the prebiotic and immunomodulatory effects of PKC extract (OligoPKC) a total of 24 male rats were randomly assigned to three treatment groups receiving basal diet (control), basal diet containing 0.5% OligoPKC, or basal diet containing 1% OligoPKC for four weeks. We found that OligoPKC had no significant effect on the tested growth parameters. However, it increased the size of the total and beneficial bacterial populations while reducing pathogen populations. OligoPKC increased the concentration of immunoglobulins in the serum and cecal contents of rats. It also enhanced the antioxidant capacity of the liver while reducing lipid peroxidation in liver tissue. OligoPKC affected the expression of genes involved in immune system function in the intestine. Therefore, OligoPKC could be considered a potential mannan-based prebiotic for humans and animals due to its beneficial effects on the health and well-being of the model rats.

  13. In vitro uptake and immune functionality of digested Rosemary extract delivered through food grade vehicles.

    Science.gov (United States)

    Arranz, E; Guri, A; Fornari, T; Mendiola, J A; Reglero, G; Corredig, M

    2017-07-01

    The digestion, absorption, uptake and bioavailability of a rosemary supercritical fluid extract encapsulated in oil in water emulsion were studied. Two emulsions with opposite surface charge were prepared, containing 7% canola oil, and either 2% lactoferrin or whey protein isolate. When absorption and uptake of carnosic acid and carnosol were followed on Caco-2 cell monolayers, there were no differences with protein type. However, when co-cultures of HT-29 MTX were employed, the presence of mucus caused a higher retention of carnosic acid in the apical layer for lactoferrin emulsions. The immune activity of the bioavailable fractions collected from cell absorption experiments was tested ex vivo on murine splenocytes. Although transport through the intestinal barrier models was low, the bioavailable fractions showed a significant effect on splenocytes proliferation. These results demonstrated the potential of using rosemary supercritical extract through protein stabilized oil in water emulsions, as a food with immunomodulatory functionality. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Aerobic Glycolysis Is Essential for Normal Rod Function and Controls Secondary Cone Death in Retinitis Pigmentosa.

    Science.gov (United States)

    Petit, Lolita; Ma, Shan; Cipi, Joris; Cheng, Shun-Yun; Zieger, Marina; Hay, Nissim; Punzo, Claudio

    2018-05-29

    Aerobic glycolysis accounts for ∼80%-90% of glucose used by adult photoreceptors (PRs); yet, the importance of aerobic glycolysis for PR function or survival remains unclear. Here, we further established the role of aerobic glycolysis in murine rod and cone PRs. We show that loss of hexokinase-2 (HK2), a key aerobic glycolysis enzyme, does not affect PR survival or structure but is required for normal rod function. Rods with HK2 loss increase their mitochondrial number, suggesting an adaptation to the inhibition of aerobic glycolysis. In contrast, cones adapt without increased mitochondrial number but require HK2 to adapt to metabolic stress conditions such as those encountered in retinitis pigmentosa, where the loss of rods causes a nutrient shortage in cones. The data support a model where aerobic glycolysis in PRs is not a necessity but rather a metabolic choice that maximizes PR function and adaptability to nutrient stress conditions. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Potential influence of the phthalates on normal liver function and cardiometabolic risk in males.

    Science.gov (United States)

    Milošević, Nataša; Milić, Nataša; Živanović Bosić, Dragana; Bajkin, Ivana; Perčić, Ivanka; Abenavoli, Ludovico; Medić Stojanoska, Milica

    2017-12-13

    Phthalates are ubiquitous environmental contaminants, massively used in industry as plasticizers and additives in cosmetics, which may impair the human endocrine system inducing fertility problems, respiratory diseases, obesity, and neuropsychological disorders. The aim of this study was to examine the influence of the monoethyl phthalate (MEP) and mono-(2-ethylhexyl) phthalate (MEHP) on the liver function and cardiometabolic risk factors in males. In this research, 102 male participants (51 normal weight and 51 overweight/obese) were enrolled and examined for phthalate metabolites exposure in urine samples after 12 h of fasting. MEP was found in 28.43% (29/102) volunteers, while MEHP was detected among 20.59% (21/102) participants. Statistically significant increment in transaminase serum levels was observed in MEP-positive normal weight subgroup. Linear correlation was obtained between MEP concentration in urine samples and triglyceride (TG) serum levels (r 2  = 0.33; p adiposity index (VAI) (r 2  = 0.41; p HDL) ratio (r 2  = 0.40, p body mass index (p = 0.03) compared to MEHP-negative participants. Urine MEHP concentrations were negatively correlated with HDL serum levels (r 2  = 0.31; p correlated with increased TG and decreased HDL cholesterol serum levels and associated with indicators of cardiometabolic risk and insulin resistance as LAP and VAI.

  16. A Simulated Heat Wave Has Diverse Effects on Immune Function and Oxidative Physiology in the Corn Snake (Pantherophis guttatus).

    Science.gov (United States)

    Stahlschmidt, Z R; French, S S; Ahn, A; Webb, A; Butler, M W

    Animals will continue to encounter increasingly warm environments, including more frequent and intense heat waves. Yet the physiological consequences of heat waves remain equivocal, potentially because of variation in adaptive plasticity (reversible acclimation) and/or aspects of experimental design. Thus, we measured a suite of physiological variables in the corn snake (Pantherophis guttatus) after exposure to field-parameterized, fluctuating temperature regimes (moderate temperature and heat wave treatments) to address two hypotheses: (1) a heat wave causes physiological stress, and (2) thermal performance of immune function exhibits adaptive plasticity in response to a heat wave. We found little support for our first hypothesis because a simulated heat wave had a negative effect on body mass, but it also reduced oxidative damage and did not affect peak performance of three immune metrics. Likewise, we found only partial support for our second hypothesis. After exposure to a simulated heat wave, P. guttatus exhibited greater performance breadth and reduced temperature specialization (the standardized difference between peak performance and performance breadth) for only one of three immune metrics and did so in a sex-dependent manner. Further, a simulated heat wave did not elicit greater performance of any immune metric at higher temperatures. Yet a heat wave likely reduced innate immune function in P. guttatus because each metric of innate immune performance in this species (as in most vertebrates) was lower at elevated temperatures. Together with previous research, our study indicates that a heat wave may have complex, modest, and even positive physiological effects in some taxa.

  17. Bacillus Coagulans Enhance the Immune Function of the Intestinal Mucosa of Yellow Broilers

    Directory of Open Access Journals (Sweden)

    L Xu

    Full Text Available ABSTRACT This experiment was conducted to investigate the effects of Bacillus coagulans on the growth performance and immune functions of the intestinal mucosa of yellow broilers. Three hundred and sixty one-day-old yellow chicks were randomly allocated to four treatments groups with six replicates of 15 chicks each. The broilers were randomly subjected to one of the following treatments for 28 days: control group (group1, fed a basal diet and three treatments (group 2, 3, 4 fed the basal diet supplemented with 100, 200, or 300 mg/kg Bacillus coagulans , respectively. The results showed that for 28 days, compared with the control diet, the dietary addition of 200 mg/kg Bacillus coagulans significantly decreased the feed/gain ratio (F/G (p<0.05, improved the thymus index, spleen index and bursa index (p<0.05, increased the villus height to crypt depth ratio (V/C in the duodenum (p<0.05, increased the number of secretory immunoglobulin (sIgA positive cells ( p<0.05. The dietary addition of 200 mg/kg Bacillus coagulans promoted a significant increase in Lactobacillus spp. populations and suppressed Escherichia coli replication in cecum, compared with the control (p<0.05. Moreover, the dietary addition of 200 mg/kg Bacillus coagulans also significantly enhanced the levels of interferon alpha (IFNα, toll-like receptor (TLR3, and melanoma differentiation-associated protein 5(MDA5 in the duodenum (p<0.05. In conclusion, the dietary addition of Bacillus coagulans significantly improved broiler performance, and enhanced the intestinal mucosal barrier and immune function. The optimal dosage of Bacillus coagulans for yellow broilers was determined as 2×108 cfu/kg.

  18. Effects of zinc-methionine on growth performance, intestinal flora and immune function in pigeon squabs.

    Science.gov (United States)

    Wang, Y; Yi, L; Zhao, M L; Wu, J Q; Wang, M Y; Cheng, X C

    2014-01-01

    1. Different concentrations of zinc-methionine (Zn-Met) were given to pigeon squabs, and the resulting effects on growth, immune functions and intestinal microflora were investigated from hatching to 28 d of age. A total of 180 artificially hatched pigeon squabs were randomly allotted to each of three treatments with three replicates of 20 squabs. The three treatments given were either one ml (2 mg/ml) Zn-Met, one ml (10 mg/ml) Zn-Met or one ml 0.9% NaCl solution. 2. The results showed that Zn-Met improved the growth performance of squabs. The average daily and average weekly weight gain was significantly greater in squabs treated with Zn-Met than in the control group. 3. The group given 2 and 10 mg supplemental Zn-Met had heavier thymus, spleen and bursa of Fabricius than the control group at d 28. 4. Maternal antibody titres against Newcastle disease haemagglutination inhibition and alpha-naphthyl acetate esterase were significantly higher in squabs treated with supplemental 2 and 10 mg Zn-Met compared to the control group at d 14 and d 28. 5. Additionally, the squabs given supplemental 2 mg Zn-Met exhibited significantly higher Bacillaceae, Lactobacillus, Enterococcus and Bifidobacterium populations at d 14 and d 28, but lower Escherichia coli populations at d 28 compared to the control group. On the contrary, Lactobacillus, Enterococcus and Bifidobacterium populations were significantly decreased with 10 mg Zn-Met at d 28. 6. This study indicates that supplementation with Zn-Met has a positive effect on growth performance, immune function and regulation of intestinal flora in pigeons. An inclusion level of 2 mg seems to be better than 10 mg Zn-Met per day per bird.

  19. Francisella tularensis Catalase Restricts Immune Function by Impairing TRPM2 Channel Activity.

    Science.gov (United States)

    Shakerley, Nicole L; Chandrasekaran, Akshaya; Trebak, Mohamed; Miller, Barbara A; Melendez, J Andrés

    2016-02-19

    As an innate defense mechanism, macrophages produce reactive oxygen species that weaken pathogens and serve as secondary messengers involved in immune function. The Gram-negative bacterium Francisella tularensis utilizes its antioxidant armature to limit the host immune response, but the mechanism behind this suppression is not defined. Here we establish that F. tularensis limits Ca(2+) entry in macrophages, thereby limiting actin reorganization and IL-6 production in a redox-dependent fashion. Wild type (live vaccine strain) or catalase-deficient F. tularensis (ΔkatG) show distinct profiles in their H2O2 scavenging rates, 1 and 0.015 pm/s, respectively. Murine alveolar macrophages infected with ΔkatG display abnormally high basal intracellular Ca(2+) concentration that did not increase further in response to H2O2. Additionally, ΔkatG-infected macrophages displayed limited Ca(2+) influx in response to ionomycin, as a result of ionophore H2O2 sensitivity. Exogenously added H2O2 or H2O2 generated by ΔkatG likely oxidizes ionomycin and alters its ability to transport Ca(2+). Basal increases in cytosolic Ca(2+) and insensitivity to H2O2-mediated Ca(2+) entry in ΔkatG-infected cells are reversed by the Ca(2+) channel inhibitors 2-aminoethyl diphenylborinate and SKF-96365. 2-Aminoethyl diphenylborinate but not SKF-96365 abrogated ΔkatG-dependent increases in macrophage actin remodeling and IL-6 secretion, suggesting a role for H2O2-mediated Ca(2+) entry through the transient receptor potential melastatin 2 (TRPM2) channel in macrophages. Indeed, increases in basal Ca(2+), actin polymerization, and IL-6 production are reversed in TRPM2-null macrophages infected with ΔkatG. Together, our findings provide compelling evidence that F. tularensis catalase restricts reactive oxygen species to temper macrophage TRPM2-mediated Ca(2+) signaling and limit host immune function. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. A biocultural perspective on fictive kinship in the Andes: social support and women's immune function in El Alto, Bolivia.

    Science.gov (United States)

    Hicks, Kathryn

    2014-09-01

    This article examines the influence of emotional and instrumental support on women's immune function, a biomarker of stress, in the city of El Alto, Bolivia. It tests the prediction that instrumental support is protective of immune function for women living in this marginal environment. Qualitative and quantitative ethnographic methods were employed to assess perceived emotional and instrumental support and common sources of support; multiple linear regression analysis was used to model the relationship between social support and antibodies to the Epstein-Barr virus. These analyses provided no evidence that instrumental social support is related to women's health, but there is some evidence that emotional support from compadres helps protect immune function. © 2014 by the American Anthropological Association.

  1. Effects of dopamine on renal haemodynamics tubular function and sodium excretion in normal humans

    DEFF Research Database (Denmark)

    Olsen, Niels Vidiendal

    1998-01-01

    The renal functional changes following infusion of dopamine are well documented. The most pronounced effect is the increase in renal blood flow and a marked natriuretic response. Due to its specific renal effects, dopamine has become one of the most frequently used drugs in the treatment...... of critically ill patients with low cardiac output states and/or acute oliguric renal failure. Pharmacological effects of dopamine are dose dependent. Low doses of dopamine predominantly stimulate dopaminergic receptors, but with increasing doses actions secondary to stimulation of adrenergic beta(1) and alpha...... indirectly may dilate the vessels by inhibition of norepinephrine release. Consistent with previous results in animals, the present haemodynamic studies revealed that dopamine in normal subjects elicits a dose dependent biphasic effect on the mean arterial blood pressure. With 1 and 2 micrograms...

  2. Overall renal and tubular function during infusion of amino acids in normal man

    DEFF Research Database (Denmark)

    Olsen, Niels Vidiendal; Hansen, J M; Ladefoged, S D

    1990-01-01

    sodium concentration] increased by 40% (P less than 0.001). Plasma renin concentration did not change significantly. 4. The results suggest that amino acids increase GFR by a primary effect on renal haemodynamics or, less likely, by reducing the signal to the tubuloglomerular feedback mechanism......1. Amino acids have been used to test renal reserve filtration capacity. Previous studies suggest that amino acids increase glomerular filtration rate (GFR) by reducing distal tubular flow and tubuloglomerular feedback activity. 2. Glomerular function and the renal tubular handling of sodium during...... infusion of amino acids was studied in 12 normal volunteers. 3. Clearance of sodium (CNa) was unchanged. Effective renal plasma flow increased slightly, but significantly, by 9% (P less than 0.05). GFR was increased by 13% (P less than 0.001). Clearance of lithium (CLi) (used as an index of proximal...

  3. Circadian Rhythm Neuropeptides in Drosophila: Signals for Normal Circadian Function and Circadian Neurodegenerative Disease.

    Science.gov (United States)

    He, Qiankun; Wu, Binbin; Price, Jeffrey L; Zhao, Zhangwu

    2017-04-21

    Circadian rhythm is a ubiquitous phenomenon in many organisms ranging from prokaryotes to eukaryotes. During more than four decades, the intrinsic and exogenous regulations of circadian rhythm have been studied. This review summarizes the core endogenous oscillation in Drosophila and then focuses on the neuropeptides, neurotransmitters and hormones that mediate its outputs and integration in Drosophila and the links between several of these (pigment dispersing factor (PDF) and insulin-like peptides) and neurodegenerative disease. These signaling molecules convey important network connectivity and signaling information for normal circadian function, but PDF and insulin-like peptides can also convey signals that lead to apoptosis, enhanced neurodegeneration and cognitive decline in flies carrying circadian mutations or in a senescent state.

  4. Kidney function in normal man during short-term growth hormone infusion

    DEFF Research Database (Denmark)

    Parving, H H; Noer, I; Mogensen, C E

    1978-01-01

    Kidney function was studied in 9 normal males before and during a 2 h growth hormone (GH) infusion of 50 ng/kg/min. The following variables were measured during each 20 min clearance period: glomerular filtration rate, GFR, effective renal plasma flow, RPF (steady state infusion technique...... with urinary collections using [125I]iothalamate and [131I]iodohippurate), and urinary albumin and beta2-microglobulin excretion rates (radioimmunoassays). The GH infusion resulted in a 10-fold increase in plasma GH concentration. All the above mentioned variables remained practically unchanged during...... the infusion except for a small (-5%) but significant decrease in renal plasma flow (P less than 0.01). Our negative results contrast to the findings of increased GFR and RPF during prolonged GH administration and suggest that GH requires several hours or days for its renal effects to become manifest....

  5. Intrathoracic toxic thyroid nodule causing hyperthyroidism with a multinodular normal functional cervical thyroid gland

    International Nuclear Information System (INIS)

    Serim, Burcu Dirlik; Korkmaz, Ulku; Can, Unal; Altun, Gulay Durmus

    2016-01-01

    Radionuclide scintigraphy with I-131 and Tc-99m pertechnetate ( 99 mTc0 4 ) has been widely used in detecting toxic nodules. Intrathoracic goiter usually presents as an anterior mediastinal mass. Mostly the connection between intrathoracic mass and the cervical thyroid gland is clearly and easily identified occurring as a result of inferior extension of thyroid tissue in the neck, which is called as secondary intrathoracic goiter. Completely separated, aberrant or in other words primary intrathoracic goiters arise as a result of abnormal embryologic migration of ectopic thyroid closely associated with aortic sac and descend into the mediastinum. Intrathoracic goiters are generally nontoxic nodules existing with mass effect without causing hyperthyroidism. However, mostly reported cases had enlarged thyroid glands in the neck. This report demonstrates the usefulness of I-131 and 99 mTc0 4 scintigraphy for detecting intrathoracic goiter causing hyperthyroidism with a normal functioned cervical thyroid gland

  6. Glutamine supplementation maintains intramuscular glutamine concentrations and normalizes lymphocyte function in infected early weaned pigs.

    Science.gov (United States)

    Yoo, S S; Field, C J; McBurney, M I

    1997-11-01

    Numerous studies in humans and rats have shown that glutamine supplementation during stressful conditions has favorable outcomes. However, the requirements for glutamine during weaning are unknown. Thus, the effects of glutamine supplementation in healthy and infected weaned pigs were investigated. At 21 d of age, pigs were weaned to an elemental diet supplemented with glutamine (+Gln) or an isonitrogenous diet containing nonessential amino acids (-Gln). At 26 d of age, pigs were intraperitoneally injected with Escherichia coli (+Ecoli) or buffered saline (-Ecoli) and killed at 28 d of age. Infection decreased (P Ecoli+Gln pigs were greater (P Ecoli-Gln pigs and not different than those of noninfected pigs. Hence, glutamine supplementation maintained muscular glutamine concentrations and normalized lymphocyte function in infected pigs.

  7. Functional magnetic resonance imaging of the normal and abnormal visual system in early life

    DEFF Research Database (Denmark)

    Born, A.P.; Miranda Gimenez-Ricco, Maria Jo; Rostrup, Egill

    2000-01-01

    in very young infants and in infants with brain damage. We examined 15 preterm infants, 12 children suspected of having a cerebral visual impairment and 10 children with a normal visual system, all of whom were either spontaneously asleep or sedated with chloral hydrate. Cortical response to stroboscopic...... showed a signal decrease. The activated cortical volumes showed a linear relation to age for healthy children younger than 90 weeks PMA, but were small in children with visual impairment. In two children with unilateral damage to the optic radiations, activation was strongly asymmetrical with greatest......Functional magnetic resonance imaging (fMRI) in young children may provide information about the development of the visual cortex, and may have predictive value for later visual performance. The purpose of this study was to evaluate the usefulness of fMRI for examining cerebral processing of vision...

  8. Trimester specific reference intervals for thyroid function tests in normal Indian pregnant women.

    Science.gov (United States)

    Sekhri, Tarun; Juhi, Juhi Agarwal; Wilfred, Reena; Kanwar, Ratnesh S; Sethi, Jyoti; Bhadra, Kuntal; Nair, Sirimavo; Singh, Satveer

    2016-01-01

    Accurate assessment of thyroid function during pregnancy is critical, for initiation of thyroid hormone therapy, as well as for adjustment of thyroid hormone dose in hypothyroid cases. We evaluated pregnant women who had no past history of thyroid disorders and studied their thyroid function in each trimester. 86 normal pregnant women in the first trimester of pregnancy were selected for setting reference intervals. All were healthy, euthyroid and negative for thyroid peroxidase antibody (TPOAb). These women were serially followed throughout pregnancy. 124 normal nonpregnant subjects were selected for comparison. Thyrotropin (TSH), free thyroxine (FT4), free triiodothyronine (FT3) and anti-TPO were measured using Roche Elecsys 1010 analyzer. Urinary iodine content was determined by simple microplate method. The 2.5th and 97.5th percentiles were calculated as the reference intervals for thyroid hormone levels during each trimester. SPSS (version 14.0, SPSS Inc., Chicago, IL, USA) was used for data processing and analysis. The reference intervals for the first, second and third trimesters for the following parameters: TSH 0.09-6.65, 0.51-6.66, 0.91-4.86 µIU/mL, FT4 9.81-18.53, 8.52-19.43, 7.39-18.28 pM/L and FT3 3.1-6.35, 2.39-5.12, 2.57-5.68 pM/L respectively. Thyroid hormone concentrations significantly differed during pregnancy at different stages of gestation. The pregnant women in the study had median urinary iodine concentration of 150-200 µg/l during each trimester. The trimester-specific reference intervals for thyroid tests during pregnancy have been established for pregnant Indian women serially followed during pregnancy using 2.5th and 97.5th percentiles.

  9. NORMAL VALUES AND FACTORS AFFECTING FUNCTIONAL REACH TEST IN SAUDI ARABIA SCHOOL CHILDREN WITH TYPICAL DEVELOPMENT

    Directory of Open Access Journals (Sweden)

    Hatem A. Emara

    2015-10-01

    Full Text Available Background: The most critical feature of motor development is the ability to balance the body in sitting or standing. Impaired balance limits a child’s ability to recover from unexpected threats to stability. The functional reach test (FRT defines the maximal distance an individual is able to reach forward beyond arm’s length in a standing position without loss of balance, taking a step, or touching the wall. The Purpose of this study was to establish the normal values for FRT in Saudi Arabia school children with typical development and to study the correlation of anthropometric measures with FRT values. Methods: This cross-sectional study was conducted in Almadinah Almonawarah, Kingdom of Saudi Arabia. A total of 280 children without disabilities aged 6 to 12 years were randomly selected. Functional reach was assessed by having subjects extend their arms to 90 degrees and reach as far forward as they could without taking a step. Reach distance was recorded by noting the beginning and final position of the subject's extended arm parallel to a yard stick attached to the wall. Three successive trials of FRT were performed and the mean of the three trials was calculated. Pearson product moment correlation was used to examine the association of FR to age, and anthropometric measures. Results: Normal mean values of FR ranged from 24.2cm to 33.95cm. Age, height and weight significantly correlate with FRT. Conclusion: The FRT is a feasible test to examine the balance of 6-12 year-old children. FRT may be useful for detecting balance impairment, change in balance performance over time.

  10. Effect of laryngeal anesthesia on pulmonary function testing in normal subjects.

    Science.gov (United States)

    Kuna, S T; Woodson, G E; Sant'Ambrogio, G

    1988-03-01

    Pulmonary function tests (PFT) were performed on 11 normal subjects before and after topical anesthesia of the larynx. The PFT consisted of flow volume loops and body box determinations of functional residual capacity and airway resistance, each performed in triplicate. After the first set of tests, cotton pledgets soaked in 4% lidocaine were held in the pyriform sinuses for 2 min to block the superior laryngeal nerves. In addition, 1.5 ml of 10% cocaine was dropped on the vocal cords via indirect laryngoscopy. PFT were repeated 5 min after anesthesia. Besides routine analysis of the flow volume loops, areas under the inspiratory (Area I) and expiratory (Area E) portions of the loops were calculated by planimetry. Area I, peak inspiratory flow (PIF), as well as forced inspiratory flow at 25, 50, and 75% forced vital capacity (FVC), decreased after anesthesia. Peak expiratory flow decreased after anesthesia, but Area E and forced expiratory flow at 25, 50, and 75% FVC were unchanged. This protocol also was performed in 12 normal subjects with isotonic saline being substituted for the lidocaine and cocaine. In this group, no significant differences were observed when flow volume loop parameters were compared before and after topical application of saline. In 5 spontaneously breathing anesthetized dogs, posterior cricoarytenoid muscle and afferent superior laryngeal nerve activity were recorded before and after laryngeal anesthesia performed with the same procedure used in the human subjects. Laryngeal anesthesia resulted in a substantial decrease or a complete disappearance of afferent SLN activity recorded during unobstructed and obstructed respiration. The data suggest that laryngeal receptors help modulate upper airway patency in man.

  11. Common chromosomal fragile sites (CFS) may be involved in normal and traumatic cognitive stress memory consolidation and altered nervous system immunity.

    Science.gov (United States)

    Gericke, G S

    2010-05-01

    Previous reports of specific patterns of increased fragility at common chromosomal fragile sites (CFS) found in association with certain neurobehavioural disorders did not attract attention at the time due to a shift towards molecular approaches to delineate neuropsychiatric disorder candidate genes. Links with miRNA, altered methylation and the origin of copy number variation indicate that CFS region characteristics may be part of chromatinomic mechanisms that are increasingly linked with neuroplasticity and memory. Current reports of large-scale double-stranded DNA breaks in differentiating neurons and evidence of ongoing DNA demethylation of specific gene promoters in adult hippocampus may shed new light on the dynamic epigenetic changes that are increasingly appreciated as contributing to long-term memory consolidation. The expression of immune recombination activating genes in key stress-induced memory regions suggests the adoption by the brain of this ancient pattern recognition and memory system to establish a structural basis for long-term memory through controlled chromosomal breakage at highly specific genomic regions. It is furthermore considered that these mechanisms for management of epigenetic information related to stress memory could be linked, in some instances, with the transfer of the somatically acquired information to the germline. Here, rearranged sequences can be subjected to further selection and possible eventual retrotranscription to become part of the more stable coding machinery if proven to be crucial for survival and reproduction. While linkage of cognitive memory with stress and fear circuitry and memory establishment through structural DNA modification is proposed as a normal process, inappropriate activation of immune-like genomic rearrangement processes through traumatic stress memory may have the potential to lead to undesirable activation of neuro-inflammatory processes. These theories could have a significant impact on the

  12. Human embryonic stem cell (hES derived dendritic cells are functionally normal and are susceptible to HIV-1 infection

    Directory of Open Access Journals (Sweden)

    Bandi Sriram

    2008-01-01

    Full Text Available Abstract Background Human embryonic stem (hES cells hold considerable promise for cell replacement and gene therapies. Their remarkable properties of pluripotency, self-renewal, and tractability for genetic modification potentially allows for the production of sizeable quantities of therapeutic cells of the hematopoietic lineage. Dendritic cells (DC arise from CD34+ hematopoietic progenitor cells (HPCs and are important in many innate and adaptive immune functions. With respect to HIV-1 infection, DCs play an important role in the efficient capture and transfer of the virus to susceptible cells. With an aim of generating DCs from a renewable source for HIV-1 studies, here we evaluated the capacity of hES cell derived CD34+ cells to give rise to DCs which can support HIV-1 infection. Results Undifferentiated hES cells were cultured on S17 mouse bone marrow stromal cell layers to derive CD34+ HPCs which were subsequently grown in specific cytokine differentiation media to promote the development of DCs. The hES derived DCs (hES-DC were subjected to phenotypic and functional analyses and compared with DCs derived from fetal liver CD34+ HPC (FL-DC. The mature hES-DCs displayed typical DC morphology consisting of veiled stellate cells. The hES-DCs also displayed characteristic phenotypic surface markers CD1a, HLA-DR, B7.1, B7.2, and DC-SIGN. The hES-DCs were found to be capable of antigen uptake and stimulating naïve allogeneic CD4+ T cells in a mixed leukocyte reaction assay. Furthermore, the hES-DCs supported productive HIV-1 viral infection akin to standard DCs. Conclusion Phenotypically normal and functionally competent DCs that support HIV-1 infection can be derived from hES cells. hES-DCs can now be exploited in applied immunology and HIV-1 infection studies. Using gene therapy approaches, it is now possible to generate HIV-1 resistant DCs from anti-HIV gene transduced hES-CD34+ hematopoietic progenitor cells.

  13. Assessment of Eustachian tube function in patients with tympanic membrane retraction and in normal subjects.

    Science.gov (United States)

    Canali, Inesângela; Petersen Schmidt Rosito, Letícia; Siliprandi, Bruno; Giugno, Cláudia; Selaimen da Costa, Sady

    The diagnosis of Eustachian tube dysfunctions is essential for better understanding of the pathogenesis of chronic otitis media. A series of tests to assess tube function are described in the literature; however, they are methodologically heterogeneous, with differences ranging from application protocols to standardization of tests and their results. To evaluate the variation in middle ear pressure in patients with tympanic membrane retraction and in normal patients during tube function tests, as well as to evaluate intra-individual variation between these tests. An observational, contemporary, cross-sectional study was conducted, in which the factor under study was the variation in middle ear pressure during tube function tests (Valsalva maneuver, sniff test, Toynbee maneuver) in healthy patients and in patients with mild and moderate/severe tympanic retraction. A total of 38 patients (76 ears) were included in the study. Patients underwent tube function tests at two different time points to determine pressure measurements after each maneuver. Statistical analysis was performed using SPSS software, version 18.0, considering p-values <0.05 as statistically significant. Mean (standard deviation) age was 11 (2.72) years; 55.3% of patients were male and 44.7% female. The prevalence of type A tympanogram was higher among participants with healthy ears and those with mild retraction, whereas type C tympanograms were more frequent in the moderate/severe retraction group. An increase in middle ear pressure was observed during the Valsalva maneuver at the first time point evaluated in all three groups of ears (p=0.012). The variation in pressure was not significant either for the sniff test or for the Toynbee maneuver at the two time points evaluated (p≥0.05). Agreement between measurements obtained at the two different time points was weak to moderate for all tests in all three groups of ears, and the variations in discrepancy between measurements were higher in ears

  14. Normal differential renal function does not indicate a normal kidney after partial ureteropelvic obstruction and subsequent relief in 2-week-old piglets

    Energy Technology Data Exchange (ETDEWEB)

    Dissing, Thomas H.; Mikkelsen, Mette Marie; Pedersen, Michael; Froekiaer, Joergen; Djurhuus, Jens Christian [University of Aarhus, Institute of Clinical Medicine, Aarhus (Denmark); Eskild-Jensen, Anni [Aarhus University Hospital, Department of Nuclear Medicine, Aarhus Sygehus, Aarhus (Denmark); Gordon, Isky [University College London, Institute of Child Health, London (United Kingdom); University College London, Radiology and Physics Unit, Institute of Child Health, London (United Kingdom)

    2008-09-15

    We investigated the functional consequences of relieving ureteric obstruction in young pigs with experimental hydronephrosis (HN) induced by partial unilateral ureteropelvic obstruction. Three groups of animals were followed from the age of 2 weeks to the age of 14 weeks: Eight animals had severe or grades 3-4 HN throughout the study. Six animals had relief of the obstruction after 4 weeks. Six animals received sham operations at both ages. Morphological and functional examinations were performed at age 6 weeks and again at age 14 weeks and consisted of magnetic resonance imaging (MRI), technetium-diethylenetriaminepentaaceticacid ({sup 99m}Tc-DTPA) renography, renal technetium-dimercaptosuccinicacid ({sup 99m}Tc-DMSA) scintigraphy, and glomerular filtration rate (GFR) measurement. After relief of the partial obstruction, there was reduction of the pelvic diameter and improvement of urinary drainage. Global and relative kidney function was not significantly affected by either obstruction or its relief. Renal {sup 99m}Tc-DMSA scintigraphy showed a change in both the appearance of the kidney and a change in the distribution within kidneys even after relief of obstruction. This study shows that partial ureteric obstruction in young pigs may be associated with little effect on global and differential kidney function. However, even after relief of HN, the distribution of {sup 99m}Tc-DMSA in the kidney remains abnormal suggesting that a normal differential renal function may not represent a normal kidney. (orig.)

  15. Antacid-induced hypermagnesemia in a patient with normal renal function and bowel obstruction.

    Science.gov (United States)

    McLaughlin, S A; McKinney, P E

    1998-03-01

    To report a case of severe hypermagnesemia caused by magnesium hydroxide in a woman with normal renal function. A 42-year-old Hispanic woman with schizophrenia and bipolar affective disorder was transported from jail to the emergency department with confusion, abdominal pain, vomiting, and constipation. She had been treated in jail with magnesium hydroxide, ordered as milk of magnesia 30 mL po each night and Maalox 30 mL po three times daily. Additional medications included lithium carbonate 300 mg po three times daily, chlorpromazine 150 mg po three times daily, benztropine mesylate 1 mg po twice daily, and docusate sodium 100 mg po each morning. Her temperature was 35.1 degrees C, blood pressure 108/58 mm Hg, heart rate 112 beats/min, and respiratory rate 24 breaths/min. She would respond only briefly to voice or painful stimuli. Her abdomen was distended and diffusely tender. Laboratory tests included serum magnesium concentration 9.1 mEq/L (normal 1.3-2), blood urea nitrogen 16 mg/dL (8-22), creatinine 0.9 mg/dL (0.5-1.1), calcium 3.9 mEq/L (4.2-5.2), and lithium 1.0 mEq/L. A laparotomy was performed, and an adhesive band from a previous oophorectomy was found to be compressing the sigmoid colon. Hypermagnesemia, hypothermia, and hypotension continued in the intensive care unit. Despite successful treatment of the hypermagnesemia with calcium, intravenous fluids, and furosemide, the patient's cardiac rhythm degenerated into fatal, pulseless electrical activity on postoperative day 2. This case of severe hypermagnesemia from magnesium hydroxide ingestion illustrates many of the risk factors for hypermagnesemia in patients with normal renal function. People using magnesium-containing medications for relief of gastrointestinal distress may be at increased risk for hypermagnesemia. A brief review of magnesium physiology, clinical effects, and treatment is provided. Frequent use of the laboratory to identify hypermagnesemia is encouraged because it is often a

  16. Study of immune function in children with thalassanemia major after partial splenic embolization

    International Nuclear Information System (INIS)

    Mei Quelin; Liu Pengcheng; Chen Yong; Li Yanhao

    2006-01-01

    Objective: To evaluate the changes of immunologic function in children with thalassanemia major after partial splenic embolization (PSE). Methods: Immunoglobulins, T cell subsets were detected by immunologic turbidimetry and APAAP with monoclonal antibody respectively in 40 children with thalassanemia major and also in 20 healthy persons before and after PSE. These immunologic indexes were compared before and after PSE. Results: The levels of IgG in serum were significantly lower one week after PSE than that before PSE. It turned to normal three weeks after PSE. The IgM, IgA levels remained unchanged during PSE. The levels of CD 3 , CD 4 ,CD 4 /CD 8 ratio in children with thalassanemia major were decreased (P<0.01) significantly in comparision with the normal controls. But , all of them were significantly increased after PSE than those before PSE (P<0.01), and returned to normal levels at the 3rd week. Conclusions: PSE is helpful for improving immunologic function of children with thalassanemia major. (authors)

  17. An accurate higher order displacement model with shear and normal deformations effects for functionally graded plates

    Energy Technology Data Exchange (ETDEWEB)

    Jha, D.K., E-mail: dkjha@barc.gov.in [Civil Engineering Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India); Kant, Tarun [Department of Civil Engineering, Indian Institute of Technology Bombay, Powai, Mumbai 400 076 (India); Srinivas, K. [Civil Engineering Division, Bhabha Atomic Research Centre, Mumbai 400 085 (India); Singh, R.K. [Reactor Safety Division, Bhabha Atomic Research Centre, Mumbai 400 085 (India)

    2013-12-15

    Highlights: • We model through-thickness variation of material properties in functionally graded (FG) plates. • Effect of material grading index on deformations, stresses and natural frequency of FG plates is studied. • Effect of higher order terms in displacement models is studied for plate statics. • The benchmark solutions for the static analysis and free vibration of thick FG plates are presented. -- Abstract: Functionally graded materials (FGMs) are the potential candidates under consideration for designing the first wall of fusion reactors with a view to make best use of potential properties of available materials under severe thermo-mechanical loading conditions. A higher order shear and normal deformations plate theory is employed for stress and free vibration analyses of functionally graded (FG) elastic, rectangular, and simply (diaphragm) supported plates. Although FGMs are highly heterogeneous in nature, they are generally idealized as continua with mechanical properties changing smoothly with respect to spatial coordinates. The material properties of FG plates are assumed here to vary through thickness of plate in a continuous manner. Young's modulii and material densities are considered to be varying continuously in thickness direction according to volume fraction of constituents which are mathematically modeled here as exponential and power law functions. The effects of variation of material properties in terms of material gradation index on deformations, stresses and natural frequency of FG plates are investigated. The accuracy of present numerical solutions has been established with respect to exact three-dimensional (3D) elasticity solutions and the other models’ solutions available in literature.

  18. Distinguishing patients with Parkinson's disease subtypes from normal controls based on functional network regional efficiencies.

    Directory of Open Access Journals (Sweden)

    Delong Zhang

    Full Text Available Many studies have demonstrated that the pathophysiology and clinical symptoms of Parkinson's disease (PD are inhomogeneous. However, the symptom-specific intrinsic neural activities underlying the PD subtypes are still not well understood. Here, 15 tremor-dominant PD patients, 10 non-tremor-dominant PD patients, and 20 matched normal controls (NCs were recruited and underwent resting-state functional magnetic resonance imaging (fMRI. Functional brain networks were constructed based on randomly generated anatomical templates with and without the cerebellum. The regional network efficiencies (i.e., the local and global efficiencies were further measured and used to distinguish subgroups of PD patients (i.e., with tremor-dominant PD and non-tremor-dominant PD from the NCs using linear discriminant analysis. The results demonstrate that the subtype-specific functional networks were small-world-organized and that the network regional efficiency could discriminate among the individual PD subgroups and the NCs. Brain regions involved in distinguishing between the study groups included the basal ganglia (i.e., the caudate and putamen, limbic regions (i.e., the hippocampus and thalamus, the cerebellum, and other cerebral regions (e.g., the insula, cingulum, and calcarine sulcus. In particular, the performances of the regional local efficiency in the functional network were better than those of the global efficiency, and the performances of global efficiency were dependent on the inclusion of the cerebellum in the analysis. These findings provide new evidence for the neurological basis of differences between PD subtypes and suggest that the cerebellum may play different roles in the pathologies of different PD subtypes. The present study demonstrated the power of the combination of graph-based network analysis and discrimination analysis in elucidating the neural basis of different PD subtypes.

  19. Nanoparticle-based B-cell targeting vaccines: Tailoring of humoral immune responses by functionalization with different TLR-ligands.

    Science.gov (United States)

    Zilker, Claudia; Kozlova, Diana; Sokolova, Viktoriya; Yan, Huimin; Epple, Matthias; Überla, Klaus; Temchura, Vladimir

    2017-01-01

    Induction of an appropriate type of humoral immune response during vaccination is essential for protection against viral and bacterial infections. We recently observed that biodegradable calcium phosphate (CaP) nanoparticles coated with proteins efficiently targeted and activated naïve antigen-specific B-cells in vitro. We now compared different administration routes for CaP-nanoparticles and demonstrated that intramuscular immunization with such CaP-nanoparticles induced stronger immune responses than immunization with monovalent antigen. Additional functionalization of the CaP-nanoparticles with TRL-ligands allowed modulating the IgG subtype response and the level of mucosal IgA antibodies. CpG-containing CaP-nanoparticles were as immunogenic as a virus-like particle vaccine. Functionalization of CaP-nanoparticles with T-helper cell epitopes or CpG also allowed overcoming lack of T-cell help. Thus, our results indicate that CaP-nanoparticle-based B-cell targeting vaccines functionalized with TLR-ligands can serve as a versatile platform for efficient induction and modulation of humoral immune responses in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Maternal immune activation leads to selective functional deficits in offspring parvalbumin interneurons.

    Science.gov (United States)

    Canetta, S; Bolkan, S; Padilla-Coreano, N; Song, L J; Sahn, R; Harrison, N L; Gordon, J A; Brown, A; Kellendonk, C

    2016-07-01

    Abnormalities in prefrontal gamma aminobutyric acid (GABA)ergic transmission, particularly in fast-spiking interneurons that express parvalbumin (PV), are hypothesized to contribute to the pathophysiology of multiple psychiatric disorders, including schizophrenia, bipolar disorder, anxiety disorders and depression. While primarily histological abnormalities have been observed in patients and in animal models of psychiatric disease, evidence for abnormalities in functional neurotransmission at the level of specific interneuron populations has been lacking in animal models and is difficult to establish in human patients. Using an animal model of a psychiatric disease risk factor, prenatal maternal immune activation (MIA), we found reduced functional GABAergic transmission in the medial prefrontal cortex (mPFC) of adult MIA offspring. Decreased transmission was selective for interneurons expressing PV, resulted from a decrease in release probability and was not observed in calretinin-expressing neurons. This deficit in PV function in MIA offspring was associated with increased anxiety-like behavior and impairments in attentional set shifting, but did not affect working memory. Furthermore, cell-type specific optogenetic inhibition of mPFC PV interneurons was sufficient to impair attentional set shifting and enhance anxiety levels. Finally, we found that in vivo mPFC gamma oscillations, which are supported by PV interneuron function, were linearly correlated with the degree of anxiety displayed in adult mice, and that this correlation was disrupted in MIA offspring. These results demonstrate a selective functional vulnerability of PV interneurons to MIA, leading to affective and cognitive symptoms that have high relevance for schizophrenia and other psychiatric disorders.

  1. Renal function evaluation in the aged with normal blood pressure and high blood pressure

    International Nuclear Information System (INIS)

    Jacob Filho, W.; Carvalho Filho, E.T. de; Papaleo Netto, M.; Baptista, M.C.

    1986-01-01

    Thirty-four patients older than 65 years were divided into two groups according to their ages: I - 66 to 74 years (17 patients), II - 75 and over (17 patients). These elderly patients were also divided according to their arterial blood pressure level (BP): A - normal BP (14 patients), B high BP (20 patients). None of these patients presented any other disease that could affect kidney function, nor have used drugs that could interfere on the BP or on the kidney function. Glomerular filtration rate (GFR) and effective renal plasmatic flow (ERPF) were analysed by radioisotopic techniques. Furthermore the filtration fraction (FF) was evaluated by the GFR/ERPF ratio. The observed GFR, ERPF and FF variations in the age groups or in normotensive and hypertensive patients were not significant, but we could assume that the physiopathological mechanisms that cause a decreased GFR in consequence of age or of systemic hypertension could be of different origins. Thus in the old hypertensive patients, alterations in the autoregulated hemodynamic mechanism could occur. (author) [pt

  2. Structural and functional changes associated with normal and abnormal fundus autofluorescence in patients with retinitis pigmentosa.

    Science.gov (United States)

    Greenstein, Vivienne C; Duncker, Tobias; Holopigian, Karen; Carr, Ronald E; Greenberg, Jonathan P; Tsang, Stephen H; Hood, Donald C

    2012-02-01

    To analyze the structure and visual function of regions bordering the hyperautofluorescent ring/arcs in retinitis pigmentosa. Twenty-one retinitis pigmentosa patients (21 eyes) with rings/arcs and 21 normal individuals (21 eyes) were studied. Visual sensitivity in the central 10° was measured with microperimetry. Retinal structure was evaluated with spectral-domain optical coherence tomography. The distance from the fovea to disruption/loss of the inner outer segment (IS/OS) junction and thicknesses of the total receptor plus retinal pigment epithelial complex and outer segment plus retinal pigment epithelial complex layers were measured. Results were compared with measurements of the distance from the fovea to the inner and outer borders of the ring/arc seen on fundus autofluorescence. Disruption/loss of the inner outer segment junction occurred closer to the inner border of the ring/arc and it was closer to the fovea in eight eyes. For 19 eyes, outer segment plus and receptor plus RPE complex thicknesses were significantly decreased at locations closer to the fovea than the appearance of the inner border of hyperautofluorescence. Mean visual sensitivity was decreased inside, across, and outside the ring/arc by 3.5 ± 3.8, 8.9 ± 4.8, and 17.0 ± 2.4 dB, respectively. Structural and functional changes can occur inside the hyperfluorescent ring/arc in retinitis pigmentosa.

  3. Diffusion tensor tractography of language functional areas and fiber pathways in normal human brain

    International Nuclear Information System (INIS)

    Sun Xuejin; Dai Jianping; Chen Hongyan; Gao Peiyi; Ai Lin; Tian Shengyong; Pang Ruilin

    2007-01-01

    Objective: To demonstrate the fiber pathways of Broca area to the other functional brain areas with diffusion tensor imaging and fiber tracking. Methods: Conventionality MRI, diffusion tensor imaging (DTI) and fiber tracking were performed using 3.0 T MRI in 20 healthy person. The fiber bundles and tracts were analyzed in Broca area and contralateral normal area. Results: The left-side fiber bundles were 428 and the right-side were 416 in B45 area, there were no statistically significant differences between both sides (t=0.216, P>0.05). The left-side fiber bundles were 432 and the right-side were 344 in B44 area,there were statistically significant (t=2.314, P 0.05). Differences of the arcuate fascicule between both sides were not statistically significant (t=-0.465, P>0.05), the mean FA on the left was higher than the right (t=1.912, P<0.05). DTI and fiber tracking exhibited that the fiber bundles from Broca area were distributed superoanteriorly to the lateral foreside of the frontal lobe, lateroinferiorly to the occipital lobe through external capsule, and went down through globus pallidus and internal capsule. Conclusion: The fiber tracts bewteen Broca area and other brain areas were the fundamental structures for performing language function of the human brain. (authors)

  4. The Effect of Executive Function on Science Achievement Among Normally Developing 10-Year Olds

    Science.gov (United States)

    Lederman, Sheri G.

    Executive function (EF) is an umbrella term used to identify a set of discrete but interrelated cognitive abilities that enable individuals to engage in goal-directed, future-oriented action in response to a novel context. Developmental studies indicate that EF is predictive of reading and math achievement in middle childhood. The purpose of this study was to identify the association between EF and science achievement among normally developing 10 year olds. A sample of fifth grade students from a Northeastern suburban community participated in tests of EF, science, and intelligence. Consistent with adult models of EF, principal components analysis identified a three-factor model of EF organization in middle childhood, including cognitive flexibility, working memory, and inhibition. Multiple regression analyses revealed that executive function processes of cognitive flexibility, working memory, and inhibition were all predictive of science performance. Post hoc analyses revealed that high-performing science students differed significantly from low-performing students in both cognitive flexibility and working memory. These findings suggest that complex academic demands specific to science achievement rely on the emergence and maturation of EF components.

  5. Neurofeedback training produces normalization in behavioural and electrophysiological measures of high-functioning autism.

    Science.gov (United States)

    Pineda, Jaime A; Carrasco, Karen; Datko, Mike; Pillen, Steven; Schalles, Matt

    2014-01-01

    Autism spectrum disorder (ASD) is a neurodevelopmental condition exhibiting impairments in behaviour, social and communication skills. These deficits may arise from aberrant functional connections that impact synchronization and effective neural communication. Neurofeedback training (NFT), based on operant conditioning of the electroencephalogram (EEG), has shown promise in addressing abnormalities in functional and structural connectivity. We tested the efficacy of NFT in reducing symptoms in children with ASD by targeting training to the mirror neuron system (MNS) via modulation of EEG mu rhythms. The human MNS has provided a neurobiological substrate for understanding concepts in social cognition relevant to behavioural and cognitive deficits observed in ASD. Furthermore, mu rhythms resemble MNS phenomenology supporting the argument that they are linked to perception and action. Thirty hours of NFT on ASD and typically developing (TD) children were assessed. Both groups completed an eyes-open/-closed EEG session as well as a mu suppression index assessment before and after training. Parents filled out pre- and post-behavioural questionnaires. The results showed improvements in ASD subjects but not in TDs. This suggests that induction of neuroplastic changes via NFT can normalize dysfunctional mirroring networks in children with autism, but the benefits are different for TD brains.

  6. Functional mapping of language networks in the normal brain using a word-association task

    International Nuclear Information System (INIS)

    Ghosh, Shantanu; Basu, Amrita; Kumaran, Senthil S; Khushu, Subash

    2010-01-01

    Language functions are known to be affected in diverse neurological conditions, including ischemic stroke, traumatic brain injury, and brain tumors. Because language networks are extensive, interpretation of functional data depends on the task completed during evaluation. The aim was to map the hemodynamic consequences of word association using functional magnetic resonance imaging (fMRI) in normal human subjects. Ten healthy subjects underwent fMRI scanning with a postlexical access semantic association task vs lexical processing task. The fMRI protocol involved a T2*-weighted gradient-echo echo-planar imaging (GE-EPI) sequence (TR 4523 ms, TE 64 ms, flip angle 90°) with alternate baseline and activation blocks. A total of 78 scans were taken (interscan interval = 3 s) with a total imaging time of 587 s. Functional data were processed in Statistical Parametric Mapping software (SPM2) with 8-mm Gaussian kernel by convolving the blood oxygenation level-dependent (BOLD) signal with an hemodynamic response function estimated by general linear method to generate SPM{t} and SPM{F} maps. Single subject analysis of the functional data (FWE-corrected, P≤0.001) revealed extensive activation in the frontal lobes, with overlaps among middle frontal gyrus (MFG), superior, and inferior frontal gyri. BOLD activity was also found in the medial frontal gyrus, middle occipital gyrus (MOG), anterior fusiform gyrus, superior and inferior parietal lobules, and to a smaller extent, the thalamus and right anterior cerebellum. Group analysis (FWE-corrected, P≤0.001) revealed neural recruitment of bilateral lingual gyri, left MFG, bilateral MOG, left superior occipital gyrus, left fusiform gyrus, bilateral thalami, and right cerebellar areas. Group data analysis revealed a cerebellar–occipital–fusiform–thalamic network centered around bilateral lingual gyri for word association, thereby indicating how these areas facilitate language comprehension by activating a semantic

  7. Functional mapping of language networks in the normal brain using a word-association task

    Directory of Open Access Journals (Sweden)

    Ghosh Shantanu

    2010-01-01

    Full Text Available Background: Language functions are known to be affected in diverse neurological conditions, including ischemic stroke, traumatic brain injury, and brain tumors. Because language networks are extensive, interpretation of functional data depends on the task completed during evaluation. Aim: The aim was to map the hemodynamic consequences of word association using functional magnetic resonance imaging (fMRI in normal human subjects. Materials and Methods: Ten healthy subjects underwent fMRI scanning with a postlexical access semantic association task vs lexical processing task. The fMRI protocol involved a T2FNx01-weighted gradient-echo echo-planar imaging (GE-EPI sequence (TR 4523 ms, TE 64 ms, flip angle 90º with alternate baseline and activation blocks. A total of 78 scans were taken (interscan interval = 3 s with a total imaging time of 587 s. Functional data were processed in Statistical Parametric Mapping software (SPM2 with 8-mm Gaussian kernel by convolving the blood oxygenation level-dependent (BOLD signal with an hemodynamic response function estimated by general linear method to generate SPM{t} and SPM{F} maps. Results: Single subject analysis of the functional data (FWE-corrected, P≤0.001 revealed extensive activation in the frontal lobes, with overlaps among middle frontal gyrus (MFG, superior, and inferior frontal gyri. BOLD activity was also found in the medial frontal gyrus, middle occipital gyrus (MOG, anterior fusiform gyrus, superior and inferior parietal lobules, and to a smaller extent, the thalamus and right anterior cerebellum. Group analysis (FWE-corrected, P≤0.001 revealed neural recruitment of bilateral lingual gyri, left MFG, bilateral MOG, left superior occipital gyrus, left fusiform gyrus, bilateral thalami, and right cerebellar areas. Conclusions: Group data analysis revealed a cerebellar-occipital-fusiform-thalamic network centered around bilateral lingual gyri for word association, thereby indicating how these

  8. Altered time structure of neuro-endocrine-immune system function in lung cancer patients

    Directory of Open Access Journals (Sweden)

    Carughi Stefano

    2010-06-01

    TcS1 was decreased in cancer patients. The melatonin/cortisol mean nocturnal level ratio was decreased in cancer patients. Conclusion The altered secretion and loss of circadian rhythmicity of many studied factors observed in the subjects suffering from neoplastic disease may be expression of gradual alteration of the integrated function of the neuro-immune-endocrine system

  9. Integrated Circuit Immunity

    Science.gov (United States)

    Sketoe, J. G.; Clark, Anthony

    2000-01-01

    This paper presents a DOD E3 program overview on integrated circuit immunity. The topics include: 1) EMI Immunity Testing; 2) Threshold Definition; 3) Bias Tee Function; 4) Bias Tee Calibration Set-Up; 5) EDM Test Figure; 6) EMI Immunity Levels; 7) NAND vs. and Gate Immunity; 8) TTL vs. LS Immunity Levels; 9) TP vs. OC Immunity Levels; 10) 7805 Volt Reg Immunity; and 11) Seventies Chip Set. This paper is presented in viewgraph form.

  10. Effect of depression on the immune function and tumor load in patients with advanced gastric cancer

    Directory of Open Access Journals (Sweden)

    Hai-Bo Shi

    2017-06-01

    Full Text Available Objective: To study the correlation between depression and immune function as well as tumor load in patients with advanced gastric cancer. Methods: 98 patients diagnosed with advanced gastric cancer in our hospital between May 2013 and September 2016 were selected and divided into depression group (n=39 with HAMD scores >50 and non-depression group with HAMD scores≤50 (n=39, serum was collected to detect the levels of cytokines interleukin-2 (IL-2, IL-4, IL-10, IL-17, interferon-γ (IFN-γ and transforming growth factor β1 (TGF- β1 as well as tumor markers carcinoembryonic antigen (CEA, carbohydrate antigen 199 (CA199, CA724, TK-1 and sLAG-3, and gastric cancer tissues were collected to determine the expression of cell cycle-related proteins CyclinD1, CDK4 and E2F. Results: Serum IL-2, IFN-γ and IL-17 levels of depression group were significantly lower than those of non-depression group (P<0.05 while IL-4, IL-10, TGF-β1, CEA, CA199, CA724, TK-1 and sLAG-3 levels were significantly higher than those of non-depression group (P<0.05; CyclinD1, CDK4 and E2F protein expression in tumor tissues of depression group were significantly higher than those of non-depression group (P<0.05. Conclusions: Depression can inhibit the anti-tumor immune response in patients with advanced gastric cancer, and then promote cancer cell proliferation and increase tumor load.

  11. Evaluation of long-term effects of 50-Hz magnetic fields on immune functions in humans

    Energy Technology Data Exchange (ETDEWEB)

    Touitou, Y.; Auzeby, A.; Camus, F. [Faculty of Medicine Pierre et Marie Curie, 75 - Paris (France); Lambrozo, J.; Souques, M.; Verrier, A. [Gaz de France (EDF/GDF), SEM, 75 - Paris (France)

    2006-07-01

    The relationship between exposure to 50-Hz magnetic fields (E.L.F.) and human health is of increasing interest since this exposure has been implicated in many different diseases including cancers in epidemiological studies, though the results are controversial. The identification of possible mechanisms of interaction between E.L.F. and biological systems that could provide a biological plausibility to the observed effects has failed so far. In this study we investigate the possible chronic effects of exposure to E.L.F. in humans. We examine the circadian rhythm of CD{sub 3}, CD{sub 4}, CD{sub 8}, Nk cells and B cells in 15 men (38.0{+-}8.9 yrs) exposed chronically and daily for a period of 1-20 years, in the workplace and at home, to a 50-Hz magnetic field in search of any cumulative effect from those chronic conditions of exposure. The weekly geometric mean of individual exposures ranged from 0.1 to 2.6 {mu}T. The results are compared to those for 15 unexposed men similar in a (39.4 {+-}1.2 yrs), with the same synchronization and physical activity who served as controls (individual exposures ranged from 0.004 to 0.092 {mu}T). Blood samples were taken hourly from 2000 to 0800. This work shows that subjects exposed over a long period (up to 20 years) and on a daily basis to magnetic fields experienced no changes in their plasma immune variables. Our data suggest therefore that magnetic fields have no cumulative effects on immune functions, at least for the variables under study. (authors)

  12. Effect of depression on the immune function and tumor load in patients with advanced gastric cancer

    Institute of Scientific and Technical Information of China (English)

    Hai-Bo Shi

    2017-01-01

    Objective:To study the correlation between depression and immune function as well as tumor load in patients with advanced gastric cancer.Methods: 98 patients diagnosed with advanced gastric cancer in our hospital between May 2013 and September 2016 were selected and divided into depression group (n=39) with HAMD scores >50 and non-depression group with HAMD scores≤50 (n=39), serum was collected to detect the levels of cytokines interleukin-2 (IL-2), IL-4, IL-10, IL-17, interferon-γ (IFN-γ) and transforming growth factorβ1 (TGF-β1) as well as tumor markers carcinoembryonic antigen (CEA), carbohydrate antigen 199 (CA199), CA724, TK-1 and sLAG-3, and gastric cancer tissues were collected to determine the expression of cell cycle-related proteins CyclinD1, CDK4 and E2F.Results:Serum IL-2, IFN-γand IL-17 levels of depression group were significantly lower than those of non-depression group (P<0.05) while IL-4, IL-10, TGF-β1, CEA, CA199, CA724, TK-1 and sLAG-3 levels were significantly higher than those of non-depression group (P<0.05);CyclinD1, CDK4 and E2F protein expression in tumor tissues of depression group were significantly higher than those of non-depression group (P<0.05).Conclusions:Depression can inhibit the anti-tumor immune response in patients with advanced gastric cancer, and then promote cancer cell proliferation and increase tumor load.

  13. Lipid mobilization, immune function and the paradigm of vitamin E in transition cows.

    Directory of Open Access Journals (Sweden)

    Ioannis Politis

    2016-06-01

    Full Text Available The number of metabolic disorders that dairy cows have to cope during the transition to lactation can be divided in three main categories. The first category includes disorders related to abnormal energy metabolism (ketosis, fatty liver, acidosis. The second and the third categories include disorders related to mineral metabolism (milk fever and disorders related directly or indirectly to impaired immune function (mastitis, metritis, retained placenta, respectively. Among the many physiological changes during the transition period, perhaps the most crucial, is an increase in the concentration of plasma non-esterified fatty acids (NEFA. A portion of this increase in NEFA is obligatory and it is under hormonal control while another portion is the result of a situation known as negative energy balance (difference between energy consumed and energy spent. In this presentation I will present data from a collaborative study between the University of Milan and the Agricultural University of Athens which proves that negative correlations exist between blood concentrations of NEFA and β-hydroxybutyrate with α-tocopherol. The adipose tissue contains two main categories of cells: adipocytes and immunocompetent cells mainly monocytes/macrophages. Our research has tested the hypothesis that a cross-talk exists between adipocytes and monocytes/macrophages and this cross-talk is mediated by fatty acids released by adipocytes especially during the transition period. Results indicate that all fatty acids tested (myristic, palmitic, palmitoleic, stearic and oleic upregulate the expression of numerous pro-inflammatory genes by both monocytes but neutrophils, as well. The longer the carbon chain, the most potent is the effect.  Another hypothesis that we have tested is that vitamin E can interfere and block the cross talk between adipocytes and immunocompetent cells. Against this notion, α-tocopherol does not interfere with the effect of fatty acids on

  14. SALPETER NORMALIZATION OF THE STELLAR INITIAL MASS FUNCTION FOR MASSIVE GALAXIES AT z ∼ 1

    International Nuclear Information System (INIS)

    Shetty, Shravan; Cappellari, Michele

    2014-01-01

    The stellar initial mass function (IMF) is a key parameter for studying galaxy evolution. Here we measure the IMF mass normalization for a sample of 68 field galaxies in the redshift range 0.7-0.9 within the Extended Groth Strip. To do this we derive the total (stellar + dark matter) mass-to-light [(M/L)] ratio using axisymmetric dynamical models. Within the region where we have kinematics (about one half-light radius), the models assume (1) that mass follows light, implying negligible differences between the slope of the stellar and total density profiles, (2) constant velocity anisotropy (β z ≡1−σ z 2 /σ R 2 =0.2), and (3) that galaxies are seen at the average inclination for random orientations (i.e., i = 60°, where i = 90° represents edge-on). The dynamical models are based on anisotropic Jeans equations, constrained by Hubble Space Telescope/Advanced Camera for Surveys imaging and the central velocity dispersion of the galaxies, extracted from good-quality spectra taken by the DEEP2 survey. The population (M/L) are derived from full-spectrum fitting of the same spectra with a grid of simple stellar population models. Recent dynamical modeling results from the ATLAS 3D project and numerical simulations of galaxy evolution indicate that the dark matter fraction within the central regions of our galaxies should be small. This suggests that our derived total (M/L) should closely approximate the stellar M/L. Our comparison of the dynamical (M/L) and the population (M/L) then implies that for galaxies with stellar mass M * ≳ 10 11 M ☉ , the average normalization of the IMF is consistent with a Salpeter slope, with a substantial scatter. This is similar to what is found within a similar mass range for nearby galaxies

  15. Serum erythropoietin level in anemic and non-anemic nephrotic children with normal kidney functions

    International Nuclear Information System (INIS)

    Moustafa, A.M.E.; Moawad, A.T.; Gad, A.A.; Ahmed, S.M.

    2005-01-01

    Nephrotic syndrome (NS) is associated with a significant alteration in protein metabolism. While lowering the concentration of certain proteins, the disease often raises the level of certain other proteins. The current study aimed to investigate the serum erythropoietin (EPO) levels in children with NS either anemic or non-anemic and to compare them to children with iron deficiency anemia (IDA) and healthy controls with normal hemoglobin level (NHB). Sixteen nephrotic children with anemia (NS-A) and 15 nephrotic children with normal hemoglobin level (NS-NHB) were examined and compared with 10 children with iron deficiency anemia (IDA) and 10 healthy controls (NHB). Circulating serum EPO levels, blood indices and iron status were measured in nephrotic patients with anemia (NS-A) and compared to those nephrotic patients with normal HE (NS-NHB). Most NS-A children were steroid resistant. The NS-A children showed greater EPO levels than those without anemia (21.01 ±4.02 mlU/ml versus 9.18 ± 0.79 mlU/ml; P < 0.001) but their response to treatment of anemia was inappropriately low when compared to IDA (EPO 96.9 ±4.9 mlU/ml) despite similar HB concentration. A significant positive correlation was observed between serum EPO and serum albumin in NS-A (r = 0.84, P < 0.001) and in NS-NHB group (r = 0.89, P < 0.001). Moreover, a significant positive correlation was observed between serum EPO and HB in the nephrotic groups indicating a blunted EPO response to anemia in NS-A (r 0.63, P < 0.05) and in NS-NHB group (r = 0.80, P < 0.001). In conclusion, anemia is a common feature of NS and is present even before the worsening of kidney function. Depletion of the iron stores due to loss of iron and transferrin in urine due to massive proteinurea may contribute to the development of anemia, but it was found that iron replacement was ineffective alone

  16. Stromal cell contributions to the homeostasis and functionality of the immune system.

    Science.gov (United States)

    Mueller, Scott N; Germain, Ronald N

    2009-09-01

    A defining characteristic of the immune system is the constant movement of many of its constituent cells through the secondary lymphoid tissues, mainly the spleen and lymph nodes, where crucial interactions that underlie homeostatic regulation, peripheral tolerance and the effective development of adaptive immune responses take place. What has only recently been recognized is the role that non-haematopoietic stromal elements have in many aspects of immune cell migration, activation and survival. In this Review, we summarize our current understanding of lymphoid compartment stromal cells, examine their possible heterogeneity, discuss how these cells contribute to immune homeostasis and the efficient initiation of adaptive immune responses, and highlight how targeting of these elements by some pathogens can influence the host immune response.

  17. Functional programming of the autonomic nervous system by early life immune exposure: implications for anxiety.

    Directory of Open Access Journals (Sweden)

    Luba Sominsky

    Full Text Available Neonatal exposure of rodents to an immune challenge alters a variety of behavioural and physiological parameters in adulthood. In particular, neonatal lipopolysaccharide (LPS; 0.05 mg/kg, i.p. exposure produces robust increases in anxiety-like behaviour, accompanied by persistent changes in hypothalamic-pituitary-adrenal (HPA axis functioning. Altered autonomic nervous system (ANS activity is an important physiological contributor to the generation of anxiety. Here we examined the long term effects of neonatal LPS exposure on ANS function and the associated changes in neuroendocrine and behavioural indices. ANS function in Wistar rats, neonatally treated with LPS, was assessed via analysis of tyrosine hydroxylase (TH in the adrenal glands on postnatal days (PNDs 50 and 85, and via plethysmographic assessment of adult respiratory rate in response to mild stress (acoustic and light stimuli. Expression of genes implicated in regulation of autonomic and endocrine activity in the relevant brain areas was also examined. Neonatal LPS exposure produced an increase in TH phosphorylation and activity at both PNDs 50 and 85. In adulthood, LPS-treated rats responded with increased respiratory rates to the lower intensities of stimuli, indicative of increased autonomic arousal. These changes were associated with increases in anxiety-like behaviours and HPA axis activity, alongside altered expression of the GABA-A receptor α2 subunit, CRH receptor type 1, CRH binding protein, and glucocorticoid receptor mRNA levels in the prefrontal cortex, hippocampus and hypothalamus. The current findings suggest that in addition to the commonly reported alterations in HPA axis functioning, neonatal LPS challenge is associated with a persistent change in ANS activity, associated with, and potentially contributing to, the anxiety-like phenotype. The findings of this study reflect the importance of changes in the perinatal microbial environment on the ontogeny of

  18. Functional programming of the autonomic nervous system by early life immune exposure: implications for anxiety.

    Science.gov (United States)

    Sominsky, Luba; Fuller, Erin A; Bondarenko, Evgeny; Ong, Lin Kooi; Averell, Lee; Nalivaiko, Eugene; Dunkley, Peter R; Dickson, Phillip W; Hodgson, Deborah M

    2013-01-01

    Neonatal exposure of rodents to an immune challenge alters a variety of behavioural and physiological parameters in adulthood. In particular, neonatal lipopolysaccharide (LPS; 0.05 mg/kg, i.p.) exposure produces robust increases in anxiety-like behaviour, accompanied by persistent changes in hypothalamic-pituitary-adrenal (HPA) axis functioning. Altered autonomic nervous system (ANS) activity is an important physiological contributor to the generation of anxiety. Here we examined the long term effects of neonatal LPS exposure on ANS function and the associated changes in neuroendocrine and behavioural indices. ANS function in Wistar rats, neonatally treated with LPS, was assessed via analysis of tyrosine hydroxylase (TH) in the adrenal glands on postnatal days (PNDs) 50 and 85, and via plethysmographic assessment of adult respiratory rate in response to mild stress (acoustic and light stimuli). Expression of genes implicated in regulation of autonomic and endocrine activity in the relevant brain areas was also examined. Neonatal LPS exposure produced an increase in TH phosphorylation and activity at both PNDs 50 and 85. In adulthood, LPS-treated rats responded with increased respiratory rates to the lower intensities of stimuli, indicative of increased autonomic arousal. These changes were associated with increases in anxiety-like behaviours and HPA axis activity, alongside altered expression of the GABA-A receptor α2 subunit, CRH receptor type 1, CRH binding protein, and glucocorticoid receptor mRNA levels in the prefrontal cortex, hippocampus and hypothalamus. The current findings suggest that in addition to the commonly reported alterations in HPA axis functioning, neonatal LPS challenge is associated with a persistent change in ANS activity, associated with, and potentially contributing to, the anxiety-like phenotype. The findings of this study reflect the importance of changes in the perinatal microbial environment on the ontogeny of physiological processes.

  19. TiO{sub 2} nanoparticle-induced ROS correlates with modulated immune cell function

    Energy Technology Data Exchange (ETDEWEB)

    Maurer-Jones, Melissa A.; Christenson, Jenna R.; Haynes, Christy L., E-mail: chaynes@umn.edu [University of Minnesota, Department of Chemistry (United States)

    2012-12-15

    Design of non-toxic nanoparticles will be greatly facilitated by understanding the nanoparticle-cell interaction mechanism on a cell function level. Mast cells are important cells for the immune system's first line of defense, and we can utilize their exocytotic behavior as a model cellular function as it is a conserved process across cell types and species. Perturbations in exocytosis can also have implications for whole organism health. One proposed mode of toxicity is nanoparticle-induced reactive oxygen species (ROS), particularly for titanium dioxide (TiO{sub 2}) nanoparticles. Herein, we have correlated changes in ROS with the perturbation of the critical cell function of exocytosis, using UV light to induce greater levels of ROS in TiO{sub 2} exposed cells. The primary culture mouse peritoneal mast cells (MPMCs) were exposed to varying concentrations of TiO{sub 2} nanoparticles for 24 h. ROS content was determined using 2,7-dihydrodichlorofluorescein diacetate (DCFDA). Cellular viability was determined with the MTT and Trypan blue assays, and exocytosis was measured by the analytical electrochemistry technique of carbon-fiber microelectrode amperometry. MPMCs exposed to TiO{sub 2} nanoparticles experienced a dose-dependent increase in total ROS content. While there was minimal impact of ROS on cellular viability, there is a correlation between ROS amount and exocytosis perturbation. As nanoparticle-induced ROS increases, there is a significant decrease (45 %) in the number of serotonin molecules being released during exocytosis, increase (26 %) in the amount of time for each exocytotic granule to release, and decrease (28 %) in the efficiency of granule trafficking and docking. This is the first evidence that nanoparticle-induced ROS correlates with chemical messenger molecule secretion, possibly making a critical connection between functional impairment and mechanisms contributing to that impairment.

  20. Efficacy of screening immune system function in at-risk newborns

    OpenAIRE

    Pavlovski, Christopher J

    2014-01-01

    This paper explores the introduction of a screening test to highlight impaired immune system status for newborn infants and its efficacy as a preventative clinical measure. Moreover, it is suggested that screening of the infantile immune system has the potential to highlight susceptibility to a range of infant and childhood diseases, bestowing an opportunity to introduce early intervention to reduce the incidence of these diseases. Development of the neonatal immune system is an important hea...

  1. T cell immunity

    OpenAIRE

    Emel Bülbül Başkan

    2013-01-01

    Since birth, our immune system is constantly bombarded with self-antigens and foreign pathogens. To stay healthy, complex immune strategies have evolved in our immune system to maintain self-tolerance and to defend against foreign pathogens. Effector T cells are the key players in steering the immune responses to execute immune functions. While effector T cells were initially identified to be immune promoting, recent studies unraveled negative regulatory functions of effector T cells...

  2. Immune System

    Science.gov (United States)

    A properly functioning immune system is essential to good health. It defends the body against infectious agents and in some cases tumor cells. Individuals with immune deficiencies resulting from genetic defects, diseases (e.g., AIDS, leukemia), or drug therapies are more suscepti...

  3. Effects of blood transportation on human peripheral mononuclear cell yield, phenotype and function: implications for immune cell biobanking.

    Directory of Open Access Journals (Sweden)

    Anita Posevitz-Fejfár

    Full Text Available Human biospecimen collection, processing and preservation are rapidly emerging subjects providing essential support to clinical as well as basic researchers. Unlike collection of other biospecimens (e.g. DNA and serum, biobanking of viable immune cells, such as peripheral blood mononuclear cells (PBMC and/or isolated immune cell subsets is still in its infancy. While certain aspects of processing and freezing conditions have been studied in the past years, little is known about the effect of blood transportation on immune cell survival, phenotype and specific functions. However, especially for multicentric and cooperative projects it is vital to precisely know those effects. In this study we investigated the effect of blood shipping and pre-processing delay on immune cell phenotype and function both on cellular and subcellular levels. Peripheral blood was collected from healthy volunteers (n = 9: at a distal location (shipped overnight and in the central laboratory (processed immediately. PBMC were processed in the central laboratory and analyzed post-cryopreservation. We analyzed yield, major immune subset distribution, proliferative capacity of T cells, cytokine pattern and T-cell receptor signal transduction. Results show that overnight transportation of blood samples does not globally compromise T- cell subsets as they largely retain their phenotype and proliferative capacity. However, NK and B cell frequencies, the production of certain PBMC-derived cytokines and IL-6 mediated cytokine signaling pathway are altered due to transportation. Various control experiments have been carried out to compare issues related to shipping versus pre-processing delay on site. Our results suggest the implementation of appropriate controls when using multicenter logistics for blood transportation aiming at subsequent isolation of viable immune cells, e.g. in multicenter clinical trials or studies analyzing immune cells/subsets. One important conclusion might

  4. Thermal sensitivity of immune function: evidence against a generalist-specialist trade-off among endothermic and ectothermic vertebrates

    Science.gov (United States)

    Butler, Michael W.; Stahlschmidt, Zachary R.; Ardia, Daniel R.; Davies, Scott; Davis, Jon; Guillette, Louis J.; Johnson, Nicholas; McCormick, Stephen D.; McGraw, Kevin J.; DeNardo, Dale F.

    2013-01-01

    Animal body temperature (Tbody) varies over daily and annual cycles, affecting multiple aspects of biological performance in both endothermic and ectothermic animals. Yet a comprehensive comparison of thermal performance among animals varying in Tbody (mean and variance) and heat production is lacking. Thus, we examined the thermal sensitivity of immune function (a crucial fitness determinant) in Vertebrata, a group encompassing species of varying thermal biology. Specifically, we investigated temperature-related variation in two innate immune performance metrics, hemagglutination and hemolysis, for 13 species across all seven major vertebrate clades. Agglutination and lysis were temperature dependent and were more strongly related to the thermal biology of species (e.g., mean Tbody) than to the phylogenetic relatedness of species, although these relationships were complex and frequently surprising (e.g., heterotherms did not exhibit broader thermal performance curves than homeotherms). Agglutination and lysis performance were positively correlated within species, except in taxa that produce squalamine, a steroidal antibiotic that does not lyse red blood cells. Interestingly, we found the antithesis of a generalist-specialist trade-off: species with broader temperature ranges of immune performance also had higher peak performance levels. In sum, we have uncovered thermal sensitivity of immune performance in both endotherms and ectotherms, highlighting the role that temperature and life history play in immune function across Vertebrata.

  5. Effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer

    Directory of Open Access Journals (Sweden)

    Qi Pan

    2017-09-01

    Full Text Available Objective: To investigate the effect of Kanglaite combined with chemotherapy on myelosuppression, immune function and tumor markers levels in patients with breast cancer. Methods: A total of 90 breast cancer patients in our hospital were randomly divided into control group (45 cases and observation group (45 cases. The two groups received CAF chemotherapy, and the observation group was additionally given Kanglaite injection (200 mL/d for 2 weeks continuously. Both groups had chemotherapy for 6 courses. The effect on myelosuppression, immune function and tumor markers levels was detected and compared before and after treatment in two groups. Results: After treatment, myelosuppression was found in both groups, and the levels of leukocyte, hemoglobin and platelet decreased significantly compared with before treatment (P0.05, and the levels of immune function indexes (CD3+, CD4+, CD4+/ CD8+ of the observation group were significantly higher than those in the control group (P<0.05) . After treatment, the levels of two tumor markers (CEA, CA15-3 decreased significantly than before treatment in both groups (P<0.05, and the decrease amplitude in the observation group was higher than that in the control group (P<0.05. Conclusions: Kanglaite combined with chemotherapy has evident therapeutic effect on breast cancer. It can alleviate the myelosuppression caused by chemotherapy, improve immune function, and reduce the concentration of tumor markers in patients with breast cancer.

  6. Restoration of the immune functions in aged mice by supplementation with a new herbal composition, HemoHIM.

    Science.gov (United States)

    Park, Hae-Ran; Jo, Sung-Kee; Jung, Uhee; Yee, Sung-Tae

    2008-01-01

    The effect of a new herbal composition, HemoHIM, on immune functions was examined in aged mice, in which various immune responses had been impaired. The composition HemoHIM was prepared by adding the ethanol-insoluble fraction to the total water extract of a mixture of three edible herbs, Angelica Radix, Cnidium Rhizoma and Paeonia Radix. Supplementation to the aged mice with HemoHIM restored the proliferative response and cytokine production of splenocytes with a response to ConA. Also, HemoHIM recovered the NK cell activity which had been impaired in the aged mice. Meanwhile aging is known to reduce the Th1-like function, but not the Th2-like function, resulting in a Th1/Th2 imbalance. HemoHIM restored the Th1/Th2 balance in the aged mice through enhanced IFN-gamma and IgG2a production, and conversely a reduced IL-4 and IgG1 production. It was found that one factor for the Th1/Th2 imbalance in the aged mice was a lower production of IL-12p70. However, HemoHIM restored the IL-12p70 production in the aged mice. These results suggested that HemoHIM was effective for the restoration of impaired immune functions of the aged mice and therefore could be a good recommendation for immune restoration in elderly humans. Copyright (c) 2007 John Wiley & Sons, Ltd.

  7. The Effects of Tacrolimus on T-Cell Proliferation Are Short-Lived: A Pilot Analysis of Immune Function Testing

    Directory of Open Access Journals (Sweden)

    Benjamin L. Laskin, MD, MS

    2017-08-01

    Conclusions. T-cell proliferation is currently not suitable to measure immunosuppression because sample processing diminishes observable effects. Future immune function testing should focus on fresh samples with minimal washing steps. Our results also emphasize the importance of adherence to immunosuppressive treatment, because T-cell proliferation recovered substantially after even brief discontinuation of tacrolimus.

  8. Effects of indomethacin suppositories on serum amylase, inflammatory factors and immune function after endoscopic retrograde cholangiopancreatography

    Directory of Open Access Journals (Sweden)

    Xiao-Bin Peng

    2016-10-01

    Full Text Available Objective: To explore the effects of indomethacin suppositories on serum amylase, inflammatory factors and immune function after endoscopic retrograde cholangiopancreatography (ERCP. Methods: A total of 85 patients with common bile duct stones or obstructive jaundice were divided into the observation group (n=45 and the control group (n=40 according to the different treatment methods, both two groups patients were treated with ERCP, patients in the observation group was given indomethacin suppositories 50 mg preoperative 30 min. Serum amylase, inflammatory factors and T cell subsets were detected preoperative, postoperative 6 h and postoperative 24 h. Inflammatory factors including interleukin -10 (IL-10, interleukin -6 (IL-6, tumor necrosis factor alpha (TNF-α and interleukin-4 (IL-4. T cell subsets including CD3+ , CD4+ , CD8+ and calculated CD4+ / CD8+ . Results: In both two groups, postoperative 6 h, 24 h serum amylase were significantly higher than before surgery; in the observation group, the postoperative 6 h, 24 h serum amylase were significantly lower than in the control group at the same time point and the differences were statistically significant (P<0.05. Both two groups’ postoperative 6 h, 24 h serum proinflammatory factor IL-6 and TNF-α increased first and then decreased, both were significantly higher than before surgery; both two groups’ postoperative 6 h, 24 h serum anti-inflammatory factor IL-10 and IL-4 gradually increased, both were significantly higher than before surgery, and the differences were statistically significant (P<0.05; In the observation group, antiinflammatory factor IL-10 and IL-4 significantly increased while pro-inflammatory factor IL-6 and TNF-α significantly decreased compared with the control group at the same time point 6 h and 24 h after surgery, the difference between the two groups was statistically significant (P<0.05. Both two groups’ postoperative 6 h, 24 h T cell subsets CD3+ , CD4+ , CD4

  9. Immuno-regulatory function of indoleamine 2,3 dioxygenase through modulation of innate immune responses.

    Directory of Open Access Journals (Sweden)

    Malihe-Sadat Poormasjedi-Meibod

    Full Text Available Successful long-term treatment of type-1 diabetes mainly relies on replacement of β-cells via islet transplantation. Donor shortage is one of the main obstacles preventing transplantation from becoming the treatment of choice. Although animal organs could be an alternative source for transplantation, common immunosuppressive treatments demonstrate low efficacy in preventing xenorejection. Immunoprotective effects of indoleamine 2,3-dioxygenase (IDO on T-cell mediated allorejection has been extensively studied. Our studies revealed that IDO expression by fibroblasts, induced apoptosis in T-cells while not affecting non-immune cell survival/function. Since macrophages play a pivotal role in xenograft rejection, herein we investigated the effect of IDO-induced tryptophan deficiency/kynurenine accumulation on macrophage function/survival. Moreover, we evaluated the local immunosuppressive effect of IDO on islet-xenograft protection. Our results indicated that IDO expression by bystander fibroblasts significantly reduced the viability of primary macrophages via apoptosis induction. Treatment of peritoneal macrophages by IDO-expressing fibroblast conditioned medium significantly reduced their proinflammatory activity through inhibition of iNOS expression. To determine whether IDO-induced tryptophan starvation or kynurenine accumulation is responsible for macrophage apoptosis and inhibition of their proinflammatory activity, Raw264.7 cell viability and proinflammatory responses were evaluated in tryptophan deficient medium or in the presence of kynurenine. Tryptophan deficiency, but not kynurenine accumulation, reduced Raw264.7 cell viability and suppressed their proinflammatory activity. Next a three-dimensional islet-xenograft was engineered by embedding rat islets within either control or IDO-expressing fibroblast-populated collagen matrix. Islets morphology and immune cell infiltration were then studied in the xenografts transplanted into the C57

  10. Radionuclide activity and the immune system functioning in residents of radiation contaminated areas

    Directory of Open Access Journals (Sweden)

    V. L. Sokolenko

    2015-09-01

    Full Text Available The objective of this research is to assess the relation of radioactive contamination degree to immune system functioning, in the absence or presence of additional potential immunosuppressants. To achieve the objective, during the period of 1995–2015 we examined 250 people, students of Cherkasy State University, who lived in the areas of enhanced radiation monitoring before. Also we evaluated the additional impact of the emotional stress caused by examinations on examined students. Indicators of cellular immunity were determined by immunophenotyping and dyeing using Romanowsky-Giemsa method. The level of immunoglobulins in blood serum was determined by radial immunodiffusion (Mancini method. The level of cortisol in blood serum was determined by immunoenzyme method. We have found that in absence of the emotional stress among residents of the areas contaminated with radionuclides, cortisol level remained at the upper limit of homeostatic norm. There is an average positive correlation between the activity of radionuclides in the territories of residence and the level of cortisol. There are marked average positive correlations between the activity of radionuclides and the level of neutrophils, and low positive correlations with the levels of IgG and IgM in blood serum. Average negative correlations between the activity of radionuclides and the following parameters are also observed: absolute and relative number of functionally mature T-lymphocytes with phenotype CD3+, absolute and relative number of their helper subpopulation CD4+, absolute and relative number of natural killer cells with phenotype CD16+; and strong negative correlations with immunoregulatory index CD4+/CD8+. Cortisol level shows the similar correlation with the same parameters, but correlation coefficient is lower. Under conditions of additional stress, caused by emotional load during the examinations, cortisol level significantly increases. This enhanced previously discovered

  11. Functional and histological assessment of the radiobiology of normal rat lung in BNCT

    International Nuclear Information System (INIS)

    Kiger, J.L.; Riley, K.J.; Binns, P.J.; Harling, O.K.; Coderre, J.A.; Kiger, W.S. III; Patel, H.

    2006-01-01

    This study investigated the radiobiology and sensitivity of the normal rat lung to Boron Neutron Capture Therapy (BNCT) radiation. Rat thorax irradiations were carried out with x-rays or with neutrons in the presence or absence of p-boronophenylalanine (BPA). Lung damage were assessed functionally with breathing rate measurement up to 180 days after irradiation and then histologically. Breathing rates 20% (∼3 σ) above the control group (sham-irradiated rats) mean were considered as positive responses to lung radiation damage. Though most responding animals demonstrated radiation induced pneumonitis (≤110 days) as well as pulmonary fibrosis (>110 days), some animals receiving neutrons plus BPA showed only the latter. The breathing rate dose response data were fit using probit analysis. The ED 50 values measured for x-rays, neutron beam only, and neutrons plus BPA were 11.5±0.4 Gy, 9.2±0.5 Gy, and 6.7±0.4 Gy, respectively. The biological weighting factors for the neutron beam (n+γ), the thermal neutron dose component, and the 10 B dose component were determined to be 1.2±0.1, 2.2±0.4, and 2.3±0.3, respectively. The histological dose response curves were linear. Consistent with the functional assay, the weighting factors measured histologically were 1.2±0.1 for the thermal neutron beam and 1.9±0.2 for the 10 B dose component. (author)

  12. Deconstructing and constructing innate immune functions using molecular sensors and actuators

    Science.gov (United States)

    Coutinho, Kester; Inoue, Takanari

    2016-05-01

    White blood cells such as neutrophils and macrophages are made competent for chemotaxis and phagocytosis -- the dynamic cellular behaviors that are hallmarks of their innate immune functions -- by the reorganization of complex biological circuits during differentiation. Conventional loss-of-function approaches have revealed that more than 100 genes participate in these cellular functions, and we have begun to understand the intricate signaling circuits that are built up from these gene products. We now appreciate: (1) that these circuits come in a variety of flavors -- so that we can make a distinction between genetic circuits, metabolic circuits and signaling circuits; and (2) that they are usually so complex that the assumption of multiple feedback loops, as well as that of crosstalk between seemingly independent pathways, is now routine. It has not escaped our notice, however, that just as physicists and electrical engineers have long been able to disentangle complex electric circuits simply by repetitive cycles of probing and measuring electric currents using a voltmeter, we might similarly be able to dissect these intricate biological circuits by incorporating equivalent approaches in the fields of cell biology and bioengineering. Existing techniques in biology for probing individual circuit components are unfortunately lacking, so that the overarching goal of drawing an exact circuit diagram for the whole cell -- complete with kinetic parameters for connections between individual circuit components -- is not yet in near sight. My laboratory and others have thus begun the development of a new series of molecular tools that can measurably investigate the circuit connectivity inside living cells, as if we were doing so on a silicon board. In these proceedings, I will introduce some of these techniques, provide examples of their implementation, and offer a perspective on directions moving forward.

  13. The relationship of theory of mind and executive functions in normal, deaf and cochlear-implanted children

    Directory of Open Access Journals (Sweden)

    Farideh Nazarzadeh

    2014-08-01

    Full Text Available Background and Aim : Theory of mind refers to the ability to understand the others have mental states that can be different from one's own mental states or facts. This study aimed to investigate the relationship of theory of mind and executive functions in normal hearing, deaf, and cochlear-implanted children.Methods: The study population consisted of normal, deaf and cochlear-implanted girl students in Mashhad city, Iran. Using random sampling, 30 children (10 normal, 10 deaf and 10 cochlear-implanted in age groups of 8-12 years old were selected. To measure the theoty of mind, theory of mind 38-item scale and to assess executive function, Coolidge neuropsychological and personality test was used. Research data were analyzed using the Spearman correlation coefficient, analysis of variance and Kruskal-Wallis tests.Results: There was a significant difference between the groups in the theory of mind and executive function subscales, organization, planning-decision-making, and inhibition. Between normal and deaf groups (p=0.01, as well as cochlear-implanted and deaf groups (p=0.01, there was significant difference in planning decision-making subscale. There was not any significant relationship between the theory of mind and executive functions generally or the theory of mind and executive function subscales in these three groups independently.Conclusion: Based on our findings, cochlear-implanted and deaf children have lower performance in theory of mind and executive function compared with normal hearing children.

  14. Periodontal disease characterization in dogs with normal renal function or chronic renal failure

    Directory of Open Access Journals (Sweden)

    Barbudo-Selmi Glenda Ramalho

    2004-01-01

    Full Text Available The purpose of this study was to evaluate periodontal disease (PD in dogs with chronic renal failure (CRF and to compare it to PD in dogs with normal renal function (NRF. Twelve dogs with CRF and 24 dogs with NRF, all presenting dental pocket formation, were compared. In all dogs, serum creatinine, blood urea nitrogen, urine specific gravity and total red and white blood cells were determined. A complete oral examination was also performed including evaluation of bacterial plaque, gingivitis, gingival recession, pocket, calculus, dental mobility, dental loss, and ulcers. These data were used to calculate plaque index (PI, gingival index (GI and periodontal destruction index (PDI. PD was graded as mild, moderate or severe based on the results. Mild, moderate or severe PD was observed in dogs with NRF, whereas dogs with CRF presented either mild or severe PD. Dogs with NRF showed higher involvement of the maxillary teeth, whereas dogs with CRF showed a higher involvement of the mandibular teeth. Plaque index was significantly higher in dogs with NRF. It was concluded that lesion distribution and periodontal disease progression may be altered in dogs with CRF, and gingival inflammatory response differs in dogs with NRF and CRF regarding to the stage of periodontal disease.

  15. Microvascular resistance in response to iodinated contrast media in normal and functionally impaired kidneys.

    Science.gov (United States)

    Kurihara, Osamu; Takano, Masamichi; Uchiyama, Saori; Fukuizumi, Isamu; Shimura, Tetsuro; Matsushita, Masato; Komiyama, Hidenori; Inami, Toru; Murakami, Daisuke; Munakata, Ryo; Ohba, Takayoshi; Hata, Noritake; Seino, Yoshihiko; Shimizu, Wataru

    2015-12-01

    Contrast-induced nephropathy (CIN) is considered to result from intrarenal vasoconstriction, and occurs more frequently in impaired than in normal kidneys. It was hypothesized that iodinated contrast media would markedly change renal blood flow and vascular resistance in functionally impaired kidneys. Thirty-six patients were enrolled (32 men; mean age, 75.3 ± 7.6 years) undergoing diagnostic coronary angiography and were divided into two groups based on the presence of chronic kidney disease (CKD), defined as an estimated glomerular filtration rate (eGFR) of contrast media. The APV and the RI were positively and inversely correlated with the eGFR at baseline, respectively (APV, R = 0.545, P = 0.001; RI, R = -0.627, P contrast media administration in the non-CKD group, but not in the CKD group (APV, P = 0.258; RI, P = 0.707). Although renal arterial resistance was higher in patients with CKD, it was not affected by contrast media administration, suggesting that patients with CKD could have an attenuated response to contrast media. © 2015 The Authors. Clinical and Experimental Pharmacology and Physiology Published by Wiley Publishing Asia Pty Ltd.

  16. Impaired cognitive functions in mild traumatic brain injury patients with normal and pathologic magnetic resonance imaging

    International Nuclear Information System (INIS)

    Kurca, E.; Sivak, S.; Kucera, P.

    2006-01-01

    Mild traumatic brain injury (MTBI) is a common neurological (neurotraumatological) diagnosis. As well as different subjective symptoms, many patients develop neuropsychological dysfunction with objective impairment of attention, memory and certain executive functions. Magnetic resonance imaging (MRI) is not routinely used in MTBI patients despite its proven greater sensitivity and specificity in comparison with computed tomography (CT). The patient group consisted of 30 persons with MTBI and the control group consisted of 30 sex- and age-matched healthy volunteers. Both groups underwent neurological examination, neuropsychological testing (including the Postconcussion Symptoms Scale questionnaire, PCSS) and brain MRI (the patient group within 96 h after injury). The analyzed groups did not differ significantly in terms of sex, age, or level or duration of education. MRI pathological findings (traumatic and nonspecific) were present in nine patients. Traumatic lesions were found in seven patients. Nonspecific white matter lesions were found in five healthy controls. There were significant differences between MTBI patients and controls in terms of subjective symptoms (PCSS) and selected neuropsychological tests. Statistically significant neuropsychological differences were found between MTBI patients with true traumatic lesions and MTBI patients with nonspecific lesions. There is evidence that MTBI patients with true traumatic MRI lesions are neuropsychologically different from MTBI patients with nonspecific MRI lesions or normal brain MRI. These results support the hypothesis that some acute MTBI signs and symptoms have a real organic basis which can be detected by selected new MRI modalities. (orig.)

  17. Relational Stability in the Expression of Normality, Variation, and Control of Thyroid Function

    Science.gov (United States)

    Hoermann, Rudolf; Midgley, John E. M.; Larisch, Rolf; Dietrich, Johannes W.

    2016-01-01

    Thyroid hormone concentrations only become sufficient to maintain a euthyroid state through appropriate stimulation by pituitary thyroid-stimulating hormone (TSH). In such a dynamic system under constant high pressure, guarding against overstimulation becomes vital. Therefore, several defensive mechanisms protect against accidental overstimulation, such as plasma protein binding, conversion of T4 into the more active T3, active transmembrane transport, counter-regulatory activities of reverse T3 and thyronamines, and negative hypothalamic–pituitary–thyroid feedback control of TSH. TSH has gained a