WorldWideScience

Sample records for normal human skin

  1. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  2. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  3. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  4. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  5. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  6. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  7. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  8. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  9. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  10. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  11. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  12. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  13. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  15. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  16. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  17. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  18. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  19. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  20. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  1. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  2. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

  4. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  5. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  6. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  7. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  8. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  9. Volumetric Visualization of Human Skin

    Science.gov (United States)

    Kawai, Toshiyuki; Kurioka, Yoshihiro

    We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-01-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  12. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  13. Human papillomavirus infection in squamous cell carcinoma of the vulva, in various synchronous epithelial changes and in normal vulvar skin

    NARCIS (Netherlands)

    Kagie, M. J.; Kenter, G. G.; Zomerdijk-Nooijen, Y.; Hermans, J.; Schuuring, E.; Timmers, P. J.; Trimbos, J. B.; Fleuren, G. J.

    1997-01-01

    OBJECTIVE: To investigate the prevalence of human papillomavirus (HPV) infection in various vulvar lesions. METHODS: HPV infection using consensus primer-PCR was studied in 66 patients with vulvar carcinoma and in the synchronous epithelial lesions. RESULTS: HPV infection was present in 13/66

  14. Adaptive response to ionizing radiation in normal human skin fibroblasts. Enhancement of DNA repair rate and modulation of gene expression

    International Nuclear Information System (INIS)

    Toledo, S.M. de; Mitchel, R.E.J.; Azzam, E.; Ottawa Univ., ON; Raaphorst, G.P.

    1994-01-01

    Low doses and dose rates of ionizing radiation enhance the rate of DNA repair in human fibroblasts and protect the cells against radiation-induced micronucleus formation. Chronic exposures reduce the mRNA levels of the genes topoisomerase II and FACC-1 (Fanconi's anemia, group C). (authors). 11 refs., 1 tab., 2 figs

  15. Solar-simulated ultraviolet irradiation induces selective influx of CD4+ T lymphocytes in normal human skin

    NARCIS (Netherlands)

    Di Nuzzo, S.; de Rie, M. A.; van der Loos, C. M.; Bos, J. D.; Teunissen, M. B.

    1996-01-01

    The proportion and composition of the human cutaneous CD3+ T lymphocyte population was determined in situ following a single exposure to physiological, erythema-inducing doses of simulated solar radiation, mainly consisting of UV radiation. Biopsies were taken 1, 2 and 7 days after local irradiation

  16. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  17. Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1987-01-01

    We have analyzed the pattern of protein synthesis in solar near ultraviolet (334 nm, 365 nm) and near visible (405 nm) irradiated normal human skin fibroblasts. Two hours after irradiation we find that one major stress protein of approximately 32 kDa is induced in irradiated cells. This protein is not induced by ultraviolet radiation at wavelengths shorter than 334 nm and is not inducible by heat shock treatment of these cells. Although sodium arsenite, diamide, and menadione all induced a 32-kDa protein, they also induced the major heat shock proteins. In contrast, the oxidizing agent, hydrogen peroxide, induced the low molecular weight stress protein without causing induction of the major heat shock proteins. A comparison of the 32-kDa proteins induced by sodium arsenite, H 2 O 2 , and solar near ultraviolet radiation using chemical peptide mapping shows that they are closely related. These results imply that the pathways for induction of the heat shock response and the 32-kDa protein are not identical and suggest that, at least in the case of radiation and treatment with H 2 O 2 , the 32-kDa protein might be induced in response to cellular oxidative stress. This conclusion is supported by the observation that depletion of endogenous cellular glutathione prior to solar near ultraviolet irradiation lowers the fluence threshold for induction of the 32-kDa stress protein

  18. Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

    Science.gov (United States)

    Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

    2000-11-01

    When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

  19. Human skin volatiles: a review.

    Science.gov (United States)

    Dormont, Laurent; Bessière, Jean-Marie; Cohuet, Anna

    2013-05-01

    Odors emitted by human skin are of great interest to biologists in many fields; applications range from forensic studies to diagnostic tools, the design of perfumes and deodorants, and the ecology of blood-sucking insect vectors of human disease. Numerous studies have investigated the chemical composition of skin odors, and various sampling methods have been used for this purpose. The literature shows that the chemical profile of skin volatiles varies greatly among studies, and the use of different sampling procedures is probably responsible for some of these variations. To our knowledge, this is the first review focused on human skin volatile compounds. We detail the different sampling techniques, each with its own set of advantages and disadvantages, which have been used for the collection of skin odors from different parts of the human body. We present the main skin volatile compounds found in these studies, with particular emphasis on the most frequently studied body regions, axillae, hands, and feet. We propose future directions for promising experimental studies on odors from human skin, particularly in relation to the chemical ecology of blood-sucking insects.

  20. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  1. Effect of friction on vibrotactile sensation of normal and dehydrated skin.

    Science.gov (United States)

    Chen, S; Ge, S; Tang, W; Zhang, J

    2016-02-01

    Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  3. Comparative potency of formulations of mometasone furoate in terms of inhibition of ′PIRHR′ in the forearm skin of normal human subjects measured with laser doppler velocimetry

    Directory of Open Access Journals (Sweden)

    Kulhalli Prabhakar

    2005-01-01

    Full Text Available BACKGROUND AND AIMS: Topical glucocorticoid formulations are widely used for effective treatment and control of a variety of dermatoses. Mometasone furoate is a newer corticoid that has high potency but low systemic toxicity. Pharmaceutical factors are known to significantly influence potency and systemic absorption of topically applied glucocorticoids. We studied the potency of "Elocon", a topical formulation of mometasone furoate, compared with two other branded formulations of the same corticoid. METHODS: Corticoid potency was measured by employing a pharmacodynamic parameter of an inhibitory effect of the corticoid on post-ischemic-reactive-hyperemic-response (PIRHR in human forearm skin under occlusive dressing. The PIRHR was expressed in terms of % increase in the skin blood flow (SBF as measured with laser doppler velocimetry (LDV. RESULTS : All three active branded formulations of mometasone furoate produced significant inhibition of PIRHR. The AUC(0-2min of PIRHR was ( Mean ± SEM , Control = 213.52 ± 11.80, Placebo = 209.77 ± 19.31, Formulation A = 119.83 ± 13.71, Formulation C = 53.67 ± 4.85 and Formulation D = 111.46 ± 22.87. Formulation "C" exhibited significantly higher topical anti-inflammatory potency than formulations "A" or "D". CONCLUSIONS: Thus, branded formulations of the same glucocorticoid, mometasone furoate significantly differed in their topical anti-inflammatory potency. "Elocon" was significantly more potent than the two other branded formulations studied.

  4. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  5. Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration

    Science.gov (United States)

    2012-03-01

    6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less

  6. Skin and the non-human human

    DEFF Research Database (Denmark)

    Rösing, Lilian Munk

    2013-01-01

    The article puts forward an aesthetic and psychoanalytic analysis of Titian's painting, The Flaying of Marsyas, arguing that the painting is a reflection on the human subject as a being constituted by skin and by a core of non-humanity. The analysis is partly an answer to Melanie Hart's (2007) ar...... of the 'Muselmann', and Anton Ehrenzweig's psychoanalytic theory of artistic creation. Whereas Hart is focusing on form and colour, I also turn my attention towards the texture of the painting....

  7. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  8. The Microbiota of the Human Skin.

    Science.gov (United States)

    Egert, Markus; Simmering, Rainer

    2016-01-01

    The aim of this chapter is to sum up important progress in the field of human skin microbiota research that was achieved over the last years.The human skin is one of the largest and most versatile organs of the human body. Owing to its function as a protective interface between the largely sterile interior of the human body and the highly microbially contaminated outer environment, it is densely colonized with a diverse and active microbiota. This skin microbiota is of high importance for human health and well-being. It is implicated in several severe skin diseases and plays a major role in wound infections. Many less severe, but negatively perceived cosmetic skin phenomena are linked with skin microbes, too. In addition, skin microorganisms, in particular on the human hands, are crucial for the field of hygiene research. Notably, apart from being only a potential source of disease and contamination, the skin microbiota also contributes to the protective functions of the human skin in many ways. Finally, the analysis of structure and function of the human skin microbiota is interesting from a basic, evolutionary perspective on human microbe interactions.Key questions in the field of skin microbiota research deal with (a) a deeper understanding of the structure (species inventory) and function (physiology) of the healthy human skin microbiota in space and time, (b) the distinction of resident and transient skin microbiota members, (c) the distinction of beneficial skin microorganisms from microorganisms or communities with an adverse or sickening effect on their hosts, (d) factors shaping the skin microbiota and its functional role in health and disease, (e) strategies to manipulate the skin microbiota for therapeutic reasons.

  9. Hydrogen water intake via tube-feeding for patients with pressure ulcer and its reconstructive effects on normal human skin cells in vitro

    Science.gov (United States)

    2013-01-01

    Background Pressure ulcer (PU) is common in immobile elderly patients, and there are some research works to investigate a preventive and curative method, but not to find sufficient effectiveness. The aim of this study is to clarify the clinical effectiveness on wound healing in patients with PU by hydrogen-dissolved water (HW) intake via tube-feeding (TF). Furthermore, normal human dermal fibroblasts OUMS-36 and normal human epidermis-derived cell line HaCaT keratinocytes were examined in vitro to explore the mechanisms relating to whether hydrogen plays a role in wound-healing at the cellular level. Methods Twenty-two severely hospitalized elderly Japanese patients with PU were recruited in the present study, and their ages ranged from 71.0 to 101.0 (86.7 ± 8.2) years old, 12 male and 10 female patients, all suffering from eating disorder and bedridden syndrome as the secondary results of various underlying diseases. All patients received routine care treatments for PU in combination with HW intake via TF for 600 mL per day, in place of partial moisture replenishment. On the other hand, HW was prepared with a hydrogen-bubbling apparatus which produces HW with 0.8-1.3 ppm of dissolved hydrogen concentration (DH) and −602 mV to −583 mV of oxidation-reduction potential (ORP), in contrast to reversed osmotic ultra-pure water (RW), as the reference, with DH of < 0.018 ppm and ORP of +184 mV for use in the in vitro experimental research. In in vitro experiments, OUMS-36 fibroblasts and HaCaT keratinocytes were respectively cultured in medium prepared with HW and/or RW. Immunostain was used for detecting type-I collagen reconstruction in OUMS-36 cells. And intracellular reactive oxygen species (ROS) were quantified by NBT assay, and cell viability of HaCaT cells was examined by WST-1 assay, respectively. Results Twenty-two patients were retrospectively divided into an effective group (EG, n = 12) and a less effective group (LG, n = 10) according to

  10. Human reconstructed skin xenografts on mice to model skin physiology.

    Science.gov (United States)

    Salgado, Giorgiana; Ng, Yi Zhen; Koh, Li Fang; Goh, Christabelle S M; Common, John E

    Xenograft models to study skin physiology have been popular for scientific use since the 1970s, with various developments and improvements to the techniques over the decades. Xenograft models are particularly useful and sought after due to the lack of clinically relevant animal models in predicting drug effectiveness in humans. Such predictions could in turn boost the process of drug discovery, since novel drug compounds have an estimated 8% chance of FDA approval despite years of rigorous preclinical testing and evaluation, albeit mostly in non-human models. In the case of skin research, the mouse persists as the most popular animal model of choice, despite its well-known anatomical differences with human skin. Differences in skin biology are especially evident when trying to dissect more complex skin conditions, such as psoriasis and eczema, where interactions between the immune system, epidermis and the environment likely occur. While the use of animal models are still considered the gold standard for systemic toxicity studies under controlled environments, there are now alternative models that have been approved for certain applications. To overcome the biological limitations of the mouse model, research efforts have also focused on "humanizing" the mice model to better recapitulate human skin physiology. In this review, we outline the different approaches undertaken thus far to study skin biology using human tissue xenografts in mice and the technical challenges involved. We also describe more recent developments to generate humanized multi-tissue compartment mice that carry both a functioning human immune system and skin xenografts. Such composite animal models provide promising opportunities to study drugs, disease and differentiation with greater clinical relevance. Copyright © 2017 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  11. Xenobiotic metabolism in human skin and 3D human skin reconstructs: A review

    NARCIS (Netherlands)

    Gibbs, S.; Sandt, J.J.M. van de; Merk, H.F.; Lockley, D.J.; Pendlington, R.U.; Pease, C.K.

    2007-01-01

    In this review, we discuss and compare studies of xenobiotic metabolism in both human skin and 3D human skin reconstructs. In comparison to the liver, the skin is a less studied organ in terms of characterising metabolic capability. While the skin forms the major protective barrier to environmental

  12. Black and white human skin differences

    DEFF Research Database (Denmark)

    Andersen, Klaus Ejner; Maibach, H I

    1979-01-01

    This review of black and white human skin differences emphasizes the alleged importance of factors other than the obvious, i.e., skin color. Physicochemical differences and differences in susceptibility to irritants and allergens suggest a more resistant black than white skin. Differences appear...

  13. In vivo study of human skin using pulsed terahertz radiation

    International Nuclear Information System (INIS)

    Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P

    2004-01-01

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation

  14. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  15. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

  16. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  17. Tribology of human skin and mechanical skin equivalents in contact with textiles

    NARCIS (Netherlands)

    Derler, S.; Schrade, G.U.; Gerhardt, L.C.

    2007-01-01

    The friction of untreated human skin (finger) against a reference textile was investigated with 12 subjects using a force plate. In touch experiments, in which the subjects assessed the surface roughness of the textile at normal loads of 1.5 ± 0.7 N, the average friction coefficients ranged from

  18. Chronic effects of UV on human skin

    International Nuclear Information System (INIS)

    Cesarini, J.P.

    1996-01-01

    Chronic exposures and acute accidents of the skin to UV has been recognized as an important risk for skin cancers in human. Attempts have been made with mathematical models to correlate the ambient UV dose and occupational irradiations with the risk of skin cancers. Development of accurate global measurements of solar irradiance and personal dosimetry is expected in the future in order to reduce the exposure of the general population, to precise the measures to be taken for indoor and outdoor workers. (author)

  19. Neurogenic inflammation in human and rodent skin

    DEFF Research Database (Denmark)

    Schmelz, M; Petersen, Lars Jelstrup

    2001-01-01

    The combination of vasodilation and protein extravasation following activation of nociceptors has been termed "neurogenic inflammation." In contrast to rodents, no neurogenic protein extravasation can be elicited in healthy human skin. Dermal microdialysis has considerably increased our knowledge...... about neurogenic inflammation in human skin, including the involvement of mast cells.......The combination of vasodilation and protein extravasation following activation of nociceptors has been termed "neurogenic inflammation." In contrast to rodents, no neurogenic protein extravasation can be elicited in healthy human skin. Dermal microdialysis has considerably increased our knowledge...

  20. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....

  1. Water vapour loss measurements on human skin.

    NARCIS (Netherlands)

    Valk, Petrus Gerardus Maria van der

    1984-01-01

    In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions

  2. Increased expression of enhancer of Zeste Homolog 2 (EZH2) differentiates squamous cell carcinoma from normal skin and actinic keratosis.

    Science.gov (United States)

    Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi

    2014-01-01

    Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.

  3. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    Science.gov (United States)

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  4. [Physiological features of skin ageing in human].

    Science.gov (United States)

    Tikhonova, I V; Tankanag, A V; Chemeris, N K

    2013-01-01

    The issue deals with the actual problem of gerontology, notably physiological features of human skin ageing. In the present review the authors have considered the kinds of ageing, central factors, affected on the ageing process (ultraviolet radiation and oxidation stress), as well as the research guidelines of the ageing changes in the skin structure and fuctions: study of mechanical properties, microcirculation, pH and skin thickness. The special attention has been payed to the methods of assessment of skin blood flow, and to results of investigations of age features of peripheral microhemodynamics. The laser Doppler flowmetry technique - one of the modern, noninvasive and extensively used methods for the assessmant of skin blood flow microcirculation system has been expanded in the review. The main results of the study of the ageing changes of skin blood perfusion using this method has been also presented.

  5. The Role of Carotenoids in Human Skin

    Directory of Open Access Journals (Sweden)

    Theognosia Vergou

    2011-12-01

    Full Text Available The human skin, as the boundary organ between the human body and the environment, is under the constant influence of free radicals (FR, both from the outside in and from the inside out. Carotenoids are known to be powerful antioxidant substances playing an essential role in the reactions of neutralization of FR (mainly reactive oxygen species ROS. Carotenoid molecules present in the tissue are capable of neutralizing several attacks of FR, especially ROS, and are then destroyed. Human skin contains carotenoids, such as α-, γ-, β-carotene, lutein, zeaxanthin, lycopene and their isomers, which serve the living cells as a protection against oxidation. Recent studies have reported the possibility to investigate carotenoids in human skin quickly and non-invasively by spectroscopic means. Results obtained from in-vivo studies on human skin have shown that carotenoids are vital components of the antioxidative protective system of the human skin and could serve as marker substances for the overall antioxidative status. Reflecting the nutritional and stress situation of volunteers, carotenoids must be administered by means of antioxidant-rich products, e.g., in the form of fruit and vegetables. Carotenoids are degraded by stress factors of any type, inter alia, sun radiation, contact with environmental hazards, illness, etc. The kinetics of the accumulation and degradation of carotenoids in the skin have been investigated.

  6. Isolation of Human Skin Dendritic Cell Subsets.

    Science.gov (United States)

    Gunawan, Merry; Jardine, Laura; Haniffa, Muzlifah

    2016-01-01

    Dendritic cells (DCs) are specialized leukocytes with antigen-processing and antigen-presenting functions. DCs can be divided into distinct subsets by anatomical location, phenotype and function. In human, the two most accessible tissues to study leukocytes are peripheral blood and skin. DCs are rare in human peripheral blood (skin covering an average total surface area of 1.8 m(2) has approximately tenfold more DCs than the average 5 L of total blood volume (Wang et al., J Invest Dermatol 134:965-974, 2014). DCs migrate spontaneously from skin explants cultured ex vivo, which provide an easy method of cell isolation (Larsen et al., J Exp Med 172:1483-1493, 1990; Lenz et al., J Clin Invest 92:2587-2596, 1993; Nestle et al., J Immunol 151:6535-6545, 1993). These factors led to the extensive use of skin DCs as the "prototype" migratory DCs in human studies. In this chapter, we detail the protocols to isolate DCs and resident macrophages from human skin. We also provide a multiparameter flow cytometry gating strategy to identify human skin DCs and to distinguish them from macrophages.

  7. Electroosmotic pore transport in human skin.

    Science.gov (United States)

    Uitto, Olivia D; White, Henry S

    2003-04-01

    To determine the pathways and origin of electroosmotic flow in human skin. Iontophoretic transport of acetaminophen in full thickness human cadaver skin was visualized and quantified by scanning electrochemical microscopy. Electroosmotic flow in the shunt pathways of full thickness skin was compared to flow in the pores of excised stratum corneum and a synthetic membrane pore. The penetration of rhodamine 6G into pore structures was investigated by laser scanning confocal microscopy. Electroosmotic transport is observed in shunt pathways in full thickness human skin (e.g., hair follicles and sweat glands), but not in pore openings of freestanding stratum corneum. Absolute values of the diffusive and iontophoretic pore fluxes of acetaminophen in full thickness human skin are also reported. Rhodamine 6G is observed to penetrate to significant depths (approximately 200 microm) along pore pathways. Iontophoresis in human cadaver skin induces localized electroosmotic flow along pore shunt paths. Electroosmotic forces arise from the passage of current through negatively charged mesoor nanoscale pores (e.g., gap functions) within cellular regions that define the pore structure beneath the stratum corneum.

  8. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  9. Multiphoton spectroscopy of human skin in vivo

    Science.gov (United States)

    Breunig, Hans G.; Weinigel, Martin; König, Karsten

    2012-03-01

    In vivo multiphoton-intensity images and emission spectra of human skin are reported. Optical sections from different depths of the epidermis and dermis have been measured with near-infrared laser-pulse excitation. While the intensity images reveal information on the morphology, the spectra show emission characteristics of main endogenous skin fluorophores like keratin, NAD(P)H, melanin, elastin and collagen as well as of second harmonic generation induced by the excitation-light interaction with the dermal collagen network.

  10. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... was characterized by calculation of the "percent error of the slope." The following permeability rates (g/m2h) of single solvents were measured: dimethyl sulfoxide (DMSO), 176; N-methyl-2-pyrrolidone, 171; dimethyl acetamide, 107; methyl ethyl ketone, 53; methylene chloride, 24; [3H]water, 14.8; ethanol, 11...

  11. Elucidation of xenobiotic metabolism pathways in human skin and human skin models by proteomic profiling.

    Directory of Open Access Journals (Sweden)

    Sven van Eijl

    Full Text Available BACKGROUND: Human skin has the capacity to metabolise foreign chemicals (xenobiotics, but knowledge of the various enzymes involved is incomplete. A broad-based unbiased proteomics approach was used to describe the profile of xenobiotic metabolising enzymes present in human skin and hence indicate principal routes of metabolism of xenobiotic compounds. Several in vitro models of human skin have been developed for the purpose of safety assessment of chemicals. The suitability of these epidermal models for studies involving biotransformation was assessed by comparing their profiles of xenobiotic metabolising enzymes with those of human skin. METHODOLOGY/PRINCIPAL FINDINGS: Label-free proteomic analysis of whole human skin (10 donors was applied and analysed using custom-built PROTSIFT software. The results showed the presence of enzymes with a capacity for the metabolism of alcohols through dehydrogenation, aldehydes through dehydrogenation and oxidation, amines through oxidation, carbonyls through reduction, epoxides and carboxylesters through hydrolysis and, of many compounds, by conjugation to glutathione. Whereas protein levels of these enzymes in skin were mostly just 4-10 fold lower than those in liver and sufficient to support metabolism, the levels of cytochrome P450 enzymes were at least 300-fold lower indicating they play no significant role. Four epidermal models of human skin had profiles very similar to one another and these overlapped substantially with that of whole skin. CONCLUSIONS/SIGNIFICANCE: The proteomics profiling approach was successful in producing a comprehensive analysis of the biotransformation characteristics of whole human skin and various in vitro skin models. The results show that skin contains a range of defined enzymes capable of metabolising different classes of chemicals. The degree of similarity of the profiles of the in vitro models indicates their suitability for epidermal toxicity testing. Overall, these

  12. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  13. Human normal tissue reactions in radiotherapy

    International Nuclear Information System (INIS)

    Taniike, Keiko

    1990-01-01

    Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)

  14. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  15. Preparation of Artificial Skin that Mimics Human Skin Surface and Mechanical Properties.

    Science.gov (United States)

    Shimizu, Rana; Nonomura, Yoshimune

    2018-01-01

    We have developed an artificial skin that mimics the morphological and mechanical properties of human skin. The artificial skin comprises a polyurethane block possessing a microscopically rough surface. We evaluated the tactile sensations when skin-care cream was applied to the artificial skin. Many subjects perceived smooth, moist, and soft feels during the application process. Cluster analysis showed that these characteristic tactile feels are similar to those when skin-care cream is applied to real human skin. Contact angle analysis showed that an oil droplet spread smoothly on the artificial skin surface, which occurred because there were many grooves several hundred micrometers in width on the skin surface. In addition, when the skin-care cream was applied, the change in frictional force during the dynamic friction process increased. These wetting and frictional properties are important factors controlling the similarity of artificial skin to real human skin.

  16. Deposition of contaminant aerosol on human skin

    DEFF Research Database (Denmark)

    Andersson, Kasper Grann; Roed, Jørn; Byrne, M.A.

    2006-01-01

    Over recent years, it has been established that deposition of various types of pollutant aerosols (e.g., radioactive) on human skin can have serious deleterious effects on health. However. only few investigations in the past have been devoted to measurement of deposition velocities on skin...... of particles of the potentially problematic sizes. An experimental programme has shown the deposition velocities on skin of particles in the ca. 0.5-5 mu m AMAD range to be high and generally associated with great variations. A series of investigations have been made to identify some of the factors that lead...... to this variation. Part of the variation was found to be caused by differences between individuals, whereas another part was found to be related to environmental factors, The identification of major influences on skin contaminant deposition is important in estimating health effects as well as in identifying means...

  17. A novel approach to measuring the frictional behaviour of human skin in vivo

    NARCIS (Netherlands)

    Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile

    2012-01-01

    Friction involving human skin plays a key role in human life. The availability of a portable tribometer improves the accessibility to large number of both subjects and anatomical sites. This is the first mobile device suitable to measure skin friction with a controlled and variable normal load

  18. Elevation of telomerase activity in chronic radiation ulcer of human skin

    International Nuclear Information System (INIS)

    Li Xiaoying; Zhao Po; Wang Dewen; Yang Zhixiang

    1997-01-01

    Objective: To investigate the levels of telomerase activity in chronic radiation ulcers of human skin and the possible relationship between the enzyme and cancer transformation. Method: Using nonisotopic telomere repeat amplification protocol (TRAP), detections were performed in 20 cases of chronic radiation ulcers of human skin, 5 cases of normal skin tissues and 5 cases of carcinoma. Results: The positive rates for telomerase activity were 30.0%(6/20), 0(0/5) and 100%(5/5) in chronic radiation ulcers of human skin, normal skin and carcinoma, respectively. The telomerase activity in radiation ulcer was weaker than in carcinoma. Conclusion: The telomerase activity assay might be used as a marker for predicting the prognosis and the effect of treatment in chronic radiation ulcer of human skin

  19. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  20. In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy

    International Nuclear Information System (INIS)

    Borisova, E.; Avramov, L.

    2000-01-01

    The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)

  1. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  2. Constituents from the roots of Taraxacum platycarpum and their effect on proliferation of human skin fibroblasts.

    Science.gov (United States)

    Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio

    2012-01-01

    A MeOH extract from the roots of Taraxacum platycarpum has shown significant effects on the proliferation of normal human skin fibroblasts. Chemical analysis of the extract resulted in the isolation of 26 compounds, including eight new triterpenes, one new sesquiterpene glycoside, and seventeen known compounds. The structure of each new compound was established using NMR spectroscopy. Some triterpenes had a significant effect on the proliferation of normal human skin fibroblasts.

  3. Modelling glucose and water dynamics in human skin

    NARCIS (Netherlands)

    Groenendaal, W.; Schmidt, K.H.; Basum, von G.; Riel, van N.A.W.; Hilbers, P.A.J.

    2008-01-01

    Background: Glucose is heterogeneously distributed in the different physiological compartments in the human skin. Therefore, for the development of a noninvasive measurement method, both a good quantification of the different compartments of human skin and an understanding of glucose transport

  4. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  5. Ultrasonic evaluation of local human skin anisotropy

    Czech Academy of Sciences Publication Activity Database

    Tokar, Daniel; Převorovský, Zdeněk; Hradilová, Jana

    2014-01-01

    Roč. 19, č. 12 (2014) ISSN 1435-4934. [European Conference on Non-Destructive Testing (ECNDT 2014) /11./. Praha, 06.10.2014-10.10.2014] Institutional support: RVO:61388998 Keywords : anisotropy * ultrasonic testing * human skin in-vivo * fabric-fiber composite * signal processing Subject RIV: BI - Acoustics http://www.ndt.net/events/ECNDT2014/app/content/Paper/324_Tokar.pdf

  6. Human skin kinetics of cyclic depsipeptide mycotoxins

    OpenAIRE

    Taevernier, Lien; Veryser, Lieselotte; ROCHE, NATHALIE; De Spiegeleer, Bart

    2014-01-01

    Cyclic depsipeptides (CDPs) are an emerging group of naturally occurring bioactive peptides, some of which are already developed as pharmaceutical drugs, e.g. valinomycin. They are produced by bacteria, marine organisms and fungi [1]. Some CDPs are secondary fungal metabolites, which can be very toxic to humans and animals, and are therefore called mycotoxins. Currently, dermal exposure data of CDP mycotoxins is scarce and fragmentary with a lack of understanding about the local skin and syst...

  7. Skin friction: a novel approach to measuring in vivo human skin

    NARCIS (Netherlands)

    Veijgen, N.K.

    2013-01-01

    The human skin plays an important role in people’s lives. It is in constant interaction with the environment, clothing and consumer products. This thesis discusses one of the parameters in the interaction between the human skin in vivo and other materials: skin friction. The thesis is divided into

  8. Materials used to simulate physical properties of human skin.

    Science.gov (United States)

    Dąbrowska, A K; Rotaru, G-M; Derler, S; Spano, F; Camenzind, M; Annaheim, S; Stämpfli, R; Schmid, M; Rossi, R M

    2016-02-01

    For many applications in research, material development and testing, physical skin models are preferable to the use of human skin, because more reliable and reproducible results can be obtained. This article gives an overview of materials applied to model physical properties of human skin to encourage multidisciplinary approaches for more realistic testing and improved understanding of skin-material interactions. The literature databases Web of Science, PubMed and Google Scholar were searched using the terms 'skin model', 'skin phantom', 'skin equivalent', 'synthetic skin', 'skin substitute', 'artificial skin', 'skin replica', and 'skin model substrate.' Articles addressing material developments or measurements that include the replication of skin properties or behaviour were analysed. It was found that the most common materials used to simulate skin are liquid suspensions, gelatinous substances, elastomers, epoxy resins, metals and textiles. Nano- and micro-fillers can be incorporated in the skin models to tune their physical properties. While numerous physical skin models have been reported, most developments are research field-specific and based on trial-and-error methods. As the complexity of advanced measurement techniques increases, new interdisciplinary approaches are needed in future to achieve refined models which realistically simulate multiple properties of human skin. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Skin friction: a novel approach to measuring in vivo human skin

    OpenAIRE

    Veijgen, N.K.

    2013-01-01

    The human skin plays an important role in people’s lives. It is in constant interaction with the environment, clothing and consumer products. This thesis discusses one of the parameters in the interaction between the human skin in vivo and other materials: skin friction. The thesis is divided into three parts. The first part is an introduction to skin friction and to current knowledge on skin friction. The second part presents the RevoltST, the tribometer that was specially developed for skin...

  10. The isolated perfused human skin flap model: A missing link in skin penetration studies?

    Science.gov (United States)

    Ternullo, Selenia; de Weerd, Louis; Flaten, Gøril Eide; Holsæter, Ann Mari; Škalko-Basnet, Nataša

    2017-01-01

    Development of effective (trans)dermal drug delivery systems requires reliable skin models to evaluate skin drug penetration. The isolated perfused human skin flap remains metabolically active tissue for up to 6h during in vitro perfusion. We introduce the isolated perfused human skin flap as a close-to-in vivo skin penetration model. To validate the model's ability to evaluate skin drug penetration the solutions of a hydrophilic (calcein) and a lipophilic (rhodamine) fluorescence marker were applied. The skin flaps were perfused with modified Krebs-Henseleit buffer (pH7.4). Infrared technology was used to monitor perfusion and to select a well-perfused skin area for administration of the markers. Flap perfusion and physiological parameters were maintained constant during the 6h experiments and the amount of markers in the perfusate was determined. Calcein was detected in the perfusate, whereas rhodamine was not detectable. Confocal images of skin cross-sections shoved that calcein was uniformly distributed through the skin, whereas rhodamine accumulated in the stratum corneum. For comparison, the penetration of both markers was evaluated on ex vivo human skin, pig skin and cellophane membrane. The proposed perfused flap model enabled us to distinguish between the penetrations of the two markers and could be a promising close-to-in vivo tool in skin penetration studies and optimization of formulations destined for skin administration. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Degradation of type IV collagen by neoplastic human skin fibroblasts

    International Nuclear Information System (INIS)

    Sheela, S.; Barrett, J.C.

    1985-01-01

    An assay for the degradation of type IV (basement membrane) collagen was developed as a biochemical marker for neoplastic cells from chemically transformed human skin fibroblasts. Type IV collagen was isolated from basement membrane of Syrian hamster lung and type I collagen was isolated from rat tails; the collagens were radioactively labelled by reductive alkylation. The abilities of normal (KD) and chemically transformed (Hut-11A) human skin fibroblasts to degrade the collagens were studied. A cell-associated assay was performed by growing either normal or transformed cells in the presence of radioactively labelled type IV collagen and measuring the released soluble peptides in the medium. This assay also demonstrated that KD cells failed to synthesize an activity capable of degrading type IV collagen whereas Hut-11A cells degraded type IV collagen in a linear manner for up to 4 h. Human serum at very low concentrations, EDTA and L-cysteine inhibited the enzyme activity, whereas protease inhibitors like phenylmethyl sulfonyl fluoride, N-ethyl maleimide or soybean trypsin inhibitor did not inhibit the enzyme from Hut-11A cells. These results suggest that the ability to degrade specifically type IV collagen may be an important marker for neoplastic human fibroblasts and supports a role for this collagenase in tumor cell invasion

  12. Human Wharton's jelly mesenchymal stem cells promote skin wound healing through paracrine signaling.

    Science.gov (United States)

    Arno, Anna I; Amini-Nik, Saeid; Blit, Patrick H; Al-Shehab, Mohammed; Belo, Cassandra; Herer, Elaine; Tien, Col Homer; Jeschke, Marc G

    2014-02-24

    The prevalence of nonhealing wounds is predicted to increase due to the growing aging population. Despite the use of novel skin substitutes and wound dressings, poorly vascularized wound niches impair wound repair. Mesenchymal stem cells (MSCs) have been reported to provide paracrine signals to promote wound healing, but the effect of human Wharton's jelly-derived MSCs (WJ-MSCs) has not yet been described in human normal skin. Human WJ-MSCs and normal skin fibroblasts were isolated from donated umbilical cords and normal adult human skin. Fibroblasts were treated with WJ-MSC-conditioned medium (WJ-MSC-CM) or nonconditioned medium. Expression of genes involved in re-epithelialization (transforming growth factor-β2), neovascularization (hypoxia-inducible factor-1α) and fibroproliferation (plasminogen activator inhibitor-1) was upregulated in WJ-MSC-CM-treated fibroblasts (P≤0.05). WJ-MSC-CM enhanced normal skin fibroblast proliferation (P≤0.001) and migration (P≤0.05), and promoted wound healing in an excisional full-thickness skin murine model. Under our experimental conditions, WJ-MSCs enhanced skin wound healing in an in vivo mouse model.

  13. Response of Human Skin to Aesthetic Scarification

    Science.gov (United States)

    Gabriel, Vincent A.; McClellan, Elizabeth A.; Scheuermann, Richard H.

    2014-01-01

    This study was undertaken to investigate changes in RNA expression in previously healthy adult human skin following thermal injury induced by contact with hot metal that was undertaken as part of aesthetic scarification, a body modification practice. Subjects were recruited to have pre-injury skin and serial wound biopsies performed. 4 mm punch biopsies were taken prior to branding and 1 hour, 1 week, and 1, 2 and 3 months post injury. RNA was extracted and quality assured prior to the use of a whole-genome based bead array platform to describe expression changes in the samples using the pre-injury skin as a comparator. Analysis of the array data was performed using k-means clustering and a hypergeometric probability distribution without replacement and corrections for multiple comparisons were done. Confirmatory q-PCR was performed. Using a k of 10, several clusters of genes were shown to co-cluster together based on Gene Ontology classification with probabilities unlikely to occur by chance alone. OF particular interest were clusters relating to cell cycle, proteinaceous extracellular matrix and keratinization. Given the consistent expression changes at one week following injury in the cell cycle cluster, there is an opportunity to intervene early following burn injury to influence scar development. PMID:24582755

  14. Comparative human cellular radiosensitivity: I. The effect of SV40 transformation and immortalisation on the gamma-irradiation survival of skin derived fibroblasts from normal individuals and from ataxia-telangiectasia patients and heterozygotes.

    Science.gov (United States)

    Arlett, C F; Green, M H; Priestley, A; Harcourt, S A; Mayne, L V

    1988-12-01

    We have compared cell killing following 60Co gamma irradiation in 22 primary human fibroblast strains, nine SV40-immortalized human fibroblast lines and seven SV40-transformed pre-crisis human fibroblast cultures. We have examined material from normal individuals, from ataxia-telangiectasia (A-T) patients and from A-T heterozygotes. We have confirmed the greater sensitivity of A-T derived cells to gamma radiation. The distinction between A-T and normal cells is maintained in cells immortalized by SV40 virus but the immortal cells are more gamma radiation resistant than the corresponding primary fibroblasts. Cells transformed by plasmids (pSV3gpt and pSV3neo) expressing SV40 T-antigen, both pre- and post-crisis, show this increased resistance, indicating that it is expression of SV40 T-antigen, rather than immortalization per se which is responsible for the change. We use D0, obtained from a straight line fit, and D, estimated from a multitarget curve, as parameters to compare radiosensitivity. We suggest that both have their advantages; D0 is perhaps more reproducible, but D is more realistic when comparing shouldered and non-shouldered data.

  15. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  16. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  17. Modelling and verification of melanin concentration on human skin type

    CSIR Research Space (South Africa)

    Karsten, AE

    2012-03-01

    Full Text Available exposure to long-wave ultraviolet and visible light. J. Invest. Dermatol. 39, 13 435-443. 14 30. Lavker, R. M. and K. H. Kaidbey (1982) Redistribution of melanosomal complexes 15 within keratinocytes following UV-A irradiation: A possible mechanism..., 1146-1154. 10 20. Salomatina, E., B. Jiang, J. Novak, and A. N. Yaroslavsky (2006) Optical properties of 11 normal and cancerous human skin in the visible and near-infrared spectral range. J. 12 Biomed. Opt. 11. 13 21. Young, A. R. (1997...

  18. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  19. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.

    2011-01-01

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  20. Relating friction on the human skin to the hydration and temperature of the skin

    NARCIS (Netherlands)

    Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile

    2013-01-01

    The human skin is constantly in interaction with materials and products. Therefore, skin friction is relevant to all people. In the literature, the frictional properties of the skin have been linked to a large variety of variables, like age, gender and hydration. The present study compares the data

  1. Tribology of skin : review and analysis of experimental results for the friction coefficient of human skin

    NARCIS (Netherlands)

    Derler, S.; Gerhardt, L.C.

    2012-01-01

    In this review, we discuss the current knowledge on the tribology of human skin and present an analysis of the available experimental results for skin-friction coefficients. Starting with an overview on the factors influencing the friction behaviour of skin, we discuss the up-to-date existing

  2. Characterization of a Cryopreserved Split-Thickness Human Skin Allograft-TheraSkin.

    Science.gov (United States)

    Landsman, Adam; Rosines, Eran; Houck, Amanda; Murchison, Angela; Jones, Alyce; Qin, Xiaofei; Chen, Silvia; Landsman, Arnold R

    2016-09-01

    The purpose of this study was to examine the characteristics of a cryopreserved split-thickness skin allograft produced from donated human skin and compare it with fresh, unprocessed human split-thickness skin. Cutaneous wound healing is a complex and organized process, where the body re-establishes the integrity of the injured tissue. However, chronic wounds, such as diabetic or venous stasis ulcers, are difficult to manage and often require advanced biologics to facilitate healing. An ideal wound care product is able to directly influence wound healing by introducing biocompatible extracellular matrices, growth factors, and viable cells to the wound bed. TheraSkin (processed by LifeNet Health, Virginia Beach, Virginia, and distributed by Soluble Systems, Newport News, Virginia) is a minimally manipulated, cryopreserved split-thickness human skin allograft, which contains natural extracellular matrices, native growth factors, and viable cells. The authors characterized TheraSkin in terms of the collagen and growth factor composition using ELISA, percentage of apoptotic cells using TUNEL analysis, and cellular viability using alamarBlue assay (Thermo Fisher Scientific, Waltham, Massachusetts), and compared these characteristics with fresh, unprocessed human split-thickness skin. It was found that the amount of the type I and type III collagen, as well as the ratio of type I to type III collagen in TheraSkin, is equivalent to fresh unprocessed human split-thickness skin. Similar quantities of vascular endothelial growth factor, insulinlike growth factor 1, fibroblast growth factor 2, and transforming growth factor β1 were detected in TheraSkin and fresh human skin. The average percent of apoptotic cells was 34.3% and 3.1% for TheraSkin and fresh skin, respectively. Cellular viability was demonstrated in both TheraSkin and fresh skin.

  3. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  4. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  5. Diffusion of [2-14C]diazepam across hairless mouse skin and human skin

    International Nuclear Information System (INIS)

    Koch, R.L.; Palicharla, P.; Groves, M.J.

    1987-01-01

    The objectives of this study were to investigate the absorption of diazepam applied topically to the hairless mouse in vivo and to determine the diffusion of diazepam across isolated hairless mouse skin and human skin. [ 14 C]Diazepam was readily absorbed after topical administration to the intact hairless mouse, a total of 75.8% of the 14 C-label applied being recovered in urine and feces. Diazepam was found to diffuse across human and hairless mouse skin unchanged in experiments with twin-chambered diffusion cells. The variation in diffusion rate or the flux for both human and mouse tissues was greater among specimens than between duplicate or triplicate trials for a single specimen. Fluxes for mouse skin (stratum corneum, epidermis, and dermis) were greater than for human skin (stratum corneum and epidermis): 0.35-0.61 microgram/cm2/h for mouse skin vs 0.24-0.42 microgram/cm2/h for human skin. The permeability coefficients for mouse skin ranged from 1.4-2.4 X 10(-2)cm/h compared with 0.8-1.4 X 10(-2)cm/h for human skin. Although human stratum corneum is almost twice the thickness of that of the hairless mouse, the diffusion coefficients for human skin were 3-12 times greater (0.76-3.31 X 10(-6) cm2/h for human skin vs 0.12-0.27 X 10(-6) cm2/h for hairless mouse) because of a shorter lag time for diffusion across human skin. These differences between the diffusion coefficients and diffusion rates (or permeability coefficients) suggest that the presence of the dermis may present some barrier properties. In vitro the dermis may require complete saturation before the diazepam can be detected in the receiving chamber

  6. In-Vivo Human Skin to Textiles Friction Measurements

    Science.gov (United States)

    Pfarr, Lukas; Zagar, Bernhard

    2017-10-01

    We report on a measurement system to determine highly reliable and accurate friction properties of textiles as needed for example as input to garment simulation software. Our investigations led to a set-up that allows to characterize not just textile to textile but also textile to in-vivo human skin tribological properties and thus to fundamental knowledge about genuine wearer interaction in garments. The method of test conveyed in this paper is measuring concurrently and in a highly time resolved manner the normal force as well as the resulting shear force caused by a friction subject intending to slide out of the static friction regime and into the dynamic regime on a test bench. Deeper analysis of various influences is enabled by extending the simple model following Coulomb's law for rigid body friction to include further essential parameters such as contact force, predominance in the yarn's orientation and also skin hydration. This easy-to-use system enables to measure reliably and reproducibly both static and dynamic friction for a variety of friction partners including human skin with all its variability there might be.

  7. Analysis of human skin tissue by millimeter-wave reflectometry

    NARCIS (Netherlands)

    Smulders, P.F.M.

    2013-01-01

    Background/pupose: Millimeter-wave reflectometry is a potentially interesting technique to analyze the human skin in vivo in order to determine the water content locally in the skin. Purpose of this work is to investigate the possibility of skin-tissue differentiation. In addition, it addresses the

  8. Characterisation of mechanical behaviour of human skin in vivo

    NARCIS (Netherlands)

    Douven, L.F.A.; Meijer, R.; Oomens, C.W.J.

    2000-01-01

    Characterization of the biomechanical properties of human skin in vivo is studied both experimentally and by numerical modeling. These properties can be important in the evaluation of skin condition (e.g. aging) as well as skin disorders. In this study the authors focus on the static behavior of the

  9. First genomic survey of human skin fungal diversity

    Science.gov (United States)

    Fungal infections of the skin affect 29 million people in the United States. In the first study of human fungal skin diversity, National Institutes of Health researchers sequenced the DNA of fungi that thrive at different skin sites of healthy adults to d

  10. Chemical ecology of interactions between human skin microbiota and mosquitoes

    NARCIS (Netherlands)

    Verhulst, N.O.; Takken, W.; Dicke, M.; Schraa, G.; Smallegange, R.C.

    2010-01-01

    Microbiota on the human skin plays a major role in body odour production. The human microbial and chemical signature displays a qualitative and quantitative correlation. Genes may influence the chemical signature by shaping the composition of the microbiota. Recent studies on human skin microbiota,

  11. Research on Normal Human Plantar Pressure Test

    Directory of Open Access Journals (Sweden)

    Liu Xi Yang

    2016-01-01

    Full Text Available FSR400 pressure sensor, nRF905 wireless transceiver and MSP40 SCM are used to design the insole pressure collection system, LabVIEW is used to make HMI of data acquisition, collecting a certain amount of normal human foot pressure data, statistical analysis of pressure distribution relations about five stages of swing phase during walking, using the grid closeness degree to identify plantar pressure distribution pattern recognition, and the algorithm simulation, experimental results demonstrated this method feasible.

  12. Analogs of human genetic skin disease in domesticated animals

    Directory of Open Access Journals (Sweden)

    Justin Finch, MD

    2017-09-01

    The genetic skin diseases we will review are pigmentary mosaicism, piebaldism, albinism, Griscelli syndrome, ectodermal dysplasias, Waardenburg syndrome, and mucinosis in both humans and domesticated animals.

  13. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  14. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  15. [The clinical use of cryopreserved human skin allografts for transplantation].

    Science.gov (United States)

    Martínez-Flores, Francisco; Chacón-Gómez, María; Madinaveitia-Villanueva, Juan Antonio; Barrera-Lopez, Araceli; Aguirre-Cruz, Lucinda; Querevalu-Murillo, Walter

    2015-01-01

    The biological recovery of human skin allografts is the gold standard for preservation in Skin Banks. However, there is no worldwide consensus about specific allocation criteria for preserved human skin allografts with living cells. A report is presented on the results of 5 years of experience of using human skin allografts in burned patient in the Skin and Tissue Bank at the "Instituto Nacional de Rehabilitacion" The human skin allografts were obtained from multi-organ donors. processed and preserved at -80 °C for 12 months. Allocation criteria were performed according to blood type match, clinical history, and burned body surface. Up to now, the Skin and Tissue Bank at 'Instituto Nacional de Rehabilitacion" has processed and recovered 125,000 cm(2) of human skin allografts. It has performed 34 surgical implants on 21 burned patients. The average of burn body surface was 59.2%. More than two-thirds (67.7%) of recipients of skin allografts were matched of the same to type blood of the donor, and 66.6% survived after 126 days hospital stay. It is proposed to consider recipient's blood group as allocation criteria to assign tissue; and use human skin allografts on patiens affected with burns over 30% of body surface (according the "rule of the 9"). Copyright © 2015 Academia Mexicana de Cirugía A.C. Published by Masson Doyma México S.A. All rights reserved.

  16. Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

    International Nuclear Information System (INIS)

    Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

    1982-01-01

    Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

  17. Studies in human skin epithelial cell carcinogenesis

    International Nuclear Information System (INIS)

    Lehman, T.A.

    1987-01-01

    Metabolism and DNA adduct formation of benzo[a]pyrene (BP) by human epidermal keratinocytes pretreated with inhibitors or inducer of cytochrame P450 was studied. To study DNA adduct analysis, cultures were pretreated as described above, and then treated with non-radiolabeled BP. DNA was prepared from these cultures, digested to the nucleotide level, and 32 P-postlabeled for adduct analysis. Cultures pretreated with BHA, 7,8-BF or disulfiralm formed significantly fewer BPDE I-dB adducts than non-pretreated cultures, while cultures pretreated with MeBHA formed more BPDE-I-dG adducts. MeBHA increased BP activation and adduct formation inhuman keratinocyte in cultures by inducing a specific isoenzyme of cytochrome P450 which preferentially increases the oxidative metabolism of BP to 7,8 diol BP and 7,8 diol BP to BPDE I. To approximate an in vivo human system, metabolism of BPDE I by human skin xenografts treated with cell cycles modulators was studied. When treated with BPDE I, specific carcinogen-DNA adducts were formed. Separation and identification of these adducts by the 32 P-postlabeling technique indicated that the 7R- and 7S-BPDE I-dG adducts were the major adducts

  18. The variability problem of normal human walking

    DEFF Research Database (Denmark)

    Simonsen, Erik B; Alkjær, Tine

    2012-01-01

    Previous investigations have suggested considerable inter-individual variability in the time course pattern of net joint moments during normal human walking, although the limited sample sizes precluded statistical analyses. The purpose of the present study was to obtain joint moment patterns from...... a group of normal subjects and to test whether or not the expected differences would prove to be statistically significant. Fifteen healthy male subjects were recorded on video while they walked across two force platforms. Ten kinematic and kinetic parameters were selected and input to a statistical...... cluster analysis to determine whether or not the 15 subjects could be divided into different 'families' (clusters) of walking strategy. The net joint moments showed a variability corroborating earlier reports. The cluster analysis showed that the 15 subjects could be grouped into two clusters of 5 and 10...

  19. Parietal podocytes in normal human glomeruli.

    Science.gov (United States)

    Bariety, Jean; Mandet, Chantal; Hill, Gary S; Bruneval, Patrick

    2006-10-01

    Although parietal podocytes along the Bowman's capsule have been described by electron microscopy in the normal human kidney, their molecular composition remains unknown. Ten human normal kidneys that were removed for cancer were assessed for the presence and the extent of parietal podocytes along the Bowman's capsule. The expression of podocyte-specific proteins (podocalyxin, glomerular epithelial protein-1, podocin, nephrin, synaptopodin, and alpha-actinin-4), podocyte synthesized proteins (vascular endothelial growth factor and novH), transcription factors (WT1 and PAX2), cyclin-dependent kinase inhibitor p57, and intermediate filaments (cytokeratins and vimentin) was tested. In addition, six normal fetal kidneys were studied to track the ontogeny of parietal podocytes. The podocyte protein labeling detected parietal podocytes in all of the kidneys, was found in 76.6% on average of Bowman's capsule sections, and was prominent at the vascular pole. WT1 and p57 were expressed in some parietal cells, whereas PAX2 was present in all or most of them, so some parietal cells coexpressed WT1 and PAX2. Furthermore, parietal podocytes coexpressed WT1 and podocyte proteins. Cytokeratin-positive cells covered a variable part of the capsule and did not express podocyte proteins. Tuft-capsular podocyte bridges were present in 15.5 +/- 3.7% of the glomerular sections. Parietal podocytes often covered the juxtaglomerular arterioles and were present within the extraglomerular mesangium. Parietal podocytes were present in fetal kidneys. Parietal podocytes that express the same epitopes as visceral podocytes do exist along Bowman's capsule in the normal adult kidney. They are a constitutive cell type of the Bowman's capsule. Therefore, their role in physiology and pathology should be investigated.

  20. Human age and skin physiology shape diversity and abundance of Archaea on skin.

    Science.gov (United States)

    Moissl-Eichinger, Christine; Probst, Alexander J; Birarda, Giovanni; Auerbach, Anna; Koskinen, Kaisa; Wolf, Peter; Holman, Hoi-Ying N

    2017-06-22

    The human skin microbiome acts as an important barrier protecting our body from pathogens and other environmental influences. Recent investigations have provided evidence that Archaea are a constant but highly variable component of the human skin microbiome, yet factors that determine their abundance changes are unknown. Here, we tested the hypothesis that the abundance of archaea on human skin is influenced by human age and skin physiology by quantitative PCR of 51 different skin samples taken from human subjects of various age. Our results reveal that archaea are more abundant in human subjects either older than 60 years or younger than 12 years as compared to middle-aged human subjects. These results, together with results obtained from spectroscopy analysis, allowed us gain first insights into a potential link of lower sebum levels and lipid content and thus reduced skin moisture with an increase in archaeal signatures. Amplicon sequencing of selected samples revealed the prevalence of specific eury- and mainly thaumarchaeal taxa, represented by a core archaeome of the human skin.

  1. Molecular cartography of the human skin surface in 3D

    Science.gov (United States)

    Bouslimani, Amina; Porto, Carla; Rath, Christopher M.; Wang, Mingxun; Guo, Yurong; Gonzalez, Antonio; Berg-Lyon, Donna; Ackermann, Gail; Moeller Christensen, Gitte Julie; Nakatsuji, Teruaki; Zhang, Lingjuan; Borkowski, Andrew W.; Meehan, Michael J.; Dorrestein, Kathleen; Gallo, Richard L.; Bandeira, Nuno; Knight, Rob; Alexandrov, Theodore; Dorrestein, Pieter C.

    2015-01-01

    The human skin is an organ with a surface area of 1.5–2 m2 that provides our interface with the environment. The molecular composition of this organ is derived from host cells, microbiota, and external molecules. The chemical makeup of the skin surface is largely undefined. Here we advance the technologies needed to explore the topographical distribution of skin molecules, using 3D mapping of mass spectrometry data and microbial 16S rRNA amplicon sequences. Our 3D maps reveal that the molecular composition of skin has diverse distributions and that the composition is defined not only by skin cells and microbes but also by our daily routines, including the application of hygiene products. The technological development of these maps lays a foundation for studying the spatial relationships of human skin with hygiene, the microbiota, and environment, with potential for developing predictive models of skin phenotypes tailored to individual health. PMID:25825778

  2. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    International Nuclear Information System (INIS)

    Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael

    2002-01-01

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  3. Advanced haptic sensor for measuring human skin conditions

    Science.gov (United States)

    Tsuchimi, Daisuke; Okuyama, Takeshi; Tanaka, Mami

    2010-01-01

    This paper is concerned with the development of a tactile sensor using PVDF (Polyvinylidene Fluoride) film as a sensory receptor of the sensor to evaluate softness, smoothness, and stickiness of human skin. Tactile sense is the most important sense in the sensation receptor of the human body along with eyesight, and we can examine skin condition quickly using these sense. But, its subjectivity and ambiguity make it difficult to quantify skin conditions. Therefore, development of measurement device which can evaluate skin conditions easily and objectively is demanded by dermatologists, cosmetic industries, and so on. In this paper, an advanced haptic sensor system that can measure multiple information of skin condition in various parts of human body is developed. The applications of the sensor system to evaluate softness, smoothness, and stickiness of skin are investigated through two experiments.

  4. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  5. Glycoprotein biosynthesis by human normal platelets

    International Nuclear Information System (INIS)

    Rodriguez, P.; Bello, O.; Apitz-Castro, R.

    1987-01-01

    Incorporation of radioactive Man, Gal, Fuc, Glc-N, and NANA into washed human normal platelets and endogenous glycoproteins has been found. Both parameters were time dependent. Analysis of hydrolyzed labeled glycoproteins by paper chromatography revealed that the radioactive monosaccharide incubated with the platelets had not been converted into other sugars. Acid hydrolysis demonstrates the presence of a glycosidic linkage. All the effort directed to the demonstration of the existence of a lipid-sugar intermediate in intact human platelets yielded negative results for Man and Glc-N used as precursors. The incorporation of these sugars into glycoproteins is insensitive to bacitracin, suggesting no involvement of lipid-linked saccharides in the synthesis of glycoproteins in human blood platelets. The absence of inhibition of the glycosylation process in the presence of cycloheximide suggests that the sugars are added to proteins present in the intact platelets. These results support the contention that glycoprotein biosynthesis in human blood platelets observed under our experimental conditions is effected through direct sugar nucleotide glycosylation

  6. Immunohistochemical study of sensory nerve formations in human glabrous skin.

    Science.gov (United States)

    Haro, J J; Vega, J A; del Valle, M E; Calzada, B; Zaccheo, D; Malinovsky, L

    1991-01-01

    The sensory nerve formations (or corpuscles) of normal human glabrous skin from hand and fingers, obtained by punch biopsies, were studied by the streptavidin-biotin method using monoclonal antibodies directed against neurofilament protein (NFP), S-100 protein, glial fibrillary acidic protein (GFAP), cytokeratins, and vimentin. NFP immunoreactivity (IR) was observed in the central axons of most sensory formations, while S-100 protein IR was restricted to non-neuronal cells forming the so-called inner cells core or lamellar cells. Furthermore, vimentin IR was found in the same cells of Meissner's and glomerular corpuscles. None of the sensory nerve formations were stained for GFAP or keratin. The present results suggest that the main nature of the intermediate filaments of the non-neuronal cells of sensory nerve formations from human glabrous skin is represented by vimentin and not by GFAP. Thus, our findings suggest that lamellar and inner core cells of SNF are modified and specialized Schwann cells and not epithelial or perineurial derived cells.

  7. Assessing human skin with diffuse reflectance spectroscopy and colorimetry

    Science.gov (United States)

    Seo, InSeok; Liu, Yang; Bargo, Paulo R.; Kollias, Nikiforos

    2012-02-01

    Colorimetry has been used as an objective measure of perceived skin color by human eye to document and score physiological responses of the skin from external insults. CIE color space values (L*, a* and b*) are the most commonly used parameters to correlate visually perceived color attributes such as L* for pigment, a* for erythema, and b* for sallowness of the skin. In this study, we investigated the relation of Lab color scale to the amount of major skin chromophores (oxy-, deoxyhemoglobin and melanin) calculated from diffuse reflectance spectroscopy. Thirty two healthy human subjects with ages from 20 to 70 years old, skin types I-VI, were recruited for the study. DRS and colorimetry measurements were taken from the left and right cheeks, and on the right upper inner arm. The melanin content calculated from 630-700 nm range of DRS measurements was shown to correlate with the lightness of skin (L*) for most skin types. For subjects with medium-to-light complexion, melanin measured at the blue part spectrum and hemoglobin interfered on the relation of lightness of the skin color to the melanin content. The sallowness of the skin that is quantified by the melanin contribution at the blue part spectrum of DRS was found to be related to b* scale. This study demonstrates the importance of documenting skin color by assessing individual skin chromophores with diffuse reflectance spectroscopy, in comparison to colorimetry assessment.

  8. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Gledhill, Karl; Guo, Zongyou; Umegaki-Arao, Noriko; Higgins, Claire A; Itoh, Munenari; Christiano, Angela M

    2015-01-01

    The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs) present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  9. Melanin Transfer in Human 3D Skin Equivalents Generated Exclusively from Induced Pluripotent Stem Cells.

    Directory of Open Access Journals (Sweden)

    Karl Gledhill

    Full Text Available The current utility of 3D skin equivalents is limited by the fact that existing models fail to recapitulate the cellular complexity of human skin. They often contain few cell types and no appendages, in part because many cells found in the skin are difficult to isolate from intact tissue and cannot be expanded in culture. Induced pluripotent stem cells (iPSCs present an avenue by which we can overcome this issue due to their ability to be differentiated into multiple cell types in the body and their unlimited growth potential. We previously reported generation of the first human 3D skin equivalents from iPSC-derived fibroblasts and iPSC-derived keratinocytes, demonstrating that iPSCs can provide a foundation for modeling a complex human organ such as skin. Here, we have increased the complexity of this model by including additional iPSC-derived melanocytes. Epidermal melanocytes, which are largely responsible for skin pigmentation, represent the second most numerous cell type found in normal human epidermis and as such represent a logical next addition. We report efficient melanin production from iPSC-derived melanocytes and transfer within an entirely iPSC-derived epidermal-melanin unit and generation of the first functional human 3D skin equivalents made from iPSC-derived fibroblasts, keratinocytes and melanocytes.

  10. First donation of human skin obtained from corpse

    International Nuclear Information System (INIS)

    Reyes F, M.L.; Luna Z, D.

    2007-01-01

    The first donation of human skin coming from a cadaverous donor was obtained in the State of Mexico. The skin was obtained of a 34 year-old multi organic donor, the extraction of the same was carried out in an operating theatre by medical personnel, supported by personal of the Radio sterilized Tissue Bank (BTR) of the ININ. The skin was transported to the BTR for it processing. (Author)

  11. Diffuse Reflectance Spectroscopy of Human Skin Using a Commercial Fiber Optic Spectrometer

    International Nuclear Information System (INIS)

    Atencio, J. A. Delgado; Rodriguez, M. Cunill; Montiel, S. Vazquez y; Castro, Jorge; Rodriguez, A. Cornejo; Gutierrez, J. L.; Martinez, F.; Gutierrez, B.; Orozco, E.

    2008-01-01

    Diffuse reflectance spectroscopy is a reliable and easy to implement technique in human tissue characterization. In this work we evaluate the performance of the commercial USB4000 miniature fiber optic spectrometer in the in-vivo measurement of the diffuse reflectance spectra of different healthy skin sites and lesions in a population of 54 volunteers. Results show, that this spectrometer reproduces well the typical signatures of skin spectra over the 400-1000 nm region. Remarkable spectral differences exist between lesions and normal surrounding skin. A diffusion-based model was used to simulate reflectance spectra collected by the optical probe of the system

  12. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

    Science.gov (United States)

    Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

    2013-12-15

    The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

  13. Effects of radiation on the skin blood volume pulse in humans

    Energy Technology Data Exchange (ETDEWEB)

    Zanelli, G D [Mount Vernon Hospital, Northwood (UK)

    1977-01-01

    Measurements have been made of the changes in skin blood volume pulse (BVP) in the irradiated skin of three patients (two female, one male) during and up to 250 days after radiotherapy for malignant disease. The instrumentation comprised a modified commercial finger photo-plethysmograph probe with associated electronics, and a survey of the literature revealed that the consensus of opinion seems to be that the recorded pulsations arise from small 'muscular' arteries and arterioles in the 40 to 300 ..mu..m size range. The results show that, as expected, normal, untreated skin shows sizeable variations in BVP. The BVP of irradiated skin became significantly greater than that of normal skin when a dose of 1000 to 1500 rad has been accumulated. The maximum amplitude of the BVP of the irradiated skin seemed to correlate well with the overall severity of the erythema, but increases in BVP preceded erythema flare-ups. In two patients, elevated BVP were recorded for irradiated areas even when most visual signs of erythema had disappeared. Mild cooling of irradiated and non-irradiated skin had differing effects in the BVP. The measurement of the BVP of irradiated skin is a simple, reliable and completely atraumatic method for investigating vascular damage to superficial tissues in humans.

  14. A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin

    Directory of Open Access Journals (Sweden)

    Nisma Mujahid

    2017-06-01

    Full Text Available The presence of dark melanin (eumelanin within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in “redhaired” Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk.

  15. A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin.

    Science.gov (United States)

    Mujahid, Nisma; Liang, Yanke; Murakami, Ryo; Choi, Hwan Geun; Dobry, Allison S; Wang, Jinhua; Suita, Yusuke; Weng, Qing Yu; Allouche, Jennifer; Kemeny, Lajos V; Hermann, Andrea L; Roider, Elisabeth M; Gray, Nathanael S; Fisher, David E

    2017-06-13

    The presence of dark melanin (eumelanin) within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in "redhaired" Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK) has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Activin receptor subunits in normal and dysfunctional adult human testis

    DEFF Research Database (Denmark)

    Dias, V; Meachem, S; Rajpert-De Meyts, E

    2008-01-01

    The cellular sites of activin action and its regulation in the normal and dysfunctional adult human testis are unknown.......The cellular sites of activin action and its regulation in the normal and dysfunctional adult human testis are unknown....

  17. Variables influencing the frictional behaviour of in vivo human skin

    NARCIS (Netherlands)

    Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile

    2013-01-01

    In the past decades, skin friction research has focused on determining which variables are important to affect the frictional behaviour of in vivo human skin. Until now, there is still limited knowledge on these variables. This study has used a large dataset to identify the effect of variables on

  18. Variables influencing the frictional behaviour of in vivo human skin

    NARCIS (Netherlands)

    Veijgen, N.K.; Masen, M.A.; Heide, E. van der

    2013-01-01

    In the past decades, skin friction research has focused on determining which variables are important to affect the frictional behaviour of in vivo human skin. Until now, there is still limited knowledge on these variables.This study has used a large dataset to identify the effect of variables on the

  19. Human skin penetration of silver nanoparticles through intact and damaged skin

    International Nuclear Information System (INIS)

    Larese, Francesca Filon; D'Agostin, Flavia; Crosera, Matteo; Adami, Gianpiero; Renzi, Nadia; Bovenzi, Massimo; Maina, Giovanni

    2009-01-01

    There is a growing interest on nanoparticle safety for topical use. The benefits of nanoparticles have been shown in several scientific fields, but little is known about their potential to penetrate the skin. This study aims at evaluating in vitro skin penetration of silver nanoparticles. Experiments were performed using the Franz diffusion cell method with intact and damaged human skin. Physiological solution was used as receiving phase and 70 μg/cm 2 of silver nanoparticles coated with polyvinylpirrolidone dispersed in synthetic sweat were applied as donor phase to the outer surface of the skin for 24 h. The receptor fluid measurements were performed by electro thermal atomic absorption spectroscopy (ETAAS). Human skin penetration was also determined by using transmission electron microscope (TEM) to verify the location of silver nanoparticles in exposed membranes. Median silver concentrations of 0.46 ng cm -2 (range -2 (range 0.43-11.6) were found in the receiving solutions of cells where the nanoparticles solution was applied on intact skin (eight cells) and on damaged skin (eight cells), respectively. Twenty-four hours silver flux permeation in damaged skin was 0.62 ± 0.2 ng cm -2 with a lag time <1 h. Our experimental data showed that silver nanoparticles absorption through intact and damaged skin was very low but detectable, and that in case of damaged skin it was possible an increasing permeation of silver applied as nanoparticles. Moreover, silver nanoparticles could be detected in the stratum corneum and the outermost surface of the epidermis by electron microscopy. We demonstrated for the first time that silver applied as nanoparticles coated with polyvinylpirrolidone is able to permeate the damaged skin in an in vitro diffusion cell system

  20. Utilization of reconstructed cultured human skin models as an alternative skin for permeation studies of chemical compounds

    OpenAIRE

    Kano, Satoshi; 藤堂, 浩明; 杉江, 謙一; 藤本, 英哲; 中田, 圭一; 徳留, 嘉寛; 橋本, フミ惠; 杉林, 堅次

    2010-01-01

    Two reconstructed human skin models, EpiskinSM and EpiDermTM, have been approved as alternative membranes for skin corrosive/irritation experiments due to their close correlation with animal skin. Such reconstructed human skin models were evaluated as alternative membranes for skin permeation experiments. Seven drugs with different lipophilicities and almost the same molecular weight were used as test penetrants. Relationships were investigated between permeability coefficients (P values) of ...

  1. Effect of fluocinolone acetonide cream on human skin blood flow

    International Nuclear Information System (INIS)

    Chimoskey, J.E.; Holloway, A. Jr.; Flanagan, W.J.

    1975-01-01

    Blood flow rate was measured in the forearm skin of human subjects exposed to ultraviolet irradiation. Blood flow was determined by the 133 Xe disappearance technique 18 hr after ultraviolet (UV) irradiation with a Westinghouse RS sunlamp held 10 inches from the skin for 10 min. Ultraviolet irradiation caused skin blood flow to increase. Application of fluocinolone acetonide cream, 0.025 percent, 4 times in the 16 hr following UV irradiation had no effect on either control skin blood flow or the UV-induced hyperemia

  2. Elastin hydrolysate derived from fish enhances proliferation of human skin fibroblasts and elastin synthesis in human skin fibroblasts and improves the skin conditions.

    Science.gov (United States)

    Shiratsuchi, Eri; Nakaba, Misako; Yamada, Michio

    2016-03-30

    Recent studies have shown that certain peptides significantly improve skin conditions, such as skin elasticity and the moisture content of the skin of healthy woman. This study aimed to investigate the effects of elastin hydrolysate on human skin. Proliferation and elastin synthesis were evaluated in human skin fibroblasts exposed to elastin hydrolysate and proryl-glycine (Pro-Gly), which is present in human blood after elastin hydrolysate ingestion. We also performed an ingestion test with elastin hydrolysate in humans and evaluated skin condition. Elastin hydrolysate and Pro-Gly enhanced the proliferation of fibroblasts and elastin synthesis. Maximal proliferation response was observed at 25 ng mL(-1) Pro-Gly. Ingestion of elastin hydrolysate improved skin condition, such as elasticity, number of wrinkles, and blood flow. Elasticity improved by 4% in the elastin hydrolysate group compared with 2% in the placebo group. Therefore, elastin hydrolysate activates human skin fibroblasts and has beneficial effects on skin conditions. © 2015 Society of Chemical Industry.

  3. An ex vivo human skin model for studying skin barrier repair.

    Science.gov (United States)

    Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A

    2015-01-01

    In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. An in vitro human skin test for assessing sensitization potential.

    Science.gov (United States)

    Ahmed, S S; Wang, X N; Fielding, M; Kerry, A; Dickinson, I; Munuswamy, R; Kimber, I; Dickinson, A M

    2016-05-01

    Sensitization to chemicals resulting in an allergy is an important health issue. The current gold-standard method for identification and characterization of skin-sensitizing chemicals was the mouse local lymph node assay (LLNA). However, for a number of reasons there has been an increasing imperative to develop alternative approaches to hazard identification that do not require the use of animals. Here we describe a human in-vitro skin explant test for identification of sensitization hazards and the assessment of relative skin sensitizing potency. This method measures histological damage in human skin as a readout of the immune response induced by the test material. Using this approach we have measured responses to 44 chemicals including skin sensitizers, pre/pro-haptens, respiratory sensitizers, non-sensitizing chemicals (including skin-irritants) and previously misclassified compounds. Based on comparisons with the LLNA, the skin explant test gave 95% specificity, 95% sensitivity, 95% concordance with a correlation coefficient of 0.9. The same specificity and sensitivity were achieved for comparison of results with published human sensitization data with a correlation coefficient of 0.91. The test also successfully identified nickel sulphate as a human skin sensitizer, which was misclassified as negative in the LLNA. In addition, sensitizers and non-sensitizers identified as positive or negative by the skin explant test have induced high/low T cell proliferation and IFNγ production, respectively. Collectively, the data suggests the human in-vitro skin explant test could provide the basis for a novel approach for characterization of the sensitizing activity as a first step in the risk assessment process. Copyright © 2015 John Wiley & Sons, Ltd.

  5. Experimental metagenomics and ribosomal profiling of the human skin microbiome.

    Science.gov (United States)

    Ferretti, Pamela; Farina, Stefania; Cristofolini, Mario; Girolomoni, Giampiero; Tett, Adrian; Segata, Nicola

    2017-03-01

    The skin is the largest organ in the human body, and it is populated by a large diversity of microbes, most of which are co-evolved with the host and live in symbiotic harmony. There is increasing evidence that the skin microbiome plays a crucial role in the defense against pathogens, immune system training and homoeostasis, and microbiome perturbations have been associated with pathological skin conditions. Studying the skin resident microbial community is thus essential to better understand the microbiome-host crosstalk and to associate its specific configurations with cutaneous diseases. Several community profiling approaches have proved successful in unravelling the composition of the skin microbiome and overcome the limitations of cultivation-based assays, but these tools remain largely inaccessible to the clinical and medical dermatology communities. The study of the skin microbiome is also characterized by specific technical challenges, such as the low amount of microbial biomass and the extensive human DNA contamination. Here, we review the available community profiling approaches to study the skin microbiome, specifically focusing on the practical experimental and analytical tools necessary to generate and analyse skin microbiome data. We describe all the steps from the initial samples collection to the final data interpretation, with the goal of enabling clinicians and researchers who are not familiar with the microbiome field to perform skin profiling experiments. © 2016 The Authors. Experimental Dermatology Published by John Wiley & Sons Ltd.

  6. Permeation of chromium salts through human skin in vitro

    DEFF Research Database (Denmark)

    Gammelgaard, Bente; Fullerton, A; Avnstorp, C

    1992-01-01

    Chromium permeation studies were performed on full thickness human skin in diffusion cells. All samples were analysed for the total chromium content by graphite furnace Zeeman-corrected atomic absorption spectrometry. Some samples were analysed by an ion chromatographic method permitting...... the simultaneous determination of Cr(VI) and Cr(III) as well. The amounts of chromium found in all skin layers were significantly higher when potassium dichromate was applied to the skin compared with chromium chloride or chromium nitrate. Chromium could only be detected in the recipient phase after application...... of the dichromate solution. Chromium skin levels increased with increasing concentrations of applied chromium salts up to 0.034 M Cr. The amount of chromium in recipient phase and skin layers increased with increasing pH when the applied solution contained potassium dichromate. This was ascribed to a decreased skin...

  7. Effect of Different Skin Penetration Promoters in Halobetasol Propionate Permeation and Retention in Human Skin

    Directory of Open Access Journals (Sweden)

    Paulina Carvajal-Vidal

    2017-11-01

    Full Text Available Halobetasol propionate (HB is a potent synthetic corticosteroid used against inflammatory skin diseases, such as dermatitis, eczema, and psoriasis, among others. The aim of this study is to define how the presence of different skin penetration enhancers (nonane, menthone, limonene, azone, carene, decanol, linoleic acid and cetiol affects the penetration and retention in skin of HB. To determine drug penetration through skin, 5% of each promoter was used in an ex vivo system with human skin on Franz cells. The results showed that the highest permeation occurs in the presence of menthone, followed by nonane. Permeation parameters were determined. The in vivo test was assessed, and the formulation containing HB-menthone presented better anti-inflammatory efficacy. These results are useful to generate a specific treatment according to each patient’s needs, and the inflammatory characteristics of the disease.

  8. Method of protecting human skin from actinic radiation

    International Nuclear Information System (INIS)

    Fusaro, R.M.

    1975-01-01

    Enhanced protection from sunlight is achieved by applying to human skin beforehand separate, time-spaced applications of (1) a carbonyl compound which is reactive with amino groups in human skin, for example dihydroxyacetone, and (2) a benzo- or naptho-quinone such as lawsone. Preferably several sequential applications of each active component in a separate carrier are made the evening before the first exposure, and protection is thereafter maintained by applying each component separately each evening

  9. Tribological behaviour of skin equivalents and ex-vivo human skin against the material components of artificial turf in sliding

    NARCIS (Netherlands)

    Morales Hurtado, Marina; Peppelman, P.; Zeng, Xiangqiong; van Erp, P.E.J.; van der Heide, Emile

    2016-01-01

    This research aims to analyse the interaction of three artificial skin equivalents and human skin against the main material components of artificial turf. The tribological performance of Lorica, Silicone Skin L7350 and a recently developed Epidermal Skin Equivalent (ESE) were studied and compared to

  10. Vehicle effects on human stratum corneum absorption and skin penetration.

    Science.gov (United States)

    Zhang, Alissa; Jung, Eui-Chang; Zhu, Hanjiang; Zou, Ying; Hui, Xiaoying; Maibach, Howard

    2017-05-01

    This study evaluated the effects of three vehicles-ethanol (EtOH), isopropyl alcohol (IPA), and isopropyl myristate (IPM)-on stratum corneum (SC) absorption and diffusion of the [ 14 C]-model compounds benzoic acid and butenafine hydrochloride to better understand the transport pathways of chemicals passing through and resident in SC. Following application of topical formulations to human dermatomed skin for 30 min, penetration flux was observed for 24 h post dosing, using an in vitro flow-through skin diffusion system. Skin absorption and penetration was compared to the chemical-SC (intact, delipidized, or SC lipid film) binding levels. A significant vehicle effect was observed for chemical skin penetration and SC absorption. IPA resulted in the greatest levels of intact SC/SC lipid absorption, skin penetration, and total skin absorption/penetration of benzoic acid, followed by IPM and EtOH, respectively. For intact SC absorption and total skin absorption/penetration of butenafine, the vehicle that demonstrated the highest level of sorption/penetration was EtOH, followed by IPA and IPM, respectively. The percent doses of butenafine that were absorbed in SC lipid film and penetrated through skin in 24 h were greatest for IPA, followed by EtOH and IPM, respectively. The vehicle effect was consistent between intact SC absorption and total chemical skin absorption and penetration, as well as SC lipid absorption and chemical penetration through skin, suggesting intercellular transport as a main pathway of skin penetration for model chemicals. These results suggest the potential to predict vehicle effects on skin permeability with simple SC absorption assays. As decontamination was applied 30 min after chemical exposure, significant vehicle effects on chemical SC partitioning and percutaneous penetration also suggest that skin decontamination efficiency is vehicle dependent, and an effective decontamination method should act on chemical solutes in the lipid domain.

  11. Skin age testing criteria: characterization of human skin structures by 500 MHz MRI multiple contrast and image processing

    International Nuclear Information System (INIS)

    Sharma, Rakesh

    2010-01-01

    Ex vivo magnetic resonance microimaging (MRM) image characteristics are reported in human skin samples in different age groups. Human excised skin samples were imaged using a custom coil placed inside a 500 MHz NMR imager for high-resolution microimaging. Skin MRI images were processed for characterization of different skin structures. Contiguous cross-sectional T1-weighted 3D spin echo MRI, T2-weighted 3D spin echo MRI and proton density images were compared with skin histopathology and NMR peaks. In all skin specimens, epidermis and dermis thickening and hair follicle size were measured using MRM. Optimized parameters TE and TR and multicontrast enhancement generated better MRI visibility of different skin components. Within high MR signal regions near to the custom coil, MRI images with short echo time were comparable with digitized histological sections for skin structures of the epidermis, dermis and hair follicles in 6 (67%) of the nine specimens. Skin % tissue composition, measurement of the epidermis, dermis, sebaceous gland and hair follicle size, and skin NMR peaks were signatures of skin type. The image processing determined the dimensionality of skin tissue components and skin typing. The ex vivo MRI images and histopathology of the skin may be used to measure the skin structure and skin NMR peaks with image processing may be a tool for determining skin typing and skin composition.

  12. Skin age testing criteria: characterization of human skin structures by 500 MHz MRI multiple contrast and image processing

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Rakesh, E-mail: rs05h@fsu.ed [Departments of Chemical Engineering and Biomedical Engineering, FAMU-FSU College of Engineering, Tallahassee, FL 32310 (United States)

    2010-07-21

    Ex vivo magnetic resonance microimaging (MRM) image characteristics are reported in human skin samples in different age groups. Human excised skin samples were imaged using a custom coil placed inside a 500 MHz NMR imager for high-resolution microimaging. Skin MRI images were processed for characterization of different skin structures. Contiguous cross-sectional T1-weighted 3D spin echo MRI, T2-weighted 3D spin echo MRI and proton density images were compared with skin histopathology and NMR peaks. In all skin specimens, epidermis and dermis thickening and hair follicle size were measured using MRM. Optimized parameters TE and TR and multicontrast enhancement generated better MRI visibility of different skin components. Within high MR signal regions near to the custom coil, MRI images with short echo time were comparable with digitized histological sections for skin structures of the epidermis, dermis and hair follicles in 6 (67%) of the nine specimens. Skin % tissue composition, measurement of the epidermis, dermis, sebaceous gland and hair follicle size, and skin NMR peaks were signatures of skin type. The image processing determined the dimensionality of skin tissue components and skin typing. The ex vivo MRI images and histopathology of the skin may be used to measure the skin structure and skin NMR peaks with image processing may be a tool for determining skin typing and skin composition.

  13. Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

    Science.gov (United States)

    Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

    2012-10-01

    An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

  14. Multivariate Models for Prediction of Human Skin Sensitization ...

    Science.gov (United States)

    One of the lnteragency Coordinating Committee on the Validation of Alternative Method's (ICCVAM) top priorities is the development and evaluation of non-animal approaches to identify potential skin sensitizers. The complexity of biological events necessary to produce skin sensitization suggests that no single alternative method will replace the currently accepted animal tests. ICCVAM is evaluating an integrated approach to testing and assessment based on the adverse outcome pathway for skin sensitization that uses machine learning approaches to predict human skin sensitization hazard. We combined data from three in chemico or in vitro assays - the direct peptide reactivity assay (DPRA), human cell line activation test (h-CLAT) and KeratinoSens TM assay - six physicochemical properties and an in silico read-across prediction of skin sensitization hazard into 12 variable groups. The variable groups were evaluated using two machine learning approaches , logistic regression and support vector machine, to predict human skin sensitization hazard. Models were trained on 72 substances and tested on an external set of 24 substances. The six models (three logistic regression and three support vector machine) with the highest accuracy (92%) used: (1) DPRA, h-CLAT and read-across; (2) DPRA, h-CLAT, read-across and KeratinoSens; or (3) DPRA, h-CLAT, read-across, KeratinoSens and log P. The models performed better at predicting human skin sensitization hazard than the murine

  15. Reconstruction of living bilayer human skin equivalent utilizing human fibrin as a scaffold.

    Science.gov (United States)

    Mazlyzam, A L; Aminuddin, B S; Fuzina, N H; Norhayati, M M; Fauziah, O; Isa, M R; Saim, L; Ruszymah, B H I

    2007-05-01

    Our aim of this study was to develop a new methodology for constructing a bilayer human skin equivalent to create a more clinical compliance skin graft composite for the treatment of various skin defects. We utilized human plasma derived fibrin as the scaffold for the development of a living bilayer human skin equivalent: fibrin-fibroblast and fibrin-keratinocyte (B-FF/FK SE). Skin cells from six consented patients were culture-expanded to passage 1. For B-FF/FK SE formation, human fibroblasts were embedded in human fibrin matrix and subsequently another layer of human keratinocytes in human fibrin matrix was stacked on top. The B-FF/FK SE was then transplanted to athymic mice model for 4 weeks to evaluate its regeneration and clinical performance. The in vivo B-FF/FK SE has similar properties as native human skin by histological analysis and expression of basal Keratin 14 gene in the epidermal layer and Collagen type I gene in the dermal layer. Electron microscopy analysis of in vivo B-FF/FK SE showed well-formed and continuous epidermal-dermal junction. We have successfully developed a technique to engineer living bilayer human skin equivalent using human fibrin matrix. The utilization of culture-expanded human skin cells and fibrin matrix from human blood will allow a fully autologous human skin equivalent construction.

  16. Protection against UVB-induced oxidative stress in human skin cells and skin models by methionine sulfoxide reductase A.

    Science.gov (United States)

    Pelle, Edward; Maes, Daniel; Huang, Xi; Frenkel, Krystyna; Pernodet, Nadine; Yarosh, Daniel B; Zhang, Qi

    2012-01-01

    Environmental trauma to human skin can lead to oxidative damage of proteins and affect their activity and structure. When methionine becomes oxidized to its sulfoxide form, methionine sulfoxide reductase A (MSRA) reduces it back to methionine. We report here the increase in MSRA in normal human epidermal keratinocytes (NHEK) after ultraviolet B (UVB) radiation, as well as the reduction in hydrogen peroxide levels in NHEK pre-treated with MSRA after exposure. Further, when NHEK were pre-treated with a non-cytotoxic pentapeptide containing methionine sulfoxide (metSO), MSRA expression increased by 18.2%. Additionally, when the media of skin models were supplemented with the metSO pentapeptide and then exposed to UVB, a 31.1% reduction in sunburn cells was evident. We conclude that the presence of MSRA or an externally applied peptide reduces oxidative damage in NHEK and skin models and that MSRA contributes to the protection of proteins against UVB-induced damage in skin.

  17. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

  18. Quality system and audit of human skin allografts

    International Nuclear Information System (INIS)

    Van Baare, J.

    1999-01-01

    Allograft skin has long been recognised as an important resource in the management of bum wounds. The important issue in skin banking is fust to guarantee safety of human cadaveric donor skin. Second, the quality of the allografts should be assured. The Euro Skin Bank, established in 1976, is located in The Netherlands. Not only in The Netherlands, but in many other (European) countries no specific regulation exists for tissue banking. With respect to skin banking in The Netherlands the Euro Skin Bank requested the government what regulations should be applied on their activities. It was stated in 1994 that human allografl skin should be regarded as a phan-naceutical drug, a magistral preparation. The Euro Skin Bank should therefore be subjected to the guidelines given for the Good Laboraton, Practices and Good Manufacturing Practices to process allogmft skin. Nevertheless, it was in the opinion of the Euro Skin Bank that regulating human tissue as a pharmaceutical drug was not sufficient e.g. no specific regulations for serologic testing of the tissue donor is given, which should be one of the most important issues in tissue banking. Recently the government has published new legislation for tissue banks in The Netherlands: on July I st, 1998, a new legislation was enforced concerning organ and tissue donation and on November I st, 1998, quality requirements for organ and tissue banks are published. The European Community discussed the possibility to bring all animal and human tissues under the Medical Device Directive (MDD). Soon it was proposed not to incorporate viable hw-nan tissue into the MDD. Last year all human tissue was excluded from the MDD. Lack of European regulations has been resulted in national laws, e.g. in The Netherlands, Germany and France. Possibly there might be a more significant role for the European Association of Tissue Banks in the near future for European legislation on tissue banking. In order to have a standard quality system wmch is

  19. DNA damage and repair in human skin in situ

    Energy Technology Data Exchange (ETDEWEB)

    Sutherland, B.M.; Gange, R.W.; Freeman, S.E.; Sutherland, J.C.

    1987-01-01

    Understanding the molecular and cellular origins of sunlight-induced skin cancers in man requires knowledge of the damages inflicted on human skin during sunlight exposure, as well as the ability of cells in skin to repair or circumvent such damage. Although repair has been studied extensively in procaryotic and eucaryotic cells - including human cells in culture - there are important differences between repair by human skin cells in culture and human skin in situ: quantitative differences in rates of repair, as well as qualitative differences, including the presence or absence of repair mechanisms. Quantitation of DNA damage and repair in human skin required the development of new approaches for measuring damage at low levels in nanogram quantities of non-radioactive DNA. The method allows for analysis of multiple samples and the resulting data should be related to behavior of the DNA molecules by analytic expressions. Furthermore, it should be possible to assay a variety of lesions using the same methodology. The development of new analysis methods, new technology, and new biochemical probes for the study of DNA damage and repair are described. 28 refs., 4 figs.

  20. DNA damage and repair in human skin in situ

    International Nuclear Information System (INIS)

    Sutherland, B.M.; Gange, R.W.; Freeman, S.E.; Sutherland, J.C.

    1987-01-01

    Understanding the molecular and cellular origins of sunlight-induced skin cancers in man requires knowledge of the damages inflicted on human skin during sunlight exposure, as well as the ability of cells in skin to repair or circumvent such damage. Although repair has been studied extensively in procaryotic and eucaryotic cells - including human cells in culture - there are important differences between repair by human skin cells in culture and human skin in situ: quantitative differences in rates of repair, as well as qualitative differences, including the presence or absence of repair mechanisms. Quantitation of DNA damage and repair in human skin required the development of new approaches for measuring damage at low levels in nanogram quantities of non-radioactive DNA. The method allows for analysis of multiple samples and the resulting data should be related to behavior of the DNA molecules by analytic expressions. Furthermore, it should be possible to assay a variety of lesions using the same methodology. The development of new analysis methods, new technology, and new biochemical probes for the study of DNA damage and repair are described. 28 refs., 4 figs

  1. Proteome Analysis of Human Sebaceous Follicle Infundibula Extracted from Healthy and Acne-Affected Skin

    Science.gov (United States)

    Bek-Thomsen, Malene; Lomholt, Hans B.; Scavenius, Carsten; Enghild, Jan J.; Brüggemann, Holger

    2014-01-01

    Acne vulgaris is a very common disease of the pilosebaceous unit of the human skin. The pathological processes of acne are not fully understood. To gain further insight sebaceous follicular casts were extracted from 18 healthy and 20 acne-affected individuals by cyanoacrylate-gel biopsies and further processed for mass spectrometry analysis, aiming at a proteomic analysis of the sebaceous follicular casts. Human as well as bacterial proteins were identified. Human proteins enriched in acne and normal samples were detected, respectively. Normal follicular casts are enriched in proteins such as prohibitins and peroxiredoxins which are involved in the protection from various stresses, including reactive oxygen species. By contrast, follicular casts extracted from acne-affected skin contained proteins involved in inflammation, wound healing and tissue remodeling. Among the most distinguishing proteins were myeloperoxidase, lactotransferrin, neutrophil elastase inhibitor and surprisingly, vimentin. The most significant biological process among all acne-enriched proteins was ‘response to a bacterium’. Identified bacterial proteins were exclusively from Propionibacterium acnes. The most abundant P. acnes proteins were surface-exposed dermatan sulphate adhesins, CAMP factors, and a so far uncharacterized lipase in follicular casts extracted from normal as well as acne-affected skin. This is a first proteomic study that identified human proteins together with proteins of the skin microbiota in sebaceous follicular casts. PMID:25238151

  2. Gamma-ray excision repair in normal and diseased human cells

    International Nuclear Information System (INIS)

    Cerutti, P.A.; Remsen, J.F.

    1976-01-01

    Radiation products of the 5,6-dihydroxy-dihydrothymine type (t') are efficiently removed from the DNA during postirradiation incubation of bacterial and mammalian cells. In this chapter we describe the t'-excision system contained in normal human cells, in human carcinoma HeLa S-3 cells, and in skin fibroblasts from xeroderma pigmentosum (XP) and Fanconi's anemia (FA) patients. The latter diseases are characterized among other symptoms by a genetically increased susceptibility for the development of cancer

  3. Effect of dioxin on normal and leukemic human hematopoietic cells

    Energy Technology Data Exchange (ETDEWEB)

    Lambertenghi-Deliliers, G.; Soligo, D. [Univ. degli Studi, Milan (Italy). Dipt. die Ematologia, Ospedale Maggiore Policlinico IRCCS; Fracchiolla, N.S. [Ospedale Maggiore Policlinico IRCCS, Milan (Italy). Dipt. di Ematologia; Servida, F. [Fondazione Matarelli, Milan (Italy); Bertazzi, P.A. [Istituti Clinici di Perfezionamento, Milan (Italy). Dipt. di Medicina del Lavoro

    2004-09-15

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) arises from chlorination of phenolic substrates or from partial combustion of organic materials in the presence of chlorine sources. TCDD has a large number of biological effects such as long-lasting skin disease, cardiovascular disease, diabete and cancer. TCDD is the prototypical agonist of the aryl hydrocarbon receptor (AhR), a member of the erb-A family that also includes the receptors for steroids, thyroid hormones, peroxisome proliferators and retinoids. When bound to dioxin, the AhR can bind to DNA and alter the expression of some genes including cytokines and growth factors. In this study, we analyzed the effect of escalating doses of TCDD on human CD34{sup +} progenitor cells from the leukapheresis of normal donors stimulated with G-CSF as well as the human myeloid leukemic cell lines HL60 (promyelocytic leukemia) and K562 (chronic myelogenous leukemia). The possible specific modulation of gene expression induced by the TCDD exposure was then tested by means of microarray analyses.

  4. Xenobiotic-metabolizing enzymes in the skin of rat, mouse, pig, guinea pig, man, and in human skin models.

    Science.gov (United States)

    Oesch, F; Fabian, E; Guth, K; Landsiedel, R

    2014-12-01

    The exposure of the skin to medical drugs, skin care products, cosmetics, and other chemicals renders information on xenobiotic-metabolizing enzymes (XME) in the skin highly interesting. Since the use of freshly excised human skin for experimental investigations meets with ethical and practical limitations, information on XME in models comes in the focus including non-human mammalian species and in vitro skin models. This review attempts to summarize the information available in the open scientific literature on XME in the skin of human, rat, mouse, guinea pig, and pig as well as human primary skin cells, human cell lines, and reconstructed human skin models. The most salient outcome is that much more research on cutaneous XME is needed for solid metabolism-dependent efficacy and safety predictions, and the cutaneous metabolism comparisons have to be viewed with caution. Keeping this fully in mind at least with respect to some cutaneous XME, some models may tentatively be considered to approximate reasonable closeness to human skin. For dermal absorption and for skin irritation among many contributing XME, esterase activity is of special importance, which in pig skin, some human cell lines, and reconstructed skin models appears reasonably close to human skin. With respect to genotoxicity and sensitization, activating XME are not yet judgeable, but reactive metabolite-reducing XME in primary human keratinocytes and several reconstructed human skin models appear reasonably close to human skin. For a more detailed delineation and discussion of the severe limitations see the "Overview and Conclusions" section in the end of this review.

  5. Development of human skin equivalents mimicking skin aging : contrast between papillary and reticular fibroblasts as a lead

    NARCIS (Netherlands)

    Janson, D.

    2017-01-01

    This thesis describes the development of human skin equivalents that show characteristics of skin aging. The type of skin equivalent used was a fibroblast derived matrix equivalent, in which the dermal compartment is generated by fibroblasts and thus is fully of human origin. Two strategies are

  6. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  7. In-vitro percutaneous absorption of losartan potassium in human skin and prediction of human skin permeability

    Directory of Open Access Journals (Sweden)

    Petkar K.C.

    2007-05-01

    Full Text Available This study describes the feasibility of transdermal controlled administration of Losartan potassium (LP across human cadaver skin. Study also defines the influence of capsaicin, sex and site of application on permeation characteristics and determined an appropriate animal model for human skin permeability. The permeation of LP of various formulations was studied using Keshary-Chein diffusion cell. Optimized controlled formulation (without capsaicin released 42.17% (±1.85 of LP in 12 hr whereas treatment formulation (with capsaicin 0.028 % w/v released 48.94% (±1.71 of LP with significant difference on null hypothesis. Influence of sex showed statistically significant difference for permeation of LP through male and female rats, as well as male and female mice across both the abdominal and dorsal sides of the skin (p<0.05. Similarly statistically significant differences were noted for permeation of LP across male and female mice abdomen-dorsal, but not for male rat abdomen-dorsal and female rat abdomen-dorsal. Furthermore, in-vitro permeation of LP across human skin was compared with the permeation across rat and mice skins. Male rat and male mice dorsal skin was found to have closer permeability characteristics to human than other skin membranes, but the Factor of Difference values were < 3 for all membranes which were used suggesting the membranes are good models for human skin permeability. In conclusion simple transdermal adhesive patches formulations incorporating high molecular weight of LP can deliver a dose in-vivo and proposed model skin membranes can be utilized for future pharmacokineic and toxicokinetic studies as well as metabolism studies of LP

  8. Mechanical response of human female breast skin under uniaxial stretching.

    Science.gov (United States)

    Kumaraswamy, N; Khatam, Hamed; Reece, Gregory P; Fingeret, Michelle C; Markey, Mia K; Ravi-Chandar, Krishnaswamy

    2017-10-01

    Skin is a complex material covering the entire surface of the human body. Studying the mechanical properties of skin to calibrate a constitutive model is of great importance to many applications such as plastic or cosmetic surgery and treatment of skin-based diseases like decubitus ulcers. The main objective of the present study was to identify and calibrate an appropriate material constitutive model for skin and establish certain universal properties that are independent of patient-specific variability. We performed uniaxial tests performed on breast skin specimens freshly harvested during mastectomy. Two different constitutive models - one phenomenological and another microstructurally inspired - were used to interpret the mechanical responses observed in the experiments. Remarkably, we found that the model parameters that characterize dependence on previous maximum stretch (or preconditioning) exhibited specimen-independent universal behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Human Skin 3D Bioprinting Using Scaffold-Free Approach.

    Science.gov (United States)

    Pourchet, Léa J; Thepot, Amélie; Albouy, Marion; Courtial, Edwin J; Boher, Aurélie; Blum, Loïc J; Marquette, Christophe A

    2017-02-01

    Organ in vitro synthesis is one of the last bottlenecks between tissue engineering and transplantation of synthetic organs. Bioprinting has proven its capacity to produce 3D objects composed of living cells but highly organized tissues such as full thickness skin (dermis + epidermis) are rarely attained. The focus of the present study is to demonstrate the capability of a newly developed ink formulation and the use of an open source printer, for the production of a really complete skin model. Proofs are given through immunostaining and electronic microscopy that the bioprinted skin presents all characteristics of human skin, both at the molecular and macromolecular level. Finally, the printability of large skin objects is demonstrated with the printing of an adult-size ear. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. A methodology for extracting the electrical properties of human skin

    International Nuclear Information System (INIS)

    Birgersson, Ulrik; Nicander, Ingrid; Ollmar, Stig; Birgersson, Erik

    2013-01-01

    A methodology to determine dielectrical properties of human skin is presented and analyzed. In short, it is based on a mathematical model that considers the local transport of charge in the various layers of the skin, which is coupled with impedance measurements of both stripped and intact skin, an automated code generator, and an optimization algorithm. New resistivity and permittivity values for the stratum corneum soaked with physiological saline solution for 1 min and the viable skin beneath are obtained and expressed as easily accessible functions. The methodology can be extended to account for different electrode designs as well as more physical phenomena that are relevant to electrical impedance measurements of skin and their interpretation. (paper)

  11. Measurement of interstitial cetirizine concentrations in human skin

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Church, M K; Rihoux, J P

    1999-01-01

    BACKGROUND: The purpose of the present study was to measure the concentrations of cetirizine in the extracellular water compartment in intact human skin and assess simultaneously inhibition of histamine-induced wheal and flare reactions. METHODS: Skin cetirizine levels were collected...... by the microdialysis technique and analyzed by high-pressure liquid chromatography with mass spectrometry detection. Skin levels in 20 subjects were compared to plasma levels for 4 h after a single oral dose of 10 or 20 mg of cetirizine. Skin prick tests were performed with histamine 100 mg/ml. RESULTS: Plasma...... cetirizine levels increased within 30 min to reach peak values of 315+/-10 and 786+/-45 ng/ml 90-120 min after administration of 10 and 20 mg of cetirizine. This was followed by a slow decline. In the skin, dialysate cetirizine levels (non-protein-bound fraction only) peaked at 1.6+/-0.1 and 2.4+/-0.3 ng...

  12. Multivariate Models for Prediction of Human Skin Sensitization Hazard

    Science.gov (United States)

    Strickland, Judy; Zang, Qingda; Paris, Michael; Lehmann, David M.; Allen, David; Choksi, Neepa; Matheson, Joanna; Jacobs, Abigail; Casey, Warren; Kleinstreuer, Nicole

    2016-01-01

    One of ICCVAM’s top priorities is the development and evaluation of non-animal approaches to identify potential skin sensitizers. The complexity of biological events necessary to produce skin sensitization suggests that no single alternative method will replace the currently accepted animal tests. ICCVAM is evaluating an integrated approach to testing and assessment based on the adverse outcome pathway for skin sensitization that uses machine learning approaches to predict human skin sensitization hazard. We combined data from three in chemico or in vitro assays—the direct peptide reactivity assay (DPRA), human cell line activation test (h-CLAT), and KeratinoSens™ assay—six physicochemical properties, and an in silico read-across prediction of skin sensitization hazard into 12 variable groups. The variable groups were evaluated using two machine learning approaches, logistic regression (LR) and support vector machine (SVM), to predict human skin sensitization hazard. Models were trained on 72 substances and tested on an external set of 24 substances. The six models (three LR and three SVM) with the highest accuracy (92%) used: (1) DPRA, h-CLAT, and read-across; (2) DPRA, h-CLAT, read-across, and KeratinoSens; or (3) DPRA, h-CLAT, read-across, KeratinoSens, and log P. The models performed better at predicting human skin sensitization hazard than the murine local lymph node assay (accuracy = 88%), any of the alternative methods alone (accuracy = 63–79%), or test batteries combining data from the individual methods (accuracy = 75%). These results suggest that computational methods are promising tools to effectively identify potential human skin sensitizers without animal testing. PMID:27480324

  13. Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer

    International Nuclear Information System (INIS)

    Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen

    2001-01-01

    Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts

  14. QSAR models of human data can enrich or replace LLNA testing for human skin sensitization

    OpenAIRE

    Alves, Vinicius M.; Capuzzi, Stephen J.; Muratov, Eugene; Braga, Rodolpho C.; Thornton, Thomas; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander

    2016-01-01

    Skin sensitization is a major environmental and occupational health hazard. Although many chemicals have been evaluated in humans, there have been no efforts to model these data to date. We have compiled, curated, analyzed, and compared the available human and LLNA data. Using these data, we have developed reliable computational models and applied them for virtual screening of chemical libraries to identify putative skin sensitizers. The overall concordance between murine LLNA and human skin ...

  15. [VISIBLE LIGHT AND HUMAN SKIN (REVIEW)].

    Science.gov (United States)

    Tsibadze, A; Chikvaidze, E; Katsitadze, A; Kvachadze, I; Tskhvediani, N; Chikviladze, A

    2015-09-01

    Biological effect of a visible light depends on extend of its property to penetrate into the tissues: the greater is a wavelength the more is an effect of a radiation. An impact of a visible light on the skin is evident by wave and quantum effects. Quanta of a visible radiation carry more energy than infrared radiation, although an influence of such radiation on the skin is produced by the light spectrum on the boarder of the ultraviolet and the infrared rays and is manifested by thermal and chemical effects. It is determined that large doses of a visible light (405-436 nm) can cause skin erythema. At this time, the ratio of generation of free radicals in the skin during an exposure to the ultraviolet and the visible light range from 67-33% respectively. Visible rays of 400-500 nm length of wave cause an increase of the concentration of oxygen's active form and mutation of DNA and proteins in the skin. The urticaria in 4-18% of young people induced by photodermatosis is described. As a result of a direct exposure to sunlight photosensitive eczema is more common in elderly. Special place holds a hereditary disease - porphyria, caused by a visible light. In recent years, dermatologists widely use phototherapy. The method uses polychromatic, non-coherent (wavelength of 515-1200 nm) pulsating beam. During phototherapy/light treatment a patient is being exposed to sunlight or bright artificial light. Sources of visible light are lasers, LEDs and fluorescent lamps which have the full range of a visible light. Phototherapy is used in the treatment of acne vulgaris, seasonal affective disorders, depression, psoriasis, eczema and neurodermities. LED of the red and near infrared range also is characterized by the therapeutic effect. They have an ability to influence cromatophores and enhance ATP synthesis in mitochondria. To speed up the healing of wounds and stimulate hair growth light sources of a weak intensity are used. The light of blue-green spectrum is widely used for

  16. Microneedle Enhanced Delivery of Cosmeceutically Relevant Peptides in Human Skin

    Science.gov (United States)

    Mohammed, Yousuf H.; Yamada, Miko; Lin, Lynlee L.; Grice, Jeffrey E.; Roberts, Michael S.; Raphael, Anthony P.; Benson, Heather A. E.; Prow, Tarl W.

    2014-01-01

    Peptides and proteins play an important role in skin health and well-being. They are also found to contribute to skin aging and melanogenesis. Microneedles have been shown to substantially enhance skin penetration and may offer an effective means of peptide delivery enhancement. The aim of this investigation was to assess the influence of microneedles on the skin penetration of peptides using fluorescence imaging to determine skin distribution. In particular the effect of peptide chain length (3, 4, 5 amino acid chain length) on passive and MN facilitated skin penetration was investigated. Confocal laser scanning microscopy was used to image fluorescence intensity and the area of penetration of fluorescently tagged peptides. Penetration studies were conducted on excised full thickness human skin in Franz type diffusion cells for 1 and 24 hours. A 2 to 22 fold signal improvement in microneedle enhanced delivery of melanostatin, rigin and pal-KTTKS was observed. To our knowledge this is the first description of microneedle enhanced skin permeation studies on these peptides. PMID:25033398

  17. Microneedle enhanced delivery of cosmeceutically relevant peptides in human skin.

    Directory of Open Access Journals (Sweden)

    Yousuf H Mohammed

    Full Text Available Peptides and proteins play an important role in skin health and well-being. They are also found to contribute to skin aging and melanogenesis. Microneedles have been shown to substantially enhance skin penetration and may offer an effective means of peptide delivery enhancement. The aim of this investigation was to assess the influence of microneedles on the skin penetration of peptides using fluorescence imaging to determine skin distribution. In particular the effect of peptide chain length (3, 4, 5 amino acid chain length on passive and MN facilitated skin penetration was investigated. Confocal laser scanning microscopy was used to image fluorescence intensity and the area of penetration of fluorescently tagged peptides. Penetration studies were conducted on excised full thickness human skin in Franz type diffusion cells for 1 and 24 hours. A 2 to 22 fold signal improvement in microneedle enhanced delivery of melanostatin, rigin and pal-KTTKS was observed. To our knowledge this is the first description of microneedle enhanced skin permeation studies on these peptides.

  18. Friction of Human Skin against Different Fabrics for Medical Use

    Directory of Open Access Journals (Sweden)

    Luís Vilhena

    2016-03-01

    Full Text Available Knowledge of the tribology of human skin is essential to improve and optimize surfaces and materials in contact with the skin. Besides that, friction between the human skin and textiles is a critical factor in the formation of skin injuries, which are caused if the loads and shear forces are high enough and/or over long periods of time. This factor is of particular importance in bedridden patients, since they are not moving about or are confined to wheelchairs. Decubitus ulcers are one of the most frequently-reported iatrogenic injuries in developed countries. The risk of developing decubitus ulcers can be predicted by using the “Braden Scale for Predicting Pressure Ulcer Risk” that was developed in 1987 and contains six areas of risk (cognitive-perceptual, immobility, inactivity, moisture, nutrition, friction/shear, although there are limitations to the use of such tools. The coefficient of friction of textiles against skin is mainly influenced by: the nature of the textile, skin moisture content and ambient humidity. This study will investigate how skin friction (different anatomical regions varies, rubbing against different types of contacting materials (i.e., fabrics for medical use under different contact conditions and their relationship in the formation and prevention of decubitus ulcers.

  19. Skin Blood Perfusion and Oxygenation Colour Affect Perceived Human Health

    Science.gov (United States)

    Stephen, Ian D.; Coetzee, Vinet; Law Smith, Miriam; Perrett, David I.

    2009-01-01

    Skin blood perfusion and oxygenation depends upon cardiovascular, hormonal and circulatory health in humans and provides socio-sexual signals of underlying physiology, dominance and reproductive status in some primates. We allowed participants to manipulate colour calibrated facial photographs along empirically-measured oxygenated and deoxygenated blood colour axes both separately and simultaneously, to optimise healthy appearance. Participants increased skin blood colour, particularly oxygenated, above basal levels to optimise healthy appearance. We show, therefore, that skin blood perfusion and oxygenation influence perceived health in a way that may be important to mate choice. PMID:19337378

  20. Characterization of innate lymphoid cells in human skin and blood demonstrates increase of NKp44+ ILC3 in psoriasis.

    Science.gov (United States)

    Villanova, Federica; Flutter, Barry; Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O

    2014-04-01

    Innate lymphoid cells (ILCs) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterize the ILCs in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in the skin and blood of normal individuals and psoriasis patients are CD3-negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in the blood of psoriasis patients compared with healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen, indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILCs in the skin compared with blood. Moreover, the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared with normal skin. A detailed time course of a psoriasis patient treated with anti-tumor necrosis factor showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis.

  1. Characterization of innate lymphoid cells (ILC) in human skin and blood demonstrates increase of NKp44+ ILC3 in psoriasis

    Science.gov (United States)

    Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O

    2013-01-01

    Innate lymphoid cells (ILC) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterise the ILC in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in skin and blood of normal individuals and psoriasis patients are CD3 negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in blood of psoriasis patients compared to healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILC in skin compared to blood. Moreover the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared to normal skin. A detailed time course of a psoriasis patient treated with anti-TNF showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis. PMID:24352038

  2. Comparison of skin decontamination efficacy of commercial decontamination products following exposure to VX on human skin.

    Science.gov (United States)

    Thors, L; Koch, M; Wigenstam, E; Koch, B; Hägglund, L; Bucht, A

    2017-08-01

    The decontamination efficacy of four commercially available skin decontamination products following exposure to the nerve agent VX was evaluated in vitro utilizing a diffusion cell and dermatomed human skin. The products included were Reactive Skin Decontamination Lotion (RSDL), the Swedish decontamination powder 104 (PS104), the absorbent Fuller's Earth and the aqueous solution alldecontMED. In addition, various decontamination procedures were assessed to further investigate important mechanisms involved in the specific products, e.g. decontamination removal from skin, physical removal by sponge swabbing and activation of degradation mechanisms. The efficacy of each decontamination product was evaluated 5 or 30 min after dermal application of VX (neat or diluted to 20% in water). The RSDL-lotion was superior in reducing the penetration of VX through human skin, both when exposed as neat agent and when diluted to 20% in water. Swabbing with the RSDL-sponge during 2 min revealed decreased efficacy compared to applying the RSDL-lotion directly on the skin for 30 min. Decontamination with Fuller's Earth and alldecontMED significantly reduced the penetration of neat concentration of VX through human skin. PS104-powder was insufficient for decontamination of VX at both time-points, independently of the skin contact time of PS104. The PS104-slurry (a mixture of PS104-powder and water), slightly improved the decontamination efficacy. Comparing the time-points for initiated decontamination revealed less penetrated VX for RSDL and Fuller's Earth when decontamination was initiated after 5 min compared to 30 min post-exposure, while alldecontMED displayed similar efficacy at both time-points. Decontamination by washing with water only resulted in a significant reduction of penetrated VX when washing was performed 5 min after exposure, but not when decontamination was delayed to 30 min post-exposure of neat VX. In conclusion, early initiated decontamination with the

  3. A novel model of human skin pressure ulcers in mice.

    Directory of Open Access Journals (Sweden)

    Andrés A Maldonado

    Full Text Available INTRODUCTION: Pressure ulcers are a prevalent health problem in today's society. The shortage of suitable animal models limits our understanding and our ability to develop new therapies. This study aims to report on the development of a novel and reproducible human skin pressure ulcer model in mice. MATERIAL AND METHODS: Male non-obese, diabetic, severe combined immunodeficiency mice (n = 22 were engrafted with human skin. A full-thickness skin graft was placed onto 4×3 cm wounds created on the dorsal skin of the mice. Two groups with permanent grafts were studied after 60 days. The control group (n = 6 was focused on the process of engraftment. Evaluations were conducted with photographic assessment, histological analysis and fluorescence in situ hybridization (FISH techniques. The pressure ulcer group (n = 12 was created using a compression device. A pressure of 150 mmHg for 8 h, with a total of three cycles of compression-release was exerted. Evaluations were conducted with photographic assessment and histological analysis. RESULTS: Skin grafts in the control group took successfully, as shown by visual assessment, FISH techniques and histological analysis. Pressure ulcers in the second group showed full-thickness skin loss with damage and necrosis of all the epidermal and dermal layers (ulcer stage III in all cases. Complete repair occurred after 40 days. CONCLUSIONS: An inexpensive, reproducible human skin pressure ulcer model has been developed. This novel model will facilitate the development of new clinically relevant therapeutic strategies that can be tested directly on human skin.

  4. Contrasting effects of ultraviolet-A and ultraviolet B exposure on induction of contact sensitivity in human skin

    DEFF Research Database (Denmark)

    Skov, Lone; Hansen, Henrik; Barker, J. N.

    1997-01-01

    Ultraviolet-B (UVB), in addition to direct effects on DNA, induces immunological changes in the skin that predispose to the development of skin cancer. Whether ultraviolet-A (UVA) induces similar changes is unknown. This effect can be investigated in humans in vivo using epicutaneous antigens...... as a model of tumour antigens. Volunteers (n = 46) were randomly assigned to received no sensitization, sensitization with the allergen diphenylcyclopropenone (DPCP) on non-UV-exposed normal skin, or sensitization with DPCP on skin exposed to three minimal erythema doses (MED) of either UVA or UVB radiation...... the immunization rate compared with sensitization on non-irradiated skin (P UVA radiation did not result in a decreased immunization rate compared with non-irradiated skin. These results indicate that in humans erythemagenic...

  5. Human skin wetness perception: psychophysical and neurophysiological bases

    Science.gov (United States)

    Filingeri, Davide; Havenith, George

    2015-01-01

    The ability to perceive thermal changes in the surrounding environment is critical for survival. However, sensing temperature is not the only factor among the cutaneous sensations to contribute to thermoregulatory responses in humans. Sensing skin wetness (i.e. hygrosensation) is also critical both for behavioral and autonomic adaptations. Although much has been done to define the biophysical role of skin wetness in contributing to thermal homeostasis, little is known on the neurophysiological mechanisms underpinning the ability to sense skin wetness. Humans are not provided with skin humidity receptors (i.e., hygroreceptors) and psychophysical studies have identified potential sensory cues (i.e. thermal and mechanosensory) which could contribute to sensing wetness. Recently, a neurophysiological model of human wetness sensitivity has been developed. In helping clarifying the peripheral and central neural mechanisms involved in sensing skin wetness, this model has provided evidence for the existence of a specific human hygrosensation strategy, which is underpinned by perceptual learning via sensory experience. Remarkably, this strategy seems to be shared by other hygroreceptor-lacking animals. However, questions remain on whether these sensory mechanisms are underpinned by specific neuromolecular pathways in humans. Although the first study on human wetness perception dates back to more than 100 years, it is surprising that the neurophysiological bases of such an important sensory feature have only recently started to be unveiled. Hence, to provide an overview of the current knowledge on human hygrosensation, along with potential directions for future research, this review will examine the psychophysical and neurophysiological bases of human skin wetness perception. PMID:27227008

  6. Xenobiotica-metabolizing enzymes in the skin of rat, mouse, pig, guinea pig, man, and in human skin models.

    Science.gov (United States)

    Oesch, F; Fabian, E; Landsiedel, Robert

    2018-06-18

    Studies on the metabolic fate of medical drugs, skin care products, cosmetics and other chemicals intentionally or accidently applied to the human skin have become increasingly important in order to ascertain pharmacological effectiveness and to avoid toxicities. The use of freshly excised human skin for experimental investigations meets with ethical and practical limitations. Hence information on xenobiotic-metabolizing enzymes (XME) in the experimental systems available for pertinent studies compared with native human skin has become crucial. This review collects available information of which-taken with great caution because of the still very limited data-the most salient points are: in the skin of all animal species and skin-derived in vitro systems considered in this review cytochrome P450 (CYP)-dependent monooxygenase activities (largely responsible for initiating xenobiotica metabolism in the organ which provides most of the xenobiotica metabolism of the mammalian organism, the liver) are very low to undetectable. Quite likely other oxidative enzymes [e.g. flavin monooxygenase, COX (cooxidation by prostaglandin synthase)] will turn out to be much more important for the oxidative xenobiotic metabolism in the skin. Moreover, conjugating enzyme activities such as glutathione transferases and glucuronosyltransferases are much higher than the oxidative CYP activities. Since these conjugating enzymes are predominantly detoxifying, the skin appears to be predominantly protected against CYP-generated reactive metabolites. The following recommendations for the use of experimental animal species or human skin in vitro models may tentatively be derived from the information available to date: for dermal absorption and for skin irritation esterase activity is of special importance which in pig skin, some human cell lines and reconstructed skin models appears reasonably close to native human skin. With respect to genotoxicity and sensitization reactive

  7. Effects of external pressure loading on human skin blood flow measured by 133Xe clearance

    International Nuclear Information System (INIS)

    Holloway, G.A. Jr.; Daly, C.H.; Kennedy, D.; Chimoskey, J.

    1976-01-01

    Forearm skin blood flow was measured during external pressure loading in normal human subjects using 133 Xe washout from intracutaneous injection sites. Pressures ranging between 5 and 150 mmHg were applied through a 3-cm-diameter disc placed over the site of flow determination. The pressure was maintained constant by a servo-controlled loading mechanism. Flow decreased with pressures from 5 to 10 and 30 to 150 mmHg, but remained constant with pressures from 10 to 30 mmHg. Reactive hyperemia occurred following removal of pressures of 90 mmHg or greater, but did not occur following removal of lower pressures. The pressure-flow curve for parasacral skin of paraplegic subjects closely paralleled the pressure-flow curve of normal skin at pressures tested: 5 to 15 mmHg. These data are interpreted to demonstrate autoregulation of skin blood flow. Autoregulation in parasacral skin of paraplegic subjects suggests a peripheral mechanism. The occurrence of hyperemia at pressures which exceed the ability of skin to autoregulate suggests that both autoregulation and post occlusion hyperemia may have the same mechanism

  8. Antimicrobials from human skin commensal bacteria protect against Staphylococcus aureus and are deficient in atopic dermatitis

    Science.gov (United States)

    Nakatsuji, Teruaki; Chen, Tiffany H.; Narala, Saisindhu; Chun, Kimberly A.; Two, Aimee M.; Yun, Tong; Shafiq, Faiza; Kotol, Paul F.; Bouslimani, Amina; Melnik, Alexey V.; Latif, Haythem; Kim, Ji-Nu; Lockhart, Alexandre; Artis, Keli; David, Gloria; Taylor, Patricia; Streib, Joanne; Dorrestein, Pieter C.; Grier, Alex; Gill, Steven R.; Zengler, Karsten; Hata, Tissa R.; Leung, Donald Y. M.; Gallo, Richard L.

    2017-01-01

    The microbiome can promote or disrupt human health by influencing both adaptive and innate immune functions. We tested whether bacteria that normally reside on human skin participate in host defense by killing Staphylococcus aureus, a pathogen commonly found in patients with atopic dermatitis (AD) and an important factor that exacerbates this disease. High-throughput screening for antimicrobial activity against S.aureus was performed on isolates of coagulase-negative Staphylococcus (CoNS) collected from the skin of healthy and AD subjects. CoNS strains with antimicrobial activity were common on the normal population but rare on AD subjects. A low frequency of strains with antimicrobial activity correlated with colonization by S.aureus. The antimicrobial activity was identified as previously unknown antimicrobial peptides (AMPs) produced by CoNS species including Staphylococcus epidermidis and Staphylococcus hominis. These AMPs were strain-specific, highly potent, selectively killed S.aureus, and synergized with the human AMP LL-37. Application of these CoNS strains to mice confirmed their defense function in vivo relative to application of nonactive strains. Strikingly, reintroduction of antimicrobial CoNS strains to human subjects with AD decreased colonization by S.aureus. These findings show how commensal skin bacteria protect against pathogens and demonstrate how dysbiosis of the skin microbiome can lead to disease. PMID:28228596

  9. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  10. Morphological evaluation of normal human corneal epithelium

    DEFF Research Database (Denmark)

    Ehlers, Niels; Heegaard, Steffen; Hjortdal, Jesper

    2010-01-01

    of corneas from 100 consecutively selected paraffin-embedded eyes were stained with hematoxylin-eosin and Periodic Acid-Schiff (PAS). All specimens were evaluated by light microscopy. The eyes were enucleated from patients with choroidal melanoma. Corneas were considered to be normal. RESULTS: Ninety of 100...

  11. Composition of human skin microbiota affects attractiveness to malaria mosquitoes.

    Directory of Open Access Journals (Sweden)

    Niels O Verhulst

    Full Text Available The African malaria mosquito Anopheles gambiae sensu stricto continues to play an important role in malaria transmission, which is aggravated by its high degree of anthropophily, making it among the foremost vectors of this disease. In the current study we set out to unravel the strong association between this mosquito species and human beings, as it is determined by odorant cues derived from the human skin. Microbial communities on the skin play key roles in the production of human body odour. We demonstrate that the composition of the skin microbiota affects the degree of attractiveness of human beings to this mosquito species. Bacterial plate counts and 16S rRNA sequencing revealed that individuals that are highly attractive to An. gambiae s.s. have a significantly higher abundance, but lower diversity of bacteria on their skin than individuals that are poorly attractive. Bacterial genera that are correlated with the relative degree of attractiveness to mosquitoes were identified. The discovery of the connection between skin microbial populations and attractiveness to mosquitoes may lead to the development of new mosquito attractants and personalized methods for protection against vectors of malaria and other infectious diseases.

  12. Percutaneous penetration of 2-phenoxyethanol through rat and human skin.

    Science.gov (United States)

    Roper, C S; Howes, D; Blain, P G; Williams, F M

    1997-01-01

    2-Phenoxyethanol applied in methanol was absorbed (64 +/- 4.4% at 24 hr) through unoccluded rat skin in vitro in the static diffusion cell with ethanol/water as receptor fluid. By comparison (43 +/- 3.7% in 24 hr) was absorbed in the flow-through diffusion system with tissue culture medium as receptor fluid. 2-Phenoxyethanol applied in methanol was absorbed (59.3 +/- 7.0% at 6 hr) through unoccluded human skin in vitro in the flow-through diffusion cell with tissue culture medium. With both unoccluded cells, 2-phenoxyethanol was lost by evaporation but occlusion of the static cell reduced evaporation and increased total absorption to 98.8 +/- 7.0%. Skin, post mitochondrial fraction, metabolized phenoxyethanol to phenoxyacetic acid at 5% of the rate for liver. Metabolism was inhibited by 1 mM pyrazole, suggesting involvement of alcohol dehydrogenase. However, first-pass metabolism of phenoxyethanol to phenoxyacetic acid was not detected during percutaneous penetration through viable rat skin in the flow-through system. First-pass metabolism in the skin does not therefore have an influence on systemic availability of dermally absorbed phenoxyethanol. These measures of phenoxyethanol absorption through rat and human skin in vitro agree well with those obtained previously in vivo.

  13. Color enhancement in multispectral image of human skin

    Science.gov (United States)

    Mitsui, Masanori; Murakami, Yuri; Obi, Takashi; Yamaguchi, Masahiro; Ohyama, Nagaaki

    2003-07-01

    Multispectral imaging is receiving attention in medical color imaging, as high-fidelity color information can be acquired by the multispectral image capturing. On the other hand, as color enhancement in medical color image is effective for distinguishing lesion from normal part, we apply a new technique for color enhancement using multispectral image to enhance the features contained in a certain spectral band, without changing the average color distribution of original image. In this method, to keep the average color distribution, KL transform is applied to spectral data, and only high-order KL coefficients are amplified in the enhancement. Multispectral images of human skin of bruised arm are captured by 16-band multispectral camera, and the proposed color enhancement is applied. The resultant images are compared with the color images reproduced assuming CIE D65 illuminant (obtained by natural color reproduction technique). As a result, the proposed technique successfully visualizes unclear bruised lesions, which are almost invisible in natural color images. The proposed technique will provide support tool for the diagnosis in dermatology, visual examination in internal medicine, nursing care for preventing bedsore, and so on.

  14. Low power cw-laser signatures on human skin

    International Nuclear Information System (INIS)

    Lihachev, A; Lesinsh, J; Jakovels, D; Spigulis, J

    2011-01-01

    Impact of cw laser radiation on autofluorescence features of human skin is studied. Two methods of autofluorescence detection are applied: the spectral method with the use of a fibreoptic probe and spectrometer for determining the autofluorescence recovery kinetics at a fixed skin area of ∼12 mm 2 , and the multispectral visualisation method with the use of a multispectral imaging camera for visualising long-term autofluorescence changes in a skin area of ∼4 cm 2 . The autofluorescence recovery kinetics after preliminary laser irradiation is determined. Skin autofluorescence images with visible long-term changes - 'signatures' of low power laser treatment are acquired. (application of lasers and laser-optical methods in life sciences)

  15. Redox proteomic evaluation of oxidative modification and recovery in a 3D reconstituted human skin tissue model exposed to UVB.

    Science.gov (United States)

    Dyer, J M; Haines, S R; Thomas, A; Wang, W; Walls, R J; Clerens, S; Harland, D P

    2017-04-01

    Exposure to UV in humans resulting in sunburn triggers a complex series of events that are a mix of immediate and delayed damage mediation and healing. While studies on the effects of UV exposure on DNA damage and repair have been reported, changes in the oxidative modification of skin proteins are poorly understood at the molecular level, despite the important role played by structural proteins in skin tissue, and the effect of the integrity of these proteins on skin appearance and health. Proteomic molecular mapping of oxidation was here applied to try to enhance understanding of skin damage and recovery from oxidative damage and UVB exposure. A redox proteomic-based approach was applied to evaluating skin protein modification when exposed to varying doses of UVB after initial oxidative stress, via tracking changes in protein oxidation during the healing process in vitro using a full-thickness reconstituted human skin tissue model. Bioassays and structural evaluation confirmed that our cultured skin tissues underwent a normal physiological response to UVB exposure. A set of potential skin marker peptides was generated, for use in tracking skin protein oxidative modification. Exposure to UVB after thermal oxidative stress was found to result in higher levels of skin protein oxidation than a non-irradiated control for up to seven days after exposure. Recovery of the skin proteins from oxidative stress, as assessed by the overall protein oxidation levels, was found to be impaired by UVB exposure. Oxidative modification was largely observed in skin structural proteins. Exposure of skin proteins to UVB exacerbates oxidative damage to structural skin proteins, with higher exposure levels leading to increasingly impaired recovery from this damage. This has potential implications for the functional performance of the proteins and inter-related skin health and cosmetic appearance. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  16. Characterization of ionizing radiation effects on human skin allografts

    International Nuclear Information System (INIS)

    Bourroul, Selma Cecilia

    2004-01-01

    The skin has a fundamental role in the viability of the human body. In the cases of extensive wounds, allograft skin provides an alternative to cover temporarily the damaged areas. After donor screening and preservation in glycerol (above 85%), the skin can be stored in the Skin Banks. The glycerol at this concentration has a bacteriostatic effect after certain time of preservation. On the other hand, skin sterilization by ionizing radiation may reduces the quarantine period for transplantation in patients and its safety is considered excellent. The objectives of this work were to establish procedures using two sources of ionizing radiation for sterilization of human skin allograft, and to evaluate the skin after gamma and electron beam irradiation. The analysis of stress-strain intended to verify possible effects of the radiation on the structure of preserved grafts. Skin samples were submitted to doses of 25 kGy and 50 kGy in an irradiator of 60 Co and in an electron beam accelerator. Morphology and ultra-structure studies were also accomplished. The samples irradiated with a dose of 25 kGy seemed to maintain the bio mechanic characteristics. The gamma irradiated samples with a dose of 50 kGy and submitted to an electron beam at doses of 25 kGy and 50 kGy presented significant differences in the values of the elasticity modulus, in relation to the control. The analysis of the ultramicrographies revealed modifications in the structure and alterations in the pattern of collagen fibrils periodicity of the irradiated samples. (author)

  17. Skin Sensitive Difference of Human Body Sections under Clothing-Smirnov Test of Skin Surface Temperatures' Dynamic Changing

    Institute of Scientific and Technical Information of China (English)

    LI Jun; WU Hai-yan; WANG Yun-yi

    2004-01-01

    Skin sensitive difference of human body sections under clothing is the theoretic foundation of thermal insulation clothing design.By a new method of researching on clothing comfort perception,the skin temperature live changing procedure of human body sections affected by the same cold stimulation is inspected.Furthermore with the Smirnov test the skin temperatures dynamic changing patterns of main human body sections are obtained.

  18. An in vitro model for detecting skin irritants: methyl green-pyronine staining of human skin explant cultures

    NARCIS (Netherlands)

    Jacobs, J. J. L.; Lehé, C.; Cammans, K. D. A.; Das, P. K.; Elliott, G. R.

    2002-01-01

    We evaluated the potential of human organotypic skin explant cultures (hOSECs) for screening skin irritants. Test chemicals were applied to the epidermis of the skin explants which were incubated for 4, 24 or 48 h in tissue culture medium. A decrease in epidermal RNA staining, visualised in frozen

  19. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

    2011-01-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  20. Topical stabilized retinol treatment induces the expression of HAS genes and HA production in human skin in vitro and in vivo.

    Science.gov (United States)

    Li, Wen-Hwa; Wong, Heng-Kuan; Serrano, José; Randhawa, Manpreet; Kaur, Simarna; Southall, Michael D; Parsa, Ramine

    2017-05-01

    Skin Aging manifests primarily with wrinkles, dyspigmentations, texture changes, and loss of elasticity. During the skin aging process, there is a loss of moisture and elasticity in skin resulting in loss of firmness finally leading to skin sagging. The key molecule involved in skin moisture is hyaluronic acid (HA), which has a significant water-binding capacity. HA levels in skin decline with age resulting in decrease in skin moisture, which may contribute to loss of firmness. Clinical trials have shown that topically applied ROL effectively reduces wrinkles and helps retain youthful appearance. In the current study, ROL was shown to induce HA production and stimulates the gene expression of all three forms of hyaluronic acid synthases (HAS) in normal human epidermal keratinocytes monolayer cultures. Moreover, in human skin equivalent tissues and in human skin explants, topical treatment of tissues with a stabilized-ROL formulation significantly induced the gene expression of HAS mRNA concomitant with an increased HA production. Finally, in a vehicle-controlled human clinical study, histochemical analysis confirmed increased HA accumulation in the epidermis in ROL-treated human skin as compared to vehicle. These results show that ROL increases skin expression of HA, a significant contributing factor responsible for wrinkle formation and skin moisture, which decrease during aging. Taken together with the activity to increase collagen, elastin, and cell proliferation, these studies establish that retinol provides multi-functional activity for photodamaged skin.

  1. Technical note: comparing von Luschan skin color tiles and modern spectrophotometry for measuring human skin pigmentation.

    Science.gov (United States)

    Swiatoniowski, Anna K; Quillen, Ellen E; Shriver, Mark D; Jablonski, Nina G

    2013-06-01

    Prior to the introduction of reflectance spectrophotometry into anthropological field research during the 1950s, human skin color was most commonly classified by visual skin color matching using the von Luschan tiles, a set of 36 standardized, opaque glass tiles arranged in a chromatic scale. Our goal was to establish a conversion formula between the tile-based color matching method and modern reflectance spectrophotometry to make historical and contemporary data comparable. Skin pigmentation measurements were taken on the forehead, inner upper arms, and backs of the hands using both the tiles and a spectrophotometer on 246 participants showing a broad range of skin pigmentation. From these data, a second-order polynomial conversion formula was derived by jackknife analysis to estimate melanin index (M-index) based on tile values. This conversion formula provides a means for comparing modern data to von Luschan tile measurements recorded in historical reports. This is particularly important for populations now extinct, extirpated, or admixed for which tile-based measures of skin pigmentation are the only data available. Copyright © 2013 Wiley Periodicals, Inc.

  2. Fatty acid uptake in normal human myocardium

    International Nuclear Information System (INIS)

    Vyska, K.; Meyer, W.; Stremmel, W.; Notohamiprodjo, G.; Minami, K.; Machulla, H.J.; Gleichmann, U.; Meyer, H.; Koerfer, R.

    1991-01-01

    Fatty acid binding protein has been found in rat aortic endothelial cell membrane. It has been identified to be a 40-kDa protein that corresponds to a 40-kDa fatty acid binding protein with high affinity for a variety of long chain fatty acids isolated from rat heart myocytes. It is proposed that this endothelial membrane fatty acid binding protein might mediate the myocardial uptake of fatty acids. For evaluation of this hypothesis in vivo, influx kinetics of tracer-labeled fatty acids was examined in 15 normal subjects by scintigraphic techniques. Variation of the plasma fatty acid concentration and plasma perfusion rate has been achieved by modulation of nutrition state and exercise conditions. The clinical results suggest that the myocardial fatty acid influx rate is saturable by increasing fatty acid plasma concentration as well as by increasing plasma flow. For analysis of these data, functional relations describing fatty acid transport from plasma into myocardial tissue in the presence and absence of an unstirred layer were developed. The fitting of these relations to experimental data indicate that the free fatty acid influx into myocardial tissue reveals the criteria of a reaction on a capillary surface in the vicinity of flowing plasma but not of a reaction in extravascular space or in an unstirred layer and that the fatty acid influx into normal myocardium is a saturable process that is characterized by the quantity corresponding to the Michaelis-Menten constant, Km, and the maximal velocity, Vmax, 0.24 ± 0.024 mumol/g and 0.37 ± 0.013 mumol/g(g.min), respectively. These data are compatible with a nondiffusional uptake process mediated by the initial interaction of fatty acids with the 40-kDa membrane fatty acid binding protein of cardiac endothelial cells

  3. High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

    Science.gov (United States)

    Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

    2016-09-01

    Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Enhancement of Human Cheek Skin Texture by Acacia Nilotica Bark ...

    African Journals Online (AJOL)

    HP

    Purpose: To evaluate the effect of a topical application of a cream formulation containing extract of. Acacia nilotica bark extract on human cheek skin texture. Methods: A cream containing 3 % concentrated extract of Acacia nilotica bark was developed by entrapping the extract in the internal aqueous phase of the cream ...

  5. Transfection of Primary Human Skin Fibroblasts for Peroxisomal Studies

    NARCIS (Netherlands)

    Koster, Janet; Waterham, Hans R.

    2017-01-01

    Functional studies with primary human skin fibroblasts from patients with a peroxisomal disorder often require efficient transfection with plasmids to correct the genetic defect or to express heterologous reporter proteins. Here, we describe a protocol we commonly use for efficient nonviral

  6. Sarcoptes scabiei mites modulate gene expression in human skin equivalents.

    Directory of Open Access Journals (Sweden)

    Marjorie S Morgan

    Full Text Available The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin's protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host's protective response allowing these mites to survive in the skin.

  7. Preliminary observations on differences in the Raman spectra of cancerous and noncancerous cells and connective tissue of human skin

    Science.gov (United States)

    Short, Michael A.; Lui, Harvey; McLean, David I.; Zeng, Haishan; Alajlan, Abdulmajeed; Chen, Michael X.

    2005-04-01

    A less invasive method of reliably detecting skin cancers is required. Raman spectroscopy is just one of several spectroscopic methods that look promising, but are not yet sufficiently reliable. More information is needed on how and why the Raman spectra of cancerous skin tissue is different from its normal counterpart. We have used confocal micro-Raman spectroscopy with a spatial resolution of about a micron to obtain spectra of unstained thin sections of human skin. We found that there were clear differences in the Raman spectra between cancerous and non-cancerous tissue both in cells and in the connective tissue. The DNA contribution to the spectra was generally stronger in malignant cells than normal ones. In regions of the dermis far away from the tumor one obtains the usual collagen spectra of normal skin, but adjacent to the tumor the spectra no longer appeared to be those of native collagen.

  8. Bioactive reagents used in mesotherapy for skin rejuvenation in vivo induce diverse physiological processes in human skin fibroblasts in vitro- a pilot study.

    Science.gov (United States)

    Jäger, Claudia; Brenner, Christiane; Habicht, Jüri; Wallich, Reinhard

    2012-01-01

    The promise of mesotherapy is maintenance and/or recovery of a youthful skin with a firm, bright and moisturized texture. Currently applied medications employ microinjections of hyaluronic acid, vitamins, minerals and amino acids into the superficial layer of the skin. However, the molecular and cellular processes underlying mesotherapy are still elusive. Here we analysed the effect of five distinct medication formulas on pivotal parameters involved in skin ageing, that is collagen expression, cell proliferation and morphological changes using normal human skin fibroblast cultures in vitro. Whereas in the presence of hyaluronic acid, NCTF135(®) and NCTF135HA(®) , cell proliferation was comparable to control cultures; however, with higher expression of collagen type-1, matrix metalloproteinase-1 and tissue inhibitor of matrix metalloproteinase-1, addition of Soluvit(®) N and Meso-BK led to apoptosis and/or necrosis of human fibroblasts. The data indicate that bioactive reagents currently applied for skin rejuvenation elicit strikingly divergent physiological processes in human skin fibroblast in vitro. © 2011 John Wiley & Sons A/S.

  9. Effect of flexing and massage on in vivo human skin penetration and toxicity of zinc oxide nanoparticles.

    Science.gov (United States)

    Leite-Silva, Vânia R; Liu, David C; Sanchez, Washington Y; Studier, Hauke; Mohammed, Yousuf H; Holmes, Amy; Becker, Wolfgang; Grice, Jeffrey E; Benson, Heather Ae; Roberts, Michael S

    2016-05-01

    We assessed the effects of flexing and massage on human skin penetration and toxicity of topically applied coated and uncoated zinc oxide nanoparticles (˜75 nm) in vivo. Noninvasive multiphoton tomography with fluorescence lifetime imaging was used to evaluate the penetration of nanoparticles through the skin barrier and cellular apoptosis in the viable epidermis. All nanoparticles applied to skin with flexing and massage were retained in the stratum corneum or skin furrows. No significant penetration into the viable epidermis was seen and no cellular toxicity was detected. Exposure of normal in vivo human skin to these nanoparticles under common in-use conditions of flexing or massage is not associated with significant adverse events.

  10. Immunolocalization of transforming growth factor alpha in normal human tissues

    DEFF Research Database (Denmark)

    Christensen, M E; Poulsen, Steen Seier

    1996-01-01

    anchorage-independent growth of normal cells and was, therefore, considered as an "oncogenic" growth factor. Later, its immunohistochemical presence in normal human cells as well as its biological effects in normal human tissues have been demonstrated. The aim of the present investigation was to elucidate...... the distribution of the growth factor in a broad spectrum of normal human tissues. Indirect immunoenzymatic staining methods were used. The polypeptide was detected with a polyclonal as well as a monoclonal antibody. The polyclonal and monoclonal antibodies demonstrated almost identical immunoreactivity. TGF......-alpha was found to be widely distributed in cells of normal human tissues derived from all three germ layers, most often in differentiated cells. In epithelial cells, three different kinds of staining patterns were observed, either diffuse cytoplasmic, cytoplasmic in the basal parts of the cells, or distinctly...

  11. Radio-sterilization and processing of frozen human skin

    International Nuclear Information System (INIS)

    Zarate S, Herman; Aguirre H, Paulina; Silva R, Samy; Hitschfeld G, Mario

    2006-01-01

    The Laboratory of Radio-sterilized Biological Tissues Processing (LPTR) belonging to the Chilean Commission of Nuclear Energy and the International Atomic Energy Agency have played a paramount role in our country, concerning the biological tissue processing, which can be radio-sterilized as human skin, pig skin, amniotic membrane, human bone and bovine bone. The frozen radio.-sterilized human skin processing began in 2001, by means of putting into practice the knowledge acquired in training courses through the IAEA and the experience transferred by experts who visited our laboratory. The human skin processing of dead donor can be divided into 6 stages: a) Profuse washing with physiological sterilized serum in to remove the microorganisms, chemical and pharmacological compounds; b) immersion in glycerol solution at 10% to better keep the stored tissues; c) packing, to avoid post manipulation of the sterilized tissue; d) microbiological controls which allow and guarantee a sterility assurance level of 10 6 ; e) radio-sterilization, technique that consists of exposing the grafts to electromagnetic gamma waves which eliminate the microorganisms of the tissue, f) and finally, dispatching and liberation of the frozen sterilized human skin for its clinical use in different centers that take care of burned people. The LPTR receives feedback from surgeons who have used these tissues in order to improve the processing stages based in an integral quality system ISO 9001.2000. The State Health System in our country counts on limited and scarce resources to implement synthetic substitutes that is why It is considered necessary to spread the use of these noble tissues which have sterility assurance and they are processed at low price

  12. Human cell transformation in the study of sunlight-induced cancers in the skin of man

    International Nuclear Information System (INIS)

    Sutherland, B.M.; Bennett, P.V.

    1988-01-01

    Human cell transformation provides a powerful approach to understanding - at the cellular and molecular levels - induction of cancers in the skin of man. A principal approach to this problem is the direct transformation of human skin cells by exposure to ultraviolet and/or near-UV radiation. The frequency of human cells transformed to anchorage independence increases with radiation exposure; the relative transforming efficiencies of different wavelengths implies that direct absorption by nucleic acids is a primary initial event. Partial reversal of potential transforming lesions by photoreactivation suggests that pyrimidine dimers, as well as other lesions, are important in UV transformation of human cells. Human cells can also be transformed by transfection with cloned oncogenes, or with DNAs from tumors or tumor cell lines. Cells treated by the transfection procedure (but without DNA) or cells transfected with DNAs from normal mammalian cells or tissues show only background levels of transformation. Human cells can be transformed to anchorage-independent growth by DNAs ineffective in transformation of NIH 3T3 cells (including most human skin cancers), permitting the analysis of oncogenic molecular changes even in tumor DNAs difficult or impossible to analyze in rodent cell systems. 29 refs.; 4 figs.; 1 table

  13. Vascular effects of leukotriene D4 in human skin

    DEFF Research Database (Denmark)

    Bisgaard, H

    1987-01-01

    Leukotriene D4 (LTD4) increased the blood flow rate in human skin, equipotent to histamine in the dose range of 3.1-200 pmol. The vasodilatation lasted for up to 60 min, and no late reactions occurred. Indomethacin did not affect the LTD4-induced blood flow rate. H1 and H2 antagonists reduced...... as a mediator of the axon reflex, and show that LTD4 causes a direct vasodilatory effect that is not mediated via histamine or cyclooxygenase products. The laser-Doppler flowmeter was applied for dynamic studies of the vasopressor response in the skin during a Valsalva maneuver, and the relative changes...

  14. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  15. Skin Sensitive Difference of Human Body Sections under Clothing--Multiple Analysis of Skin Surface Temperature Changes

    Institute of Scientific and Technical Information of China (English)

    李俊; 吴海燕; 张渭源

    2003-01-01

    A new researching method on clothing comfort perception is developed.By it the skin surface temperature changes and subjective psychological perception of human body sections stimulated by the same cold stimulation are studied.With the multiple comparison analysis method the changing laws of skin temperature of main human body sections is obtained.

  16. Studies of the in vivo radiosensitivity of human skin fibroblasts

    International Nuclear Information System (INIS)

    Hill, Richard P.; Kaspler, Pavel; Griffin, Anthony M.; O'Sullivan, Brian; Catton, Charles; Alasti, Hamideh; Abbas, Ahmar; Heydarian, Moustafa; Ferguson, Peter; Wunder, Jay S.; Bell, Robert S.

    2007-01-01

    Background and purpose: To examine the radiosensitivity of skin cells obtained directly from the irradiated skin of patients undergoing fractionated radiation treatment prior to surgery for treatment of soft tissue sarcoma (STS) and to determine if there was a relationship with the development of wound healing complications associated with the surgery post-radiotherapy. Methods: Micronucleus (MN) formation was measured in cells (primarily dermal fibroblasts) obtained from human skin at their first division after being removed from STS patients during post-radiotherapy surgery (2-9 weeks after the end of the radiotherapy). At the time of radiotherapy (planned tumor dose - 50 Gy in 25 daily fractions) measurements were made of surface skin dose at predetermined marked sites. Skin from these sites was obtained at surgery and cell suspensions were prepared directly for the cytokinesis-blocked MN assay. Cultured strains of the fibroblasts were also established from skin nominally outside the edge of the radiation beam and DNA damage (MN formation) was examined following irradiation in vitro for comparison with the results from the in situ irradiations. Results: Extensive DNA damage (MN) was detectable in fibroblasts from human skin at extended periods after irradiation (2-9 weeks after the end of the 5-week fractionated radiotherapy). Analysis of skin receiving a range of doses demonstrated that the level of damage observed was dose dependent. There was no clear correlation between the level of damage observed after irradiation in situ and irradiation of cell strains in culture. Similarly, there was no correlation between the extent of MN formation following in situ irradiation and the propensity for the patient to develop wound healing complications post-surgery. Conclusions: Despite the presence of DNA damage in dermal fibroblasts weeks after the end of the radiation treatment, there was no relationship between this damage and wound healing complications following

  17. Evaluation of a Silicone Membrane as an Alternative to Human Skin for Determining Skin Permeation Parameters of Chemical Compounds.

    Science.gov (United States)

    Uchida, Takashi; Yakumaru, Masafumi; Nishioka, Keisuke; Higashi, Yoshihiro; Sano, Tomohiko; Todo, Hiroaki; Sugibayashi, Kenji

    2016-01-01

    We evaluated the effectiveness of a silicone membrane as an alternative to human skin using the skin permeation parameters of chemical compounds. An in vitro permeation study using 15 model compounds was conducted, and permeation parameters comprising permeability coefficient (P), diffusion parameter (DL(-2)), and partition parameter (KL) were calculated from each permeation profile. Significant correlations were obtained in log P, log DL(-2), and log KL values between the silicone membrane and human skin. DL(-2) values of model compounds, except flurbiprofen, in the silicone membrane were independent of the lipophilicity of the model compounds and were 100-fold higher than those in human skin. For antipyrine and caffeine, which are hydrophilic, KL values in the silicone membrane were 100-fold lower than those in human skin, and P values, calculated as the product of a DL(-2) and KL, were similar. For lipophilic compounds, such as n-butyl paraben and flurbiprofen, KL values for silicone were similar to or 10-fold higher than those in human skin, and P values for silicone were 100-fold higher than those in human skin. Furthermore, for amphiphilic compounds with log Ko/w values from 0.5 to 3.5, KL values in the silicone membrane were 10-fold lower than those in human skin, and P values for silicone were 10-fold higher than those in human skin. The silicone membrane was useful as a human skin alternative in an in vitro skin permeation study. However, depending on the lipophilicity of the model compounds, some parameters may be over- or underestimated.

  18. Influence of low-energy laser radiation on normal skin and certain tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Pletnev, S.D.; Karpenko, O.M.

    For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

  19. Sarcoptes scabiei Mites Modulate Gene Expression in Human Skin Equivalents

    Science.gov (United States)

    Morgan, Marjorie S.; Arlian, Larry G.; Markey, Michael P.

    2013-01-01

    The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs) that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α) precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF) precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin’s protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host’s protective response allowing these mites to survive in the skin. PMID:23940705

  20. Antimelanogenic Efficacy of Melasolv (3,4,5-Trimethoxycinnamate Thymol Ester) in Melanocytes and Three-Dimensional Human Skin Equivalent.

    Science.gov (United States)

    Lee, John Hwan; Lee, Eun-Soo; Bae, Il-Hong; Hwang, Jeong-Ah; Kim, Se-Hwa; Kim, Dae-Yong; Park, Nok-Hyun; Rho, Ho Sik; Kim, Yong Jin; Oh, Seong-Geun; Lee, Chang Seok

    2017-01-01

    Excessive melanogenesis often causes unaesthetic hyperpigmentation. In a previous report, our group introduced a newly synthesized depigmentary agent, Melasolv™ (3,4,5-trimethoxycinnamate thymol ester). In this study, we demonstrated the significant whitening efficacy of Melasolv using various melanocytes and human skin equivalents as in vitro experimental systems. The depigmentary effect of Melasolv was tested in melan-a cells (immortalized normal murine melanocytes), α-melanocyte-stimulating hormone (α-MSH)-stimulated B16 murine melanoma cells, primary normal human melanocytes (NHMs), and human skin equivalent (MelanoDerm). The whitening efficacy of Melasolv was further demonstrated by photography, time-lapse microscopy, Fontana-Masson (F&M) staining, and 2-photon microscopy. Melasolv significantly inhibited melanogenesis in the melan-a and α-MSH-stimulated B16 cells. In human systems, Melasolv also clearly showed a whitening effect in NHMs and human skin equivalent, reflecting a decrease in melanin content. F&M staining and 2-photon microscopy revealed that Melasolv suppressed melanin transfer into multiple epidermal layers from melanocytes as well as melanin synthesis in human skin equivalent. Our study showed that Melasolv clearly exerts a whitening effect on various melanocytes and human skin equivalent. These results suggest the possibility that Melasolv can be used as a depigmentary agent to treat pigmentary disorders as well as an active ingredient in cosmetics to increase whitening efficacy. © 2017 S. Karger AG, Basel.

  1. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  2. Near infrared laser penetration and absorption in human skin

    Science.gov (United States)

    Nasouri, Babak; Murphy, Thomas E.; Berberoglu, Halil

    2014-02-01

    For understanding the mechanisms of low level laser/light therapy (LLLT), accurate knowledge of light interaction with tissue is necessary. In this paper, we present a three dimensional, multi-layer Monte Carlo simulation tool for studying light penetration and absorption in human skin. The skin is modeled as a three-layer participating medium, namely epidermis, dermis, and subcutaneous, where its geometrical and optical properties are obtained from the literature. Both refraction and reflection are taken into account at the boundaries according to Snell's law and Fresnel relations. A forward Monte Carlo method was implemented and validated for accurately simulating light penetration and absorption in absorbing and anisotropically scattering media. Local profiles of light penetration and volumetric absorption densities were simulated for uniform as well as Gaussian profile beams with different spreads at 155 mW average power over the spectral range from 1000 nm to 1900 nm. The results show the effects of beam profiles and wavelength on the local fluence within each skin layer. Particularly, the results identify different wavelength bands for targeted deposition of power in different skin layers. Finally, we show that light penetration scales well with the transport optical thickness of skin. We expect that this tool along with the results presented will aid researchers resolve issues related to dose and targeted delivery of energy in tissues for LLLT.

  3. Dietary water affects human skin hydration and biomechanics

    Directory of Open Access Journals (Sweden)

    Palma L

    2015-08-01

    Full Text Available Lídia Palma,1 Liliana Tavares Marques,1 Julia Bujan,2,3 Luís Monteiro Rodrigues1,4 1CBIOS – Research Center for Health Science and Technologies, Universidade Lusófona, Campo Grande, Lisboa, Portugal; 2Department of Medicine and Medical Specialities, Universidad de Alcalá de Henares, Madrid, Spain; 3CIBER-BBN, Madrid, España, Spain; 4Department of Pharmacological Sciences, School of Pharmacy, Universidade de Lisboa, Lisboa, Portugal Abstract: It is generally assumed that dietary water might be beneficial for the health, especially in dermatological (age preventing terms. The present study was designed to quantify the impact of dietary water on major indicators of skin physiology. A total of 49 healthy females (mean 24.5±4.3 years were selected and characterized in terms of their dietary daily habits, especially focused in water consumption, by a Food Frequency Questionnaire. This allowed two groups to be set – Group 1 consuming less than 3,200 mL/day (n=38, and Group 2 consuming more than 3,200 mL/day (n=11. Approximately 2 L of water were added to the daily diet of Group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology. Measurements involving epidermal superficial and deep hydration, transepidermal water loss, and several biomechanical descriptors were taken at day 0 (T0, 15 (T1, and 30 (T2 in several anatomical sites (face, upper limb, and leg. This stress test (2 L/day for 30 days significantly modified superficial and deep skin hydration, especially in Group 1. The same impact was registered with the most relevant biomechanical descriptors. Thus, in this study, it is clear that higher water inputs in regular diet might positively impact normal skin physiology, in particular in those individuals with lower daily water consumptions. Keywords: dietary water, water consume, skin hydration, TEWL, skin biomechanics

  4. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  5. Normal human bone marrow and its variations in MRI

    International Nuclear Information System (INIS)

    Vahlensieck, M.; Schmidt, H.M.

    2000-01-01

    Physiology and age dependant changes of human bone marrow are described. The resulting normal distribution patterns of active and inactive bone marrow including the various contrasts on different MR-sequences are discussed. (orig.) [de

  6. A molecular systems approach to modelling human skin pigmentation: identifying underlying pathways and critical components.

    Science.gov (United States)

    Raghunath, Arathi; Sambarey, Awanti; Sharma, Neha; Mahadevan, Usha; Chandra, Nagasuma

    2015-04-29

    Ultraviolet radiations (UV) serve as an environmental stress for human skin, and result in melanogenesis, with the pigment melanin having protective effects against UV induced damage. This involves a dynamic and complex regulation of various biological processes that results in the expression of melanin in the outer most layers of the epidermis, where it can exert its protective effect. A comprehensive understanding of the underlying cross talk among different signalling molecules and cell types is only possible through a systems perspective. Increasing incidences of both melanoma and non-melanoma skin cancers necessitate the need to better comprehend UV mediated effects on skin pigmentation at a systems level, so as to ultimately evolve knowledge-based strategies for efficient protection and prevention of skin diseases. A network model for UV-mediated skin pigmentation in the epidermis was constructed and subjected to shortest path analysis. Virtual knock-outs were carried out to identify essential signalling components. We describe a network model for UV-mediated skin pigmentation in the epidermis. The model consists of 265 components (nodes) and 429 directed interactions among them, capturing the manner in which one component influences the other and channels information. Through shortest path analysis, we identify novel signalling pathways relevant to pigmentation. Virtual knock-outs or perturbations of specific nodes in the network have led to the identification of alternate modes of signalling as well as enabled determining essential nodes in the process. The model presented provides a comprehensive picture of UV mediated signalling manifesting in human skin pigmentation. A systems perspective helps provide a holistic purview of interconnections and complexity in the processes leading to pigmentation. The model described here is extensive yet amenable to expansion as new data is gathered. Through this study, we provide a list of important proteins essential

  7. Determination of the optical properties of melanin-pigmented human skin equivalents using terahertz time-domain spectroscopy

    Science.gov (United States)

    Lipscomb, Dawn; Echchgadda, Ibtissam; Peralta, Xomalin G.; Wilmink, Gerald J.

    2013-02-01

    Terahertz time-domain spectroscopy (THz-TDS) methods have been utilized in previous studies in order to characterize the optical properties of skin and its primary constituents (i.e., water, collagen, and keratin). However, similar experiments have not yet been performed to investigate whether melanocytes and the melanin pigment that they synthesize contribute to skin's optical properties. In this study, we used THz-TDS methods operating in transmission geometry to measure the optical properties of in vitro human skin equivalents with or without normal human melanocytes. Skin equivalents were cultured for three weeks to promote gradual melanogenesis, and THz time domain data were collected at various time intervals. Frequency-domain analysis techniques were performed to determine the index of refraction (n) and absorption coefficient (μa) for each skin sample over the frequency range of 0.1-2.0 THz. We found that for all samples as frequency increased, n decreased exponentially and the μa increased linearly. Additionally, we observed that skin samples with higher levels of melanin exhibited greater n and μa values than the non-pigmented samples. Our results indicate that melanocytes and the degree of melanin pigmentation contribute in an appreciable manner to the skin's optical properties. Future studies will be performed to examine whether these contributions are observed in human skin in vivo.

  8. Ultrastructural changes in human skin after exposure to a pulsed laser

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, H.; Tan, O.T.; Parrish, J.A.

    1985-05-01

    Selective vascular injury following irradiation using a pulsed laser source at 577 nm was examined using ultrastructural methods in the skin of 3 fair-skinned healthy human volunteers. This vascular-specific damage was confined to the papillary dermis. Red blood cells were altered in several ways. As well as an increase in the electron density, configurational distortion modified the normal biconcave forms to ameboid structures. The most interesting finding was the appearance within these altered cells of well-defined circular/oval electron-lucent areas of 800 A diameter, possibly representing a heat-fixed record of steam formation within the red blood cell. In addition, considerable degenerative changes were evident in endothelial cells and pericytes, while mast cells, neutrophils, histiocytes, and fibroblasts as well as collagen bundles immediately surrounding most laser-damaged blood vessels appeared normal.

  9. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2018-05-01

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Dietary water affects human skin hydration and biomechanics.

    Science.gov (United States)

    Palma, Lídia; Marques, Liliana Tavares; Bujan, Julia; Rodrigues, Luís Monteiro

    2015-01-01

    It is generally assumed that dietary water might be beneficial for the health, especially in dermatological (age preventing) terms. The present study was designed to quantify the impact of dietary water on major indicators of skin physiology. A total of 49 healthy females (mean 24.5±4.3 years) were selected and characterized in terms of their dietary daily habits, especially focused in water consumption, by a Food Frequency Questionnaire. This allowed two groups to be set - Group 1 consuming less than 3,200 mL/day (n=38), and Group 2 consuming more than 3,200 mL/day (n=11). Approximately 2 L of water were added to the daily diet of Group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology. Measurements involving epidermal superficial and deep hydration, transepidermal water loss, and several biomechanical descriptors were taken at day 0 (T0), 15 (T1), and 30 (T2) in several anatomical sites (face, upper limb, and leg). This stress test (2 L/day for 30 days) significantly modified superficial and deep skin hydration, especially in Group 1. The same impact was registered with the most relevant biomechanical descriptors. Thus, in this study, it is clear that higher water inputs in regular diet might positively impact normal skin physiology, in particular in those individuals with lower daily water consumptions.

  11. Collagen cross-linking in sun-exposed and unexposed sites of aged human skin

    Science.gov (United States)

    Yamauchi, M.; Prisayanh, P.; Haque, Z.; Woodley, D. T.

    1991-01-01

    A recently described nonreducible, acid-heat stable compound, histidinohydroxylysinonorleucine (HHL), is a collagen cross-link isolated from mature skin tissue. Its abundance is related to chronologic aging of skin. The present communication describes the quantity of HHL from aged human skin of the same individuals in sun-exposed (wrist) and unexposed (buttock) sites. Punch biopsies were obtained from these sites from nine people of age 60 or older. HHL contents (moles/mole of collagen) at these sites were for wrist 0.13 +/- 0.07 and for buttock 0.69 +/- 0.17 (mean +/- SD, p less than 0.001). In addition, it was found that acute irradiation of the cross-linked peptides with UVA (up to 250 J/cm2) and UVB (up to 1 J/cm2) had no effect on HHL structure. The same treatment significantly degraded another nonreducible, stable collagen cross-link, pyridinoline. The results suggest that chronic sunlight exposure may be associated with an impediment to normal maturation of human dermal collagen resulting in tenuous amount of HHL. Thus, the process of photoaging in dermal collagen is different from that of chronologic aging in human skin.

  12. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  13. Exosomes derived from human umbilical cord blood mesenchymal stem cells stimulates rejuvenation of human skin.

    Science.gov (United States)

    Kim, Yoon-Jin; Yoo, Sae Mi; Park, Hwan Hee; Lim, Hye Jin; Kim, Yu-Lee; Lee, Seunghee; Seo, Kwang-Won; Kang, Kyung-Sun

    2017-11-18

    Human umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) play an important role in cutaneous wound healing, and recent studies suggested that MSC-derived exosomes activate several signaling pathways, which are conducive in wound healing and cell growth. In this study, we investigated the roles of exosomes that are derived from USC-CM (USC-CM Exos) in cutaneous collagen synthesis and permeation. We found that USC-CM has various growth factors associated with skin rejuvenation. Our in vitro results showed that USC-CM Exos integrate in Human Dermal Fibroblasts (HDFs) and consequently promote cell migration and collagen synthesis of HDFs. Moreover, we evaluated skin permeation of USC-CM Exos by using human skin tissues. Results showed that Exo-Green labeled USC-CM Exos approached the outermost layer of the epidermis after 3 h and gradually approached the epidermis after 18 h. Moreover, increased expressions of Collagen I and Elastin were found after 3 days of treatment on human skin. The results showed that USC-CM Exos is absorbed into human skin, it promotes Collagen I and Elastin synthesis in the skin, which are essential to skin rejuvenation and shows the potential of USC-CM integration with the cosmetics or therapeutics. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. QSAR models of human data can enrich or replace LLNA testing for human skin sensitization

    Science.gov (United States)

    Alves, Vinicius M.; Capuzzi, Stephen J.; Muratov, Eugene; Braga, Rodolpho C.; Thornton, Thomas; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander

    2016-01-01

    Skin sensitization is a major environmental and occupational health hazard. Although many chemicals have been evaluated in humans, there have been no efforts to model these data to date. We have compiled, curated, analyzed, and compared the available human and LLNA data. Using these data, we have developed reliable computational models and applied them for virtual screening of chemical libraries to identify putative skin sensitizers. The overall concordance between murine LLNA and human skin sensitization responses for a set of 135 unique chemicals was low (R = 28-43%), although several chemical classes had high concordance. We have succeeded to develop predictive QSAR models of all available human data with the external correct classification rate of 71%. A consensus model integrating concordant QSAR predictions and LLNA results afforded a higher CCR of 82% but at the expense of the reduced external dataset coverage (52%). We used the developed QSAR models for virtual screening of CosIng database and identified 1061 putative skin sensitizers; for seventeen of these compounds, we found published evidence of their skin sensitization effects. Models reported herein provide more accurate alternative to LLNA testing for human skin sensitization assessment across diverse chemical data. In addition, they can also be used to guide the structural optimization of toxic compounds to reduce their skin sensitization potential. PMID:28630595

  15. Demonstration of tyrosinase in the vitiligo skin of human beings by a sensitive fluorometric method as well as by 14C(U)-L-tyrosine incorporation into melanin

    International Nuclear Information System (INIS)

    Husain, I.; Vijayan, E.; Ramaiah, A.; Pasricha, J.S.; Madan, N.C.

    1982-01-01

    Tyrosinase activity (Monophenol, dihydroxyphenylalanine: oxygen oxidoreductase EC 1.14.18.1) in vitiligo and normal epidermal homogenates of skin from human beings was measured by estimating beta 3,4-dihydroxyphenylalanine (dopa) by a highly sensitive fluorometric method described in this paper. The tyrosine activity in the vitiligo skin was about 4 to 37% of corresponding normal skin. The activity of tyrosinase in normal human skin from different individuals and from different regions of the body was in the range of 4 to 140 picomoles of beta 3,4-dihydroxyphenylalanine formed per min/mg protein of epidermal homogenate. The enzyme from vitiligo and normal skin was severely inhibited by substance(s) of low molecular weight. The enzyme exhibits a lag of about 4 hr in the absence of added beta 3,4-dihydroxyphenylalanine and 1 hr in presence of 5 microM dopa. Tyrosinase from the normal and vitiligo skin was inhibited by excess concentration of tyrosine. The homogenates from vitiligo skin could synthesize melanin from C14(U)-L-Tyrosine. The rate of tyrosine incorporation into melanin by the epidermal homogenates is increased by 3,4-dihydroxyphenylalanine (dopa) disproportionate to its effect on tyrosinase activity. Based on the data presented in this paper it is concluded that melanocytes are present in the vitiligo skin. A tentative hypothesis is put forward to explain the lack of melanin synthesis by the vitiligo skin under in vivo conditions, although melanocytes are present

  16. Differential susceptibility of primary cultured human skin cells to hypericin PDT in an in vitro model.

    Science.gov (United States)

    Popovic, A; Wiggins, T; Davids, L M

    2015-08-01

    Skin cancer is the most common cancer worldwide, and its incidence rate in South Africa is increasing. Photodynamic therapy (PDT) has been shown to be an effective treatment modality, through topical administration, for treatment of non-melanoma skin cancers. Our group investigates hypericin-induced PDT (HYP-PDT) for the treatment of both non-melanoma and melanoma skin cancers. However, a prerequisite for effective cancer treatments is efficient and selective targeting of the tumoral cells with minimal collateral damage to the surrounding normal cells, as it is well established that cancer therapies have bystander effects on normal cells in the body, often causing undesirable side effects. The aim of this study was to investigate the cellular and molecular effects of HYP-PDT on normal primary human keratinocytes (Kc), melanocytes (Mc) and fibroblasts (Fb) in an in vitro tissue culture model which represented both the epidermal and dermal cellular compartments of human skin. Cell viability analysis revealed a differential cytotoxic response to a range of HYP-PDT doses in all the human skin cell types, showing that Fb (LD50=1.75μM) were the most susceptible to HYP-PDT, followed by Mc (LD50=3.5μM) and Kc (LD50>4μM HYP-PDT) These results correlated with the morphological analysis which displayed distinct morphological changes in Fb and Mc, 24h post treatment with non-lethal (1μM) and lethal (3μM) doses of HYP-PDT, but the highest HYP-PDT doses had no effect on Kc morphology. Fluorescent microscopy displayed cytoplasmic localization of HYP in all the 3 skin cell types and additionally, HYP was excluded from the nuclei in all the cell types. Intracellular ROS levels measured in Fb at 3μM HYP-PDT, displayed a significant 3.8 fold (phuman skin cells thus highlighting the efficacy and indeed, the potential bystander effect of if administered in vivo. This study contributes toward our knowledge of the cellular response of the epidermis to photodynamic therapies and

  17. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  18. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV☆

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D.; Wondrak, Georg T.

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  19. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV.

    Science.gov (United States)

    Tao, Shasha; Justiniano, Rebecca; Zhang, Donna D; Wondrak, Georg T

    2013-01-01

    Exposure to solar ultraviolet (UV) radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2), a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I), dihydrotanshinone (DHT), tanshinone IIA (T-II-A) and cryptotanshinone (CT)] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1) with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm(2) UVB; 1.53 J/cm(2) UVA). The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities) was significantly attenuated in DHT

  20. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV

    Directory of Open Access Journals (Sweden)

    Shasha Tao

    2013-01-01

    Full Text Available Exposure to solar ultraviolet (UV radiation is a causative factor in skin photocarcinogenesis and photoaging, and an urgent need exists for improved strategies for skin photoprotection. The redox-sensitive transcription factor Nrf2 (nuclear factor-E2-related factor 2, a master regulator of the cellular antioxidant defense against environmental electrophilic insult, has recently emerged as an important determinant of cutaneous damage from solar UV, and the concept of pharmacological activation of Nrf2 has attracted considerable attention as a novel approach to skin photoprotection. In this study, we examined feasibility of using tanshinones, a novel class of phenanthrenequinone-based cytoprotective Nrf2 inducers derived from the medicinal plant Salvia miltiorrhiza, for protection of cultured human skin cells and reconstructed human skin against solar simulated UV. Using a dual luciferase reporter assay in human Hs27 dermal fibroblasts pronounced transcriptional activation of Nrf2 by four major tanshinones [tanshinone I (T-I, dihydrotanshinone (DHT, tanshinone IIA (T-II-A and cryptotanshinone (CT] was detected. In fibroblasts, the more potent tanshinones T-I and DHT caused a significant increase in Nrf2 protein half-life via blockage of ubiquitination, ultimately resulting in upregulated expression of cytoprotective Nrf2 target genes (GCLC, NQO1 with the elevation of cellular glutathione levels. Similar tanshinone-induced changes were also observed in HaCaT keratinocytes. T-I and DHT pretreatment caused significant suppression of skin cell death induced by solar simulated UV and riboflavin-sensitized UVA. Moreover, feasibility of tanshinone-based cutaneous photoprotection was tested employing a human skin reconstruct exposed to solar simulated UV (80 mJ/cm2 UVB; 1.53 J/cm2 UVA. The occurrence of markers of epidermal solar insult (cleaved procaspase 3, pycnotic nuclei, eosinophilic cytoplasm, acellular cavities was significantly attenuated in DHT

  1. Studies on nerve terminations in human mucosa and skin

    OpenAIRE

    Hilliges, Marita

    1997-01-01

    - In spite of their accessibility and important sensory function,the nervous tissue components of human oral and vaginal mucosa and skin have beensubject to very few, if any, systematic investigations. Studies on the innervationof oral tissues have mainly focused on the dental pulp, the periodontium and thegingiva, probably because of specific clinical interest, thus largely neglectingthe mucosa. Genital studies comprise only in a few cases the vagina and when thevagina is i...

  2. DNA amplification is rare in normal human cells

    International Nuclear Information System (INIS)

    Wright, J.A.; Watt, F.M.; Hudson, D.L.; Stark, G.R.; Smith, H.S.; Hancock, M.C.

    1990-01-01

    Three types of normal human cells were selected in tissue culture with three drugs without observing a single amplification event from a total of 5 x 10 8 cells. No drug-resistant colonies were observed when normal foreskin keratinocytes were selected with N-(phosphonacetyl)-L-aspartate or with hydroxyurea or when normal mammary epithelial cells were selected with methotrexate. Some slightly resistant colonies with limited potential for growth were obtained when normal diploid fibroblast cells derived from fetal lung were selected with methotrexate or hydroxyurea but careful copy-number analysis of the dihydrofolate reductase and ribonucleotide reductase genes revealed no evidence of amplification. The rarity of DNA amplification in normal human cells contrasts strongly with the situation in tumors and in established cell lines, where amplification of onogenes and of genes mediating drug resistance is frequent. The results suggest that tumors and cell lines have acquired the abnormal ability to amplify DNA with high frequency

  3. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  4. Artichoke compound cynarin differentially affects the survival, growth and stress response of normal, immortalized and cancerous human cells

    DEFF Research Database (Denmark)

    Gezer, Ceren; Yücecan, Sevinç; Rattan, Suresh Inder Singh

    2015-01-01

    of CYN on the proliferative potential, survival, morphology, and stress response (SR) markers haemoxygenase-1 (HO-1) and heat shock protein-70 (HSP70) in normal human skin fibroblasts (FSF-1), telomerase-immortalized mesenchymal stem cells (hTERT-MSC) and cervical cancer cells, HeLa. Effects of CYN...

  5. Organelle-specific injury to melanin-containing cells in human skin by pulsed laser irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, G.F.; Shepard, R.S.; Paul, B.S.; Menkes, A.; Anderson, R.R.; Parrish, J.A.

    1983-12-01

    Physical models predict that ultraviolet laser radiation of appropriately brief pulses can selectively alter melanin-containing cellular targets in human skin. Skin of normal human volunteers was exposed to brief (20 nanosecond) 351-nm wave length pulses from a XeF excimer laser, predicting that those cells containing the greatest quantities of melanized melanosomes (lower half of the epidermis) would be selectively damaged. Transmission electron microscopy revealed the earliest cellular alteration to be immediate disruption of melanosomes, both within melanocytes and basal keratinocytes. This disruption was dose dependent and culminated in striking degenerative changes in these cells. Superficial keratinocytes and Langerhans cells were not affected. It was concluded that the XeF excimer laser is capable of organelle-specific injury to melanosomes. These findings may have important clinical implications in the treatment of both benign and malignant pigmented lesions by laser radiations of defined wave lengths and pulse durations.

  6. Degradation and protection of DNAzymes on human skin.

    Science.gov (United States)

    Marquardt, Kay; Eicher, Anna-Carola; Dobler, Dorota; Höfer, Frank; Schmidts, Thomas; Schäfer, Jens; Renz, Harald; Runkel, Frank

    2016-10-01

    DNAzymes are catalytic nucleic acid based molecules that have become a new class of active pharmaceutical ingredients (API). Until now, five DNAzymes have entered clinical trials. Two of them were tested for topical application, whereby dermally applied DNAzymes had been prone to enzymatic degradation. To protect the DNAzymes the enzymatic activity of human skin has to be examined. Therefore, the enzymatic activity of human skin was qualitatively and quantitatively analyzed. Activity similar to that of DNase II could be identified and the specific activity was determined to be 0.59Units/mg. These results were used to develop an in vitro degradation assay to screen different kinds of protective systems on human skin. The chosen protective systems consisted of biodegradable chitosans or polyethylenimine, which forms polyplexes when combined with DNAzymes. The polyplexes were characterized in terms of particle size, zeta potential, stability and degree of complexation. The screening revealed that the protective efficiency of the polyplexes depended on the polycation and the charge ratio (ξ). At a critical ξ ratio between 1.0 and 4.1 and at a maximal zeta potential, sufficient protection of the DNAzyme was achieved. The results of this study will be helpful for the development of a protective dermal drug delivery systems using polyplexes. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Pig and guinea pig skin as surrogates for human in vitro penetration studies: a quantitative review.

    Science.gov (United States)

    Barbero, Ana M; Frasch, H Frederick

    2009-02-01

    Both human and animal skin in vitro models are used to predict percutaneous penetration in humans. The objective of this review is a quantitative comparison of permeability and lag time measurements between human and animal skin, including an evaluation of the intra and inter species variability. We limit our focus to domestic pig and rodent guinea pig skin as surrogates for human skin, and consider only studies in which both animal and human penetration of a given chemical were measured jointly in the same lab. When the in vitro permeability of pig and human skin were compared, the Pearson product moment correlation coefficient (r) was 0.88 (Ppig and 35% for human, and an inter species average coefficient of variation of 37% for the set of studied compounds (n=41). The lag times of pig skin and human skin did not correlate (r=0.35, P=0.26). When the in vitro permeability of guinea pig and human skin were compared, r=0.96 (Pguinea pig and 24% for human, and an inter species coefficient of variation of permeability of 41% for the set of studied compounds (n=15). Lag times of guinea pig and human skin correlated (r=0.90, Ppig skin (n=50) and guinea pig skin (n=25). For pig skin, 80% of measurements fell within the range 0.3guinea pig skin, 65% fell within that range. Both pig and guinea pig are good models for human skin permeability and have less variability than the human skin model. The skin model of choice will depend on the final purpose of the study and the compound under investigation.

  8. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  9. Wound healing properties of ethyl acetate fraction of Moringa oleifera in normal human dermal fibroblasts

    Directory of Open Access Journals (Sweden)

    Sivapragasam Gothai

    2016-03-01

    Full Text Available Background/Aim: Wounds are the outcome of injuries to the skin that interrupt the soft tissue. Healing of a wound is a complex and long-drawn-out process of tissue repair and remodeling in response to injury. A large number of plants are used by folklore traditions for treatment of cuts, wounds and burns. Moringa oleifera is an herb used as traditional folk medicine for the treatment of various skin wounds and associated diseases. The underlying mechanisms of wound healing activity of ethyl acetate fraction of M. oleifera leaves extract are completely unknown. Methods: In the current study, ethyl acetate fraction of Moringa oleifera leaves was investigated for its efficacy on cell viability, proliferation and migration (wound closure rate in human normal dermal fibroblast cells. Results: Results revealed that lower concentration (12.5 µg/ml, 25 µg/ml, and 50 µg/ml of ethyl acetate fraction of M. oleifera leaves showed remarkable proliferative and migratory effect on normal human dermal fibroblasts. Conclusion: The present study suggested that ethyl acetate fraction of M. oleifera leaves might be a potential therapeutic agent for skin wound healing by promoting fibroblast proliferation and migration through increasing the wound closure rate corroborating its traditional use. [J Complement Med Res 2016; 5(1.000: 1-6

  10. Immune Cell-Supplemented Human Skin Model for Studying Fungal Infections.

    Science.gov (United States)

    Kühbacher, Andreas; Sohn, Kai; Burger-Kentischer, Anke; Rupp, Steffen

    2017-01-01

    Human skin is a niche for various fungal species which either colonize the surface of this tissue as commensals or, primarily under conditions of immunosuppression, invade the skin and cause infection. Here we present a method for generation of a human in vitro skin model supplemented with immune cells of choice. This model represents a complex yet amenable tool to study molecular mechanisms of host-fungi interactions at human skin.

  11. Use of Clotted Human Plasma and Aprotinin in Skin Tissue Engineering: A Novel Approach to Engineering Composite Skin on a Porous Scaffold.

    Science.gov (United States)

    Paul, Michelle; Kaur, Pritinder; Herson, Marisa; Cheshire, Perdita; Cleland, Heather; Akbarzadeh, Shiva

    2015-10-01

    Tissue-engineered composite skin is a promising therapy for the treatment of chronic and acute wounds, including burns. Providing the wound bed with a dermal scaffold populated by autologous dermal and epidermal cellular components can further entice host cell infiltration and vascularization to achieve permanent wound closure in a single stage. However, the high porosity and the lack of a supportive basement membrane in most commercially available dermal scaffolds hinders organized keratinocyte proliferation and stratification in vitro and may delay re-epithelization in vivo. The objective of this study was to develop a method to enable the in vitro production of a human skin equivalent (HSE) that included a porous scaffold and dermal and epidermal cells expanded ex vivo, with the potential to be used for definitive treatment of skin defects in a single procedure. A collagen-glycosaminoglycan dermal scaffold (Integra(®)) was populated with adult fibroblasts. A near-normal skin architecture was achieved by the addition of coagulated human plasma to the fibroblast-populated scaffold before seeding cultured keratinocytes. This resulted in reducing scaffold pore size and improving contact surfaces. Skin architecture and basement membrane formation was further improved by the addition of aprotinin (a serine protease inhibitor) to the culture media to inhibit premature clot digestion. Histological assessment of the novel HSE revealed expression of keratin 14 and keratin 10 similar to native skin, with a multilayered neoepidermis morphologically comparable to human skin. Furthermore, deposition of collagen IV and laminin-511 were detected by immunofluorescence, indicating the formation of a continuous basement membrane at the dermal-epidermal junction. The proposed method was efficient in producing an in vitro near native HSE using the chosen off-the-shelf porous scaffold (Integra). The same principles and promising outcomes should be applicable to other biodegradable

  12. Sunscreens: topical and systemic approaches for protection of human skin against harmful effects of solar radiation

    International Nuclear Information System (INIS)

    Pathak, M.A.

    1982-01-01

    This review deals with topical and systemic approaches for protection of human skin against the harmful effects of solar radiation. Two concerns about the deleterious effects of sun exposure involve: (1) acute effects (e.g., sunburn and drug-induced phototoxicity) and (2) potential long-term risks of repeated sun exposures leading to development of solar elastosis, keratoses, induction of both nonmelanoma and melanoma skin cancer, and alteration of immune responses and functions. Action spectra of normal and abnormal reactions of human skin to acute and chronic effects of solar radiation are presented with a view to helping the physician prescribe the appropriate sunscreens. Factors that influence acute effects of sunburn are reviewed. Various artificial methods effective in minimizing or preventing harmful effects of solar radiation, both in normal individuals and in patients with photosensitivity-related problems, are discussed. Emphasis is placed on the commercially available chemical sunscreens and their properties. Sun protection factor (SPF) values of several brand-name formulations determined with a solar simulator under indoor conditions (laboratory) and with solar radiation under natural, field conditions are presented. Factors responsible for variations of SPF values observed under indoor and outdoor conditions are reviewed. Systemic photoprotective agents and their limitations are outlined. The photobiology of melanin pigmentation (the tanning reaction) is briefly discussed, with emphasis on the dangers of using quick-tanning lotions for stimulation of the tanning reaction

  13. The safety of donor skin preserved with glycerol - Evaluating the Euro Skin Bank preservation procedures of human donor skin against the prEN 12442 standard

    NARCIS (Netherlands)

    Geertsma RE; Wassenaar C; LGM

    2000-01-01

    The procedures for preservation of human donor skin with glycerol, as applied by the Euro Skin Bank (ESB), were evaluated against the prEN 12442 standard: animal tissues and their derivatives used in the manufacture of medical devices. The focus chosen for this review is on risks related to the

  14. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  15. Collagen synthesis in human musculoskeletal tissues and skin

    DEFF Research Database (Denmark)

    Babraj, J A; Cuthbertson, D J R; Smith, K

    2005-01-01

    We have developed a direct method for the measurement of human musculoskeletal collagen synthesis on the basis of the incorporation of stable isotope-labeled proline or leucine into protein and have used it to measure the rate of synthesis of collagen in tendon, ligament, muscle, and skin....... In postabsorptive, healthy young men (28 +/- 6 yr) synthetic rates for tendon, ligament, muscle, and skin collagen were 0.046 +/- 0.005, 0.040 +/- 0.006, 0.016 +/- 0.002, and 0.037 +/- 0.003%/h, respectively (means +/- SD). In postabsorptive, healthy elderly men (70 +/- 6 yr) the rate of skeletal muscle collagen...... synthesis is greater than in the young (0.023 +/- 0.002%/h, P collagen are similar to those of mixed skeletal muscle protein in the postabsorptive state, whereas the rate for muscle collagen synthesis is much lower in both young and elderly men...

  16. Absorption of orally administered 65Zn by normal human subjects

    International Nuclear Information System (INIS)

    Aamodt, R.L.; Rumble, W.F.; Johnston, G.S.; Markley, E.J.; Henkin, R.I.

    1981-01-01

    Despite studies by several investigators of human gastrointestinal 65Zn absorption, implications of these data for evaluation of functional zinc status are unclear because limited numbers of normal subjects have been studied. To evaluated zinc absorption in normal humans, 75 subjects (31 women, 44 men, ages 18 to 84 yr) were given 10 micro Ci carrier-free 65Zn orally after an overnight fast. Absorption calculated from total body retention measured 7, 14, and 21 days after administration of tracer was 65 +/- 11% (mean +/- 1 SD), range from 40 to 86%. Comparison of these results with those for patients with a variety of diseases indicate that patients exhibit a wider range of absorption and, in four of six studies patients exhibit decreased mean zinc absorption. These results of gastrointestinal zinc absorption in a large number of normal humans offer a basis for a clearer comparison with data from patients who exhibit abnormalities of zinc absorption

  17. Establishing the proteome of normal human cerebrospinal fluid.

    Directory of Open Access Journals (Sweden)

    Steven E Schutzer

    2010-06-01

    Full Text Available Knowledge of the entire protein content, the proteome, of normal human cerebrospinal fluid (CSF would enable insights into neurologic and psychiatric disorders. Until now technologic hurdles and access to true normal samples hindered attaining this goal.We applied immunoaffinity separation and high sensitivity and resolution liquid chromatography-mass spectrometry to examine CSF from healthy normal individuals. 2630 proteins in CSF from normal subjects were identified, of which 56% were CSF-specific, not found in the much larger set of 3654 proteins we have identified in plasma. We also examined CSF from groups of subjects previously examined by others as surrogates for normals where neurologic symptoms warranted a lumbar puncture but where clinical laboratory were reported as normal. We found statistically significant differences between their CSF proteins and our non-neurological normals. We also examined CSF from 10 volunteer subjects who had lumbar punctures at least 4 weeks apart and found that there was little variability in CSF proteins in an individual as compared to subject to subject.Our results represent the most comprehensive characterization of true normal CSF to date. This normal CSF proteome establishes a comparative standard and basis for investigations into a variety of diseases with neurological and psychiatric features.

  18. Functional electrospun fibers for the treatment of human skin wounds.

    Science.gov (United States)

    Wang, Jing; Windbergs, Maike

    2017-10-01

    Wounds are trauma induced defects of the human skin involving a multitude of endogenous biochemical events and cellular reactions of the immune system. The healing process is extremely complex and affected by the patient's physiological conditions, potential implications like infectious pathogens and inflammation as well as external factors. Due to increasing incidence of chronic wounds and proceeding resistance of infection pathogens, there is a strong need for effective therapeutic wound care. In this context, electrospun fibers with diameters in the nano- to micrometer range gain increasing interest. While resembling the structure of the native human extracellular matrix, such fiber mats provide physical and mechanical protection (including protection against bacterial invasion). At the same time, the fibers allow for gas exchange and prevent occlusion of the wound bed, thus facilitating wound healing. In addition, drugs can be incorporated within such fiber mats and their release can be adjusted by the material and dimensions of the individual fibers. The review gives a comprehensive overview about the current state of electrospun fibers for therapeutic application on skin wounds. Different materials as well as fabrication techniques are introduced including approaches for incorporation of drugs into or drug attachment onto the fiber surface. Against the background of wound pathophysiology and established therapy approaches, the therapeutic potential of electrospun fiber systems is discussed. A specific focus is set on interactions of fibers with skin cells/tissues as well as wound pathogens and strategies to modify and control them as key aspects for developing effective wound therapeutics. Further, advantages and limitations of controlled drug delivery from fiber mats to skin wounds are discussed and a future perspective is provided. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

    Science.gov (United States)

    Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

    2011-04-01

    The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  20. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  1. Bacteriostatic enterochelin-specific immunoglobulin from normal human serum

    Energy Technology Data Exchange (ETDEWEB)

    Moore, D.G.; Yancey, R.J.; Lankford, C.E.; Earhart, C.F.

    1980-02-01

    Heat-inactivated normal human serum produces iron-reversible bacteriostasis of a number of microorganisms. This inhibitory effect was abolished by adsorption of serum with ultraviolet-killed cells of species that produce the siderophore enterochelin. Bacteriostasis also was alleviated by asorption of serum with 2,3-dihydroxy-N-benzoyl-L-serine, a degradation product of enterochelin, bound to the insoluble matrix AH-Sepharose 4B. Our results indicate that enterochelin-specific immunoglobulins exist in normal human serum. These immunoglobulins may act synergistically with transferrin to effect bacteriostasis of enterochelin-producing pathogens.

  2. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  3. Age-associated decrease in GDNF and its cognate receptor GFRα-1 protein expression in human skin.

    Science.gov (United States)

    Adly, Mohamed A; Assaf, Hanan A; Hussein, Mahmoud Rezk Abdelwahed

    2016-06-01

    Glial cell line-derived neurotrophic factor (GDNF) and its cognate receptor (GFRα-1) are expressed in normal human skin. They are involved in murine hair follicle morphogenesis and cycling control. We hypothesize that 'GDNF and GFRα-1 protein expression in human skin undergoes age-associated alterations. To test our hypothesis, the expression of these proteins was examined in human skin specimens obtained from 30 healthy individuals representing three age groups: children (5-18 years), adults (19-60 years) and the elderly (61-81 years). Immunofluorescent and light microscopic immunohistologic analyses were performed using tyramide signal amplification and avidin-biotin complex staining methods respectively. GDNF mRNA expression was examined by RT-PCR analysis. GDNF mRNA and protein as well as GFRα-1 protein expressions were detected in normal human skin. We found significantly reduced epidermal expression of these proteins with ageing. In the epidermis, the expression was strong in the skin of children and declined gradually with ageing, being moderate in adults and weak in the elderly. In children and adults, the expression of both GDNF and GFRα-1 proteins was strongest in the stratum basale and decreased gradually towards the surface layers where it was completely absent in the stratum corneum. In the elderly, GDNF and GFRα-1 protein expression was confined to the stratum basale. In the dermis, both GDNF and GFRα-1 proteins had strong expressions in the fibroblasts, sweat glands, sebaceous glands, hair follicles and blood vessels regardless of the age. Thus there is a decrease in epidermal GDNF and GFRα-1 protein expression in normal human skin with ageing. Our findings suggest that the consequences of this is that GFRα-1-mediated signalling is altered during the ageing process. The clinical and therapeutic ramifications of these observations mandate further investigations. © 2016 The Authors. International Journal of Experimental Pathology © 2016

  4. The human skin/chick chorioallantoic membrane model accurately predicts the potency of cosmetic allergens.

    Science.gov (United States)

    Slodownik, Dan; Grinberg, Igor; Spira, Ram M; Skornik, Yehuda; Goldstein, Ronald S

    2009-04-01

    The current standard method for predicting contact allergenicity is the murine local lymph node assay (LLNA). Public objection to the use of animals in testing of cosmetics makes the development of a system that does not use sentient animals highly desirable. The chorioallantoic membrane (CAM) of the chick egg has been extensively used for the growth of normal and transformed mammalian tissues. The CAM is not innervated, and embryos are sacrificed before the development of pain perception. The aim of this study was to determine whether the sensitization phase of contact dermatitis to known cosmetic allergens can be quantified using CAM-engrafted human skin and how these results compare with published EC3 data obtained with the LLNA. We studied six common molecules used in allergen testing and quantified migration of epidermal Langerhans cells (LC) as a measure of their allergic potency. All agents with known allergic potential induced statistically significant migration of LC. The data obtained correlated well with published data for these allergens generated using the LLNA test. The human-skin CAM model therefore has great potential as an inexpensive, non-radioactive, in vivo alternative to the LLNA, which does not require the use of sentient animals. In addition, this system has the advantage of testing the allergic response of human, rather than animal skin.

  5. Response of Human Skin Equivalents to Sarcoptes scabiei

    Science.gov (United States)

    MORGAN, MARJORIE S.; ARLIAN, LARRY G.

    2010-01-01

    Studies have shown that molecules in an extract made from bodies of the ectoparasitic mite, Sarcoptes scabiei De Geer, modulate cytokine secretion from cultured human keratinocytes and fibroblasts. In vivo, in the parasitized skin, these cells interact with each other by contact and cytokine mediators and with the matrix in which they reside. Therefore, these cell types may function differently together than they do separately. In this study, we used a human skin equivalent (HSE) model to investigate the influence of cellular interactions between keratinocytes and fibroblasts when the cells were exposed to active/burrowing scabies mites, mite products, and mite extracts. The HSE consisted of an epidermis of stratified stratum corneum, living keratinocytes, and basal cells above a dermis of fibroblasts in a collagen matrix. HSEs were inoculated on the surface or in the culture medium, and their cytokine secretions on the skin surface and into the culture medium were determined by enzyme-linked immunosorbent assay. Active mites on the surface of the HSE induced secretion of cutaneous T cell-attracting chemokine, thymic stromal lymphopoietin, interleukin (IL)-1α, IL-1β, IL-1 receptor antagonist (IL-1ra), IL-6, IL-8, monocyte chemoattractant protein-1, granulocyte/macrophage colony-stimulating factor, and macrophage colony-stimulating factor. The main difference between HSEs and monocultured cells was that the HSEs produced the proinflammatory cytokines IL-1α and IL-1β and their competitive inhibitor IL-1ra, whereas very little of these mediators was previously found for cultured keratinocytes and fibroblasts. It is not clear how the balance between these cytokines influences the overall host response. However, IL-1ra may contribute to the depression of an early cutaneous inflammatory response to scabies in humans. These contrasting results illustrate that cell interactions are important in the host’s response to burrowing scabies mites. PMID:20939384

  6. Recovery of latent fingerprints and DNA on human skin.

    Science.gov (United States)

    Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

    2010-11-01

    The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%). © 2010 American Academy of Forensic Sciences.

  7. Pyrimidine dimer formation and repair in human skin

    International Nuclear Information System (INIS)

    Sutherland, B.M.; Harber, L.C.; Kochevar, I.E.

    1980-01-01

    Cyclobutyl pyrimidine dimers have been detected in the DNA of human skin following in vivo irradiation with suberythermal doses of ultraviolet (UV) radiation from FS-20 sun lamp fluorescent tubes. Dimers were assayed by treatment of extracted DNA with Micrococus luteus UV-specific endonuclease, alkaline agarose electrophoresis, and ethidum bromide staining. This technique, in contrast to conventional dimer assays, can be used with nonradioactive DNA and is optimal at low UV light doses. These data suggest that some dimer disappearance by excision repair occurs within 20 min of UV irradiation and that photoreactivation of dimers can make a contribution to the total repair process

  8. In vitro dermal absorption of pyrethroid pesticides in human and rat skin

    International Nuclear Information System (INIS)

    Hughes, Michael F.; Edwards, Brenda C.

    2010-01-01

    Dermal exposure to pyrethroid pesticides can occur during manufacture and application. This study examined the in vitro dermal absorption of pyrethroids using rat and human skin. Dermatomed skin from adult male Long Evans rats or human cadavers was mounted in flow-through diffusion cells, and radiolabeled bifenthrin, deltamethrin or cis-permethrin was applied in acetone to the skin. Fractions of receptor fluid were collected every 4 h. At 24 h, the skins were washed with soap and water to remove unabsorbed chemical. The skin was then solubilized. Two additional experiments were performed after washing the skin; the first was tape-stripping the skin and the second was the collection of receptor fluid for an additional 24 h. Receptor fluid, skin washes, tape strips and skin were analyzed for radioactivity. For rat skin, the wash removed 53-71% of the dose and 26-43% remained in the skin. The cumulative percentage of the dose at 24 h in the receptor fluid ranged from 1 to 5%. For human skin, the wash removed 71-83% of the dose and 14-25% remained in the skin. The cumulative percentage of the dose at 24 h in the receptor fluid was 1-2%. Tape-stripping removed 50-56% and 79-95% of the dose in rat and human skin, respectively, after the wash. From 24-48 h, 1-3% and about 1% of the dose diffused into the receptor fluid of rat and human skin, respectively. The pyrethroids bifenthrin, deltamethrin and cis-permethrin penetrated rat and human skin following dermal application in vitro. However, a skin wash removed 50% or more of the dose from rat and human skin. Rat skin was more permeable to the pyrethroids than human skin. Of the dose in skin, 50% or more was removed by tape-stripping, suggesting that permeation of pyrethroids into viable tissue could be impeded. The percentage of the dose absorbed into the receptor fluid was considerably less than the dose in rat and human skin. Therefore, consideration of the skin type used and fractions analyzed are important when using

  9. Detection of hypercholesterolemia using hyperspectral imaging of human skin

    Science.gov (United States)

    Milanic, Matija; Bjorgan, Asgeir; Larsson, Marcus; Strömberg, Tomas; Randeberg, Lise L.

    2015-07-01

    Hypercholesterolemia is characterized by high blood levels of cholesterol and is associated with increased risk of atherosclerosis and cardiovascular disease. Xanthelasma is a subcutaneous lesion appearing in the skin around the eyes. Xanthelasma is related to hypercholesterolemia. Identifying micro-xanthelasma can thereforeprovide a mean for early detection of hypercholesterolemia and prevent onset and progress of disease. The goal of this study was to investigate spectral and spatial characteristics of hypercholesterolemia in facial skin. Optical techniques like hyperspectral imaging (HSI) might be a suitable tool for such characterization as it simultaneously provides high resolution spatial and spectral information. In this study a 3D Monte Carlo model of lipid inclusions in human skin was developed to create hyperspectral images in the spectral range 400-1090 nm. Four lesions with diameters 0.12-1.0 mm were simulated for three different skin types. The simulations were analyzed using three algorithms: the Tissue Indices (TI), the two layer Diffusion Approximation (DA), and the Minimum Noise Fraction transform (MNF). The simulated lesions were detected by all methods, but the best performance was obtained by the MNF algorithm. The results were verified using data from 11 volunteers with known cholesterol levels. The face of the volunteers was imaged by a LCTF system (400- 720 nm), and the images were analyzed using the previously mentioned algorithms. The identified features were then compared to the known cholesterol levels of the subjects. Significant correlation was obtained for the MNF algorithm only. This study demonstrates that HSI can be a promising, rapid modality for detection of hypercholesterolemia.

  10. From hundreds to thousands: Widening the normal human Urinome

    Directory of Open Access Journals (Sweden)

    Laura Santucci

    2014-12-01

    The data are related to Santucci et al. (in press [1] and available both here and at ChorusProject.org under project name “From hundreds to thousands: widening the normal human Urinome”. The material supplied to Chorus Progect.org includes technical MS spectra data only.

  11. Loss of Brain Aerobic Glycolysis in Normal Human Aging.

    Science.gov (United States)

    Goyal, Manu S; Vlassenko, Andrei G; Blazey, Tyler M; Su, Yi; Couture, Lars E; Durbin, Tony J; Bateman, Randall J; Benzinger, Tammie L-S; Morris, John C; Raichle, Marcus E

    2017-08-01

    The normal aging human brain experiences global decreases in metabolism, but whether this affects the topography of brain metabolism is unknown. Here we describe PET-based measurements of brain glucose uptake, oxygen utilization, and blood flow in cognitively normal adults from 20 to 82 years of age. Age-related decreases in brain glucose uptake exceed that of oxygen use, resulting in loss of brain aerobic glycolysis (AG). Whereas the topographies of total brain glucose uptake, oxygen utilization, and blood flow remain largely stable with age, brain AG topography changes significantly. Brain regions with high AG in young adults show the greatest change, as do regions with prolonged developmental transcriptional features (i.e., neoteny). The normal aging human brain thus undergoes characteristic metabolic changes, largely driven by global loss and topographic changes in brain AG. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Detection of human papillomavirus in nonmelanoma skin cancer lesions and healthy perilesional skin in kidney transplant recipients and immunocompetent patients.

    Science.gov (United States)

    Bernat-García, J; Morales Suárez-Varela, M; Vilata-Corell, J J; Marquina-Vila, A

    2014-04-01

    The influence of human papillomavirus (HPV) on the development of nonmelanoma skin cancer (NMSC) is a topic of debate. HPV types from the beta genus (HPV-β) have been most frequently associated with the development of skin cancer. To analyze the prevalence and range of HPV types in NMSC lesions and healthy perilesional skin in immunodepressed and immunocompetent patients and to evaluate the influence of various clinical factors on the prevalence of HPV in skin cancer. Nested polymerase chain reaction and sequencing were used to detect HPV in 120 NMSC samples obtained by biopsy from 30 kidney transplant recipients and 30 immunocompetent patients. In all cases, a sample was taken from the tumor site and the surrounding healthy skin. Potential confounders were assessed and the data analyzed by multivariate logistic regression. HPV DNA was detected in 44 (73.3%) of the 60 samples from immunodepressed patients and in 32 (53.3%) of the 60 samples from immunocompetent patients (adjusted odds ratio, 3.4; 95% CI, 1.2-9.6). In both groups of patients, HPV was more common in healthy perilesional skin than in lesional skin. HPV-β was the most common type isolated. We found a wide range of HPV types (mostly HPV-β) in the skin of kidney transplant recipients and immunocompetent patients with skin cancer. Copyright © 2013 Elsevier España, S.L. and AEDV. All rights reserved.

  13. Prediction of Human Pharmacokinetic Profile After Transdermal Drug Application Using Excised Human Skin.

    Science.gov (United States)

    Yamamoto, Syunsuke; Karashima, Masatoshi; Arai, Yuta; Tohyama, Kimio; Amano, Nobuyuki

    2017-09-01

    Although several mathematical models have been reported for the estimation of human plasma concentration profiles of drug substances after dermal application, the successful cases that can predict human pharmacokinetic profiles are limited. Therefore, the aim of this study is to investigate the prediction of human plasma concentrations after dermal application using in vitro permeation parameters obtained from excised human skin. The in vitro skin permeability of 7 marketed drug products was evaluated. The plasma concentration-time profiles of the drug substances in humans after their dermal application were simulated using compartment models and the clinical pharmacokinetic parameters. The transdermal process was simulated using the in vitro skin permeation rate and lag time assuming a zero-order absorption. These simulated plasma concentration profiles were compared with the clinical data. The result revealed that the steady-state plasma concentration of diclofenac and the maximum concentrations of nicotine, bisoprolol, rivastigmine, and lidocaine after topical application were within 2-fold of the clinical data. Furthermore, the simulated concentration profiles of bisoprolol, nicotine, and rivastigmine reproduced the decrease in absorption due to drug depletion from the formulation. In conclusion, this simple compartment model using in vitro human skin permeation parameters as zero-order absorption predicted the human plasma concentrations accurately. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  14. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao

    2006-01-01

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  15. A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Abbas Rasi

    2014-01-01

    Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

  16. Assessment of penetration of quantum dots through in vitro and in vivo human skin using the human skin equivalent model and the tape stripping method

    International Nuclear Information System (INIS)

    Jeong, Sang Hoon; Kim, Jae Hwan; Yi, Sang Min; Lee, Jung Pyo; Kim, Jin Ho; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-01

    Quantum dots (QDs) are rapidly emerging as an important class of nanoparticles (NPs) with potential applications in medicine. However, little is known about penetration of QDs through human skin. This study investigated skin penetration of QDs in both in vivo and in vitro human skin. Using the tape stripping method, this study demonstrates for the first time that QDs can actually penetrate through the stratum corneum (SC) of human skin. Transmission electron microscope (TEM) and energy diverse X-ray (EDX) analysis showed accumulation of QDs in the SC of a human skin equivalent model (HSEM) after dermal exposure to QDs. These findings suggest possible transdermal absorption of QDs after dermal exposure over a relatively long period of time.

  17. Fractional calculus model of electrical impedance applied to human skin.

    Science.gov (United States)

    Vosika, Zoran B; Lazovic, Goran M; Misevic, Gradimir N; Simic-Krstic, Jovana B

    2013-01-01

    Fractional calculus is a mathematical approach dealing with derivatives and integrals of arbitrary and complex orders. Therefore, it adds a new dimension to understand and describe basic nature and behavior of complex systems in an improved way. Here we use the fractional calculus for modeling electrical properties of biological systems. We derived a new class of generalized models for electrical impedance and applied them to human skin by experimental data fitting. The primary model introduces new generalizations of: 1) Weyl fractional derivative operator, 2) Cole equation, and 3) Constant Phase Element (CPE). These generalizations were described by the novel equation which presented parameter [Formula: see text] related to remnant memory and corrected four essential parameters [Formula: see text] We further generalized single generalized element by introducing specific partial sum of Maclaurin series determined by parameters [Formula: see text] We defined individual primary model elements and their serial combination models by the appropriate equations and electrical schemes. Cole equation is a special case of our generalized class of models for[Formula: see text] Previous bioimpedance data analyses of living systems using basic Cole and serial Cole models show significant imprecisions. Our new class of models considerably improves the quality of fitting, evaluated by mean square errors, for bioimpedance data obtained from human skin. Our models with new parameters presented in specific partial sum of Maclaurin series also extend representation, understanding and description of complex systems electrical properties in terms of remnant memory effects.

  18. Fractional calculus model of electrical impedance applied to human skin.

    Directory of Open Access Journals (Sweden)

    Zoran B Vosika

    Full Text Available Fractional calculus is a mathematical approach dealing with derivatives and integrals of arbitrary and complex orders. Therefore, it adds a new dimension to understand and describe basic nature and behavior of complex systems in an improved way. Here we use the fractional calculus for modeling electrical properties of biological systems. We derived a new class of generalized models for electrical impedance and applied them to human skin by experimental data fitting. The primary model introduces new generalizations of: 1 Weyl fractional derivative operator, 2 Cole equation, and 3 Constant Phase Element (CPE. These generalizations were described by the novel equation which presented parameter [Formula: see text] related to remnant memory and corrected four essential parameters [Formula: see text] We further generalized single generalized element by introducing specific partial sum of Maclaurin series determined by parameters [Formula: see text] We defined individual primary model elements and their serial combination models by the appropriate equations and electrical schemes. Cole equation is a special case of our generalized class of models for[Formula: see text] Previous bioimpedance data analyses of living systems using basic Cole and serial Cole models show significant imprecisions. Our new class of models considerably improves the quality of fitting, evaluated by mean square errors, for bioimpedance data obtained from human skin. Our models with new parameters presented in specific partial sum of Maclaurin series also extend representation, understanding and description of complex systems electrical properties in terms of remnant memory effects.

  19. Analyzing reflectance spectra of human skin in legal medicine

    Science.gov (United States)

    Belenki, Liudmila; Sterzik, Vera; Schulz, Katharina; Bohnert, Michael

    2013-01-01

    Our current research in the framework of an interdisciplinary project focuses on modelling the dynamics of the hemoglobin reoxygenation process in post-mortem human skin by reflectance spectrometry. The observations of reoxygenation of hemoglobin in livores after postmortem exposure to a cold environment relate the reoxygenation to the commonly known phenomenon that the color impression of livores changes from livid to pink under low ambient temperatures. We analyze the spectra with respect to a physical model describing the optical properties of human skin, discuss the dynamics of the reoxygenation, and propose a phenomenological model for reoxygenation. For additional characterization of the reflectance spectra, the curvature of the local minimum and maximum in the investigated spectral range is considered. There is a strong correlation between the curvature of specra at a wavelength of 560 nm and the concentration of O2-Hb. The analysis is carried out via C programs, as well as MySQL database queries in Java EE, JDBC, Matlab, and Python.

  20. Ultraviolet Radiation Induced Apoptosis in Human Skin In Vivo

    Energy Technology Data Exchange (ETDEWEB)

    Sheehan, J.M.; Young, A.R

    2000-07-01

    Sunburn cells, having many characteristics of apoptotic cells, appear in human skin after exposure to UVB. Time-courses and dose responses for solar simulated radiation (SSR)-induced sunburn cells in human volunteers of skin type II have been determined. For the time-course, two groups of volunteers were exposed to two minimal erythema doses (MED) of SSR. Punch biopsies were obtained from Group 1 immediately, 3, 6, 12, 18 and 24 h after SSR exposure and Group 2 were biopsied immediately, 18, 24, 36, 48 and 72 h after exposure. For the dose-response (Group 3), biopsies were taken 24 h after SSR exposure to 0, 0.25, 0.5, 1, 2 and 3 MED. Sections were stained with H and E and also using TUNEL and analysed by light microscopy. Results show a dose-dependent appearance of SBC after SSR exposure. The time point for maximum SBC counts with both H and E staining and TUNEL staining lie between 24 and 36 h. (author)

  1. Ultraviolet Radiation Induced Apoptosis in Human Skin In Vivo

    International Nuclear Information System (INIS)

    Sheehan, J.M.; Young, A.R.

    2000-01-01

    Sunburn cells, having many characteristics of apoptotic cells, appear in human skin after exposure to UVB. Time-courses and dose responses for solar simulated radiation (SSR)-induced sunburn cells in human volunteers of skin type II have been determined. For the time-course, two groups of volunteers were exposed to two minimal erythema doses (MED) of SSR. Punch biopsies were obtained from Group 1 immediately, 3, 6, 12, 18 and 24 h after SSR exposure and Group 2 were biopsied immediately, 18, 24, 36, 48 and 72 h after exposure. For the dose-response (Group 3), biopsies were taken 24 h after SSR exposure to 0, 0.25, 0.5, 1, 2 and 3 MED. Sections were stained with H and E and also using TUNEL and analysed by light microscopy. Results show a dose-dependent appearance of SBC after SSR exposure. The time point for maximum SBC counts with both H and E staining and TUNEL staining lie between 24 and 36 h. (author)

  2. In Vitro Desensitization of Human Skin Mast Cells

    Science.gov (United States)

    Zhao, Wei; Gomez, Gregorio; Macey, Matthew; Kepley, Christopher L.

    2013-01-01

    Desensitization is a clinical procedure whereby incremental doses of a drug are administered over several hours to a sensitive patient until a therapeutic dose and clinical tolerance are achieved. Clinical tolerance may occur in part by attenuating the mast cell response. In the present study, primary human skin mast cells were used to establish and characterize an in vitro model of desensitization. Mast cells in culture were armed with allergen-specific (4-hydroxy-3-nitro-phenylacety and Der p2) and non-specific IgE antibodies, and then desensitized by incremental exposures to 4-hydroxy-3-nitrophenylacety-BSA. This desensitization procedure abrogated the subsequent degranulation response to the desensitizing allergen, to an unrelated allergen, and to IgG anti-FcεRI, but not to C5a, substance P, compound 48/80, and calcium ionophore. Desensitized cells regained their FcεRI-dependent degranulation capability by 24–48 h after free allergen had been removed. Therefore, sensitized human skin mast cells are reversibly desensitized in vitro by exposure to incremental doses of that allergen, which also cross-desensitizes them to an unrelated allergen. PMID:22009002

  3. Does human leukocyte elastase degrade intact skin elastin?

    DEFF Research Database (Denmark)

    Schmelzer, Christian E H; Jung, Michael C; Wohlrab, Johannes

    2012-01-01

    This study aimed to investigate the susceptibility of intact fibrillar human elastin to human leukocyte elastase and cathepsin G. Elastin is a vital protein of the extracellular matrix of vertebrates, and provides exceptional properties including elasticity and tensile strength to many tissues...... and organs, including the aorta, lung, cartilage, elastic ligaments and skin, and is thus critical for their long-term function. Mature elastin is an insoluble and extremely durable protein that undergoes very little turnover, but sustained exposure to proteases may lead to irreversible and severe damage......, and thus to functional loss of the elastic fiber network. Hence, it is a key issue to understand which enzymes actually initiate elastolysis under certain pathological conditions or during intrinsic aging. In this paper, we provide a complete workflow for isolation of pure and intact elastin from very...

  4. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  5. Temperature modulation of the visible and near infrared absorption and scattering coefficients of human skin.

    Science.gov (United States)

    Khalil, Omar S; Yeh, Shu-Jen; Lowery, Michael G; Wu, Xiaomao; Hanna, Charles F; Kantor, Stanislaw; Jeng, Tzyy-Wen; Kanger, Johannes S; Bolt, Rene A; de Mul, Frits F

    2003-04-01

    We determine temperature effect on the absorption and reduced scattering coefficients (mu(a) and mu(s)(')) of human forearm skin. Optical and thermal simulation data suggest that mu( a) and mu(s)(') are determined within a temperature-controlled depth of approximately 2 mm. Cutaneous mu(s)(') change linearly with temperature. Change in mu(a) was complex and irreversible above body normal temperatures. Light penetration depth (delta) in skin increased on cooling, with considerable person-to-person variations. We attribute the effect of temperature on mu(s)(') to change in refractive index mismatch, and its effect on mu(a) to perfusion changes. The reversible temperature effect on mu (s)(' ) was maintained during more than 90 min. contact between skin and the measuring probe, where temperature was modulated between 38 and 22 degrees C for multiple cycles While temperature modulated mu(s)(' ) instantaneously and reversibly, mu(a) exhibited slower response time and consistent drift. There was a statistically significant upward drift in mu(a) and a mostly downward drift in mu( s)(') over the contact period. The drift in temperature-induced fractional change in mu(s)(') was less statistically significant than the drift in mu(s)('). Deltamu( s)(') values determined under temperature modulation conditions may have less nonspecific drift than mu(s)(') which may have significance for noninvasive determination of analytes in human tissue.

  6. Next generation human skin constructs as advanced tools for drug development.

    Science.gov (United States)

    Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela

    2017-11-01

    Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various

  7. Porphyrin metabolisms in human skin commensal Propionibacterium acnes bacteria: potential application to monitor human radiation risk.

    Science.gov (United States)

    Shu, M; Kuo, S; Wang, Y; Jiang, Y; Liu, Y-T; Gallo, R L; Huang, C-M

    2013-01-01

    Propionibacterium acnes (P. acnes), a Gram-positive anaerobic bacterium, is a commensal organism in human skin. Like human cells, the bacteria produce porphyrins, which exhibit fluorescence properties and make bacteria visible with a Wood's lamp. In this review, we compare the porphyrin biosynthesis in humans and P. acnes. Also, since P. acnes living on the surface of skin receive the same radiation exposure as humans, we envision that the changes in porphyrin profiles (the absorption spectra and/or metabolism) of P. acnes by radiation may mirror the response of human cells to radiation. The porphyrin profiles of P. acnes may be a more accurate reflection of radiation risk to the patient than other biodosimeters/biomarkers such as gene up-/down-regulation, which may be non-specific due to patient related factors such as autoimmune diseases. Lastly, we discuss the challenges and possible solutions for using the P. acnes response to predict the radiation risk.

  8. Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

    Science.gov (United States)

    Fullerton, A; Serup, J

    1997-02-01

    To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

  9. In vivo transformation of human skin with human papillomavirus type 11 from condylomatot acuminata

    International Nuclear Information System (INIS)

    Kreider, J.W.; Howett, M.K.; Lill, N.L.; Bartlett, G.L.; Zaino, R.J.; Sedlacek, T.V.; Mortel, R.

    1986-01-01

    Human papillomaviruses (HPVs) have been implicated in the development of a number of human malignancies, but direct tests of their involvement have not been possible. The authors describe a system in which human skin from various skin from various sites was infected with HPV type 11 (HPV-11) extracted from vulvar condylomata and was grafted beneath the renal capsule of athymic mice. Most of the skin grafts so treated underwent morphological transformation, resulting in the development of condylomata identical to those which occur spontaneously in patients. Foreskins responded with the most vigorous proliferative response to HPV-11. The lesions produced the characteristic intranuclear group-specific antigen of papillomaviruses. Both dot blot and Southern blot analysis of DNA from the lesions revealed the presence of HPV-11 DNA in the transformed grafts. These results demonstrate the first laboratory system for the study of the interaction of human skin with an HPV. The method may be useful in understanding the mechanisms of HPV transformation and replication and is free of the ethical restraints which have impeded study. This system will allow the direct study of factors which permit neoplastic progression of HPV-induced cutaneous lesions in human tissues

  10. Regulation of pigmentation by substrate elasticity in normal human melanocytes and melanotic MNT1 human melanoma cells.

    Science.gov (United States)

    Choi, Hyunjung; Kim, Mina; Ahn, Song Ih; Cho, Eun-Gyung; Lee, Tae Ryong; Shin, Jennifer H

    2014-03-01

    The elasticity of the cellular microenvironment is a key regulator of cellular physiology in many cell types. To investigate the effects of substrate stiffness on the pigmentation process, we cultured normal human melanocytes (NHM) and MNT1 melanoma cells on laminin-coated polydimethylsiloxane (PDMS) substrates of different stiffness. The dendricity of NHM and MNT1 cells was reduced as the substrate stiffness decreased, and the degree of melanosome transfer from NHM or MNT1 cells to normal human keratinocytes was decreased on softer substrates with the reduced dendricity. Gene and protein expressions of MITF, tyrosinase, TRP2, and gp100/PMEL17 exhibited a consistent decreasing trend with the decreasing stiffness. Because the stiffness sensing is mediated by focal adhesion complex through integrin receptors, we checked laminin specific integrin alpha 6 and p-FAK for MNT1 cells to observe that the substrate adhesion was weakened as the substrate stiffness decreased. Weaker adhesion on a softer substrate was accompanied by dynamic shape changes in MNT1 cells with higher speed and larger scattering. Dendritic MNT1 cells cultured on a stiffer substrate exhibited lower migration with smaller root mean squared displacement. These results demonstrate the possibility that skin pigmentation can be influenced by mechanical properties of the cellular microenvironment and can increase when the skin becomes stiff. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  12. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  13. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  14. EPR detection of free radicals in UV-irradiated skin: mouse versus human

    International Nuclear Information System (INIS)

    Jurkiewicz, B.A.; Buettner, G.R.

    1996-01-01

    Ultraviolet radiation produces free radicals in Skh-1 mouse skin, contributing to photoaging and carcinogenesis. If a mouse model is a general indicator of free radical processes in human skin photobiology, then radical production observed in mouse and human skin should be directly comparative. In this work we show that UV radiation (λ > 300 nm, 14 μW/cm 2 UVB; 3.5 mW/cm 2 UVA) increases the ascorbate free radical (Asc) electron paramagnetic resonance (EPR) signal in both Skh-1 mouse skin (45%) and human facial skin biopsies (340%). Visible light (λ > 400 nm; 0.23 mW/cm 2 UVA) also increased the Ascsignal in human skin samples (45%) but did not increase baseline mouse Asc, indicating that human skin is more susceptible to free radical formation and that a chromophore for visible light may be present. Using EPR spin-trapping techniques, UV radiation produced spin adducts consistent with trapping lipid alkyl radicals in mouse skin (α-[4-pyridyl 1-oxide]-N-tert-butyl nitrone/alkyl radical adduct; a N = 15.56 G and a H 2.70 G) and lipid alkoxyl radicals in human skin (5,5-dimethylpyrroline -1-oxide/alkoxyl radical adduct; a N = 14.54 G and a H = 16.0 G). Topical application of the iron chelator Desferal to human skin significantly decreases these radicals (∼50%), indicating a role for iron in lipid peroxidation. (Author)

  15. Quantitative second-harmonic generation imaging to detect osteogenesis imperfecta in human skin samples

    Science.gov (United States)

    Adur, J.; Ferreira, A. E.; D'Souza-Li, L.; Pelegati, V. B.; de Thomaz, A. A.; Almeida, D. B.; Baratti, M. O.; Carvalho, H. F.; Cesar, C. L.

    2012-03-01

    Osteogenesis Imperfecta (OI) is a genetic disorder that leads to bone fractures due to mutations in the Col1A1 or Col1A2 genes that affect the primary structure of the collagen I chain with the ultimate outcome in collagen I fibrils that are either reduced in quantity or abnormally organized in the whole body. A quick test screening of the patients would largely reduce the sample number to be studied by the time consuming molecular genetics techniques. For this reason an assessment of the human skin collagen structure by Second Harmonic Generation (SHG) can be used as a screening technique to speed up the correlation of genetics/phenotype/OI types understanding. In the present work we have used quantitative second harmonic generation (SHG) imaging microscopy to investigate the collagen matrix organization of the OI human skin samples comparing with normal control patients. By comparing fibril collagen distribution and spatial organization, we calculated the anisotropy and texture patterns of this structural protein. The analysis of the anisotropy was performed by means of the two-dimensional Discrete Fourier Transform and image pattern analysis with Gray-Level Co-occurrence Matrix (GLCM). From these results, we show that statistically different results are obtained for the normal and disease states of OI.

  16. Human renin biosynthesis and secretion in normal and ischemic kidneys

    International Nuclear Information System (INIS)

    Pratt, R.E.; Carleton, J.E.; Richie, J.P.; Heusser, C.; Dzau, V.J.

    1987-01-01

    The pathway of renin biosynthesis and secretion in normal and ischemic human kidneys has been investigated by pulse-labeling experiments. The results indicate that in normal human kidney, preprorenin is rapidly processed to 47-kDa prorenin. Microradiosequencing showed that this molecule was generated by cleavage between Gly-23 and Leu-24, yielding a 43-amino acid proregion. Analysis of prorenin secreted by the kidney tissue yielded an identical sequence, indicating that prorenin is secreted without any further proteolysis. An examination of the kinetics of processing and secretion suggested that a majority of the newly synthesized prorenin is quickly secreted, while only a small fraction is processed intracellularly to the mature renin. The differences in secretion kinetics between prorenin and mature renin and the selective inhibition of prorenin secretion by monensin suggest that they are secreted independently via two pathways: a constitutive pathway probably from the Golgi or protogranules that rapidly release prorenin and a regulated pathway that secretes mature renin from the mature granules. A comparison of the kinetics of processing between normal and ischemic tissues suggests that renal ischemia leads to an overall increase in the rate of processing or prorenin to mature renin. In addition, prolonged biosynthetic labeling of renin in the ischemic kidney yielded two smaller molecular weight immunoreactive forms suggestive of renin fragments that may be degradative products. These fragments were not detected in normal kidney tissue labeled for similar lengths of time

  17. Speckle reduction in optical coherence tomography images of human skin by a spatial diversity method - art. no. 66270P

    DEFF Research Database (Denmark)

    Jørgensen, Thomas Martini; Thrane, Lars; Mogensen, M.

    2007-01-01

    the scheme with a mobile fiber-based time-domain real-time OCT system. Essential enhancement was obtained in image contrast when performing in vivo imaging of normal skin and lesions. Resulting images show improved delineation of structure in correspondence with the observed improvements in contrast...... system. Here, we consider a method that in principle can be fitted to most OCT systems without major modifications. Specifically, we address a spatial diversity technique for suppressing speckle noise in OCT images of human skin. The method is a variant of changing the position of the sample relative...

  18. 3D bioprinting of functional human skin: production and in vivo analysis.

    Science.gov (United States)

    Cubo, Nieves; Garcia, Marta; Del Cañizo, Juan F; Velasco, Diego; Jorcano, Jose L

    2016-12-05

    Significant progress has been made over the past 25 years in the development of in vitro-engineered substitutes that mimic human skin, either to be used as grafts for the replacement of lost skin, or for the establishment of in vitro human skin models. In this sense, laboratory-grown skin substitutes containing dermal and epidermal components offer a promising approach to skin engineering. In particular, a human plasma-based bilayered skin generated by our group, has been applied successfully to treat burns as well as traumatic and surgical wounds in a large number of patients in Spain. There are some aspects requiring improvements in the production process of this skin; for example, the relatively long time (three weeks) needed to produce the surface required to cover an extensive burn or a large wound, and the necessity to automatize and standardize a process currently performed manually. 3D bioprinting has emerged as a flexible tool in regenerative medicine and it provides a platform to address these challenges. In the present study, we have used this technique to print a human bilayered skin using bioinks containing human plasma as well as primary human fibroblasts and keratinocytes that were obtained from skin biopsies. We were able to generate 100 cm 2 , a standard P100 tissue culture plate, of printed skin in less than 35 min (including the 30 min required for fibrin gelation). We have analysed the structure and function of the printed skin using histological and immunohistochemical methods, both in 3D in vitro cultures and after long-term transplantation to immunodeficient mice. In both cases, the generated skin was very similar to human skin and, furthermore, it was indistinguishable from bilayered dermo-epidermal equivalents, handmade in our laboratories. These results demonstrate that 3D bioprinting is a suitable technology to generate bioengineered skin for therapeutical and industrial applications in an automatized manner.

  19. Appreciating the image of God in all humanity: Towards a pastoral response to skin lightening as image enhancement to exit dark skin

    Directory of Open Access Journals (Sweden)

    Noah K. Tenai

    2016-05-01

    Full Text Available The practice of skin lightening is prevalent amongst dark-skinned people globally. Various current studies that map this practice and that seek motivations behind the practice are examined. It is observed that through shrewd marketing, dark-skinned people are offered a promise of a better quality of life, obtained by a lighter skin, through the use of skin lighteners. In spite of the severe health risks involved, the promise is ostensibly irresistible to some dark-skinned persons. A pastoral response is offered that affirms the full personhood and complete humanity of dark-skinned people as fully human and whole in their dark skins. Keywords: Skin lightening, Dark skin, Image of God

  20. Proteome analysis identifies L1CAM/CD171 and DPP4/CD26 as novel markers of human skin mast cells.

    Science.gov (United States)

    Gschwandtner, M; Paulitschke, V; Mildner, M; Brunner, P M; Hacker, S; Eisenwort, G; Sperr, W R; Valent, P; Gerner, C; Tschachler, E

    2017-01-01

    The function of skin mast cells has been well documented in IgE-mediated allergic reactions, whereas other mast cell functions are poorly defined. This study aimed at identifying novel mast cell proteins by proteome analysis of primary human skin mast cells. The proteome of skin mast cells was compared to other cell types and analyzed using bioinformatics. The expression and function of two proteins hitherto not described in skin mast cells was investigated in isolated mast cells as well as in mast cells in situ. Within the mast cell proteome, we identified 49 highly expressed proteins previously not described in mast cells; 21 of these proteins were found to be selectively expressed in mast cells. Two proteins, the neural cell adhesion molecule L1 and dipeptidyl peptidase 4, were further studied. L1 was found to be highly expressed in mast cells in normal, psoriasis, and mastocytosis skin. Dipeptidyl peptidase 4 was found to be expressed in mast cells in normal, psoriasis, and mastocytosis skin as well as in bone marrow mast cells in patients with systemic mastocytosis. In normal skin, mast cells were identified as a major source of dipeptidyl peptidase 4 and we also found that skin mast cells and fibroblasts secrete an active form of this enzyme. In a systematic proteomics approach we identified two novel mast cell proteins potentially relevant to skin homeostasis: neural cell adhesion molecule L1 and dipeptidyl peptidase 4. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Enhanced skin permeation of naltrexone by pulsed electromagnetic fields in human skin in vitro.

    Science.gov (United States)

    Krishnan, Gayathri; Edwards, Jeffrey; Chen, Yan; Benson, Heather A E

    2010-06-01

    The aim of the present study was to evaluate the skin permeation of naltrexone (NTX) under the influence of a pulsed electromagnetic field (PEMF). The permeation of NTX across human epidermis and a silicone membrane in vitro was monitored during and after application of the PEMF and compared to passive application. Enhancement ratios of NTX human epidermis permeation by PEMF over passive diffusion, calculated based on the AUC of cumulative NTX permeation to the receptor compartment verses time for 0-4 h, 4-8 h, and over the entire experiment (0-8 h) were 6.52, 5.25, and 5.66, respectively. Observation of the curve indicated an initial enhancement of NTX permeation compared to passive delivery whilst the PEMF was active (0-4 h). This was followed by a secondary phase after termination of PEMF energy (4-8 h) in which there was a steady increase in NTX permeation. No significant enhancement of NTX penetration across silicone membrane occurred with PEMF application in comparison to passively applied NTX. In a preliminary experiment PEMF enhanced the penetration of 10 nm gold nanoparticles through the stratum corneum as visualized by multiphoton microscopy. This suggests that the channels through which the nanoparticles move must be larger than the 10 nm diameter of these rigid particles. (c) 2009 Wiley-Liss, Inc. and the American Pharmacists Association

  2. The Protective Role of Melanin Against UV Damage in Human Skin

    OpenAIRE

    Brenner, Michaela; Hearing, Vincent J.

    2008-01-01

    Human skin is repeatedly exposed to ultraviolet radiation (UVR) that influences the function and survival of many cell types and is regarded as the main causative factor in the induction of skin cancer. It has been traditionally believed that skin pigmentation is the most important photoprotective factor, since melanin, besides functioning as a broadband UV absorbent, has antioxidant and radical scavenging properties. Besides, many epidemiological studies have shown a lower incidence for skin...

  3. Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

    Science.gov (United States)

    Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

    2018-04-06

    The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

  4. Characterising the variations in ethnic skin colours: a new calibrated data base for human skin.

    Science.gov (United States)

    Xiao, K; Yates, J M; Zardawi, F; Sueeprasan, S; Liao, N; Gill, L; Li, C; Wuerger, S

    2017-02-01

    Accurate skin colour measurements are important for numerous medical applications including the diagnosis and treatment of cutaneous disorders and the provision of maxillofacial soft tissue prostheses. In this study, we obtained accurate skin colour measurements from four different ethnic groups (Caucasian, Chinese, Kurdish, Thai) and at four different body locations (Forehead, cheek, inner arm, back of hand) with a view of establishing a new skin colour database for medical and cosmetic applications. Skin colours are measured using a spectrophotometer and converted to a device-independent standard colour appearance space (CIELAB) where skin colour is expressed as values along the three dimensions: Lightness L*, Redness a* and Yellowness b*. Skin colour differences and variation are then evaluated as a function of ethnicity and body location. We report three main results: (1) When plotted in a standard colour appearance space (CIELAB), skin colour distributions for the four ethnic groups overlap significantly, although there are systematic mean differences. Between ethnicities, the most significant skin colour differences occur along the yellowness dimension, with Thai skin exhibiting the highest yellowness (b*) value and Caucasian skin the lowest value. Facial redness (a*) is invariant across the four ethnic groups. (2) Between different body locations, there are significant variations in redness (a*), with the forehead showing the highest redness value and the inner arm the lowest. (3) The colour gamut is smallest in the Chinese sample and largest in the Caucasian sample, with the Chinese gamut lying entirely the Caucasian gamut. Similarly, the largest variability in skin tones is found in the Caucasian group, and the smallest in the Chinese group. Broadly speaking, skin colour variation can be explained by two main factors: individual differences in lightness and yellowness are mostly due to ethnicity, whereas differences in redness are primarily due to

  5. Proof-of-concept: 3D bioprinting of pigmented human skin constructs.

    Science.gov (United States)

    Ng, Wei Long; Qi, Jovina Tan Zhi; Yeong, Wai Yee; Naing, May Win

    2018-01-23

    Three-dimensional (3D) pigmented human skin constructs have been fabricated using a 3D bioprinting approach. The 3D pigmented human skin constructs are obtained from using three different types of skin cells (keratinocytes, melanocytes and fibroblasts from three different skin donors) and they exhibit similar constitutive pigmentation (pale pigmentation) as the skin donors. A two-step drop-on-demand bioprinting strategy facilitates the deposition of cell droplets to emulate the epidermal melanin units (pre-defined patterning of keratinocytes and melanocytes at the desired positions) and manipulation of the microenvironment to fabricate 3D biomimetic hierarchical porous structures found in native skin tissue. The 3D bioprinted pigmented skin constructs are compared to the pigmented skin constructs fabricated by conventional a manual-casting approach; in-depth characterization of both the 3D pigmented skin constructs has indicated that the 3D bioprinted skin constructs have a higher degree of resemblance to native skin tissue in term of the presence of well-developed stratified epidermal layers and the presence of a continuous layer of basement membrane proteins as compared to the manually-cast samples. The 3D bioprinting approach facilitates the development of 3D in vitro pigmented human skin constructs for potential toxicology testing and fundamental cell biology research.

  6. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  7. Multivariate Models for Prediction of Human Skin Sensitization Hazard.

    Science.gov (United States)

    One of the lnteragency Coordinating Committee on the Validation of Alternative Method's (ICCVAM) top priorities is the development and evaluation of non-animal approaches to identify potential skin sensitizers. The complexity of biological events necessary to produce skin sensiti...

  8. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  9. The effects of Sophora angustifolia and other natural plant extracts on melanogenesis and melanin transfer in human skin cells.

    Science.gov (United States)

    Singh, Suman K; Baker, Richard; Wibawa, Judata I D; Bell, Mike; Tobin, Desmond J

    2013-01-01

    Skin pigmentation is a multistep process of melanin synthesis by melanocytes, its transfer to recipient keratinocytes and its degradation. As dyspigmentation is a prominent marker of skin ageing, novel effective agents that modulate pigmentation safely are being sought for both clinical and cosmetic use. Here, a number of plant extracts were examined for their effect on melanogenesis (by melanin assay and Western blotting) and melanin transfer (by confocal immunomicroscopy of gp100-positive melanin granules in cocultures and by SEM analysis of filopodia), in human melanocytes and in cocultures with phototype-matched normal adult epidermal keratinocytes. Mulberry, Kiwi and Sophora extracts were assessed against isobutylmethylxanthine, hydroquinone, vitamin C and niacinamide. Compared with unstimulated control, all extracts significantly reduced melanogenesis in human melanoma cells and normal adult epidermal melanocytes. These extracts also reduced melanin transfer and reduced filopodia expression on melanocytes, similar to hydroquinone and niacinamide, indicating their effectiveness as multimode pigmentation actives. © 2013 John Wiley & Sons A/S.

  10. Targeting PI3K-AKT-mTOR by LY3023414 inhibits human skin squamous cell carcinoma cell growth in vitro and in vivo.

    Science.gov (United States)

    Zou, Ying; Ge, Minggai; Wang, Xuemin

    2017-08-19

    Abnormal activation of PI3K-AKT-mTOR signaling is detected in human skin squamous cell carcinoma (SCC). LY3023414 is a novel, potent, and orally bio-available PI3K-AKT-mTOR inhibitor. Its activity against human skin SCC cells was tested. We demonstrated that LY3023414 was cytotoxic when added to established (A431 line) and primary (patient-derived) human skin SCC cells. LY3023414 induced G0/1-S arrest and inhibited proliferation of skin SCC cells. Moreover, LY3023414 induced activation of caspase-3/-9 and apoptosis in skin SCC cells. Intriguingly, LY3023414 was yet non-cytotoxic nor pro-apoptotic to normal human skin cells (melanocytes, keratinocytes and fibroblasts). At the molecular level, LY3023414 blocked PI3K-AKT-mTOR activation in skin SCC cells, as it dephosphorylated PI3K-AKT-mTOR substrates: P85, AKT and S6K1. In vivo studies showed that oral administration of LY3023414 at well-tolerated doses inhibited A431 xenograft tumor growth in severe combined immunodeficiency (SCID) mice. AKT-mTOR activation in LY3023414-treated tumors was also largely inhibited. Together, these results suggest that targeting PI3K-AKT-mTOR by LY3023414 inhibits human skin SCC cell growth in vitro and in vivo, establishing the rationale for further clinical testing. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. INTESTINAL VIROME AND NORMAL MICROFLORA OF HUMAN: FEATURES OF INTERACTION

    Directory of Open Access Journals (Sweden)

    Bobyr V.V.

    2015-05-01

    Full Text Available Summary: Intestinal bacteria defend the host organism and narrow pathogenic bacterial colonization. However, the microbiome effect to enteric viruses is unexplored largely as well as role of microbiota in the pathogenesis of viral infections in general. This review focuses on precisely these issues. Keywords: microbiome, virome, normal microflora, enteric viruses, contagiousness. In this review article, facts about viral persistence in the human gut are summarized. It is described the role of viral populations during health and diseases. After analyzing of the literary facts it was concluded that the gastrointestinal tract is an environment for one from the most complex microbial ecosystems, which requires of more deeper study of its composition, role in physiological processes, as well as the dynamics of changes under influence of the environment. Normal microflora performs a different important functions providing the physiological homeostasis of the human body, including, in particular, an important role in the human metabolic processes, supporting of homeostasis, limiting of colonization by infectious bacteria. The multifactorial significance of the normal gastrointestinal microflora can be divided into immunological, structural and metabolic functions. At the same time, interaction between intestinal microflora and enteric viruses has not been studied largely. In recent years, much attention is paid to study of viruses-bacteria associations, and it is possible, obtained results should change our understanding of microbiota role in the systematic pathogenesis of the diseases with viral etiology. In contrast to the well-known benefits of normal microflora to the host, the viruses can use intestinal microflora as a trigger for replication at the optimal region. Recent studies give a reason for assumption that depletion of normal microflora with antibiotics can determining the antiviral effect. Thus, the role of commensal bacteria in viral

  12. General anesthesia suppresses normal heart rate variability in humans

    Science.gov (United States)

    Matchett, Gerald; Wood, Philip

    2014-06-01

    The human heart normally exhibits robust beat-to-beat heart rate variability (HRV). The loss of this variability is associated with pathology, including disease states such as congestive heart failure (CHF). The effect of general anesthesia on intrinsic HRV is unknown. In this prospective, observational study we enrolled 100 human subjects having elective major surgical procedures under general anesthesia. We recorded continuous heart rate data via continuous electrocardiogram before, during, and after anesthesia, and we assessed HRV of the R-R intervals. We assessed HRV using several common metrics including Detrended Fluctuation Analysis (DFA), Multifractal Analysis, and Multiscale Entropy Analysis. Each of these analyses was done in each of the four clinical phases for each study subject over the course of 24 h: Before anesthesia, during anesthesia, early recovery, and late recovery. On average, we observed a loss of variability on the aforementioned metrics that appeared to correspond to the state of general anesthesia. Following the conclusion of anesthesia, most study subjects appeared to regain their normal HRV, although this did not occur immediately. The resumption of normal HRV was especially delayed on DFA. Qualitatively, the reduction in HRV under anesthesia appears similar to the reduction in HRV observed in CHF. These observations will need to be validated in future studies, and the broader clinical implications of these observations, if any, are unknown.

  13. Super Normal Vector for Human Activity Recognition with Depth Cameras.

    Science.gov (United States)

    Yang, Xiaodong; Tian, YingLi

    2017-05-01

    The advent of cost-effectiveness and easy-operation depth cameras has facilitated a variety of visual recognition tasks including human activity recognition. This paper presents a novel framework for recognizing human activities from video sequences captured by depth cameras. We extend the surface normal to polynormal by assembling local neighboring hypersurface normals from a depth sequence to jointly characterize local motion and shape information. We then propose a general scheme of super normal vector (SNV) to aggregate the low-level polynormals into a discriminative representation, which can be viewed as a simplified version of the Fisher kernel representation. In order to globally capture the spatial layout and temporal order, an adaptive spatio-temporal pyramid is introduced to subdivide a depth video into a set of space-time cells. In the extensive experiments, the proposed approach achieves superior performance to the state-of-the-art methods on the four public benchmark datasets, i.e., MSRAction3D, MSRDailyActivity3D, MSRGesture3D, and MSRActionPairs3D.

  14. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  15. The Human Skin Microbiome Associates with the Outcome of and Is Influenced by Bacterial Infection

    OpenAIRE

    van Rensburg, Julia J.; Lin, Huaiying; Gao, Xiang; Toh, Evelyn; Fortney, Kate R.; Ellinger, Sheila; Zwickl, Beth; Janowicz, Diane M.; Katz, Barry P.; Nelson, David E.; Dong, Qunfeng; Spinola, Stanley M.

    2015-01-01

    ABSTRACT The influence of the skin microbiota on host susceptibility to infectious agents is largely unexplored. The skin harbors diverse bacterial species that may promote or antagonize the growth of an invading pathogen. We developed a human infection model for Haemophilus ducreyi in which human volunteers are inoculated on the upper arm. After inoculation, papules form and either spontaneously resolve or progress to pustules. To examine the role of the skin microbiota in the outcome of H. ...

  16. Characterisation of human skin models - stability, metabolic capacity and comparative investigations in percutaneous absorption

    OpenAIRE

    Schreiber, Sylvia

    2010-01-01

    In recent years, the demand for alternative test methods in safety assessment of cosmetics, risk assessment of chemicals, and testing of pharmaceuticals was increasingly included in the EU directives. Thereby, alternative test methods for the determination of percutaneous absorption should achieve a more reliable in vivo prediction of the response of human skin than animal skin. Even though freshly excised human skin is considered as a preferred test matrix its routine use is often difficult ...

  17. Comparison of protocols for measuring cosmetic ingredient distribution in human and pig skin.

    Science.gov (United States)

    Gerstel, D; Jacques-Jamin, C; Schepky, A; Cubberley, R; Eilstein, J; Grégoire, S; Hewitt, N; Klaric, M; Rothe, H; Duplan, H

    2016-08-01

    The Cosmetics Europe Skin Bioavailability and Metabolism Task Force aims to improve the measurement and prediction of the bioavailability of topically-exposed compounds for risk assessment. Key parameters of the experimental design of the skin penetration studies were compared. Penetration studies with frozen human and pig skin were conducted in two laboratories, according to the SCCS and OECD 428 guidelines. The disposition in skin was measured 24h after finite topical doses of caffeine, resorcinol and 7-ethoxycoumarin. The bioavailability distribution in skin layers of cold and radiolabelled chemicals were comparable. Furthermore, the distribution of each chemical was comparable in human and pig skin. The protocol was reproducible across the two laboratories. There were small differences in the amount of chemical detected in the skin layers, which were attributed to differences in washing procedures and anatomical sites of the skin used. In conclusion, these studies support the use of pig skin as an alternative source of skin should the availability of human skin become a limiting factor. If radiolabelled chemicals are not available, cold chemicals can be used, provided that the influence of chemical stability, reactivity or metabolism on the experimental design and the relevance of the data obtained is considered. Copyright © 2016. Published by Elsevier Ltd.

  18. Multiphoton STED and FRET in human skin: Resolving the skin barrier

    DEFF Research Database (Denmark)

    Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.

    intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...

  19. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Lei [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Xiao, Yongsheng [Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States); Wang, Yinsheng, E-mail: yinsheng.wang@ucr.edu [Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521-0403 (United States); Department of Chemistry, University of California, Riverside, CA 92521-0403 (United States)

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

  20. Histamine is not released in acute thermal injury in human skin in vivo: a microdialysis study

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Pedersen, Juri Lindy; Skov, Per Stahl

    2009-01-01

    BACKGROUND: Animal models have shown histamine to be released from the skin during the acute phase of a burn injury. The role of histamine during the early phase of thermal injuries in humans remains unclear. PURPOSE: The objectives of this trial were to study histamine release in human skin during...

  1. Metabolism of azo dyes by human skin microbiota.

    Science.gov (United States)

    Stingley, Robin L; Zou, Wen; Heinze, Thomas M; Chen, Huizhong; Cerniglia, Carl E

    2010-01-01

    Reduction of Methyl Red (MR) and Orange II (Or II) by 26 human skin bacterial species was monitored by a rapid spectrophotometric assay. The analysis indicated that skin bacteria, representing the genera Staphylococcus, Corynebacterium, Micrococcus, Dermacoccus and Kocuria, were able to reduce MR by 74-100 % in 24 h, with only three species unable to reduce completely the dye in that time. Among the species tested, only Corynebacterium xerosis was unable to reduce Or II to any degree by 24 h, and only Staphylococcus delphini, Staphylococcus sciuri subsp. sciuri and Pseudomonas aeruginosa were able to reduce completely this dye within 24 h. MR reduction started with early-exponential growth in Staphylococcus aureus and Staphylococcus epidermidis, and around late-exponential/early-stationary growth in P. aeruginosa. Reduction of Or II, Ponceau S and Ponceau BS started during late-exponential/early-stationary growth for all three species. Using liquid chromatography/electrospray ionization mass spectrometry analyses, MR metabolites produced by Staph. aureus, Staph. epidermidis and P. aeruginosa were identified as N,N-dimethyl-p-phenylenediamine and 2-aminobenzoic acid. Searches of available genomic and proteomic data revealed that at least four of the staphylococci in this study, Staphylococcus haemolyticus, Staph. epidermidis, Staphylococcus cohnii and Staphylococcus saprophyticus, have hypothetical genes with 77, 76, 75 and 74 % sequence identity to azo1 encoding an azoreductase from Staph. aureus and hypothetical proteins with 82, 80, 72 and 74 % identity to Azo1, respectively. In addition, Staphylococcus capitis has a protein with 79 % identity to Azo1. Western analysis detected proteins similar to Azo1 in all the staphylococci tested, except Staph. delphini, Staph. sciuri subsp. sciuri and Staphylococcus auricularis. The data presented in this report will be useful in the risk assessment process for evaluation of public exposure to products containing these dyes.

  2. Blackcurrant Anthocyanins Increase the Levels of Collagen, Elastin, and Hyaluronic Acid in Human Skin Fibroblasts and Ovariectomized Rats

    Directory of Open Access Journals (Sweden)

    Naoki Nanashima

    2018-04-01

    Full Text Available Blackcurrants (Ribes nigrum L. contain high levels of anthocyanin polyphenols, which have beneficial effects on health, owing to their antioxidant and anticarcinogenic properties. Phytoestrogens are plant-derived substances with estrogenic activity, which could have beneficial effects on the skin. Estradiol secretion decreases during menopause, reducing extracellular matrix (ECM component production by skin fibroblasts. Using a normal human female skin fibroblast cell line (TIG113 and ovariectomized rats, the present study investigated whether an anthocyanin-rich blackcurrant extract (BCE and four blackcurrant anthocyanins have novel phytoestrogenic activities that could benefit the skin in menopausal women. In TIG113 cells, a microarray and the Ingenuity® Pathway Analysis showed that 1.0 μg/mL of BCE upregulated the expression of many estrogen signaling-related genes. A quantitative RT-PCR analysis confirmed that BCE (1.0 or 10.0 μg/mL and four types of anthocyanins (10 μM altered the mRNA expression of ECM proteins and enzymes involved in ECM turnover. Immunofluorescence staining indicated that the anthocyanins stimulated the expression of ECM proteins, such as collagen (types I and III and elastin. Dietary administration of 3% BCE to ovariectomized rats for 3 months increased skin levels of collagen, elastin, and hyaluronic acid. This is the first study to show that blackcurrant phytoestrogens have beneficial effects on skin experimental models.

  3. Insertion Testing of Polyethylene Glycol Microneedle Array into Cultured Human Skin with Biaxial Tension

    Science.gov (United States)

    Takano, Naoki; Tachikawa, Hiroto; Miyano, Takaya; Nishiyabu, Kazuaki

    Aiming at the practical use of polyethylene glycol (PEG) microneedles for transdermal drug delivery system (DDS), a testing apparatus for their insertion into cultured human skin has been developed. To simulate the variety of conditions of human skin, biaxial tension can be applied to the cultured human skin. An adopted testing scheme to apply and control the biaxial tension is similar to the deep-draw forming technique. An attention was also paid to the short-time setup of small, thin and wet cultured skin. One dimensional array with four needles was inserted and influence of tension was discussed. It was found that tension, deflection of skin during insertion and original curvature of skin are the important parameters for microneedles array design.

  4. Characterization of the early local immune response to Ixodes ricinus tick bites in human skin.

    Science.gov (United States)

    Glatz, Martin; Means, Terry; Haas, Josef; Steere, Allen C; Müllegger, Robert R

    2017-03-01

    Little is known about the immunomodulation by tick saliva during a natural tick bite in human skin, the site of the tick-host interaction. We examined the expression of chemokines, cytokines and leucocyte markers on the mRNA levels and histopathologic changes in human skin biopsies of tick bites (n=37) compared to unaffected skin (n=9). Early tick-bite skin lesions (skin. With longer tick attachment (>24 hours), the numbers of innate immune cells and mediators (not significantly) declined, whereas the numbers of lymphocytes (not significantly) increased. Natural tick bites by Ixodes ricinus ticks initially elicit a strong local innate immune response in human skin. Beyond 24 hours of tick attachment, this response usually becomes less, perhaps because of immunomodulation by tick saliva. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Human Skin Is the Largest Epithelial Surface for Interaction with Microbes.

    Science.gov (United States)

    Gallo, Richard L

    2017-06-01

    Human skin contains an abundant and diverse population of microbial organisms. Many of these microbes inhabit follicular structures of the skin. Furthermore, numerous studies have shown that the interaction of some members of the skin microbiome with host cells will result in changes in cell function. However, estimates of the potential for the microbiome to influence human health through skin have ignored the inner follicular surface, and therefore vastly underestimated the potential of the skin microbiome to have a systemic effect on the human body. By calculating the surface area of follicular and the interfollicular epithelial surface it is shown that skin provides a vast interface for interactions with the microbiome. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  6. Under Persistent Assault: Understanding the Factors that Deteriorate Human Skin and Clinical Efficacy of Topical Antioxidants in Treating Aging Skin

    Directory of Open Access Journals (Sweden)

    Patricia K. Farris

    2015-11-01

    Full Text Available Recent studies contend that the skin is subject to far more damage than just ultraviolet (UV light, with infrared radiation and pollution now clearly demonstrated to degrade cutaneous tissue. While consumers continue to strive for new ways to augment the aesthetic appeal and improve the health of their skin, awareness regarding environmental insults and effective ways to protect the skin remains low. New advances in dermatologic science have exponentially increased the available information on the underlying mechanism of cutaneous damage and potential of topical antioxidants to treat aging skin. Combining antioxidants that can work through multiple pathways holds great potential for a cumulative and synergistic way to treat aging skin. Our goal is to provide a comprehensive review on environmental factors that damage human skin, discuss scientifically proven benefits of topical antioxidants, understand challenges of formulating and administering topical antioxidants, evaluate novel mechanisms of antioxidant activity, and suggest practical ways of integrating topical antioxidants with aesthetic procedures to complement clinical outcomes.

  7. DNA repair synthesis in human skin exposed to ultraviolet radiation used in PUVA (psoralen and UV-A) therapy for psoriasis

    International Nuclear Information System (INIS)

    Bishop, S.C.

    1979-01-01

    The ultraviolet radiation used in psoralen and UV-A (PUVA) therapy stimulated DNA repair activity in normal human skin and in the uninvolved skin from psoriatic patients. The activity detected by autoradiography increased linearly with exposure time. No stimulation was observed when the UV-B component was removed from the incident radiation by filtration through glass. Therefore UV-B damage to DNA was found responsible for the activity detected following exposure to the unfiltered PUVA light source. (author)

  8. Amnion s and radio-sterilized porcine skin use as potential matrices for the development of human skin substitutes

    International Nuclear Information System (INIS)

    Martinez P, M. E.; Reyes F, M. L.; Reboyo B, D.; Velasquillo M, M. C.; Sanchez S, R.; Brena M, A. M.; Ibarra P, J. C.

    2014-10-01

    The injuries by burns constitute a primordial problem of public health; they cause a high mortality index, severe physical and psychological disability, etc. The autologous skin transplant is the replacement therapy recommended for its treatment, but in patients that present a high percentage of burnt skin; this is not possible to carry out. Another strategy is the transplant of donated skin; however, due to the little donation that exists in our country is not very feasible to apply this treatment. A challenge of the tissues engineering is to develop biological skin substitutes, based on cells and amnion s, favoring the cutaneous regeneration and quick repair of injuries, diminishing this way the hospitalization expenses. At present skin substitutes that can equal to the same skin do not exist. On the other hand, the mesenchymal stromal cells (Msc) represent an alternative to achieve this objective; since has been demonstrated that the Msc participate in the tissue repair by means of inhibition of pro-inflammatory cytokines and differentiation to dermal fibroblasts and keratinocytes. To apply the Msc in cutaneous injuries a support material is required that to allow transplanting these cells to a lesion or burn. The radio-sterilized human amnion and the radio-sterilized porcine skin, processed by the Radio-Sterilized Tissues Bank of the Instituto Nacional de Investigaciones Nucleares (ININ), are biomaterials that are used as temporary cutaneous coverings. We suppose that these two matrices will be appropriate for the growth and maintenance in cultivation of the Msc, to generate two biological skin substitutes, in collaboration with the Biotechnology Laboratory of the Instituto Nacional de Rehabilitacion. (Author)

  9. Targeted sequencing of clade-specific markers from skin microbiomes for forensic human identification.

    Science.gov (United States)

    Schmedes, Sarah E; Woerner, August E; Novroski, Nicole M M; Wendt, Frank R; King, Jonathan L; Stephens, Kathryn M; Budowle, Bruce

    2018-01-01

    The human skin microbiome is comprised of diverse communities of bacterial, eukaryotic, and viral taxa and contributes millions of additional genes to the repertoire of human genes, affecting human metabolism and immune response. Numerous genetic and environmental factors influence the microbiome composition and as such contribute to individual-specific microbial signatures which may be exploited for forensic applications. Previous studies have demonstrated the potential to associate skin microbial profiles collected from touched items to their individual owner, mainly using unsupervised methods from samples collected over short time intervals. Those studies utilize either targeted 16S rRNA or shotgun metagenomic sequencing to characterize skin microbiomes; however, these approaches have limited species and strain resolution and susceptibility to stochastic effects, respectively. Clade-specific markers from the skin microbiome, using supervised learning, can predict individual identity using skin microbiomes from their respective donors with high accuracy. In this study the hidSkinPlex is presented, a novel targeted sequencing method using skin microbiome markers developed for human identification. The hidSkinPlex (comprised of 286 bacterial (and phage) family-, genus-, species-, and subspecies-level markers), initially was evaluated on three bacterial control samples represented in the panel (i.e., Propionibacterium acnes, Propionibacterium granulosum, and Rothia dentocariosa) to assess the performance of the multiplex. The hidSkinPlex was further evaluated for prediction purposes. The hidSkinPlex markers were used to attribute skin microbiomes collected from eight individuals from three body sites (i.e., foot (Fb), hand (Hp) and manubrium (Mb)) to their host donor. Supervised learning, specifically regularized multinomial logistic regression and 1-nearest-neighbor classification were used to classify skin microbiomes to their hosts with up to 92% (Fb), 96% (Mb

  10. Abnormal phenotype of cultured fibroblasts in human skin with chronic radiotherapy damage

    International Nuclear Information System (INIS)

    Delanian, S.; Martin, M.; Lefaix, J.-L.; Bravard, A.; Luccioni, C.

    1998-01-01

    Purpose: The pathophysiological aspects of radiation-induced fibrosis (RIF) have not been well characterized. We therefore cultured human fibroblasts from samples of skin with RIF to investigate the long-term effects of therapeutic irradiation. Materials and methods: Biopsies of normal and RIF skin were obtained from patients previously irradiated for cancer, without recurrence. Cells were extracted from dermis samples by the outgrowth technique, seeded as monolayers and cultured at confluence. Enzyme activities and proteins were assayed, RNA was isolated and Northern blot analysis was performed on surviving cells between passages 2 and 5. Results: RIF cell cultures displayed heterogeneous fibroblasts populations. The initial outgrowth consisted of one-third small cells that floated rapidly, one-third spindle-shaped cells migrating far from the explant to form islets and one-third large pleiomorphic cells. In subsequent subcultures, surviving cells exhibited either myofibroblastic characteristics with a normal proliferative capacity or senescent morphology with a reduced proliferative capacity. These RIF cells had a brief finite lifespan, with dramatically reduced growth rate during their initial outgrowth and the following passages. Study of the antioxidant metabolism showed that Mn superoxide dismutase and catalase activities were significantly weaker in surviving RIF cells than healthy fibroblasts. These exhausted RIF cells exhibited no overexpression of transforming growth factor β or tissue inhibitor of metalloproteinase. Conclusion: Irradiation may lead to apparently contradictory effects such as fibrosis and necrosis in clinical practice. In cell culture, we observed two main cellular phenotypes which may be related to both processes, i.e. myofibroblast-like cells and fibrocyte-like cells. These two phenotypes may represent two steps in the differentiation induced as a long-term effect of therapeutic irradiation of the skin. Cell culture probably

  11. An Approach to Noise Reduction in Human Skin Admittance Measurements

    National Research Council Canada - National Science Library

    Kondakci, Suleyman

    2001-01-01

    This paper presents the development of a signal averaging algorithm for recovering excitation responses contaminated by overwhelming amount of various types of interference in skin admittance measurements...

  12. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  13. Ketone body metabolism in normal and diabetic human skeletal muscle

    International Nuclear Information System (INIS)

    Nosadini, R.; Avogaro, A.; Sacca, L.

    1985-01-01

    Although the liver is considered the major source of ketone bodies (KB) in humans, these compounds may also be formed by nonhepatic tissues. To study this aspect further, 3-[ 14 C]hydroxybutyrate (BOH) or [3- 14 C]acetoacetate (AcAc) were constantly infused after a priming dose and contemporaneous arterial and venous samples were taken at splanchnic, heart, kidney, and leg sites in eight normal subjects (N) undergoing diagnostic catheterization and at the forearm site in five normal and six ketotic diabetic (D) subjects. After 70 min of infusion, tracer and tracee levels of AcAc and BOH reached a steady state in the artery and vein in both normal and diabetic subjects. The venous-arterial (V-A) difference at the forearm step for cold KB was negligible both in normal and diabetic subjects, whereas for labeled KB it was approximately 10-fold higher in diabetic subjects (V-A AcAc, -31 +/- 7 and -270 +/- 34 dpm/ml in N and D, respectively; V-A BOH, -38 +/- 6 and -344 +/- 126 dpm/ml in N and D, respectively). The authors assumed that the V-A difference in tracer concentration was consistent with dilution of the tracer by newly synthesized tracee inside the muscle and calculated that the forearm muscle produces KB at a rate of 16.2 +/- 3.3 mumol/min in D and 0.9 +/- 0.9 mumol/min in N. These findings can be accounted for by the hypothesis that the disappearance flux of KB from circulation was replaced by an equivalent flux of KB entering the vein at the muscle step in D but not in N. Moreover, in N KB were not only produced but also utilized by the splanchnic area (39 +/- 9 mumol/min)

  14. Human skin in vitro permeation of bentazon and isoproturon formulations with or without protective clothing suit.

    Science.gov (United States)

    Berthet, Aurélie; Hopf, Nancy B; Miles, Alexandra; Spring, Philipp; Charrière, Nicole; Garrigou, Alain; Baldi, Isabelle; Vernez, David

    2014-01-01

    Skin exposures to chemicals may lead, through percutaneous permeation, to a significant increase in systemic circulation. Skin is the primary route of entry during some occupational activities, especially in agriculture. To reduce skin exposures, the use of personal protective equipment (PPE) is recommended. PPE efficiency is characterized as the time until products permeate through material (lag time, Tlag). Both skin and PPE permeations are assessed using similar in vitro methods; the diffusion cell system. Flow-through diffusion cells were used in this study to assess the permeation of two herbicides, bentazon and isoproturon, as well as four related commercial formulations (Basagran(®), Basamais(®), Arelon(®) and Matara(®)). Permeation was measured through fresh excised human skin, protective clothing suits (suits) (Microchem(®) 3000, AgriSafe Pro(®), Proshield(®) and Microgard(®) 2000 Plus Green), and a combination of skin and suits. Both herbicides, tested by itself or as an active ingredient in formulations, permeated readily through human skin and tested suits (Tlag < 2 h). High permeation coefficients were obtained regardless of formulations or tested membranes, except for Microchem(®) 3000. Short Tlag, were observed even when skin was covered with suits, except for Microchem(®) 3000. Kp values tended to decrease when suits covered the skin (except when Arelon(®) was applied to skin covered with AgriSafe Pro and Microgard(®) 2000), suggesting that Tlag alone is insufficient in characterizing suits. To better estimate human skin permeations, in vitro experiments should not only use human skin but also consider the intended use of the suit, i.e., the active ingredient concentrations and type of formulations, which significantly affect skin permeation.

  15. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  16. From frog integument to human skin: dermatological perspectives from frog skin biology

    NARCIS (Netherlands)

    Haslam, I.S.; Roubos, E.W.; Mangoni, M.L.; Yoshizato, K.; Vaudry, H.; Kloepper, J.E.; Pattwell, D.M.; Maderson, P.F.A.; Paus, R.

    2014-01-01

    For over a century, frogs have been studied across various scientific fields, including physiology, embryology, neuroscience, (neuro)endocrinology, ecology, genetics, behavioural science, evolution, drug development, and conservation biology. In some cases, frog skin has proven very successful as a

  17. Normalization of Deviation: Quotation Error in Human Factors.

    Science.gov (United States)

    Lock, Jordan; Bearman, Chris

    2018-05-01

    Objective The objective of this paper is to examine quotation error in human factors. Background Science progresses through building on the work of previous research. This requires accurate quotation. Quotation error has a number of adverse consequences: loss of credibility, loss of confidence in the journal, and a flawed basis for academic debate and scientific progress. Quotation error has been observed in a number of domains, including marine biology and medicine, but there has been little or no previous study of this form of error in human factors, a domain that specializes in the causes and management of error. Methods A study was conducted examining quotation accuracy of 187 extracts from 118 published articles that cited a control article (Vaughan's 1996 book: The Challenger Launch Decision: Risky Technology, Culture, and Deviance at NASA). Results Of extracts studied, 12.8% ( n = 24) were classed as inaccurate, with 87.2% ( n = 163) being classed as accurate. A second dimension of agreement was examined with 96.3% ( n = 180) agreeing with the control article and only 3.7% ( n = 7) disagreeing. The categories of accuracy and agreement form a two by two matrix. Conclusion Rather than simply blaming individuals for quotation error, systemic factors should also be considered. Vaughan's theory, normalization of deviance, is one systemic theory that can account for quotation error. Application Quotation error is occurring in human factors and should receive more attention. According to Vaughan's theory, the normal everyday systems that promote scholarship may also allow mistakes, mishaps, and quotation error to occur.

  18. Ultrastructural age-related changes in the sensory corpuscles of the human genital skin.

    Science.gov (United States)

    Tammaro, A; Parisella, F R; Cavallotti, C; Persechino, S; Cavallotti, C

    2013-01-01

    In human genital skin the majority of superficial sensory corpuscles is represented by glomerular corpuscles. These corpuscles show an own morphology. Our aim is to compare the ultra-structure of superficial sensory corpuscles in the penis skin of younger and older subjects. In this report the ultra-structure of the sensitive corpuscle in the penis skin of the younger and older subjects was compared, showing that the genital skin of the older humans contains more simple complexes than the younger ones. Our findings support the view that the age-related changes that can be observed in human glomerular genital corpuscles are consistent with an increase of the simple complexes and a strong decrease of the poly-lamellar one in the older people. These findings demonstrate that human genital corpuscles underwent age-related changes. Moreover our morphological findings can be correlated in relation to the clinical evolution of the sensitivity in the genital skin.

  19. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  20. Imaging-guided two-photon excitation-emission-matrix measurements of human skin tissues

    Science.gov (United States)

    Yu, Yingqiu; Lee, Anthony M. D.; Wang, Hequn; Tang, Shuo; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

    2012-07-01

    There are increased interests on using multiphoton imaging and spectroscopy for skin tissue characterization and diagnosis. However, most studies have been done with just a few excitation wavelengths. Our objective is to perform a systematic study of the two-photon fluorescence (TPF) properties of skin fluorophores, normal skin, and diseased skin tissues. A nonlinear excitation-emission-matrix (EEM) spectroscopy system with multiphoton imaging guidance was constructed. A tunable femtosecond laser was used to vary excitation wavelengths from 730 to 920 nm for EEM data acquisition. EEM measurements were performed on excised fresh normal skin tissues, seborrheic keratosis tissue samples, and skin fluorophores including: NADH, FAD, keratin, melanin, collagen, and elastin. We found that in the stratum corneum and upper epidermis of normal skin, the cells have large sizes and the TPF originates from keratin. In the lower epidermis, cells are smaller and TPF is dominated by NADH contributions. In the dermis, TPF is dominated by elastin components. The depth resolved EEM measurements also demonstrated that keratin structure has intruded into the middle sublayers of the epidermal part of the seborrheic keratosis lesion. These results suggest that the imaging guided TPF EEM spectroscopy provides useful information for the development of multiphoton clinical devices for skin disease diagnosis.

  1. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  2. Chronologic and actinically induced aging in human facial skin

    International Nuclear Information System (INIS)

    Gilchrest, B.A.; Szabo, G.; Flynn, E.; Goldwyn, R.M.

    1983-01-01

    Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation

  3. Machine Learning Approaches for Predicting Human Skin Sensitization Hazard

    Science.gov (United States)

    One of ICCVAM’s top priorities is the development and evaluation of non-animal approaches to identify potential skin sensitizers. The complexity of biological events necessary for a substance to elicit a skin sensitization reaction suggests that no single in chemico, in vit...

  4. Multivariate Models for Prediction of Skin Sensitization Hazard in Humans

    Science.gov (United States)

    One of ICCVAM’s highest priorities is the development and evaluation of non-animal approaches to identify potential skin sensitizers. The complexity of biological events necessary for a substance to elicit a skin sensitization reaction suggests that no single alternative me...

  5. Photoprotection by pistachio bioactives in a 3-dimensional human skin equivalent tissue model.

    Science.gov (United States)

    Chen, C-Y Oliver; Smith, Avi; Liu, Yuntao; Du, Peng; Blumberg, Jeffrey B; Garlick, Jonathan

    2017-09-01

    Reactive oxygen species (ROS) generated during ultraviolet (UV) light exposure can induce skin damage and aging. Antioxidants can provide protection against oxidative injury to skin via "quenching" ROS. Using a validated 3-dimensional (3D) human skin equivalent (HSE) tissue model that closely mimics human skin, we examined whether pistachio antioxidants could protect HSE against UVA-induced damage. Lutein and γ-tocopherol are the predominant lipophilic antioxidants in pistachios; treatment with these compounds prior to UVA exposure protected against morphological changes to the epithelial and connective tissue compartments of HSE. Pistachio antioxidants preserved overall skin thickness and organization, as well as fibroblast morphology, in HSE exposed to UVA irradiation. However, this protection was not substantiated by the analysis of the proliferation of keratinocytes and apoptosis of fibroblasts. Additional studies are warranted to elucidate the basis of these discordant results and extend research into the potential role of pistachio bioactives promoting skin health.

  6. Cutaneous in vivo metabolism of topical lidocaine formulation in human skin

    DEFF Research Database (Denmark)

    Rolsted, K; Benfeldt, E; Kissmeyer, A-M

    2009-01-01

    Little is known about the metabolising capacity of the human skin in relation to topically applied drugs and formulations. We chose lidocaine as a model compound since the metabolic pathways are well known from studies concerning hepatic metabolism following systemic drug administration. However......, the enzymes involved are also expressed in the skin. Hence, the aim of the current study was to investigate the extent of the cutaneous in vivo metabolism of topically applied lidocaine in human volunteers. A dose of 5 mg/cm(2) of Xylocaine(R) (5% lidocaine) ointment was applied onto the buttock skin...... of the volunteers. After 2 h, residual formulation was removed, and two 4-mm punch biopsies were taken from each volunteer. The quantity of lidocaine extracted from the skin samples (epidermis + dermis) was 109 +/- 43 ng/mm(2) skin. One metabolite (monoethylglycine xylidide, MEGX) was detected in skin from 7...

  7. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier

    DEFF Research Database (Denmark)

    Dreier, Jes; Sørensen, Jens A; Brewer, Jonathan R

    2016-01-01

    In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS) to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human...... skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED) images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm...... liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers...

  8. Three-dimensional multispectral optoacoustic mesoscopy reveals melanin and blood oxygenation in human skin in vivo.

    Science.gov (United States)

    Schwarz, Mathias; Buehler, Andreas; Aguirre, Juan; Ntziachristos, Vasilis

    2016-01-01

    Optical imaging plays a major role in disease detection in dermatology. However, current optical methods are limited by lack of three-dimensional detection of pathophysiological parameters within skin. It was recently shown that single-wavelength optoacoustic (photoacoustic) mesoscopy resolves skin morphology, i.e. melanin and blood vessels within epidermis and dermis. In this work we employed illumination at multiple wavelengths for enabling three-dimensional multispectral optoacoustic mesoscopy (MSOM) of natural chromophores in human skin in vivo operating at 15-125 MHz. We employ a per-pulse tunable laser to inherently co-register spectral datasets, and reveal previously undisclosed insights of melanin, and blood oxygenation in human skin. We further reveal broadband absorption spectra of specific skin compartments. We discuss the potential of MSOM for label-free visualization of physiological biomarkers in skin in vivo. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Oxidative stress and CCN1 protein in human skin connective tissue aging

    Directory of Open Access Journals (Sweden)

    Zhaoping Qin

    2016-06-01

    Full Text Available Reactive oxygen species (ROS is an important pathogenic factor involved in human aging. Human skin is a primary target of oxidative stress from ROS generated from both extrinsic and intrinsic sources, like ultraviolet irradiation (UV and endogenous oxidative metabolism. Oxidative stress causes the alterations of collagen-rich extracellular matrix (ECM, the hallmark of skin connective tissue aging. Age-related alteration of dermal collagenous ECM impairs skin structural integrity and creates a tissue microenvironment that promotes age-related skin diseases, such as poor wound healing and skin cancer. Here, we review recent advances in our understanding of oxidative stress and CCN1 protein (first member of CCN family proteins, a critical mediator of oxidative stress-induced skin connective tissue aging.

  10. Herpes virus production as a marker of repair in ultra-violet irradiated human skin cells of different origin

    Energy Technology Data Exchange (ETDEWEB)

    Coppey, J; Nocentini, S; Menezes, S [Institut du Radium, 75 - Paris (France). Lab. Curie; Moreno, G

    1979-07-01

    Human skin fibroblast cultures were irradiated with ultraviolet light 0 to 48 hours before infection with herpes simplex virus type 1 (HSV). Different viral yields were obtained according to the origin of the host cells. Cells from normal donors showed a dose-dependent recovery of HSV production during the 36-40 hours following U.V. exposure. The recovery was maximal for a dose at which a plateau level of unscheduled DNA synthesis (UDS) was reached (24Jm/sup -2/). In a xeroderma pigmentosum (XP) heterozygote line from a mother of XP children, the level of UDS after irradiation up to 48 Jm/sup -2/ was normal whereas the extent of recovery of HSV production capacity was lower than normal. In strains from XP children, with a normal UDS (XP variants), the recovery process was slower and its extent was lower than in normal or XP heterozygote cells. Excision-deficient XP strains from XP children presented little or no recovery, the extent of which was in good agreement with the corresponding level of UDS. Measurement of this recovery seems to be a very sensitive assay for detecting differences in the repair abilities of U.V.-irradiated human skin cells of various origins.

  11. Investigation of pion-treated human skin nodules for therapeutic gain

    International Nuclear Information System (INIS)

    Kligerman, M.M.; Sala, J.M.; Wilson, S.; Yuhas, J.M.

    1978-01-01

    A patient with multiple metastatic tumor nodules in the skin, from a primary breast carcinoma, was treated with graded doses of pions and x rays to establish skin tolerance. She was followed up for 346 days, permitting observation of time to regrowth of the tumor nodules. All 16 of these had disappeared after treatment, without significant correlation with type of radiation or dose, or with nodule size. However, time to regrowth depended both on the type and the dose of radiation. Earlier, relative biological effectiveness (RBE), was established at 1.42 for acute skin injury. Using this RBE to normalize doses of pions and x rays causing equivalent acute skin injury, and plotting those doses vs time to regrowth of tumor nodules, yielded a therapeutic gain (37.5%) in favor of pions. No late skin or subcutaneous tissue changes were seen, and no qualitative difference between pions and x rays in late skin effects was observed

  12. Research on human skin laser damage thresholds. Final report, Nov 1971--Jun 1974

    Energy Technology Data Exchange (ETDEWEB)

    Rockwell, R.J. Jr.; Goldman, L.

    1974-06-01

    The report gives the results of a two-year study to determine the lowest radiant exposure levels at which the first observable reactions occur on human skin exposed to electromagnetic radiations emitted by normal mode and Q-switched ruby, Q-switched neodymium-glass, carbon dioxide, argon and neodymium-YAG laser devices. The principal goal of the study was to establish the 50 percent probability dose for such minimal reactions observed one-hour post-exposure. Such minimal radiant exposure levels are defined, for the purpose of this report, as the fifty percent probability dose for minimal reactions, and are designated as MRD50 (Minimal Reaction Dose, 50% probability). (GRA)

  13. Psoriasiform skin disease in transgenic pigs with high-copy ectopic expression of human integrins α2 and β1

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Stenderup, Karin; Mortensen, Sidsel; Primo, Maria Nascimento; Steiniche, Torben; Liu, Ying; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Schrøder, Lisbeth Dahl; Svensson, Lars; Petersen, Thomas Kongstad; Callesen, Henrik; Bolund, Lars

    2017-01-01

    ABSTRACT Psoriasis is a complex human-specific disease characterized by perturbed keratinocyte proliferation and a pro-inflammatory environment in the skin. Porcine skin architecture and immunity are very similar to that in humans, rendering the pig a suitable animal model for studying the biology and treatment of psoriasis. Expression of integrins, which is normally confined to the basal layer of the epidermis, is maintained in suprabasal keratinocytes in psoriatic skin, modulating proliferation and differentiation as well as leukocyte infiltration. Here, we generated minipigs co-expressing integrins α2 and β1 in suprabasal epidermal layers. Integrin-transgenic minipigs born into the project displayed skin phenotypes that correlated with the number of inserted transgenes. Molecular analyses were in good concordance with histological observations of psoriatic hallmarks, including hypogranulosis and T-lymphocyte infiltration. These findings mark the first creation of minipigs with a psoriasiform phenotype resembling human psoriasis and demonstrate that integrin signaling plays a key role in psoriasis pathology. PMID:28679670

  14. Solar ultraviolet irradiation induces decorin degradation in human skin likely via neutrophil elastase.

    Science.gov (United States)

    Li, Yong; Xia, Wei; Liu, Ying; Remmer, Henriette A; Voorhees, John; Fisher, Gary J

    2013-01-01

    Exposure of human skin to solar ultraviolet (UV) irradiation induces matrix metalloproteinase-1 (MMP-1) activity, which degrades type I collagen fibrils. Type I collagen is the most abundant protein in skin and constitutes the majority of skin connective tissue (dermis). Degradation of collagen fibrils impairs the structure and function of skin that characterize skin aging. Decorin is the predominant proteoglycan in human dermis. In model systems, decorin binds to and protects type I collagen fibrils from proteolytic degradation by enzymes such as MMP-1. Little is known regarding alterations of decorin in response to UV irradiation. We found that solar-simulated UV irradiation of human skin in vivo stimulated substantial decorin degradation, with kinetics similar to infiltration of polymorphonuclear (PMN) cells. Proteases that were released from isolated PMN cells degraded decorin in vitro. A highly selective inhibitor of neutrophil elastase blocked decorin breakdown by proteases released from PMN cells. Furthermore, purified neutrophil elastase cleaved decorin in vitro and generated fragments with similar molecular weights as those resulting from protease activity released from PMN cells, and as observed in UV-irradiated human skin. Cleavage of decorin by neutrophil elastase significantly augmented fragmentation of type I collagen fibrils by MMP-1. Taken together, these data indicate that PMN cell proteases, especially neutrophil elastase, degrade decorin, and this degradation renders collagen fibrils more susceptible to MMP-1 cleavage. These data identify decorin degradation and neutrophil elastase as potential therapeutic targets for mitigating sun exposure-induced collagen fibril degradation in human skin.

  15. First donation of human skin obtained from corpse; Primera donacion de piel humana obtenida de cadaver

    Energy Technology Data Exchange (ETDEWEB)

    Reyes F, M L; Luna Z, D [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)

    2007-07-01

    The first donation of human skin coming from a cadaverous donor was obtained in the State of Mexico. The skin was obtained of a 34 year-old multi organic donor, the extraction of the same was carried out in an operating theatre by medical personnel, supported by personal of the Radio sterilized Tissue Bank (BTR) of the ININ. The skin was transported to the BTR for it processing. (Author)

  16. Impedance planimetric description of normal rectoanal motility in humans

    DEFF Research Database (Denmark)

    Andersen, Inge S; Michelsen, Hanne B; Krogh, Klaus

    2007-01-01

    PURPOSE: Manometry and pressure-volume measurements are commonly used to study anorectal physiology. However, the methods are limited by several sources of error. Recently, a new impedance planimetric system has been introduced in a porcine model. It allows simultaneous determination of anorectal...... pressures and multiple rectal luminal cross-sectional areas. This study was designed to study normal human rectoanal motility by means of impedance planimetry with multiple rectal cross-sectional areas and rectal and anal pressure. METHODS: Twelve healthy volunteers (10 females), aged 24 to 53 years, were...... the experiment, the cross-sectional area at all channels showed strong cyclic contractile activity and the anal pressure increased by approximately 100 percent. CONCLUSIONS: The new rectal impedance planimetry system allows highly detailed description of rectoanal motility patterns. It has promise as a new...

  17. Repair replication in cultured normal and transformed human fibroblasts

    International Nuclear Information System (INIS)

    Smith, C.A.; Hanawalt, P.C.

    1976-01-01

    Repair replication in response to ultraviolet irradiation has been studied in normal human diploid fibroblast cultures, W138, and an SV40 transformant, VA13. Quantitative comparisons have been made using the combined isotopic and density labelling method for assaying repair replication. No significant difference was found in the amount of repair replication performed, its dose response, or the time course between growing and confluent W138 cells, early passage and senescent cells, or normal W138 cells and the transformed VA13 cells. When [ 3 H]dThd was employed as the isotopic label in the presence of a 30-200 fold excess of unlabelled BrdUrd apparent differences in repair replication were seen between W138 cells shortly after subcultivation and cells which had been allowed to reach confluence. These differences were the same over a wide dose range and regardless of the passage number of the cells, but could be influenced by using different serum lots. The differences were not seen, however, when [ 3 H]BrdUrd provided the isotopic label; thus they reflect either impurities in the [ 3 H]dThd or a slight discrimination by some cellular process

  18. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  19. The human POLH gene is not mutated, and is expressed in a cohort of patients with basal or squamous cell carcinoma of the skin.

    LENUS (Irish Health Repository)

    Flanagan, Annabelle M

    2007-04-01

    Skin cancer, the most common cancer in the general population, is strongly associated with exposure to the ultraviolet component of sunlight. To investigate the relationship between DNA damage processing and skin tumour development, we determined the POLH status of a cohort of skin cancer patients. The human POLH gene encodes DNA polymerase eta (poleta), which normally carries out accurate translesion synthesis past the major UV-induced photoproduct, the dithymine cyclobutane dimer. In the absence of active poleta in xeroderma pigmentosum variant (XPV) patients, mutations accumulate at sites of UV-induced DNA damage, providing the initiating step in skin carcinogenesis. Forty patients diagnosed with skin cancer were genotyped for polymorphisms in the POLH protein-coding sequence, using glycosylase-mediated polymorphism detection (GMPD) and direct DNA sequencing of POLH PCR products derived from white blood cell genomic DNA. All individuals carried the wild-type POLH sequence. No POLH mutations were identified in genomic DNA from skin tumours derived from 15 of these patients. As determined by RT-PCR, POLH mRNA was expressed in all normal and skin tumour tissue examined. Poleta protein was also detectable by Western blotting, in two matched normal and skin tumour extracts. An alternatively spliced form of POLH mRNA, lacking exon 2, was more readily detected in skin tissue than in white blood cells from the same patient. Real-time PCR was used to quantify POLH expression in matched normal and skin tumour-derived mRNA from a series of patients diagnosed with either basal or squamous cell carcinoma. Compared to matched normal skin tissue from the same patient, 1 of 7 SCC, and 4 of 10 BCC tumours examined showed at least a 2-fold reduction in POLH expression, while 1 of 7 SCC, and 3 of 10 BCC tumours showed at least a 2-fold increase in POLH expression. Differences in gene expression, rather than sequence changes may be the main mechanism by which POLH status varies

  20. Impact of chemical peeling combined with negative pressure on human skin.

    Science.gov (United States)

    Kim, S J; Kang, I J; Shin, M K; Jeong, K H; Baek, J H; Koh, J S; Lee, S J

    2016-10-01

    In vivo changes in skin barrier function after chemical peeling with alpha hydroxyacids (AHAs) have been previously reported. However, the additional effects of physical treatment with chemical agents on skin barrier function have not been adequately studied. This study measured the degree of acute skin damage and the time required for skin barrier repair using non-invasive bioengineering methods in vivo with human skin to investigate the additional effect of a 4% AHA chemical jet accelerated at supersonic velocities. Thirteen female subjects (average age: 29.54 ± 4.86 years) participated in this study. The faces of the subjects were divided into half according to the block randomization design and were then assigned to receive AHA peeling alone or AHA peeling combined with pneumatic pressure on each side of the face. Transepidermal water loss (TEWL), skin colour and skin blood flow were evaluated at baseline and at 30 min, 2, 5 and 7 days after treatment. The TEWL and skin blood flow were significantly increased after 30 min in chemodermabrasion compared with chemical peeling alone (P peeling alone (P < 0.05). Chemodermabrasion can temporarily impair skin barriers, but it is estimated that it can enhance the skin barrier function after 7 days compared to the use of a chemical agent alone. In addition, chemodermabrasion has a more effective impact in the dermis and relatively preserves the skin barrier. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  1. Dermal absorption behavior of fluorescent molecules in nanoparticles on human and porcine skin models.

    Science.gov (United States)

    Debotton, Nir; Badihi, Amit; Robinpour, Mano; Enk, Claes D; Benita, Simon

    2017-05-30

    The percutaneous passage of poorly skin absorbed molecules can be improved using nanocarriers, particularly biodegradable polymeric nanospheres (NSs) or nanocapsules (NCs). However, penetration of the encapsulated molecules may be affected by other factors than the nanocarrier properties. To gain insight information on the skin absorption of two fluorescent cargos, DiIC 18 (5) and coumarin-6 were incorporated in NSs or NCs and topically applied on various human and porcine skin samples. 3D imaging techniques suggest that NSs and NCs enhanced deep dermal penetration of both probes similarly, when applied on excised human skin irrespective of the nature of the cargo. However, when ex vivo pig skin was utilized, the cutaneous absorption of DiIC 18 (5) was more pronounced by means of PLGA NCs than NSs. In contrast, PLGA NSs noticeably improved the porcine skin penetration of coumarin-6, as compared to the NCs. Furthermore, the porcine skin results were reproducible when triplicated whereas from various human skin samples, as expected, the results were not sufficiently reproducible and large deviations were observed. The overall findings from this comprehensive comparison emphasize the potential of PLGA NCs or NSs to promote cutaneous bioavailability of encapsulated drugs, exhibiting different physicochemical properties but depending on the nature of the skin. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Human Colors-The Rainbow Garden of Pathology: What Gives Normal and Pathologic Tissues Their Color?

    Science.gov (United States)

    Piña-Oviedo, Sergio; Ortiz-Hidalgo, Carlos; Ayala, Alberto G

    2017-03-01

    - Colors are important to all living organisms because they are crucial for camouflage and protection, metabolism, sexual behavior, and communication. Human organs obviously have color, but the underlying biologic processes that dictate the specific colors of organs and tissues are not completely understood. A literature search on the determinants of color in human organs yielded scant information. - To address 2 specific questions: (1) why do human organs have color, and (2) what gives normal and pathologic tissues their distinctive colors? - Endogenous colors are the result of complex biochemical reactions that produce biologic pigments: red-brown cytochromes and porphyrins (blood, liver, spleen, kidneys, striated muscle), brown-black melanins (skin, appendages, brain nuclei), dark-brown lipochromes (aging organs), and colors that result from tissue structure (tendons, aponeurosis, muscles). Yellow-orange carotenes that deposit in lipid-rich tissues are only produced by plants and are acquired from the diet. However, there is lack of information about the cause of color in other organs, such as the gray and white matter, neuroendocrine organs, and white tissues (epithelia, soft tissues). Neoplastic tissues usually retain the color of their nonneoplastic counterpart. - Most available information on the function of pigments comes from studies in plants, microorganisms, cephalopods, and vertebrates, not humans. Biologic pigments have antioxidant and cytoprotective properties and should be considered as potential future therapies for disease and cancer. We discuss the bioproducts that may be responsible for organ coloration and invite pathologists and pathology residents to look at a "routine grossing day" with a different perspective.

  3. A Role for Human Skin Mast Cells in Dengue Virus Infection and Systemic Spread.

    Science.gov (United States)

    Troupin, Andrea; Shirley, Devon; Londono-Renteria, Berlin; Watson, Alan M; McHale, Cody; Hall, Alex; Hartstone-Rose, Adam; Klimstra, William B; Gomez, Gregorio; Colpitts, Tonya M

    2016-12-01

    Dengue virus (DENV) is a mosquito-borne flavivirus that causes serious global human disease and mortality. Skin immune cells are an important component of initial DENV infection and systemic spread. Here, we show that mast cells are a target of DENV in human skin and that DENV infection of skin mast cells induces degranulation and alters cytokine and growth factor expression profiles. Importantly, to our knowledge, we also demonstrate for the first time that DENV localizes within secretory granules in infected skin mast cells. In addition, DENV within extracellular granules was infectious in vitro and in vivo, trafficking through lymph to draining lymph nodes in mice. We demonstrate an important role for human skin mast cells in DENV infection and identify a novel mechanism for systemic spread of DENV infection from the initial peripheral mosquito injection site. Copyright © 2016 by The American Association of Immunologists, Inc.

  4. Identification of a novel pro-inflammatory human skin-homing Vγ9Vδ2 T cell subset with a potential role in psoriasis

    Science.gov (United States)

    LAGGNER, Ute; DI MEGLIO, Paola; PERERA, Gayathri K.; HUNDHAUSEN, Christian; LACY, Katie E.; ALI, Niwa; SMITH, Catherine H.; HAYDAY, Adrian C.; NICKOLOFF, Brian J.; NESTLE, Frank O.

    2011-01-01

    γδ T cells mediate rapid tissue responses in murine skin and participate in cutaneous immune regulation including protection against cancer. The role of human γδ cells in cutaneous homeostasis and pathology is poorly characterized. In this study we show in vivo evidence that human blood contains a distinct subset of pro-inflammatory cutaneous lymphocyte antigen (CLA) and C-C chemokine receptor (CCR) 6 positive Vγ9Vδ2 T cells, which is rapidly recruited into perturbed human skin. Vγ9Vδ2 T cells produced an array of pro-inflammatory mediators including IL-17A and activated keratinocytes in a TNF-α and IFN-γ dependent manner. Examination of the common inflammatory skin disease psoriasis revealed a striking reduction of circulating Vγ9Vδ2 T cells in psoriasis patients compared to healthy controls and atopic dermatitis patients. Decreased numbers of circulating Vγ9Vδ2 T cells normalized after successful treatment with psoriasis-targeted therapy. Together with the increased presence of Vγ9Vδ2 T cells in psoriatic skin, this data indicates redistribution of Vγ9Vδ2 T cells from the blood to the skin compartment in psoriasis. In summary, we report a novel human pro-inflammatory γδ T cell involved in skin immune surveillance with immediate response characteristics and with potential clinical relevance in inflammatory skin disease. PMID:21813772

  5. Identification of a novel proinflammatory human skin-homing Vγ9Vδ2 T cell subset with a potential role in psoriasis.

    Science.gov (United States)

    Laggner, Ute; Di Meglio, Paola; Perera, Gayathri K; Hundhausen, Christian; Lacy, Katie E; Ali, Niwa; Smith, Catherine H; Hayday, Adrian C; Nickoloff, Brian J; Nestle, Frank O

    2011-09-01

    γδ T cells mediate rapid tissue responses in murine skin and participate in cutaneous immune regulation including protection against cancer. The role of human γδ cells in cutaneous homeostasis and pathology is characterized poorly. In this study, we show in vivo evidence that human blood contains a distinct subset of proinflammatory cutaneous lymphocyte Ag and CCR6-positive Vγ9Vδ2 T cells, which is rapidly recruited into perturbed human skin. Vγ9Vδ2 T cells produced an array of proinflammatory mediators including IL-17A and activated keratinocytes in a TNF-α- and IFN-γ-dependent manner. Examination of the common inflammatory skin disease psoriasis revealed a striking reduction of circulating Vγ9Vδ2 T cells in psoriasis patients compared with healthy controls and atopic dermatitis patients. Decreased numbers of circulating Vγ9Vδ2 T cells normalized after successful treatment with psoriasis-targeted therapy. Taken together with the increased presence of Vγ9Vδ2 T cells in psoriatic skin, these data indicate redistribution of Vγ9Vδ2 T cells from the blood to the skin compartment in psoriasis. In summary, we report a novel human proinflammatory γδ T cell involved in skin immune surveillance with immediate response characteristics and with potential clinical relevance in inflammatory skin disease.

  6. Raman spectroscopy of human skin: looking for a quantitative algorithm to reliably estimate human age

    Science.gov (United States)

    Pezzotti, Giuseppe; Boffelli, Marco; Miyamori, Daisuke; Uemura, Takeshi; Marunaka, Yoshinori; Zhu, Wenliang; Ikegaya, Hiroshi

    2015-06-01

    The possibility of examining soft tissues by Raman spectroscopy is challenged in an attempt to probe human age for the changes in biochemical composition of skin that accompany aging. We present a proof-of-concept report for explicating the biophysical links between vibrational characteristics and the specific compositional and chemical changes associated with aging. The actual existence of such links is then phenomenologically proved. In an attempt to foster the basics for a quantitative use of Raman spectroscopy in assessing aging from human skin samples, a precise spectral deconvolution is performed as a function of donors' ages on five cadaveric samples, which emphasizes the physical significance and the morphological modifications of the Raman bands. The outputs suggest the presence of spectral markers for age identification from skin samples. Some of them appeared as authentic "biological clocks" for the apparent exactness with which they are related to age. Our spectroscopic approach yields clear compositional information of protein folding and crystallization of lipid structures, which can lead to a precise identification of age from infants to adults. Once statistically validated, these parameters might be used to link vibrational aspects at the molecular scale for practical forensic purposes.

  7. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  8. Differential Intracochlear Sound Pressure Measurements in Normal Human Temporal Bones

    Science.gov (United States)

    Nakajima, Hideko Heidi; Dong, Wei; Olson, Elizabeth S.; Merchant, Saumil N.; Ravicz, Michael E.; Rosowski, John J.

    2009-02-01

    We present the first simultaneous sound pressure measurements in scala vestibuli and scala tympani of the cochlea in human cadaveric temporal bones. Micro-scale fiberoptic pressure sensors enabled the study of differential sound pressure at the cochlear base. This differential pressure is the input to the cochlear partition, driving cochlear waves and auditory transduction. Results showed that: pressure of scala vestibuli was much greater than scala tympani except at low and high frequencies where scala tympani pressure affects the input to the cochlea; the differential pressure proved to be an excellent measure of normal ossicular transduction of sound (shown to decrease 30-50 dB with ossicular disarticulation, whereas the individual scala pressures were significantly affected by non-ossicular conduction of sound at high frequencies); the middle-ear gain and differential pressure were generally bandpass in frequency dependence; and the middle-ear delay in the human was over twice that of the gerbil. Concurrent stapes velocity measurements allowed determination of the differential impedance across the partition and round-window impedance. The differential impedance was generally resistive, while the round-window impedance was consistent with a compliance in conjunction with distributed inertia and damping. Our techniques can be used to study inner-ear conductive pathologies (e.g., semicircular dehiscence), as well as non-ossicular cochlear stimulation (e.g., round-window stimulation) - situations that cannot be completely quantified by measurements of stapes velocity or scala-vestibuli pressure by themselves.

  9. Dermal damage promoted by repeated low-level UV-A1 exposure despite tanning response in human skin.

    Science.gov (United States)

    Wang, Frank; Smith, Noah R; Tran, Bao Anh Patrick; Kang, Sewon; Voorhees, John J; Fisher, Gary J

    2014-04-01

    Solar UV irradiation causes photoaging, characterized by fragmentation and reduced production of type I collagen fibrils that provide strength to skin. Exposure to UV-B irradiation (280-320 nm) causes these changes by inducing matrix metalloproteinase 1 and suppressing type I collagen synthesis. The role of UV-A irradiation (320-400 nm) in promoting similar molecular alterations is less clear yet important to consider because it is 10 to 100 times more abundant in natural sunlight than UV-B irradiation and penetrates deeper into the dermis than UV-B irradiation. Most (approximately 75%) of solar UV-A irradiation is composed of UV-A1 irradiation (340-400 nm), which is also the primary component of tanning beds. To evaluate the effects of low levels of UV-A1 irradiation, as might be encountered in daily life, on expression of matrix metalloproteinase 1 and type I procollagen (the precursor of type I collagen). In vivo biochemical analyses were conducted after UV-A1 irradiation of normal human skin at an academic referral center. Participants included 22 healthy individuals without skin disease. Skin pigmentation was measured by a color meter (chromometer) under the L* variable (luminescence), which ranges from 0 (black) to 100 (white). Gene expression in skin samples was assessed by real-time polymerase chain reaction. Lightly pigmented human skin (L* >65) was exposed up to 4 times (1 exposure/d) to UV-A1 irradiation at a low dose (20 J/cm2), mimicking UV-A levels from strong sun exposure lasting approximately 2 hours. A single exposure to low-dose UV-A1 irradiation darkened skin slightly and did not alter matrix metalloproteinase 1 or type I procollagen gene expression. With repeated low-dose UV-A1 irradiation, skin darkened incrementally with each exposure. Despite this darkening, 2 or more exposures to low-dose UV-A1 irradiation significantly induced matrix metalloproteinase 1 gene expression, which increased progressively with successive exposures. Repeated UV-A1

  10. Friction of human skin against smooth and rough glass as a function of the contact pressure

    NARCIS (Netherlands)

    Derler, S.; Gerhardt, L.C.; Lenz, A.; Bertaux, E.; Hadad, M.

    2009-01-01

    The friction behaviour of human skin was studied by combining friction measurements using a tri-axial force plate with skin contact area measurements using a pressure sensitive film. Four subjects carried out friction measurement series, in which they rubbed the index finger pad and the edge of the

  11. Human skin condition and its associations with nutrient concentrations in serum and diet

    NARCIS (Netherlands)

    Boelsma, E.; Vijver, L.P.L. van de; Goldbohm, R.A.; Klöpping-Ketelaars, I.A.A.; Hendriks, H.F.J.; Roza, L.

    2003-01-01

    Background: Nutritional factors exert promising actions on the skin, but only scant information is available on the modulating effects of physiologic concentrations of nutrients on the skin condition of humans. Objective: The objective was to evaluate whether nutrient concentrations in serum and

  12. Oral Polypodium leucotomos extract decreases ultraviolet-induced damage of human skin

    NARCIS (Netherlands)

    Middelkamp-Hup, Maritza A.; Pathak, Madhu A.; Parrado, Concepcion; Goukassian, David; Rius-Díaz, Francisca; Mihm, Martín C.; Fitzpatrick, Thomas B.; González, Salvador

    2004-01-01

    BACKGROUND: UV radiation induces damage to human skin. Protection of skin by an oral photoprotective agent would have substantial benefits. Objective We investigated the photoprotective effect of oral administration of an extract of the natural antioxidant Polypodium leucotomos (PL). METHODS: A

  13. Thyrotropin-releasing hormone (TRH promotes wound re-epithelialisation in frog and human skin.

    Directory of Open Access Journals (Sweden)

    Natalia T Meier

    Full Text Available There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression. Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters.

  14. Thyrotropin-Releasing Hormone (TRH) Promotes Wound Re-Epithelialisation in Frog and Human Skin

    Science.gov (United States)

    Zhang, Guo-You; Emelianov, Vladimir; Paredes, Roberto; Debus, Sebastian; Augustin, Matthias; Funk, Wolfgang; Amaya, Enrique; Kloepper, Jennifer E.; Hardman, Matthew J.; Paus, Ralf

    2013-01-01

    There remains a critical need for new therapeutics that promote wound healing in patients suffering from chronic skin wounds. This is, in part, due to a shortage of simple, physiologically and clinically relevant test systems for investigating candidate agents. The skin of amphibians possesses a remarkable regenerative capacity, which remains insufficiently explored for clinical purposes. Combining comparative biology with a translational medicine approach, we report the development and application of a simple ex vivo frog (Xenopus tropicalis) skin organ culture system that permits exploration of the effects of amphibian skin-derived agents on re-epithelialisation in both frog and human skin. Using this amphibian model, we identify thyrotropin-releasing hormone (TRH) as a novel stimulant of epidermal regeneration. Moving to a complementary human ex vivo wounded skin assay, we demonstrate that the effects of TRH are conserved across the amphibian-mammalian divide: TRH stimulates wound closure and formation of neo-epidermis in organ-cultured human skin, accompanied by increased keratinocyte proliferation and wound healing-associated differentiation (cytokeratin 6 expression). Thus, TRH represents a novel, clinically relevant neuroendocrine wound repair promoter that deserves further exploration. These complementary frog and human skin ex vivo assays encourage a comparative biology approach in future wound healing research so as to facilitate the rapid identification and preclinical testing of novel, evolutionarily conserved, and clinically relevant wound healing promoters. PMID:24023889

  15. New Regions of the Human Genome Linked to Skin Color Variation in Some African Populations

    Science.gov (United States)

    In the first study of its kind, an international team of genomics researchers has identified new regions of the human genome that are associated with skin color variation in some African populations, opening new avenues for research on skin diseases and cancer in all populations.

  16. Phasor analysis of multiphoton spectral images distinguishes autofluorescence components of in vivo human skin

    NARCIS (Netherlands)

    Fereidouni, F.; Bader, A.N.; Colonna, A.; Gerritsen, H.C.

    2014-01-01

    Skin contains many autofluorescent components that can be studied using spectral imaging. We employed a spectral phasor method to analyse two photon excited auto-fluorescence and second harmonic generation images of in vivo human skin. This method allows segmentation of images based on spectral

  17. Modeling and simulation of heat distribution in human skin caused by laser irradiation

    NARCIS (Netherlands)

    Luan, Y.; Dams, S.D.

    2009-01-01

    Study of light-based skin rejuvenation needs prospective insights of mechanism of laser tissue interaction. A well-built model plays a key role in predicting temperature distribution in human skin exposed to laser irradiation. Therefore, it not only provides guidance for in vitro experiment, but

  18. Inhibition of ultraviolet irradiation response of human skin by topical phlogostatic compounds

    International Nuclear Information System (INIS)

    Weirich, E.G.; Lutz, U.C.

    1977-01-01

    By adaption of the model of UV dermatitis in human skin a test procedure has been developed which facilitates realistic assessment of topical contra-inflammatory activity of steroidal as well as non-steroidal compounds. Sixt typical skin drug agents were tested according to their reaction inhibition effect. (orig./MG) [de

  19. Non-enzymatic NO production in human skin: effect of UVA on cutaneous NO stores

    NARCIS (Netherlands)

    Suschek, C.; Opländer, C.; van Faassen, E.E.H.

    2009-01-01

    Nitric oxide (NO) in human skin has been under investigation since first reports of NOS expression in skin tissue in 1992 [1]. NO plays a key role in the dermal response to external stimuli such as heat, ultraviolet (UV) light, or infection, and in healing of abrasions, lesions or burns. Recently, a

  20. Migration of human antigen-presenting cells in a human skin graft onto nude mice model after contact sensitization

    NARCIS (Netherlands)

    Hoefakker, S.; Balk, H.P.; Boersma, W.J.A.; Joost, T. van; Notten, W.R.F.; Claassen, E.

    1995-01-01

    Fluorescent contact chemical allergens provoke sensitization after application on both syngeneic and allogeneic skin grafts in mice. We attempted to determine whether the functional activity in a contact sensitization response of human skin graft was affected at the level of antigen uptake and

  1. Investigation of the effect of hydration on dermal collagen in ex vivo human skin tissue using second harmonic generation microscopy

    Science.gov (United States)

    Samatham, Ravikant; Wang, Nicholas K.; Jacques, Steven L.

    2016-02-01

    Effect of hydration on the dermal collagen structure in human skin was investigated using second harmonic generation microscopy. Dog ears from the Mohs micrographic surgery department were procured for the study. Skin samples with subject aged between 58-90 years old were used in the study. Three dimensional Multiphoton (Two-photon and backward SHG) control data was acquired from the skin samples. After the control measurement, the skin tissue was either soaked in deionized water for 2 hours (Hydration) or kept at room temperature for 2 hours (Desiccation), and SHG data was acquired. The data was normalized for changes in laser power and detector gain. The collagen signal per unit volume from the dermis was calculated. The desiccated skin tissue gave higher backward SHG compared to respective control tissue, while hydration sample gave a lower backward SHG. The collagen signal decreased with increase in hydration of the dermal collagen. Hydration affected the packing of the collagen fibrils causing a change in the backward SHG signal. In this study, the use of multiphoton microscopy to study the effect of hydration on dermal structure was demonstrated in ex vivo tissue.

  2. Enhancement of Human Cheek Skin Texture by Acacia Nilotica Bark ...

    African Journals Online (AJOL)

    HP

    Keywords: Acacia nilotica, Cream, Visioscan VC 98, Skin texture, Anti-aging. Tropical Journal of .... volunteer (A) before and (B) after application of extract cream for 3 months The .... Antioxidants and vitamins in Cosmetics. Clin. Dermatol. 2001 ...

  3. Accumulation of sunscreen in human skin after daily applications

    DEFF Research Database (Denmark)

    Bodekær, Mette; Akerström, Ulf; Wulf, Hans Christian

    2012-01-01

    Sunscreen applied to the skin provides a considerable sun protection factor (SPF) even after 8 h. Sunscreen use for consecutive days may therefore result in an accumulation of the product. This study investigated the consequences of accumulation for SPF....

  4. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  5. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  6. In situ visualization of glucocerebrosidase in human skin tissue: zymography versus activity-based probe labeling.

    Science.gov (United States)

    van Smeden, Jeroen; Dijkhoff, Irini M; Helder, Richard W J; Al-Khakany, Hanin; Boer, Daphne E C; Schreuder, Anne; Kallemeijn, Wouter W; Absalah, Samira; Overkleeft, Herman S; Aerts, Johannes M F G; Bouwstra, Joke A

    2017-12-01

    Epidermal β-glucocerebrosidase (GBA1), an acid β-glucosidase normally located in lysosomes, converts (glucosyl)ceramides into ceramides, which is crucial to generate an optimal barrier function of the outermost skin layer, the stratum corneum (SC). Here we report on two developed in situ methods to localize active GBA in human epidermis: i ) an optimized zymography method that is less labor intensive and visualizes enzymatic activity with higher resolution than currently reported methods using either substrate 4-methylumbelliferyl-β-D-glucopyranoside or resorufin-β-D-glucopyranoside; and ii ) a novel technique to visualize active GBA1 molecules by their specific labeling with a fluorescent activity-based probe (ABP), MDW941. The latter method pro-ved to be more robust and sensitive, provided higher resolution microscopic images, and was less prone to sample preparation effects. Moreover, in contrast to the zymography substrates that react with various β-glucosidases, MDW941 specifically labeled GBA1. We demonstrate that active GBA1 in the epidermis is primarily located in the extracellular lipid matrix at the interface of the viable epidermis and the lower layers of the SC. With ABP-labeling, we observed reduced GBA1 activity in 3D-cultured skin models when supplemented with the reversible inhibitor, isofagomine, irrespective of GBA expression. This inhibition affected the SC ceramide composition: MS analysis revealed an inhibitor-dependent increase in the glucosylceramide:ceramide ratio. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  7. The protective effects of fucosterol against skin damage in UVB-irradiated human dermal fibroblasts.

    Science.gov (United States)

    Hwang, Eunson; Park, Sang-Yong; Sun, Zheng-wang; Shin, Heon-Sub; Lee, Don-Gil; Yi, Tae Hoo

    2014-06-01

    Exposure to ultraviolet (UV) light causes matrix metalloproteinase (MMP) overexpression and extracellular matrix depletion, leading to skin photoaging. The activation of MMP is related to increased interlukin-6 (IL-6) and type I procollagen production, which is regulated by transforming growth factor-β1 (TGF-β1). Activator protein-1 (AP-1) activation induces MMP-1 production and reduces type I procollagen secretion. Fucosterol, which is extracted and purified from the brown algae Hizikia fusiformis, is a phytosterol. We assessed the effects of fucosterol on photodamage and investigated its molecular mechanism of action in UVB-irradiated normal human dermal fibroblasts by using enzyme-linked immunosorbent assay, Western blot analysis, and reverse transcription-polymerase chain reaction. Our results showed that fucosterol significantly decreased the UVB-induced expression of MMP-1, IL-6, p-c-Jun, and p-c-Fos. Additionally, fucosterol markedly increased the UVB-induced production of type I procollagen and TGF-β1. Our results indicate that fucosterol regulates MMP-1 and type I procollagen expression by modulating AP-1 and TGF-β1 signaling and that MMP-1 activation is correlated with IL-6. These data suggest that fucosterol is a promising botanical agent to protect against skin photodamage.

  8. Reconstruction of segmented human voxel phantoms for skin dosimetry

    International Nuclear Information System (INIS)

    Antunes, Paula C.G.; Siqueira, Paulo de Tarso D.; Yoriyaz, Helio; Fonseca, Gabriel P.; Reis, Gabriela; Furnari, Laura

    2009-01-01

    High-resolution medical images along with methods that simulate the interaction of radiation with matter, as the Monte Carlo radiation transport codes, have been widely used in medical physics procedures. These images provide the construction of realistic anatomical models, which after being coupled to these codes, may drive to better assessments of dose distributions on the patient. These anatomical models constructed from medical images are known as voxel phantoms (voxel - volume element of an image). Present day regular images are unsuitable to correctly perform skin dose distribution evaluations. This inability is due to improper skin discrimination in most of the current medical images, once its thickness stands below the resolution of the pixels that form the image. This paper proposes the voxel phantom reconstruction by subdividing and segmenting the elements that form the phantom. It is done in order to better discriminate the skin by assigning it more adequate thickness and actual location, allowing a better dosimetric evaluation of the skin. This task is an important issue in many radiotherapy procedures. Particular interest lays in Total Skin Irradiation (TSI) with electron beams, where skin dose evaluation stands as the treatment key point of the whole body irradiation. This radiotherapy procedure is under implementation at the Hospital das Clinicas da Universidade de Sao Paulo (HC-USP). (author)

  9. Anti-Mycobacterium leprae monoclonal antibodies cross-react with human skin: an alternative explanation for the immune responses in leprosy

    NARCIS (Netherlands)

    Naafs, B.; Kolk, A. H.; Chin A Lien, R. A.; Faber, W. R.; van Dijk, G.; Kuijper, S.; Stolz, E.; van Joost, T.

    1990-01-01

    A panel of 17 mouse monoclonal antibodies (MoAb) raised against Mycobacterium leprae (M. leprae) antigens was used to detect antigenic determinants in normal human skin. An indirect immunoperoxidase technique was used. Eight of the MoAb detected epidermal antigens similar to patterns well known for

  10. Characterizing human skin blood flow regulation in response to different local skin temperature perturbations

    NARCIS (Netherlands)

    Wu, Y.; Nieuwenhoff, M.D.; Huygen, Frank J.P.M.; van der Helm, F. C.T.; Niehof, S.P.; Schouten, A. C.

    2017-01-01

    Small nerve fibers regulate local skin blood flow in response to local thermal perturbations. Small nerve fiber function is difficult to assess with classical neurophysiological tests. In this study, a vasomotor response model in combination with a heating protocol was developed to quantitatively

  11. Induction of Skin-Derived Precursor Cells from Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Sugiyama-Nakagiri, Yoriko; Fujimura, Tsutomu; Moriwaki, Shigeru

    2016-01-01

    The generation of full thickness human skin from dissociated cells is an attractive approach not only for treating skin diseases, but also for treating many systemic disorders. However, it is currently not possible to obtain an unlimited number of skin dermal cells. The goal of this study was to develop a procedure to produce skin dermal stem cells from induced pluripotent stem cells (iPSCs). Skin-derived precursor cells (SKPs) were isolated as adult dermal precursors that could differentiate into both neural and mesodermal progenies and could reconstitute the dermis. Thus, we attempted to generate SKPs from iPSCs that could reconstitute the skin dermis. Human iPSCs were initially cultured with recombinant noggin and SB431542, an inhibitor of activin/nodal and TGFβ signaling, to induce neural crest progenitor cells. Those cells were then treated with SKP medium that included CHIR99021, a WNT signal activator. The induction efficacy from neural crest progenitor cells to SKPs was more than 97%. No other modifiers tested were able to induce those cells. Those human iPSC-derived SKPs (hiPSC-SKPs) showed a similar gene expression signature to SKPs isolated from human skin dermis. Human iPSC-SKPs differentiated into neural and mesodermal progenies, including adipocytes, skeletogenic cell types and Schwann cells. Moreover, they could be induced to follicular type keratinization when co-cultured with human epidermal keratinocytes. We here provide a new efficient protocol to create human skin dermal stem cells from hiPSCs that could contribute to the treatment of various skin disorders.

  12. BAY11 enhances OCT4 synthetic mRNA expression in adult human skin cells.

    Science.gov (United States)

    Awe, Jason P; Crespo, Agustin Vega; Li, You; Kiledjian, Megerditch; Byrne, James A

    2013-02-06

    The OCT4 transcription factor is involved in many cellular processes, including development, reprogramming, maintaining pluripotency and differentiation. Synthetic OCT4 mRNA was recently used (in conjunction with other reprogramming factors) to generate human induced pluripotent stem cells. Here, we discovered that BAY 11-7082 (BAY11), at least partially through an NF-κB-inhibition based mechanism, could significantly increase the expression of OCT4 following transfection of synthetic mRNA (synRNA) into adult human skin cells. We tested various chemical and molecular small molecules on their ability to suppress the innate immune response seen upon synthetic mRNA transfection. Three molecules - B18R, BX795, and BAY11 - were used in immunocytochemical and proliferation-based assays. We also utilized global transcriptional meta-analysis coupled with quantitative PCR to identify relative gene expression downstream of OCT4. We found that human skin cells cultured in the presence of BAY11 resulted in reproducible increased expression of OCT4 that did not inhibit normal cell proliferation. The increased levels of OCT4 resulted in significantly increased expression of genes downstream of OCT4, including the previously identified SPP1, DUSP4 and GADD45G, suggesting the expressed OCT4 was functional. We also discovered a novel OCT4 putative downstream target gene SLC16A9 which demonstrated significantly increased expression following elevation of OCT4 levels. For the first time we have shown that small molecule-based stabilization of synthetic mRNA expression can be achieved with use of BAY11. This small molecule-based inhibition of innate immune responses and subsequent robust expression of transfected synthetic mRNAs may have multiple applications for future cell-based research and therapeutics.

  13. Angiogenic effects of cryosurgery with liquid nitrogen on the normal skin of rats, through morphometric study.

    Science.gov (United States)

    Pimentel, Camila Bianco; Moraes, Aparecida Machado de; Cintra, Maria Letícia

    2014-01-01

    Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

  14. The use of ex vivo human skin tissue for genotoxicity testing

    International Nuclear Information System (INIS)

    Reus, Astrid A.; Usta, Mustafa; Krul, Cyrille A.M.

    2012-01-01

    As a result of the chemical legislation concerning the registration, evaluation, authorization and restriction of chemicals (REACH), and the Seventh Amendment to the Cosmetics Directive, which prohibits animal testing in Europe for cosmetics, alternative methods for safety evaluation of chemicals are urgently needed. Current in vitro genotoxicity assays are not sufficiently predictive for the in vivo situation, resulting in an unacceptably high number of misleading positives. For many chemicals and ingredients of personal care products the skin is the first site of contact, but there are no in vitro genotoxicity assays available in the skin for additional evaluation of positive or equivocal responses observed in regulatory in vitro genotoxicity assays. In the present study ex vivo human skin tissue obtained from surgery was used for genotoxicity evaluation of chemicals by using the comet assay. Fresh ex vivo human skin tissue was cultured in an air–liquid interface and topically exposed to 20 chemicals, including true positive, misleading positive and true negative genotoxins. Based on the results obtained in the present study, the sensitivity, specificity and accuracy of the ex vivo skin comet assay to predict in vivo genotoxicity were 89%, 90% and 89%, respectively. Donor and experimental variability were mainly reflected in the magnitude of the response and not the difference between the presence and absence of a genotoxic response. The present study indicates that human skin obtained from surgery is a promising and robust model for safety evaluation of chemicals that are in direct contact with the skin. -- Highlights: ► We use human skin obtained from surgery for genotoxicity evaluation of chemicals. ► We use the comet assay as parameter for genotoxicity in ex vivo human skin. ► Sensitivity, specificity and accuracy to predict in vivo genotoxins are determined. ► Sensitivity, specificity and accuracy are 89%, 90% and 90%, respectively. ► The method

  15. The use of ex vivo human skin tissue for genotoxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Reus, Astrid A.; Usta, Mustafa [TNO Triskelion BV, Utrechtseweg 48, 3704 HE, Zeist (Netherlands); Krul, Cyrille A.M., E-mail: cyrille.krul@tno.nl [TNO, Utrechtseweg 48, 3704 HE Zeist (Netherlands)

    2012-06-01

    As a result of the chemical legislation concerning the registration, evaluation, authorization and restriction of chemicals (REACH), and the Seventh Amendment to the Cosmetics Directive, which prohibits animal testing in Europe for cosmetics, alternative methods for safety evaluation of chemicals are urgently needed. Current in vitro genotoxicity assays are not sufficiently predictive for the in vivo situation, resulting in an unacceptably high number of misleading positives. For many chemicals and ingredients of personal care products the skin is the first site of contact, but there are no in vitro genotoxicity assays available in the skin for additional evaluation of positive or equivocal responses observed in regulatory in vitro genotoxicity assays. In the present study ex vivo human skin tissue obtained from surgery was used for genotoxicity evaluation of chemicals by using the comet assay. Fresh ex vivo human skin tissue was cultured in an air–liquid interface and topically exposed to 20 chemicals, including true positive, misleading positive and true negative genotoxins. Based on the results obtained in the present study, the sensitivity, specificity and accuracy of the ex vivo skin comet assay to predict in vivo genotoxicity were 89%, 90% and 89%, respectively. Donor and experimental variability were mainly reflected in the magnitude of the response and not the difference between the presence and absence of a genotoxic response. The present study indicates that human skin obtained from surgery is a promising and robust model for safety evaluation of chemicals that are in direct contact with the skin. -- Highlights: ► We use human skin obtained from surgery for genotoxicity evaluation of chemicals. ► We use the comet assay as parameter for genotoxicity in ex vivo human skin. ► Sensitivity, specificity and accuracy to predict in vivo genotoxins are determined. ► Sensitivity, specificity and accuracy are 89%, 90% and 90%, respectively. ► The method

  16. Simulation study of melanoma detection in human skin tissues by laser-generated surface acoustic waves.

    Science.gov (United States)

    Chen, Kun; Fu, Xing; Dorantes-Gonzalez, Dante J; Lu, Zimo; Li, Tingting; Li, Yanning; Wu, Sen; Hu, Xiaotang

    2014-01-01

    Air pollution has been correlated to an increasing number of cases of human skin diseases in recent years. However, the investigation of human skin tissues has received only limited attention, to the point that there are not yet satisfactory modern detection technologies to accurately, noninvasively, and rapidly diagnose human skin at epidermis and dermis levels. In order to detect and analyze severe skin diseases such as melanoma, a finite element method (FEM) simulation study of the application of the laser-generated surface acoustic wave (LSAW) technique is developed. A three-layer human skin model is built, where LSAW’s are generated and propagated, and their effects in the skin medium with melanoma are analyzed. Frequency domain analysis is used as a main tool to investigate such issues as minimum detectable size of melanoma, filtering spectra from noise and from computational irregularities, as well as on how the FEM model meshing size and computational capabilities influence the accuracy of the results. Based on the aforementioned aspects, the analysis of the signals under the scrutiny of the phase velocity dispersion curve is verified to be a reliable, a sensitive, and a promising approach for detecting and characterizing melanoma in human skin.

  17. Langerhans cell precursors acquire RANK/CD265 in prenatal human skin.

    Science.gov (United States)

    Schöppl, Alice; Botta, Albert; Prior, Marion; Akgün, Johnnie; Schuster, Christopher; Elbe-Bürger, Adelheid

    2015-01-01

    The skin is the first barrier against foreign pathogens and the prenatal formation of a strong network of various innate and adaptive cells is required to protect the newborn from perinatal infections. While many studies about the immune system in healthy and diseased adult human skin exist, our knowledge about the cutaneous prenatal/developing immune system and especially about the phenotype and function of antigen-presenting cells such as epidermal Langerhans cells (LCs) in human skin is still scarce. It has been shown previously that LCs in healthy adult human skin express receptor activator of NF-κB (RANK), an important molecule prolonging their survival. In this study, we investigated at which developmental stage LCs acquire this important molecule. Immunofluorescence double-labeling of cryostat sections revealed that LC precursors in prenatal human skin either do not yet [10-11 weeks of estimated gestational age (EGA)] or only faintly (13-15 weeks EGA) express RANK. LCs express RANK at levels comparable to adult LCs by the end of the second trimester. Comparable with adult skin, dermal antigen-presenting cells at no gestational age express this marker. These findings indicate that epidermal leukocytes gradually acquire RANK during gestation - a phenomenon previously observed also for other markers on LCs in prenatal human skin. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  18. Simulation study of melanoma detection in human skin tissues by laser-generated surface acoustic waves

    Science.gov (United States)

    Chen, Kun; Fu, Xing; Dorantes-Gonzalez, Dante J.; Lu, Zimo; Li, Tingting; Li, Yanning; Wu, Sen; Hu, Xiaotang

    2014-07-01

    Air pollution has been correlated to an increasing number of cases of human skin diseases in recent years. However, the investigation of human skin tissues has received only limited attention, to the point that there are not yet satisfactory modern detection technologies to accurately, noninvasively, and rapidly diagnose human skin at epidermis and dermis levels. In order to detect and analyze severe skin diseases such as melanoma, a finite element method (FEM) simulation study of the application of the laser-generated surface acoustic wave (LSAW) technique is developed. A three-layer human skin model is built, where LSAW's are generated and propagated, and their effects in the skin medium with melanoma are analyzed. Frequency domain analysis is used as a main tool to investigate such issues as minimum detectable size of melanoma, filtering spectra from noise and from computational irregularities, as well as on how the FEM model meshing size and computational capabilities influence the accuracy of the results. Based on the aforementioned aspects, the analysis of the signals under the scrutiny of the phase velocity dispersion curve is verified to be a reliable, a sensitive, and a promising approach for detecting and characterizing melanoma in human skin.

  19. Flexible Nanosomes (SECosomes) Enable Efficient siRNA Delivery in Cultured Primary Skin Cells and in the Viable Epidermis of Ex Vivo Human Skin

    NARCIS (Netherlands)

    Geusens, Barbara; Van Gele, Mireille; Braat, Sien; De Smedt, Stefaan C.; Stuart, Marc C. A.; Prow, Tarl W.; Sanchez, Washington; Roberts, Michael S.; Sanders, Niek N.; Lambert, Jo

    2010-01-01

    The extent to which nanoscale-engineered systems cross intact human skin and can exert pharmacological effects in viable epidermis is controversial. This research seeks to develop a new lipid-based nanosome that enables the effective delivery of siRNA into human skin. The major finding is that an

  20. Automation Diagnosis of Skin Disease in Humans using Dempster-Shafer Method

    Science.gov (United States)

    Khairina, Dyna Marisa; Hatta, Heliza Rahmania; Rustam; Maharani, Septya

    2018-02-01

    Skin disease is an infectious disease that is common in people of all ages. Disorders of the skin often occur because there are factors, among others, are climate, environment, shelter, unhealthy living habits, allergies and others. Skin diseases in Indonesia are mostly caused by bacterial, fungal, parasitic, and allergies. The objective of the research is to diagnose skin diseases in humans by using the method of making decision tree then performing the search by forward chaining and calculating the probability value of Dempster-Shafer method. The results of research in the form of an automated system that can resemble an expert in diagnosing skin disease accurately and can help in overcoming the problem of skin diseases.

  1. Chondroitin-6-sulfate-containing proteoglycan: a new component of human skin dermoepidermal junction

    DEFF Research Database (Denmark)

    Fine, J D; Couchman, J R

    1988-01-01

    chondroitin sulfate proteoglycan is present in adult, neonatal, and/or fetal skin, and if present, its ultrastructural localization. Indirect immunofluorescence was performed on human adult, neonatal, and fetal skin. To detect the antigen, specimens were pretreated with chondroitinase ABC; absence of enzyme...... treatment served as negative control. Chondroitin sulfate proteoglycan was detectable in linear homogeneous array along the dermoepidermal junction and within vascular (and when present, adnexal) basement membranes in both adult and neonatal skin. In fetal skin, basement membrane staining was noted as early...... as 54 gestational days. Indirect immunoelectron microscopy and NaCl-split skin studies were performed to ultrastructurally localize the antigen; immune deposits were detectable within the lamina densa in chondroitinase-treated skin. These findings demonstrate that chondroitin sulfate proteoglycan...

  2. Royal jelly protects against ultraviolet B-induced photoaging in human skin fibroblasts via enhancing collagen production.

    Science.gov (United States)

    Park, Hye Min; Hwang, Eunson; Lee, Kwang Gill; Han, Sang-Mi; Cho, Yunhi; Kim, Sun Yeou

    2011-09-01

    Royal jelly (RJ) is a honeybee product containing proteins, carbohydrates, fats, free amino acids, vitamins, and minerals. As its principal unsaturated fatty acid, RJ contains 10-hydroxy-2-decenoic acid (10-HDA), which may have antitumor and antibacterial activity and a capacity to stimulate collagen production. RJ has attracted interest in various parts of the world for its pharmacological properties. However, the effects of RJ on ultraviolet (UV)-induced photoaging of the skin have not been reported. In this study we measured the 10-HDA content of RJ by high-performance liquid chromatography and tested the effects of RJ on UVB-induced skin photoaging in normal human dermal fibroblasts. The effects of RJ and 10-HDA on UVB-induced photoaging were tested by measuring procollagen type I, transforming growth factor (TGF)-β1, and matrix metalloproteinase (MMP)-1 after UVB irradiation. The RJ contained about 0.211% 10-HDA. The UVB-irradiated human skin fibroblasts treated with RJ and 10-HDA had increased procollagen type I and TGF-β1 productions, but the level of MMP-1 was not changed. Thus RJ may potentially protect the skin from UVB-induced photoaging by enhancing collagen production.

  3. In vitro dermal absorption of decabromodiphenyl ethane in rat and human skin

    Data.gov (United States)

    U.S. Environmental Protection Agency — In vitro dermal absorption of decabromodiphenyl ethane in rat and human skin. This dataset is associated with the following publication: Knudsen, G., J.M. Sanders,...

  4. The moisturizing effects of glycolipid biosurfactants, mannosylerythritol lipids, on human skin.

    Science.gov (United States)

    Yamamoto, Shuhei; Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Yanagidani, Shusaku; Sogabe, Atsushi; Kitamoto, Dai; Kitagawa, Masaru

    2012-01-01

    Glycolipid biosurfactants, such as mannosylerythritol lipids (MELs), are produced by different yeasts belonging to the genus Pseudozyma and have been attracting much attention as new cosmetic ingredients owing to their unique liquid-crystal-forming and moisturizing properties. In this study, the effects of different MEL derivatives on the skin were evaluated in detail using a three-dimensional cultured human skin model and an in vivo human study. The skin cells were cultured and treated with sodium dodecyl sulfate (SDS), and the effects of different lipids on the SDS-damaged cells were evaluated on the basis of cell viability. Most MEL derivatives efficiently recovered the viability of the cells and showed high recovery rates (over 80%) comparable with that of natural ceramide. It is interesting that the recovery rate with MEL-A prepared from olive oil was significantly higher than that of MEL-A prepared from soybean oil. The water retention properties of MEL-B were further investigated on human forearm skin in a preliminary study. Compared with the control, the aqueous solution of MEL-B (5 wt%) was estimated to considerably increase the stratum corneum water content in the skin. Moreover, perspiration on the skin surface was clearly suppressed by treatment with the MEL-B solution. These results suggest that MELs are likely to exhibit a high moisturizing action, by assisting the barrier function of the skin. Accordingly, the yeast glycolipids have a strong potential as a new ingredient for skin care products.

  5. Novel Inhibitory Effect of N-(2-Hydroxycyclohexylvaliolamine on Melanin Production in a Human Skin Model

    Directory of Open Access Journals (Sweden)

    Bum-Ho Bin

    2014-07-01

    Full Text Available Hyper-pigmentation causes skin darkness and medical disorders, such as post-inflammatory melanoderma and melasma. Therefore, the development of anti-melanogenic agents is important for treating these conditions and for cosmetic production. In our previous paper, we demonstrated that the anti-diabetic drug voglibose, a valiolamine derivative, is a potent anti-melanogenic agent. In addition, we proposed an alternative screening strategy to identify valiolamine derivatives with high skin permeability that act as anti-melanogenic agents when applied topically. In this study, we synthesized several valiolamine derivatives with enhanced lipophilicity and examined their inhibitory effects in a human skin model. N-(2-hydroxycyclohexylvaliolamine (HV possesses a stronger inhibitory effect on melanin production than voglibose in a human skin model, suggesting that HV is a more potent anti-melanogenic agent for the skin.

  6. Blood-group-related carbohydrates are expressed in organotypic cultures of human skin and oral mucosa

    DEFF Research Database (Denmark)

    Grøn, B; Andersson, A; Dabelsteen, Erik

    1999-01-01

    cultures. The organotypic skin and oral mucosa cultures showed a histological differentiation pattern analogous to that of normal skin and buccal mucosa, and a tissue-specific expression of carbohydrate structures and cytokeratins. However, both types of organotypic cultures also expressed markers which...... are normally seen during wound healing, including Lewis y, cytokeratin 16, and cytokeratin 19. We conclude that the organotypic cultures of oral mucosa and skin are suitable models for future studies of the function of cell-surface carbohydrates, although the expression of wound healing markers has to be taken...... the function of cell-surface carbohydrates, we established organotypic cultures of skin and buccal mucosa. In these cultures, keratinocytes are grown at the air-liquid interface on a supporting matrix consisting of homologous fibroblasts embedded in a collagen type I gel. We examined the expression of blood...

  7. Reference man models based on normal data from human populations

    International Nuclear Information System (INIS)

    Tanaka, Gi-ichiro; Kawamura, Hisao

    2000-01-01

    Quantitative description of the physical, and metabolic parameters of the human body is the very basic for internal dosimetry. Compilation of anatomical and other types of data Asian populations for internal (and external) dosimetry is of grate significance because of the potential spread of nuclear energy use in the Asian region and the major contribution of the region to the world population (about 58%). It has been observed that some differences exist for habitat, race, body sizes and pattern of food consumption. In the early stage of revision of ICRP Reference man by the Task Group, Characteristics of the human body of non-European populations received considerable attention as well as those of the European populations of different sexes and ages. In this context, an IAEA-RCA Co-ordinated Research Program on Compilation of Anatomical, Physiological and Metabolic Characteristics for a Reference Asian Man endorsed. In later stages of reference Man revision, anatomical data for Asians was discusses together with those of European populations, presumably due to ICRP's decision of unanimous use of the Reference Man for radiation protection. Reference man models for adults and 15, 10, 5, 1, 0 year-old males and females of Asian populations were developed for use in internal and external dosimetry. Based on the concept of ICRP Reference Man (Publication 23), the reference values were derived from the normal organ mass data for Japanese and statistical data on the physique and nutrition of Japanese and Chinese. Also incorporated were variations in physical measurements, as observed in the above mentioned IAEA-RCA Co-ordinated Research Program. The work was partly carried out within the activities of the ICRP Task Group on Reference Man. The weight of the skeleton was adjusted following the revised values in Publication 70. This paper will report basic shared and non-shared characteristics of Reference Man' for Asians and ICRP Reference Man. (author)

  8. Reproducibility of P-31 spectroscopic imaging of normal human myocardium

    International Nuclear Information System (INIS)

    Tavares, N.J.; Chew, W.; Auffermann, W.; Higgins, C.B.

    1988-01-01

    To assess reproducibility of P-31 MR spectroscopy of human myocardium, ten normal male volunteers were studied on two separate occasions. Spectra were acquired on a clinical 1.5-T MR imaging unit (Signa, General Electric) using a one-dimensional gated spectroscopic imaging sequence (matrix size, 32 X 256) over 20 minutes. Peaks in the adenosine triphosphate (ATP) region, phosphocreatine (PCR), phosphodiesters (PD), and peaks attributable to 2,3 diphosphoglycerate from blood were observed. Interindividual and intraindividual variability expressed as standard errors of the mean (mean +- SEM) were 1.54 +- 0.04 (variability among subjects) and 0.04 (variability between first and second studies) for PCR/β ATP; 0.97 +- 0.18 and 0.06 for PD/β ATP; and 0.62 +- 0.10 and 0.05 for PD/PCR, respectively. In conclusion, P-31 MR spectroscopy yields consistent and reproducible myocardial spectra that might be useful in the future for the evaluation and monitoring of cardiac disease

  9. Mechanical compression attenuates normal human bronchial epithelial wound healing

    Directory of Open Access Journals (Sweden)

    Malavia Nikita

    2009-02-01

    Full Text Available Abstract Background Airway narrowing associated with chronic asthma results in the transmission of injurious compressive forces to the bronchial epithelium and promotes the release of pro-inflammatory mediators and the denudation of the bronchial epithelium. While the individual effects of compression or denudation are well characterized, there is no data to elucidate how these cells respond to the application of mechanical compression in the presence of a compromised epithelial layer. Methods Accordingly, differentiated normal human bronchial epithelial cells were exposed to one of four conditions: 1 unperturbed control cells, 2 single scrape wound only, 3 static compression (6 hours of 30 cmH2O, and 4 6 hours of static compression after a scrape wound. Following treatment, wound closure rate was recorded, media was assayed for mediator content and the cytoskeletal network was fluorescently labeled. Results We found that mechanical compression and scrape injury increase TGF-β2 and endothelin-1 secretion, while EGF content in the media is attenuated with both injury modes. The application of compression after a pre-existing scrape wound augmented these observations, and also decreased PGE2 media content. Compression stimulated depolymerization of the actin cytoskeleton and significantly attenuated wound healing. Closure rate was partially restored with the addition of exogenous PGE2, but not EGF. Conclusion Our results suggest that mechanical compression reduces the capacity of the bronchial epithelium to close wounds, and is, in part, mediated by PGE2 and a compromised cytoskeleton.

  10. Zinc in human prostate gland. Normal, hyperplastic and cancerous

    International Nuclear Information System (INIS)

    Zaichick, V.Ye.; Sviridova, T.V.; Zaichick, S.V.

    1997-01-01

    Zinc concentration in a prostate gland is much higher than that in other human tissues. Data about zinc changes for different prostate diseases are limited and greatly contradictory. Zinc content was determined for biopsy and resected materials of transrectal puncture tissues from benign prostate hyperplasia (BPH) and prostate cancer. There were 109 patients (50 BPH and 59 cancer) available for the present study. Control group consisted of 37 intact glands of men died an unexpected death (accident, murder, acute cardiac insufficiency, etc.). All materials studied were divided into two parts. One of them was morphologically examined, while another one was subjected to zinc analysis by INAA. Zinc contents (M ± SE) of normal, benign hyperplastic and cancerous prostate glands were found to be 1018 ± 124, 1142 ± 77, and 146 ± 10 μg/g dry tissue, respectively. It was shown that zinc assessments in the materials of transrectal puncture biopsy of indurated prostate sites can be used as an additional test for differential diagnostics of BPH and cancer. Accuracy, sensitivity and specificity of the test are 98 ± 2%. (author)

  11. Progesterone Upregulates Gene Expression in Normal Human Thyroid Follicular Cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Santin Bertoni

    2015-01-01

    Full Text Available Thyroid cancer and thyroid nodules are more prevalent in women than men, so female sex hormones may have an etiological role in these conditions. There are no data about direct effects of progesterone on thyroid cells, so the aim of the present study was to evaluate progesterone effects in the sodium-iodide symporter NIS, thyroglobulin TG, thyroperoxidase TPO, and KI-67 genes expression, in normal thyroid follicular cells, derived from human tissue. NIS, TG, TPO, and KI-67 mRNA expression increased significantly after TSH 20 μUI/mL, respectively: 2.08 times, P<0.0001; 2.39 times, P=0.01; 1.58 times, P=0.0003; and 1.87 times, P<0.0001. In thyroid cells treated with 20 μUI/mL TSH plus 10 nM progesterone, RNA expression of NIS, TG, and KI-67 genes increased, respectively: 1.78 times, P<0.0001; 1.75 times, P=0.037; and 1.95 times, P<0.0001, and TPO mRNA expression also increased, though not significantly (1.77 times, P=0.069. These effects were abolished by mifepristone, an antagonist of progesterone receptor, suggesting that genes involved in thyroid cell function and proliferation are upregulated by progesterone. This work provides evidence that progesterone has a direct effect on thyroid cells, upregulating genes involved in thyroid function and growth.

  12. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  13. Effects of ultraviolet radiations on the human skin

    International Nuclear Information System (INIS)

    Cesarini, J.P.

    1987-01-01

    Skin cancers and, particularly, malignant melanomas are the end product of a long chain of events which start with the very first exposure to sunlight. The genetic program which directs the capacity to develop a protective tan has failed when a skin cancer arises. The price to pay before building an efficient defense is already too high for those who develop skin cancers. Less exposures to solar or artificial UVR and larger use of complementary efficient sunscreens should reduce the cutaneous damages to a level compatible with the repair capacity. Nevertheless, care should be taken to discourage individuals at high risk for cancers to develop a tan since increasing phaeomelanic content of the epidermis is equivalent to increase the risk

  14. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  15. Quantitative relationship between the local lymph node assay and human skin sensitization assays.

    Science.gov (United States)

    Schneider, K; Akkan, Z

    2004-06-01

    The local lymph node assay (LLNA) is a new test method which allows for the quantitative assessment of sensitizing potency in the mouse. Here, we investigate the quantitative correlation between results from the LLNA and two human sensitization tests--specifically, human repeat insult patch tests (HRIPTs) and human maximization tests (HMTs). Data for 57 substances were evaluated, of which 46 showed skin sensitizing properties in human tests, whereas 11 yielded negative results in humans. For better comparability data from mouse and human tests were transformed to applied doses per skin area, which ranged over four orders of magnitude for the substances considered. Regression analysis for the 46 human sensitizing substances revealed a significant positive correlation between the LLNA and human tests. The correlation was better between LLNA and HRIPT data (n=23; r=0.77) than between LLNA and HMT data (n=38; r=0.65). The observed scattering of data points is related to various uncertainties, in part associated with insufficiencies of data from older HMT studies. Predominantly negative results in the LLNA for another 11 substances which showed no skin sensitizing activity in human maximization tests further corroborate the correspondence between LLNA and human tests. Based on this analysis, the LLNA can be considered a reliable basis for relative potency assessments for skin sensitizers. Proposals are made for the regulatory exploitation of the LLNA: four potency groups can be established, and assignment of substances to these groups according to the outcome of the LLNA can be used to characterize skin sensitizing potency in substance-specific assessments. Moreover, based on these potency groups, a more adequate consideration of sensitizing substances in preparations becomes possible. It is proposed to replace the current single concentration limit for skin sensitizers in preparations, which leads to an all or nothing classification of a preparation as sensitizing to

  16. Characterisation of a behavioural protocol for the assessment of nociception in normal and inflamed porcine skin

    DEFF Research Database (Denmark)

    di Giminiani, Pierpaolo

    2012-01-01

    The study of pain has been historically based on the investigation of human clinical conditions with the purpose of identifying the direct causes of pain to develop suitable analgesic treatments. The need to comprehend the mechanisms behind the processes of pain ignited the rapid development of pre......-clinical research, based on the investigation of experimental models designed to reproduce painful conditions or parts thereof. Animals play a fundamental role, since they provide the platform to reproduce human conditions in order to study the mechanisms behind pain processes, and during the last three decades...... increasing scepticism because a large proportion of emerging pharmaceutical products never reached marketing approval due to poor correlations between preclinical therapeutic findings and the eventual efficacy of these compounds in clinical trials. Thus, the behavioural component of pre-clinical studies...

  17. Repair of DNA damage in light sensitive human skin diseases

    Energy Technology Data Exchange (ETDEWEB)

    Horkay, I.; Varga, L.; Tam' asi P., Gundy, S.

    1978-12-01

    Repair of uv-light induced DNA damage and changes in the semiconservative DNA synthesis were studied by in vitro autoradiography in the skin of patients with lightdermatoses (polymorphous light eruption, porphyria cutanea tarda, erythropoietic protoporphyria) and xeroderma pigmentosum as well as in that of healthy controls. In polymorphous light eruption the semiconservative DNA replication rate was more intensive in the area of the skin lesions and in the repeated phototest site, the excision repair synthesis appeared to be unaltered. In cutaneous prophyrias a decreased rate of the repair incorporation could be detected. Xeroderma pigmentosum was characterized by a strongly reduced repair synthesis.

  18. Going skin deep: A direct comparison of penetration potential of lipid-based nanovesicles on the isolated perfused human skin flap model.

    Science.gov (United States)

    Ternullo, Selenia; de Weerd, Louis; Holsæter, Ann Mari; Flaten, Gøril Eide; Škalko-Basnet, Nataša

    2017-12-01

    Phospholipid-based nanocarriers are attractive drug carriers for improved local skin therapy. In the present study, the recently developed isolated perfused human skin flap (IPHSF) model was used to directly compare the skin penetration enhancing potential of the three commonly used nanocarriers, namely conventional liposomes (CLs), deformable liposomes (DLs) and solid lipid nanoparticles (SLNs). Two fluorescent markers, calcein (hydrophilic) or rhodamine (lipophilic), were incorporated individually in the three nanosystems. The nanocarrier size ranged between 200 and 300nm; the surface charge and entrapment efficiency for both markers were dependent on the lipid composition and the employed surfactant. Both carrier-associated markers could not penetrate the full thickness human skin, confirming their suitability for dermal drug delivery. CLs exhibited higher retention of both markers on the skin surface compared to DLs and SLNs, indicating a depo formation. DLs and SLNs enabled the deeper penetration of the two markers into the skin layers. In vitro and ex vivo skin penetration studies performed on the cellophane membrane and full thickness pig/human skin, respectively, confirmed the findings. In conclusion, efficient dermal drug delivery can be achieved by optimization of a lipid nanocarrier on the suitable skin-mimicking model to assure system's accumulation in the targeted skin layer. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. © 2012 John Wiley & Sons A/S.

  20. The deceptive nature of UVA-tanning versus the modest protective effects of UVB-tanning on human skin

    OpenAIRE

    Miyamura, Yoshinori; Coelho, Sergio G.; Schlenz, Kathrin; Batzer, Jan; Smuda, Christoph; Choi, Wonseon; Brenner, Michaela; Passeron, Thierry; Zhang, Guofeng; Kolbe, Ludger; Wolber, Rainer; Hearing, Vincent J.

    2010-01-01

    The relationship between human skin pigmentation and protection from ultraviolet (UV) radiation is an important element underlying differences in skin carcinogenesis rates. The association between UV damage and the risk of skin cancer is clear, yet a strategic balance in exposure to UV needs to be met. Dark skin is protected from UV-induced DNA damage significantly more than light skin due to the constitutively higher pigmentation but an as yet unresolved and important question is what photop...

  1. Global classification of human facial healthy skin using PLS discriminant analysis and clustering analysis.

    Science.gov (United States)

    Guinot, C; Latreille, J; Tenenhaus, M; Malvy, D J

    2001-04-01

    Today's classifications of healthy skin are predominantly based on a very limited number of skin characteristics, such as skin oiliness or susceptibility to sun exposure. The aim of the present analysis was to set up a global classification of healthy facial skin, using mathematical models. This classification is based on clinical, biophysical skin characteristics and self-reported information related to the skin, as well as the results of a theoretical skin classification assessed separately for the frontal and the malar zones of the face. In order to maximize the predictive power of the models with a minimum of variables, the Partial Least Square (PLS) discriminant analysis method was used. The resulting PLS components were subjected to clustering analyses to identify the plausible number of clusters and to group the individuals according to their proximities. Using this approach, four PLS components could be constructed and six clusters were found relevant. So, from the 36 hypothetical combinations of the theoretical skin types classification, we tended to a strengthened six classes proposal. Our data suggest that the association of the PLS discriminant analysis and the clustering methods leads to a valid and simple way to classify healthy human skin and represents a potentially useful tool for cosmetic and dermatological research.

  2. Effectiveness of hand washing on the removal of iron oxide nanoparticles from human skin ex vivo.

    Science.gov (United States)

    Lewinski, Nastassja A; Berthet, Aurélie; Maurizi, Lionel; Eisenbeis, Antoine; Hopf, Nancy B

    2017-08-01

    In this study, the effectiveness of washing with soap and water in removing nanoparticles from exposed skin was investigated. Dry, nanoscale hematite (α-Fe 2 O 3 ) or maghemite (γ-Fe 2 O 3 ) powder, with primary particle diameters between 20-30 nm, were applied to two samples each of fresh and frozen ex vivo human skin in two independent experiments. The permeation of nanoparticles through skin, and the removal of nanoparticles after washing with soap and water were investigated. Bare iron oxide nanoparticles remained primarily on the surface of the skin, without penetrating beyond the stratum corneum. Skin exposed to iron oxide nanoparticles for 1 and 20 hr resulted in removal of 85% and 90%, respectively, of the original dose after washing. In the event of dermal exposure to chemicals, removal is essential to avoid potential local irritation or permeation across skin. Although manufactured at an industrial scale and used extensively in laboratory experiments, limited data are available on the removal of engineered nanoparticles after skin contact. Our finding raises questions about the potential consequences of nanoparticles remaining on the skin and whether alternative washing methods should be proposed. Further studies on skin decontamination beyond use of soap and water are needed to improve the understanding of the potential health consequences of dermal exposure to nanoparticles.

  3. Uncovering of melanin fluorescence in human skin tissue

    Science.gov (United States)

    Scholz, Matthias; Stankovic, Goran; Seewald, Gunter; Leupold, Dieter

    2007-07-01

    Due to its extremely low fluorescence quantum yield, in the conventionally (one-photon) excited autofluorescence of skin tissue, melanin fluorescence is masked by several other endogenous and possibly also exogenous fluorophores (e.g. NADH, FAD, Porphyrins). A first step to enhance the melanin contribution had been realized by two-photon fs-pulse excitation in the red/near IR, based on the fact that melanin can be excited by stepwise two-photon absorption, whereas all other fluorophores in this spectral region allow only simultaneous two-photon excitation. Now, the next and decisive step has been realized: Using an extremely sensitive detection system, for the first time twophoton fluorescence of skin tissue excited with pulses in the ns-range could be measured. The motivation for this step was based on the fact that the population density of the fluorescent level resulting from a stepwise excitation has a different dependence of the pulse duration than that from a simultaneous excitation (Δt2 vs. Δt). Due to this strong discrimination between the fluorophores, practically pure melanin fluorescence can be obtained. Examples for in-vivo, ex-vivo as well as paraffin embedded skin tissue will be shown. The content of information with respect to early diagnosis of skin deseases will be discussed.

  4. Age-related changes in expression and function of Toll-like receptors in human skin

    Science.gov (United States)

    Iram, Nousheen; Mildner, Michael; Prior, Marion; Petzelbauer, Peter; Fiala, Christian; Hacker, Stefan; Schöppl, Alice; Tschachler, Erwin; Elbe-Bürger, Adelheid

    2012-01-01

    Toll-like receptors (TLRs) initiate innate immune responses and direct subsequent adaptive immunity. They play a major role in cutaneous host defense against micro-organisms and in the pathophysiology of several inflammatory skin diseases. To understand the role of TLRs in the acquisition of immunological competence, we conducted a comprehensive study to evaluate TLR expression and function in the developing human skin before and after birth and compared it with adults. We found that prenatal skin already expresses the same spectrum of TLRs as adult skin. Strikingly, many TLRs were significantly higher expressed in prenatal (TLRs 1-5) and infant and child (TLRs 1 and 3) skin than in adult skin. Surprisingly, neither dendritic cell precursors in prenatal skin nor epidermal Langerhans cells and dermal dendritic cells in adult skin expressed TLRs 3 and 6, whereas the staining pattern and intensity of both TLRs in fetal basal keratinocytes was almost comparable to those of adults. Stimulation of primary human keratinocytes from fetal, neonatal and adult donors with selected TLR agonists revealed that the synthetic TLR3 ligand poly (I:C) specifically, mimicking viral double-stranded RNA, induced a significantly enhanced secretion of CXCL8/IL8, CXCL10/IP-10 and TNFα in fetal and neonatal keratinocytes compared with adult keratinocytes. This study demonstrates quantitative age-specific modifications in TLR expression and innate skin immune reactivity in response to TLR activation. Thus, antiviral innate immunity already in prenatal skin may contribute to protect the developing human body from viral infections in utero in a scenario where the adaptive immune system is not yet fully functional. PMID:23034637

  5. Generation of Genetically Modified Organotypic Skin Cultures Using Devitalized Human Dermis.

    Science.gov (United States)

    Li, Jingting; Sen, George L

    2015-12-14

    Organotypic cultures allow the reconstitution of a 3D environment critical for cell-cell contact and cell-matrix interactions which mimics the function and physiology of their in vivo tissue counterparts. This is exemplified by organotypic skin cultures which faithfully recapitulates the epidermal differentiation and stratification program. Primary human epidermal keratinocytes are genetically manipulable through retroviruses where genes can be easily overexpressed or knocked down. These genetically modified keratinocytes can then be used to regenerate human epidermis in organotypic skin cultures providing a powerful model to study genetic pathways impacting epidermal growth, differentiation, and disease progression. The protocols presented here describe methods to prepare devitalized human dermis as well as to genetically manipulate primary human keratinocytes in order to generate organotypic skin cultures. Regenerated human skin can be used in downstream applications such as gene expression profiling, immunostaining, and chromatin immunoprecipitations followed by high throughput sequencing. Thus, generation of these genetically modified organotypic skin cultures will allow the determination of genes that are critical for maintaining skin homeostasis.

  6. Validation of radiosterilization dose of human skin dressings for burnt treatment: preliminary study

    International Nuclear Information System (INIS)

    Castro, E.

    2008-01-01

    Full text: Due to the need for better materials to treat burnt patients, the Peruvian Institute of Nuclear Energy (IPEN) and the Rosa Guerzoni Chambergo Tissue Bank are collaborating for developing human skin dressings. Skin was procured from living donors, who surgically were performed a dermolipectomy. Exclusion criteria, stated by the Peruvian Organization for Transplant and Donation were observed. Glycerolized human skin dressings were processed at the tissue bank and sent to IPEN, where the gamma irradiation sterilizing dose was determined. The purpose of this work is to validate the radiation sterilization dose delivered to human skin dressings using the IAEA Code of Practice for the Radiation Sterilization of Tissue Allografts: Requirements for Validation and Routine Control. A batch of human skin dressings was tested. Average values of bioburden present in ten samples was 30 UFC/item, obtaining a sub-sterilization dose of 4 kGy. Irradiations were performed in the GammacellExcel 220. Sterility tests performed fulfilled the requirements established by the Code, achieving a validated dose value of 19.7 kGy. This preliminary study, that should be repeated in two other batches of processed human skin, allows to diminish 25 kGy the sterilizing dose to the stated above dose value, in a frame of a quality assurance system that also comprises the processes held at tissue banks previous irradiation. It also permit the availability of these materials in Peruvian hospitals. (Author)

  7. DNA damage by carbonyl stress in human skin cells

    International Nuclear Information System (INIS)

    Roberts, Michael J.; Wondrak, Georg T.; Laurean, Daniel Cervantes; Jacobson, Myron K.; Jacobson, Elaine L.

    2003-01-01

    Reactive carbonyl species (RCS) are potent mediators of cellular carbonyl stress originating from endogenous chemical processes such as lipid peroxidation and glycation. Skin deterioration as observed in photoaging and diabetes has been linked to accumulative protein damage from glycation, but the effects of carbonyl stress on skin cell genomic integrity are ill defined. In this study, the genotoxic effects of acute carbonyl stress on HaCaT keratinocytes and CF3 fibroblasts were assessed. Administration of the α-dicarbonyl compounds glyoxal and methylglyoxal as physiologically relevant RCS inhibited skin cell proliferation, led to intra-cellular protein glycation as evidenced by the accumulation of N ε -(carboxymethyl)-L-lysine (CML) in histones, and caused extensive DNA strand cleavage as assessed by the comet assay. These effects were prevented by treatment with the carbonyl scavenger D-penicillamine. Both glyoxal and methylglyoxal damaged DNA in intact cells. Glyoxal caused DNA strand breaks while methylglyoxal produced extensive DNA-protein cross-linking as evidenced by pronounced nuclear condensation and total suppression of comet formation. Glycation by glyoxal and methylglyoxal resulted in histone cross-linking in vitro and induced oxygen-dependent cleavage of plasmid DNA, which was partly suppressed by the hydroxyl scavenger mannitol. We suggest that a chemical mechanism of cellular DNA damage by carbonyl stress occurs in which histone glycoxidation is followed by reactive oxygen induced DNA stand breaks. The genotoxic potential of RCS in cultured skin cells and its suppression by a carbonyl scavenger as described in this study have implications for skin damage and carcinogenesis and its prevention by agents selective for carbonyl stress

  8. DNA damage by carbonyl stress in human skin cells

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Michael J.; Wondrak, Georg T.; Laurean, Daniel Cervantes; Jacobson, Myron K.; Jacobson, Elaine L

    2003-01-28

    Reactive carbonyl species (RCS) are potent mediators of cellular carbonyl stress originating from endogenous chemical processes such as lipid peroxidation and glycation. Skin deterioration as observed in photoaging and diabetes has been linked to accumulative protein damage from glycation, but the effects of carbonyl stress on skin cell genomic integrity are ill defined. In this study, the genotoxic effects of acute carbonyl stress on HaCaT keratinocytes and CF3 fibroblasts were assessed. Administration of the {alpha}-dicarbonyl compounds glyoxal and methylglyoxal as physiologically relevant RCS inhibited skin cell proliferation, led to intra-cellular protein glycation as evidenced by the accumulation of N{sup {epsilon}}-(carboxymethyl)-L-lysine (CML) in histones, and caused extensive DNA strand cleavage as assessed by the comet assay. These effects were prevented by treatment with the carbonyl scavenger D-penicillamine. Both glyoxal and methylglyoxal damaged DNA in intact cells. Glyoxal caused DNA strand breaks while methylglyoxal produced extensive DNA-protein cross-linking as evidenced by pronounced nuclear condensation and total suppression of comet formation. Glycation by glyoxal and methylglyoxal resulted in histone cross-linking in vitro and induced oxygen-dependent cleavage of plasmid DNA, which was partly suppressed by the hydroxyl scavenger mannitol. We suggest that a chemical mechanism of cellular DNA damage by carbonyl stress occurs in which histone glycoxidation is followed by reactive oxygen induced DNA stand breaks. The genotoxic potential of RCS in cultured skin cells and its suppression by a carbonyl scavenger as described in this study have implications for skin damage and carcinogenesis and its prevention by agents selective for carbonyl stress.

  9. Novel Tissue Models of Junctional Epidermolysis Bullosa to Characterize Functional Mechanisms of Sulfur Mustard Injury to Human Skin

    National Research Council Canada - National Science Library

    Garlick, Joanthan

    2003-01-01

    In the second year of our research, our laboratory has extensively studied skin pathophysiology in response to SM by adapting in vivo, human skin/nude mouse chimera to further understand mechanisms...

  10. Nutraceuticals for Skin Care: A Comprehensive Review of Human Clinical Studies.

    Science.gov (United States)

    Pérez-Sánchez, Almudena; Barrajón-Catalán, Enrique; Herranz-López, María; Micol, Vicente

    2018-03-24

    The skin is the body's largest organ, it participates in sensitivity and offers protection against microorganisms, chemicals and ultraviolet (UV) radiation. Consequently, the skin may suffer alterations such as photo-ageing, immune dysfunction and inflammation which may significantly affect human health. Nutraceuticals represent a promising strategy for preventing, delaying, or minimising premature ageing of the skin and also to alleviate certain skin disorders. Among them, bioactive peptides and oligosaccharides, plant polyphenols, carotenoids, vitamins and polyunsaturated fatty acids are the most widely used ingredients. Supplementation with these products has shown evidence of having an effect on the signs of ageing and protection against UV radiation ageing in several human trials. In this review, the most relevant human studies on skin nutraceuticals are evaluated and the statistical resolution, biological relevance of their results, and, the trial protocols are discussed. In conclusion, quality and rigorousness of the trials must be improved to build credible scientific evidence for skin nutraceuticals and to establish a cause-effect relationship between the ingredients the beneficial effects for the skin.

  11. Nutraceuticals for Skin Care: A Comprehensive Review of Human Clinical Studies

    Directory of Open Access Journals (Sweden)

    Almudena Pérez-Sánchez

    2018-03-01

    Full Text Available The skin is the body’s largest organ, it participates in sensitivity and offers protection against microorganisms, chemicals and ultraviolet (UV radiation. Consequently, the skin may suffer alterations such as photo-ageing, immune dysfunction and inflammation which may significantly affect human health. Nutraceuticals represent a promising strategy for preventing, delaying, or minimising premature ageing of the skin and also to alleviate certain skin disorders. Among them, bioactive peptides and oligosaccharides, plant polyphenols, carotenoids, vitamins and polyunsaturated fatty acids are the most widely used ingredients. Supplementation with these products has shown evidence of having an effect on the signs of ageing and protection against UV radiation ageing in several human trials. In this review, the most relevant human studies on skin nutraceuticals are evaluated and the statistical resolution, biological relevance of their results, and, the trial protocols are discussed. In conclusion, quality and rigorousness of the trials must be improved to build credible scientific evidence for skin nutraceuticals and to establish a cause-effect relationship between the ingredients the beneficial effects for the skin.

  12. Nutraceuticals for Skin Care: A Comprehensive Review of Human Clinical Studies

    Science.gov (United States)

    Pérez-Sánchez, Almudena; Micol, Vicente

    2018-01-01

    The skin is the body’s largest organ, it participates in sensitivity and offers protection against microorganisms, chemicals and ultraviolet (UV) radiation. Consequently, the skin may suffer alterations such as photo-ageing, immune dysfunction and inflammation which may significantly affect human health. Nutraceuticals represent a promising strategy for preventing, delaying, or minimising premature ageing of the skin and also to alleviate certain skin disorders. Among them, bioactive peptides and oligosaccharides, plant polyphenols, carotenoids, vitamins and polyunsaturated fatty acids are the most widely used ingredients. Supplementation with these products has shown evidence of having an effect on the signs of ageing and protection against UV radiation ageing in several human trials. In this review, the most relevant human studies on skin nutraceuticals are evaluated and the statistical resolution, biological relevance of their results, and, the trial protocols are discussed. In conclusion, quality and rigorousness of the trials must be improved to build credible scientific evidence for skin nutraceuticals and to establish a cause-effect relationship between the ingredients the beneficial effects for the skin. PMID:29587342

  13. In vivo evaluation of Fe in the human skin and swins mice skin through the X-rays fluorescence technique

    International Nuclear Information System (INIS)

    Estevam, Marcelo

    2005-01-01

    Recent technological improvements allow the method of in vivo XRF to supply useful sensibility for diagnostics or monitoring in biomedical applications. In cases of hereditary sanguine disorders as the β-Thalassaemia or a genetic disorder like Haemochromatosis, there is a high concentration of elements as Fe, Zn and Cu in the skin and internal organs, due to the treatment of those abnormalities or due to the own dysfunction caused by the disease. The levels of Fe related to the patient bearers of the β-Thalassaemia are determined, at the moment, measuring a protein in the sanguine current, called ferritin. The monitoring of the protein is ineffective in several situations, such as when the patient suffers any disturbance of health. Nowadays, the main forms of measuring the levels of those metals through hepatic storage are the biopsy of the liver, that is invasive and potentially dangerous, presenting a rate of mortality of 0,1%, and through magnetic susceptibilities that employs a quantum superconductor, which is highly expensive and there are only three main world medical centers with this equipment. This work investigates the use of a Si PIN-diode detector and a 238Pu source (13 and 17 keV; 13%; 95.2 mCi; 86y) for the measurement of Fe skin levels compatible with those associated to the disease β-Thalassaemia. XRF spectra were analyzed using a set of AXIL-WinQXAS programs elaborated and disseminated by the IAEA. The determination coefficient of the calibration model (sensitivity curve) was 0.97. Measurements on skin phantoms containing concentrations of Fe in the range from 15 to 150 parts per million (ppm), indicate that we are able to detect Fe at levels of the order of 13 ppm, using monitoring periods of 50 seconds and skin entrance dose less than 10 mSv. The literature reports skin Fe levels from 15.0 to 60.0 ppm in normal persons and from 70 to 150 ppm in thalassaemic patients. So, the employed methodology allows the in vivo measurement of the skin Fe

  14. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  15. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  16. Fermentation of Propionibacterium acnes, a commensal bacterium in the human skin microbiome, as skin probiotics against methicillin-resistant Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Muya Shu

    Full Text Available Bacterial interference creates an ecological competition between commensal and pathogenic bacteria. Through fermentation of milk with gut-friendly bacteria, yogurt is an excellent aid to balance the bacteriological ecosystem in the human intestine. Here, we demonstrate that fermentation of glycerol with Propionibacterium acnes (P. acnes, a skin commensal bacterium, can function as a skin probiotic for in vitro and in vivo growth suppression of USA300, the most prevalent community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA. We also promote the notion that inappropriate use of antibiotics may eliminate the skin commensals, making it more difficult to fight pathogen infection. This study warrants further investigation to better understand the role of fermentation of skin commensals in infectious disease and the importance of the human skin microbiome in skin health.

  17. Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro

    Directory of Open Access Journals (Sweden)

    Zou Y

    2017-10-01

    Full Text Available Ying Zou,1,2,* Anna Celli,2,3,* Hanjiang Zhu,2,* Akram Elmahdy,2 Yachao Cao,2 Xiaoying Hui,2 Howard Maibach2 1Skin & Cosmetic Research Department, Shanghai Skin Disease Hospital, Shanghai, People’s Republic of China; 2Department of Dermatology, School of Medicine, University of California San Francisco, San Francisco, CA, USA; 3San Francisco Veterans Medical Center, San Francisco, CA, USA *These authors contributed equally to this work Objective: With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration.Methods: Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy.Results: NPs were localized in the stratum corneum (SC and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not.Conclusion: Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. Keywords: nanoparticles, skin penetration, stratum corneum, confocal laser scanning microscopy, tape stripping

  18. A multivariable model for predicting the frictional behaviour and hydration of the human skin.

    Science.gov (United States)

    Veijgen, N K; van der Heide, E; Masen, M A

    2013-08-01

    The frictional characteristics of skin-object interactions are important when handling objects, in the assessment of perception and comfort of products and materials and in the origins and prevention of skin injuries. In this study, based on statistical methods, a quantitative model is developed that describes the friction behaviour of human skin as a function of the subject characteristics, contact conditions, the properties of the counter material as well as environmental conditions. Although the frictional behaviour of human skin is a multivariable problem, in literature the variables that are associated with skin friction have been studied using univariable methods. In this work, multivariable models for the static and dynamic coefficients of friction as well as for the hydration of the skin are presented. A total of 634 skin-friction measurements were performed using a recently developed tribometer. Using a statistical analysis, previously defined potential influential variables were linked to the static and dynamic coefficient of friction and to the hydration of the skin, resulting in three predictive quantitative models that descibe the friction behaviour and the hydration of human skin respectively. Increased dynamic coefficients of friction were obtained from older subjects, on the index finger, with materials with a higher surface energy at higher room temperatures, whereas lower dynamic coefficients of friction were obtained at lower skin temperatures, on the temple with rougher contact materials. The static coefficient of friction increased with higher skin hydration, increasing age, on the index finger, with materials with a higher surface energy and at higher ambient temperatures. The hydration of the skin was associated with the skin temperature, anatomical location, presence of hair on the skin and the relative air humidity. Predictive models have been derived for the static and dynamic coefficient of friction using a multivariable approach. These

  19. Sialylation regulates myofibroblast differentiation of human skin fibroblasts.

    Science.gov (United States)

    Sasaki, Norihiko; Itakura, Yoko; Toyoda, Masashi

    2017-04-18

    Fibroblasts are key players in maintaining skin homeostasis and in orchestrating physiological tissue repair and skin regeneration. Dysfunctions in fibroblasts that occur with aging and the senescent process lead to the delayed healing observed in elderly people. The molecular mechanisms leading to fibroblast dysfunction during aging and the senescent process have not yet been clarified. Previously, changes in patterns of glycosylation were observed in fibroblasts in aging and the senescent process, but the effect of these changes on the function of fibroblasts has not been well documented. Here, we investigated whether changes in glycosylation during the process to senescence may have functional effects on fibroblasts. The changes in cell surface glycans on skin fibroblasts during the process to senescence were examined in early-passage (EP) and late-passage (LP) skin fibroblasts by fluorescence-activated cell sorting analysis using lectins. The contributors to the changes in cell surface glycans were examined by real-time polymerase chain reaction or Western blot analysis. The effects of changes in glycosylation on proliferation, migration, induction of cellular senescence, and myofibroblast differentiation induced by transforming growth factor (TGF)-β1 stimulation were examined in EP fibroblasts. The changes in glycosylation were performed by GalNAc-α-O-benzyl or sialidase treatment. A decrease in sialylation of glycoproteins and an increase in sialidase NEU1 were observed in LP fibroblasts. The reduction of sialylation did not have any effect on proliferation, migration, or induction of cellular senescence. On the other hand, myofibroblast differentiation was inhibited by the reduction of sialylation, indicating that sialylation is important for myofibroblast differentiation. The localization of CD44 in lipid rafts, which is required for myofibroblast differentiation, was inhibited by the reduction of sialylation. Furthermore, reduced myofibroblast

  20. The small Rho GTPase Rac1 controls normal human dermal fibroblasts proliferation with phosphorylation of the oncoprotein c-myc

    International Nuclear Information System (INIS)

    Nikolova, Ekaterina; Mitev, Vanio; Zhelev, Nikolai; Deroanne, Christophe F.; Poumay, Yves

    2007-01-01

    Proliferation of dermal fibroblasts is crucial for the maintenance of skin. The small Rho GTPase, Rac1, has been identified as a key transducer of proliferative signals in various cell types, but in normal human dermal fibroblasts its significance to cell growth control has not been studied. In this study, we applied the method of RNA interference to suppress endogenous Rac1 expression and examined the consequences on human skin fibroblasts. Rac1 knock-down resulted in inhibition of DNA synthesis. This effect was not mediated by inhibition of the central transducer of proliferative stimuli, ERK1/2 or by activation of the pro-apoptotic p38. Rather, as a consequence of the suppressed Rac1 expression we observed a significant decrease in phosphorylation of c-myc, revealing for the first time that in human fibroblasts Rac1 exerts control on proliferation through c-myc phosphorylation. Thus Rac1 activates proliferation of normal fibroblasts through stimulation of c-myc phosphorylation without affecting ERK1/2 activity

  1. Nanotribological characterization of human hair and skin using atomic force microscopy

    International Nuclear Information System (INIS)

    LaTorre, Carmen; Bhushan, Bharat

    2005-01-01

    Healthy hair and skin is highly desired. Characterization of their morphological, frictional, and adhesive properties (tribological properties) is essential to enhance understanding of hair and skin and to advance the science. Literature on the tribological characterization of hair and skin is scarce to date. The paper presents nanotribological data and analysis on hair (Caucasian, Asian, and African hair at virgin, chemo-mechanically damaged, and treated conditions) and synthetic hair and skin, as well as roughness data of human skin replica. Roughness statistics are presented to characterize the vertical and spatial surface parameters. Average coefficient of friction values were determined for each ethnicity and hair type, and are discussed. The directionality dependence of friction is also discussed. Magnitude and spatial distribution of adhesive force are used to estimate thickness and distribution of the conditioner film

  2. Ultrathin conformal devices for precise and continuous thermal characterization of human skin

    Science.gov (United States)

    Webb, R. Chad; Bonifas, Andrew P.; Behnaz, Alex; Zhang, Yihui; Yu, Ki Jun; Cheng, Huanyu; Shi, Mingxing; Bian, Zuguang; Liu, Zhuangjian; Kim, Yun-Soung; Yeo, Woon-Hong; Park, Jae Suk; Song, Jizhou; Li, Yuhang; Huang, Yonggang; Gorbach, Alexander M.; Rogers, John A.

    2013-10-01

    Precision thermometry of the skin can, together with other measurements, provide clinically relevant information about cardiovascular health, cognitive state, malignancy and many other important aspects of human physiology. Here, we introduce an ultrathin, compliant skin-like sensor/actuator technology that can pliably laminate onto the epidermis to provide continuous, accurate thermal characterizations that are unavailable with other methods. Examples include non-invasive spatial mapping of skin temperature with millikelvin precision, and simultaneous quantitative assessment of tissue thermal conductivity. Such devices can also be implemented in ways that reveal the time-dynamic influence of blood flow and perfusion on these properties. Experimental and theoretical studies establish the underlying principles of operation, and define engineering guidelines for device design. Evaluation of subtle variations in skin temperature associated with mental activity, physical stimulation and vasoconstriction/dilation along with accurate determination of skin hydration through measurements of thermal conductivity represent some important operational examples.

  3. Absorption of human skin and its detecting platform in the process of laser cosmetology

    Science.gov (United States)

    Zhang, Yong-Lin; Ouyang, Li; Wang, Yang

    2000-10-01

    Because of the melanin, hemoglobin and water molecules, etc. contained, light absorption of human skin tissue changes with wavelength of light. This is the principle used in laser cosmetology for treating pigment diseases and vascular lesion diseases as well as skin decoration such as body tattooing, eyebrow tattooing, etc. The parameters of treatment used in laser cosmetology principally come from the research of the skin tissue optical characteristics of whites, and it is not suitable for the Oriental. The absorption spectrum of yellow race alive skin has been researched. The detecting platform for use in the measuring of vivi-tissue absorption spectrum has been developed which using opto-electronic nondestructive testing and virtual instrument techniques. The degree of pathological changes of skin can be detected by this platform also, thus the shortcoming of dosage selection in laser clinical treatments which have been decided only by naked eye observation and past experience of doctors can be solved.

  4. Methodological assessment of skin and limb blood flows in the human forearm during thermal and baroreceptor provocations.

    Science.gov (United States)

    Brothers, R Matthew; Wingo, Jonathan E; Hubing, Kimberly A; Crandall, Craig G

    2010-09-01

    Skin blood flow responses in the human forearm, assessed by three commonly used technologies-single-point laser-Doppler flowmetry, integrated laser-Doppler flowmetry, and laser-Doppler imaging-were compared in eight subjects during normothermic baseline, acute skin-surface cooling, and whole body heat stress (Δ internal temperature=1.0±0.2 degrees C; Pforearm blood flow (FBF) measures obtained using venous occlusion plethysmography and Doppler ultrasound were made during the aforementioned perturbations. Relative to normothermic baseline, skin blood flow decreased during normothermia+LBNP (Pcooling (Peffect of device: P>0.05 for all conditions). Similarly, no differences were identified across all perturbations between FBF measures using plethysmography and Doppler ultrasound (P>0.05 for all perturbations). These data indicate that when normalized to maximum, assessment of skin blood flow in response to vasoconstrictor and dilator perturbations are similar regardless of methodology. Likewise, FBF responses to these perturbations are similar between two commonly used methodologies of limb blood flow assessment.

  5. On revealing the gene targets of Ebola virus microRNAs involved in the human skin microbiome

    Directory of Open Access Journals (Sweden)

    Pei-Chun Hsu

    2018-01-01

    Full Text Available Ebola virus, a negative-sense single-stranded RNA virus, causes severe viral hemorrhagic fever and has a high mortality rate. Histopathological and immunopathological analyses of Ebola virus have revealed that histopathological changes in skin tissue are associated with various degrees of endothelial cell swelling and necrosis. The interactions of microbes within or on a host are a crucial for the skin immune shield. The discovery of microRNAs (miRNAs in Ebola virus implies that immune escape, endothelial cell rupture, and tissue dissolution during Ebola virus infection are a result of the effects of Ebola virus miRNAs. Keratinocytes obtained from normal skin can attach and spread through expression of the thrombospondin family of proteins, playing a role in initiation of cell-mediated immune responses in the skin. Several miRNAs have been shown to bind the 3′ untranslated region of thrombospondin mRNA, thereby controlling its stability and translational activity. In this study, we discovered short RNA sequences that may act as miRNAs from Propionibacterium acnes using a practical workflow of bioinformatics methods. Subsequently, we deciphered the common target gene. These RNA sequences tended to bind to the same thrombospondin protein, THSD4, emphasizing the potential importance of the synergistic binding of miRNAs from Ebola virus, Propionibacterium acnes, and humans to the target. These results provide important insights into the molecular mechanisms of thrombospondin proteins and miRNAs in Ebola virus infection.

  6. The effects of mucopolysaccharide polysulphate on hydration and elasticity of human skin.

    Science.gov (United States)

    Wanitphakdeedecha, Rungsima; Eimpunth, Sasima; Manuskiatti, Woraphong

    2011-01-01

    Background. Mucopolysaccharide polysulphate (MPS) has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS) completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P = 0.47). Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P = 0.01). Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P skin elasticity between MPS and vehicle-control group

  7. TGF-beta-induced early gene-1 overexpression promotes oxidative stress protection and actin cytoskeleton rearrangement in human skin fibroblasts.

    Science.gov (United States)

    Leduc, Chloe; Sobilo, Lauren; Toumi, Hechmi; Mondon, Philippe; Lespessailles, Eric; Ossant, Fédéric; Kurfurst, Robin; Pichon, Chantal

    2016-06-01

    Transforming growth factor beta inducible early gene-1 (TIEG-1), a member of the Krüppel-like factor, was identified as a primary response gene for TGF-β. The role of TIEG-1 in skin repair has been mainly addressed in vivo on TIEG-1 null mice model and the mechanism remains unexplored. We investigated the modulation of TIEG-1 expression in normal human skin fibroblasts by either down-expressing or overexpressing the gene. We evaluated reactive oxygen species production and the cell viability of treated cells. The effect of TIEG-1 overexpression was monitored by wound healing assay and immunofluorescence staining of actin fibers organization and alpha-smooth muscle actin (α-SMA). Western blots were carried out to identify the level of expression or phosphorylation of key proteins such as cofilin, Rho GTPases, and p38 mitogen-activated protein kinase (p38 MAPK). TIEG-1 down-regulation had a deleterious effect on the cell viability. It was significantly reduced (65±5%) and exposure to ultraviolet further increased this effect (47±3%). By contrast, cells overexpressing TIEG-1 had a reduced reactive oxygen species production (75%) compared to control and mock-transfected cells. This overexpression also resulted in formation of actin stress fibers and increased α-SMA expression and an enhanced wound healing feature. RhoB GTPase was upregulated and phosphorylation of cofilin and p38 MAPK was observed. TIEG-1 overexpression in normal human skin fibroblasts results in improved resistance to oxidative stress, myofibroblast-like conversion that involved RhoB signaling pathway with cofilin and p38 MAPK proteins activation. This study enlightens the role of TIEG-1 role in skin biology. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Confocal laser scanning microscopy to estimate nanoparticles' human skin penetration in vitro.

    Science.gov (United States)

    Zou, Ying; Celli, Anna; Zhu, Hanjiang; Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard

    2017-01-01

    With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human "viable" epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested.

  9. Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro

    Science.gov (United States)

    Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard

    2017-01-01

    Objective With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Methods Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. Results NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Conclusion Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. PMID:29184403

  10. Thermal Effect of Pulsed Laser on Human Skin

    OpenAIRE

    N. C. Majumdar; V. K. Kochhar

    1985-01-01

    An attempt has been made to derive from theoretical considerations, some idea about safety limits of exposure with regard to radiant energy skin burns. This may be regarded as a preliminary enquiry in respect of thermal tissue damage by pulsed laser radiation, since the effects of isolated single pulses from ruby laser only have been considered. The study needs to be extended to other wavelengths as well as to trains of pulses.

  11. A robust sebum, oil, and particulate pollution model for assessing cleansing efficacy of human skin.

    Science.gov (United States)

    Peterson, G; Rapaka, S; Koski, N; Kearney, M; Ortblad, K; Tadlock, L

    2017-06-01

    With increasing concerns over the rise of atmospheric particulate pollution globally and its impact on systemic health and skin ageing, we have developed a pollution model to mimic particulate matter trapped in sebum and oils creating a robust (difficult to remove) surrogate for dirty, polluted skin. To evaluate the cleansing efficacy/protective effect of a sonic brush vs. manual cleansing against particulate pollution (trapped in grease/oil typical of human sebum). The pollution model (Sebollution; sebum pollution model; SPM) consists of atmospheric particulate matter/pollution combined with grease/oils typical of human sebum. Twenty subjects between the ages of 18-65 were enrolled in a single-centre, cleansing study comparisons between the sonic cleansing brush (normal speed) compared to manual cleansing. Equal amount of SPM was applied to the centre of each cheek (left and right). Method of cleansing (sonic vs. manual) was randomized to the side of the face (left or right) for each subject. Each side was cleansed for five-seconds using the sonic cleansing device with sensitive brush head or manually, using equal amounts of water and a gel cleanser. Photographs (VISIA-CR, Canfield Imaging, NJ, USA) were taken at baseline (before application of the SPM), after application of SPM (pre-cleansing), and following cleansing. Image analysis (ImageJ, NIH, Bethesda, MD, USA) was used to quantify colour intensity (amount of particulate pollutants on the skin) using a scale of 0 to 255 (0 = all black pixels; 255 = all white pixels). Differences between the baseline and post-cleansing values (pixels) are reported as the amount of SPM remaining following each method of cleansing. Using a robust cleansing protocol to assess removal of pollutants (SPM; atmospheric particulate matter trapped in grease/oil), the sonic brush removed significantly more SPM than manual cleansing (P pollution method easily allows assessment of efficacy through image analysis. © 2016 The Authors

  12. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  13. Chromium content in human skin after in vitro application of ordinary cement and ferrous-sulphate-reduced cement

    DEFF Research Database (Denmark)

    Fullerton, A; Gammelgaard, Bente; Avnstorp, C

    1993-01-01

    The amount of chromium found in human skin after in vitro application of cement suspensions on full-thickness human skin in diffusion cells was investigated. Cement suspensions made from ordinary Portland cement or Portland cement with the chromate reduced with added ferrous sulphate were used....... The cement suspensions were either applied on the skin surface under occlusion for 48 h or applied repeatedly every 24 h for 96 h. No statistically significant difference in chromium content of skin layers between skin exposed to ordinary Portland cement, skin exposed to cement with added ferrous sulphate...... and unexposed skin was observed, despite a more permeable skin barrier at the alkaline pH of the cement suspensions, i.e., pH 12.5. Increased chromium levels in epidermis and dermis were seen when ordinary Portland cement was applied as a suspension with added sodium sulphate (20%) on the skin surface for 96 h...

  14. Development and Characterisation of a Human Chronic Skin Wound Cell Line-Towards an Alternative for Animal Experimentation.

    Science.gov (United States)

    Caley, Matthew; Wall, Ivan B; Peake, Matthew; Kipling, David; Giles, Peter; Thomas, David W; Stephens, Phil

    2018-03-27

    Background : Chronic skin wounds are a growing financial burden for healthcare providers, causing discomfort/immobility to patients. Whilst animal chronic wound models have been developed to allow for mechanistic studies and to develop/test potential therapies, such systems are not good representations of the human chronic wound state. As an alternative, human chronic wound fibroblasts (CWFs) have permitted an insight into the dysfunctional cellular mechanisms that are associated with these wounds. However, such cells strains have a limited replicative lifespan and therefore a limited reproducibility/usefulness. Objectives : To develop/characterise immortalised cell lines of CWF and patient-matched normal fibroblasts (NFs). Methods and Results : Immortalisation with human telomerase resulted in both CWF and NF proliferating well beyond their replicative senescence end-point (respective cell strains senesced as normal). Gene expression analysis demonstrated that, whilst proliferation-associated genes were up-regulated in the cell lines (as would be expected), the immortalisation process did not significantly affect the disease-specific genotype. Immortalised CWF (as compared to NF) also retained a distinct impairment in their wound repopulation potential (in line with CWF cell strains). Conclusions : These novel CWF cell lines are a credible animal alternative and could be a valuable research tool for understanding both the aetiology of chronic skin wounds and for therapeutic pre-screening.

  15. Development and Characterisation of a Human Chronic Skin Wound Cell Line—Towards an Alternative for Animal Experimentation

    Science.gov (United States)

    Wall, Ivan B.; Peake, Matthew; Kipling, David; Giles, Peter; Thomas, David W.

    2018-01-01

    Background: Chronic skin wounds are a growing financial burden for healthcare providers, causing discomfort/immobility to patients. Whilst animal chronic wound models have been developed to allow for mechanistic studies and to develop/test potential therapies, such systems are not good representations of the human chronic wound state. As an alternative, human chronic wound fibroblasts (CWFs) have permitted an insight into the dysfunctional cellular mechanisms that are associated with these wounds. However, such cells strains have a limited replicative lifespan and therefore a limited reproducibility/usefulness. Objectives: To develop/characterise immortalised cell lines of CWF and patient-matched normal fibroblasts (NFs). Methods and Results: Immortalisation with human telomerase resulted in both CWF and NF proliferating well beyond their replicative senescence end-point (respective cell strains senesced as normal). Gene expression analysis demonstrated that, whilst proliferation-associated genes were up-regulated in the cell lines (as would be expected), the immortalisation process did not significantly affect the disease-specific genotype. Immortalised CWF (as compared to NF) also retained a distinct impairment in their wound repopulation potential (in line with CWF cell strains). Conclusions: These novel CWF cell lines are a credible animal alternative and could be a valuable research tool for understanding both the aetiology of chronic skin wounds and for therapeutic pre-screening. PMID:29584680

  16. Permeation of platinum and rhodium nanoparticles through intact and damaged human skin

    International Nuclear Information System (INIS)

    Mauro, Marcella; Crosera, Matteo; Bianco, Carlotta; Adami, Gianpiero; Montini, Tiziano; Fornasiero, Paolo; Jaganjac, Morana; Bovenzi, Massimo; Filon, Francesca Larese

    2015-01-01

    The aim of the study was to evaluate percutaneous penetration of platinum and rhodium nanoparticles (PtNPs: 5.8 ± 0.9 nm, RhNPs: 5.3 ± 1.9 nm) through human skin. Salts compounds of these metals are sensitizers and some also carcinogenic agents. In vitro permeation experiments were performed using Franz diffusion cells with intact and damaged skin. PtNPs and RhNPs, stabilized with polyvinylpyrrolidone, were synthesized by reduction of Na 2 PtC l6 and RhCl 3 ·3H 2 O respectively. Suspensions with a concentration of 2.0 g/L of PtNPs and RhNPs were dispersed separately in synthetic sweat at pH 4.5 and applied as donor phases to the outer surface of the skin for 24 h. Measurements of the content of the metals in the receiving solution and in the skin were performed subsequently. Rhodium skin permeation was demonstrated through damaged skin, with a permeation flux of 0.04 ± 0.04 μg cm −2  h −1 and a lag time of 7.9 ± 1.1 h, while no traces of platinum were found in receiving solutions. Platinum and rhodium skin-analysis showed significantly higher concentrations of the metals in damaged skin. Rh and Pt applied as NPs can penetrate the skin barrier and Rh can be found in receiving solutions. These experiments pointed out the need for skin contamination prevention, since even a minor injury to the skin barrier can significantly increase penetration

  17. Assessment of organ culture for the conservation of human skin allografts.

    Science.gov (United States)

    Hautier, A; Sabatier, F; Stellmann, P; Andrac, L; Nouaille De Gorce, Y; Dignat-George, F; Magalon, G

    2008-03-01

    Human skin allografts are used in the treatment of severe burns and their preservation is therefore critical for optimal clinical benefit. Current preservation methods, such as 4 degrees C storage or cryopreservation, cannot prevent the decrease of tissue viability. The aim of this study was to assess viability and function of skin allografts in a new skin organ culture model, allowing conservation parameters as close as possible to physiological conditions: 32 degrees C, air-liquid interface and physiological skin tension. Twelve skin samples, harvested from 6 living surgical donors, were conserved 35 days in two conditions: conservation at 4 degrees C and organ culture. Viability and function of skin samples were investigated at Day 0, 7, 14, 21, 28 and 35 using cell culture methods (trypan blue exclusion, Colony Forming Efficiency and Growth Rate), histopathological and histoenzymological studies (Ki67 immunostaining). In the two conditions, fibroblast and keratinocyte viability was progressively affected by storage, with a significant decrease observed after 35 days. No statistical difference could be observed between the two conditions. The two methods were also comparable regarding alterations of fibroblast and keratinocyte culture parameters, which were respectively significantly reduced at Day 7 and 21, compared to fresh skin. By contrast, histopathological and histoenzymological studies revealed a better preservation of skin architecture and proliferative potential at 4 degrees C, as compared to organ culture. These results indicate that skin organ culture does not provide significant advantages for skin allograft preservation. However, its potential use as an experimental model to study skin physiology and wound healing should be further evaluated.

  18. Permeation of platinum and rhodium nanoparticles through intact and damaged human skin

    Energy Technology Data Exchange (ETDEWEB)

    Mauro, Marcella [University of Trieste, Clinical Unit of Occupational Medicine, Department of Medical Sciences (Italy); Crosera, Matteo; Bianco, Carlotta; Adami, Gianpiero; Montini, Tiziano; Fornasiero, Paolo [University of Trieste, Department of Chemical and Pharmaceutical Sciences (Italy); Jaganjac, Morana [Rudjer Boskovic Institute, Laboratory for Oxidative Stress, Department of Molecular Medicine (Croatia); Bovenzi, Massimo; Filon, Francesca Larese, E-mail: larese@units.it [University of Trieste, Clinical Unit of Occupational Medicine, Department of Medical Sciences (Italy)

    2015-06-15

    The aim of the study was to evaluate percutaneous penetration of platinum and rhodium nanoparticles (PtNPs: 5.8 ± 0.9 nm, RhNPs: 5.3 ± 1.9 nm) through human skin. Salts compounds of these metals are sensitizers and some also carcinogenic agents. In vitro permeation experiments were performed using Franz diffusion cells with intact and damaged skin. PtNPs and RhNPs, stabilized with polyvinylpyrrolidone, were synthesized by reduction of Na{sub 2}PtC{sub l6} and RhCl{sub 3}·3H{sub 2}O respectively. Suspensions with a concentration of 2.0 g/L of PtNPs and RhNPs were dispersed separately in synthetic sweat at pH 4.5 and applied as donor phases to the outer surface of the skin for 24 h. Measurements of the content of the metals in the receiving solution and in the skin were performed subsequently. Rhodium skin permeation was demonstrated through damaged skin, with a permeation flux of 0.04 ± 0.04 μg cm{sup −2} h{sup −1} and a lag time of 7.9 ± 1.1 h, while no traces of platinum were found in receiving solutions. Platinum and rhodium skin-analysis showed significantly higher concentrations of the metals in damaged skin. Rh and Pt applied as NPs can penetrate the skin barrier and Rh can be found in receiving solutions. These experiments pointed out the need for skin contamination prevention, since even a minor injury to the skin barrier can significantly increase penetration.

  19. Essential role of RAB27A in determining constitutive human skin color.

    Directory of Open Access Journals (Sweden)

    Yasuko Yoshida-Amano

    Full Text Available Human skin color is predominantly determined by melanin produced in melanosomes within melanocytes and subsequently distributed to keratinocytes. There are many studies that have proposed mechanisms underlying ethnic skin color variations, whereas the processes involved from melanin synthesis in melanocytes to the transfer of melanosomes to keratinocytes are common among humans. Apart from the activities in the melanogenic rate-limiting enzyme, tyrosinase, in melanocytes and the amounts and distribution patterns of melanosomes in keratinocytes, the abilities of the actin-associated factors in charge of melanosome transport within melanocytes also regulate pigmentation. Mutations in genes encoding melanosome transport-related molecules, such as MYO5A, RAB27A and SLAC-2A, have been reported to cause a human pigmentary disease known as Griscelli syndrome, which is associated with diluted skin and hair color. Thus we hypothesized that process might play a role in modulating skin color variations. To address that hypothesis, the correlations of expression of RAB27A and its specific effector, SLAC2-A, to melanogenic ability were evaluated in comparison with tyrosinase, using human melanocytes derived from 19 individuals of varying skin types. Following the finding of the highest correlation in RAB27A expression to the melanogenic ability, darkly-pigmented melanocytes with significantly higher RAB27A expression were found to transfer significantly more melanosomes to keratinocytes than lightly-pigmented melanocytes in co-culture and in human skin substitutes (HSSs in vivo, resulting in darker skin color in concert with the difference observed in African-descent and Caucasian skins. Additionally, RAB27A knockdown by a lentivirus-derived shRNA in melanocytes concomitantly demonstrated a significantly reduced number of transferred melanosomes to keratinocytes in co-culture and a significantly diminished epidermal melanin content skin color intensity (

  20. Optical coherence tomography applied to tests of skin care products in humans--a case study.

    Science.gov (United States)

    Vasquez-Pinto, L M C; Maldonado, E P; Raele, M P; Amaral, M M; de Freitas, A Z

    2015-02-01

    When evaluating skin care products for human skin, quantitative test methods need to be simple, precise and reliable. Optical coherence tomography (OCT), provides high-resolution sectional images of translucent materials to a depth of a few millimeters, a technique usually applied to medical measurements in ophthalmology and dermatology. This study aimed to demonstrate the application of OCT as the main technique for monitoring changes in skin topography during tests of a wrinkle-reduction product in humans. We used a commercial OCT apparatus to perform clinical examinations of skin roughness in treated and non-treated sites in the periorbital region of thirty human voluntaries who were using an anti-aging product commercially available: Natura Chronos® Flavonóides de Passiflora 45+ FPS15, from Natura Cosméticos, Brazil. Measurements were performed days 0, 7, 14 and 28 of treatment. Equipment and software allowed real-time recording of skin roughness parameters and wrinkle depths. The OCT measurements have allowed the monitoring of changes in skin roughness, which have shown reduction in treated sites around 10%. The obtained depth distributions also indicate reduction in the occurrence of wrinkles deeper than 170 μm. The verified results are consistent with those typically obtained after successful treatment with modern anti-aging products. By using the OCT technique, it was possible to quantify changes in skin roughness and in the distribution of depths of skin wrinkles, with adequate sensitivity. OCT imaging allows the direct visualization of the skin topography with resolution of micrometers, a reliable and interactive tool for clinical use. Therefore, for the first time, we demonstrated the use of OCT technique to verify the efficacy of cosmetic products in real time. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. NIH Human Microbiome Project defines normal bacterial makeup of the body

    Science.gov (United States)

    Microbes inhabit just about every part of the human body, living on the skin, in the gut, and up the nose. Sometimes they cause sickness, but most of the time, microorganisms live in harmony with their human hosts, providing vital functions essential for

  2. Airborne polycyclic aromatic hydrocarbons trigger human skin cells aging through aryl hydrocarbon receptor.

    Science.gov (United States)

    Qiao, Yuan; Li, Qiang; Du, Hong-Yang; Wang, Qiao-Wei; Huang, Ye; Liu, Wei

    2017-07-01

    Accumulating evidence suggests that polycyclic aromatic hydrocarbons (PAH) which adsorbed on the surface of ambient air particulate matters (PM), are the major toxic compound to cause cardiovascular and respiratory diseases, even cancer. However, its detrimental effects on human skin cell remain unclear. Here, we demonstrated that SRM1649b, a reference urban dust material of PAH, triggers human skin cells aging through cell cycle arrest, cell growth inhibition and apoptosis. Principally, SRM1649b facilitated Aryl hydrocarbon receptor (AhR) translocated into nucleus, subsequently activated ERK/MAPK signaling pathway, and upregulated aging-related genes expression. Most important, we found that AhR antagonist efficiently revert the aging of skin cells. Thus our novel findings firstly revealed the mechanism of skin aging under PAH contamination and provided potential strategy for clinical application. Copyright © 2017. Published by Elsevier Inc.

  3. Biohydrogels for the In Vitro Re-construction and In Situ Regeneration of Human Skin

    Science.gov (United States)

    Korkina, Liudmila; Kostyuk, Vladimir; Guerra, Liliana

    Natural and synthetic biohydrogels are of great interest for the development of innovative medicinal and cosmetic products feasible for the treatment of numerous skin diseases and age-related changes in skin structure and function. Here, the characteristics of bio-resorbable hydrogels as scaffolds for the in vitro re-construction of temporary skin substitutes or full skin equivalents for further transplantation are reviewed. Another fast developing area of regenerative medicine is the in situ regeneration of human skin. The approach is mainly applicable to activate and facilitate the skin regeneration process and angiogenesis in chronic wounds with impaired healing. In this case, extracellular matrix resembling polymers are used to stimulate cell growth, adhesion, and movement. Better results could be achieved by activation of biocompatible hydrogels either with proteins (growth factors, adhesion molecules or/and cytokines) or with allogenic skin cells producing and releasing these molecules. Hydrogels are widely applied as carriers of low molecular weight substances with antioxidant, anti-inflammatory, anti-ageing, and wound healing action. Incorporation of these substances into hydrogels enhances their penetration through the skin barrier and prevents their destruction by oxidation. Potential roles of hydrogel-based products for modern dermatology and cosmetology are also discussed.

  4. Influence of two different IR radiators on the antioxidative potential of the human skin

    International Nuclear Information System (INIS)

    Darvin, M E; Patzelt, A; Meinke, M; Sterry, W; Lademann, J

    2009-01-01

    Resonance Raman spectroscopy was used for the fast in vivo detection of the concentration of carotenoid antioxidant substances such as beta-carotene and lycopene in human skin and for the measurement of their degradation dynamics, subsequent to infrared (IR) irradiation emitted by two different IR radiators applied at the same power density. One of the radiators was equipped with a water filter in front of the radiation source (WIRA) and the other was a usual broadband system without a water filter (standard IR radiator – SIR). It was found that the SIR exerted a higher influence on the degradation of carotenoids in the skin than the WIRA. Furthermore, all twelve volunteers who participated in the study felt that the irradiation with the SIR was disagreeably warmer on the skin surface compared to the WIRA, in spite of the same power density values for both radiators on the skin surface. The average degradation magnitude of the carotenoids in the skin of all volunteers after an IR irradiation was determined at 23% for WIRA and 33% for the SIR. A correlation (R 2 ∼ 0.6) was found between the individual level of carotenoids in the skin of the volunteers and the magnitude of degradation of the carotenoids for both IR radiators. Taking the previous investigations into consideration, which clearly showed production of free radicals in the skin subsequent to IR irradiation, it can be concluded that during the application of WIRA irradiation on the skin, fewer radicals are produced in comparison to the SIR

  5. Minimally-invasive Sampling of Interleukin-1α and Interleukin-1 Receptor Antagonist from the Skin: A Systematic Review of In vivo Studies in Humans.

    Science.gov (United States)

    Falcone, Denise; Spee, Pieter; van de Kerkhof, Peter C M; van Erp, Piet E J

    2017-10-02

    Interleukin-1α (IL-1α) and its receptor antagonist IL-1RA play a pivotal role in skin homeostasis and disease. Although the use of biopsies to sample these cytokines from human skin is widely employed in dermatological practice, knowledge about less invasive, in vivo sampling methods is scarce. The aim of this study was to provide an overview of such methods by systematically reviewing studies in Medline, EMBASE, Web of Science and Cochrane Library using combinations of the terms "IL-1α", IL-1RA", "skin", "human", including all possible synonyms. Quality was assessed using the STrengthening the Reporting of OBservational studies in Epidemiology (STROBE) checklist. The search, performed on 14 October 2016, revealed 10 different sampling methods, with varying degrees of invasiveness and wide application spectrum, including assessment of both normal and diseased skin, from several body sites. The possibility to sample quantifiable amounts of cytokines from human skin with no or minimal discomfort holds promise for linking clinical outcomes to molecular profiles of skin inflammation.

  6. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier.

    Directory of Open Access Journals (Sweden)

    Jes Dreier

    Full Text Available In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers.

  7. Automated epidermis segmentation in histopathological images of human skin stained with hematoxylin and eosin

    Science.gov (United States)

    Kłeczek, Paweł; Dyduch, Grzegorz; Jaworek-Korjakowska, Joanna; Tadeusiewicz, Ryszard

    2017-03-01

    Background: Epidermis area is an important observation area for the diagnosis of inflammatory skin diseases and skin cancers. Therefore, in order to develop a computer-aided diagnosis system, segmentation of the epidermis area is usually an essential, initial step. This study presents an automated and robust method for epidermis segmentation in whole slide histopathological images of human skin, stained with hematoxylin and eosin. Methods: The proposed method performs epidermis segmentation based on the information about shape and distribution of transparent regions in a slide image and information about distribution and concentration of hematoxylin and eosin stains. It utilizes domain-specific knowledge of morphometric and biochemical properties of skin tissue elements to segment the relevant histopathological structures in human skin. Results: Experimental results on 88 skin histopathological images from three different sources show that the proposed method segments the epidermis with a mean sensitivity of 87 %, a mean specificity of 95% and a mean precision of 57%. It is robust to inter- and intra-image variations in both staining and illumination, and makes no assumptions about the type of skin disorder. The proposed method provides a superior performance compared to the existing techniques.

  8. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  9. Survival of human osteosarcoma cells and normal human fibroblasts following alpha particle irradiation

    International Nuclear Information System (INIS)

    Lloyd, E.L.; Gemmell, M.A.

    1981-01-01

    Cell survival of human osteosarcoma cells in culture following alpha particle irradiation is reported here for the first time. The osteosarcoma cell line (TE-85) is found to be less sensitive to inactivation by 5.6 MeV alpha particles (LET 86 keV/μm) than normal diploid human fibroblasts (NFS). Values for the mean lethal doses were estimated to be 103 rads for the TE-85 cells compared with 68 rads for the NFS cultures irradiated under identical conditions. It is postulated that the aneuploidy of the tumor cells with increased DNA chromosomal material may confer a selective advantage for the survival of tumor cells relative to normal cells with diploid chromosomes

  10. 3D imaging of cleared human skin biopsies using light-sheet microscopy: A new way to visualize in-depth skin structure.

    Science.gov (United States)

    Abadie, S; Jardet, C; Colombelli, J; Chaput, B; David, A; Grolleau, J-L; Bedos, P; Lobjois, V; Descargues, P; Rouquette, J

    2018-05-01

    Human skin is composed of the superimposition of tissue layers of various thicknesses and components. Histological staining of skin sections is the benchmark approach to analyse the organization and integrity of human skin biopsies; however, this approach does not allow 3D tissue visualization. Alternatively, confocal or two-photon microscopy is an effective approach to perform fluorescent-based 3D imaging. However, owing to light scattering, these methods display limited light penetration in depth. The objectives of this study were therefore to combine optical clearing and light-sheet fluorescence microscopy (LSFM) to perform in-depth optical sectioning of 5 mm-thick human skin biopsies and generate 3D images of entire human skin biopsies. A benzyl alcohol and benzyl benzoate solution was used to successfully optically clear entire formalin fixed human skin biopsies, making them transparent. In-depth optical sectioning was performed with LSFM on the basis of tissue-autofluorescence observations. 3D image analysis of optical sections generated with LSFM was performed by using the Amira ® software. This new approach allowed us to observe in situ the different layers and compartments of human skin, such as the stratum corneum, the dermis and epidermal appendages. With this approach, we easily performed 3D reconstruction to visualise an entire human skin biopsy. Finally, we demonstrated that this method is useful to visualise and quantify histological anomalies, such as epidermal hyperplasia. The combination of optical clearing and LSFM has new applications in dermatology and dermatological research by allowing 3D visualization and analysis of whole human skin biopsies. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Percutaneous absorption and skin decontamination of PCBs: In vitro studies with human skin and in vivo studies in the rhesus monkey

    International Nuclear Information System (INIS)

    Wester, R.C.; Maibach, H.I.; Bucks, D.A.; McMaster, J.; Mobayen, M.; Sarason, R.; Moore, A.

    1990-01-01

    Knowledge of the entry of polychlorinated biphenyls through the skin into the body and subsequent disposition aids estimation of potential for human health hazard. [14C]Aroclor 1242 and [14C]Aroclor 1254 were separately administered intravenously and topically to rhesus monkeys. Following iv administration, 30-d excretion was 39.4 +/- 5.9% urine and 16.1 +/- 0.8% feces (total 55.5 +/- 5.1%) for Aroclor 1242, and 7.0 +/- 2.2% urine and 19.7 +/- 5.8% feces (total 26.7 +/- 7.5%) for Aroclor 1254. Mineral oil and trichlorobenzene are common PCB cosolvents in transformers. Skin absorption of Aroclor 1242 was 20.4 +/- 8.5% formulated in mineral oil and 18.0 +/- 3.8% in trichlorobenzene (p greater than .05). Absorption of Aroclor 1254 was 20.8 +/- 8.3% in mineral oil and 14.6 +/- 3.6% in trichlorobenzene (p greater than .05). PCBs are thus absorbed through skin, and excretion from the body is slow. Vehicle (trichlorobenzene or mineral oil) did not affect percutaneous absorption. In vitro skin absorption in human cadaver skin did not correlate with in vivo findings. This was due to lack of PCB partition from skin into the water receptor fluid, even with addition of 6% Oleth 20 (Volpo 20) solubilizer. Skin decontamination of PCBs showed soap and water to be as effective as or better than the solvent ethanol, mineral oil, and trichlorobenzene in removing PCBs from skin. There is a dynamic time lapse for PCBs between initial skin contact and skin absorption (irreversible removal). Thus initially most PCBs could be removed from skin, but this ability decreased with time to the point where at 24 h only about 25% of the initial PCB skin dose could be recovered with skin washing

  12. Quantitative proteome profiling of normal human circulating microparticles

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer T; Iversen, Line V

    2012-01-01

    Circulating microparticles (MPs) are produced as part of normal physiology. Their numbers, origin, and composition change in pathology. Despite this, the normal MP proteome has not yet been characterized with standardized high-resolution methods. We here quantitatively profile the normal MP...... proteome using nano-LC-MS/MS on an LTQ-Orbitrap with optimized sample collection, preparation, and analysis of 12 different normal samples. Analytical and procedural variation were estimated in triply processed samples analyzed in triplicate from two different donors. Label-free quantitation was validated...... by the correlation of cytoskeletal protein intensities with MP numbers obtained by flow cytometry. Finally, the validity of using pooled samples was evaluated using overlap protein identification numbers and multivariate data analysis. Using conservative parameters, 536 different unique proteins were quantitated...

  13. Design and fabrication of human skin by three-dimensional bioprinting.

    Science.gov (United States)

    Lee, Vivian; Singh, Gurtej; Trasatti, John P; Bjornsson, Chris; Xu, Xiawei; Tran, Thanh Nga; Yoo, Seung-Schik; Dai, Guohao; Karande, Pankaj

    2014-06-01

    Three-dimensional (3D) bioprinting, a flexible automated on-demand platform for the free-form fabrication of complex living architectures, is a novel approach for the design and engineering of human organs and tissues. Here, we demonstrate the potential of 3D bioprinting for tissue engineering using human skin as a prototypical example. Keratinocytes and fibroblasts were used as constituent cells to represent the epidermis and dermis, and collagen was used to represent the dermal matrix of the skin. Preliminary studies were conducted to optimize printing parameters for maximum cell viability as well as for the optimization of cell densities in the epidermis and dermis to mimic physiologically relevant attributes of human skin. Printed 3D constructs were cultured in submerged media conditions followed by exposure of the epidermal layer to the air-liquid interface to promote maturation and stratification. Histology and immunofluorescence characterization demonstrated that 3D printed skin tissue was morphologically and biologically representative of in vivo human skin tissue. In comparison with traditional methods for skin engineering, 3D bioprinting offers several advantages in terms of shape- and form retention, flexibility, reproducibility, and high culture throughput. It has a broad range of applications in transdermal and topical formulation discovery, dermal toxicity studies, and in designing autologous grafts for wound healing. The proof-of-concept studies presented here can be further extended for enhancing the complexity of the skin model via the incorporation of secondary and adnexal structures or the inclusion of diseased cells to serve as a model for studying the pathophysiology of skin diseases.

  14. Direct visualization of lipid domains in human skin stratum corneum's lipid membranes

    DEFF Research Database (Denmark)

    Plasencia, I; Norlen, Lars; Bagatolli, Luis

    2007-01-01

    scanning calorimetry, fluorescence spectroscopy, and two-photon excitation and laser scanning confocal fluorescence microscopy. Here we show that hydrated bilayers of human skin stratum corneum lipids express a giant sponge-like morphology with dimensions corresponding to the global three......-dimensional morphology of the stratum corneum extracellular space. These structures can be directly visualized using the aforementioned fluorescence microscopy techniques. At skin physiological temperatures (28 degrees C-32 degrees C), the phase state of these hydrated bilayers correspond microscopically (radial...

  15. RNA isolation for transcriptomics of human and mouse small skin biopsies

    Directory of Open Access Journals (Sweden)

    Breit Timo M

    2011-10-01

    Full Text Available Abstract Background Isolation of RNA from skin biopsies presents a challenge, due to the tough nature of skin tissue and a high presence of RNases. As we lacked the dedicated equipment, i.e. homogenizer or bead-beater, needed for the available RNA from skin isolation methods, we adapted and tested our zebrafish single-embryo RNA-isolation protocol for RNA isolation from skin punch biopsies. Findings We tested our new RNA-isolation protocol in two experiments: a large-scale study with 97 human skin samples, and a small study with 16 mouse skin samples. Human skin was sampled with 4.0 mm biopsy punches and for the mouse skin different punch diameter sizes were tested; 1.0, 1.5, 2.0, and 2.5 mm. The average RNA yield in human samples was 1.5 μg with an average RNA quality RIN value of 8.1. For the mouse biopsies, the average RNA yield was 2.4 μg with an average RIN value of 7.5. For 96% of the human biopsies and 100% of the mouse biopsies we obtained enough high-quality RNA. The RNA samples were successfully tested in a transcriptomics analysis using the Affymetrix and Roche NimbleGen platforms. Conclusions Using our new RNA-isolation protocol, we were able to consistently isolate high-quality RNA, which is apt for further transcriptomics analysis. Furthermore, this method is already useable on biopsy material obtained with a punch diameter as small as 1.5 mm.