WorldWideScience

Sample records for normal human epidermal

  1. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  2. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  3. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Verrando, P.; Ortonne, J.P.

    1985-01-01

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  4. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    Pinkas-Sarafova, Adriana; Markova, N.G.; Simon, M.

    2005-01-01

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  5. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  6. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    Science.gov (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Epidermal cell-shape regulation and subpopulation kinetics during butyrate-induced terminal maturation of normal and SV40-transformed human keratinocytes: epithelial models of differentiation therapy.

    Science.gov (United States)

    Staiano-Coico, L; Steinberg, M; Higgins, P J

    1990-10-15

    Recent data indicate that malignant human epidermal cells may be appropriate targets for sodium butyrate (NaB)-mediated differentiation therapy. The response of pre- and post-crisis populations of SV40-transformed human keratinocytes (SVKs) to this differentiation-inducing agent was assessed, therefore, within the framework of NaB-directed normal human keratinocyte (NHK) maturation. NaB augmented cornified envelope (CE) production in NHK and pre-crisis SVK cultures; the time-course and efficiency of induced maturation were similar in the 2 cell systems. In NHKs, the percentage of amplifying ("B" substate) cells decreased with time in NaB correlating with increases in both "C" stage keratinocytes and CEs. The latter formed over one or 2 layers of nucleated basal-like cells. Inductions were accompanied by immediate cell cycle blocks (in both the G1 and G2/M phases), reorganization within the actin cytoskeleton, and transient early increases in cellular actin content. Increased NHK and pre-crisis SVK cytoskeletal-associated actin reached a maximum approximately 48 hr after NaB addition and preceded development of CEs. The CE precursors, thus, probably reside in the "B" substate. Post-crisis SVKs, in contrast, were refractive to NaB-induced terminal maturation or cell-cycle perturbation, failed to initiate actin filament rearrangements, and retained a basal cell-like phenotype. Stable transformation of human SVKs in post-crisis phase, therefore, appears to be associated with loss of maturation "competence" within the "B" keratinocyte subpopulation.

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. Gene expression profiling of histologically normal breast tissue in females with human epidermal growth factor receptor 2‑positive breast cancer.

    Science.gov (United States)

    Zubor, Pavol; Hatok, Jozef; Moricova, Petra; Kapustova, Ivana; Kajo, Karol; Mendelova, Andrea; Sivonova, Monika Kmetova; Danko, Jan

    2015-02-01

    Gene expression profile‑based taxonomy of breast cancer (BC) has been described as a significant breakthrough in comprehending the differences in the origin and behavior of cancer to allow individually tailored therapeutic approaches. In line with this, we hypothesized that the gene expression profile of histologically normal epithelium (HNEpi) could harbor certain genetic abnormalities predisposing breast tissue cells to develop human epidermal growth factor receptor 2 (HER2)‑positive BC. Thus, the aim of the present study was to assess gene expression in normal and BC tissue (BCTis) from patients with BC in order to establish its value as a potential diagnostic marker for cancer development. An array study evaluating a panel of 84 pathway‑ and disease‑specific genes in HER2‑positive BC and tumor‑adjacent HNEpi was performed using quantitative polymerase chain reaction in 12 patients using microdissected samples from frozen tissue. Common prognostic and predictive parameters of BC were assessed by immunohistochemistry and in situ hybridization. In the BCTis and HNEpi samples of 12 HER2‑positive subjects with BC, the expression of 2,016 genes was assessed. A total of 39.3% of genes were deregulated at a minimal two‑fold deregulation rate and 10.7% at a five‑fold deregulation rate in samples of HNEpi or BCTis. Significant differences in gene expression between BCTis and HNEpi samples were revealed for BCL2L2, CD44, CTSD, EGFR, ERBB2, ITGA6, NGFB, RPL27, SCBG2A1 and SCGB1D2 genes (Pbreast tissue revealed gene expression abnormalities that may represent potential markers of increased risk for HER2‑positive malignant transformation of breast tissue, and may be able to be employed as predictors of prognosis.

  10. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  11. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  12. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  13. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  15. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  16. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  17. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  18. Sensing radiosensitivity of human epidermal stem cells

    International Nuclear Information System (INIS)

    Rachidi, Walid; Harfourche, Ghida; Lemaitre, Gilles; Amiot, Franck; Vaigot, Pierre; Martin, Michele T.

    2007-01-01

    Purpose: Radiosensitivity of stem cells is a matter of debate. For mouse somatic stem cells, both radiosensitive and radioresistant stem cells have been described. By contrast, the response of human stem cells to radiation has been poorly studied. As epidermis is a radiosensitive tissue, we evaluated in the present work the radiosensitivity of cell populations enriched for epithelial stem cells of human epidermis. Methods and materials: The total keratinocyte population was enzymatically isolated from normal human skin. We used flow cytometry and antibodies against cell surface markers to isolate basal cell populations from human foreskin. Cell survival was measured after a dose of 2 Gy with the XTT assay at 72 h after exposure and with a clonogenic assay at 2 weeks. Transcriptome analysis using oligonucleotide microarrays was performed to assess the genomic cell responses to radiation. Results: Cell sorting based on two membrane proteins, α6 integrin and the transferrin receptor CD71, allowed isolation of keratinocyte populations enriched for the two types of cells found in the basal layer of epidermis: stem cells and progenitors. Both the XTT assay and the clonogenic assay showed that the stem cells were radioresistant whereas the progenitors were radiosensitive. We made the hypothesis that upstream DNA damage signalling might be different in the stem cells and used microarray technology to test this hypothesis. The stem cells exhibited a much more reduced gene response to a dose of 2 Gy than the progenitors, as we found that 6% of the spotted genes were regulated in the stem cells and 20% in the progenitors. Using Ingenuity Pathway Analysis software, we found that radiation exposure induced very specific pathways in the stem cells. The most striking responses were the repression of a network of genes involved in apoptosis and the induction of a network of cytokines and growth factors. Conclusion: These results show for the first time that keratinocyte

  19. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  20. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  1. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  2. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  3. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  4. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  5. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    Energy Technology Data Exchange (ETDEWEB)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-02-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG{sub 1}), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of {sup 99m}Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14{+-}2.50 %ID/g, 5.06{+-}2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy.

  6. Humanized versus murine anti-human epidermal growth factor receptor monoclonal antibodies for immunoscintigraphic studies

    International Nuclear Information System (INIS)

    Morales, Alejo A. Morales; Duconge, Jorge; Alvarez-Ruiz, Daniel; Becquer-Viart, Maria de Los Angeles; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Caballero-Torres, Idania; Iznaga-Escobar, Normando

    2000-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized antibody h-R3 (IgG 1 ), which binds to an extracellular domain of EGF-R, was used to evaluate the biodistribution on nude mice xenografted with A431 epidermoid carcinoma cell line. Results are compared with its murine version ior egf/r3 monoclonal antibody (mAb). Twenty-one athymic female 4NMRI nu/nu mice were injected intravenously with 10 μg/100 μCi of 99m Tc-labeled mAbs. The mAb ior C5 that recognizes an antigen expressed preferentially on the surface of malignant and cytoplasm of normal colorectal cells was used as negative control. Immunoreactivity of 99m Tc-labeled mAbs was measured by enzyme linked immunosorbent assay on A431 cell line and the immunoreactive fractions determined by Lindmo method. Among all organs significant accumulation was found in tumor (6.14±2.50 %ID/g, 5.06±2.61 %ID/g for murine and humanized mAbs, respectively) 4 h after injection. The immunoreactive fractions were found to be 0.88 and 0.81 for murine and humanized mAb, respectively. Thus, we expect better results using the humanized mAb h-R3 for diagnostic immunoscintigraphy

  7. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  8. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  9. Leptin regulates the pro-inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Lee, Moonyoung; Lee, Eunyoung; Jin, Sun Hee; Ahn, Sungjin; Kim, Sae On; Kim, Jungmin; Choi, Dalwoong; Lim, Kyung-Min; Lee, Seung-Taek; Noh, Minsoo

    2018-05-01

    The role of leptin in cutaneous wound healing process has been suggested in genetically obese mouse studies. However, the molecular and cellular effects of leptin on human epidermal keratinocytes are still unclear. In this study, the whole-genome-scale microarray analysis was performed to elucidate the effect of leptin on epidermal keratinocyte functions. In the leptin-treated normal human keratinocytes (NHKs), we identified the 151 upregulated and 53 downregulated differentially expressed genes (DEGs). The gene ontology (GO) enrichment analysis with the leptin-induced DEGs suggests that leptin regulates NHKs to promote pro-inflammatory responses, extracellular matrix organization, and angiogenesis. Among the DEGs, the protein expression of IL-8, MMP-1, fibronectin, and S100A7, which play roles in which is important in the regulation of cutaneous inflammation, was confirmed in the leptin-treated NHKs. The upregulation of the leptin-induced proteins is mainly regulated by the STAT3 signaling pathway in NHKs. Among the downregulated DEGs, the protein expression of nucleosome assembly-associated centromere protein A (CENPA) and CENPM was confirmed in the leptin-treated NHKs. However, the expression of CENPA and CENPM was not coupled with those of other chromosome passenger complex like Aurora A kinase, INCENP, and survivin. In cell growth kinetics analysis, leptin had no significant effect on the cell growth curves of NHKs in the normal growth factor-enriched condition. Therefore, leptin-dependent downregulation of CENPA and CENPM in NHKs may not be directly associated with mitotic regulation during inflammation.

  10. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  11. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  12. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  13. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  14. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  15. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    Science.gov (United States)

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    In vitro studies with human cell lines have demonstrated that the death receptor Fas plays a role in ultraviolet (UV)-induced apoptosis. The purpose of the present study was to investigate the relation between Fas expression and apoptosis as well as clustering of Fas in human epidermis after...... a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry....... Clustering of Fas was from skin biopsied. Soluble FasL in suction blister fluid was quantified by ELISA. Flow cytometric analysis demonstrated increased expression intensity of Fas after irradiation, with 1.6-,2.2- and 2.7-fold increased median expression at 24, 48 and 72 h after irradiation, respectively (n...

  17. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  18. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  19. Flow cytometry of human primary epidermal and follicular keratinocytes.

    Science.gov (United States)

    Gragnani, Alfredo; Ipolito, Michelle Zampieri; Sobral, Christiane S; Brunialti, Milena Karina Coló; Salomão, Reinaldo; Ferreira, Lydia Masako

    2008-02-19

    The aim of this study was to characterize using flow cytometry cultured human primary keratinocytes isolated from the epidermis and hair follicles by different methods. Human keratinocytes derived from discarded fragments of total skin and scalp hair follicles from patients who underwent plastic surgery in the Plastic Surgery Division at UNIFESP were used. The epidermal keratinocytes were isolated by using 3 different methods: the standard method, upon exposure to trypsin for 30 minutes; the second, by treatment with dispase for 18 hours and with trypsin for 10 minutes; and the third, by treatment with dispase for 18 hours and with trypsin for 30 minutes. Follicular keratinocytes were isolated using the standard method. On comparing the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with dispase for 18 hours and with trypsin for 30 minutes, it was observed that the first group presented the largest number of viable cells, the smallest number of cells in late apoptosis and necrosis with statistical significance, and no difference in apoptosis. When we compared the group treated with dispase for 18 hours and with trypsin for 10 minutes with the group treated with trypsin, the first group presented the largest number of viable cells, the smallest number of cells in apoptosis with statistical significance, and no difference in late apoptosis and necrosis. When we compared the results of the group treated with dispase for 18 hours and with trypsin for 10 minutes with the results for follical isolation, there was a statistical difference in apoptosis and viable cells. The isolation method of treatment with dispase for 18 hours and with trypsin for 10 minutes produced the largest number of viable cells and the smallest number of cells in apoptosis/necrosis.

  20. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanin production in human melanocyte cultures could be reproduced on human skin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Normal epidermal growth factor receptor signaling is dispensable for bone anabolic effects of parathyroid hormone.

    Science.gov (United States)

    Schneider, Marlon R; Dahlhoff, Maik; Andrukhova, Olena; Grill, Jessica; Glösmann, Martin; Schüler, Christiane; Weber, Karin; Wolf, Eckhard; Erben, Reinhold G

    2012-01-01

    Although the bone anabolic properties of intermittent parathyroid hormone (PTH) have long been employed in the treatment of osteoporosis, the molecular mechanisms behind this action remain largely unknown. Previous studies showed that PTH increases the expression and the activity of epidermal growth factor receptor (EGFR) in osteoblasts, and activation of ERK1/2 by PTH in osteoblasts was demonstrated to induce the proteolytical release of EGFR ligands and EGFR transactivation. However, conclusive evidence for an important role of the EGFR system in mediating the anabolic actions of intermittent PTH on bone in vivo is lacking. Here, we evaluated the effects of intermittent PTH on bone in Waved-5 (Wa5) mice which carry an antimorphic Egfr allele whose product acts as a dominant negative receptor. Heterozygous Wa5 females and control littermates received a subcutaneous injection of PTH (80 μg/kg) or buffer on 5 days per week for 4 weeks. Wa5 mice had slightly lower total bone mineral density (BMD), but normal cancellous bone volume and turnover in the distal femoral metaphysis. The presence of the antimorphic Egfr allele neither influenced the PTH-induced increase in serum osteocalcin nor the increases in distal femoral BMD, cortical thickness, cancellous bone volume, and cancellous bone formation rate. Similarly, the PTH-induced rise in lumbar vertebral BMD was unchanged in Wa5 relative to wild-type mice. Wa5-derived osteoblasts showed considerably lower basal extracellular signal-regulated kinase 1/2 (ERK1/2) activation as compared to control osteoblasts. Whereas activation of ERK1/2 by the EGFR ligand amphiregulin was largely blocked in Wa5 osteoblasts, treatment with PTH induced ERK1/2 activation comparable to that observed in control osteoblasts, relative to baseline levels. Our data indicate that impairment of EGFR signaling does not affect the anabolic action of intermittent PTH on cancellous and cortical bone. Copyright © 2011. Published by Elsevier Inc.

  2. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  3. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  4. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  5. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  6. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  7. In vivo UVB irradiation induces clustering of Fas (CD95) on human epidermal cells

    DEFF Research Database (Denmark)

    Bang, Bo; Gniadecki, Robert; Larsen, Jørgen K

    2003-01-01

    a single dose of UVB irradiation. Normal healthy individuals were irradiated with three minimal erythema doses (MED) of UVB on forearm or buttock skin. Suction blisters from unirradiated and irradiated skin were raised, and Fas, FasL, and apoptosis of epidermal cells quantified by flow cytometry...

  8. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  9. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  10. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  11. Brief study about the distribution of recombinant human Epidermic Growth Factor (rh-EGF)

    International Nuclear Information System (INIS)

    Rodriguez Garcia, J.C.; De Dios D Espaux, R.; Bello Garciga, J.L.

    1997-01-01

    This report describes results of the study about biodistribution of I-125 recombinant human Epidermic Growth Factor (rhEGF). The radiolabelled product was administrated to Sprague Dawley rats in three different ways: intramuscular, subcutaneous and epidermic; the highest concentration of EGF in blood was found 4 hours after rhEGF administration, with a greater distribution in the plasma with regard to cellular pellet. The slowest plasma clearance corresponded to the intramuscular administration. The highest concentration of radiolabelled rhEGF was found in liver, kidney and intestine. It was found that radiolabelled EGF is excreted mainly throughout urine and faeces although other excretion pathways could exist

  12. Influence of epidermal hydration on the friction of human skin against textiles

    OpenAIRE

    Gerhardt, L.-C; Strässle, V; Lenz, A; Spencer, N.D; Derler, S

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles.

  13. Influence of epidermal hydration on the friction of human skin against textile

    NARCIS (Netherlands)

    Gerhardt, L.C.; Strässle, V.; Lenz, A.; Spencer, N.D.; Derler, S.

    2008-01-01

    Friction and shear forces, as well as moisture between the human skin and textiles are critical factors in the formation of skin injuries such as blisters, abrasions and decubitus. This study investigated how epidermal hydration affects the friction between skin and textiles. The friction between

  14. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  15. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie

    2010-01-01

    Lipid rafts are cholesterol-rich plasma membrane domains that regulate signal transduction. Because our earlier work indicated that raft disruption inhibited proliferation and caused cell death, we investigated here the role of membrane cholesterol, the crucial raft constituent, in the regulation...... of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...... in deactivation of mammalian target of rapamycin, activation of FoxO3a, and increased sensitivity to apoptosis stimuli. Lipid raft disruption abrogated the binding of Akt and the major Akt kinase, phosphatidylinositol-dependent kinase 1, to the membrane by pleckstrin-homology domains. Thus, the integrity of lipid...

  16. Correlation of human epidermal growth factor receptor protein expression and colorectal cancer.

    Science.gov (United States)

    Yang, Wen-Juan; Shen, Xing-Jie; Ma, Xiao-Xia; Tan, Zhi-Gang; Song, Yan; Guo, Yi-Tong; Yuan, Mei

    2015-07-28

    To investigate the correlation between human epidermal growth factor receptor (HER-2) protein expression and colorectal cancer (CRC) using a case-control study and meta-analysis. Tumor tissue specimens from 162 CRC patients were selected for the case group. Fifty cases were randomly selected, and normal CRC tissue at least 10 cm away from the tumor margins of these cases was used to generate the control group. The expression of the HER-2 protein in the 162 CRC tissue samples and the 50 adjacent normal mucosa tissue samples was detected via immunohistochemistry. The experimental data were analyzed using SPSS 18.0 software, and R software version 3.1.0 was utilized for further verification. The expression of HER-2 protein in the 162 CRC tissue samples was significantly higher than in the normal tissue specimens. The data showed that the expression of HER-2 in CRC was related to the Dukes' stage, the depth of invasion and lymph node metastasis. The HER-2-positive patients had lower 3- and 5-year OS rates than the HER-2-negative patients, but there was no significant difference. However, there was a statistically significant difference in the 3- and 5-year disease-free survival (DFS) rates of HER-2-positive and HER-2-negative patients. The results of the meta-analysis showed that the expression of HER-2 in CRC patients was statistically significantly increased over that of healthy people. The 3-year DFS rate in HER-2-positive patients was markedly lower than that in HER-2-negative patients. Down-regulation of HER-2 expression might be a dependable strategy for CRC therapy.

  17. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    International Nuclear Information System (INIS)

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana

    2008-01-01

    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 μM triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure

  19. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  20. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-01-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  1. Dermal-epidermal membrane systems by using human keratinocytes and mesenchymal stem cells isolated from dermis

    Energy Technology Data Exchange (ETDEWEB)

    Salerno, Simona, E-mail: s.salerno@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Messina, Antonietta [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); Giordano, Francesca [Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, I-87036 Rende, (CS) (Italy); Bader, Augustinus [Biomedical-Biotechnological Center, BBZ, University of Leipzig, D-04103 Leipzig (Germany); Drioli, Enrico [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy); WCU Energy Engineering Department, Hanyang University, Seoul (Korea, Republic of); De Bartolo, Loredana, E-mail: l.debartolo@itm.cnr.it [Institute on Membrane Technology, National Research Council of Italy, ITM-CNR, c/o University of Calabria, via P. Bucci cubo 17/C, I-87036, Rende (CS) (Italy)

    2017-02-01

    Dermal-epidermal membrane systems were developed by co-culturing human keratinocytes with Skin derived Stem Cells (SSCs), which are Mesenchymal Stem Cells (MSCs) isolated from dermis, on biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT and PCL. The membranes display physico-chemical, morphological, mechanical and biodegradation properties that could satisfy and fulfil specific requirements in skin tissue engineering. CHT membrane exhibits an optimal biodegradation rate for acute wounds; CHT-PCL for the chronic ones. On the other hand, PCL membrane in spite of its very slow biodegradation rate exhibits mechanical properties similar to in vivo dermis, a lower hydrophilic character, and a surface roughness, all properties that make it able to sustain cell adhesion and proliferation for in vitro skin models. Both CHT–PCL and PCL membranes guided epidermal and dermal differentiation of SSCs as pointed out by the expression of cytokeratins and the deposition of the ECM protein fibronectin, respectively. In the dermal-epidermal membrane systems, a more suitable microenvironment for the SSCs differentiation was promoted by the interactions and the mutual interplay with keratinocytes. Being skin tissue-biased stem cells committed to their specific final dermal and/or epidermal cell differentiation, SSCs are more suitable for skin tissue engineering than other adult MSCs with different origin. For this reason, they represent a useful autologous cell source for engineering skin substitutes for both in vivo and in vitro applications.

  2. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    Directory of Open Access Journals (Sweden)

    Yung-Yi Lee

    2013-06-01

    Full Text Available Toxic epidermal necrolysis (TEN is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of skin biopsy were compatible with Stevens–Johnson syndrome (SJS. SJS progressed to TEN within 2 days. Etanercept treatment showed a dramatic improvement in the symptoms of mucocutaneous lesions. To our knowledge, this is the first report on the treatment of TEN using etanercept in a human immunodeficiency virus-positive patient.

  3. Heavy metal-induced cytotoxicity to cultured human epidermal keratinocytes and effects of antioxidants.

    Science.gov (United States)

    Kappus, H; Reinhold, C

    1994-04-01

    Human epidermal keratinocytes which have been cultured were treated with the heavy metal ions of cadmium, mercury, copper and zinc. Cytotoxicity was measured either by protein estimation or by using the neutral red assay. Antioxidants were added in order to find out whether heavy metal-induced cytotoxicity is related to oxidative stress. All metals used showed considerable cytotoxic effects within 24 h in moderate concentrations. None of the antioxidants vitamin E (alpha-tocopherol), pyrogallol, propyl gallate, BHT or ebselen showed any protective or preventive effect. This indicates that oxidative stress may not be involved in the cytotoxicity induced by heavy metals in human epidermal keratinocytes. The cells used are, however, a valuable tool to study mechanisms of cytotoxicity.

  4. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  5. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  6. Epidermal growth factor receptor-induced activato protein 1 activity controls density-dependent growht inhibition in normal rat kidney fibroblasts.

    NARCIS (Netherlands)

    Hornberg, J.J.; Dekker, H.; Peters, P.H.J.; Langerak, P.; Westerhoff, H.V.; Lankelma, J.; Zoelen, E.J.J.

    2006-01-01

    Density-dependent growth inhibition secures tissue homeostasis. Dysfunction of the mechanisms, which regulate this type of growth control is a major cause of neoplasia. In confluent normal rat kidney (NRK) fibroblasts, epidermal growth factor (EGF) receptor levels decline, ultimately rendering these

  7. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Morrison, A.I.; Keeble, S.; Watt, F.M.

    1988-01-01

    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of [ 14 C]galactose- or [ 14 C]mannose- and [ 14 C]glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification

  8. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    Directory of Open Access Journals (Sweden)

    Kynan T. Lawlor

    2015-11-01

    Full Text Available The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes.

  9. The acyl-CoA binding protein is required for normal epidermal barrier function in mice

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Bek, Signe; Marcher, Ann-Britt

    2012-01-01

    (+/+) and ACBP(-/-) mice showed very similar composition, except for a significant and specific decrease in the very long chain free fatty acids (VLC-FFA) in stratum corneum of ACBP(-/-) mice. This finding indicates that ACBP is critically involved in the processes that lead to production of stratum corneum VLC......The acyl-CoA binding protein (ACBP) is a 10 kDa intracellular protein expressed in all eukaryotic species. Mice with targeted disruption of Acbp (ACBP(-/-) mice) are viable and fertile but present a visible skin and fur phenotype characterized by greasy fur and development of alopecia and scaling...... with age. Morphology and development of skin and appendages are normal in ACBP(-/-) mice; however, the stratum corneum display altered biophysical properties with reduced proton activity and decreased water content. Mass spectrometry analyses of lipids from epidermis and stratum corneum of ACBP...

  10. Immunohistochemical localization of epidermal growth factor in the second-trimester human fetus

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Kryger-Baggesen, N; Nexø, Ebba

    1996-01-01

    Epidermal growth factor (EGF) is considered to be important in mammalian neonatal growth and development. In order to clarify its developmental role, we have investigated, by immunohistochemistry, the localization of EGF and the time of its first appearance in various organs from a series of 25...... midtrimester human fetuses with a gestational age ranging from 13 to 22 weeks. The first detectable EGF immunoreactivity occurred in week 15-16 fetuses in the placenta, the skin, the distal tubules of the kidney, the surface epithelium of the stomach, and the tips of the small intestinal villi, as well...

  11. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  12. 125I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    International Nuclear Information System (INIS)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)

  13. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  14. Effects of epidermal growth factor, transferrin, and insulin on lipofection efficiency in human lung carcinoma cells.

    Science.gov (United States)

    Yanagihara, K; Cheng, H; Cheng, P W

    2000-01-01

    Poor transfection efficiency is the major drawback of lipofection. We showed previously that addition of transferrin (TF) to Lipofectin enhanced the expression of a reporter gene in HeLa cells by 120-fold and achieved close to 100% transfection efficiency. The purpose of this study was to determine whether TF and other ligands could improve the efficiency of lipofection in lung carcinoma cells. Confluent A549, Calu3, and H292 cells were transfected for 18 hours with a plasmid DNA (pCMVlacZ) using Lipofectin plus TF, insulin, or epidermal growth factor as the vector. The transfected cells were assessed for transfection efficiency by beta-galactosidase activity (light units/microg protein) and the percentage of blue cells following 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside staining. Lipofectin supplemented with epidermal growth factor yielded the largest enhancement of lipofection efficiency (lipofection efficiency in A549 and Calu3 cells but not in H292 cells, whereas TF showed significant lipofection efficiency-enhancing effect in Calu3 and H292 cells but not in A549 cells. The transfection efficiency correlated well with the amounts of DNA delivered to the nucleus as well as the amounts of the receptor. These results indicate that the gene delivery strategy employing ligand-facilitated lipofection can achieve high transfection efficiency in human lung carcinoma cells. In addition, enhancement of the expression of the receptor may be a possible strategy for increasing the efficiency of gene targeting.

  15. Immunohistochemical detection of cytochrome P450 isoenzymes in cultured human epidermal cells.

    Science.gov (United States)

    Van Pelt, F N; Meierink, Y J; Blaauboer, B J; Weterings, P J

    1990-12-01

    We used specific monoclonal antibodies (MAb) to human cytochrome P450 isoenzymes to determine the presence of these proteins in human epidermal cells. Two MAb (P450-5 and P450-8) recognize major forms of hepatic cytochrome P450 involved in biotransformation of xenobiotics. A third MAb, to cytochrome P450-9, is not fully characterized. The proteins were determined by the indirect immunoperoxidase technique after fixation with methanol and acetone. Biopsy materials for cultured keratinocytes, i.e., foreskin and hair follicles, contained the two major forms of cytochrome P450. In cultured keratinocytes derived from hair follicles the proteins were undetectable, whereas the keratinocytes derived from foreskin continued to express the two major forms of hepatic cytochrome P450. Cultured human fibroblasts and a human keratinocyte cell line (SVK14) showed staining similar to that of the foreskin keratinocytes. Cytochrome P450-9 was detectable only in human hepatocytes. The results indicate that, under the culture conditions applied, cultured human foreskin cells and the cell line SVK14 continue to express specific cytochrome P450 isoenzymes in culture, in contrast to hair follicle keratinocytes.

  16. Linking γ-aminobutyric acid A receptor to epidermal growth factor receptor pathways activation in human prostate cancer.

    Science.gov (United States)

    Wu, Weijuan; Yang, Qing; Fung, Kar-Ming; Humphreys, Mitchell R; Brame, Lacy S; Cao, Amy; Fang, Yu-Ting; Shih, Pin-Tsen; Kropp, Bradley P; Lin, Hsueh-Kung

    2014-03-05

    Neuroendocrine (NE) differentiation has been attributed to the progression of castration-resistant prostate cancer (CRPC). Growth factor pathways including the epidermal growth factor receptor (EGFR) signaling have been implicated in the development of NE features and progression to a castration-resistant phenotype. However, upstream molecules that regulate the growth factor pathway remain largely unknown. Using androgen-insensitive bone metastasis PC-3 cells and androgen-sensitive lymph node metastasis LNCaP cells derived from human prostate cancer (PCa) patients, we demonstrated that γ-aminobutyric acid A receptor (GABA(A)R) ligand (GABA) and agonist (isoguvacine) stimulate cell proliferation, enhance EGF family members expression, and activate EGFR and a downstream signaling molecule, Src, in both PC-3 and LNCaP cells. Inclusion of a GABA(A)R antagonist, picrotoxin, or an EGFR tyrosine kinase inhibitor, Gefitinib (ZD1839 or Iressa), blocked isoguvacine and GABA-stimulated cell growth, trans-phospohorylation of EGFR, and tyrosyl phosphorylation of Src in both PCa cell lines. Spatial distributions of GABAAR α₁ and phosphorylated Src (Tyr416) were studied in human prostate tissues by immunohistochemistry. In contrast to extremely low or absence of GABA(A)R α₁-positive immunoreactivity in normal prostate epithelium, elevated GABA(A)R α₁ immunoreactivity was detected in prostate carcinomatous glands. Similarly, immunoreactivity of phospho-Src (Tyr416) was specifically localized and limited to the nucleoli of all invasive prostate carcinoma cells, but negative in normal tissues. Strong GABAAR α₁ immunoreactivity was spatially adjacent to the neoplastic glands where strong phospho-Src (Tyr416)-positive immunoreactivity was demonstrated, but not in adjacent to normal glands. These results suggest that the GABA signaling is linked to the EGFR pathway and may work through autocrine or paracine mechanism to promote CRPC progression. Copyright © 2013 Elsevier

  17. /sup 125/I-human epidermal growth factor specific binding to placentas and fetal membranes from varoius pregnancy states

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.

    1988-01-01

    Specific binding of /sup 125/I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class AB diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more /sup 125/I-hEGF than did fetal membranes (P<0.0001). There was no significant differnce in /sup 125/I-hEGF binding to fetal membranes from the various pregnancy states (P<0.05). /sup 125/I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P<0.05). The binding to placentas from pregnancies complicated by White class AB diabetes or large for gestational age infants, on the other hand, was not significantly different from that to placentas from normal and appropriate for gestational age pregnancies. /sup 125/I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P<0.05). Placental and fetal membrane /sup 125/I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P<0.05). Placental but not fetal membrane /sup 125/I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone.

  18. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    International Nuclear Information System (INIS)

    Korc, M.; Magun, B.E.

    1985-01-01

    PANC-1 human pancreatic carcinoma cells readily bound and internalized 125 I-labeled epidermal growth factor (EGF). Bound 125 I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of 125 I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound 125 I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell

  19. Cultivation of human dermal fibroblasts and epidermal keratinocytes on keratin-coated silica bead substrates.

    Science.gov (United States)

    Tan, Bee Yi; Nguyen, Luong T H; Kim, Hyo-Sop; Kim, Jae-Ho; Ng, Kee Woei

    2017-10-01

    Human hair keratin is promising as a bioactive material platform for various biomedical applications. To explore its versatility further, human hair keratin was coated onto monolayers of silica beads to produce film-like substrates. This combination was hypothesized to provide a synergistic effect in improving the biochemical properties of the resultant composite. Atomic force microscopy analysis showed uniform coatings of keratin on the silica beads with a slight increase in the resulting surface roughness. Keratin-coated silica beads had higher surface energy and relatively lower negative charge than those of bare silica beads. To investigate cell response, human dermal fibroblasts (HDFs), and human epidermal keratinocytes (HEKs) were cultured on the substrates over 4 days. Results showed that keratin coatings significantly enhanced the metabolic activity of HDFs and encouraged cell spreading but did not exert any significant effects on HEKs. HDF expression of collagen I was significantly more intense on the keratin-coated compared to the bare silica substrates. Furthermore, HDF secretion of various cytokines suggested that keratin coatings triggered active cell responses related to wound healing. Collectively, our study demonstrated that human hair keratin-coated silica bead monolayers have the potential to modulate HDF behavior in culture and may be exploited further. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2789-2798, 2017. © 2017 Wiley Periodicals, Inc.

  20. Topical Human Epidermal Growth Factor in the Treatment of Senile Purpura and the Prevention of Dermatoporosis.

    Science.gov (United States)

    McKnight, Braden; Seidel, Rachel; Moy, Ron

    2015-10-01

    Senile purpura presents itself as a largely unexplored challenge as it has been long thought of as a benign condition without long-term health sequelae. It is becoming increasingly accepted that skin aging not only results in cosmetic disturbances, but as a functional ones. With modern increases in lifespan, skin atrophy associated with solar damage is presenting as a clinically significant inability to mechanically protect patients. This chronic cutaneous insufficiency/fragility syndrome was recently termed dermatoporosis and senile purpura appears to be a visible marker of early stage dysfunction. To examine the effects of topically human epidermal growth factor on the clinical presence of senile purpura and its effect on skin thickness as measured via cutaneous ultrasound. Six subjects applied human epidermal growth factor morning and night for six weeks. Clinical outcomes were evaluated by comparing initial clinical photos to 6-week photos and performing a blinded investigator's global assessment (IGA). Skin thickness was evaluated via cutaneous ultrasound measurement. Ultrasound measurements indicated a mean skin thickening of 195.2 ± 35.7 um (SEM) over 6 weeks. The average number of purpuric lesions decreased from 15 ± 4.6 (SEM) to 2.3 ± 0.7 (SEM) over that same period. Senile purpura presents itself as a cosmetic disturbance posing significant psychological distress and serves as a marker of the severity of skin thinning. In this study, we demonstrate that topical h-EGF diminishes the appearance of senile purpura by thickening skin and may help prevent the development of late stage dermatoporosis.

  1. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J.M.; de Munck, L.; de Graaf, J.C.; Siesling, Sabine; de Vries, Erik G.; Boers, J.E.

    2014-01-01

    Background Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  2. Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

    NARCIS (Netherlands)

    Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

    2003-01-01

    Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

  3. Limited human epidermal growth factor receptor 2 discordance in metastatic breast cancer patients treated with trastuzumab, a population based study

    NARCIS (Netherlands)

    van Rooijen, J. M.; de Munck, L.; de Graaf, J. C.; Siesling, S.; de Vries, E. G.; Boers, J. E.

    Background: Accurate assessment of the human epidermal growth factor receptor 2 (HER2) in breast cancer is essential for proper treatment decisions. HER2 positivity confirmation rates in breast cancer trials by central testing pathology laboratories were reported to be approximately 85%. The aim of

  4. Research on Normal Human Plantar Pressure Test

    Directory of Open Access Journals (Sweden)

    Liu Xi Yang

    2016-01-01

    Full Text Available FSR400 pressure sensor, nRF905 wireless transceiver and MSP40 SCM are used to design the insole pressure collection system, LabVIEW is used to make HMI of data acquisition, collecting a certain amount of normal human foot pressure data, statistical analysis of pressure distribution relations about five stages of swing phase during walking, using the grid closeness degree to identify plantar pressure distribution pattern recognition, and the algorithm simulation, experimental results demonstrated this method feasible.

  5. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  6. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  7. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  8. Pharmacologic induction of epidermal melanin and protection against sunburn in a humanized mouse model.

    Science.gov (United States)

    Amaro-Ortiz, Alexandra; Vanover, Jillian C; Scott, Timothy L; D'Orazio, John A

    2013-09-07

    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection (1). Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure.

  9. Pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    Energy Technology Data Exchange (ETDEWEB)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t{sub (1(2{alpha}}{sub ))}) of 0.250 h and a mean elimination (t{sub (1(2{beta}}{sub ))}) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with {sup 99m}Tc-labeled humanized MAb R3 conjugate in patients should be supported.

  10. Pharmacokinetics, biodistribution and dosimetry of 99mTc-labeled anti-human epidermal growth factor receptor humanized monoclonal antibody R3 in rats

    International Nuclear Information System (INIS)

    Escobar, Normando Iznaga; Morales, Alejo Morales; Duconge, Jorge; Torres, Idania Caballero; Fernandez, Eduardo; Gomez, Jose A.

    1998-01-01

    The pharmacokinetics, biodistribution and dosimetry of 99m Tc-labeled anti-human epidermal growth factor receptor (anti-hEGF-r) humanized monoclonal antibody (MAb) R3 was investigated following intravenous injection in normal Wistar rats. Serum disappearance curves were best fit by a two-compartment model having a mean distribution half-life (t (1(2α)) ) of 0.250 h and a mean elimination (t (1(2β)) ) of 13.89 h. Among the various organs, a little accumulation of the radiolabeled antibody was found only in kidneys. Biodistribution and dosimetry studies in humans were performed by extrapolation of the animal data to humans. Absorbed dose to normal organs and the remainder of the whole body were estimated using the medical internal radiation dose formula, and dose contributions from radioactivity in transit through the gastrointestinal tract were estimated using a compartment model. Extrapolated values of radiation absorbed dose to normal organs in rads per millicurie administered were whole body, 0.0085; lower large intestine wall, 0.0898; small intestine, 0.0530; upper large intestine wall, 0.0731; and kidneys, 0.0455. The effective dose equivalent predicted was 0.0162 rem/mCi and the effective dose was found to be 0.015 rem/mCi. On the basis of the pharmacokinetics, biodistribution and internal radiation dosimetry information obtained in this study, a diagnostic phase I clinical trial with 99m Tc-labeled humanized MAb R3 conjugate in patients should be supported

  11. Use of a collagen-elastin matrix as transport carrier system to transfer proliferating epidermal cells to human dermis in vitro.

    Science.gov (United States)

    Waaijman, Taco; Breetveld, Melanie; Ulrich, Magda; Middelkoop, Esther; Scheper, Rik J; Gibbs, Susan

    2010-01-01

    This in vitro study describes a novel cell culture, transport, and transfer protocol that may be highly suitable for delivering cultured proliferating keratinocytes and melanocytes to large open skin wounds (e.g., burns). We have taken into account previous limitations identified using other keratinocyte transfer techniques, such as regulatory issues, stability of keratinocytes during transport (single cell suspensions undergo terminal differentiation), ease of handling during application, and the degree of epidermal blistering resulting after transplantation (both related to transplanting keratinocyte sheets). Large numbers of proliferating epidermal cells (EC) (keratinocytes and melanocytes) were generated within 10-14 days and seeded onto a three-dimensional matrix composed of elastin and collagen types I, III, and V (Matriderm®), which enabled easy and stable transport of the EC for up to 24 h under ambient conditions. All culture conditions were in accordance with the regulations set by the Dutch Central Committee on Research Involving Human Subjects (CCMO). As an in vitro model system for clinical in vivo transfer, the EC were then transferred from Matriderm onto human acellular dermis during a period of 3 days. After transfer the EC maintained the ability to regenerate into a fully differentiated epidermis containing melanocytes on the human dermis. Proliferating keratinocytes were located in the basal layer and keratin-10 expression was located in differentiating suprabasal layers similar to that found in human epidermis. No blistering was observed (separation of the epidermis from the basement membrane). Keratin-6 expression was strongly upregulated in the regenerating epidermis similar to normal wound healing. In summary, we show that EC-Matriderm contains viable, metabolically active keratinocytes and melanocytes cultured in a manner that permits easy transportation and contains epidermal cells with the potential to form a pigmented reconstructed

  12. The variability problem of normal human walking

    DEFF Research Database (Denmark)

    Simonsen, Erik B; Alkjær, Tine

    2012-01-01

    Previous investigations have suggested considerable inter-individual variability in the time course pattern of net joint moments during normal human walking, although the limited sample sizes precluded statistical analyses. The purpose of the present study was to obtain joint moment patterns from...... a group of normal subjects and to test whether or not the expected differences would prove to be statistically significant. Fifteen healthy male subjects were recorded on video while they walked across two force platforms. Ten kinematic and kinetic parameters were selected and input to a statistical...... cluster analysis to determine whether or not the 15 subjects could be divided into different 'families' (clusters) of walking strategy. The net joint moments showed a variability corroborating earlier reports. The cluster analysis showed that the 15 subjects could be grouped into two clusters of 5 and 10...

  13. Parietal podocytes in normal human glomeruli.

    Science.gov (United States)

    Bariety, Jean; Mandet, Chantal; Hill, Gary S; Bruneval, Patrick

    2006-10-01

    Although parietal podocytes along the Bowman's capsule have been described by electron microscopy in the normal human kidney, their molecular composition remains unknown. Ten human normal kidneys that were removed for cancer were assessed for the presence and the extent of parietal podocytes along the Bowman's capsule. The expression of podocyte-specific proteins (podocalyxin, glomerular epithelial protein-1, podocin, nephrin, synaptopodin, and alpha-actinin-4), podocyte synthesized proteins (vascular endothelial growth factor and novH), transcription factors (WT1 and PAX2), cyclin-dependent kinase inhibitor p57, and intermediate filaments (cytokeratins and vimentin) was tested. In addition, six normal fetal kidneys were studied to track the ontogeny of parietal podocytes. The podocyte protein labeling detected parietal podocytes in all of the kidneys, was found in 76.6% on average of Bowman's capsule sections, and was prominent at the vascular pole. WT1 and p57 were expressed in some parietal cells, whereas PAX2 was present in all or most of them, so some parietal cells coexpressed WT1 and PAX2. Furthermore, parietal podocytes coexpressed WT1 and podocyte proteins. Cytokeratin-positive cells covered a variable part of the capsule and did not express podocyte proteins. Tuft-capsular podocyte bridges were present in 15.5 +/- 3.7% of the glomerular sections. Parietal podocytes often covered the juxtaglomerular arterioles and were present within the extraglomerular mesangium. Parietal podocytes were present in fetal kidneys. Parietal podocytes that express the same epitopes as visceral podocytes do exist along Bowman's capsule in the normal adult kidney. They are a constitutive cell type of the Bowman's capsule. Therefore, their role in physiology and pathology should be investigated.

  14. Protective Effect of Liposome-Encapsulated Glutathione in a Human Epidermal Model Exposed to a Mustard Gas Analog

    Directory of Open Access Journals (Sweden)

    Victor Paromov

    2011-01-01

    Full Text Available Sulfur mustard or mustard gas (HD and its monofunctional analog, 2-chloroethyl ethyl sulfide (CEES, or “half-mustard gas,” are alkylating agents that induce DNA damage, oxidative stress, and inflammation. HD/CEES are rapidly absorbed in the skin causing extensive injury. We hypothesize that antioxidant liposomes that deliver both water-soluble and lipid-soluble antioxidants protect skin cells from immediate CEES-induced damage via attenuating oxidative stress. Liposomes containing water-soluble antioxidants and/or lipid-soluble antioxidants were evaluated using in vitro model systems. Initially, we found that liposomes containing encapsulated glutathione (GSH-liposomes increased cell viability and attenuated production of reactive oxygen species (ROS in HaCaT cells exposed to CEES. Next, GSH-liposomes were tested in a human epidermal model, EpiDerm. In the EpiDerm, GSH-liposomes administered simultaneously or 1 hour after CEES exposure (2.5 mM increased cell viability, inhibited CEES-induced loss of ATP and attenuated changes in cellular morphology, but did not reduce caspase-3 activity. These findings paralleled the previously described in vivo protective effect of antioxidant liposomes in the rat lung and established the effectiveness of GSH-liposomes in a human epidermal model. This study provides a rationale for use of antioxidant liposomes against HD toxicity in the skin considering further verification in animal models exposed to HD.

  15. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Hanson, D.; DeLeo, V.

    1990-01-01

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  16. Glycoprotein biosynthesis by human normal platelets

    International Nuclear Information System (INIS)

    Rodriguez, P.; Bello, O.; Apitz-Castro, R.

    1987-01-01

    Incorporation of radioactive Man, Gal, Fuc, Glc-N, and NANA into washed human normal platelets and endogenous glycoproteins has been found. Both parameters were time dependent. Analysis of hydrolyzed labeled glycoproteins by paper chromatography revealed that the radioactive monosaccharide incubated with the platelets had not been converted into other sugars. Acid hydrolysis demonstrates the presence of a glycosidic linkage. All the effort directed to the demonstration of the existence of a lipid-sugar intermediate in intact human platelets yielded negative results for Man and Glc-N used as precursors. The incorporation of these sugars into glycoproteins is insensitive to bacitracin, suggesting no involvement of lipid-linked saccharides in the synthesis of glycoproteins in human blood platelets. The absence of inhibition of the glycosylation process in the presence of cycloheximide suggests that the sugars are added to proteins present in the intact platelets. These results support the contention that glycoprotein biosynthesis in human blood platelets observed under our experimental conditions is effected through direct sugar nucleotide glycosylation

  17. Human Epidermal Growth Factor Receptor 2 Overexpression in Micropapillary and Other Variants of Urothelial Carcinoma.

    Science.gov (United States)

    Behzatoğlu, Kemal; Yörükoğlu, Kutsal; Demir, Hale; Bal, Nebil

    2016-06-21

    Human epidermal growth factor receptor 2 (HER2) protein overexpression or gene amplification has been shown in urothelial bladder cancer. This could be helpful when using targeted anti-HER2 therapy on these tumors. To evaluate HER2 immunohistochemical expression in conventional urothelial carcinoma (UC), in situ UC, and UC variants primarily in micropapillary urothelial carcinoma (MPUC). The study evaluated 60 MPUC cases; 25 invasive, 20 low-grade noninvasive, and 10 high-grade noninvasive UC cases; 8 in situ UC cases; and 69 UC variant cases. The immunohistochemistry staining was scored according to recommendations of the American Society of Clinical Oncology/College of American Pathologists 2013 HER2 test guideline established for breast cancer and only 3+ staining was considered HER2 overexpression. HER2 overexpression was determined by 3+ staining. 34 of 60 MPUC cases (56%) showed HER2 overexpression (3+ staining). We observed 3+ staining HER2 overexpression in nine of 25 conventional invasive UC cases (36%), four of eight in situ UC cases (50%), and three of six lipid cell variant cases (50%). 3+ staining HER2 overexpression was not seen in eight glandular, six small cell, and five sarcomatoid variant cases. HER2 overexpression was negative in the 20 low-grade noninvasive UC cases but positive in two of the 10 high-grade noninvasive UC cases (20%). We observed HER2 overexpression most commonly in MPUC cases. We also found HER2 overexpression in conventional invasive and in situ UC cases. Pure in situ UC and conventional invasive UC, especially MPUC, could be candidate tumors for treatment with anti-HER2 antibody (trastuzumab therapy). Targeted therapy has a limited place in treatment of bladder cancer. In this study, human epidermal growth factor receptor 2 (HER2) overexpression in bladder carcinomas was evaluated in a large number of cases. Anti-HER2 therapy could be used in bladder cancers, as in breast and gastric cancers. Copyright © 2016 European

  18. Human papilloma virus DNAs immortalize normal human mammary epithelial cells and reduce their growth factor requirements

    International Nuclear Information System (INIS)

    Band, V.; Zajchowski, D.; Kulesa, V.; Sager, R.

    1990-01-01

    Human papilloma virus (HPV) types 16 and 18 are most commonly associated with cervical carcinoma in patients and induce immortalization of human keratinocytes in culture. HPV has not been associated with breast cancer. This report describes the immortalization of normal human mammary epithelial cells (76N) by plasmid pHPV18 or pHPV16, each containing the linearized viral genome. Transfectants were grown continuously for more than 60 passages, whereas 76N cells senesce after 18-20 passages. The transfectants also differ from 76N cells in cloning in a completely defined medium called D2 and growing a minimally supplemented defined medium (D3) containing epidermal growth factor. All transfectant tested contain integrated HPV DNA, express HPV RNA, and produce HPV E7 protein. HPV transfectants do not form tumors in a nude mouse assay. It is concluded that products of the HPV genome induce immortalization of human breast epithelial cells and reduce their growth factor requirements. This result raises the possibility that HPV might be involved in breast cancer. Furthermore, other tissue-specific primary epithelial cells that are presently difficult to grown and investigate may also be immortalized by HPV

  19. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Sub [Dept. of Radiology, Jeju National University Hospital, Jeju (Korea, Republic of); Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo [Seoul National University Hospital, Seoul (Korea, Republic of)

    2017-09-15

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers.

  20. Phosphoproteomic fingerprinting of epidermal growth factor signaling and anticancer drug action in human tumor cells.

    Science.gov (United States)

    Lim, Yoon-Pin; Diong, Lang-Shi; Qi, Robert; Druker, Brian J; Epstein, Richard J

    2003-12-01

    Many proteins regulating cancer cell growth are tyrosine phosphorylated. Using antiphosphotyrosine affinity chromatography, thiourea protein solubilization, two-dimensional PAGE, and mass spectrometry, we report here the characterization of the epidermal growth factor (EGF)-induced phosphoproteome in A431 human epidermoid carcinoma cells. Using this approach, more than 50 distinct tyrosine phosphoproteins are identifiable within five main clusters-cytoskeletal proteins, signaling enzymes, SH2-containing adaptors, chaperones, and focal adhesion proteins. Comparison of the phosphoproteomes induced in vitro by transforming growth factor-alpha and platelet-derived growth factor demonstrates the pathway- and cell-specific nature of the phosphoproteomes induced. Elimination of both basal and ligand-dependent phosphoproteins by cell exposure to the EGF receptor catalytic inhibitor gefitinib (Iressa, ZD1839) suggests either an autocrine growth loop or the presence of a second inhibited kinase in A431 cells. By identifying distinct patterns of phosphorylation involving novel signaling substrates, and by clarifying the mechanism of action of anticancer drugs, these findings illustrate the potential of immunoaffinity-based phosphoproteomics for guiding the discovery of new drug targets and the rational utilization of pathway-specific chemotherapies.

  1. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  2. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  3. Human epidermal growth factor receptor2 expression in unresectable gastric cancers: Relationship with CT characteristics

    International Nuclear Information System (INIS)

    Lee, Jeong Sub; Kim, Se Hyung; Im, Seock Ah; Kim, Min A; Han, Joon Koo

    2017-01-01

    To retrospectively analyze the qualitative CT features that correlate with human epidermal growth factor receptor 2 (HER2)-expression in pathologically-proven gastric cancers. A total of 181 patients with pathologically-proven unresectable gastric cancers with HER2-expression (HER2-positive [n = 32] and negative [n = 149]) were included. CT features of primary gastric and metastatic tumors were reviewed. The prevalence of each CT finding was compared in both groups. Thereafter, binary logistic regression determined the most significant differential CT features. Clinical outcomes were compared using Kaplan-Meier method. HER2-postive cancers showed lower clinical T stage (21.9% vs. 8.1%; p = 0.015), hyperattenuation on portal phase (62.5% vs. 30.9%; p = 0.003), and was more frequently metastasized to the liver (62.5% vs. 32.2%; p = 0.001), than HER2-negative cancers. On binary regression analysis, hyperattenuation of the tumor (odds ratio [OR], 4.68; p < 0.001) and hepatic metastasis (OR, 4.43; p = 0.001) were significant independent factors that predict HER2-positive cancers. Median survival of HER2-positive cancers (13.7 months) was significantly longer than HER2-negative cancers (9.6 months) (p = 0.035). HER2-positive gastric cancers show less-advanced T stage, hyperattenuation on the portal phase, and frequently metastasize to the liver, as compared to HER2-negative cancers

  4. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Tae Ryool [Dept. of Radiation Oncology, Hallym University Chuncheon Sacred Heart Hospital, Chuncheon (Korea, Republic of); Kim, In Ah [Dept. of Radiation Oncology, Seoul National University Bundang Hospital, Seongnam (Korea, Republic of)

    2016-03-15

    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents.

  5. The effect of wound dressings on a bio-engineered human dermo-epidermal skin substitute in a rat model

    OpenAIRE

    Hüging, Martina; Biedermann, Thomas; Sobrio, Monia; Meyer, Sarah; Böttcher-Haberzeth, Sophie; Manuel, Edith; Horst, Maya; Hynes, Sally; Reichmann, Ernst; Schiestl, Clemens; Hartmann-Fritsch, Fabienne

    2017-01-01

    Autologous bio-engineered dermo-epidermal skin substitutes are a promising treatment for large skin defects such as burns. For their successful clinical application, the graft dressing must protect and support the keratinocyte layer and, in many cases, possess antimicrobial properties. However, silver in many antimicrobial dressings may inhibit keratinocyte growth and differentiation. The purpose of our study is to evaluate the effect of various wound dressings on the healing of a human hydro...

  6. Activin receptor subunits in normal and dysfunctional adult human testis

    DEFF Research Database (Denmark)

    Dias, V; Meachem, S; Rajpert-De Meyts, E

    2008-01-01

    The cellular sites of activin action and its regulation in the normal and dysfunctional adult human testis are unknown.......The cellular sites of activin action and its regulation in the normal and dysfunctional adult human testis are unknown....

  7. C4.4A gene ablation is compatible with normal epidermal development and causes modest overt phenotypes

    DEFF Research Database (Denmark)

    Kriegbaum, Mette Camilla; Jacobsen, Benedikte; Füchtbauer, Annette

    2016-01-01

    of C4.4A in normal physiology and cancer progression. The unchallenged C4.4A-deficient mice were viable, fertile, born in a normal Mendelian distribution and, surprisingly, displayed normal development of squamous epithelia. The C4.4A-deficient mice were, nonetheless, significantly lighter than...

  8. Effects of Human Mesenchymal Stem Cells Coculture on Calcium-Induced Differentiation of Normal Human Keratinocytes.

    Science.gov (United States)

    Sah, Shyam Kishor; Kim, Hae Young; Lee, Ji Hae; Lee, Seong-Wook; Kim, Hyung-Sik; Kim, Yeon-Soo; Kang, Kyung-Sun; Kim, Tae-Yoon

    2017-06-01

    The influence of mesenchymal stem cells (MSCs) on keratinocytes in altered microenvironments is poorly understood. Here, we cocultured umbilical cord blood-derived MSCs with normal human epidermal keratinocytes to evaluate their paracrine effect in the presence of high extracellular calcium (Ca 2+ ) concentration. High Ca 2+ environment to keratinocytes can disrupt normal skin barrier function due to abnormal/premature differentiation of keratinocytes. Surprisingly, we found that MSCs suppress both proliferation and differentiation of keratinocytes under a high Ca 2+ environment in transforming growth factors β1 (TGFβ1)-dependent manner. Furthermore, we determined that MSCs can regulate the mitogen-activated protein kinases, phosphatidylinositol 3-kinase/protein kinase B, and protein kinase C pathways in Ca 2+ -induced differentiated keratinocytes. Knockdown of TGFβ1 from MSCs results in decreased suppression of differentiation with significantly increased proliferation of keratinocytes compared with control MSCs. MSCs-derived TGFβ1 further induced growth inhibition of keratinocyte in high extracellular Ca 2+ environment as analyzed by a decrease in DNA synthesis, accumulation of phosphorylated retinoblastoma protein, cdc2, and increased mRNA level of p21, and independent of TGFβ1/SMAD pathway. Taken together, we found that MSCs-derived TGFβ1 is a critical regulator of keratinocyte function, and involves multiple proximal signaling cascades. Stem Cells 2017;35:1592-1602. © 2017 AlphaMed Press.

  9. Radiolabeled pertuzumab for imaging of human epidermal growth factor receptor 2 expression in ovarian cancer

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Dawei [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Im, Hyung-Jun [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Sun, Haiyan; Cho, Steve Y. [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Valdovinos, Hector F.; England, Christopher G.; Ehlerding, Emily B.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Lee, Dong Soo [Seoul National University, Graduate School of Convergence Science and Technology, Seoul (Korea, Republic of); Huang, Peng [Shenzhen University, Guangdong Key Laboratory for Biomedical Measurements and Ultrasound Imaging, School of Biomedical Engineering, Shenzhen (China); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2017-08-15

    Human epidermal growth factor receptor 2 (HER2) is over-expressed in over 30% of ovarian cancer cases, playing an essential role in tumorigenesis and metastasis. Non-invasive imaging of HER2 is of great interest for physicians as a mean to better detect and monitor the progression of ovarian cancer. In this study, HER2 was assessed as a biomarker for ovarian cancer imaging using {sup 64}Cu-labeled pertuzumab for immunoPET imaging. HER2 expression and binding were examined in three ovarian cancer cell lines (SKOV3, OVCAR3, Caov3) using in vitro techniques, including western blot and saturation binding assays. PET imaging and biodistribution studies in subcutaneous models of ovarian cancer were performed for non-invasive in vivo evaluation of HER2 expression. Additionally, orthotopic models were employed to further validate the imaging capability of {sup 64}Cu-NOTA-pertuzumab. HER2 expression was highest in SKOV3 cells, while OVCAR3 and Caov3 displayed lower HER2 expression. {sup 64}Cu-NOTA-pertuzumab showed high specificity for HER2 (K{sub a} = 3.1 ± 0.6 nM) in SKOV3. In subcutaneous tumors, PET imaging revealed tumor uptake of 41.8 ± 3.8, 10.5 ± 3.9, and 12.1 ± 2.3%ID/g at 48 h post-injection for SKOV3, OVCAR3, and Caov3, respectively (n = 3). In orthotopic models, PET imaging with {sup 64}Cu-NOTA-pertuzumab allowed for rapid and clear delineation of both primary and small peritoneal metastases in HER2-expressing ovarian cancer. {sup 64}Cu-NOTA-pertuzumab is an effective PET tracer for the non-invasive imaging of HER2 expression in vivo, rendering it a potential tracer for treatment monitoring and improved patient stratification. (orig.)

  10. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.

    2008-01-01

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  11. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).

    Science.gov (United States)

    Kremer, M; Lang, E; Berger, A C

    2000-09-01

    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  12. Cellular processes involved in human epidermal cells exposed to extremely low frequency electric fields.

    Science.gov (United States)

    Collard, J-F; Hinsenkamp, M

    2015-05-01

    We observed on different tissues and organisms a biological response after exposure to pulsed low frequency and low amplitude electric or electromagnetic fields but the precise mechanism of cell response remains unknown. The aim of this publication is to understand, using bioinformatics, the biological relevance of processes involved in the modification of gene expression. The list of genes analyzed was obtained after microarray protocol realized on cultures of human epidermal explants growing on deepidermized human skin exposed to a pulsed low frequency electric field. The directed acyclic graph on a WebGestalt Gene Ontology module shows six categories under the biological process root: "biological regulation", "cellular process", "cell proliferation", "death", "metabolic process" and "response to stimulus". Enriched derived categories are coherent with the type of in vitro culture, the stimulation protocol or with the previous results showing a decrease of cell proliferation and an increase of differentiation. The Kegg module on WebGestalt has highlighted "cell cycle" and "p53 signaling pathway" as significantly involved. The Kegg website brings out interactions between FoxO, MAPK, JNK, p53, p38, PI3K/Akt, Wnt, mTor or NF-KappaB. Some genes expressed by the stimulation are known to have an exclusive function on these pathways. Analyses performed with Pathway Studio linked cell proliferation, cell differentiation, apoptosis, cell cycle, mitosis, cell death etc. with our microarrays results. Medline citation generated by the software and the fold change variation confirms a diminution of the proliferation, activation of the differentiation and a less well-defined role of apoptosis or wound healing. Wnt and DKK functional classes, DKK1, MACF1, ATF3, MME, TXNRD1, and BMP-2 genes proposed in previous publications after a manual analysis are also highlighted with other genes after Pathway Studio automatic procedure. Finally, an analysis conducted on a list of genes

  13. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  14. Differences in human skin between the epidermal growth factor receptor distribution detected by EGF binding and monoclonal antibody recognition

    DEFF Research Database (Denmark)

    Green, M R; Couchman, J R

    1985-01-01

    , the eccrine sweat glands, capillary system, and the hair follicle outer root sheath, generally similar in pattern to that previously reported for full-thickness rat skin and human epidermis. The same areas also bound EGF-R1 but in addition the monoclonal antibody recognized a cone of melanin containing......Two methods have been used to examine epidermal growth factor (EGF) receptor distribution in human scalp and foreskin. The first employed [125I]EGF viable explants and autoradiography to determine the EGF binding pattern while the second used a monoclonal antibody to the human EGF receptor to map...... whether EGF-R1 could recognize molecules unrelated to the EGF receptor, the EGF binding and EGF-R1 recognition profiles were compared on cultures of SVK14 cells, a SV40 transformed human keratinocyte cell line. EGF binding and EGF-R1 monoclonal antibody distribution on these cells was found to be similar...

  15. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Taichman, L.B.; Setlow, R.B.

    1979-01-01

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  16. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.

    Science.gov (United States)

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme

    2017-01-01

    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  17. Morphological evaluation of normal human corneal epithelium

    DEFF Research Database (Denmark)

    Ehlers, Niels; Heegaard, Steffen; Hjortdal, Jesper

    2010-01-01

    of corneas from 100 consecutively selected paraffin-embedded eyes were stained with hematoxylin-eosin and Periodic Acid-Schiff (PAS). All specimens were evaluated by light microscopy. The eyes were enucleated from patients with choroidal melanoma. Corneas were considered to be normal. RESULTS: Ninety of 100...

  18. UVA-induced immune suppression in human skin: protective effect of vitamin E in human epidermal cells in vitro

    International Nuclear Information System (INIS)

    Clement-Lacroix, P.; Michel, L.; Moysan, A.; Morliere, P.; Dubertret, L.

    1996-01-01

    UVA (320-400 nm) radiation damage to membranes, proteins, DNA and other cellular targets is predominantly related to oxidative processes. In the present study, we demonstrated that cutaneous UVA-induced immunosuppression can be related, at least in part, to the appearance of these oxidative processes. The UVA-induced oxidative processes in freshly isolated epidermal cells were monitored by measuring the thiobarbituric acid reactive substances (TBARS) as an index of peroxidation. The in vitro immunosuppressive effects of UVA were demonstrated by measuring the allogenic lymphocyte proliferation induced by epidermal cells or purified Langerhans cells in the mixed epidermal cell-lymphocyte reaction (MECLR). In addition, the effects of a potent antioxidant (vitamin E) on these two UVA-induced processes were analysed. (author)

  19. A nomogram for predicting pathological complete response in patients with human epidermal growth factor receptor 2 negative breast cancer

    International Nuclear Information System (INIS)

    Jin, Xi; Jiang, Yi-Zhou; Chen, Sheng; Yu, Ke-Da; Ma, Ding; Sun, Wei; Shao, Zhi-Min; Di, Gen-Hong

    2016-01-01

    The response to neoadjuvant chemotherapy has been proven to predict long-term clinical benefits for patients. Our research is to construct a nomogram to predict pathological complete response of human epidermal growth factor receptor 2 negative breast cancer patients. We enrolled 815 patients who received neoadjuvant chemotherapy from 2003 to 2015 and divided them into a training set and a validation set. Univariate logistic regression was performed to screen for predictors and construct the nomogram; multivariate logistic regression was performed to identify independent predictors. After performing the univariate logistic regression analysis in the training set, tumor size, hormone receptor status, regimens of neoadjuvant chemotherapy and cycles of neoadjuvant chemotherapy were the final predictors for the construction of the nomogram. The multivariate logistic regression analysis demonstrated that T4 status, hormone receptor status and receiving regimen of paclitaxel and carboplatin were independent predictors of pathological complete response. The area under the receiver operating characteristic curve of the training set and the validation set was 0.779 and 0.701, respectively. We constructed and validated a nomogram to predict pathological complete response in human epidermal growth factor receptor 2 negative breast cancer patients. We also identified tumor size, hormone receptor status and paclitaxel and carboplatin regimen as independent predictors of pathological complete response. The online version of this article (doi:10.1186/s12885-016-2652-z) contains supplementary material, which is available to authorized users

  20. Laminin-5 Degradation Due to Mustard in Cultured Normal Human Epidermal Keratinocytes (NHEK)

    National Research Council Canada - National Science Library

    Ray, Prabhati; Jin, Xiannu; Leng, Yan; Li, Zhuangwu; Ray, Radharaman

    2003-01-01

    .... We observed that in NHEK, mustards degrade laminin-5. Calmodulin antagonist, W7 or the serine protease inhibitor, TLCK prior to mustard exposure prevented mustard-induced degradation of laminin-5...

  1. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  2. Fatty acid uptake in normal human myocardium

    International Nuclear Information System (INIS)

    Vyska, K.; Meyer, W.; Stremmel, W.; Notohamiprodjo, G.; Minami, K.; Machulla, H.J.; Gleichmann, U.; Meyer, H.; Koerfer, R.

    1991-01-01

    Fatty acid binding protein has been found in rat aortic endothelial cell membrane. It has been identified to be a 40-kDa protein that corresponds to a 40-kDa fatty acid binding protein with high affinity for a variety of long chain fatty acids isolated from rat heart myocytes. It is proposed that this endothelial membrane fatty acid binding protein might mediate the myocardial uptake of fatty acids. For evaluation of this hypothesis in vivo, influx kinetics of tracer-labeled fatty acids was examined in 15 normal subjects by scintigraphic techniques. Variation of the plasma fatty acid concentration and plasma perfusion rate has been achieved by modulation of nutrition state and exercise conditions. The clinical results suggest that the myocardial fatty acid influx rate is saturable by increasing fatty acid plasma concentration as well as by increasing plasma flow. For analysis of these data, functional relations describing fatty acid transport from plasma into myocardial tissue in the presence and absence of an unstirred layer were developed. The fitting of these relations to experimental data indicate that the free fatty acid influx into myocardial tissue reveals the criteria of a reaction on a capillary surface in the vicinity of flowing plasma but not of a reaction in extravascular space or in an unstirred layer and that the fatty acid influx into normal myocardium is a saturable process that is characterized by the quantity corresponding to the Michaelis-Menten constant, Km, and the maximal velocity, Vmax, 0.24 ± 0.024 mumol/g and 0.37 ± 0.013 mumol/g(g.min), respectively. These data are compatible with a nondiffusional uptake process mediated by the initial interaction of fatty acids with the 40-kDa membrane fatty acid binding protein of cardiac endothelial cells

  3. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  4. Desmosomal Molecules In and Out of Adhering Junctions: Normal and Diseased States of Epidermal, Cardiac and Mesenchymally Derived Cells

    Directory of Open Access Journals (Sweden)

    Sebastian Pieperhoff

    2010-01-01

    Full Text Available Current cell biology textbooks mention only two kinds of cell-to-cell adhering junctions coated with the cytoplasmic plaques: the desmosomes (maculae adhaerentes, anchoring intermediate-sized filaments (IFs, and the actin microfilament-anchoring adherens junctions (AJs, including both punctate (puncta adhaerentia and elongate (fasciae adhaerentes structures. In addition, however, a series of other junction types has been identified and characterized which contain desmosomal molecules but do not fit the definition of desmosomes. Of these special cell-cell junctions containing desmosomal glycoproteins or proteins we review the composite junctions (areae compositae connecting the cardiomyocytes of mature mammalian hearts and their importance in relation to human arrhythmogenic cardiomyopathies. We also emphasize the various plakophilin-2-positive plaques in AJs (coniunctiones adhaerentes connecting proliferatively active mesenchymally-derived cells, including interstitial cells of the heart and several soft tissue tumor cell types. Moreover, desmoplakin has also been recognized as a constituent of the plaques of the complexus adhaerentes connecting certain lymphatic endothelial cells. Finally, we emphasize the occurrence of the desmosomal transmembrane glycoprotein, desmoglein Dsg2, out of the context of any junction as dispersed cell surface molecules in certain types of melanoma cells and melanocytes. This broadening of our knowledge on the diversity of AJ structures indicates that it may still be too premature to close the textbook chapters on cell-cell junctions.

  5. Immunolocalization of transforming growth factor alpha in normal human tissues

    DEFF Research Database (Denmark)

    Christensen, M E; Poulsen, Steen Seier

    1996-01-01

    anchorage-independent growth of normal cells and was, therefore, considered as an "oncogenic" growth factor. Later, its immunohistochemical presence in normal human cells as well as its biological effects in normal human tissues have been demonstrated. The aim of the present investigation was to elucidate...... the distribution of the growth factor in a broad spectrum of normal human tissues. Indirect immunoenzymatic staining methods were used. The polypeptide was detected with a polyclonal as well as a monoclonal antibody. The polyclonal and monoclonal antibodies demonstrated almost identical immunoreactivity. TGF......-alpha was found to be widely distributed in cells of normal human tissues derived from all three germ layers, most often in differentiated cells. In epithelial cells, three different kinds of staining patterns were observed, either diffuse cytoplasmic, cytoplasmic in the basal parts of the cells, or distinctly...

  6. Human normal tissue reactions in radiotherapy

    International Nuclear Information System (INIS)

    Taniike, Keiko

    1990-01-01

    Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)

  7. A Premature Termination of Human Epidermal Growth Factor Receptor Transcription in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jihene Elloumi-Mseddi

    2014-01-01

    Full Text Available Our success in producing an active epidermal growth factor receptor (EGFR tyrosine kinase in Escherichia coli encouraged us to express the full-length receptor in the same host. Despite its large size, we were successful at producing the full-length EGFR protein fused to glutathione S-transferase (GST that was detected by Western blot analysis. Moreover, we obtained a majoritarian truncated GST-EGFR form detectable by gel electrophoresis and Western blot. This truncated protein was purified and confirmed by MALDI-TOF/TOF analysis to belong to the N-terminal extracellular region of the EGFR fused to GST. Northern blot analysis showed two transcripts suggesting the occurrence of a transcriptional arrest.

  8. Phase III randomized study comparing docetaxel plus trastuzumab with vinorelbine plus trastuzumab as first-line therapy of metastatic or locally advanced human epidermal growth factor receptor 2-positive breast cancer: the HERNATA study

    DEFF Research Database (Denmark)

    Andersson, Michael; Lidbrink, Elisabeth; Bjerre, Karsten

    2011-01-01

    To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer.......To evaluate docetaxel or vinorelbine, both with trastuzumab, as first-line therapy of human epidermal growth factor receptor 2-positive advanced breast cancer....

  9. Epidermal growth factor receptor antibody plus recombinant human endostatin in treatment of hepatic metastases after remnant gastric cancer resection

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    We report a 55-year-old male who developed advanced hepatic metastasis and peritoneal carcinomatosis after resection of remnant gastric cancer resection 3 mo ago. The patient only received epidermal growth factor (EGF) receptor antibody (Cetuximab) plus recombinant human endostatin (Endostar).Anti-tumor activity was assessed by 18F-fluorodeoxyglucose (18F-FDG)positron emission tomography/computer tomography (PET/CT) at baseline and then every 4 wk. The case illustrates that 18FDG-PET/CT could make an early prediction of the response to Cetuximab plus Endostar in such clinical situations. 18FDG-PET/CT is a useful molecular imaging modality to evaluate the biological response advanced hepatic metastasis and peritoneal carcinomatosis to Cetuximab plus Endostar in patients after remnant gastric cancer resection.

  10. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  11. Protein kinase C is differentially regulated by thrombin, insulin, and epidermal growth factor in human mammary tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, M.L.; Tellez-Inon, M.T. (Instituto de Ingenieria Genetica y Biologia Molecular, Buenos Aires (Argentina)); Medrano, E.E.; Cafferatta, E.G.A. (Instituto de Investigaciones Bioquimicas Fundacion Campomar, Buenos Aires (Argentina))

    1988-03-01

    The exposure of serum-deprived mammary tumor cells MCF-7 and T-47D to insulin, thrombin, and epidermal growth factor (EGF) resulted in dramatic modifications in the activity and in the translocation capacity of protein kinase C from cytosol to membrane fractions. Insulin induces a 600% activation of the enzyme after 5 h of exposure to the hormone in MCF-7 cells; thrombin either activates (200% in MCF-7) or down-regulates (in T-47D), and EGF exerts only a moderate effect. Thus, the growth factors studied modulate differentially the protein kinase C activity in human mammary tumor cells. The physiological significance of the results obtained are discussed in terms of the growth response elicited by insulin, thrombin, and EGF.

  12. Harnessing Integrative Omics to Facilitate Molecular Imaging of the Human Epidermal Growth Factor Receptor Family for Precision Medicine.

    Science.gov (United States)

    Pool, Martin; de Boer, H Rudolf; Hooge, Marjolijn N Lub-de; van Vugt, Marcel A T M; de Vries, Elisabeth G E

    2017-01-01

    Cancer is a growing problem worldwide. The cause of death in cancer patients is often due to treatment-resistant metastatic disease. Many molecularly targeted anticancer drugs have been developed against 'oncogenic driver' pathways. However, these treatments are usually only effective in properly selected patients. Resistance to molecularly targeted drugs through selective pressure on acquired mutations or molecular rewiring can hinder their effectiveness. This review summarizes how molecular imaging techniques can potentially facilitate the optimal implementation of targeted agents. Using the human epidermal growth factor receptor (HER) family as a model in (pre)clinical studies, we illustrate how molecular imaging may be employed to characterize whole body target expression as well as monitor drug effectiveness and the emergence of tumor resistance. We further discuss how an integrative omics discovery platform could guide the selection of 'effect sensors' - new molecular imaging targets - which are dynamic markers that indicate treatment effectiveness or resistance.

  13. Normal human bone marrow and its variations in MRI

    International Nuclear Information System (INIS)

    Vahlensieck, M.; Schmidt, H.M.

    2000-01-01

    Physiology and age dependant changes of human bone marrow are described. The resulting normal distribution patterns of active and inactive bone marrow including the various contrasts on different MR-sequences are discussed. (orig.) [de

  14. Thermal analysis of epidermal electronic devices integrated with human skin considering the effects of interfacial thermal resistance

    Science.gov (United States)

    Li, Yuhang; Zhang, Jianpeng; Xing, Yufeng; Song, Jizhou

    2018-05-01

    Epidermal electronic devices (EEDs) have similar mechanical properties as those of human skin such that they can be integrated with human skin for potential applications in monitoring of human vital signs for diagnostic, therapeutic or surgical functions. Thermal management is critical for EEDs in these applications since excessive heating may cause discomfort. Comprehensive analytical studies, finite element analysis and experiments are carried out to study the effects of interfacial thermal resistance between EEDs and human skin on thermal properties of the EED/skin system in this paper. The coupling between the Fourier heat transfer in EEDs and the bio-heat transfer in human skin is accounted in the analytical model based on the transfer matrix method to give accurate predictions on temperatures, which agree well with finite element analysis and experimental measurements. It is shown that the maximum temperature increase of the EED for the case of imperfect bonding between EED and skin is much higher than that of perfect bonding. These results may help the design of EEDs in bi-integrated applications and suggest a valuable route to evaluate the bonding condition between EEDs and biological tissues.

  15. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer

    NARCIS (Netherlands)

    Wolff, Antonio C.; Hammond, M. Elizabeth H.; Schwartz, Jared N.; Hagerty, Karen L.; Allred, D. Craig; Cote, Richard J.; Dowsett, Mitchell; Fitzgibbons, Patrick L.; Hanna, Wedad M.; Langer, Amy; McShane, Lisa M.; Paik, Soonmyung; Pegram, Mark D.; Perez, Edith A.; Press, Michael F.; Rhodes, Anthony; Sturgeon, Catharine; Taube, Sheila E.; Tubbs, Raymond; Vance, Gail H.; van de Vijver, Marc; Wheeler, Thomas M.; Hayes, Daniel F.

    2007-01-01

    PURPOSE: To develop a guideline to improve the accuracy of human epidermal growth factor receptor 2 (HER2) testing in invasive breast cancer and its utility as a predictive marker. METHODS: The American Society of Clinical Oncology and the College of American Pathologists convened an expert panel,

  16. Experimental radioimmunotherapy of a xenografted human glioma using [sup 131]I-labeled monoclonal antibody to epidermal growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, Hiroshi; Nakazawa, Shozo [Nippon Medical School, Tokyo (Japan); Herlyn, D

    1993-09-01

    [sup 131]I-labeled F (ab')[sub 2] fragments of murine monoclonal antibodies (MAb) 425 specific to the epidermal growth factor receptor expressed on human gliomas were used in experimental human malignant glioma immunotherapy. Two injections of 150 [mu]Ci [sup 131]I-labeled 425 F(ab')[sub 2] achieved growth inhibition of U-87MG human malignant glioma xenografts in nude mice. This radiolabeled specific MAb F(ab')[sub 2] was significantly superior to radiolabeled fragments of an anti-hepatitis virus control MAb A5C3 in influencing tumor growth. However, similar treatment of established human malignant glioma xenografts did not inhibit progressive tumor growth significantly. No clear tumor inhibition was produced by unlabeled MAb 425F(ab')[sub 2]. These studies suggest that [sup 131]I-labeled MAbs have a significant antitumor effect where unmodified antibody is ineffective. Multiple doses of antibody may achieve an increase in labeled MAb concentration in tumors. (author).

  17. DNA amplification is rare in normal human cells

    International Nuclear Information System (INIS)

    Wright, J.A.; Watt, F.M.; Hudson, D.L.; Stark, G.R.; Smith, H.S.; Hancock, M.C.

    1990-01-01

    Three types of normal human cells were selected in tissue culture with three drugs without observing a single amplification event from a total of 5 x 10 8 cells. No drug-resistant colonies were observed when normal foreskin keratinocytes were selected with N-(phosphonacetyl)-L-aspartate or with hydroxyurea or when normal mammary epithelial cells were selected with methotrexate. Some slightly resistant colonies with limited potential for growth were obtained when normal diploid fibroblast cells derived from fetal lung were selected with methotrexate or hydroxyurea but careful copy-number analysis of the dihydrofolate reductase and ribonucleotide reductase genes revealed no evidence of amplification. The rarity of DNA amplification in normal human cells contrasts strongly with the situation in tumors and in established cell lines, where amplification of onogenes and of genes mediating drug resistance is frequent. The results suggest that tumors and cell lines have acquired the abnormal ability to amplify DNA with high frequency

  18. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  19. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  20. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  1. Effects of recombinant human epidermal growth factor (rhEGF) on experimental radiation-induced oral mucositis in rats

    International Nuclear Information System (INIS)

    Jung, Kwon Il; Kim, Sun Hee; Moon, Soo Young; Kim, Yeon Wha; Hong, Joon Pio; Lee, Sang Wook; Kim, Hyun Sook

    2006-01-01

    Oral mucositis is a common toxicity of radiation or chemotherapy, which is used a treatment for head and neck cancer. We investigated effects of recombinant human epidermal growth factor (rhEGF) on radiation-induced oral mucositis in rat model. Spraque-Dawley rats (7 per group) exposed to a single dose of 25 Gy (day 0) on their head, except for one group, were randomly divided into un-treated, vehicle-treated, and two rhEGF-treated groups. Rats were topically applied with rhEGF (15 or 30 μ g/oral cavity/day) or vehicle to their oral mucosa. Survival rate of rats, weight changes, and food intakes were examined from day 0 to 18 after radiation. Histology study was performed from oral mucosa of rats at day 7 and 18 after radiation. rhEGF-treated groups (15 or 30 μ g/day) showed all survival rate 33%, whereas un-treated and vehicle-treated groups showed all survival rate 0% at the end of experiment. rhEGF-treated groups statistically had less weight loss compared to vehicle-treated group from day 2 to 7 after radiation. Food intake of rats with rhEGF treatment turned to increase at day 14 after radiation. At 7 day after radiation, un-treated and vehicle-treated groups showed severe pseudomembraneous of ulcerative oral mucositis. On the other hand, rhEGF-treated groups had no more than cellular swelling and degeneration of epidermal cells in oral mucosa of rats. These results suggest that rhEGF has significantly positive effects on radiation-induced oral mucositis in rats. rhEGF display a therapeutic potential on a clinical level

  2. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model.

    Science.gov (United States)

    Tanaka, Yohei; Nakayama, Jun

    2016-01-01

    Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000-1,800 nm wavelengths and excluded 1,400-1,500 nm wavelengths. A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm(2) irradiation (Psolar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both UV and NIR radiation may prevent changes in gene expression and in turn eye damage.

  3. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.

    1987-01-01

    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  4. Assessment of Epidermal Growth Factor Receptor (EGFR expression in human meningioma

    Directory of Open Access Journals (Sweden)

    Perry Arie

    2010-05-01

    Full Text Available Abstract Purpose This study explores whether meningioma expresses epidermal growth factor receptor (EGFR and determines if there is a correlation between the WHO grade of this tumor and the degree of EGFR expression. Methods Following institutional review board approval, 113 meningioma specimens from 89 patients were chosen. Of these, 85 were used for final analysis. After a blinded review, immunohistochemical stains for EGFR were performed. Staining intensity (SI was scored on a scale 0-3 (from no staining to strong staining. Staining percentage of immunoreactive cells (SP was scored 1-5 (from the least to the maximum percent of the specimen staining. Immunohistochemical score (IHS was calculated as the product of SI and SP. Results Eighty-five samples of meningioma were classified in accordance with World Health Organization (WHO criteria: benign 57/85 (67%, atypical 23/85 (27%, and malignant 5/85 (6%. The majority of samples demonstrated a moderate SI for EGFR. IHS for EGFR demonstrated a significant association between SI and histopathologic subtype. Also, there was a correlation between the SP and histopathologic subtype (p = 0.029. A significant association was determined when the benign and the atypical samples were compared to the malignant with respect to the SP (p = 0.009. While there was a range of the IHS for the benign and the atypical histologic subtypes, malignant tumors exhibited the lowest score and were statistically different from the benign and the atypical specimens (p Conclusions To our knowledge, this represents the largest series of meningioma samples analyzed for EGFR expression reported in the literature. EGFR expression is greatest in benign meningiomas and may serve a potential target for therapeutic intervention with selective EGFR inhibitors.

  5. Protective effect of Juglans regia L. against ultraviolet B radiation induced inflammatory responses in human epidermal keratinocytes.

    Science.gov (United States)

    Muzaffer, Umar; Paul, V I; Prasad, Nagarajan Rajendra; Karthikeyan, Ramasamy; Agilan, Balupillai

    2018-03-15

    Juglans regia L. has a history of traditional medicinal use for the treatment of various maladies and have been documented with significant antioxidant and antiinflammatory properties. Although all parts of the plant are medicinally important, but male the flower of the plant has not been yet investigated against the photo-damage. The present study, we sought to determine the photoprotective effect of the male flower of J. regia L. against ultraviolet-B radiation-induced inflammatory responses in human skin cells. The profile of pharmacological active compounds present in the male flower of J. regia was analyzed by GC-MS. Then, the antioxidant property of methanolic extract of J. regia (MEJR) was analyzed by in vitro free radical scavenging assays. Further, we analyzed the sun protection factor of this extract by spectrophotometry. Moreover, we investigated the photoprotective effect of MEJR against UVB induced inflammatory signaling in human epidermal cells. Human skin epidermal keratinocytes (HaCaT) were pretreated with the MEJR (80 µg/ml), 30 min prior to UVB-irradiation at a dose of 20 mJ/cm 2 and were investigated for lipid peroxidation, enzymatic antioxidants activity, apoptosis and inflammatory markers expression level. The GC-MS results showed the presence of good amount of pharmacologically active compounds in the MEJR. We observed that the MEJR possess significant free radical scavenging activity and it was comparable with standard antioxidants. Further, the MEJR exhibits 8.8 sun-protection-factor (SPF) value. Pretreatment with MEJR, 30 min prior to UVB-irradiation, prevented ROS generation, lipid peroxidation and restored the activity of antioxidant status in HaCaT cells. Moreover, MEJR pretreatment significantly prevented UVB activated inflammatory markers like TNF-α, IL-1, IL-6, NF-κB, COX-2 in HaCaT. The present findings suggest that MEJR exhibit photoprotective effects and hence it may be useful for the treatment of inflammation related

  6. Absorption of orally administered 65Zn by normal human subjects

    International Nuclear Information System (INIS)

    Aamodt, R.L.; Rumble, W.F.; Johnston, G.S.; Markley, E.J.; Henkin, R.I.

    1981-01-01

    Despite studies by several investigators of human gastrointestinal 65Zn absorption, implications of these data for evaluation of functional zinc status are unclear because limited numbers of normal subjects have been studied. To evaluated zinc absorption in normal humans, 75 subjects (31 women, 44 men, ages 18 to 84 yr) were given 10 micro Ci carrier-free 65Zn orally after an overnight fast. Absorption calculated from total body retention measured 7, 14, and 21 days after administration of tracer was 65 +/- 11% (mean +/- 1 SD), range from 40 to 86%. Comparison of these results with those for patients with a variety of diseases indicate that patients exhibit a wider range of absorption and, in four of six studies patients exhibit decreased mean zinc absorption. These results of gastrointestinal zinc absorption in a large number of normal humans offer a basis for a clearer comparison with data from patients who exhibit abnormalities of zinc absorption

  7. Establishing the proteome of normal human cerebrospinal fluid.

    Directory of Open Access Journals (Sweden)

    Steven E Schutzer

    2010-06-01

    Full Text Available Knowledge of the entire protein content, the proteome, of normal human cerebrospinal fluid (CSF would enable insights into neurologic and psychiatric disorders. Until now technologic hurdles and access to true normal samples hindered attaining this goal.We applied immunoaffinity separation and high sensitivity and resolution liquid chromatography-mass spectrometry to examine CSF from healthy normal individuals. 2630 proteins in CSF from normal subjects were identified, of which 56% were CSF-specific, not found in the much larger set of 3654 proteins we have identified in plasma. We also examined CSF from groups of subjects previously examined by others as surrogates for normals where neurologic symptoms warranted a lumbar puncture but where clinical laboratory were reported as normal. We found statistically significant differences between their CSF proteins and our non-neurological normals. We also examined CSF from 10 volunteer subjects who had lumbar punctures at least 4 weeks apart and found that there was little variability in CSF proteins in an individual as compared to subject to subject.Our results represent the most comprehensive characterization of true normal CSF to date. This normal CSF proteome establishes a comparative standard and basis for investigations into a variety of diseases with neurological and psychiatric features.

  8. Establishment of H2Mab-119, an Anti-Human Epidermal Growth Factor Receptor 2 Monoclonal Antibody, Against Pancreatic Cancer.

    Science.gov (United States)

    Yamada, Shinji; Itai, Shunsuke; Nakamura, Takuro; Chang, Yao-Wen; Harada, Hiroyuki; Suzuki, Hiroyoshi; Kaneko, Mika K; Kato, Yukinari

    2017-12-01

    Human epidermal growth factor receptor 2 (HER2) is overexpressed in breast cancer and is associated with poor clinical outcomes. In addition, HER2 expression has been reported in other cancers, such as gastric, colorectal, lung, and pancreatic cancers. An anti-HER2 humanized antibody, trastuzumab, leads to significant survival benefits in patients with HER2-overexpressing breast cancers and gastric cancers. Herein, we established a novel anti-HER2 monoclonal antibody (mAb), H 2 Mab-119 (IgG 1 , kappa), and characterized its efficacy against pancreatic cancers using flow cytometry, Western blot, and immunohistochemical analyses. H 2 Mab-119 reacted with pancreatic cancer cell lines, such as KLM-1, Capan-2, and MIA PaCa-2, but did not react with PANC-1 in flow cytometry analysis. Western blot analysis also revealed a moderate signal for KLM-1 and a weak signal for MIA PaCa-2, although H 2 Mab-119 reacted strongly with LN229/HER2 cells. Finally, immunohistochemical analyses with H 2 Mab-119 revealed sensitive and specific reactions against breast and colon cancers but did not react with pancreatic cancers, indicating that H 2 Mab-119 is useful for detecting HER2 overexpression in pancreatic cancers using flow cytometry and Western blot analyses.

  9. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Directory of Open Access Journals (Sweden)

    Rong-Dih Lin

    2015-12-01

    Full Text Available Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9 and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13, as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics.

  10. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. © The Author(s) 2015.

  11. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    Science.gov (United States)

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien

    2015-01-01

    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  12. Bacteriostatic enterochelin-specific immunoglobulin from normal human serum

    Energy Technology Data Exchange (ETDEWEB)

    Moore, D.G.; Yancey, R.J.; Lankford, C.E.; Earhart, C.F.

    1980-02-01

    Heat-inactivated normal human serum produces iron-reversible bacteriostasis of a number of microorganisms. This inhibitory effect was abolished by adsorption of serum with ultraviolet-killed cells of species that produce the siderophore enterochelin. Bacteriostasis also was alleviated by asorption of serum with 2,3-dihydroxy-N-benzoyl-L-serine, a degradation product of enterochelin, bound to the insoluble matrix AH-Sepharose 4B. Our results indicate that enterochelin-specific immunoglobulins exist in normal human serum. These immunoglobulins may act synergistically with transferrin to effect bacteriostasis of enterochelin-producing pathogens.

  13. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may...

  14. Inhibition of iodine-125-labeled human follitropin binding to testicular receptor by epidermal growth factor and synthetic peptides

    International Nuclear Information System (INIS)

    Sluss, P.M.; Krystek, S.R. Jr.; Andersen, T.T.; Melson, B.E.; Huston, J.S.; Ridge, R.; Reichert, L.E. Jr.

    1986-01-01

    Two tetrapeptide sequence homologies between mouse epidermal growth factor precursor (mEGFP) and human follitropin (FSH) were revealed by a computer program that identifies identical residues among polypeptide sequences. The two tetrapeptides, Lys-Thr-Cys-Thr (KTCT) and Thr-Arg-Asp-Leu (TRDL), are present in the hormone-specific beta subunit of FSH from all species studied. These tetrapeptides are not present in the alpha subunit, which is common to all pituitary glycoprotein hormones. Both tetrapeptides are also found in mEGFP, and one tetrapeptide, TRDL, is located within the 53-residue form of mEGF purified from mouse submaxillary glands. Computer-generated hydropathy profiles predicted that both tetrapeptides are located in hydrophilic portions of the FSH beta subunit and that TRDL is in a hydrophilic portion of commercially available mEGF. Therefore, the tetrapeptides might be accessible to receptor binding sites for FSH. We report that mEGF inhibits binding of 125 I-labeled human FSH to receptors in testis by 50% (I50) at a concentration of 1.8 X 10(-5) M. No binding inhibition was observed by GnRH or arginine-vasopressin at 10(-4) M, neither of which contain the tetrapeptide sequences. FSH beta subunit, which contains both tetrapeptides, also inhibited binding (I50 = 9 X 10(-8) M) of 125 I-labeled human FSH to testis receptor. Thus, it appears that FSH beta subunit and mEGF are capable of inhibiting binding of FSH to testicular FSH receptors, presumably through interactions that include the homologous tetrapeptides. This presumption was supported by the observation that the synthetic tetrapeptides (KTCT or TRDL) were also active in inhibiting binding of 125 I-labeled human FSH to testis receptor

  15. Development of an affinity-matured humanized anti-epidermal growth factor receptor antibody for cancer immunotherapy.

    Science.gov (United States)

    Nakanishi, Takeshi; Maru, Takamitsu; Tahara, Kazuhiro; Sanada, Hideaki; Umetsu, Mitsuo; Asano, Ryutaro; Kumagai, Izumi

    2013-02-01

    We showed previously that humanization of 528, a murine anti-epidermal growth factor receptor (EGFR) antibody, causes reduced affinity for its target. Here, to improve the affinity of the humanized antibody for use in cancer immunotherapy, we constructed phage display libraries focused on the complementarity-determining regions (CDRs) of the antibody and carried out affinity selection. Two-step selections using libraries constructed in a stepwise manner enabled a 32-fold affinity enhancement of humanized 528 (h528). Thermodynamic analysis of the interactions between the variable domain fragment of h528 (h528Fv) mutants and the soluble extracellular domain of EGFR indicated that the h528Fv mutants obtained from the first selection showed a large increase in negative enthalpy change due to binding, resulting in affinity enhancement. Furthermore, mutants from the second selection showed a decrease in entropy loss, which led to further affinity maturation. These results suggest that a single mutation in the heavy chain variable domain (i.e. Tyr(52) to Trp) enthalpically contributed for overcoming the energetic barrier to the antigen-antibody interaction, which was a major hurdle for the in vitro affinity maturation of h528. We reported previously that the humanized bispecific diabody hEx3 Db, which targets EGFR and CD3, shows strong anti-tumor activity. hEx3 Db mutants, in which the variable domains of h528 were replaced with those of the affinity-enhanced mutants, were prepared and characterized. In a growth inhibition assay of tumor cells, the hEx3 Db mutants showed stronger anti-tumor activity than that of hEx3 Db, suggesting that affinity enhancement of h528Fv enhances the anti-tumor activity of the bispecific diabody.

  16. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  17. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.

    Science.gov (United States)

    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis

    2008-12-01

    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  18. From hundreds to thousands: Widening the normal human Urinome

    Directory of Open Access Journals (Sweden)

    Laura Santucci

    2014-12-01

    The data are related to Santucci et al. (in press [1] and available both here and at ChorusProject.org under project name “From hundreds to thousands: widening the normal human Urinome”. The material supplied to Chorus Progect.org includes technical MS spectra data only.

  19. Loss of Brain Aerobic Glycolysis in Normal Human Aging.

    Science.gov (United States)

    Goyal, Manu S; Vlassenko, Andrei G; Blazey, Tyler M; Su, Yi; Couture, Lars E; Durbin, Tony J; Bateman, Randall J; Benzinger, Tammie L-S; Morris, John C; Raichle, Marcus E

    2017-08-01

    The normal aging human brain experiences global decreases in metabolism, but whether this affects the topography of brain metabolism is unknown. Here we describe PET-based measurements of brain glucose uptake, oxygen utilization, and blood flow in cognitively normal adults from 20 to 82 years of age. Age-related decreases in brain glucose uptake exceed that of oxygen use, resulting in loss of brain aerobic glycolysis (AG). Whereas the topographies of total brain glucose uptake, oxygen utilization, and blood flow remain largely stable with age, brain AG topography changes significantly. Brain regions with high AG in young adults show the greatest change, as do regions with prolonged developmental transcriptional features (i.e., neoteny). The normal aging human brain thus undergoes characteristic metabolic changes, largely driven by global loss and topographic changes in brain AG. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Mapping of Carboxypeptidase M in Normal Human Kidney and Renal Cell Carcinoma

    Science.gov (United States)

    Denis, Catherine J.; Van Acker, Nathalie; De Schepper, Stefanie; De Bie, Martine; Andries, Luc; Fransen, Erik; Hendriks, Dirk; Kockx, Mark M.

    2013-01-01

    Although the kidney generally has been regarded as an excellent source of carboxypeptidase M (CPM), little is known about its renal-specific expression level and distribution. This study provides a detailed localization of CPM in healthy and diseased human kidneys. The results indicate a broad distribution of CPM along the renal tubular structures in the healthy kidney. CPM was identified at the parietal epithelium beneath the Bowman’s basement membrane and in glomerular mesangial cells. Capillaries, podocytes, and most interstitial cells were CPM negative. Tumor cells of renal cell carcinoma subtypes lose CPM expression upon dedifferentiation. Tissue microarray analysis demonstrated a correlation between low CPM expression and tumor cell type. CPM staining was intense on phagocytotic tumor-associated macrophages. Immunoreactive CPM was also detected in the tumor-associated vasculature. The absence of CPM in normal renal blood vessels points toward a role for CPM in angiogenesis. Coexistence of CPM and the epidermal growth factor receptor (EGFR) was detected in papillary renal cell carcinoma. However, the different subcellular localization of CPM and EGFR argues against an interaction between these h proteins. The description of the distribution of CPM in human kidney forms the foundation for further study of the (patho)physiological activities of CPM in the kidney. PMID:23172796

  1. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.

    Directory of Open Access Journals (Sweden)

    V Chandana Epa

    Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  2. EPIDERMAL GROWTH FACTOR RECEPTOR (EGFR AND HUMAN PAPILLOMAVIRUS (HPV L1 CAPSID PROTEIN IN CERVICAL SQUAMOUS INTRAEPITHELIAL LESIONS

    Directory of Open Access Journals (Sweden)

    Balan Raluca

    2010-09-01

    Full Text Available We analyzed the immunohistochemical pattern of epidermal growth factor receptor (EGFR in cervical squamous intraepithelial lesions (SILs in correlation with L1 HPV capsid protein, in order to determine the relationship between EGFR expression and the infection status of human papillomavirus (HPV. The study included 40 cases, 24 LSIL (low grade SIL (CIN1, cervical intraepithelial neoplasia and 16 HSIL (high grade SIL (6 cases of CIN2 and 10 cases of CIN3. The immunoexpression of L1 HPV protein was assessed on conventional cervico-vaginal smears and EGFR was immunohistochemically evaluated on the corresponding cervical biopsies. The HPV L1 capsid protein was expressed in 45.83% of LSIL and 25% of HSIL. EGFR was overexpressed in 62,4% of HSIL (58,4% CIN2 and 41,6% CIN3 and 37,6% LSIL. The immunoexpression of L1 HPV has clinical application in the progression assessment of the cervical precancerous lesions without a correlation to the grade of the cervical SIL. EGFR is expressed by all proliferating squamous epithelial cells, thus corresponding with the grade of SIL. The evaluation of EGFR status, correlated with L1 HPV protein expression, can provide useful data of progression risk of cervical squamous intraepithelial lesions

  3. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.

    Science.gov (United States)

    Jackisch, Christian; Lammers, Philip; Jacobs, Ira

    2017-04-01

    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer. Copyright © 2017 Authors, Pfizer Inc. Published by Elsevier Ltd.. All rights reserved.

  4. Association of Polymorphisms in Connective Tissue Growth Factor and Epidermal Growth Factor Receptor Genes With Human Longevity.

    Science.gov (United States)

    Donlon, Timothy A; Morris, Brian J; He, Qimei; Chen, Randi; Masaki, Kamal H; Allsopp, Richard C; Willcox, D Craig; Tranah, Gregory J; Parimi, Neeta; Evans, Daniel S; Flachsbart, Friederike; Nebel, Almut; Kim, Duk-Hwan; Park, Joobae; Willcox, Bradley J

    2017-08-01

    Growth pathways play key roles in longevity. The present study tested single-nucleotide polymorphisms (SNPs) in the connective tissue growth factor gene (CTGF) and the epidermal growth factor receptor gene (EGFR) for association with longevity. Comparison of allele and genotype frequencies of 12 CTGF SNPs and 41 EGFR SNPs between 440 American men of Japanese ancestry aged ≥95 years and 374 men of average life span revealed association with longevity at the p cases, consistent with heterozygote advantage in living to extreme old age. No associations of the most significant SNPs were observed in whites or Koreans. In conclusion, the present findings indicate that genetic variation in CTGF and EGFR may contribute to the attainment of extreme old age in Japanese. More research is needed to confirm that genetic variation in CTGF and EGFR contributes to the attainment of extreme old age across human populations. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  6. Pattern of distribution of blood group antigens on human epidermal cells during maturation

    DEFF Research Database (Denmark)

    Dabelsteen, Erik; Buschard, Karsten; Hakomori, Sen-Itiroh

    1984-01-01

    The distribution in human epidermis of A, B, and H blood group antigens and of a precursor carbohydrate chain, N-acetyl-lactosamine, was examined using immunofluorescence staining techniques. The material included tissue from 10 blood group A, 4 blood group B, and 9 blood group O persons. Murine...... on the lower spinous cells whereas H antigen was seen predominantly on upper spinous cells or on the granular cells. Epithelia from blood group A or B persons demonstrated A or B antigens, respectively, but only if the tissue sections were trypsinized before staining. In such cases A or B antigens were found...... monoclonal antibodies were used to identify H antigen (type 2 chain) and N-acetyl-lactosamine. Human antisera were used to identify A and B antigens. In all groups N-acetyl-lactosamine and H antigen were found on the cell membranes of the spinous cell layer. N-acetyl-lactosamine was present mainly...

  7. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  8. Materials and optimized designs for human-machine interfaces via epidermal electronics.

    Science.gov (United States)

    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A

    2013-12-17

    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    Directory of Open Access Journals (Sweden)

    Tanaka Y

    2016-08-01

    Full Text Available Yohei Tanaka,1,2 Jun Nakayama2 1Department of Plastic Surgery, Clinica Tanaka Plastic, Reconstructive Surgery and Anti-aging Center, 2Department of Molecular Pathology, Shinshu University Graduate School of Medicine, Matsumoto, Nagano, Japan Background and objective: Humans are increasingly exposed to near-infrared (NIR radiation from both natural (eg, solar and artificial (eg, electrical appliances sources. Although the biological effects of sun and ultraviolet (UV exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues.Materials and methods: DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C. The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths.Results: A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05.Conclusion: We found that NIR irradiation induced the

  10. Urinary transforming growth factors in neoplasia: separation of 125I-labeled transforming growth factor-alpha from epidermal growth factor in human urine

    International Nuclear Information System (INIS)

    Stromberg, K.; Hudgins, W.R.

    1986-01-01

    Purified human epidermal growth factor (hEGF) from urine promotes anchorage-independent cell growth in soft agar medium. This growth is enhanced by transforming growth factor-beta (TGF-beta), and is specifically inhibited by hEGF antiserum. Transforming growth factors of the alpha type (TGF-alpha), potentially present in normal human urine or urine from tumor-bearing patients, also promote anchorage-independent cell growth and compete with EGF for membrane receptor binding. Consequently, TGF-alpha cannot be distinguished from urinary hEGF by these two functional assays. Therefore, a technique for separation of TGF-alpha and related peptides from urinary EGF based on biochemical characteristics would be useful. Radioiodination of characterized growth factors [mouse EGF (mEGF), hEGF, and rat TGF-alpha (rTGF-alpha)], which were then separately added to human urine, was used to evaluate a resolution scheme that separates TGF-alpha from the high level of background hEGF present in human urine. Methyl bonded microparticulate silica efficiently adsorbed the 125 I-labeled mEGF, 125 I-labeled hEGF, and 125 I-labeled rTGF-alpha that were added to 24-h human urine samples. Fractional elution with acetonitrile (MeCN) of the adsorbed silica released approximately 70 to 80% of the 125 I-labeled mEGF and 125 I-labeled hEGF between 25 and 30% MeCN, and over 80% of the 125 I-labeled rTGF-alpha between 15 and 25% MeCN, with retention after dialysis of less than 0.2 and 1.7% of the original urinary protein, respectively. A single-step enrichment of about 400-fold for mEGF and hEGF, and 50-fold for rTGF-alpha were achieved rapidly. 125 I-labeled mEGF and 125 I-labeled hEGF eluted later than would be predicted on the basis of their reported molecular weight of approximately 6000, whereas 125 I-labeled rTGF-alpha eluted from Bio-Gel P-10 at an approximate molecular weight of 8000 to 9000

  11. Human renin biosynthesis and secretion in normal and ischemic kidneys

    International Nuclear Information System (INIS)

    Pratt, R.E.; Carleton, J.E.; Richie, J.P.; Heusser, C.; Dzau, V.J.

    1987-01-01

    The pathway of renin biosynthesis and secretion in normal and ischemic human kidneys has been investigated by pulse-labeling experiments. The results indicate that in normal human kidney, preprorenin is rapidly processed to 47-kDa prorenin. Microradiosequencing showed that this molecule was generated by cleavage between Gly-23 and Leu-24, yielding a 43-amino acid proregion. Analysis of prorenin secreted by the kidney tissue yielded an identical sequence, indicating that prorenin is secreted without any further proteolysis. An examination of the kinetics of processing and secretion suggested that a majority of the newly synthesized prorenin is quickly secreted, while only a small fraction is processed intracellularly to the mature renin. The differences in secretion kinetics between prorenin and mature renin and the selective inhibition of prorenin secretion by monensin suggest that they are secreted independently via two pathways: a constitutive pathway probably from the Golgi or protogranules that rapidly release prorenin and a regulated pathway that secretes mature renin from the mature granules. A comparison of the kinetics of processing between normal and ischemic tissues suggests that renal ischemia leads to an overall increase in the rate of processing or prorenin to mature renin. In addition, prolonged biosynthetic labeling of renin in the ischemic kidney yielded two smaller molecular weight immunoreactive forms suggestive of renin fragments that may be degradative products. These fragments were not detected in normal kidney tissue labeled for similar lengths of time

  12. A role for the epidermal growth factor receptor signaling in development of intestinal serrated polyps in mice and humans.

    Science.gov (United States)

    Bongers, Gerold; Muniz, Luciana R; Pacer, Michelle E; Iuga, Alina C; Thirunarayanan, Nanthakumar; Slinger, Erik; Smit, Martine J; Reddy, E Premkumar; Mayer, Lloyd; Furtado, Glaucia C; Harpaz, Noam; Lira, Sergio A

    2012-09-01

    Epithelial cancers can be initiated by activating mutations in components of the mitogen-activated protein kinase signaling pathway such as v-raf murine sarcoma viral oncogene homolog B1 (BRAF), v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), or epidermal growth factor receptor (EGFR). Human intestinal serrated polyps are a heterogeneous group of benign lesions, but some progress to colorectal cancer. Tumors that arise from these polyps frequently contain activating mutations in BRAF or KRAS, but little is known about the role of EGFR activation in their development. Polyp samples were obtained from adults during screening colonoscopies at Mount Sinai Hospital in New York. We measured levels of EGFR protein and phosphorylation in human serrated polyps by immunohistochemical and immunoblot analyses. We generated transgenic mice that express the ligand for EGFR, Heparin-binding EGF-like growth factor (HB-EGF), in the intestine. EGFR and the extracellular-regulated kinases (ERK)1/2 were phosphorylated in serrated areas of human hyperplastic polyps (HPPs), sessile serrated adenomas, and traditional serrated adenomas. EGFR and ERK1/2 were phosphorylated in the absence of KRAS or BRAF activating mutations in a subset of HPP. Transgenic expression of the EGFR ligand HB-EGF in the intestines of mice promoted development of small cecal serrated polyps. Mice that expressed a combination of HB-EGF and US28 (a constitutively active, G-protein-coupled receptor that increases processing of HB-EGF from the membrane) rapidly developed large cecal serrated polyps. These polyps were similar to HPPs and had increased phosphorylation of EGFR and ERK1/2 within the serrated epithelium. Administration of pharmacologic inhibitors of EGFR or MAPK to these transgenic mice significantly reduced polyp development. Activation of EGFR signaling in the intestine of mice promotes development of serrated polyps. EGFR signaling also is activated in human HPPs, sessile serrated adenomas

  13. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  14. Differential regulation of type I interferon and epidermal growth factor pathways by a human Respirovirus virulence factor.

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2009-09-01

    Full Text Available A number of paramyxoviruses are responsible for acute respiratory infections in children, elderly and immuno-compromised individuals, resulting in airway inflammation and exacerbation of chronic diseases like asthma. To understand the molecular pathogenesis of these infections, we searched for cellular targets of the virulence protein C of human parainfluenza virus type 3 (hPIV3-C. We found that hPIV3-C interacts directly through its C-terminal domain with STAT1 and GRB2, whereas C proteins from measles or Nipah viruses failed to do so. Binding to STAT1 explains the previously reported capacity of hPIV3-C to block type I interferon signaling, but the interaction with GRB2 was unexpected. This adaptor protein bridges Epidermal Growth Factor (EGF receptor to MAPK/ERK pathway, a signaling cascade recently found to be involved in airway inflammatory response. We report that either hPIV3 infection or transient expression of hPIV3-C both increase cellular response to EGF, as assessed by Elk1 transactivation and phosphorylation levels of ERK1/2, 40S ribosomal subunit protein S6 and translation initiation factor 4E (eIF4E. Furthermore, inhibition of MAPK/ERK pathway with U0126 prevented viral protein expression in infected cells. Altogether, our data provide molecular basis to explain the role of hPIV3-C as a virulence factor and determinant of pathogenesis and demonstrate that Paramyxoviridae have evolved a single virulence factor to block type I interferon signaling and to boost simultaneous cellular response to growth factors.

  15. Human epidermal growth factor receptor 2 status of gastric cancer patients in Asia: results from a large, multicountry study.

    Science.gov (United States)

    Pathmanathan, Nirmala; Geng, Jing-Shu; Li, Wencai; Nie, Xiu; Veloso, Januario; Wang, John; Hill, Julie; Mccloud, Philip; Bilous, Michael

    2017-06-01

    Current estimates of the human epidermal growth factor receptor 2 (HER2)-positivity rate in gastric cancer vary widely in the literature, and there are limited data from countries in Asia. The primary aim of this study was to conduct a clinical audit of laboratories across seven countries in Asia to determine the incidence of HER2-positive gastric cancer in this region. Pathologists were asked to collect data on patient gender, age, cancer site, specimen type, tumor spread, type and grade, HER2 test results, including protein and/or gene copy enumeration, and final HER2 status on consecutive gastric cancer cases tested for HER2 in their laboratory over a 2-year period. HER2 results from 5,301 gastric cancers were submitted by 50 laboratories. The overall HER2-positivity rate was 9.7% which, after the exclusion of China, increased to 18.1%. The rate between countries ranged from 0% to 23.1%, and from 0% to 50.0% between laboratories. An equivocal HER2 result was recorded in 19.5% of cases. Despite the lack of centralized testing to confirm the accuracy of HER2 diagnoses, the incidence of HER2-positive gastric cancer observed here was comparable to that reported in the literature. Nevertheless, rates were highly variable between countries and laboratories, which suggests a lack of HER2 testing expertise in gastric cancer. Given that the mortality rates for gastric cancer in Eastern Asia are the highest in the world, efforts should focus on improving HER2 testing expertise in the region so that patients receive the appropriate treatment early in their disease. © 2016 The Authors. Asia-Pacific Journal of Clinical Oncology Published by John Wiley & Sons Australia, Ltd.

  16. Relationship between body mass index and the expression of hormone receptors or human epidermal growth factor receptor 2 with respect to breast cancer survival

    International Nuclear Information System (INIS)

    Jeon, Ye Won; Kang, Su Hwan; Park, Min Ho; Lim, Woosung; Cho, Se Heun; Suh, Young Jin

    2015-01-01

    The association between body mass index (BMI) at the time of breast cancer diagnosis and the prognosis of breast cancer patients remains controversial. Furthermore, the association between BMI and prognosis with respect to different breast cancer subtypes is not clearly defined. We analyzed data from 41,021 invasive breast cancer patients between January 1988 and February 2008 from the Korean Breast Cancer Registry (KBCR) database. Overall survival (OS) and breast cancer-specific survival (BCSS) were analyzed using the Kaplan-Meier method and Cox’s proportional hazard regression model among all patients and specific breast cancer subtypes with respect to BMI categories. A U-shaped association between BMI and mortality was observed in the total cohort. Underweight and obese individuals exhibited worse OS (hazard ratio, 1.23 [95 % confidence interval {CI}, 1.05 to 1.44] and 1.29 [1.13 to 1.48], respectively) and BCSS (1.26 [1.03 to 1.54] and 1.21 [1.02 to 1.43], respectively) than normal-weight individuals. In the estrogen receptor (ER) and/or progesterone receptor (PR)+/human epidermal growth factor receptor 2 (HER2) - subgroup, obese individuals exhibited worse OS (1.48 [1.18 to 1.85]) and BCSS (1.31 [1.13 to 1.52]) than normal-weight individuals. Conversely, in the ER and PR-/HER2+ subgroup, underweight individuals exhibited worse OS (1.68 [1.12 to 2.47]) and BCSS (1.79 [1.11 to 2.90]) than normal-weight individuals. We observed a U-shaped relationship between BMI at diagnosis and poor OS and BCSS among all breast cancer patients. However, obesity in the ER and/or PR+/HER2- subgroup and underweight in the ER and PR-/HER2+ subgroup were poor prognostic factors. Therefore, BMI at diagnosis and breast cancer subtype should be considered simultaneously in various treatment decision processes and surveillance schedules

  17. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  18. Epidermal changes following application of 7,12-dimethylbenz(a)anthracene and 12-O-tetradecanoylphorbol-13-acetate to human skin transplanted to nude mice studied with histological species markers

    International Nuclear Information System (INIS)

    Graem, N.

    1986-01-01

    Effects of the tumor initiator 7,12-dimethylbenz(a)anthracene (DMBA) and of the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) on epidermis of human fetal and adult skin were studied in the nude mouse/human skin model. Human skin grafts on NC nude mice were exposed to two topical applications of 1 mg of DMBA in 50 microliter of acetone with an interval of 3 days and/or to applications of 10 micrograms of TPA in 50 microliter of acetone twice weekly. In some animals, it was attempted to augment the susceptibility of the grafts to the tumor-initiating effect of DMBA by pretreatment with TPA or ultraviolet light. The mice were sacrificed 8-32 wk after the initial treatment. Tumors did not appear in the central portions of any of the grafts, but epidermal tumors were seen at the graft border in 34.9% of the DMBA-treated animals. To identify human epidermis on the grafts and to determine the species origin of the induced tumors, two independently working histological marker methods were applied. (a) The first is detection of a human Blood Group B-like antigen present in mouse epidermis and in chemically induced murine epidermal tumors. This antigen cannot be demonstrated in human epidermis and in epidermal tumors of human patients. (b) The second is histological staining with the DNA-specific fluorochrome, bisbenzimide, displaying a characteristic pattern of 5-10 intranuclear fluorescent bodies in murine nonneoplastic epidermal cells and in murine epidermal tumor cells. Such a pattern is not seen in human epidermis and in epidermal tumors of human patients. The studies showed that TPA treatment resulted in epidermal hyperplasia in both the human epidermis and the adjacent mouse epidermis and that the induced tumors were derived from murine tissue

  19. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. INTESTINAL VIROME AND NORMAL MICROFLORA OF HUMAN: FEATURES OF INTERACTION

    Directory of Open Access Journals (Sweden)

    Bobyr V.V.

    2015-05-01

    Full Text Available Summary: Intestinal bacteria defend the host organism and narrow pathogenic bacterial colonization. However, the microbiome effect to enteric viruses is unexplored largely as well as role of microbiota in the pathogenesis of viral infections in general. This review focuses on precisely these issues. Keywords: microbiome, virome, normal microflora, enteric viruses, contagiousness. In this review article, facts about viral persistence in the human gut are summarized. It is described the role of viral populations during health and diseases. After analyzing of the literary facts it was concluded that the gastrointestinal tract is an environment for one from the most complex microbial ecosystems, which requires of more deeper study of its composition, role in physiological processes, as well as the dynamics of changes under influence of the environment. Normal microflora performs a different important functions providing the physiological homeostasis of the human body, including, in particular, an important role in the human metabolic processes, supporting of homeostasis, limiting of colonization by infectious bacteria. The multifactorial significance of the normal gastrointestinal microflora can be divided into immunological, structural and metabolic functions. At the same time, interaction between intestinal microflora and enteric viruses has not been studied largely. In recent years, much attention is paid to study of viruses-bacteria associations, and it is possible, obtained results should change our understanding of microbiota role in the systematic pathogenesis of the diseases with viral etiology. In contrast to the well-known benefits of normal microflora to the host, the viruses can use intestinal microflora as a trigger for replication at the optimal region. Recent studies give a reason for assumption that depletion of normal microflora with antibiotics can determining the antiviral effect. Thus, the role of commensal bacteria in viral

  1. General anesthesia suppresses normal heart rate variability in humans

    Science.gov (United States)

    Matchett, Gerald; Wood, Philip

    2014-06-01

    The human heart normally exhibits robust beat-to-beat heart rate variability (HRV). The loss of this variability is associated with pathology, including disease states such as congestive heart failure (CHF). The effect of general anesthesia on intrinsic HRV is unknown. In this prospective, observational study we enrolled 100 human subjects having elective major surgical procedures under general anesthesia. We recorded continuous heart rate data via continuous electrocardiogram before, during, and after anesthesia, and we assessed HRV of the R-R intervals. We assessed HRV using several common metrics including Detrended Fluctuation Analysis (DFA), Multifractal Analysis, and Multiscale Entropy Analysis. Each of these analyses was done in each of the four clinical phases for each study subject over the course of 24 h: Before anesthesia, during anesthesia, early recovery, and late recovery. On average, we observed a loss of variability on the aforementioned metrics that appeared to correspond to the state of general anesthesia. Following the conclusion of anesthesia, most study subjects appeared to regain their normal HRV, although this did not occur immediately. The resumption of normal HRV was especially delayed on DFA. Qualitatively, the reduction in HRV under anesthesia appears similar to the reduction in HRV observed in CHF. These observations will need to be validated in future studies, and the broader clinical implications of these observations, if any, are unknown.

  2. Super Normal Vector for Human Activity Recognition with Depth Cameras.

    Science.gov (United States)

    Yang, Xiaodong; Tian, YingLi

    2017-05-01

    The advent of cost-effectiveness and easy-operation depth cameras has facilitated a variety of visual recognition tasks including human activity recognition. This paper presents a novel framework for recognizing human activities from video sequences captured by depth cameras. We extend the surface normal to polynormal by assembling local neighboring hypersurface normals from a depth sequence to jointly characterize local motion and shape information. We then propose a general scheme of super normal vector (SNV) to aggregate the low-level polynormals into a discriminative representation, which can be viewed as a simplified version of the Fisher kernel representation. In order to globally capture the spatial layout and temporal order, an adaptive spatio-temporal pyramid is introduced to subdivide a depth video into a set of space-time cells. In the extensive experiments, the proposed approach achieves superior performance to the state-of-the-art methods on the four public benchmark datasets, i.e., MSRAction3D, MSRDailyActivity3D, MSRGesture3D, and MSRActionPairs3D.

  3. Synthetic inhibitors of matrix metalloproteinases prevent sulfur mustard-induced epidermal-dermal separation in human skin pieces

    NARCIS (Netherlands)

    Mol, M.A.E.; Alblas, S.W.; Hammer, A.; Benschop, H.P.

    2000-01-01

    Degradation of proteins of the basement membrane zone (BMZ) in the skin depends on the activity of proteolytic enzymes, particularly those belonging to the group of matrix metalloproteinases (MMPs). In the present study we have investigated the contribution of these enzymes to the epidermal-dermal

  4. Inhibition of Epidermal Growth Factor Receptor and PI3K/Akt Signaling Suppresses Cell Proliferation and Survival through Regulation of Stat3 Activation in Human Cutaneous Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Bito, T.; Sumita, N.; Ashida, M.; Budiyanto, A.; Ueda, M.; Ichihashi, M.; Nishigori, C.; Tokura, Y.; Bito, T.

    2011-01-01

    Recent studies have emphasized the important role of Stat3 activation in a number of human tumors from the viewpoint of its oncogenic and anti apoptotic activity. In this study, we examined the role and related signaling molecules of Stat3 in the carcinogenesis of human cutaneous squamous cell carcinoma (SCC). In 35 human cutaneous SCC samples, 86% showed overexpression of phosphorylated (p)-Stat3, and most of those simultaneously over expressed p-EGFR or p-Akt. Constitutive activation of EGFR and Stat3 was observed in three SCC cell lines and four of five SCC tissues. AG1478, an inhibitor of the EGFR, down regulated Stat3 activation in HSC-1 human SCC cells. AG1478 inhibited cell proliferation and induced apoptosis of HSC-1 cells but did not inhibit the growth of normal human epidermal keratinocytes that did not show Stat3 activation. Furthermore, a PI3K inhibitor also suppressed Stat3 activation in HSC-1 cells to some degree. Combined treatment with the PI3K inhibitor and AG1478 strongly suppressed Stat3 activity and dramatically induced apoptosis of HSC-1 cells. These data suggest that Stat3 activation through EGFR and/or PI3K/Akt activation plays a critical role in the proliferation and survival of human cutaneous SCC.

  5. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    Directory of Open Access Journals (Sweden)

    Boér K

    2016-10-01

    Full Text Available Katalin Boér Department of Medical Oncology, Szent Margit Hospital, Budapest, Hungary Abstract: Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6 inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2-ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant

  6. Human epidermal growth factor receptor 2-positive breast cancer: which cytotoxic agent best complements trastuzumab's efficacy in vitro?

    Directory of Open Access Journals (Sweden)

    Hurrell T

    2013-06-01

    Full Text Available Tracey Hurrell, Kim OuthoffDepartment of Pharmacology, University of Pretoria, Pretoria, South AfricaIntroduction: Despite trastuzumab having enhanced selectivity for human epidermal growth factor receptor 2 (HER-2 overexpressing breast cancer cells, treatment is hampered by interindividual variation and tumors with high mitogenic potential. The lack of significant clinical benefit in certain patient cohorts suggests that HER-2 expression is ineffective as a sole prognostic indicator of response to therapy. Therefore, optimizing the clinical role of trastuzumab in drug combinations remains critical for clinical success.Aim: To investigate the effects of trastuzumab in combination with either doxorubicin or geldanamycin on in vitro cell viability, cell cycling, apoptosis and relative HER-2 expression in HER-2-positive (SK-BR-3 and estrogen receptor-positive (MCF-7 breast adenocarcinoma models.Results: HER-2-rich SK-BR-3 cells demonstrated a greater sensitivity to the effects of doxorubicin than MCF-7 cells. Concurrent trastuzumab exposure resulted in a further reduction in cell viability. This decreased cell viability induced by doxorubicin was associated with activation of executioner caspases as well as with alterations in cell-cycle kinetics, primarily promoting S-phase accumulation. Doxorubicin had no effect on surface HER-2 density expression. Geldanamycin reduced cell viability significantly greater in SK-BR-3 than MCF-7 cells, and was associated with G2 cell-cycle accumulation. The addition of trastuzumab did not augment these effects. Geldanamycin promoted substantial reductions in relative surface HER-2 density in SK-BR-3 cells.Conclusion: The in vitro data supported the rationale for using doxorubicin in trastuzumab-based therapies. Therefore, despite the incidence of cardiotoxicity, doxorubicin could retain a fundamental role in treating HER-2-positive breast cancer. While geldanamycin is a potent cytotoxic agent, its concurrent use

  7. Targeted delivery of polyamidoamine-paclitaxel conjugate functionalized with anti-human epidermal growth factor receptor 2 trastuzumab

    Directory of Open Access Journals (Sweden)

    Ma P

    2015-03-01

    Full Text Available Pengkai Ma,1 Xuemei Zhang,1 Ling Ni,2 Jinming Li,2 Fengpu Zhang,1 Zheng Wang,1 Shengnan Lian,1 Kaoxiang Sun1 1School of Pharmacy, Yantai University, Yantai, Shandong Province, People’s Republic of China; 2State Key Laboratory of Long-acting and Targeting Drug Delivery System, Yantai, Shandong Province, People’s Republic of China Background: Antibody-dendrimer conjugates have the potential to improve the targeting and release of chemotherapeutic drugs at the tumor site while reducing adverse side effects caused by drug accumulation in healthy tissues. In this study, trastuzumab (TMAB, which binds to human epidermal growth factor receptor 2 (HER2, was used as a targeting agent in a TMAB-polyamidoamine (PAMAM conjugate carrying paclitaxel (PTX specifically to cells overexpressing HER2. Methods: TMAB was covalently linked to a PAMAM dendrimer via bifunctional polyethylene glycol (PEG. PTX was conjugated to PAMAM using succinic anhydride as a cross-linker, yielding TMAB-PEG-PAMAM-PTX. Dynamic light scattering and transmission electron microscopy were used to characterize the conjugates. The cellular uptake and in vivo biodistribution were studied by fluorescence microscopy, flow cytometry, and Carestream In Vivo FX, respectively. Results: Nuclear magnetic resonance spectroscopy demonstrated that PEG, PTX, fluorescein isothiocyanate, and cyanine7 were conjugated to PAMAM. Ultraviolet-visible spectroscopy and sodium dodecyl sulfate polyacrylamide gel electrophoresis demonstrated that TMAB was conjugated to PEG-PAMAM. Dynamic light scattering and transmission electron microscopy measurements revealed that the different conjugates ranged in size between 10 and 35 nm and had a spherical shape. In vitro cellular uptake demonstrated that the TMAB-conjugated PAMAM was taken up by HER2-overexpressing BT474 cells more efficiently than MCF-7 cells that expressed lower levels of HER2. Co-localization experiments indicated that TMAB-conjugated PAMAM was

  8. Effects of recombinant human epidermal growth factor on the proliferation and radiation survival of human fibroblast cell lines in vitro

    International Nuclear Information System (INIS)

    Kim, Hyun Sook; Kang, Ki Mun; Na, Jae Boem; Chai, Gyu Young; Lee, Sang Wook

    2006-01-01

    To explore the effect of recombinant human EGF on the proliferation and survival of human fibroblast cell lines following irradiation. Fibroblast was originated human skin and primary cultured. The trypan blue stain assay and MTT assay were used to study the proliferative effects of EGF on human fibroblast cell lines in vitro. An incubation of fibroblasts with rhEGF for 24 hours immediately after irradiation was counted everyday. Cell cycle distributions were analyzed by FACS analysis. Number of fibroblast was significant more increased rhEGF (1.0 nM, 10 nM, 100 nM, 1,000 nM) treated cell than control after 8 Gy irradiation. Most effective dose of rhEGF was at 160 nM. These survival differences were maintained at 1 week later. Proportion of S phase was significantly increased on rhEGF treated cells. rhEGF cause increased fibroblast proliferation following irradiation. We expect that rhEGF was effective for radiation induced wound healing

  9. Ketone body metabolism in normal and diabetic human skeletal muscle

    International Nuclear Information System (INIS)

    Nosadini, R.; Avogaro, A.; Sacca, L.

    1985-01-01

    Although the liver is considered the major source of ketone bodies (KB) in humans, these compounds may also be formed by nonhepatic tissues. To study this aspect further, 3-[ 14 C]hydroxybutyrate (BOH) or [3- 14 C]acetoacetate (AcAc) were constantly infused after a priming dose and contemporaneous arterial and venous samples were taken at splanchnic, heart, kidney, and leg sites in eight normal subjects (N) undergoing diagnostic catheterization and at the forearm site in five normal and six ketotic diabetic (D) subjects. After 70 min of infusion, tracer and tracee levels of AcAc and BOH reached a steady state in the artery and vein in both normal and diabetic subjects. The venous-arterial (V-A) difference at the forearm step for cold KB was negligible both in normal and diabetic subjects, whereas for labeled KB it was approximately 10-fold higher in diabetic subjects (V-A AcAc, -31 +/- 7 and -270 +/- 34 dpm/ml in N and D, respectively; V-A BOH, -38 +/- 6 and -344 +/- 126 dpm/ml in N and D, respectively). The authors assumed that the V-A difference in tracer concentration was consistent with dilution of the tracer by newly synthesized tracee inside the muscle and calculated that the forearm muscle produces KB at a rate of 16.2 +/- 3.3 mumol/min in D and 0.9 +/- 0.9 mumol/min in N. These findings can be accounted for by the hypothesis that the disappearance flux of KB from circulation was replaced by an equivalent flux of KB entering the vein at the muscle step in D but not in N. Moreover, in N KB were not only produced but also utilized by the splanchnic area (39 +/- 9 mumol/min)

  10. Normalization of Deviation: Quotation Error in Human Factors.

    Science.gov (United States)

    Lock, Jordan; Bearman, Chris

    2018-05-01

    Objective The objective of this paper is to examine quotation error in human factors. Background Science progresses through building on the work of previous research. This requires accurate quotation. Quotation error has a number of adverse consequences: loss of credibility, loss of confidence in the journal, and a flawed basis for academic debate and scientific progress. Quotation error has been observed in a number of domains, including marine biology and medicine, but there has been little or no previous study of this form of error in human factors, a domain that specializes in the causes and management of error. Methods A study was conducted examining quotation accuracy of 187 extracts from 118 published articles that cited a control article (Vaughan's 1996 book: The Challenger Launch Decision: Risky Technology, Culture, and Deviance at NASA). Results Of extracts studied, 12.8% ( n = 24) were classed as inaccurate, with 87.2% ( n = 163) being classed as accurate. A second dimension of agreement was examined with 96.3% ( n = 180) agreeing with the control article and only 3.7% ( n = 7) disagreeing. The categories of accuracy and agreement form a two by two matrix. Conclusion Rather than simply blaming individuals for quotation error, systemic factors should also be considered. Vaughan's theory, normalization of deviance, is one systemic theory that can account for quotation error. Application Quotation error is occurring in human factors and should receive more attention. According to Vaughan's theory, the normal everyday systems that promote scholarship may also allow mistakes, mishaps, and quotation error to occur.

  11. Autophagy participates in isoliquiritigenin-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling.

    Science.gov (United States)

    Yang, Zhibo; Zeng, Biyun; Pan, Yi; Huang, Pan; Wang, Chang

    2018-01-01

    Melanin is the pigment responsible for the color of human skin and hair. Melanin serves as a double-edge sword which can exert both protective and spot-causing effects on skin. Although melanin has an important role in protecting the skin against UV damage, an excessive or uneven melanin production can lead to the formation of freckles and age spots. Isoliquiritigenin (ISL) has been reported to inhibit melanin synthesis; however, its role in melanin degradation remains unclear. In the present study, we evaluated the detailed function of ISL in melanin degradation in human epidermal keratinocytes. Since autophagy has been reported to be related to melanin degradation, we also examined the activation of autophagy by ISL treatment in keratinocytes by measurement of autophagy-related proteins, ATG7, LC3 and p62. Moreover, si-ATG7-induced ATG7 knockdown and autophagy inhibitor 3-MA decreased LC3 II protein levels and increased PMEL17, p62 and melanin levels in HaCaT cells, which could be partially reversed by ISL treatment, indicating that autophagy participated in melanin degradation. The decreased p-AKT and p-mTOR proteins upon ISL treatment indicated the involvement of PI3K/AKT/mTOR signaling in ISL-induced melanin degradation. Taken together, we demonstrated that autophagy participates in ISL-induced melanin degradation in human epidermal keratinocytes through PI3K/AKT/mTOR signaling. Copyright © 2017. Published by Elsevier Masson SAS.

  12. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  13. Impedance planimetric description of normal rectoanal motility in humans

    DEFF Research Database (Denmark)

    Andersen, Inge S; Michelsen, Hanne B; Krogh, Klaus

    2007-01-01

    PURPOSE: Manometry and pressure-volume measurements are commonly used to study anorectal physiology. However, the methods are limited by several sources of error. Recently, a new impedance planimetric system has been introduced in a porcine model. It allows simultaneous determination of anorectal...... pressures and multiple rectal luminal cross-sectional areas. This study was designed to study normal human rectoanal motility by means of impedance planimetry with multiple rectal cross-sectional areas and rectal and anal pressure. METHODS: Twelve healthy volunteers (10 females), aged 24 to 53 years, were...... the experiment, the cross-sectional area at all channels showed strong cyclic contractile activity and the anal pressure increased by approximately 100 percent. CONCLUSIONS: The new rectal impedance planimetry system allows highly detailed description of rectoanal motility patterns. It has promise as a new...

  14. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  15. Repair replication in cultured normal and transformed human fibroblasts

    International Nuclear Information System (INIS)

    Smith, C.A.; Hanawalt, P.C.

    1976-01-01

    Repair replication in response to ultraviolet irradiation has been studied in normal human diploid fibroblast cultures, W138, and an SV40 transformant, VA13. Quantitative comparisons have been made using the combined isotopic and density labelling method for assaying repair replication. No significant difference was found in the amount of repair replication performed, its dose response, or the time course between growing and confluent W138 cells, early passage and senescent cells, or normal W138 cells and the transformed VA13 cells. When [ 3 H]dThd was employed as the isotopic label in the presence of a 30-200 fold excess of unlabelled BrdUrd apparent differences in repair replication were seen between W138 cells shortly after subcultivation and cells which had been allowed to reach confluence. These differences were the same over a wide dose range and regardless of the passage number of the cells, but could be influenced by using different serum lots. The differences were not seen, however, when [ 3 H]BrdUrd provided the isotopic label; thus they reflect either impurities in the [ 3 H]dThd or a slight discrimination by some cellular process

  16. Human epidermal growth factor receptor 2/neu overexpression in urothelial carcinoma of the bladder and its prognostic significance: Is it worth hype?

    Directory of Open Access Journals (Sweden)

    Santosh Kumar

    2015-01-01

    Full Text Available Aims: In urothelial tumors of the urinary bladder, human epidermal growth factor receptor 2 (HER-2/neu expression has been reported over 10 years, but there is no clear correlation between prognosis and recurrence rate. The present study evaluates prognostic implication of HER-2/neu expression. Subjects and Methods: In this study, 100 formalin-fixed paraffin-embedded specimens of primary transitional cell carcinoma of the bladder were processed. HER-2/neu monoclonal antibody immunohistochemistry staining procedure used for the study. Results: A total of 70 (70% patients were positive for overexpression of HER-2/neu. HER-2/neu was positive in patients with 42 (70% superficial tumor, 28 (70% muscle invasive tumor, 41 (75.9% high-grade tumor, 29 (63% low grade tumor, 31 (68.9% recurrent tumor, and 6 (66.6% had positive lymph nodes. Conclusions: Human epidermal growth factor receptor 2/neu over expression was not correlated with the tumor stage, lymphnode metastasis or recurrence of the disease. HER-2/neu overexpression was statistically insignificantly correlated with the differentiation grade (P < 0.161 as compared to previous studies. Future studies on HER-2 expression with chemo-sensitivity and efficacy of HER-2-targeted therapies in urothelial carcinomas is needed.

  17. Effect of dioxin on normal and leukemic human hematopoietic cells

    Energy Technology Data Exchange (ETDEWEB)

    Lambertenghi-Deliliers, G.; Soligo, D. [Univ. degli Studi, Milan (Italy). Dipt. die Ematologia, Ospedale Maggiore Policlinico IRCCS; Fracchiolla, N.S. [Ospedale Maggiore Policlinico IRCCS, Milan (Italy). Dipt. di Ematologia; Servida, F. [Fondazione Matarelli, Milan (Italy); Bertazzi, P.A. [Istituti Clinici di Perfezionamento, Milan (Italy). Dipt. di Medicina del Lavoro

    2004-09-15

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) arises from chlorination of phenolic substrates or from partial combustion of organic materials in the presence of chlorine sources. TCDD has a large number of biological effects such as long-lasting skin disease, cardiovascular disease, diabete and cancer. TCDD is the prototypical agonist of the aryl hydrocarbon receptor (AhR), a member of the erb-A family that also includes the receptors for steroids, thyroid hormones, peroxisome proliferators and retinoids. When bound to dioxin, the AhR can bind to DNA and alter the expression of some genes including cytokines and growth factors. In this study, we analyzed the effect of escalating doses of TCDD on human CD34{sup +} progenitor cells from the leukapheresis of normal donors stimulated with G-CSF as well as the human myeloid leukemic cell lines HL60 (promyelocytic leukemia) and K562 (chronic myelogenous leukemia). The possible specific modulation of gene expression induced by the TCDD exposure was then tested by means of microarray analyses.

  18. Differential Intracochlear Sound Pressure Measurements in Normal Human Temporal Bones

    Science.gov (United States)

    Nakajima, Hideko Heidi; Dong, Wei; Olson, Elizabeth S.; Merchant, Saumil N.; Ravicz, Michael E.; Rosowski, John J.

    2009-02-01

    We present the first simultaneous sound pressure measurements in scala vestibuli and scala tympani of the cochlea in human cadaveric temporal bones. Micro-scale fiberoptic pressure sensors enabled the study of differential sound pressure at the cochlear base. This differential pressure is the input to the cochlear partition, driving cochlear waves and auditory transduction. Results showed that: pressure of scala vestibuli was much greater than scala tympani except at low and high frequencies where scala tympani pressure affects the input to the cochlea; the differential pressure proved to be an excellent measure of normal ossicular transduction of sound (shown to decrease 30-50 dB with ossicular disarticulation, whereas the individual scala pressures were significantly affected by non-ossicular conduction of sound at high frequencies); the middle-ear gain and differential pressure were generally bandpass in frequency dependence; and the middle-ear delay in the human was over twice that of the gerbil. Concurrent stapes velocity measurements allowed determination of the differential impedance across the partition and round-window impedance. The differential impedance was generally resistive, while the round-window impedance was consistent with a compliance in conjunction with distributed inertia and damping. Our techniques can be used to study inner-ear conductive pathologies (e.g., semicircular dehiscence), as well as non-ossicular cochlear stimulation (e.g., round-window stimulation) - situations that cannot be completely quantified by measurements of stapes velocity or scala-vestibuli pressure by themselves.

  19. Functional imaging of human epidermal growth factor receptor 2-positive metastatic breast cancer using (64)Cu-DOTA-trastuzumab PET.

    Science.gov (United States)

    Mortimer, Joanne E; Bading, James R; Colcher, David M; Conti, Peter S; Frankel, Paul H; Carroll, Mary I; Tong, Shan; Poku, Erasmus; Miles, Joshua K; Shively, John E; Raubitschek, Andrew A

    2014-01-01

    Women with human epidermal growth factor receptor 2 (HER2)-positive breast cancer are candidates for treatment with the anti-HER2 antibody trastuzumab. Assessment of HER2 status in recurrent disease is usually made by core needle biopsy of a single lesion, which may not represent the larger tumor mass or other sites of disease. Our long-range goal is to develop PET of radiolabeled trastuzumab for systemically assessing tumor HER2 expression and identifying appropriate use of anti-HER2 therapies. The purpose of this study was to evaluate PET/CT of (64)Cu-DOTA-trastuzumab for detecting and measuring tumor uptake of trastuzumab in patients with HER2-positive metastatic breast cancer. Eight women with biopsy-confirmed HER2-positive metastatic breast cancer and no anti-HER2 therapy for 4 mo or longer underwent complete staging, including (18)F-FDG PET/CT. For 6 of the 8 patients, (64)Cu-DOTA-trastuzumab injection (364-512 MBq, 5 mg of trastuzumab) was preceded by trastuzumab infusion (45 mg). PET/CT (PET scan duration 1 h) was performed 21-25 (day 1) and 47-49 (day 2) h after (64)Cu-DOTA-trastuzumab injection. Scan fields of view were chosen on the basis of (18)F-FDG PET/CT. Tumor detection sensitivity and uptake analyses were limited to lesions identifiable on CT; lesions visualized relative to adjacent tissue on PET were considered PET-positive. Radiolabel uptake in prominent lesions was measured as maximum single-voxel standardized uptake value (SUVmax). Liver uptake of (64)Cu was reduced approximately 75% with the 45-mg trastuzumab predose, without significant effect on tumor uptake. The study included 89 CT-positive lesions. Detection sensitivity was 77%, 89%, and 93% for day 1, day 2, and (18)F-FDG, respectively. On average, tumor uptake was similar for (64)Cu-DOTA-trastuzumab and (18)F-FDG (SUVmax and range, 8.1 and 3.0-22.5 for day 1 [n = 48]; 8.9 and 0.9-28.9 for day 2 [n = 38]; 9.7 and 3.3-25.4 for (18)F-FDG [n = 56]), but same-lesion SUVmax was not correlated

  20. Reference man models based on normal data from human populations

    International Nuclear Information System (INIS)

    Tanaka, Gi-ichiro; Kawamura, Hisao

    2000-01-01

    Quantitative description of the physical, and metabolic parameters of the human body is the very basic for internal dosimetry. Compilation of anatomical and other types of data Asian populations for internal (and external) dosimetry is of grate significance because of the potential spread of nuclear energy use in the Asian region and the major contribution of the region to the world population (about 58%). It has been observed that some differences exist for habitat, race, body sizes and pattern of food consumption. In the early stage of revision of ICRP Reference man by the Task Group, Characteristics of the human body of non-European populations received considerable attention as well as those of the European populations of different sexes and ages. In this context, an IAEA-RCA Co-ordinated Research Program on Compilation of Anatomical, Physiological and Metabolic Characteristics for a Reference Asian Man endorsed. In later stages of reference Man revision, anatomical data for Asians was discusses together with those of European populations, presumably due to ICRP's decision of unanimous use of the Reference Man for radiation protection. Reference man models for adults and 15, 10, 5, 1, 0 year-old males and females of Asian populations were developed for use in internal and external dosimetry. Based on the concept of ICRP Reference Man (Publication 23), the reference values were derived from the normal organ mass data for Japanese and statistical data on the physique and nutrition of Japanese and Chinese. Also incorporated were variations in physical measurements, as observed in the above mentioned IAEA-RCA Co-ordinated Research Program. The work was partly carried out within the activities of the ICRP Task Group on Reference Man. The weight of the skeleton was adjusted following the revised values in Publication 70. This paper will report basic shared and non-shared characteristics of Reference Man' for Asians and ICRP Reference Man. (author)

  1. Reproducibility of P-31 spectroscopic imaging of normal human myocardium

    International Nuclear Information System (INIS)

    Tavares, N.J.; Chew, W.; Auffermann, W.; Higgins, C.B.

    1988-01-01

    To assess reproducibility of P-31 MR spectroscopy of human myocardium, ten normal male volunteers were studied on two separate occasions. Spectra were acquired on a clinical 1.5-T MR imaging unit (Signa, General Electric) using a one-dimensional gated spectroscopic imaging sequence (matrix size, 32 X 256) over 20 minutes. Peaks in the adenosine triphosphate (ATP) region, phosphocreatine (PCR), phosphodiesters (PD), and peaks attributable to 2,3 diphosphoglycerate from blood were observed. Interindividual and intraindividual variability expressed as standard errors of the mean (mean +- SEM) were 1.54 +- 0.04 (variability among subjects) and 0.04 (variability between first and second studies) for PCR/β ATP; 0.97 +- 0.18 and 0.06 for PD/β ATP; and 0.62 +- 0.10 and 0.05 for PD/PCR, respectively. In conclusion, P-31 MR spectroscopy yields consistent and reproducible myocardial spectra that might be useful in the future for the evaluation and monitoring of cardiac disease

  2. Mechanical compression attenuates normal human bronchial epithelial wound healing

    Directory of Open Access Journals (Sweden)

    Malavia Nikita

    2009-02-01

    Full Text Available Abstract Background Airway narrowing associated with chronic asthma results in the transmission of injurious compressive forces to the bronchial epithelium and promotes the release of pro-inflammatory mediators and the denudation of the bronchial epithelium. While the individual effects of compression or denudation are well characterized, there is no data to elucidate how these cells respond to the application of mechanical compression in the presence of a compromised epithelial layer. Methods Accordingly, differentiated normal human bronchial epithelial cells were exposed to one of four conditions: 1 unperturbed control cells, 2 single scrape wound only, 3 static compression (6 hours of 30 cmH2O, and 4 6 hours of static compression after a scrape wound. Following treatment, wound closure rate was recorded, media was assayed for mediator content and the cytoskeletal network was fluorescently labeled. Results We found that mechanical compression and scrape injury increase TGF-β2 and endothelin-1 secretion, while EGF content in the media is attenuated with both injury modes. The application of compression after a pre-existing scrape wound augmented these observations, and also decreased PGE2 media content. Compression stimulated depolymerization of the actin cytoskeleton and significantly attenuated wound healing. Closure rate was partially restored with the addition of exogenous PGE2, but not EGF. Conclusion Our results suggest that mechanical compression reduces the capacity of the bronchial epithelium to close wounds, and is, in part, mediated by PGE2 and a compromised cytoskeleton.

  3. Zinc in human prostate gland. Normal, hyperplastic and cancerous

    International Nuclear Information System (INIS)

    Zaichick, V.Ye.; Sviridova, T.V.; Zaichick, S.V.

    1997-01-01

    Zinc concentration in a prostate gland is much higher than that in other human tissues. Data about zinc changes for different prostate diseases are limited and greatly contradictory. Zinc content was determined for biopsy and resected materials of transrectal puncture tissues from benign prostate hyperplasia (BPH) and prostate cancer. There were 109 patients (50 BPH and 59 cancer) available for the present study. Control group consisted of 37 intact glands of men died an unexpected death (accident, murder, acute cardiac insufficiency, etc.). All materials studied were divided into two parts. One of them was morphologically examined, while another one was subjected to zinc analysis by INAA. Zinc contents (M ± SE) of normal, benign hyperplastic and cancerous prostate glands were found to be 1018 ± 124, 1142 ± 77, and 146 ± 10 μg/g dry tissue, respectively. It was shown that zinc assessments in the materials of transrectal puncture biopsy of indurated prostate sites can be used as an additional test for differential diagnostics of BPH and cancer. Accuracy, sensitivity and specificity of the test are 98 ± 2%. (author)

  4. Progesterone Upregulates Gene Expression in Normal Human Thyroid Follicular Cells

    Directory of Open Access Journals (Sweden)

    Ana Paula Santin Bertoni

    2015-01-01

    Full Text Available Thyroid cancer and thyroid nodules are more prevalent in women than men, so female sex hormones may have an etiological role in these conditions. There are no data about direct effects of progesterone on thyroid cells, so the aim of the present study was to evaluate progesterone effects in the sodium-iodide symporter NIS, thyroglobulin TG, thyroperoxidase TPO, and KI-67 genes expression, in normal thyroid follicular cells, derived from human tissue. NIS, TG, TPO, and KI-67 mRNA expression increased significantly after TSH 20 μUI/mL, respectively: 2.08 times, P<0.0001; 2.39 times, P=0.01; 1.58 times, P=0.0003; and 1.87 times, P<0.0001. In thyroid cells treated with 20 μUI/mL TSH plus 10 nM progesterone, RNA expression of NIS, TG, and KI-67 genes increased, respectively: 1.78 times, P<0.0001; 1.75 times, P=0.037; and 1.95 times, P<0.0001, and TPO mRNA expression also increased, though not significantly (1.77 times, P=0.069. These effects were abolished by mifepristone, an antagonist of progesterone receptor, suggesting that genes involved in thyroid cell function and proliferation are upregulated by progesterone. This work provides evidence that progesterone has a direct effect on thyroid cells, upregulating genes involved in thyroid function and growth.

  5. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  7. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture

    International Nuclear Information System (INIS)

    Yoshito, Daniele

    2011-01-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  8. Antisense imaging of epidermal growth factor-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 human breast cancer xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Judy; Chen, Paul; Mrkobrada, Marko [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Hu, Meiduo [Leslie Dan Faculty of Pharmacy, University of Toronto, 19 Russell Street, M5S 2S2, Toronto, Ontario (Canada); Department of Pharmaceutical Sciences, University of Toronto, Toronto, Ontario (Canada); Vallis, Katherine A. [Department of Radiation Oncology, Princess Margaret Hospital, University Health Network, 610 University Avenue, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Department of Medical Biophysics, University of Toronto, Toronto, Ontario (Canada); Reilly, Raymond M. [Department of Medical Imaging, University of Toronto, Toronto, Ontario (Canada)

    2003-09-01

    Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21{sup WAF-1/CIP-1}, a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21{sup WAF-1/CIP-1} gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with {sup 111}In. The known induction of the p21{sup WAF-1/CIP-1} gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 nM) increased the ratio of p21{sup WAF-1/CIP-1} mRNA/{beta}-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21{sup WAF-1/CIP-1} protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 {mu}M. There was a fourfold lower inhibition of p21{sup WAF-1/CIP-1} protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 {mu}g/day x 3 days) were employed to induce p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21{sup WAF-1/CIP-1} mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21{sup WAF-1/CIP-1} gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of {sup 111}In-labeled antisense ODNs (3.7 MBq; 2 {mu}g). Tumors displaying basal levels of p21{sup WAF-1/CIP-1} gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor

  9. Structure and function of the Juxta membrane domain of the human epidermal growth factor receptor by NMR spectroscopy

    International Nuclear Information System (INIS)

    Choowongkomon, Kiattawee; Carlin, Cathleen; Sonnichsen, Frank D.

    2005-10-01

    The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family involved in the regulation of cellular proliferation and differentiation. Its juxta membrane domain (JX), the region located between the transmembrane and kinase domains, plays important roles in receptor trafficking since both basolateral sorting in polarized epithelial cells and lysosomal sorting signals are identified in this region. In order to understand the regulation of these signals, we characterized the structural properties of recombinant JX domain in dodecyl phosphocholine detergent (DPC) by nuclear magnetic resonance (NMR) spectroscopy. In DPC micelles, structures derived from NMR data showed three amphipathic, helical segments. Two equivalent average structural models on the surface of micelles were obtained that differ only in the relative orientation between the first and second helices. Our data suggests that the activity of sorting signals may be regulated by their membrane association and restricted accessibility in the intact receptor

  10. The biological activity of the human epidermal growth factor receptor is positively regulated by its C-terminal tyrosines

    DEFF Research Database (Denmark)

    Helin, K; Velu, T; Martin, P

    1991-01-01

    mutants in the full length receptor. EGF-dependent transforming ability of the single point mutants is similar to that of the wild type, while that of double mutants is decreased and an even lower activity is present in the triple mutant. In each bioassay, including EGF-dependent focal transformation...... biologically. The EGF-R kinase activity is affected by tyrosine substitution since in vitro phosphorylation of exogenous substrates is reduced in the double and triple mutants. Autophosphorylation, in vivo and in vitro, is also reduced, but not totally abolished in the triple point mutant and Dc123 indicating......The epidermal growth factor receptor (EGF-R) C-terminus contains three conserved tyrosines (Y-1068, Y-1148, Y-1173) which are phosphorylated upon EGF activation. To clarify the functional role of these tyrosines, each has been mutated to phenylalanine and studied as single, double and triple...

  11. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  12. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  13. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    International Nuclear Information System (INIS)

    Gradishar, William J

    2016-01-01

    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

  14. Establishment and characterization of a new cell line, FPS-1, derived from human undifferentiated pleomorphic sarcoma, overexpressing epidermal growth factor receptor and cyclooxygenase-2.

    Science.gov (United States)

    Hakozaki, Michiyuki; Hojo, Hiroshi; Sato, Michiko; Tajino, Takahiro; Yamada, Hitoshi; Kikuchi, Shinichi; Abe, Masafumi

    2006-01-01

    Undifferentiated pleomorphic sarcoma (UPS) is among the most common soft tissue sarcomas in adults. In order to improve its aggressive course or prognosis and establish new therapeutic methods, molecular genetic and biological characterizations of UPS are required. A new human UPS cell line (FPS-1) was established from UPS of the upper arm of a 79-year-old man. The cell line has been maintained for over 14 months with more than 60 passages. FPS-1 cells were characterized using molecular biological methods. FPS-1 cells showed the same morphological and immunophenotypical characteristics as the primary tumor. Cytogenetic and molecular analyses revealed a nonsense mutation in exon 6 of the p53 gene. Epidermal growth factor receptor (EGFR) and cyclooxygenase-2 (COX-2) were expressed in FPS-1 cells. FPS-1 cells might be useful for investigating biological behavior and developing new molecular targeting antitumor drugs for UPS with EGFR or COX-2 expression.

  15. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    International Nuclear Information System (INIS)

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.

    2007-01-01

    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile

  16. Trastuzumab beyond progression in human epidermal growth factor receptor 2-positive advanced breast cancer: a german breast group 26/breast international group 03-05 study

    DEFF Research Database (Denmark)

    von Minckwitz, Gunter; du Bois, Andreas; Schmidt, Marcus

    2009-01-01

    PURPOSE: Trastuzumab shows clinical activity in human epidermal growth factor receptor 2 (HER-2)-positive early and advanced breast cancer. In the German Breast Group 26/Breast International Group 03-05 trial, we investigated if trastuzumab treatment should be continued beyond progression. METHODS......: Patients with HER-2-positive breast cancer that progresses during treatment with trastuzumab were randomly assigned to receive capecitabine (2,500 mg/m(2) body-surface area on days 1 through 14 [1,250 mg/m(2) semi-daily]) alone or with continuation of trastuzumab (6 mg/kg body weight) in 3-week cycles....... The primary end point was time to progression. RESULTS: We randomly assigned 78 patients to capecitabine and 78 patients to capecitabine plus trastuzumab. Sixty-five events and 38 deaths in the capecitabine group and 62 events and 33 deaths in the capecitabine-plus-trastuzumab group occurred during 15...

  17. Prognostic significance of equivocal human epidermal growth factor receptor 2 results and clinical utility of alternative chromosome 17 genes in patients with invasive breast cancer: A cohort study.

    Science.gov (United States)

    Sneige, Nour; Hess, Kenneth R; Multani, Asha S; Gong, Yun; Ibrahim, Nuhad K

    2017-04-01

    The 2013 testing guidelines for determining the human epidermal growth factor receptor 2 (HER2) status include new cutoff points for the HER2/chromosome enumeration probe 17 (CEP17) ratio and the average HER2 copy number per cell, and they recommend using a reflex test with alternative chromosome 17 probes (Ch17Ps) to resolve equivocal HER2 results. This study sought to determine the clinical utility of alternative Ch17Ps in equivocal cases and the effects of equivocal results and/or a change in the HER2 status on patients' outcomes. The University of Texas MD Anderson Cancer Center database of HER2 dual-probe fluorescence in situ hybridization results from 2000 to 2010 was searched for cases of invasive breast cancer with HER2/CEP17 ratios Cancer 2017;123:1115-1123. © 2016 American Cancer Society. © 2016 American Cancer Society.

  18. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  19. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  20. Gemcitabine Plus Docetaxel Versus Docetaxel in Patients With Predominantly Human Epidermal Growth Factor Receptor 2-Negative Locally Advanced or Metastatic Breast Cancer: A Randomized, Phase III Study by the Danish Breast Cancer Cooperative Group

    DEFF Research Database (Denmark)

    Nielsen, Dorte L; Bjerre, Karsten D; Jakobsen, Erik H

    2011-01-01

    PURPOSE The objective of this phase III study was to compare the efficacy of gemcitabine plus docetaxel (GD) versus docetaxel in patients with advanced breast cancer. PATIENTS AND METHODS Predominantly human epidermal growth factor receptor 2 (HER2) -negative patients were randomly assigned...

  1. Survival of human osteosarcoma cells and normal human fibroblasts following alpha particle irradiation

    International Nuclear Information System (INIS)

    Lloyd, E.L.; Gemmell, M.A.

    1981-01-01

    Cell survival of human osteosarcoma cells in culture following alpha particle irradiation is reported here for the first time. The osteosarcoma cell line (TE-85) is found to be less sensitive to inactivation by 5.6 MeV alpha particles (LET 86 keV/μm) than normal diploid human fibroblasts (NFS). Values for the mean lethal doses were estimated to be 103 rads for the TE-85 cells compared with 68 rads for the NFS cultures irradiated under identical conditions. It is postulated that the aneuploidy of the tumor cells with increased DNA chromosomal material may confer a selective advantage for the survival of tumor cells relative to normal cells with diploid chromosomes

  2. Quantitative proteome profiling of normal human circulating microparticles

    DEFF Research Database (Denmark)

    Østergaard, Ole; Nielsen, Christoffer T; Iversen, Line V

    2012-01-01

    Circulating microparticles (MPs) are produced as part of normal physiology. Their numbers, origin, and composition change in pathology. Despite this, the normal MP proteome has not yet been characterized with standardized high-resolution methods. We here quantitatively profile the normal MP...... proteome using nano-LC-MS/MS on an LTQ-Orbitrap with optimized sample collection, preparation, and analysis of 12 different normal samples. Analytical and procedural variation were estimated in triply processed samples analyzed in triplicate from two different donors. Label-free quantitation was validated...... by the correlation of cytoskeletal protein intensities with MP numbers obtained by flow cytometry. Finally, the validity of using pooled samples was evaluated using overlap protein identification numbers and multivariate data analysis. Using conservative parameters, 536 different unique proteins were quantitated...

  3. Herceptin Enhances the Antitumor Effect of Natural Killer Cells on Breast Cancer Cells Expressing Human Epidermal Growth Factor Receptor-2

    Directory of Open Access Journals (Sweden)

    Xiao Tian

    2017-10-01

    Full Text Available Optimal adoptive cell therapy (ACT should contribute to effective cancer treatment. The unique ability of natural killer (NK cells to kill cancer cells independent of major histocompatibility requirement makes them suitable as ACT tools. Herceptin, an antihuman epidermal growth factor receptor-2 (anti-HER2 monoclonal antibody, is used to treat HER2+ breast cancer. However, it has limited effectiveness and possible severe cardiotoxicity. Given that Herceptin may increase the cytotoxicity of lymphocytes, we explored the possible augmentation of NK cell cytotoxicity against HER2+ breast cancer cells by Herceptin. We demonstrated that Herceptin could interact with CD16 on NK cells to expand the cytotoxic NK (specifically, CD56dim cell population. Additionally, Herceptin increased NK cell migration and cytotoxicity against HER2+ breast cancer cells. In a pilot study, Herceptin-treated NK cells shrunk lung nodular metastasis in a woman with HER2+ breast cancer who could not tolerate the cardiotoxic side effects of Herceptin. Our findings support the therapeutic potential of Herceptin-treated NK cells in patients with HER2+ and Herceptin-intolerant breast cancer.

  4. Ultra-weak photon emission as a non-invasive tool for monitoring of oxidative processes in the epidermal cells of human skin: comparative study on the dorsal and the palm side of the hand.

    Science.gov (United States)

    Rastogi, Anshu; Pospísil, Pavel

    2010-08-01

    All living organisms emit spontaneous ultra-weak photon emission as a result of cellular metabolic processes. Exposure of living organisms to exogenous factors results in oxidative processes and enhancement in ultra-weak photon emission. Here, hydrogen peroxide (H(2)O(2)), as a strongly oxidizing molecule, was used to induce oxidative processes and enhance ultra-weak photon emission in human hand skin. The presented work intends to compare both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the dorsal and the palm side of the hand. A highly sensitive photomultiplier tube and a charge-coupled device camera were used to detect ultra-weak photon emission from human hand skin. Spontaneous ultra-weak photon emission from the epidermal cells on the dorsal side of the hand was 4 counts/s. Topical application of 500 mM H(2)O(2) to the dorsal side of the hand caused enhancement in ultra-weak photon emission to 40 counts/s. Interestingly, both spontaneous and peroxide-induced ultra-weak photon emission from the epidermal cells on the palm side of the hand were observed to increase twice their values, i.e. 8 and 80 counts/s, respectively. Similarly, the two-dimensional image of ultra-weak photon emission observed after topical application of H(2)O(2) to human skin reveals that photon emission from the palm side exceeds the photon emission from the dorsal side of the hand. The results presented indicate that the ultra-weak photon emission originating from the epidermal cells on the dorsal and the palm side of the hand is related to the histological structure of the human hand skin. Ultra-weak photon emission is shown as a non-destructive technique for monitoring of oxidative processes in the epidermal cells of the human hand skin and as a diagnostic tool for skin diseases.

  5. VEGF, FGF-2 and TGFβ expression in the normal and regenerating epidermis of geckos: implications for epidermal homeostasis and wound healing in reptiles.

    Science.gov (United States)

    Subramaniam, Noeline; Petrik, James J; Vickaryous, Matthew K

    2018-05-01

    The skin is a bilayered organ that serves as a key barrier between an organism and its environment. In addition to protecting against microbial invasion, physical trauma and environmental damage, skin participates in maintaining homeostasis. Skin is also capable of spontaneous self-repair following injury. These functions are mediated by numerous pleiotrophic growth factors, including members of the vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and transforming growth factor β (TGFβ) families. Although growth factor expression has been well documented in mammals, particularly during wound healing, for groups such as reptiles less is known. Here, we investigate the spatio-temporal pattern of expression of multiple growth factors in normal skin and following a full-thickness cutaneous injury in the representative lizard Eublepharis macularius, the leopard gecko. Unlike mammals, leopard geckos can heal cutaneous wounds without scarring. We demonstrate that before, during and after injury, keratinocytes of the epidermis express a diverse panel of growth factor ligands and receptors, including: VEGF, VEGFR1, VEGFR2, and phosphorylated VEGFR2; FGF-2 and FGFR1; and phosphorylated SMAD2, TGFβ1, and activin βA. Unexpectedly, only the tyrosine kinase receptors VEGFR1 and FGFR1 were dynamically expressed, and only during the earliest phases of re-epithelization; otherwise all the proteins of interest were constitutively present. We propose that the ubiquitous pattern of growth factor expression by keratinocytes is associated with various roles during tissue homeostasis, including protection against ultraviolet photodamage and coordinated body-wide skin shedding. © 2018 Anatomical Society.

  6. Differences in otosclerotic and normal human stapedial osteoblast properties are normalized by alendronate in vitro.

    Science.gov (United States)

    Gronowicz, Gloria; Richardson, Yvonne L; Flynn, John; Kveton, John; Eisen, Marc; Leonard, Gerald; Aronow, Michael; Rodner, Craig; Parham, Kourosh

    2014-10-01

    Identify and compare phenotypic properties of osteoblasts from patients with otosclerosis (OSO), normal bones (HOB), and normal stapes (NSO) to determine a possible cause for OSO hypermineralization and assess any effects of the bisphosphonate, alendronate. OSO (n = 11), NSO (n = 4), and HOB (n = 13) cultures were assayed for proliferation, adhesion, mineralization, and gene expression with and without 10(-10)M-10(-8)M alendronate. Academic hospital. Cultures were matched for age, sex, and passage number. Cell attachment and proliferation + alendronate were determined by Coulter counting cells and assaying tritiated thymidine uptake, respectively. At 7, 14, and 21 days of culture + alendronate, calcium content and gene expression by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) were determined. OSO had significantly more cells adhere but less proliferation than NSO or HOB. Calcification was significantly increased in OSO compared to HOB and NSO. NSO and HOB had similar cell adhesion and proliferation rates. A dose-dependent effect of alendronate on OSO adhesion, proliferation, and mineralization was found, resulting in levels equal to NSO and HOB. All cultures expressed osteoblast-specific genes such as RUNX2, alkaline phosphatase, type I collagen, and osteocalcin. However, osteopontin was dramatically reduced, 9.4-fold at 14 days, in OSO compared to NSO. Receptor activator of nuclear factor κB ligand/osteoprotegerin (RANKL/OPG), important in bone resorption, was elevated in OSO with decreased levels of OPG levels. Alendronate had little effect on gene expression in HOB but in OSO increased osteopontin levels and decreased RANKL/OPG. OSO cultures displayed properties of hypermineralization due to decreased osteopontin (OPN) and also had increased RANKL/OPG, which were normalized by alendronate. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2014.

  7. Gene expression signatures affected by ethanol and/or nicotine in normal human normal oral keratinocytes (NHOKs

    Directory of Open Access Journals (Sweden)

    Jeffrey J. Kim

    2014-12-01

    Full Text Available It has been reported that nicotine/alcohol alters epigenetic control and leads to abrogated DNA methylation and histone modifications, which could subsequently perturb transcriptional regulation critically important in cellular transformation. The aim of this study is to determine the molecular mechanisms of nicotine/alcohol-induced epigenetic alterations and their mechanistic roles in transcriptional regulation in human adult stem cells. We hypothesized that nicotine/alcohol induces deregulation of epigenetic machinery and leads to epigenetic alterations, which subsequently affect transcriptional regulation in oral epithelial stem cells. As an initiating step we have profiled transcriptomic alterations induced by the combinatory administration of EtOH and nicotine in primary normal human oral keratinocytes. Here we provide detailed experimental methods, analysis and information associated with our data deposited into Gene Expression Omnibus (GEO under GSE57634. Our data provide comprehensive transcriptomic map describing molecular changes induced by EtOH and nicotine on normal human oral keratinocytes.

  8. Analysis of epidermal lipids in normal and atopic dogs, before and after administration of an oral omega-6/omega-3 fatty acid feed supplement. A pilot study.

    Science.gov (United States)

    Popa, Iuliana; Pin, Didier; Remoué, Noëlle; Remoué, Nathalie; Osta, Bilal; Callejon, Sylvie; Videmont, Emilie; Gatto, Hugues; Portoukalian, Jacques; Haftek, Marek

    2011-12-01

    Alterations of the lipid expression in the skin of human and canine atopic subjects may be one of the key factors in the disease development. We have analyzed the ultrastructure of the clinically uninvolved skin of atopic dogs and compared it with the lipid composition of their tape-stripped stratum corneum (SC). The effect of a 2 month treatment of atopic dogs by food supplementation with a mixture of essential fatty acids was evaluated on skin samples taken before and after the treatment period. Electron microscopy revealed that the non-lesional skin of atopic dogs exhibited an abnormal and largely incomplete structure of the lamellar lipids with little cohesion between the corneocyte strata. The SC of atopic dogs was characterized by a significant decrease in the lipid content when compared to the healthy controls. Following oral supplementation with the mixture of essential fatty acids, the overall lipid content of the SC markedly increased. This feature was observed both with the free and, most importantly, with the protein-bound lipids (cholesterol, fatty acids and ceramides), the latter constituting the corneocyte-bound scaffold for ordinate organisation of the extracellular lipid bi-layers. Indeed, the semi-quantitative electron microscopy study revealed that the treatment resulted in a significantly improved organization of the lamellar lipids in the lower SC, comparable to that of the healthy dogs. Our results indicate the potential interest of long-term alimentary supplementation with omega-6 and omega-3 essential fatty acids in canine atopic dermatitis.

  9. Measurement of human normal tissue and tumour responses

    International Nuclear Information System (INIS)

    Ross, G.; Yarnold, J.R.

    1988-01-01

    The scarcity of quantitative measures of normal tissue damage and tumour response in patients undergoing radiotherapy is an obstacle to the clinical evaluation of new treatment strategies. Retrospective studies of complications in critical normal tissues taught important lessons in the past concerning the potential dangers of hypofractionation. However, it is unethical to use serious complications as planned end-points in prospective studies. This paper reviews the desirable characteristics of clinical end-points required to compare alternative treatments employing radiotherapy, with emphasis on simple scales applied by clinicians or even the patients themselves

  10. Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

    Science.gov (United States)

    Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

    2012-05-01

    Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

  11. Human papillomavirus in normal cervical smears from Cape Town ...

    African Journals Online (AJOL)

    The types of HPV found in normal cervical tissue from Cape Town did not differ significantly from those found elsewhere in the world. Nine per cent (17/192) were positive for 'high-risk' HPV types which are associated with premalignant and malignant cervical lesions. In the age group 20 - 39 years, 15 of 92 (16%) were ...

  12. Biodistribution of 99mTc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando

    1999-01-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG 1 ), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 μg/100 μCi of 99m Tc-labeled MAbs. Immunoreactivity of 99m Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 ± 2.08 %ID/g) and tumor (3.903 ± 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 ± 0.50 %ID/g and 2.19 ± 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the 99m Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued

  13. Biodistribution of {sup 99m}Tc-labeled anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody h-R3 in a xenograft model of human lung adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Morales, Alejo; Duconge, Jorge; Caballero-Torres, Idania; Nunez-Gandolff, Gilda; Fernandez, Eduardo; Iznaga-Escobar, Normando E-mail: normando@ict.cim.sld.cu

    1999-04-01

    The anti-human epidermal growth factor receptor (EGF-R) humanized monoclonal antibody (MAb) h-R3 is an (IgG{sub 1}), which binds to an extracellular domain of EGF-R. It was used to evaluate the biodistribution on nude mice xenografted with H-125 human lung adenocarcinoma cell line. Results were compared with its murine version of the MAb ior-egf/r3. Twenty-one athymic female 4NMRI nu/nu mice were injected intraperitoneally with 10 {mu}g/100 {mu}Ci of {sup 99m}Tc-labeled MAbs. Immunoreactivity of {sup 99m}Tc-labeled MAbs were measured by enzyme-linked immunosorbent assay (ELISA) on H-125 cell line and the immunoreactive fractions was determined by the Lindmo method. Among all organs, significant accumulation was found in serum (27.05 {+-} 2.08 %ID/g) and tumor (3.903 {+-} 0.89 %ID/g) at 4 h after injection. These values decreased to 5.03 {+-} 0.50 %ID/g and 2.19 {+-} 0.56 %ID/g for serum and tumor, respectively. The immunoreactive fraction was found to be 0.70, with a correlation coefficient r=0.9984. With the good biodistribution and tumor uptake of the {sup 99m}Tc-labeled humanized antibody h-R3, a phase I diagnostic clinical trial of tumor with epithelial origin should be pursued.

  14. Effects of organophosphorus flame retardant TDCPP on normal human corneal epithelial cells: Implications for human health.

    Science.gov (United States)

    Xiang, Ping; Liu, Rong-Yan; Li, Chao; Gao, Peng; Cui, Xin-Yi; Ma, Lena Q

    2017-11-01

    Tris(1,3-dichloro-2-propyl) phosphate (TDCPP) is one of the most detected organophosphorus flame retardants (OPFRs) in the environment, especially in indoor dust. Continuous daily exposure to TDCPP-containing dust may adversely impact human cornea. However, its detrimental effects on human corneal epithelium are largely unknown. In this study, we investigated the cell apoptosis in normal human corneal epithelial cells (HCECs) after TDCPP exposure and elucidated the underlying molecular mechanisms. Our data indicated a dose-dependent decrease of cell viability after TDCPP exposure with LC 50 at 202 μg/mL. A concentration-dependent apoptotic sign was observed in HCECs after exposing to ≥2 μg/mL TDCPP. Endoplasmic reticulum stress induction was evidenced by up-regulation of its biomarker genes (ATF-4, CHOP, BiP, and XBP1). Furthermore, alternation of Bcl-2/Bax expression, mitochondrial membrane potential loss, cellular ATP content decrease, and caspase-3 and -9 activity increase were observed after exposing to 2 or 20 μg/mL TDCPP. Taken together, the data implicated the involvement of endoplasmic reticulum stress in TDCPP-induced HCEC apoptosis, probably mediated by mitochondrial apoptotic pathway. Our findings showed TDCPP exposure induced toxicity to human cornea. Due to TDCPP's presence at high levels in indoor dust, further study is warranted to evaluate its health risk on human corneas. Published by Elsevier Ltd.

  15. Rapid Visualization of Human Tumor Xenografts through Optical Imaging with a Near-Infrared Fluorescent Anti–Epidermal Growth Factor Receptor Nanobody

    Directory of Open Access Journals (Sweden)

    Sabrina Oliveira

    2012-01-01

    Full Text Available Given that overexpression of the epidermal growth factor receptor (EGFR is found in many types of human epithelial cancers, noninvasive molecular imaging of this receptor is of great interest. A number of studies have employed monoclonal antibodies as probes; however, their characteristic long half-life in the bloodstream has encouraged the development of smaller probes. In this study, an anti-EGFR nanobody-based probe was developed and tested in comparison with cetuximab for application in optical molecular imaging. To this aim, the anti-EGFR nanobody 7D12 and cetuximab were conjugated to the near-infrared fluorophore IRDye800CW. 7D12-IR allowed the visualization of tumors as early as 30 minutes postinjection, whereas with cetuximab-IR, no signal above background was observed at the tumor site. Quantification of the IR-conjugated proteins in the tumors revealed ≈ 17% of injected dose per gram 2 hours after injection of 7D12-IR, which was significantly higher than the tumor uptake obtained 24 hours after injection of cetuximab-IR. This difference is associated with the superior penetration and distribution of 7D12-IR within the tumor. These results demonstrate that this anti-EGFR nanobody conjugated to the NIR fluorophore has excellent properties for rapid preclinical optical imaging, which holds promise for its future use as a complementary diagnostic tool in humans.

  16. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  17. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Science.gov (United States)

    Ruiz, Lorena; Espinosa-Martos, Irene; García-Carral, Cristina; Manzano, Susana; McGuire, Michelle K.; Meehan, Courtney L.; McGuire, Mark A.; Williams, Janet E.; Foster, James; Sellen, Daniel W.; Kamau-Mbuthia, Elizabeth W.; Kamundia, Egidioh W.; Mbugua, Samwel; Moore, Sophie E.; Kvist, Linda J.; Otoo, Gloria E.; Lackey, Kimberly A.; Flores, Katherine; Pareja, Rossina G.; Bode, Lars; Rodríguez, Juan M.

    2017-01-01

    Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα), acquired immunity factors (IL2, IL4, IL10, IL13, IL17), chemokines (IL8, Groα, MCP1, MIP1β), growth factors [IL5, IL7, epidermal growth factor (EGF), granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM), in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not) common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid. Clinical Trial Registration: www.ClinicalTrials.gov, identifier NCT02670278. PMID:28713365

  18. What’s Normal? Immune Profiling of Human Milk from Healthy Women Living in Different Geographical and Socioeconomic Settings

    Directory of Open Access Journals (Sweden)

    Lorena Ruiz

    2017-06-01

    Full Text Available Human milk provides a very wide range of nutrients and bioactive components, including immune factors, human milk oligosaccharides, and a commensal microbiota. These factors are essential for interconnected processes including immunity programming and the development of a normal infant gastrointestinal microbiome. Newborn immune protection mostly relies on maternal immune factors provided through milk. However, studies dealing with an in-depth profiling of the different immune compounds present in human milk and with the assessment of their natural variation in healthy women from different populations are scarce. In this context, the objective of this work was the detection and quantification of a wide array of immune compounds, including innate immunity factors (IL1β, IL6, IL12, INFγ, TNFα, acquired immunity factors (IL2, IL4, IL10, IL13, IL17, chemokines (IL8, Groα, MCP1, MIP1β, growth factors [IL5, IL7, epidermal growth factor (EGF, granulocyte colony-stimulating factor, granulocyte–macrophage colony-stimulating factor, TGFβ2], and immunoglobulins (IgA, IgG, IgM, in milk produced by healthy women of different ethnicities living in different geographic, dietary, socioeconomic, and environmental settings. Among the analyzed factors, IgA, IgG, IgM, EGF, TGFβ2, IL7, IL8, Groα, and MIP1β were detected in all or most of the samples collected in each population and, therefore, this specific set of compounds might be considered as the “core” soluble immune factors in milk produced by healthy women worldwide. This approach may help define which immune factors are (or are not common in milk produced by women living in various conditions, and to identify host, lifestyle, and environmental factors that affect the immunological composition of this complex biological fluid.Clinical Trial Registration:www.ClinicalTrials.gov, identifier NCT02670278.

  19. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    Science.gov (United States)

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2014-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  20. Object Detection and Tracking-Based Camera Calibration for Normalized Human Height Estimation

    Directory of Open Access Journals (Sweden)

    Jaehoon Jung

    2016-01-01

    Full Text Available This paper presents a normalized human height estimation algorithm using an uncalibrated camera. To estimate the normalized human height, the proposed algorithm detects a moving object and performs tracking-based automatic camera calibration. The proposed method consists of three steps: (i moving human detection and tracking, (ii automatic camera calibration, and (iii human height estimation and error correction. The proposed method automatically calibrates camera by detecting moving humans and estimates the human height using error correction. The proposed method can be applied to object-based video surveillance systems and digital forensic.

  1. Specific binding of beta-endorphin to normal human erythrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chenet, B.; Hollis, V. Jr.; Kang, Y.; Simpkins, C.

    1986-03-05

    Beta-endorphin (BE) exhibits peripheral functions which may not be mediated by interactions with receptors in the brain. Recent studies have demonstrated binding of BE to both opioid and non-opioid receptors on lymphocytes and monocytes. Abood has reported specific binding of /sup 3/H-dihydromorphine in erythrocytes. Using 5 x 10/sup -11/M /sup 125/I-beta-endorphin and 10/sup -5/M unlabeled BE, they have detected 50% specific binding to human erythrocytes. This finding is supported by results from immunoelectron microscopy using rabbit anti-BE antibody and biotinylated secondary antibody with avidin-biotin complexes horseradish peroxidase. Binding is clearly observed and is confined to only one side of the cells. Conclusions: (1) BE binding to human erythrocytes was demonstrated by radioreceptor assay and immunoelectron microscopy, and (2) BE binding sites exist on only one side of the cells.

  2. Quantitation of small intestinal permeability during normal human drug absorption

    OpenAIRE

    Levitt, David G

    2013-01-01

    Background Understanding the quantitative relationship between a drug?s physical chemical properties and its rate of intestinal absorption (QSAR) is critical for selecting candidate drugs. Because of limited experimental human small intestinal permeability data, approximate surrogates such as the fraction absorbed or Caco-2 permeability are used, both of which have limitations. Methods Given the blood concentration following an oral and intravenous dose, the time course of intestinal absorpti...

  3. Vulnerability of Normal Human Mammary Epithelial Cells to Oncogenic Transformation

    Science.gov (United States)

    2012-04-01

    control expression of many of these miRNA genes. Many of the epigenetically regulated miRNAs identified are deregulated in breast cancer-derived...review board and Health Insurance Portability and Accountability Act regulations. At the time of surgery, a 1 to 3 cm section of the tumor was immediately...transformation process for- ward; the early deregulation of the HOX gene family clusters, which are decisively linked to human carcinogenesis, are one clear

  4. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  5. Cardiovascular, endocrine and renal effects of urodilatin in normal humans

    DEFF Research Database (Denmark)

    Bestle, M.H.; Olsen, N.V.; Christensen, P.

    1999-01-01

    remained below 0.1%. The results indicate that even moderately natriuretic doses of urodilatin exert protracted effects on systemic hemodynamic, endocrine, and renal functions, including decreases in cardiac output and renal blood flow, without changes in arterial pressure or glomerular filtration rate......Effects of urodilatin (5, 10, 20, and 40 ng. kg-1. min-1) infused over 2 h on separate study days were studied in eight normal subjects with use of a randomized, double-blind protocol. All doses decreased renal plasma flow (hippurate clearance, 13-37%) and increased fractional Li+ clearance (7......-22%) and urinary Na+ excretion (by 30, 76, 136, and 99% at 5, 10, 20, and 40 ng. kg-1. min-1, respectively). Glomerular filtration rate did not increase significantly with any dose. The two lowest doses decreased cardiac output (7 and 16%) and stroke volume (10 and 20%) without changing mean arterial blood...

  6. Compound sensory action potential in normal and pathological human nerves

    DEFF Research Database (Denmark)

    Krarup, Christian

    2004-01-01

    The compound sensory nerve action potential (SNAP) is the result of phase summation and cancellation of single fiber potentials (SFAPs) with amplitudes that depend on fiber diameter, and the amplitude and shape of the SNAP is determined by the distribution of fiber diameters. Conduction velocities...... dispersion over increasing conduction distance is greater for the SNAP than CMAP, and demonstration of conduction block is therefore difficult. In addition, the effect of temporal dispersion on amplitude and shape is strongly dependent on the number of conducting fibers and their distribution, and......, with fiber loss or increased conduction velocity variability changes of the SNAP may be smaller than expected from normal nerve. The biophysical characteristics of sensory and motor fibers differ, and this may to some extent determine divergent pathophysiological changes in sensory and motor fibers...

  7. Plasma catecholamine responses to physiologic stimuli in normal human pregnancy.

    Science.gov (United States)

    Barron, W M; Mujais, S K; Zinaman, M; Bravo, E L; Lindheimer, M D

    1986-01-01

    The dynamic response of the sympathoadrenal system was evaluated during and after pregnancy in 13 healthy women with a protocol that compared cardiovascular parameters and plasma catecholamine levels during the basal state, after postural maneuvers, and following isometric exercise. Plasma epinephrine and norepinephrine levels were similar during and after gestation when the women rested on their sides, but heart rate was greater in pregnancy. Ten minutes of supine recumbency produced minimal changes, but attenuation of the anticipated increases in heart rate and plasma norepinephrine levels during standing and isometric exercise were observed during pregnancy. In contrast, alterations in plasma epinephrine appeared unaffected by gestation. Plasma renin activity and aldosterone levels were, as expected, greater during pregnancy; however, increments in response to upright posture were similar in pregnant and postpartum women. To the extent that circulating catecholamines may be considered indices of sympathoadrenal function, these data suggest that normal pregnancy alters cardiovascular and sympathetic nervous system responses to physiologic stimuli.

  8. Mineral density volume gradients in normal and diseased human tissues.

    Directory of Open Access Journals (Sweden)

    Sabra I Djomehri

    Full Text Available Clinical computed tomography provides a single mineral density (MD value for heterogeneous calcified tissues containing early and late stage pathologic formations. The novel aspect of this study is that, it extends current quantitative methods of mapping mineral density gradients to three dimensions, discretizes early and late mineralized stages, identifies elemental distribution in discretized volumes, and correlates measured MD with respective calcium (Ca to phosphorus (P and Ca to zinc (Zn elemental ratios. To accomplish this, MD variations identified using polychromatic radiation from a high resolution micro-computed tomography (micro-CT benchtop unit were correlated with elemental mapping obtained from a microprobe X-ray fluorescence (XRF using synchrotron monochromatic radiation. Digital segmentation of tomograms from normal and diseased tissues (N=5 per group; 40-60 year old males contained significant mineral density variations (enamel: 2820-3095 mg/cc, bone: 570-1415 mg/cc, cementum: 1240-1340 mg/cc, dentin: 1480-1590 mg/cc, cementum affected by periodontitis: 1100-1220 mg/cc, hypomineralized carious dentin: 345-1450 mg/cc, hypermineralized carious dentin: 1815-2740 mg/cc, and dental calculus: 1290-1770 mg/cc. A plausible linear correlation between segmented MD volumes and elemental ratios within these volumes was established, and Ca/P ratios for dentin (1.49, hypomineralized dentin (0.32-0.46, cementum (1.51, and bone (1.68 were observed. Furthermore, varying Ca/Zn ratios were distinguished in adapted compared to normal tissues, such as in bone (855-2765 and in cementum (595-990, highlighting Zn as an influential element in prompting observed adaptive properties. Hence, results provide insights on mineral density gradients with elemental concentrations and elemental footprints that in turn could aid in elucidating mechanistic processes for pathologic formations.

  9. Mineral Density Volume Gradients in Normal and Diseased Human Tissues

    Science.gov (United States)

    Djomehri, Sabra I.; Candell, Susan; Case, Thomas; Browning, Alyssa; Marshall, Grayson W.; Yun, Wenbing; Lau, S. H.; Webb, Samuel; Ho, Sunita P.

    2015-01-01

    Clinical computed tomography provides a single mineral density (MD) value for heterogeneous calcified tissues containing early and late stage pathologic formations. The novel aspect of this study is that, it extends current quantitative methods of mapping mineral density gradients to three dimensions, discretizes early and late mineralized stages, identifies elemental distribution in discretized volumes, and correlates measured MD with respective calcium (Ca) to phosphorus (P) and Ca to zinc (Zn) elemental ratios. To accomplish this, MD variations identified using polychromatic radiation from a high resolution micro-computed tomography (micro-CT) benchtop unit were correlated with elemental mapping obtained from a microprobe X-ray fluorescence (XRF) using synchrotron monochromatic radiation. Digital segmentation of tomograms from normal and diseased tissues (N=5 per group; 40-60 year old males) contained significant mineral density variations (enamel: 2820-3095mg/cc, bone: 570-1415mg/cc, cementum: 1240-1340mg/cc, dentin: 1480-1590mg/cc, cementum affected by periodontitis: 1100-1220mg/cc, hypomineralized carious dentin: 345-1450mg/cc, hypermineralized carious dentin: 1815-2740mg/cc, and dental calculus: 1290-1770mg/cc). A plausible linear correlation between segmented MD volumes and elemental ratios within these volumes was established, and Ca/P ratios for dentin (1.49), hypomineralized dentin (0.32-0.46), cementum (1.51), and bone (1.68) were observed. Furthermore, varying Ca/Zn ratios were distinguished in adapted compared to normal tissues, such as in bone (855-2765) and in cementum (595-990), highlighting Zn as an influential element in prompting observed adaptive properties. Hence, results provide insights on mineral density gradients with elemental concentrations and elemental footprints that in turn could aid in elucidating mechanistic processes for pathologic formations. PMID:25856386

  10. Effects of Thermal Resistance on One-Dimensional Thermal Analysis of the Epidermal Flexible Electronic Devices Integrated with Human Skin

    Science.gov (United States)

    Li, He; Cui, Yun

    2017-12-01

    Nowadays, flexible electronic devices are increasingly used in direct contact with human skin to monitor the real-time health of human body. Based on the Fourier heat conduction equation and Pennes bio-heat transfer equation, this paper deduces the analytical solutions of one - dimensional heat transfer for flexible electronic devices integrated with human skin under the condition of a constant power. The influence of contact thermal resistance between devices and skin is considered as well. The corresponding finite element model is established to verify the correctness of analytical solutions. The results show that the finite element analysis agrees well with the analytical solution. With bigger thermal resistance, temperature increase of skin surface will decrease. This result can provide guidance for the design of flexible electronic devices to reduce the negative impact that exceeding temperature leave on human skin.

  11. INHIBITION OF PROTEIN TYROSINE PHOSPHATASE ACTIVITY MEDIATES EPIDERMAL GROWTH FACTOR RECEPTOR SIGNALING IN HUMAN AIRWAY EPITHELIAL CELLS

    Science.gov (United States)

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  12. Epidermal growth factor receptor signalling in human breast cancer cells operates parallel to estrogen receptor α signalling and results in tamoxifen insensitive proliferation

    International Nuclear Information System (INIS)

    Moerkens, Marja; Zhang, Yinghui; Wester, Lynn; Water, Bob van de; Meerman, John HN

    2014-01-01

    Tamoxifen resistance is a major problem in the treatment of estrogen receptor (ER) α -positive breast cancer patients. Although the mechanisms behind tamoxifen resistance are still not completely understood, clinical data suggests that increased expression of receptor tyrosine kinases is involved. Here, we studied the estrogen and anti-estrogen sensitivity of human breast cancer MCF7 cells that have a moderate, retroviral-mediated, ectopic expression of epidermal growth factor receptor (MCF7-EGFR). Proliferation of MCF7-EGFR and parental cells was induced by 17β-estradiol (E2), epidermal growth factor (EGF) or a combination of these. Inhibition of proliferation under these conditions was investigated with 4-hydroxy-tamoxifen (TAM) or fulvestrant at 10 -12 to 10 -6 M. Cells were lysed at different time points to determine the phosphorylation status of EGFR, MAPK 1/3 , AKT and the expression of ERα. Knockdown of target genes was established using smartpool siRNAs. Transcriptomics analysis was done 6 hr after stimulation with growth factors using Affymetrix HG-U133 PM array plates. While proliferation of parental MCF7 cells could only be induced by E2, proliferation of MCF7-EGFR cells could be induced by either E2 or EGF. Treatment with TAM or fulvestrant did significantly inhibit proliferation of MCF7-EGFR cells stimulated with E2 alone. EGF treatment of E2/TAM treated cells led to a marked cell proliferation thereby overruling the anti-estrogen-mediated inhibition of cell proliferation. Under these conditions, TAM however did still inhibit ERα- mediated transcription. While siRNA-mediated knock-down of EGFR inhibited the EGF- driven proliferation under TAM/E2/EGF condition, knock down of ERα did not. The TAM resistant cell proliferation mediated by the conditional EGFR-signaling may be dependent on the PI3K/Akt pathway but not the MEK/MAPK pathway, since a MEK inhibitor (U0126), did not block the proliferation. Transcriptomic analysis under the various E2/TAM

  13. Radionecrosis skin model induced an athymic mouse nude (Nu/Nu) for development of dermal-epidermal human substitute based regenerative therapy

    International Nuclear Information System (INIS)

    Mosca, Rodrigo Crespo

    2014-01-01

    The neoplasms incidence has increased significantly in recent years and continued population growth and aging will increase the statistics of this illness in the world's diseases. The cancer treatment usually consists in individual or combined use of chemotherapy, surgery and radiotherapy depending on the etiology of the tumor. In cases where radiotherapy is used in addition to the therapeutic effects of radiation, specific complications can occur, and in the skin, these complications can be present with a clinical expression ranging from erythema to radionecrosis, and this latter being the adverse effect with greater severity. The radionecrosis treatment consists in debridement necrotic areas and covering the surgical wounds. Autologous grafts are most commonly used for this covering, however when large areas are affected, allografts can be used for occlusive treatment and the keratinocytes and adipose derived stem cells (ADSC) addition becomes an alternative, due to the knowing for immunomodulatory and regenerative response. For that reason, aiming to simulate the radionecrosis adverse effects, an animal model of induced cutaneous radionecrosis was created, in athymic mouse Nude (Nu/Nu), for developing regenerative therapies based on human dermal-epidermal substitutes containing keratinocytes and ADSC, which proved occlusive as an efficient treatment, furthermore, having this radionecrosis animal model established, new possibilities for treatment of diseases involving dermal regeneration, can be tested. (author)

  14. Altered growth, differentiation, and responsiveness to epidermal growth factor of human embryonic mesenchymal cells of palate by persistent rubella virus infection

    International Nuclear Information System (INIS)

    Yoneda, T.; Urade, M.; Sakuda, M.; Miyazaki, T.

    1986-01-01

    We previously demonstrated that human embryonic mesenchymal cells derived from the palate (HEMP cells) retain alkaline phosphatase (ALP) content and capacity for collagen synthesis after long-term culture, and their growth is markedly stimulated by epidermal growth factor (EGF). There was a dramatic decrease in ALP content and capacity to synthesize collagen in HEMP cells (HEMP-RV cells) persistently infected with rubella virus (RV). EGF increased ALP activity and decreased collagen synthesis in HEMP cells, whereas EGF showed no effect on these activities in HEMP-RV cells. Growth of HEMP-RV cells was slightly reduced compared with that of HEMP cells. EGF stimulated growth of HEMP cells and to a lesser extent of HEMP-RV cells. Binding of 125 I-EGF to cell-surface receptors in HEMP-RV cells was, to our surprise, twice as much as that in HEMP cells. However, internalization of bound 125 I-EGF in HEMP-RV cells was profoundly diminished. Thus, persistent RV infection causes not only changes in HEMP cell growth and differentiation but a decrease in or loss of HEMP cell responsiveness to EGF. The effects of persistent RV infection on palatal cell differentiation as well as growth may be responsible for the pathogenesis of congenital rubella. Furthermore, since HEMP cells appear to be closely related to osteoblasts, these results suggest a mechanism for RV-induced osseous abnormalities manifested in congenital rubella patients

  15. Comet assay in reconstructed 3D human epidermal skin models—investigation of intra- and inter-laboratory reproducibility with coded chemicals

    Science.gov (United States)

    Pfuhler, Stefan

    2013-01-01

    Reconstructed 3D human epidermal skin models are being used increasingly for safety testing of chemicals. Based on EpiDerm™ tissues, an assay was developed in which the tissues were topically exposed to test chemicals for 3h followed by cell isolation and assessment of DNA damage using the comet assay. Inter-laboratory reproducibility of the 3D skin comet assay was initially demonstrated using two model genotoxic carcinogens, methyl methane sulfonate (MMS) and 4-nitroquinoline-n-oxide, and the results showed good concordance among three different laboratories and with in vivo data. In Phase 2 of the project, intra- and inter-laboratory reproducibility was investigated with five coded compounds with different genotoxicity liability tested at three different laboratories. For the genotoxic carcinogens MMS and N-ethyl-N-nitrosourea, all laboratories reported a dose-related and statistically significant increase (P 30% cell loss), and the overall response was comparable in all laboratories despite some differences in doses tested. The results of the collaborative study for the coded compounds were generally reproducible among the laboratories involved and intra-laboratory reproducibility was also good. These data indicate that the comet assay in EpiDerm™ skin models is a promising model for the safety assessment of compounds with a dermal route of exposure. PMID:24150594

  16. Recommendations on disease management for patients with advanced human epidermal growth factor receptor 2-positive breast cancer and brain metastases: American Society of Clinical Oncology clinical practice guideline.

    Science.gov (United States)

    Ramakrishna, Naren; Temin, Sarah; Chandarlapaty, Sarat; Crews, Jennie R; Davidson, Nancy E; Esteva, Francisco J; Giordano, Sharon H; Gonzalez-Angulo, Ana M; Kirshner, Jeffrey J; Krop, Ian; Levinson, Jennifer; Modi, Shanu; Patt, Debra A; Perez, Edith A; Perlmutter, Jane; Winer, Eric P; Lin, Nancy U

    2014-07-01

    To provide formal expert consensus-based recommendations to practicing oncologists and others on the management of brain metastases for patients with human epidermal growth factor receptor 2 (HER2) -positive advanced breast cancer. The American Society of Clinical Oncology (ASCO) convened a panel of medical oncology, radiation oncology, guideline implementation, and advocacy experts and conducted a systematic review of the literature. When that failed to yield sufficiently strong quality evidence, the Expert Panel undertook a formal expert consensus-based process to produce these recommendations. ASCO used a modified Delphi process. The panel members drafted recommendations, and a group of other experts joined them for two rounds of formal ratings of the recommendations. No studies or existing guidelines met the systematic review criteria; therefore, ASCO conducted a formal expert consensus-based process. Patients with brain metastases should receive appropriate local therapy and systemic therapy, if indicated. Local therapies include surgery, whole-brain radiotherapy, and stereotactic radiosurgery. Treatments depend on factors such as patient prognosis, presence of symptoms, resectability, number and size of metastases, prior therapy, and whether metastases are diffuse. Other options include systemic therapy, best supportive care, enrollment onto a clinical trial, and/or palliative care. Clinicians should not perform routine magnetic resonance imaging (MRI) to screen for brain metastases, but rather should have a low threshold for MRI of the brain because of the high incidence of brain metastases among patients with HER2-positive advanced breast cancer. © 2014 by American Society of Clinical Oncology.

  17. From bench to bedside: What do we know about hormone receptor-positive and human epidermal growth factor receptor 2-positive breast cancer?

    Science.gov (United States)

    Wu, Victoria Shang; Kanaya, Noriko; Lo, Chiao; Mortimer, Joanne; Chen, Shiuan

    2015-09-01

    Breast cancer is a heterogeneous disease. Thanks to extensive efforts from research scientists and clinicians, treatment for breast cancer has advanced into the era of targeted medicine. With the use of several well-established biomarkers, such as hormone receptors (HRs) (i.e., estrogen receptor [ER] and progesterone receptor [PgR]) and human epidermal growth factor receptor-2 (HER2), breast cancer patients can be categorized into multiple subgroups with specific targeted treatment strategies. Although therapeutic strategies for HR-positive (HR+) HER2-negative (HER2-) breast cancer and HR-negative (HR-) HER2-positive (HER2+) breast cancer are well-defined, HR+ HER2+ breast cancer is still an overlooked subgroup without tailored therapeutic options. In this review, we have summarized the molecular characteristics, etiology, preclinical tools and therapeutic options for HR+ HER2+ breast cancer. We hope to raise the attention of both the research and the medical community on HR+ HER2+ breast cancer, and to advance patient care for this subtype of disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Characteristics and treatment of human epidermal growth factor receptor 2 positive breast cancer: 43,485 cases from the National Cancer Database treated in 2010 and 2011.

    Science.gov (United States)

    Killelea, Brigid K; Chagpar, Anees B; Horowitz, Nina R; Lannin, Donald R

    2017-02-01

    Although identification of human epidermal growth factor receptor 2 (Her2) positive breast cancer represents one of the greatest advances over the past 3 decades, it has not been studied extensively on a national level. The National Cancer Database is a joint project of the American Cancer Society and the American College of Surgeons and contains data on about 70% of the cancer cases in the United States. Data on Her2 have been collected since 2010 and was used for this study. Of 298,937 cases of invasive breast cancer with known Her2 status diagnosed in 2010 and 2011, 43,485 (14.5%) were Her2 positive. Her2 positivity was greatest in Asian/Pacific Islanders and least in non-Hispanic Whites and was markedly more common in younger women. The incidence of Her2 positive tumors ranged from a low of 13.9% in the Mountain West region to a high of 16.0% in the West South Central region (P breast preservation (odds ratio = .78, confidence interval = .76 to .80). Her2 positive tumors have distinct epidemiologic, clinical, and treatment characteristics. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Human epidermal growth factor receptor 2 testing in invasive breast cancer: should histological grade, type and oestrogen receptor status influence the decision to repeat testing?

    Science.gov (United States)

    Rakha, Emad A; Pigera, Marian; Shin, Sandra J; D'Alfonso, Timothy; Ellis, Ian O; Lee, Andrew H S

    2016-07-01

    The recent American Society of Clinical Oncology/College of American Pathologists guidelines for human epidermal growth factor receptor 2 (HER2) testing in breast cancer recommend repeat testing based on tumour grade, tumour type, and hormone receptor status. The aim of this study was to test the value of these criteria. HER2 status was concordant in the core biopsies and excision specimens in 392 of 400 invasive carcinomas. The major reasons for discordance were amplification around the cut-off for positivity and tumour heterogeneity. Of 116 grade 3 carcinomas that were HER2-negative in the core biopsy, four were HER2-positive in the excision specimen. Three of these four either showed borderline negative amplification in the core biopsy or were heterogeneous. None of the 55 grade 1 carcinomas were HER2-positive. Review of repeat testing of HER2 in routine practice suggested that it may also be of value for multifocal tumours and if recommended by the person assessing the in-situ hybridization. Mandatory repeat HER2 testing of grade 3 HER2-negative carcinomas is not appropriate. This is particularly true if repeat testing is performed after borderline negative amplification in the core biopsy or in HER2-negative heterogeneous carcinomas. © 2015 John Wiley & Sons Ltd.

  20. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10.

    Science.gov (United States)

    Seok, Jin Kyung; Lee, Jeong-Won; Kim, Young Mi; Boo, Yong Chool

    2018-01-01

    Airborne particulate matter with a diameter of < 10 µm (PM10) causes oxidative damage, inflammation, and premature skin aging. In this study, we evaluated whether polyphenolic antioxidants attenuate the inflammatory responses of PM10-exposed keratinocytes. Primary human epidermal keratinocytes were exposed in vitro to PM10 in the absence or presence of punicalagin and (-)-epigallocatechin-3-gallate (EGCG), which are the major polyphenolic antioxidants found in pomegranate and green tea, respectively. Assays were performed to determine cell viability, production of reactive oxygen species (ROS), and expression of NADPH oxidases (NOX), proinflammatory cytokines, and matrix metalloproteinase (MMP)-1. PM10 decreased cell viability and increased ROS production in a dose-dependent manner. It also increased the expression levels of NOX-1, NOX-2, tumor necrosis factor-α (TNF-α), interleukin (IL)-1β, IL-6, IL-8, and MMP-1. Punicalagin was not cytotoxic up to 300 μM, and (-)-EGCG was cytotoxic above 30 μM, respectively. Further, punicalagin (3-30 μM) and EGCG (3-10 μM) rescued the viability of PM10-exposed cells. They also attenuated ROS production and the expression of NOX-1, NOX-2, TNF-α, IL-1β, IL-6, IL-8, and MMP-1 stimulated by PM10. This study demonstrates that polyphenolic antioxidants, such as punicalagin and (-)-EGCG, rescue keratinocyte viability and attenuate the inflammatory responses of these cells due to airborne particles. © 2018 S. Karger AG, Basel.

  1. Real world cost of human epidermal receptor 2-positive metastatic breast cancer patients: a longitudinal incidence-based observational costing study in the Netherlands and Belgium.

    Science.gov (United States)

    Frederix, G W J; Severens, J L; Hövels, A M; van Hasselt, J G C; Hooiveld, M J J; Neven, P; Raaijmakers, J A M; Schellens, J H M

    2015-05-01

    Currently, no country-specific metastatic breast cancer (MBC) observational costing data are available for the Netherlands and Belgium. Our aim is to describe country-specific resource use and costs of human epidermal receptor 2 (HER-2)-positive MBC in the Netherlands and Belgium, making use of real-world data. The eligibility period for patient selection was from April 2004 to April 2010. Inclusion and retrospective data collection begins at the time of first diagnosis of HER-2-positive MBC during the eligibility period and ends 24 months post-index diagnosis of MBC or at patient death. We identified 88 eligible patients in the Netherlands and 44 patients in Belgium. The total costs of medical treatment and other resource use utilisation per patient was €48,301 in the Netherlands and €37,431 in Belgium. Majority of costs was related to the use of trastuzumab in both countries, which was 50% of the total costs in the Netherlands and 56% in Belgium respectively. Our study provides estimates of resource use and costs for HER-2-positive MBC in the Netherlands and Belgium. We noticed various differences in resource use patterns between both countries demonstrating caution is needed when transferring cost estimates between countries. © 2014 John Wiley & Sons Ltd.

  2. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  3. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    International Nuclear Information System (INIS)

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  4. Different methods of measuring ADC values in normal human brain

    International Nuclear Information System (INIS)

    Wei Youping; Sheng Junkang; Zhang Caiyuan

    2009-01-01

    Objective: To investigate better method of measuring ADC values of normal brain, and provide reference for further research. Methods: Twenty healthy people's MR imaging were reviewed. All of them underwent routine MRI scans and echo-planar diffusion-weighted imaging (DWI), and ADC maps were reconstructed on work station. Six regions of interest (ROI) were selected for each object, the mean ADC values were obtained for each position on DWI and ADC maps respectively. Results: On the anisotropic DWI map calculated in the hypothalamus, ADC M , ADC P , ADC S values were no significant difference (P>0.05), in the frontal white matter and internal capsule hindlimb, there was a significant difference (P ave value exist significant difference to direct measurement on the anisotropic (isotropic) ADC map (P<0.001). Conclusion: Diffusion of water in the frontal white matter and internal capsule are anisotropic, but it is isotropic in the hypothalamus; different quantitative methods of diffusion measurement of 4ADC values have significant difference, but ADC values calculated through the DWI map is more accurate, quantitative diffusion study of brain tissue should also consider the diffusion measurement method. (authors)

  5. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans

    NARCIS (Netherlands)

    Stacey, Martin; Chang, Gin-Wen; Davies, John Q.; Kwakkenbos, Mark J.; Sanderson, Ralph D.; Hamann, Jörg; Gordon, Siamon; Lin, Hsi-Hsien

    2003-01-01

    Using multivalent protein probes, an evolutionarily conserved endogenous ligand for EMR2, a human myeloid cell-restricted EGF-TM7 receptor, was identified on the surface of a number of adherent cell lines. In addition, in situ staining of the ligand has revealed specific in vivo patterns consistent

  6. The physiology of the normal human breast: an exploratory study.

    Science.gov (United States)

    Mills, Dixie; Gordon, Eva J; Casano, Ashley; Lahti, Sarah Michelle; Nguyen, Tinh; Preston, Alex; Tondre, Julie; Wu, Kuan; Yanase, Tiffany; Chan, Henry; Chia, David; Esfandiari, Mahtash; Himmel, Tiffany; Love, Susan M

    2011-12-01

    The physiology of the nonlactating human breast likely plays a key role in factors that contribute to the etiology of breast cancer and other breast conditions. Although there has been extensive research into the physiology of lactation, few reports explore the physiology of the resting mammary gland, including mechanisms by which compounds such as hormones, drugs, and potential carcinogens enter the breast ducts. The purpose of this study was to explore transport of exogenous drugs into ductal fluid in nonlactating women and determine if their concentrations in the fluid are similar to those observed in the breast milk of lactating women. We selected two compounds that have been well characterized during lactation, caffeine and cimetidine. Caffeine passively diffuses into breast milk, but cimetidine is actively transported and concentrated in breast milk. After ingestion of caffeine and cimetidine, 14 nonlactating subjects had blood drawn and underwent ductal lavage at five time points over 12 h to measure drug levels in the fluid and blood. The concentrations of both caffeine and cimetidine in lavage fluid were substantially less than those observed in breast milk. Our results support recent evidence that the cimetidine transporter is not expressed in the nonlactating mammary gland, and highlight intriguing differences in the physiology and molecular transport of the lactating and nonlactating breast. The findings of this exploratory study warrant further exploration into the physiology of the nonlactating mammary gland to elucidate factors involved in disease initiation and progression.

  7. Histochemical and radioautographic studies of normal human fetal colon

    International Nuclear Information System (INIS)

    Lev, R.; Orlic, D.; New York Medical Coll., N.Y.

    1974-01-01

    Twenty fetal and infant colons ranging from 10 weeks in utero to 20 months postpartum, and 12 adult human colons were examined using histochemical techniques in conjunction with in vitro radioautography using Na 2 35 SO 4 as a sulfomucin precursor. Only the sulfated components of mucus in fetal goblet cells was found to differ significantly from adult colonic mucins. In the fetus sulfomucin staining was much weaker than in the adult, and was more intense in the left colon which is the reverse of the adult pattern. Sulfomucin was concentrated in the crypts throughout the fetal colon whereas in the adult right colon it predominated in the surface cells. As in the adult, saponification liberated carboxyl groups, possibly belonging to sialic acid, and vicinal hydroxyl groups from fetal mucins suggesting that this procedure hydrolyses an ester linkage between these 2 reactive groups. During the middle trimester of fetal life the colon possesses villi whose constituent cells display alkaline phosphatase in their surface coat. These and other morphological and histochemical similarities to fetal small intestine suggest that the fetal colon may have a limited capacity to absorb materials contained within swallowed amniotic fluid during this period. (orig.) [de

  8. A variety of human monoclonal antibodies against epidermal growth factor receptor isolated from a phage antibody library.

    Science.gov (United States)

    Kurosawa, Gene; Kondo, Mariko; Kurosawa, Yoshikazu

    2016-11-04

    When the technology for constructing human antibody (Ab) libraries using a phage-display system was developed, many researchers in Ab-related fields anticipated that it would be widely applied to the development of pharmaceutical drugs against various diseases, including cancers. However, successful examples of such applications are very limited. Moreover, researchers who utilize phage-display technology now show divergent ways of thinking about phage Ab libraries. For example, there is debate about what should be the source of V H and V L genes for the construction of libraries to cover the whole repertoire of Abs present in the human body. In the immune system, the introduction of mutations into V genes followed by selection based on binding activity, termed Ab maturation, is required for the production of Abs exhibiting high affinity to the antigen (Ag). Therefore, introduction of mutations and selection are required for isolation of Abs with high affinity after isolation of clones from phage Ab libraries. We constructed a large human Ab library termed AIMS, developed a screening method termed ICOS, and succeeded in isolating many human monoclonal Abs (mAbs) that specifically and strongly bind to various tumor-associated Ags. Eight anti-EGFR mAbs were included, which we characterized. These mAbs showed various different activities against EGFR-expressing cancer cells. In this paper, we describe these data and discuss the possibility and necessity that the mAbs isolated from the AIMS library might be developed as therapeutic drugs against cancers without introduction of mutations. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Magnetic resonance elastography in normal human brain: preliminary study

    International Nuclear Information System (INIS)

    Xu Lei; Gao Peiyi; Lin Yan; Han Jiancheng; Xi Zhinong; Shen Hao

    2007-01-01

    Objective: To study the application of magnetic resonance elastography (MRE) in the human brain. Methods: An external force actuator was developed. The actuator was fixed to the head coil. During MRE scan, one side of the actuator was attached to the volunteers' head. Low frequency oscillation was produced by the actuator and generated shear waves propagating into brain tissue. The pulse sequence of MRE was designed. A modified gradient echo sequence was developed with motion sensitizing gradient (MSG) imposed along X, Y or Z direction. Cyclic displacement within brain tissue induced by shear waves caused a measurable phase shift in the received MR signal. From the measured phase shift, the displacement at each voxel could be calculated, and the shear waves within the brain were directly imaged. By adjusting the phase offset, the dynamic propagation of shear waves in a wave cycle was obtained. Phase images were processed with local frequency estimation (LFE) technique to obtain the elasticity images. Shear waves at 100 Hz, 150 Hz, and 200 Hz were applied. Results: The phase images of MRE directly imaged the propagating shear waves within the brain. The direction of the propagation was from surface of the brain to the center. The wavelength of shear waves varied with the change of actuating frequency. The change of wavelength of shear waves in gray and white matter of the brain was identified. The wavelength of shear waves in gray matter was shorter than that in white matter. The elasticity image of the brain revealed that the shear modulus of the white matter was higher than that of gray matter. Conclusion: The phase images of MRE can directly visualize the propagation of shear waves in the brain tissue. The elasticity image of the brain can demonstrate the change of elasticity between gray and white matter. (authors)

  10. Validation of endogenous normalizing genes for expression analyses in adult human testis and germ cell neoplasms

    DEFF Research Database (Denmark)

    Svingen, T; Jørgensen, Anne; Rajpert-De Meyts, E

    2014-01-01

    to define suitable normalizing genes for specific cells and tissues. Here, we report on the performance of a panel of nine commonly employed normalizing genes in adult human testis and testicular pathologies. Our analyses revealed significant variability in transcript abundance for commonly used normalizers......, highlighting the importance of selecting appropriate normalizing genes as comparative measurements can yield variable results when different normalizing genes are employed. Based on our results, we recommend using RPS20, RPS29 or SRSF4 when analysing relative gene expression levels in human testis...... and associated testicular pathologies. OCT4 and SALL4 can be used with caution as second-tier normalizers when determining changes in gene expression in germ cells and germ cell tumour components, but the relative transcript abundance appears variable between different germ cell tumour types. We further...

  11. Comparison of radiosensitivities of human autologous normal and neoplastic thyroid epithelial cells

    International Nuclear Information System (INIS)

    Miller, R.C.; Kopecky, K.J.; Hiraoka, T.; Ezaki, H.; Clifton, K.H.

    1986-01-01

    Studies were conducted to examine differences between the radiosensitivities of normal and neoplastic epithelial cells of the human thyroid. Freshly excised thyroid tissues from the tumours of eight patients with papillary carcinoma (PC) and five with follicular adenoma (FA) were cultured in vitro separately from normal thyroid tissue obtained from the surgical margins of the same patients. Plating efficiency of unirradiated control tissue was lower, on average for tumour tissue compared with normal tissue. Radiosensitivity, measured by the 37% inactivation dose D 0 , was greater for carcinoma tissue than for normal tissue in seven out of eight PC cases. Adenomatous tissue was less radiosensitive than normal tissue in four out of five FA cases. This is the first report comparing the radiosensitivity of autologous normal and abnormal epithelial tissue from the human thyroid. (author)

  12. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells.

    Science.gov (United States)

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon

    2017-02-04

    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  13. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    Directory of Open Access Journals (Sweden)

    Minyong Kang

    2017-02-01

    Full Text Available Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1, chloroquine (CQ and 3-methyladenine (3-MA were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8 assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating

  14. Hypoxia changes the expression of the epidermal growth factor (EGF) system in human hearts and cultured cardiomyocytes

    DEFF Research Database (Denmark)

    Munk, Mathias; Memon, Ashfaque Ahmed; Goetze, Jens Peter

    2012-01-01

    by treatment with trastuzumab (20 nM). This resulted in inhibition of cardiomyocyte proliferation, but interestingly only in hypoxic cells. Co-treatment of HL-1 cells with HB-EGF (10 nM) but not with NRG-1 (5 ng/ml) rescued the cardiomyocytes from HER2 inhibition. HL-1 cardiomyocytes exposed to hypoxia...... revealed nuclear translocation of activated MAPK and the activity of this downstream signaling molecule was decreased by HER2 inhibition (20 nM trastuzumab), and re-established by HB-EGF (10 nM). CONCLUSIONS/SIGNIFICANCE: Hypoxia in the human heart alters the expression of the EGF system. Mimicking the HER...

  15. Effects of a prolonged standardized diet on normalizing the human metabolome123

    OpenAIRE

    Winnike, Jason H; Busby, Marjorie G; Watkins, Paul B; O'Connell, Thomas M

    2009-01-01

    Background: Although the effects of acute dietary interventions on the human metabolome have been studied, the extent to which the metabolome can be normalized by extended dietary standardization has not yet been examined.

  16. The sinusoidal lining cells in "normal" human liver. A scanning electron microscopic investigation

    DEFF Research Database (Denmark)

    Horn, T; Henriksen, Jens Henrik Sahl; Christoffersen, P

    1986-01-01

    The scanning electron microscopic was used to study the fenestrations of human liver sinusoids. Thirteen biopsies, where light microscopy and transmission electron microscopy revealed normal sinusoidal architecture, were investigated. The number of fenestrae was calculated in acinar zone 3...

  17. Ginsenosides Rb1 and Rg1 Stimulate Melanogenesis in Human Epidermal Melanocytes via PKA/CREB/MITF Signaling

    Directory of Open Access Journals (Sweden)

    Mao Lin

    2014-01-01

    Full Text Available Reduced or defective melanin skin pigmentation may cause many hypopigmentation disorders and increase the risk of damage to the skin triggered by UV irradiation. Ginsenosides Rb1 and Rg1 have many molecular targets including the cAMP-response element-binding protein (CREB, which is involved in melanogenesis. This study aimed to investigate the effects of ginsenosides Rb1 and Rg1 on melanogenesis in human melanocytes and their related mechanisms. The effects of Rb1 and Rg1 on cell viability, tyrosinase activity, cellular melanin content and protein levels of tyrosinase, microphthalmia-associated transcription factor (MITF, and activation of CREB in melanocytes were assessed. Results showed that Rb1 or Rg1 significantly increased cellular melanin content and tyrosinase activity in a dose-dependent manner. By contrast, the cell viability of melanocytes remained unchanged. After exposure to Rb1 or Rg1, the protein levels of tyrosinase, MITF, and phosphorylated CREB were significantly increased. Furthermore, pretreatment with the selective PKA inhibitor H-89 significantly blocked the Rb1- or Rg1-induced increase of melanin content. These findings indicated that Rb1 and Rg1 increased melanogenesis and tyrosinase activity in human melanocytes, which was associated with activation of PKA/CREB/MITF signaling. The effects and mechanisms of Rb1 or Rg1 on skin pigmentation deserve further study.

  18. Primary study on the clinical significance of measurement of epidermal growth factor (EGF) and NPY concentrations in human semen plasma

    International Nuclear Information System (INIS)

    Zhang Jiyun; Ning Yong

    2008-01-01

    Objective: To investigate the difference between the semen plasma contents of EGF and NPY in fertile and non-fertile males with the relevant sperm count and motility. Methods: Semen plasma contents of EGF and NPY were determined with RIA in 110 non-fertile males. Simultaneous semen analysis revealed (1) Group A, n=45, with normal sperm count, (2) Group B, n=34 low sperm count (0-20) x 10 6 /ml and (3) Group C n=31, with aspermia. White blood cell/HPF was examined in all the semen specimens and sperm motile rate and motility were examined in Group A specimens. Results: The semen plasma contents of EGF and NPY in non-fertile males were significantly higher than those in fertile males (P 1 x 10 6 /ml) were significantly lower than those in specimens with more white blood cells (P<0.05). Conclusion: Higher semen plasma contents of EGF and NPY might exert toxic effect on the sperms, contributing to the development of infertility. (authors)

  19. Determination of Elements in Normal and Leukemic Human Whole Blood by Neutron Activation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Brune, D; Frykberg, B; Samsahl, K; Wester, P O

    1961-11-15

    By means of gamma-spectrometry the following elements were simultaneously determined in normal and leukemic human whole blood: Cu, Mn, Zn, Sr, Na, P, Ca, Rb, Cd, Sb, Au, Cs and Fe. Chemical separations were performed according to a group separation method using ion-exchange technique. No significant difference between the concentrations of the elements in normal- and leukemic blood was observed.

  20. Determination of Elements in Normal and Leukemic Human Whole Blood by Neutron Activation Analysis

    International Nuclear Information System (INIS)

    Brune, D.; Frykberg, B.; Samsahl, K.; Wester, P.O.

    1961-11-01

    By means of gamma-spectrometry the following elements were simultaneously determined in normal and leukemic human whole blood: Cu, Mn, Zn, Sr, Na, P, Ca, Rb, Cd, Sb, Au, Cs and Fe. Chemical separations were performed according to a group separation method using ion-exchange technique. No significant difference between the concentrations of the elements in normal- and leukemic blood was observed

  1. Articular cartilage explant culture; an appropriate in vitro system to compare osteoarthritic and normal human cartilage

    NARCIS (Netherlands)

    Lafeber, F. P.; Vander Kraan, P. M.; van Roy, J. L.; Huber-Bruning, O.; Bijlsma, J. W.

    1993-01-01

    Proteoglycan metabolism of normal and histologically mild to moderate osteoarthritic cartilage explants were studied. Explants were obtained from the human knee of donors aged over 40 years. Proteoglycan content, synthesis and release were very similar in normal cartilage obtained from donors with

  2. Generation of hiPSTZ16 (ISMMSi003-A cell line from normal human foreskin fibroblasts

    Directory of Open Access Journals (Sweden)

    Marion Dejosez

    2018-01-01

    Full Text Available Human foreskin fibroblasts from a commercial source were reprogrammed into induced pluripotent stem cells to establish a clonal stem cell line, hiPSTZ16 (ISMMSi003-A. These cells show a normal karyotype and full differentiation potential in teratoma assays. The described cells provide a useful resource in combination with other iPS cell lines generated from normal human foreskin fibroblasts to study source- and reprogramming method-independent effects in downstream applications.

  3. Human antibody fragments specific for the epidermal growth factor receptor selected from large non-immunised phage display libraries.

    Science.gov (United States)

    Souriau, Christelle; Rothacker, Julie; Hoogenboom, Hennie R; Nice, Edouard

    2004-09-01

    Antibodies to EGFR have been shown to display anti-tumour effects mediated in part by inhibition of cellular proliferation and angiogenesis, and by enhancement of apoptosis. Humanised antibodies are preferred for clinical use to reduce complications with HAMA and HAHA responses frequently seen with murine and chimaeric antibodies. We have used depletion and subtractive selection strategies on cells expressing the EGFR to sample two large antibody fragment phage display libraries for the presence of human antibodies which are specific for the EGFR. Four Fab fragments and six scFv fragments were identified, with affinities of up to 2.2nM as determined by BIAcore analysis using global fitting of the binding curves to obtain the individual rate constants (ka and kd). This overall approach offers a generic screening method for the identification of growth factor specific antibodies and antibody fragments from large expression libraries and has potential for the rapid development of new therapeutic and diagnostic reagents.

  4. Everolimus Plus Endocrine Therapy for Postmenopausal Women With Estrogen Receptor-Positive, Human Epidermal Growth Factor Receptor 2-Negative Advanced Breast Cancer: A Clinical Trial.

    Science.gov (United States)

    Royce, Melanie; Bachelot, Thomas; Villanueva, Cristian; Özgüroglu, Mustafa; Azevedo, Sergio J; Cruz, Felipe Melo; Debled, Marc; Hegg, Roberto; Toyama, Tatsuya; Falkson, Carla; Jeong, Joon; Srimuninnimit, Vichien; Gradishar, William J; Arce, Christina; Ridolfi, Antonia; Lin, Chinjune; Cardoso, Fatima

    2018-03-22

    Cotargeting the mammalian target of rapamycin pathway and estrogen receptor may prevent or delay endocrine resistance in patients receiving first-line treatment for advanced breast cancer. To investigate the combination of everolimus plus endocrine therapy in first-line and second-line treatment settings for postmenopausal women with estrogen receptor-positive, human epidermal growth receptor 2-negative advanced breast cancer. In the multicenter, open-label, single-arm, phase 2 BOLERO-4 (Breast Cancer Trials of Oral Everolimus) clinical trial, 245 patients were screened for eligibility; 202 were enrolled between March 7, 2013, and December 17, 2014. A median follow-up of 29.5 months had been achieved by the data cutoff date (December 17, 2016). Patients received first-line treatment with everolimus, 10 mg/d, plus letrozole, 2.5 mg/d. Second-line treatment with everolimus, 10 mg/d, plus exemestane, 25 mg/d, was offered at the investigator's discretion upon initial disease progression. The primary end point was investigator-assessed progression-free survival in the first-line setting per Response Evaluation Criteria in Solid Tumors, version 1.0. Safety was assessed in patients who received at least 1 dose of study medication and at least 1 postbaseline safety assessment. A total of 202 women treated in the first-line setting had a median age of 64.0 years (interquartile range, 58.0-70.0 years) with metastatic (194 [96.0%]) or locally advanced (8 [4.0%]) breast cancer. Median progression-free survival was 22.0 months (95% CI, 18.1-25.1 months) with everolimus and letrozole. Median overall survival was not reached; 24-month estimated overall survival rate was 78.7% (95% CI, 72.1%-83.9%). Fifty patients started second-line treatment; median progression-free survival was 3.7 months (95% CI, 1.9-7.4 months). No new safety signals were observed. In the first-line setting, the most common all-grade adverse event was stomatitis (139 [68.8%]); the most common grade 3 to 4

  5. Phase II study of paclitaxel given once per week along with trastuzumab and pertuzumab in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer.

    Science.gov (United States)

    Dang, Chau; Iyengar, Neil; Datko, Farrah; D'Andrea, Gabriella; Theodoulou, Maria; Dickler, Maura; Goldfarb, Shari; Lake, Diana; Fasano, Julie; Fornier, Monica; Gilewski, Theresa; Modi, Shanu; Gajria, Devika; Moynahan, Mary Ellen; Hamilton, Nicola; Patil, Sujata; Jochelson, Maxine; Norton, Larry; Baselga, Jose; Hudis, Clifford

    2015-02-10

    The CLEOPATRA (Clinical Evaluation of Trastuzumab and Pertuzumab) study demonstrated superior progression-free survival (PFS) and overall survival when pertuzumab was added to trastuzumab and docetaxel. Paclitaxel given once per week is effective and less toxic than docetaxel. We performed a phase II study to evaluate the efficacy and safety of pertuzumab and trastuzumab with paclitaxel given once per week. Patients with metastatic human epidermal growth factor receptor 2-positive breast cancer with zero to one prior therapy were enrolled. Treatment consisted of paclitaxel 80 mg/m(2) once per week plus trastuzumab (8 mg/kg loading dose → 6 mg/kg) once every 3 weeks plus pertuzumab (840 mg loading dose → 420 mg) once every 3 weeks, all given intravenously. The primary end point was 6-month PFS assessed by Kaplan-Meier methods. From January 2011 to December 2013, we enrolled 69 patients: 51 (74%) and 18 (26%) treated in first- and second-line metastatic settings, respectively. At a median follow-up of 21 months (range, 3 to 38 months), 6-month PFS was 86% (95% CI, 75% to 92%). The median PFS was 19.5 months (95% CI, 14 to 26 months) overall. PFS was 24.2 months (95% CI, 14 months to not reached [NR]) and 16.4 months (95% CI, 8.5 months to NR) for those without and with prior treatment, respectively. At 1 year, Kaplan-Meier PFS was 70% (95% CI, 56% to 79%) overall, 71% (95% CI, 55% to 82%) for those without prior therapy, and 66% (95% CI, 40% to 83%) for those with prior therapy. Treatment was well-tolerated; there was no febrile neutropenia or symptomatic left ventricular systolic dysfunction. Paclitaxel given once per week with trastuzumab and pertuzumab is highly active and well tolerated and seems to be an effective alternative to docetaxel-based combination therapy. © 2014 by American Society of Clinical Oncology.

  6. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  7. Molecular subclassification determined by human papillomavirus and epidermal growth factor receptor status is associated with the prognosis of oropharyngeal squamous cell carcinoma.

    Science.gov (United States)

    Nakano, Takafumi; Yamamoto, Hidetaka; Nakashima, Torahiko; Nishijima, Toshimitsu; Satoh, Masanobu; Hatanaka, Yui; Shiratsuchi, Hideki; Yasumatsu, Ryuji; Toh, Satoshi; Komune, Shizuo; Oda, Yoshinao

    2016-04-01

    Human papillomavirus (HPV) infection is an indicator of good response to chemoradiotherapy in oropharyngeal squamous cell carcinoma (OPSCC), and epidermal growth factor receptor (EGFR) is a molecular-therapeutic target in head and neck squamous cell carcinoma. Here we investigated the prevalence and prognostic significance of HPV infection and EGFR alteration in OPSCC. We analyzed the presence of high-risk HPV using in situ hybridization, protein expressions of p16 and EGFR using immunohistochemistry, and the EGFR gene copy number gain using chromogenic in situ hybridization (CISH) in 105 cases of OPSCC. The biopsy specimens before chemoradiotherapy were used for these analyses. HPV infection and p16 protein overexpression were detected in 53.3% and 52.4% of the OPSCCs, and each factor was associated with better overall survival (P = .0026 and P = .0026) and nonkeratinizing histology (P = .0002 and P = .0004), respectively. EGFR gene copy number gain (high polysomy or amplification) was detected in 12.4% of the OPSCCs and was correlated with EGFR protein overexpression (P = .0667) and worse overall survival (P CISH positive) were mutually exclusive. The HPV-negative/EGFR CISH-positive OPSCCs had significantly worse overall survival than did the HPV-positive/EGFR CISH-negative OPSCCs and HPV-negative/EGFR CISH-negative OPSCCs (P CISH-negative OPSCCs had favorable prognosis irrespective of HPV infection. Our results suggest that EGFR gene copy number gain-positive tumors represent an HPV-negative, aggressive subgroup of OPSCCs. The molecular subclassification of OPSCCs based on HPV infection and EGFR status may serve as important information for appropriate therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. The curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive breast cancer: A meta-analysis.

    Science.gov (United States)

    Shao, Minghai; Zhang, Chi; Qin, Qin; Zhang, Zhaoyue; Zhu, Hongcheng; Di, Xiaoke; Sun, Xinchen

    2017-09-01

    This meta-analysis was designed to fully assess the curative effects of radiotherapy-based therapies for human epidermal growth factor receptor 2-positive (HER2+) breast cancer (BC). English articles were retrieved through searching Cochrane library, PubMed, and Embase databases updated to February 2017. Studies were selected based on the inclusion and exclusion criteria. The curative effects of radiotherapy-based therapies forHER2+ BC patients were assessed using hazard rates (HRs) or odds ratios (ORs), as well as their 95% confidence intervals (CIs). In addition, Egger test was used to assess publication bias, followed by sensitivity analysis. All statistic methods were conducted using R 3.12 software. A total of 9 eligible studies were included into this meta-analysis, which involved 2236 HER2+ BC patients. Egger test showed that the eligible studies had no publication bias (t = 2.198, P = .05918). Sensitivity analysis demonstrated that the results were stable. HER2+ BC patients in radiotherapy group had lower locoregional recurrences than those in other groups. Moreover, meta-analysis showed that no significant difference was found between HER2+ BC patients in radiotherapy group and other groups on the 1-year overall survival (P = 0.5263, I = 65.4%), 3-year overall survival (P = 0.4591, I = 0), and 5-year overall survival (P = 0.06277, I = 0). Radiotherapy-based therapies might have certain advantages in treating HER2+ BC patients.

  9. Disease management patterns for postmenopausal women in Europe with hormone-receptor-positive, human epidermal growth factor receptor-2 negative advanced breast cancer.

    Science.gov (United States)

    André, Fabrice; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Baladi, Jean-Francois; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Jerusalem, Guy

    2014-06-01

    International guidelines for hormone-receptor-positive (HR(+)), human epidermal growth factor receptor-2 negative (HER2(-)) advanced breast cancer (BC) recommend sequential lines of hormonal therapy (HT), and only recommend chemotherapy for patients with extensive visceral involvement or rapidly progressive disease. This study evaluated actual physician-reported treatments for advanced BC in Europe. We conducted a retrospective chart review of 355 postmenopausal women with HR(+), HER2(-) advanced BC who progressed on ≥1 line of HT (adjuvant or advanced) and completed ≥1 line of chemotherapy (advanced). Treatment choice was evaluated for each line of therapy. Of 355 patients, 111 (31%) received first-line chemotherapy, whereas 218 (61%) and 26 (7%) switched from HT to chemotherapy in second and third line, respectively. More patients receiving first-line HT had bone metastases (73% vs 27% chemotherapy). Patients treated with first-line chemotherapy had more brain (12% vs 3% HT) or extensive liver (13% vs 6% HT) metastases. Subgroup analysis of 188 patients who received first-line HT and had de novo advanced BC or relapsed/recurrent disease more than 1 year after adjuvant therapy found that the majority (89%; n = 167) of these patients switched to chemotherapy in second line. However, among these 167 patients, 27% had no significant changes in metastases between first and second line. Among the 73% of patients who had significant changes in metastases, 20% had no brain metastases or extensive visceral disease. Our study suggests that the guideline-recommended use of multiple HT lines is open to interpretation and that optimal treatment for European postmenopausal women with HR(+), HER2(-) advanced BC who responded to HT may not be achieved.

  10. Patterns of resource utilization and cost for postmenopausal women with hormone-receptor–positive, human epidermal growth factor receptor-2–negative advanced breast cancer in Europe

    International Nuclear Information System (INIS)

    Jerusalem, Guy; Neven, Patrick; Marinsek, Nina; Zhang, Jie; Degun, Ravi; Benelli, Giancarlo; Saletan, Stephen; Ricci, Jean-François; Andre, Fabrice

    2015-01-01

    Healthcare resource utilization in breast cancer varies by disease characteristics and treatment choices. However, lack of clarity in guidelines can result in varied interpretation and heterogeneous treatment management and costs. In Europe, the extent of this variability is unclear. Therefore, evaluation of chemotherapy use and costs versus hormone therapy across Europe is needed. This retrospective chart review (N = 355) examined primarily direct costs for chemotherapy versus hormone therapy in postmenopausal women with hormone-receptor–positive (HR+), human epidermal growth factor receptor-2–negative (HER2–) advanced breast cancer across 5 European countries (France, Germany, The Netherlands, Belgium, and Sweden). Total direct costs across the first 3 treatment lines were approximately €10 000 to €14 000 lower for an additional line of hormone therapy-based treatment versus switching to chemotherapy-based treatment. Direct cost difference between chemotherapy-based and hormone therapy-based regimens was approximately €1900 to €2500 per month. Chemotherapy-based regimens were associated with increased resource utilization (managing side effects; concomitant targeted therapy use; and increased frequencies of hospitalizations, provider visits, and monitoring tests). The proportion of patients taking sick leave doubled after switching from hormone therapy to chemotherapy. These results suggest chemotherapy is associated with increased direct costs and potentially with increased indirect costs (lower productivity of working patients) versus hormone therapy in HR+, HER2– advanced breast cancer. The online version of this article (doi:10.1186/s12885-015-1762-3) contains supplementary material, which is available to authorized users

  11. GEP100/Arf6 is required for epidermal growth factor-induced ERK/Rac1 signaling and cell migration in human hepatoma HepG2 cells.

    Directory of Open Access Journals (Sweden)

    ZhenZhen Hu

    Full Text Available BACKGROUND: Epidermal growth factor (EGF signaling is implicated in the invasion and metastasis of hepatoma cells. However, the signaling pathways for EGF-induced motility of hepatoma cells remain undefined. METHODOLOGY/PRINCIPAL FINDINGS: We found that EGF dose-dependently stimulated the migration of human hepatoma cells HepG2, with the maximal effect at 10 ng/mL. Additionally, EGF increased Arf6 activity, and ectopic expression of Arf6 T27N, a dominant negative Arf6 mutant, largely abolish EGF-induced cell migration. Blocking GEP100 with GEP100 siRNA or GEP100-△PH, a pleckstrin homology (PH domain deletion mutant of GEP100, blocked EGF-induced Arf6 activity and cell migration. EGF also increased ERK and Rac1 activity. Ectopic expression GEP100 siRNA, GEP100-△PH, or Arf6-T27N suppressed EGF-induced ERK and Rac1 activity. Furthermore, blocking ERK signaling with its inhibitor U0126 remarkably inhibited both EGF-induced Rac1 activation as well as cell migration, and ectopic expression of inactive mutant form of Rac1 (Rac1-T17N also largely abolished EGF-induced cell migration. CONCLUSIONS/SIGNIFICANCE: Taken together, this study highlights the function of the PH domain of GEP100 and its regulated Arf6/ERK/Rac1 signaling cascade in EGF-induced hepatoma cell migration. These findings could provide a rationale for designing new therapy based on inhibition of hepatoma metastasis.

  12. Suppressors for Human Epidermal Growth Factor Receptor 2/4 (HER2/4): A New Family of Anti-Toxoplasmic Agents in ARPE-19 Cells.

    Science.gov (United States)

    Kim, Yeong Hoon; Bhatt, Lokraj; Ahn, Hye-Jin; Yang, Zhaoshou; Lee, Won-Kyu; Nam, Ho-Woo

    2017-10-01

    The effects of tyrosine kinase inhibitors (TKIs) were evaluated on growth inhibition of intracellular Toxoplasma gondii in host ARPE-19 cells. The number of tachyzoites per parasitophorous vacuolar membrane (PVM) was counted after treatment with TKIs. T. gondii protein expression was assessed by western blot. Immunofluorescence assay was performed using Programmed Cell Death 4 (PDCD4) and T. gondii GRA3 antibodies. The TKIs were divided into 3 groups; non-epidermal growth factor receptor (non-EGFR), anti-human EGFR 2 (anti-HER2), and anti-HER2/4 TKIs, respectively. Group I TKIs (nintedanib, AZD9291, and sunitinib) were unable to inhibit proliferation without destroying host cells. Group II TKIs (lapatinib, gefitinib, erlotinib, and AG1478) inhibited proliferation up to 98% equivalent to control pyrimethamine (5 μM) at 20 μM and higher, without affecting host cells. Group III TKIs (neratinib, dacomitinib, afatinib, and pelitinib) inhibited proliferation up to 98% equivalent to pyrimethamine at 1-5 μM, but host cells were destroyed at 10-20 μM. In Group I, TgHSP90 and SAG1 inhibitions were weak, and GRA3 expression was moderately inhibited. In Group II, TgHSP90 and SAG1 expressions seemed to be slightly enhanced, while GRA3 showed none to mild inhibition; however, AG1478 inhibited all proteins moderately. Protein expression was blocked in Group III, comparable to pyrimethamine. PDCD4 and GRA3 were well localized inside the nuclei in Group I, mildly disrupted in Group II, and were completely disrupted in Group III. This study suggests the possibility of a vital T. gondii TK having potential HER2/4 properties, thus anti-HER2/4 TKIs may inhibit intracellular parasite proliferation with minimal adverse effects on host cells.

  13. Phase I study of neratinib in combination with temsirolimus in patients with human epidermal growth factor receptor 2-dependent and other solid tumors.

    Science.gov (United States)

    Gandhi, Leena; Bahleda, Rastislav; Tolaney, Sara M; Kwak, Eunice L; Cleary, James M; Pandya, Shuchi S; Hollebecque, Antoine; Abbas, Richat; Ananthakrishnan, Revathi; Berkenblit, Anna; Krygowski, Mizue; Liang, Yali; Turnbull, Kathleen W; Shapiro, Geoffrey I; Soria, Jean-Charles

    2014-01-10

    Human epidermal growth factor (HER) -mediated signaling is critical in many cancers, including subsets of breast and lung cancer. HER family members signal via the phosphatidylinositide 3-kinase (PI3K) -AKT/protein kinase B-mammalian target of rapamycin (mTOR) cascade; mTOR activation is critical for the expression of multiple contributors to tumor growth and invasion. On the basis of preclinical data suggesting synergy of HER2 inhibition and mTOR inhibition in breast and lung cancer models, we conducted a phase I combination study of neratinib, a small-molecule irreversible pan-HER tyrosine kinase inhibitor, and temsirolimus, an mTOR inhibitor, in patients with advanced solid tumors. This study enrolled patients to dosing combinations of neratinib and temsirolimus. The primary objective was to estimate the toxicity contour of the combination and establish recommended phase II doses. Sixty patients were treated on 12 of 16 possible dosing combinations. Diarrhea was the most common drug-related (93%) and dose-limiting toxicity (DLT), constituting four of 10 DLTs. Dose-limiting grade 3 metabolic abnormalities were also observed. Other frequent drug-related toxicities included nausea, stomatitis (both 53%), and anemia (48%). Two maximum-tolerated dose combinations were identified: 200 mg of neratinib/25 mg of temsirolimus and 160 mg of neratinib/50 mg of temsirolimus. Responses were noted in patients with HER2-amplified breast cancer resistant to trastuzumab, HER2-mutant non-small-cell lung cancer, and tumor types without identified mutations in the HER-PI3K-mTOR pathway. The combination of neratinib and temsirolimus was tolerable and demonstrated antitumor activity in multiple tumor types, warranting further evaluation.

  14. Gene protein detection platform--a comparison of a new human epidermal growth factor receptor 2 assay with conventional immunohistochemistry and fluorescence in situ hybridization platforms.

    Science.gov (United States)

    Stålhammar, Gustav; Farrajota, Pedro; Olsson, Ann; Silva, Cristina; Hartman, Johan; Elmberger, Göran

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) are widely used semiquantitative assays for selecting breast cancer patients for HER2 antibody therapy. However, both techniques have been shown to have disadvantages. Our aim was to test a recent automated technique of combined IHC and brightfield dual in situ hybridization-gene protein detection platform (GPDP)-in breast cancer HER2 protein, gene, and chromosome 17 centromere status evaluations, comparing the results in accordance to the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from both 2007 and 2013. The GPDP technique performance was evaluated on 52 consecutive whole slide invasive breast cancer cases with HER2 IHC 2/3+ scoring results. Applying in turns the American Society of Clinical Oncology/College of American Pathologists recommendations for HER2 testing in breast cancer from 2007 and 2013 to both FISH and GPDP DISH assays, the HER2 gene amplification results showed 100% concordance among amplified/nonamplified cases, but there was a shift in 4 cases toward positive from equivocal results and toward equivocal from negative results. This might be related to the emphasis on the average HER2 copy number in the 2013 criteria. HER2 expression by IVD market IHC kit (Pathway®) has a strong correlation with GPDP HER2 protein, including a full concordance for all cases scored as 3+ and a reduction from 2+ to 1+ in 7 cases corresponding to nonamplified cases. Gene protein detection platform HER2 protein "solo" could have spared the need for 7 FISH studies. In addition, the platform offered advantages on interpretation reassurance including selecting areas for counting gene signals paralleled with protein IHC expression, on heterogeneity detection, interpretation time, technical time, and tissue expense. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Toxicity of jet fuel aliphatic and aromatic hydrocarbon mixtures on human epidermal Keratinocytes: evaluation based on in vitro cytotoxicity and interleukin-8 release

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Jen-Hung (Chung-Shan Medical University Hospital, Department of Dermatology, Taichung, Taiwan, R.O.C); Lee, Chia-Hue; Tsang, Chau-Loong [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); Monteiro-Riviere, Nancy A.; Riviere, Jim E. [North Carolina State University, Center for Chemical Toxicology Research and Pharmacokinetics (CCTRP), Raleigh, NC (United States); Chou, Chi-Chung [National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan); National Chung-Hsing University, College of Veterinary Medicine, Taichung (Taiwan)

    2006-08-15

    Jet fuels are complex mixtures of aliphatic (ALI) and aromatic (ARO) hydrocarbons that vary significantly in individual cytotoxicity and proinflammatory activity in human epidermal keratinocytes (HEK). In order to delineate the toxicological interactions among individual hydrocarbons in a mixture and their contributions to cutaneous toxicity, nine ALI and five ARO hydrocarbons were each divided into five (high/medium/low cytotoxic and strong/weak IL-8 induction) groups and intra/inter-mixed to assess for their mixture effects on HEK mortality and IL-8 release. Addition of single hydrocarbon to JP-8 fuel was also evaluated for their changes in fuel dermatotoxicity. The results indicated that when hydrocarbons were mixed, HEK mortality and IL-8 release were not all predictable by their individual ability affecting these two parameters. The lowest HEK mortality (7%) and the highest IL-8 production were induced with mixtures including high cytotoxic and weak IL-8 inductive ARO hydrocarbons. Antagonistic reactions not consistently correlated with ALI carbon chain length and ARO structure were evident and carried different weight in the overall mixture toxicities. Single addition of benzene, toluene, xylene or ethylbenzene for up to tenfold in JP-8 did not increase HEK mortality while single addition of ALI hydrocarbons exhibited dose-related differential response in IL-8. In an all ALI environment, no single hydrocarbon is the dominating factor in the determination of HEK cytotoxicity while deletion of hexadecane resulted in a 2.5-fold increase in IL-8 production. Overall, decane, undecane and dodecane were the major hydrocarbons associated with high cytotoxicity while tetradecane, pentadecane and hexadecane were those which had the greatest buffering effect attenuating dermatotoxicity. The mixture effects must be considered when evaluating jet fuel toxicity to HEK. (orig.)

  16. Safety and efficacy of neratinib in combination with capecitabine in patients with metastatic human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Saura, Cristina; Garcia-Saenz, Jose A; Xu, Binghe; Harb, Wael; Moroose, Rebecca; Pluard, Timothy; Cortés, Javier; Kiger, Corinne; Germa, Caroline; Wang, Kongming; Martin, Miguel; Baselga, José; Kim, Sung-Bae

    2014-11-10

    Neratinib is a potent irreversible pan-tyrosine kinase inhibitor with antitumor activity and acceptable tolerability in patients with human epidermal growth factor receptor 2 (HER2) -positive breast cancer. A multinational, open-label, phase I/II trial was conducted to determine the maximum-tolerated dose (MTD) of neratinib plus capecitabine in patients with solid tumors (part one) and to evaluate the safety and efficacy of neratinib plus capecitabine in patients with HER2-positive metastatic breast cancer (part two). Part one was a 3 + 3 dose-escalation study in which patients with advanced solid tumors received oral neratinib once per day continuously plus capecitabine twice per day on days 1 to 14 of a 21-day cycle at predefined dose levels. In part two, patients with trastuzumab-pretreated HER2-positive metastatic breast cancer received neratinib plus capecitabine at the MTD. The primary end point in part two was objective response rate (ORR). In part one (n = 33), the combination of neratinib 240 mg per day plus capecitabine 1,500 mg/m(2) per day was defined as the MTD, which was further evaluated in part 2 (n = 72). The most common drug-related adverse events were diarrhea (88%) and palmar-plantar erythrodysesthesia syndrome (48%). In part two, the ORR was 64% (n = 39 of 61) in patients with no prior lapatinib exposure and 57% (n = 4 of 7) in patients previously treated with lapatinib. Median progression-free survival was 40.3 and 35.9 weeks, respectively. Neratinib in combination with capecitabine had a manageable toxicity profile and showed promising antitumor activity in patients with HER2-positive metastatic breast cancer pretreated with trastuzumab and lapatinib. © 2014 by American Society of Clinical Oncology.

  17. Human Papillomavirus and Epidermal Growth Factor Receptor in Oral Cavity and Oropharyngeal Squamous Cell Carcinoma: Correlation With Dynamic Contrast-Enhanced MRI Parameters.

    Science.gov (United States)

    Choi, Yoon Seong; Park, Mina; Kwon, Hyeong Ju; Koh, Yoon Woo; Lee, Seung-Koo; Kim, Jinna

    2016-02-01

    The objective of this study was to investigate differences in dynamic contrast-enhanced MRI (DCE-MRI) parameters on the basis of the status of human papillomavirus (HPV) and epidermal growth factor receptor (EGFR) biomarkers in patients with squamous cell carcinoma (SCC) of the oral cavity and oropharynx by use of histogram analysis. A total of 22 consecutive patients with oral cavity and oropharyngeal SCC underwent DCE-MRI before receiving treatment. DCE parameter maps of the volume transfer constant (K(trans)), the flux rate constant (kep), and the extravascular extracellular volume fraction (ve) were obtained. The histogram parameters were calculated using the entire enhancing tumor volume and were compared between the patient subgroups on the basis of HPV and EGFR biomarker statuses. The cumulative histogram parameters of K(trans) and kep showed lower values in the HPV-negative and EFGR-overexpression group than in the HPV-positive EGFR-negative group. These differences were statistically significant for the mean (p = 0.009), 25th, 50th, and 75th percentile values of K(trans) and for the 25th percentile value of kep when correlated with HPV status in addition to the mean K(trans) value (p = 0.047) and kep value (p = 0.004) when correlated with EGFR status. No statistically significant difference in ve was found on the basis of HPV and EGFR status. DCE-MRI is useful for the assessment of the tumor microenvironment associated with HPV and EGFR biomarkers before treatment of patients with oral cavity and oropharyngeal SCC.

  18. Detection of Alpha-Toxin and Other Virulence Factors in Biofilms of Staphylococcus aureus on Polystyrene and a Human Epidermal Model.

    Science.gov (United States)

    den Reijer, P M; Haisma, E M; Lemmens-den Toom, N A; Willemse, J; Koning, R I; Koning, R A; Demmers, J A A; Dekkers, D H W; Rijkers, E; El Ghalbzouri, A; Nibbering, P H; van Wamel, W

    2016-01-01

    The ability of Staphylococcus aureus to successfully colonize (a)biotic surfaces may be explained by biofilm formation and the actions of virulence factors. The aim of the present study was to establish the presence of 52 proteins, including virulence factors such as alpha-toxin, during biofilm formation of five different (methicillin resistant) S. aureus strains on Leiden human epidermal models (LEMs) and polystyrene surfaces (PS) using a competitive Luminex-based assay. All five S. aureus strains formed biofilms on PS, whereas only three out of five strains formed biofilms on LEMs. Out of the 52 tested proteins, six functionally diverse proteins (ClfB, glucosaminidase, IsdA, IsaA, SACOL0688 and nuclease) were detected in biofilms of all strains on both PS and LEMs. At the same time, four toxins (alpha-toxin, gamma-hemolysin B and leukocidins D and E), two immune modulators (formyl peptide receptor-like inhibitory protein and Staphylococcal superantigen-like protein 1), and two other proteins (lipase and LytM) were detectable in biofilms by all five S. aureus strains on LEMs, but not on PS. In contrast, fibronectin-binding protein B (FnbpB) was detectable in biofilms by all S. aureus biofilms on PS, but not on LEMs. These data were largely confirmed by the results from proteomic and transcriptomic analyses and in case of alpha-toxin additionally by GFP-reporter technology. Functionally diverse virulence factors of (methicillin-resistant) S. aureus are present during biofilm formation on LEMs and PS. These results could aid in identifying novel targets for future treatment strategies against biofilm-associated infections.

  19. Utility of the CPS+EG staging system in hormone receptor-positive, human epidermal growth factor receptor 2-negative breast cancer treated with neoadjuvant chemotherapy.

    Science.gov (United States)

    Marmé, Frederik; Lederer, Bianca; Blohmer, Jens-Uwe; Costa, Serban Dan; Denkert, Carsten; Eidtmann, Holger; Gerber, Bernd; Hanusch, Claus; Hilfrich, Jörn; Huober, Jens; Jackisch, Christian; Kümmel, Sherko; Loibl, Sibylle; Paepke, Stefan; Untch, Michael; von Minckwitz, Gunter; Schneeweiss, Andreas

    2016-01-01

    Pathologic complete response after neoadjuvant chemotherapy (NACT) correlates with overall survival (OS) in primary breast cancer. A recently described staging system based on pre-treatment clinical stage (CS), final pathological stage (PS), estrogen receptor (ER) status and nuclear grade (NG) leads to a refined estimation of prognosis in unselected patients. Its performance in luminal type breast cancers has not been determined. This study investigates the clinical utility of this CPS+EG score when restricted to hormone receptor-positive (HR+)/human epidermal growth factor receptor 2-negative (HER2-) patients and compares the results to a cohort of unselected patients. The CPS+EG score was calculated for 6637 unselected patients and 2454 patients with HR+/HER2- tumours who received anthracycline/taxane-based NACT within 8 prospective German trials. Five-year disease-free survival (DFS) and OS were 75.6% and 84.1% for the unselected cohort and 80.6% and 87.8% for the HR+/HER2- subgroup, respectively. The CPS+EG system distinguished different prognostic groups with 5-year DFS ranging from 0% to 91%. The CPS+EG system leads to an improved categorisation of patients by outcome compared to CS, PS, ER or NG alone. When applying the CPS+EG score to the HR+/HER2- subgroup, a shift to lower scores was observed compared to the overall population, but 5-year DFS and OS for the individual scores were identical to that observed in the overall population. In HR+/HER2- patients, the CPS+EG staging system retains its ability to facilitate a refined stratification of patients according to outcome. It can help to select candidates for post-neoadjuvant clinical trials in luminal breast cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. The Effect of Adjuvant Trastuzumab on Locoregional Recurrence of Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer Treated with Mastectomy.

    Science.gov (United States)

    Lanning, Ryan M; Morrow, Monica; Riaz, Nadeem; McArthur, Heather L; Dang, Chau; Moo, Tracy-Ann; El-Tamer, Mahmoud; Krause, Kate; Siu, Chun; Hsu, Meier; Zhang, Zhigang; Pei, Xin; McCormick, Beryl; Powell, Simon N; Ho, Alice

    2015-08-01

    Human epidermal growth factor receptor 2 (HER2) overexpression was associated with locoregional recurrence (LRR) in the preadjuvant trastuzumab era. This study aimed to examine the effect of trastuzumab on LRR in mastectomy patients and whether it varied with postmastectomy radiation (PMRT). From the authors' institutional database, 501 women with stages I-III HER2-positive breast cancer who underwent mastectomy from 1998 to 2007 were identified. A landmark analysis was performed to compare two cohorts: 170 women who received trastuzumab and 281 who did not. Kaplan-Meier methods were used to estimate locoregional recurrence-free survival (LRRFS). A propensity score analysis was used to balance the treatment groups with respect to multiple covariates. Analogous methods were used to study the effect of PMRT. The women in the trastuzumab group were more likely to be node positive and to receive systemic therapy or PMRT (p < 0.01). The 5-year LRRFS was 98 % in the trastuzumab troup versus 94 % in the no trastuzumab group [hazard ratio (HR) 0.31; 95 % confidence interval (CI) 0.09-1.09; p = 0.07]. After adjustment for multiple covariates, including receipt of chemotherapy and PMRT, trastuzumab decreased LRR rates (HR 0.21; 95 % CI 0.04-0.94; p = 0.04). Among the women who received PMRT, trastuzumab reduced the 5-year LRR rate (0 vs 5 %; p = 0.06). Among those who did not receive PMRT, trastuzumab did not significantly decrease LRR (3 vs 6 %; p = 0.26). High rates of locoregional control (5-year rate, 98 %) were observed among patients who received trastuzumab and mastectomy ± PMRT. Trastuzumab decreased LRR in HER2-positive women who received mastectomy and PMRT, suggesting that the largest benefit is seen in a higher-risk subset of patients.

  1. Strain-dependent augmentation of tight-junction barrier function in human primary epidermal keratinocytes by Lactobacillus and Bifidobacterium lysates.

    Science.gov (United States)

    Sultana, Reshma; McBain, Andrew J; O'Neill, Catherine A

    2013-08-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by measurements of transepithelial electrical resistance (TEER). However, B. longum and L. rhamnosus GG were the most efficacious, producing dose-dependent increases in resistance that were maintained for 4 days. These increases in TEER correlated with elevated expression of tight-junction protein components. Neutralization of Toll-like receptor 2 abolished both the increase in TEER and expression of tight-junction proteins induced by B. longum, but not L. rhamnosus GG. These data suggest that some bacterial strains increase tight-junction function via modulation of protein components but the different pathways involved may vary depending on the bacterial strain.

  2. Reactive oxygen species-mediated DNA damage and apoptosis in human skin epidermal cells after exposure to nickel nanoparticles.

    Science.gov (United States)

    Alarifi, Saud; Ali, Daoud; Alakhtani, Saad; Al Suhaibani, Entissar S; Al-Qahtani, Ahmed A

    2014-01-01

    Nickel nanoparticles (NiNPs) are increasingly used in various applications due to their unique properties. However, there is little information concerning the toxicity of NiNPs in the human skin cell (A431). The present study was designed to investigate the cytotoxicity, apoptosis, and DNA damage due to NiNPs in A431 cells. A cellular proliferative capacity test showed that NiNPs induce significant cytotoxicity in a dose- and time-dependent manner. NiNPs were also found to induce oxidative stress evidenced by the generation of reactive oxygen species (ROS) and depletion of glutathione (GSH). Further, co-treatment with the antioxidant N-acetylcysteine (NAC) mitigated the ROS generation due to NiNPs, suggesting the potential mechanism of oxidative stress. NiNPs also induced significant elevation of lipid peroxidation, catalase, and superoxide dismutase and caspase-3 activity in A431 cells. In addition, NAC suppressed NiNP-induced caspase-3 activity. DNA fragmentation analysis using the comet assay showed that the NiNPs cause genotoxicity in a dose- and time-dependent manner. Therefore, the study points out the capability of the NiNPs to induce oxidative stress resulting in apoptosis and genotoxicity. This study warrants more careful assessment of NiNPs before their industrial applications.

  3. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  4. Expression and Prognostic Significance of Human Epidermal Growth Factor Receptors 1, 2 and 3 in Periampullary Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Jacob Elebro

    Full Text Available Periampullary adenocarcinoma, including pancreatic cancer, is a heterogeneous group of tumours with dismal prognosis, for which there is an urgent need to identify novel treatment strategies. The human epithelial growth factor receptors EGFR, HER2 and HER3 have been studied in several tumour types, and HER-targeting drugs have a beneficial effect on survival in selected types of cancer. However, these effects have not been evident in pancreatic cancer, and remain unexplored in other types of periampullary cancer. The prognostic impact of HER-expression in these cancers also remains unclear. The aim of this study was therefore to examine the expression and prognostic value of EGFR, HER2 and HER3 in periampullary cancer, with particular reference to histological subtype. To this end, protein expression of EGFR, HER2 and HER3, and HER2 gene amplification was assessed by immunohistochemistry and silver in situ hybridization, respectively, on tissue microarrays with tumours from 175 periampullary adenocarcinomas, with follow-up data on recurrence-free survival (RFS and overall survival (OS for up to 5 years. EGFR expression was similar in pancreatobiliary (PB and intestinal (I type tumours, but high HER2 and HER3 expression was significantly more common in I-type tumours. In PB-type cases receiving adjuvant gemcitabine, but not in untreated cases, high EGFR expression was significantly associated with a shorter OS and RFS, with a significant treatment interaction in relation to OS (pinteraction = 0.042. In I-type cases, high EGFR expression was associated with a shorter OS and RFS in univariable, but not in multivariable, analysis. High HER3 expression was associated with a prolonged RFS in univariable, but not in multivariable, analysis. Neither HER2 protein expression nor gene amplification was prognostic. The finding of a potential interaction between the expression of EGFR and response to adjuvant chemotherapy in PB-type tumours needs validation

  5. In vitro human epidermal permeation of nicotine from electronic cigarette refill liquids and implications for dermal exposure assessment.

    Science.gov (United States)

    Frasch, H Frederick; Barbero, Ana M

    2017-11-01

    Nicotine plus flavorings in a propylene glycol (PG) vehicle are the components of electronic cigarette liquids (e-liquids), which are vaporized and inhaled by the user. Dermal exposure to nicotine and e-liquids may occur among workers in mixing and filling of e-cigarettes in the manufacturing process. Inadvertent skin contact among consumers is also a concern. In vitro nicotine permeation studies using heat-separated human epidermis were performed with surrogate and two commercial e-liquids, neat and aqueous nicotine donor formulations. Steady-state fluxes (J ss ), and lag times (t lag ) were measured for each formulation. In addition, transient (4 h) exposure and finite dose (1-10 μl/cm 2 ) experiments were undertaken using one commercial e-liquid. Average J ss (μg/cm 2 /h) from formulations were: nicotine in PG (24 mg/ml): 3.97; commercial e-liquid containing menthol (25 mg/ml nicotine): 10.2; commercial e-liquid containing limonene (25 mg/ml nicotine): 23.7; neat nicotine: 175. E-liquid lag times ranged from 5 to 10 h. Absorbed fraction of nicotine from finite doses was ≈0.3 at 48 h. The data were applied to transient exposure and finite dose dermal exposure assessment models and to a simple pharmacokinetic model. Three illustrative exposure scenarios demonstrate use of the data to predict systemic uptake and plasma concentrations from dermal exposure. The data demonstrate the potential for significant nicotine absorption through skin contact with e-cigarette refill solutions and the neat nicotine used to mix them.

  6. Muscle protein analysis. II. Two-dimensional electrophoresis of normal and diseased human skeletal muscle

    Energy Technology Data Exchange (ETDEWEB)

    Giometti, C.S. (Argonne National Lab., IL); Barany, M.; Danon, M.J.; Anderson, N.G.

    1980-07-01

    High-resolution two-dimensional electrophoresis was used to analyze the major proteins of normal and pathological human-muscle samples. The normal human-muscle pattern contains four myosin light chains: three that co-migrate with the myosin light chains from rabbit fast muscle (extensor digitorum longus), and one that co-migrates with the light chain 2 from rabbit slow muscle (soleus). Of seven Duchenne muscular dystrophy samples, four yielded patterns with decreased amounts of actin and myosin relative to normal muscle, while three samples gave patterns comparable to that for normal muscle. Six samples from patients with myotonic dystrophy also gave normal patterns. In nemaline rod myopathy, in contrast, the pattern was deficient in two of the fast-type myosin light chains.

  7. Cyclooxygenase-2 expression in the normal human eye and its expression pattern in selected eye tumours

    DEFF Research Database (Denmark)

    Wang, Jinmei; Wu, Yazhen; Heegaard, Steffen

    2011-01-01

    Purpose: Cyclooxygenase-2 (COX-2) is an enzyme involved in neoplastic processes. The purpose of the present study is to investigate COX-2 expression in the normal human eye and the expression pattern in selected eye tumours involving COX-2 expressing cells. Methods: Immunohistochemical staining...... using antibodies against COX-2 was performed on paraffin sections of normal human eyes and selected eye tumours arising from cells expressing COX-2. Results: Cyclooxygenase-2 expression was found in various structures of the normal eye. Abundant expression was seen in the cornea, iris, ciliary body...... and retina. The COX-2 expression was less in tumours deriving from the ciliary epithelium and also in retinoblastoma. Conclusion: Cyclooxygenase-2 is constitutively expressed in normal human eyes. The expression of COX-2 is much lower in selected eye tumours involving COX-2 expressing cells....

  8. A novel generalized normal distribution for human longevity and other negatively skewed data.

    Science.gov (United States)

    Robertson, Henry T; Allison, David B

    2012-01-01

    Negatively skewed data arise occasionally in statistical practice; perhaps the most familiar example is the distribution of human longevity. Although other generalizations of the normal distribution exist, we demonstrate a new alternative that apparently fits human longevity data better. We propose an alternative approach of a normal distribution whose scale parameter is conditioned on attained age. This approach is consistent with previous findings that longevity conditioned on survival to the modal age behaves like a normal distribution. We derive such a distribution and demonstrate its accuracy in modeling human longevity data from life tables. The new distribution is characterized by 1. An intuitively straightforward genesis; 2. Closed forms for the pdf, cdf, mode, quantile, and hazard functions; and 3. Accessibility to non-statisticians, based on its close relationship to the normal distribution.

  9. Human osteoarthritic cartilage is synthetically more active but in culture less vital than normal cartilage

    NARCIS (Netherlands)

    Lafeber, F. P.; van Roy, H.; Wilbrink, B.; Huber-Bruning, O.; Bijlsma, J. W.

    1992-01-01

    The proteoglycan turnover of human osteoarthritic (OA) cartilage was compared to that of normal (N) cartilage. The cartilage was obtained postmortem from human femoral knee condyles. Short term cultures were compared to longterm cultures, and proteoglycan synthesis rate, content and release

  10. Identification of markers for quiescent pancreatic stellate cells in the normal human pancreas

    DEFF Research Database (Denmark)

    Nielsen, Michael Friberg Bruun; Mortensen, Michael Bau; Detlefsen, Sönke

    2017-01-01

    cells in the normal human pancreas and perisinusoidal cells in the normal human liver. The immunolabelling capacity was evaluated according to a semiquantitative scoring system. Double-IF of the markers of interest together with markers for other periacinar cells was performed. Moreover, the utility...... of histochemical stains for the identification of human qPSCs was examined, and their ultrastructure was revisited by electron microscopy. Adipophilin, CRBP-1, cytoglobin and vinculin were expressed in qHSCs in the liver, whereas cytoglobin and adipophilin were expressed in qPSCs in the pancreas. Adipophilin...... are markers of qPSCs in the normal human pancreas. However, the use of adipophilin as a qPSC marker may be limited due to its high dependence on optimal PATI. Cytoglobin, on the other hand, is a sensitive marker for qPSCs but is expressed in FBs as well....

  11. The expression of Egfl7 in human normal tissues and epithelial tumors.

    Science.gov (United States)

    Fan, Chun; Yang, Lian-Yue; Wu, Fan; Tao, Yi-Ming; Liu, Lin-Sen; Zhang, Jin-Fan; He, Ya-Ning; Tang, Li-Li; Chen, Guo-Dong; Guo, Lei

    2013-04-23

    To investigate the expression of Egfl7 in normal adult human tissues and human epithelial tumors.
 RT-PCR and Western blot were employed to detect Egfl7 expression in normal adult human tissues and 10 human epithelial tumors including hepatocellular carcinoma (HCC), lung cancer, breast cancer, prostate cancer, colorectal cancer, gastric cancer, esophageal cancer, malignant glioma, ovarian cancer and renal cancer. Immunohistochemistry and cytoimmunofluorescence were subsequently used to determine the localization of Egfl7 in human epithelial tumor tissues and cell lines. ELISA was also carried out to examine the serum Egfl7 levels in cancer patients. In addition, correlations between Egfl7 expression and clinicopathological features as well as prognosis of HCC and breast cancer were also analyzed on the basis of immunohistochemistry results.
 Egfl7 was differentially expressed in 19 adult human normal tissues and was overexpressed in all 10 human epithelial tumor tissues. The serum Egfl7 level was also significantly elevated in cancer patients. The increased Egfl7 expression in HCC correlated with vein invasion, absence of capsule formation, multiple tumor nodes and poor prognosis. Similarly, upregulation of Egfl7 in breast cancer correlated strongly with TNM stage, lymphatic metastasis, estrogen receptor positivity, Her2 positivity and poor prognosis. 
 Egfl7 is significantly upregulated in human epithelial tumor tissues, suggesting Egfl7 to be a potential biomarker for human epithelial tumors, especially HCC and breast cancer.

  12. ProNormz--an integrated approach for human proteins and protein kinases normalization.

    Science.gov (United States)

    Subramani, Suresh; Raja, Kalpana; Natarajan, Jeyakumar

    2014-02-01

    The task of recognizing and normalizing protein name mentions in biomedical literature is a challenging task and important for text mining applications such as protein-protein interactions, pathway reconstruction and many more. In this paper, we present ProNormz, an integrated approach for human proteins (HPs) tagging and normalization. In Homo sapiens, a greater number of biological processes are regulated by a large human gene family called protein kinases by post translational phosphorylation. Recognition and normalization of human protein kinases (HPKs) is considered to be important for the extraction of the underlying information on its regulatory mechanism from biomedical literature. ProNormz distinguishes HPKs from other HPs besides tagging and normalization. To our knowledge, ProNormz is the first normalization system available to distinguish HPKs from other HPs in addition to gene normalization task. ProNormz incorporates a specialized synonyms dictionary for human proteins and protein kinases, a set of 15 string matching rules and a disambiguation module to achieve the normalization. Experimental results on benchmark BioCreative II training and test datasets show that our integrated approach achieve a fairly good performance and outperforms more sophisticated semantic similarity and disambiguation systems presented in BioCreative II GN task. As a freely available web tool, ProNormz is useful to developers as extensible gene normalization implementation, to researchers as a standard for comparing their innovative techniques, and to biologists for normalization and categorization of HPs and HPKs mentions in biomedical literature. URL: http://www.biominingbu.org/pronormz. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

    Directory of Open Access Journals (Sweden)

    Aurélie Hayez

    Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

  14. Effect of resveratrol and zinc on intracellular zinc status in normal human prostate epithelial cells

    Science.gov (United States)

    To evaluate the influence of resveratrol on cellular zinc status, normal human prostate epithelial (NHPrE) cells were treated with 6 levels of resveratrol (0, 0.5, 1, 2.5, 5 and 10 microM) and 4 levels of zinc [0, 4, 16, and 32 microM for zinc-deficient (ZD), zinc-normal (ZN), zinc-adequate (ZA), an...

  15. Duchenne Muscular Dystrophy Gene Expression in Normal and Diseased Human Muscle

    Science.gov (United States)

    Oronzi Scott, M.; Sylvester, J. E.; Heiman-Patterson, T.; Shi, Y.-J.; Fieles, W.; Stedman, H.; Burghes, A.; Ray, P.; Worton, R.; Fischbeck, K. H.

    1988-03-01

    A probe for the 5' end of the Duchenne muscular dystrophy (DMD) gene was used to study expression of the gene in normal human muscle, myogenic cell cultures, and muscle from patients with DMD. Expression was found in RNA from normal fetal muscle, adult cardiac and skeletal muscle, and cultured muscle after myoblast fusion. In DMD muscle, expression of this portion of the gene was also revealed by in situ RNA hybridization, particularly in regenerating muscle fibers.

  16. Validation of endogenous normalizing genes for expression analyses in adult human testis and germ cell neoplasms.

    Science.gov (United States)

    Svingen, T; Jørgensen, A; Rajpert-De Meyts, E

    2014-08-01

    The measurement of gene expression levels in cells and tissues typically depends on a suitable point of reference for inferring biological relevance. For quantitative (or real-time) RT-PCR assays, the method of choice is often to normalize gene expression data to an endogenous gene that is stably expressed across the samples analysed: a so-called normalizing or housekeeping gene. Although this is a valid strategy, the identification of stable normalizing genes has proved challenging and a gene showing stable expression across all cells or tissues is unlikely to exist. Therefore, it is necessary to define suitable normalizing genes for specific cells and tissues. Here, we report on the performance of a panel of nine commonly employed normalizing genes in adult human testis and testicular pathologies. Our analyses revealed significant variability in transcript abundance for commonly used normalizers, highlighting the importance of selecting appropriate normalizing genes as comparative measurements can yield variable results when different normalizing genes are employed. Based on our results, we recommend using RPS20, RPS29 or SRSF4 when analysing relative gene expression levels in human testis and associated testicular pathologies. OCT4 and SALL4 can be used with caution as second-tier normalizers when determining changes in gene expression in germ cells and germ cell tumour components, but the relative transcript abundance appears variable between different germ cell tumour types. We further recommend that such studies should be accompanied by additional assessment of histology and cellularity of each sample. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle

    Science.gov (United States)

    Sakhnini, Lama

    2003-05-01

    In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

  18. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer.

    Science.gov (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim

    2012-04-17

    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  19. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania.

    Science.gov (United States)

    Mwakigonja, Amos Rodger; Lushina, Nyanda Elias; Mwanga, Ally

    2017-01-01

    Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu) expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH). A cross-sectional study of female breast post-modified radical mastectomy (MRM)/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January-December 2013). Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER), and progesterone (PgR) receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS). A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18-75 years and mean age was 48.36 years. Majority (64.3%) were in the 36-55 years age-group. Histologically, most (88.6%) women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78%) were stage three. Due to logistical constrains, 75.7% ( n  = 53/70) cases where immunostained for hormones including 43.4% (ER+), 26.4% (PgR+), and 28% (ER+/PgR+). Furthermore, 65.7% ( n  = 46/70) cases were immunostained for HER-2 and 15.2% ( n  = 7/46) were positive, 45.6% were triple negative (ER-,PgR-,HER2-), 23.9% (ER+,PgR+,HER2-) or luminal B, 2.2% (ER+,PgR-,HER2+),13% (ER-,PgR-,HER2+) and 15% (ER+,PgR-,HER2-) with none being triple positive. Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion of triple negative breast carcinomas (TNBC) is

  20. Characterization of hormonal receptors and human epidermal growth factor receptor-2 in tissues of women with breast cancer at Muhimbili National Hospital, Dar es salaam, Tanzania

    Directory of Open Access Journals (Sweden)

    Amos Rodger Mwakigonja

    2017-11-01

    Full Text Available Abstract Background Breast cancer is a leading cause of morbidity and deaths among women worldwide. In Tanzania there is no published data on human epidermal growth receptor-2 (HER2/neu expression in breast carcinoma. Hormonal receptors and HER2/neu status reportedly influence post-mastectomy adjuvant therapy and predict treatment outcome and prognosis. Here we evaluate hormonal receptors and HER-2 status in biopsies of women with breast cancer at Muhimbili National Hospital (MNH. Methods A cross-sectional study of female breast post-modified radical mastectomy (MRM/incisional biopsies confirmed to be carcinoma at the Histopathology Unit (January–December 2013. Tissue blocks having poor morphology, without tumor, secondary tumors, cases outside the study period and male patients were excluded. Routine staining was done followed by immunohistochemistry for estrogen (ER, and progesterone (PgR receptors and HER2. Data analyzed using Statistical Package for Social Sciences (SPSS. Results A total of 218 cases were confirmed to be carcinoma including 70 meeting inclusion criteria. Age at diagnosis ranged 18–75 years and mean age was 48.36 years. Majority (64.3% were in the 36–55 years age-group. Histologically, most (88.6% women had invasive ductal carcinoma including 43.1% of intermediate grade. A great majority (78% were stage three. Due to logistical constrains, 75.7% (n = 53/70 cases where immunostained for hormones including 43.4% (ER+, 26.4% (PgR+, and 28% (ER+/PgR+. Furthermore, 65.7% (n = 46/70 cases were immunostained for HER-2 and 15.2% (n = 7/46 were positive, 45.6% were triple negative (ER-,PgR-,HER2-, 23.9% (ER+,PgR+,HER2- or luminal B, 2.2% (ER+,PgR-,HER2+,13% (ER-,PgR-,HER2+ and 15% (ER+,PgR-,HER2- with none being triple positive. Conclusions Hormonal receptors and HER2 expression at MNH appears to be comparable to previous Africans/African Americans reports but not with studies among Caucasians and the current proportion

  1. Budget impact analysis of everolimus for the treatment of hormone receptor positive, human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer in the United States.

    Science.gov (United States)

    Xie, Jipan; Diener, Melissa; De, Gourab; Yang, Hongbo; Wu, Eric Q; Namjoshi, Madhav

    2013-01-01

    To estimate the budget impact of everolimus as the first and second treatment option after letrozole or anastrozole (L/A) failure for post-menopausal women with hormone receptor positive (HR+), human epidermal growth factor receptor-2 negative (HER2-) advanced breast cancer (ABC). Pharmacy and medical budget impacts (2011 USD) were estimated over the first year of everolimus use in HR+, HER2- ABC from a US payer perspective. Epidemiology data were used to estimate target population size. Pre-everolimus entry treatment options included exemestane, fulvestrant, and tamoxifen. Pre- and post-everolimus entry market shares were estimated based on market research and assumptions. Drug costs were based on wholesale acquisition cost. Patients were assumed to be on treatment until progression or death. Annual medical costs were calculated as the average of pre- and post-progression medical costs weighted by the time in each period, adjusted for survival. One-way and two-way sensitivity analyses were conducted to assess the model robustness. In a hypothetical 1,000,000 member plan, 72 and 159 patients were expected to be candidates for everolimus treatment as first and second treatment option, respectively, after L/A failure. The total budget impact for the first year post-everolimus entry was $0.044 per member per month [PMPM] (pharmacy budget: $0.058 PMPM; medical budget: -$0.014 PMPM), assuming 10% of the target population would receive everolimus. The total budget impacts for the first and second treatment options after L/A failure were $0.014 PMPM (pharmacy budget: $0.018; medical budget: -$0.004) and $0.030 PMPM (pharmacy budget: $0.040; medical budget: -$0.010), respectively. Results remained robust in sensitivity analyses. Assumptions about some model input parameters were necessary and may impact results. Increased pharmacy costs for HR+, HER2- ABC following everolimus entry are expected to be partially offset by reduced medical service costs. Pharmacy and total

  2. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Translational Breast Cancer Research Consortium (TBCRC) 022: A Phase II Trial of Neratinib for Patients With Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer and Brain Metastases.

    Science.gov (United States)

    Freedman, Rachel A; Gelman, Rebecca S; Wefel, Jeffrey S; Melisko, Michelle E; Hess, Kenneth R; Connolly, Roisin M; Van Poznak, Catherine H; Niravath, Polly A; Puhalla, Shannon L; Ibrahim, Nuhad; Blackwell, Kimberly L; Moy, Beverly; Herold, Christina; Liu, Minetta C; Lowe, Alarice; Agar, Nathalie Y R; Ryabin, Nicole; Farooq, Sarah; Lawler, Elizabeth; Rimawi, Mothaffar F; Krop, Ian E; Wolff, Antonio C; Winer, Eric P; Lin, Nancy U

    2016-03-20

    Evidence-based treatments for metastatic, human epidermal growth factor receptor 2 (HER2)-positive breast cancer in the CNS are limited. Neratinib is an irreversible inhibitor of erbB1, HER2, and erbB4, with promising activity in HER2-positive breast cancer; however, its activity in the CNS is unknown. We evaluated the efficacy of treatment with neratinib in patients with HER2-positive breast cancer brain metastases in a multicenter, phase II open-label trial. Eligible patients were those with HER2-positive brain metastases (≥ 1 cm in longest dimension) who experienced progression in the CNS after one or more line of CNS-directed therapy, such as whole-brain radiotherapy, stereotactic radiosurgery, and/or surgical resection. Patients received neratinib 240 mg orally once per day, and tumors were assessed every two cycles. The primary endpoint was composite CNS objective response rate (ORR), requiring all of the following: ≥ 50% reduction in volumetric sum of target CNS lesions and no progression of non-target lesions, new lesions, escalating corticosteroids, progressive neurologic signs/symptoms, or non-CNS progression--the threshold for success was five of 40 responders. Forty patients were enrolled between February 2012 and June 2013; 78% of patients had previous whole-brain radiotherapy. Three women achieved a partial response (CNS objective response rate, 8%; 95% CI, 2% to 22%). The median number of cycles received was two (range, one to seven cycles), with a median progression-free survival of 1.9 months. Five women received six or more cycles. The most common grade ≥ 3 event was diarrhea (occurring in 21% of patients taking prespecified loperamide prophylaxis and 28% of those without prophylaxis). Patients in the study experienced a decreased quality of life over time. Although neratinib had low activity and did not meet our threshold for success, 12.5% of patients received six or more cycles. Studies combining neratinib with chemotherapy in patients

  4. Lapatinib or Trastuzumab Plus Taxane Therapy for Human Epidermal Growth Factor Receptor 2-Positive Advanced Breast Cancer: Final Results of NCIC CTG MA.31.

    Science.gov (United States)

    Gelmon, Karen A; Boyle, Frances M; Kaufman, Bella; Huntsman, David G; Manikhas, Alexey; Di Leo, Angelo; Martin, Miguel; Schwartzberg, Lee S; Lemieux, Julie; Aparicio, Samuel; Shepherd, Lois E; Dent, Susan; Ellard, Susan L; Tonkin, Katia; Pritchard, Kathleen I; Whelan, Timothy J; Nomikos, Dora; Nusch, Arnd; Coleman, Robert E; Mukai, Hirofumi; Tjulandin, Sergei; Khasanov, Rustem; Rizel, Shulamith; Connor, Anne P; Santillana, Sergio L; Chapman, Judith-Anne W; Parulekar, Wendy R

    2015-05-10

    The efficacy of lapatinib versus trastuzumab combined with taxanes in the first-line setting of human epidermal growth factor receptor 2 (HER2) -positive metastatic breast cancer (BC) is unknown. The MA.31 trial compared a combination of first-line anti-HER2 therapy (lapatinib or trastuzumab) and taxane therapy for 24 weeks, followed by the same anti-HER2 monotherapy until progression. Stratification was by prior (neo)adjuvant anti-HER2 therapy, prior (neo)adjuvant taxane, planned taxane, and liver metastases. The primary end point was intention-to-treat (ITT) progression-free survival (PFS), defined as time from random assignment to progression by RECIST (version 1.0) criteria, or death for patients with locally assessed HER2-positive tumors. The primary test statistic was a stratified log-rank test for noninferiority. PFS was also assessed for patients with centrally confirmed HER2-positive tumors. From July 17, 2008, to December 1, 2011, 652 patients were accrued from 21 countries, resulting in 537 patients with centrally confirmed HER2-positive tumors. Median follow-up was 21.5 months. Median ITT PFS was 9.0 months with lapatinib and 11.3 months with trastuzumab. By ITT analysis, PFS was inferior for lapatinib compared with trastuzumab, with a stratified hazard ratio (HR) of 1.37 (95% CI, 1.13 to 1.65; P = .001). In patients with centrally confirmed HER2-positive tumors, median PFS was 9.1 months with lapatinib and 13.6 months with trastuzumab (HR, 1.48; 95% CI, 1.20 to 1.83; P < .001). More grade 3 or 4 diarrhea and rash were observed with lapatinib (P < .001). PFS results were supported by the secondary end point of overall survival, with an ITT HR of 1.28 (95% CI, 0.95 to 1.72; P = .11); in patients with centrally confirmed HER2-positive tumors, the HR was 1.47 (95% CI, 1.03 to 2.09; P = .03). As first-line therapy for HER2-positive metastatic BC, lapatinib combined with taxane was associated with shorter PFS and more toxicity compared with trastuzumab

  5. Cultivation and irradiation of human fibroblasts in a medium enriched with platelet lysate for obtaining feeder layer in epidermal cell culture; Cultivo e irradiacao de fibroblastos humanos em meio enriquecido com lisado de plaquetas para obtencao de camada de sustentacao em culturas de celulas da epiderme

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele

    2011-07-01

    For over 30 years, the use of culture medium, enriched with bovine serum, and murines fibroblasts, with the rate of proliferation controlled by irradiation or by share anticarcinogenic drugs, has been playing successfully its role in assisting in the development of keratinocytes in culture, for clinical purposes. However, currently there is a growing concern about the possibility of transmitting prions and animals viruses to transplanted patients. Taking into account this concern, the present work aims to cultivate human fibroblasts in a medium enriched with human platelets lysate and determine the irradiation dose of these cells, for obtaining feeder layer in epidermal cell culture. For carrying out the proposed objective, platelets lysis has standardized, this lysate was used for human fibroblasts cultivation and the irradiation dose enough to inhibit its duplication was evaluated. Human keratinocytes were cultivated in these feeder layers, in culture medium enriched with the lysate. With these results we conclude that the 10% platelets lysate promoted a better adhesion and proliferation of human fibroblasts and in all dose levels tested (60 to 300 Gy), these had their mitotic activity inactivated by ionizing irradiation, being that the feeder layers obtained with doses from 70 to 150 Gy were those that provided the best development of keratinocytes in medium containing 2.5% of human platelet lysate. Therefore, it was possible to standardize both the cultivation of human fibroblasts as its inactivation for use as feeder layer in culture of keratinocytes, so as to eliminate xenobiotics components. (author)

  6. Identification of markers for quiescent pancreatic stellate cells in the normal human pancreas.

    Science.gov (United States)

    Nielsen, Michael Friberg Bruun; Mortensen, Michael Bau; Detlefsen, Sönke

    2017-10-01

    Pancreatic stellate cells (PSCs) play a central role as source of fibrogenic cells in pancreatic cancer and chronic pancreatitis. In contrast to quiescent hepatic stellate cells (qHSCs), a specific marker for quiescent PSCs (qPSCs) that can be used in formalin-fixed and paraffin embedded (FFPE) normal human pancreatic tissue has not been identified. The aim of this study was to identify a marker enabling the identification of qPSCs in normal human FFPE pancreatic tissue. Immunohistochemical (IHC), double-IHC, immunofluorescence (IF) and double-IF analyses were carried out using a tissue microarray consisting of cores with normal human pancreatic tissue. Cores with normal human liver served as control. Antibodies directed against adipophilin, α-SMA, CD146, CRBP-1, cytoglobin, desmin, GFAP, nestin, S100A4 and vinculin were examined, with special emphasis on their expression in periacinar cells in the normal human pancreas and perisinusoidal cells in the normal human liver. The immunolabelling capacity was evaluated according to a semiquantitative scoring system. Double-IF of the markers of interest together with markers for other periacinar cells was performed. Moreover, the utility of histochemical stains for the identification of human qPSCs was examined, and their ultrastructure was revisited by electron microscopy. Adipophilin, CRBP-1, cytoglobin and vinculin were expressed in qHSCs in the liver, whereas cytoglobin and adipophilin were expressed in qPSCs in the pancreas. Adipophilin immunohistochemistry was highly dependent on the preanalytical time interval (PATI) from removal of the tissue to formalin fixation. Cytoglobin, S100A4 and vinculin were expressed in periacinar fibroblasts (FBs). The other examined markers were negative in human qPSCs. Our data indicate that cytoglobin and adipophilin are markers of qPSCs in the normal human pancreas. However, the use of adipophilin as a qPSC marker may be limited due to its high dependence on optimal PATI

  7. Secretion of human epidermal growth factor (EGF) in autotrophic culture by a recombinant hydrogen-utilizing bacterium, Pseudomonas pseudoflava, carrying broad-host-range EGF secretion vector pKSEGF2.

    OpenAIRE

    Hayase, N; Ishiyama, A; Niwano, M

    1994-01-01

    We constructed the broad-host-range human epidermal growth factor (EGF) secretion plasmid pKSEGF2 by inserting the Escherichia coli tac promoter, the signal sequence of Pseudomonas stutzeri amylase, and the synthesized EGF gene into the broad-host-range vector pKT230. E. coli JM109 carrying pKSEGF2 secreted EGF into the periplasm and the culture medium under the control of the tac promoter. Pseudomonas aeruginosa PAO1161 carrying pKSEGF2 and Pseudomonas putida AC10 carrying pKSEGF2 secreted E...

  8. The distribution of YKL-40 in osteoarthritic and normal human articular cartilage

    DEFF Research Database (Denmark)

    Volck, B; Ostergaard, K; Johansen, J S

    1999-01-01

    YKL-40, also called human cartilage glycoprotein-39, is a major secretory protein of human chondrocytes in cell culture. YKL-40 mRNA is expressed by cartilage from patients with rheumatoid arthritis, but is not detectable in normal human cartilage. The aim was to investigate the distribution of YKL......-40 in osteoarthritic (n=9) and macroscopically normal (n=5) human articular cartilage, collected from 12 pre-selected areas of the femoral head, to discover a potential role for YKL-40 in cartilage remodelling in osteoarthritis. Immunohistochemical analysis showed that YKL-40 staining was found...... in chondrocytes of osteoarthritic cartilage mainly in the superficial and middle zone of the cartilage rather than the deep zone. There was a tendency for high number of YKL-40 positive chondrocytes in areas of the femoral head with a considerable biomechanical load. The number of chondrocytes with a positive...

  9. Gestational trophoblastic neoplasia after spontaneous human chorionic gonadotropin normalization following molar pregnancy evacuation.

    Science.gov (United States)

    Braga, Antonio; Maestá, Izildinha; Matos, Michelle; Elias, Kevin M; Rizzo, Julianna; Viggiano, Maurício Guilherme Campos

    2015-11-01

    To evaluate the risk of gestational trophoblastic neoplasia (GTN) after spontaneous human chorionic gonadotropin normalization in postmolar follow-up. Retrospective chart review of 2284 consecutive cases of hydatidiform mole with spontaneous normalization of hCG following uterine evacuation treated at one of five Brazilian reference centers from January 2002 to June 2013. After hCG normalization, GTN occurred in 10/2284 patients (0.4%; 95% CI 0.2%-0.8%). GTN developed in 9/1424 patients (0.6%; 95% CI 0.3%-1.2%) after a complete hydatidiform mole, in 1/849 patients (0.1%; 95% CInormalization was 18months, and no diagnoses were made before six months of postmolar surveillance. Patients who required more than 56days to achieve a normal hCG value had a ten-fold increased risk of developing GTN after hCG normalization (9/1074; 0.8%; 95% CI 0.4%-1.6%) compared to those who reached a normal hCG level in fewer than 56days (1/1210;0.08%; 95% CInormalization following molar pregnancy is exceedingly rare, and the few patients who do develop GTN after achieving a normal hCG value are likely to be diagnosed after completing the commonly recommended six months of postmolar surveillance. Current recommendations for surveillance after hCG normalization should be revisited. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Gamma-ray excision repair in normal and diseased human cells

    International Nuclear Information System (INIS)

    Cerutti, P.A.; Remsen, J.F.

    1976-01-01

    Radiation products of the 5,6-dihydroxy-dihydrothymine type (t') are efficiently removed from the DNA during postirradiation incubation of bacterial and mammalian cells. In this chapter we describe the t'-excision system contained in normal human cells, in human carcinoma HeLa S-3 cells, and in skin fibroblasts from xeroderma pigmentosum (XP) and Fanconi's anemia (FA) patients. The latter diseases are characterized among other symptoms by a genetically increased susceptibility for the development of cancer

  11. Immunohistochemical analysis of Sonic hedgehog signalling in normal human urinary tract development

    OpenAIRE

    Jenkins, Dagan; Winyard, Paul J D; Woolf, Adrian S.

    2007-01-01

    Studies of mouse mutants have demonstrated that Sonic hedgehog (SHH) signalling has a functional role in morphogenesis and differentiation at multiple sites within the forming urinary tract, and urinary tract malformations have been reported in humans with mutations that disrupt SHH signalling. However, there is only strikingly sparse and fragmentary information about the expression of SHH and associated signalling genes in normal human urinary tract development. We used immunohistochemistry ...

  12. [Effect of low-energy 633 nm red light stimulation on proliferation and reactive oxygen species level of human epidermal cell line HaCaT].

    Science.gov (United States)

    Chen, Z Y; Li, D L; Duan, X D; Peng, D Z

    2016-09-20

    To investigate the changes of proliferative activity and reactive oxygen species level of human epidermal cell line HaCaT after being irradiated with low-energy 633 nm red light. Irradiation distance was determined through preliminary experiment. HaCaT cells were conventionally sub-cultured with RPMI 1640 culture medium containing 10% fetal calf serum, 100 U/mL penicillin, and 100 μg/mL streptomycin. Cells of the third passage were used in the following experiments. (1) Cells were divided into blank control group and 0.082, 0.164, 0.245, 0.491, 1.472, 2.453, 4.910, and 9.810 J/cm(2) irradiation groups according to the random number table, with 3 wells in each group. Cells in blank control group were not irradiated, while cells in the latter 8 irradiation groups were irradiated with 633 nm red light for 10, 20, 30, 60, 180, 300, 600, and 1 200 s in turn. Cells were reirradiated once every 8 hours. After being irradiated for 48 hours (6 times) in irradiation groups, the proliferative activity of cells in 9 groups was determined with cell counting kit 8 and microplate reader (denoted as absorbance value). (2) Another batch of cells were grouped and irradiated as in experiment (1). After being irradiated for once in irradiation groups, cells in 9 groups were conventionally cultured for 60 min with detection reagent of reactive oxygen species. At post culture minute (PCM) 0 (immediately), 30, 60, and 120, reactive oxygen species level of cells was determined with microplate reader (denoted as absorbance value). (3) Another batch of cells were divided into blank control group, 0.082, 0.491, 2.453, and 9.810 J/cm(2) irradiation groups, and positive control group. Cells in blank control group and positive control group were not irradiated (positive control reagent of reactive oxygen species was added to cells in positive control group), and cells in irradiation groups were irradiated as in experiment (1) for once. The expression of reactive oxygen species in cells of each

  13. Inhibition of Epidermal Growth Factor Receptor and Vascular Endothelial Growth Factor Receptor Phosphorylation on Tumor-Associated Endothelial Cells Leads to Treatment of Orthotopic Human Colon Cancer in Nude Mice

    Directory of Open Access Journals (Sweden)

    Takamitsu Sasaki

    2007-12-01

    Full Text Available The purpose of our study was to determine whether the dual inhibition of epidermal growth factor receptor (EGFR and vascular endothelial growth factor receptor (VEGFR signaling pathways in tumor-associated endothelial cells can inhibit the progressive growth of human colon carcinoma in the cecum of nude mice. SW620CE2 human colon cancer cells growing in culture and orthotopically in the cecum of nude mice expressed a high level of transforming growth factor alpha (TGF-α and vascular endothelial growth factor (VEGF but were negative for EGFR, human epidermal growth factor receptor 2 (HER2, VEGFR. Double immunofluorescence staining revealed that tumorassociated endothelial cells expressed EGFR, VEGFR2, phosphorylated EGFR (pEGFR, phosphorylated VEGFR (pVEGFR. Treatment of mice with either 7H-pyrrolo [2,3-d]-pyrimidine lead scaffold (AEE788; an inhibitor of EGFR and VEGFR tyrosine kinase or CPT-11 as single agents significantly inhibited the growth of cecal tumors (P < .01; this decrease was even more pronounced with AEE788 combined with CPT-11 (P < .001. AEE788 alone or combined with CPT-11 also inhibited the expression of pEGFR and pVEGFR on tumor-associated endothelial cells, significantly decreased vascularization and tumor cell proliferation, increased the level of apoptosis in both tumorassociated endothelial cells and tumor cells. These data demonstrate that targeting EGFR and VEGFR signaling on tumor-associated endothelial cells provides a viable approach for the treatment of colon cancer.

  14. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    Energy Technology Data Exchange (ETDEWEB)

    Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

    2011-12-15

    We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

  15. Dopamine D2 receptor expression in the corticotroph cells of the human normal pituitary gland.

    Science.gov (United States)

    Pivonello, Rosario; Waaijers, Marlijn; Kros, Johan M; Pivonello, Claudia; de Angelis, Cristina; Cozzolino, Alessia; Colao, Annamaria; Lamberts, Steven W J; Hofland, Leo J

    2017-08-01

    The dopamine D 2 receptor is the main dopamine receptor expressed in the human normal pituitary gland. The aim of the current study was to evaluate dopamine D 2 receptor expression in the corticotroph cell populations of the anterior lobe and pars intermedia, as well as posterior lobe of the human normal pituitary gland by immunohistochemistry. Human normal pituitary gland samples obtained from routine autopsies were used for the study. In all cases, histology together with immunostaining for adrenocorticotropic hormone, melanocyte-stimulating hormone, prolactin, and neurofilaments were performed and compared to the immunostaining for D 2 receptor. D 2 receptor was heterogeneously expressed in the majority of the cell populations of the anterior and posterior lobe as well as in the area localized between the anterior and posterior lobe, and arbitrary defined as "intermediate zone". This zone, characterized by the presence of nerve fibers included the residual pars intermedia represented by the colloid-filled cysts lined by the remnant melanotroph cells strongly expressing D 2 receptors, and clusters of corticotroph cells, belonging to the anterior lobe but localized within the cysts and adjacent to the posterior lobe, variably expressing D 2 receptors. D 2 dopamine receptor is expressed in the majority of the cell populations of the human normal pituitary gland, and particularly, in the different corticotroph cell populations localized in the anterior lobe and the intermediate zone of the pituitary gland.

  16. Distortion-Product Otoacoustic Emission Measured Below 300 Hz in Normal-Hearing Human Subjects

    DEFF Research Database (Denmark)

    Christensen, Anders Tornvig; Ordoñez Pizarro, Rodrigo Eduardo; Hammershøi, Dorte

    2017-01-01

    , a custom-built low-frequency acoustic probe was put to use in 21 normal-hearing human subjects (of 34 recruited). Distortion-product otoacoustic emission (DPOAE) was measured in the enclosed ear canal volume as the response to two simultaneously presented tones with frequencies f1 and f2. The stimulus...

  17. Primary pulmonary choriocarcinoma after human chorionic gonadotropin normalization following hydatidiform mole

    DEFF Research Database (Denmark)

    Maestá, Izildinha; Leite, Fábio Vicente; Michelin, Odair Carlito

    2010-01-01

    BACKGROUND: Primary pulmonary choriocarcinoma (PPC) is rare and frequently leads to death. CASES: Two young patients presented with previous molar pregnancy and spontaneous serum human chorionic gonadotropin (hCG) normalization. Patient 1 was referred to our center after partial response to chemo...

  18. Stable radioresistance in ataxia-telangiectasia cells containing DNA from normal human cells

    International Nuclear Information System (INIS)

    Kapp, L.N.; Painter, R.B.

    1989-01-01

    SV40-transformed ataxia-telangiectasia (AT) cells were transfected with a cosmid containing a normal human DNA library and selectable marker, the neo gene, which endows successfully transformed mammalian cells with resistance to the antibiotic G418. Cells from this line were irradiated with 50 Gy of X-rays and fused with non-transfected AT cells. Among the G418-resistant colonies recovered was one stably resistant to radiation. Resistance to ionizing radiation of both primary transfectant line and its fusion derivative was intermediate between that of AT cells and normal cells, as assayed by colony-forming ability and measurement of radiation-induced G 2 chromatic aberrations; both cell lines retained AT-like radioresistant DNA synthesis. Results suggest that, because radioresistance in transfected cells was not as great as in normal human cells, two hallmarks of AT, radiosensitivity and radioresistant DNA synthesis, may still be the result of a single defective AT gene. (author)

  19. Identification of normal and cancerous human colorectal muscularis propria by multiphoton microscopy in different sections

    International Nuclear Information System (INIS)

    Zhou, Yi; Li, Lianhuang; Zhuo, Shuangmu; Zhu, Xiaoqin; Chen, Jianxin; Chen, Zhifen; Guan, Guoxian; Kang, Deyong

    2016-01-01

    Multiphoton microscopy (MPM) based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) as a potential diagnostic tool is attractive. MPM can effectively provide information about morphological and biochemical changes in biological tissues at the molecular level. In this paper, we attempt to identify normal and cancerous human colorectal muscularis propria by multiphoton microscopy in different sections (both in transverse and longitudinal sections). The results show that MPM can display different microstructure changes in the transverse and longitudinal sections of colorectal muscularis propria. MPM also can quantitatively describe the alteration of collagen content between normal and cancerous muscle layers. These are important pathological findings that MPM images can bring more detailed complementary information about tissue architecture and cell morphology through observing the transverse and longitudinal sections of colorectal muscularis propria. This work demonstrates that MPM can be better for identifying the microstructural characteristics of normal and cancerous human colorectal muscularis propria in different sections. (paper)

  20. Response of cultured normal human mammary epithelial cells to X rays

    International Nuclear Information System (INIS)

    Yang, T.C.; Stampfer, M.R.; Smith, H.S.

    1983-01-01

    The effect of X rays on the reproductive death of cultured normal human mammary epithelial cells was examined. Techniques were developed for isolating and culturing normal human mammary epithelial cells which provide sufficient cells at second passage for radiation studies, and an efficient clonogenic assay suitable for measuring radiation survival curves. It was found that the survival curves for epithelial cells from normal breast tissue were exponential and had D 0 values of about 109-148 rad for 225 kVp X rays. No consistent change in cell radiosensitivity with the age of donor was observed, and no sublethal damage repair in these cells could be detected with the split-dose technique

  1. Cdx2 modulates proliferation in normal human intestinal epithelial crypt cells

    International Nuclear Information System (INIS)

    Escaffit, Fabrice; Pare, Frederic; Gauthier, Remy; Rivard, Nathalie; Boudreau, Francois; Beaulieu, Jean-Francois

    2006-01-01

    The homeobox gene Cdx2 is involved in the regulation of the expression of intestine specific markers such as sucrase-isomaltase and lactase-phlorizin hydrolase. Previous studies performed with immortalized or transformed intestinal cell lines have provided evidence that Cdx2 can promote morphological and functional differentiation in these experimental models. However, no data exist concerning the implication of this factor in normal human intestinal cell physiology. In the present work, we have investigated the role of Cdx2 in normal human intestinal epithelial crypt (HIEC) cells that lack this transcription factor. The establishment of HIEC cells expressing Cdx2 in an inducible manner shows that forced expression of Cdx2 significantly alters the proliferation of intestinal crypt cells and stimulates dipeptidylpeptidase IV expression but is not sufficient to trigger intestinal terminal differentiation. These observations suggest that Cdx2 requires additional factors to activate the enterocyte differentiation program in normal undifferentiated cells

  2. Identification of normal and cancerous human colorectal muscularis propria by multiphoton microscopy in different sections

    Science.gov (United States)

    Zhou, Yi; Chen, Zhifen; Kang, Deyong; li, Lianhuang; Zhuo, Shuangmu; Zhu, Xiaoqin; Guan, Guoxian; Chen, Jianxin

    2016-01-01

    Multiphoton microscopy (MPM) based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) as a potential diagnostic tool is attractive. MPM can effectively provide information about morphological and biochemical changes in biological tissues at the molecular level. In this paper, we attempt to identify normal and cancerous human colorectal muscularis propria by multiphoton microscopy in different sections (both in transverse and longitudinal sections). The results show that MPM can display different microstructure changes in the transverse and longitudinal sections of colorectal muscularis propria. MPM also can quantitatively describe the alteration of collagen content between normal and cancerous muscle layers. These are important pathological findings that MPM images can bring more detailed complementary information about tissue architecture and cell morphology through observing the transverse and longitudinal sections of colorectal muscularis propria. This work demonstrates that MPM can be better for identifying the microstructural characteristics of normal and cancerous human colorectal muscularis propria in different sections.

  3. Cell survival of human tumor cells compared with normal fibroblasts following 60Co gamma irradiation

    International Nuclear Information System (INIS)

    Lloyd, E.L.; Henning, C.B.; Reynolds, S.D.; Holmblad, G.L.; Trier, J.E.

    1982-01-01

    Three tumor cell lines, two of which were shown to be HeLa cells, were irradiated with 60 Co gamma irradiation, together with two cell cultures of normal human diploid fibroblasts. Cell survival was studied in three different experiments over a dose range of 2 to 14 gray. All the tumor cell lines showed a very wide shoulder in the dose response curves in contrast to the extremely narrow shoulder of the normal fibroblasts. In addition, the D/sub o/ values for the tumor cell lines were somewhat greater. These two characteristics of the dose response curves resulted in up to 2 orders of magnitude less sensitivity for cell inactivation of HeLa cells when compared with normal cells at high doses (10 gray). Because of these large differences, the extrapolation of results from the irradiation of HeLa cells concerning the mechanisms of normal cell killing should be interpreted with great caution

  4. The distribution of YKL-40 in osteoarthritic and normal human articular cartilage

    DEFF Research Database (Denmark)

    Volck, B; Ostergaard, K; Johansen, J S

    1999-01-01

    YKL-40, also called human cartilage glycoprotein-39, is a major secretory protein of human chondrocytes in cell culture. YKL-40 mRNA is expressed by cartilage from patients with rheumatoid arthritis, but is not detectable in normal human cartilage. The aim was to investigate the distribution of YKL...... in chondrocytes of osteoarthritic cartilage mainly in the superficial and middle zone of the cartilage rather than the deep zone. There was a tendency for high number of YKL-40 positive chondrocytes in areas of the femoral head with a considerable biomechanical load. The number of chondrocytes with a positive...

  5. Finite element based nonlinear normalization of human lumbar intervertebral disc stiffness to account for its morphology.

    Science.gov (United States)

    Maquer, Ghislain; Laurent, Marc; Brandejsky, Vaclav; Pretterklieber, Michael L; Zysset, Philippe K

    2014-06-01

    Disc degeneration, usually associated with low back pain and changes of intervertebral stiffness, represents a major health issue. As the intervertebral disc (IVD) morphology influences its stiffness, the link between mechanical properties and degenerative grade is partially lost without an efficient normalization of the stiffness with respect to the morphology. Moreover, although the behavior of soft tissues is highly nonlinear, only linear normalization protocols have been defined so far for the disc stiffness. Thus, the aim of this work is to propose a nonlinear normalization based on finite elements (FE) simulations and evaluate its impact on the stiffness of human anatomical specimens of lumbar IVD. First, a parameter study involving simulations of biomechanical tests (compression, flexion/extension, bilateral torsion and bending) on 20 FE models of IVDs with various dimensions was carried out to evaluate the effect of the disc's geometry on its compliance and establish stiffness/morphology relations necessary to the nonlinear normalization. The computed stiffness was then normalized by height (H), cross-sectional area (CSA), polar moment of inertia (J) or moments of inertia (Ixx, Iyy) to quantify the effect of both linear and nonlinear normalizations. In the second part of the study, T1-weighted MRI images were acquired to determine H, CSA, J, Ixx and Iyy of 14 human lumbar IVDs. Based on the measured morphology and pre-established relation with stiffness, linear and nonlinear normalization routines were then applied to the compliance of the specimens for each quasi-static biomechanical test. The variability of the stiffness prior to and after normalization was assessed via coefficient of variation (CV). The FE study confirmed that larger and thinner IVDs were stiffer while the normalization strongly attenuated the effect of the disc geometry on its stiffness. Yet, notwithstanding the results of the FE study, the experimental stiffness showed consistently

  6. Normalized Metadata Generation for Human Retrieval Using Multiple Video Surveillance Cameras

    Directory of Open Access Journals (Sweden)

    Jaehoon Jung

    2016-06-01

    Full Text Available Since it is impossible for surveillance personnel to keep monitoring videos from a multiple camera-based surveillance system, an efficient technique is needed to help recognize important situations by retrieving the metadata of an object-of-interest. In a multiple camera-based surveillance system, an object detected in a camera has a different shape in another camera, which is a critical issue of wide-range, real-time surveillance systems. In order to address the problem, this paper presents an object retrieval method by extracting the normalized metadata of an object-of-interest from multiple, heterogeneous cameras. The proposed metadata generation algorithm consists of three steps: (i generation of a three-dimensional (3D human model; (ii human object-based automatic scene calibration; and (iii metadata generation. More specifically, an appropriately-generated 3D human model provides the foot-to-head direction information that is used as the input of the automatic calibration of each camera. The normalized object information is used to retrieve an object-of-interest in a wide-range, multiple-camera surveillance system in the form of metadata. Experimental results show that the 3D human model matches the ground truth, and automatic calibration-based normalization of metadata enables a successful retrieval and tracking of a human object in the multiple-camera video surveillance system.

  7. Detection of genomic instability in normal human bronchial epithelial cells exposed to 238Pu

    International Nuclear Information System (INIS)

    Kennedy, C.H.; Fukushima, N.H.; Neft, R.E.; Lechner, J.F.

    1994-01-01

    Alpha particle-emitting radon daughters constitute a risk for development of lung cancer in humans. The development of this disease involves multiple genetic alterations. These changes and the time course they follow are not yet defined despite numerous in vitro endeavors to transform human lung cells with various physical or chemical agents. However, genomic instability, characterized both by structural and numerical chromosomal aberrations and by elevated rates of point mutations, is a common feature of tumor cells. Further, both types of genomic instability have been reported in the noncancerous progeny of normal murine hemopoietic cells exposed in vitro to α-particles. The purpose of this investigation was to determine if genomic instability is also a prominent feature of normal human bronchial epithelial cells exposed to α-particle irradiation from the decay of inhaled radon daughters

  8. The measurement of intrinsic cellular radiosensitivity in human tumours and normal tissues

    International Nuclear Information System (INIS)

    Lawton, P.A.

    1995-01-01

    Human tumour and normal cell radiosensitivity are thought to be important factors determining the response of tumour and normal tissues to radiotherapy, respectively. Clonogenic assays are the standard method for measuring radiosensitivity but they are of limited applicability for clinical use with fresh human tumours. The main aim of this work was to evaluate the Adhesive Tumour Cell Culture System (ATCCS), as a method for measuring the radiosensitivity of human tumours. A soft agar clonogenic assay, the modified Courtenay-Mills assay, was used as a standard to compare with the ATCCS. The demonstration that fibroblast contamination could occur with both assay methods led to the investigation of a new technique for removing unwanted fibroblasts from tumour cell suspensions and to the use of a multiwell assay for measuring fibroblast radiosensitivity. (author)

  9. The measurement of intrinsic cellular radiosensitivity in human tumours and normal tissues

    Energy Technology Data Exchange (ETDEWEB)

    Lawton, P.A.

    1995-12-31

    Human tumour and normal cell radiosensitivity are thought to be important factors determining the response of tumour and normal tissues to radiotherapy, respectively. Clonogenic assays are the standard method for measuring radiosensitivity but they are of limited applicability for clinical use with fresh human tumours. The main aim of this work was to evaluate the Adhesive Tumour Cell Culture System (ATCCS), as a method for measuring the radiosensitivity of human tumours. A soft agar clonogenic assay, the modified Courtenay-Mills assay, was used as a standard to compare with the ATCCS. The demonstration that fibroblast contamination could occur with both assay methods led to the investigation of a new technique for removing unwanted fibroblasts from tumour cell suspensions and to the use of a multiwell assay for measuring fibroblast radiosensitivity. (author).

  10. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    Science.gov (United States)

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT

  11. Human neural tuning estimated from compound action potentials in normal hearing human volunteers

    Science.gov (United States)

    Verschooten, Eric; Desloovere, Christian; Joris, Philip X.

    2015-12-01

    The sharpness of cochlear frequency tuning in humans is debated. Evoked otoacoustic emissions and psychophysical measurements suggest sharper tuning in humans than in laboratory animals [15], but this is disputed based on comparisons of behavioral and electrophysiological measurements across species [14]. Here we used evoked mass potentials to electrophysiologically quantify tuning (Q10) in humans. We combined a notched noise forward masking paradigm [9] with the recording of trans tympanic compound action potentials (CAP) from masked probe tones in awake human and anesthetized monkey (Macaca mulatta). We compare our results to data obtained with the same paradigm in cat and chinchilla [16], and find that CAP-Q10values in human are ˜1.6x higher than in cat and chinchilla and ˜1.3x higher than in monkey. To estimate frequency tuning of single auditory nerve fibers (ANFs) in humans, we derive conversion functions from ANFs in cat, chinchilla, and monkey and apply these to the human CAP measurements. The data suggest that sharp cochlear tuning is a feature of old-world primates.

  12. Radioimmunoassay of erythropoietin: circulating levels in normal and polycythemic human beings

    International Nuclear Information System (INIS)

    Garcia, J.F.; Ebbe, S.N.; Hollander, L.; Cutting, H.O.; Miller, M.E.; Cronkite, E.P.

    1982-01-01

    Techniques are described in detail for the RIA of human Ep in unextracted plasma or serum. With 100 μl of sample, the assay is sensitive at an Ep concentration of approximately 4 mU/ml, and when required, the sensitivity can be increased to 0.4 mU/ml, a range considerably less than the concentration observed in normal human beings. This is approximately 100 times more sensitive than existing in vivo bioassays for this hormone. Studies concerned with the validation of the Ep RIA show a high degree of correlation with the polycythemic mouse bioassay. Dilutions of a variety of human serum samples show a parallel relationship with the standard reference preparation for Ep. Validation of the RIA is further confirmed by observations of appropriate increases or decreases of circulating Ep levels in physiological and clinical conditions known to be associated with stimulation or suppression of Ep secretion. Significantly different mean serum concentrations of 17.2 mU/ml for normal male subjects and 18.8 mU/ml for normal female subjects were observed. Mean plasma Ep concentrations in patients with polycythemia vera are significantly decreased, and those of patients with secondary polycythemia are significantly increased as compared to plasma levels in normal subjects. These results demonstrate an initial practical value of the Ep RA in the hematology clinic, which will most certainly be expanded with its more extensive use

  13. Human-Machine interface for off normal and emergency situations in nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Kee Choon [Korea Atomic Energy Research Institute, Taejeon (Korea)

    2000-01-01

    Many nuclear power plants (NPPs) have reported that a high percentage of all major failures in the plants are caused by human errors. Therefore, there has been much focus on elimination of human errors, enhancement of human performance, and general improvement of human machine interface (HMI). Both the utility management and the regulators are demanding improvement in this area. The International Atomic Energy Agency (IAEA) Specialists' Meeting on 'Human-Machine Interface for Off Normal and Emergency Situations in Nuclear Power Plants' was co-organized by the Korea Atomic Energy Research Institute (KAERI) and the Korea Power Engineering Company, INC (KOPEC), and took place in Taejeon, Republic of Korea, 1999 October 26-28. Fifty eight participants, representing nine member countries reviewed recent developments and discussed directions for future efforts in the Human-Machine Interface for Off Normal and Emergency Situations in NPPs. Twenty papers were presented, covering a wide spectrum of technical and scientific subjects including recent experience and benefits from Operational Experience with HMI, Development of HMI System, Licensing Issues for HMI and Future Development and Trends. (Author)

  14. Human-Machine interface for off normal and emergency situations in nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Kee Choon [Korea Atomic Energy Research Institute, Taejeon (Korea)

    2000-01-01

    Many nuclear power plants (NPPs) have reported that a high percentage of all major failures in the plants are caused by human errors. Therefore, there has been much focus on elimination of human errors, enhancement of human performance, and general improvement of human machine interface (HMI). Both the utility management and the regulators are demanding improvement in this area. The International Atomic Energy Agency (IAEA) Specialists' Meeting on 'Human-Machine Interface for Off Normal and Emergency Situations in Nuclear Power Plants' was co-organized by the Korea Atomic Energy Research Institute (KAERI) and the Korea Power Engineering Company, INC (KOPEC), and took place in Taejeon, Republic of Korea, 1999 October 26-28. Fifty eight participants, representing nine member countries reviewed recent developments and discussed directions for future efforts in the Human-Machine Interface for Off Normal and Emergency Situations in NPPs. Twenty papers were presented, covering a wide spectrum of technical and scientific subjects including recent experience and benefits from Operational Experience with HMI, Development of HMI System, Licensing Issues for HMI and Future Development and Trends. (Author)

  15. Enhanced normal short-term human myelopoiesis in mice engineered to express human-specific myeloid growth factors.

    Science.gov (United States)

    Miller, Paul H; Cheung, Alice M S; Beer, Philip A; Knapp, David J H F; Dhillon, Kiran; Rabu, Gabrielle; Rostamirad, Shabnam; Humphries, R Keith; Eaves, Connie J

    2013-01-31

    Better methods to characterize normal human hematopoietic cells with short-term repopulating activity cells (STRCs) are needed to facilitate improving recovery rates in transplanted patients.We now show that 5-fold more human myeloid cells are produced in sublethally irradiated NOD/SCID-IL-2Receptor-γchain-null (NSG) mice engineered to constitutively produce human interleukin-3, granulocyte-macrophage colony-stimulating factor and Steel factor (NSG-3GS mice) than in regular NSG mice 3 weeks after an intravenous injection of CD34 human cord blood cells. Importantly, the NSG-3GS mice also show a concomitant and matched increase in circulating mature human neutrophils. Imaging NSG-3GS recipients of lenti-luciferase-transduced cells showed that human cells being produced 3 weeks posttransplant were heterogeneously distributed, validating the blood as a more representative measure of transplanted STRC activity. Limiting dilution transplants further demonstrated that the early increase in human granulopoiesis in NSG-3GS mice reflects an expanded output of differentiated cells per STRC rather than an increase in STRC detection. NSG-3GS mice support enhanced clonal outputs from human short-term repopulating cells (STRCs) without affecting their engrafting efficiency. Increased human STRC clone sizes enable their more precise and efficient measurement by peripheral blood monitoring.

  16. Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis

    International Nuclear Information System (INIS)

    Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.

    1986-01-01

    Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers

  17. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  18. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  19. In vivo H MR spectroscopy of human brain in six normal volunteers

    International Nuclear Information System (INIS)

    Choe, Bo Young; Suh, Tae Suk; Bahk, Yong Whee; Shinn, Kyung Sub

    1993-01-01

    In vivo H MR spectroscopic studies were performed on the human brain in six normal volunteers. Some distinct proton metabolites, such as N-acetylaspartate (NAA), creatine/phosphocreatine (Cr), choline/phosphocholine (Cho), myo-inositol (Ins) and lipid (fat) were clearly identified in normal brain tissue. The signal intensity of NAA resonance is strongest. The standard ratios of metabolites from the normal brain tissue in specific regions were obtained for the references of further in vivo H MR spectroscopic studies. Our initial resulting suggest the in vivo H MR spectroscopy may provide more precise diagnosis on the basis of the metabolic information on brain tissues. The unique ability of In vivo H MR spectroscopy to offer noninvasive information about tissue biochemistry in patients will stimulate its impact on clinical research and disease diagnosis

  20. A radioimmunoassay for erythropoietin: serum levels in normal human subjects and patients with hemopoietic disorders

    International Nuclear Information System (INIS)

    Rege, A.B.; Brookins, J.; Fisher, J.W.

    1982-01-01

    An RIA for Ep has been developed that is highly sensitive and specific. A homogeneous Ep preparation was labeled with 125 I by the chloramine-T method to a specific activity of 90 to 136 micro Ci/microgram and immunoreactivity of 80%. Ep antiserum, which was produced to a human urinary Ep preparation (80 U/mg of protein), was adsorbed with normal human urinary and serum proteins without any loss in sensitivity of the RIA to increase the specificity of the assay. A good correlation was seen between the RIA and the exhypoxic polycythemic mouse assay (corr. coef. 0.967; slope 1.05 and y intercept 0.75). Ep titers in sera from 175 hematologically normal human subjects exhibited a normal frequency distribution and ranged between 5.8 and 36.6 mU/ml with a mean of 14.9 +/- 4.7 (S.D.) and median of 14.3 Serum Ep titers were markedly elevated in seven patients with aplastic anemia and one patient with pure red cell aplasia (1350 to 20,640 mU/ml) and were lower than normal in two patients with polycythemia vera (8.1 and 9.4 mU/ml). The serum Ep titers in a prenephrectomy patient with chronic glomerulonephritis (32.1 mU/ml) decreased to below normal levels (9.04 mU/ml) after nephrectomy. The cord serum erythropoietin titers in 10 IDM [90.82 +/- 134.1 (S.D.) mu/ml] returned to values within the normal range (13.86 +/- 5.55) on day 3 after birth, suggesting the utility of the RIA in elucidating the role of hypoxia and/or insulin in increased erythropoiesis in IDM. The serum Ep titers in patients with anemias and polycythemias were compared to those of normal human subjects and agreed well with pathophysiologic mechanisms of these hemopoietic disorders, confirming the validity of the RIA

  1. A radioimmunoassay for erythropoietin: serum levels in normal human subjects and patients with hemopoietic disorders

    International Nuclear Information System (INIS)

    Rege, A.B.; Brookins, J.; Fisher, J.W.

    1982-01-01

    An RIA for Ep has been developed that is highly sensitive and specific. A homogeneous Ep preparation was labeled with 125 I by the chloramine-T method to a specific activity of 90 to 136 μCi/μg and immunoreactivity of 80%. Ep antiserum, which was produced to a human urinary Ep preparation (80 U/mg of protein), was adsorbed with normal human urinary and serum proteins without any loss in sensitivity of the RIA to increase the specificity of the assay. A good correlation was seen between the RIA and the exhypoxic polycythemic mouse assay (corr. coef. 0.967; slope 1.05 and ''y'' intercept 0.75). Ep titers in sera from 175 hematologically normal human subjects exhibited a normal frequency distribution and ranged between 5.8 and 36.6 mU/ml with a mean of 14.9 +/- 4.7 (S.D.) and median of 14.3. Serum Ep titers were markedly elevated in seven patients with aplastic anemia and one patient with pure red cell aplasia (1350 to 20,640 mU/ml) and were lower than normal in two patients with polycythemia vera (8.1 and 9.4 mU/ml). The serum Ep titers in a prenephrectomy patient with chronic glomerulonephritis (31.1 mU/ml) decreased to below normal levels (9.04 mU/ml) after nephrectomy. The cord serum erythropoietin titers in 10 IDM [90.82 +/- 134.1 (S.D.) mu/ml] returned to values within the normal range (13.86 +/- 5.55) on day 3 after birth, suggesting the utility of the RIA in elucidating the role of hypoxia and/or insulin in increased erythropoiesis in IDM. The serum Ep titers in patients with anemias and polycythemias were compared to those of normal human subjects and agreed well with pathophysiologic mechanisms of these hemopoietic disorders, confirming the validity of the RIA

  2. Repair of human DNA: radiation and chemical damage in normal and xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    Regan, J.D.; Setlow, R.B.

    1976-01-01

    We present the experimental evidence we have gathered, using a particular assay for DNA repair in human cells, the photolysis of bromodeoxyuridine (BrdUrd) incorporated during repair. This assay characterizes the sequence of repair events that occur in human cells after radiation, both ultraviolet and ionizing, and permits an estimation of the size of the average repaired region after these physical insults to DNA. We will discuss chemical insults to DNA and attempt to liken the repair processes after chemical damages of various kinds to those repair processes that occur in human DNA after damage from physical agents. We will also show results indicating that, under certain conditions, repair events resembling those seen after uv-irradiation can be observed in normal human cells after ionizing radiation. Furthermore the XP cells, defective in the repair of uv-induced DNA damage, show defective repair of these uv-like DNA lesions induced by ionizing radiation

  3. Biomechanics of normal and pathological gait: implications for understanding human locomotor control.

    Science.gov (United States)

    Winter, D A

    1989-12-01

    The biomechanical (kinetic) analysis of human gait reveals the integrated and detailed motor patterns that are essential in pinpointing the abnormal patterns in pathological gait. In a similar manner, these motor patterns (moments, powers, and EMGs) can be used to identify synergies and to validate theories of CNS control. Based on kinetic and EMG patterns for a wide range of normal subjects and cadences, evidence is presented that both supports and negates the central pattern generator theory of locomotion. Adaptive motor patterns that are evident in peripheral gait pathologies reinforce a strong peripheral rather than a central control. Finally, a three-component subtask theory of human gait is presented and is supported by reference to the motor patterns seen in a normal gait. The identified subtasks are (a) support (against collapse during stance); (b) dynamic balance of the upper body, also during stance; and (c) feedforward control of the foot trajectory to achieve safe ground clearance and a gentle heel contact.

  4. Alpha-amidated peptides derived from pro-opiomelanocortin in normal human pituitary

    DEFF Research Database (Denmark)

    Fenger, M; Johnsen, A H

    1988-01-01

    Normal human pituitaries were extracted in boiling water and acetic acid, and the alpha-amidated peptide products of pro-opiomelanocortin (POMC), alpha-melanocyte-stimulating hormone (alpha MSH), gamma-melanocyte-stimulating hormone (gamma 1MSH), and amidated hinge peptide (HP-N), as well...... (ACTH)-(1-39), ACTH-(1-14) and alpha MSH immunoreactivity]. alpha MSH and ACTH-(1-14) were only present in non- or mono-acetylated forms. Only large forms of gamma 1MSH and gamma 2MSH were present in partly glycosylated states. The hinge peptides were amidated to an extent two to three orders...... amidated POMC-related peptides are present in normal human pituitary. It also shows that cleavage in vivo at all dibasic amino acids but one, takes place at the N-terminal POMC region; the exception is at the POMC-(49-50) N-terminal of the gamma MSH sequence. The pattern of peptides produced suggests...

  5. Protein structure of fetal antigen 1 (FA1). A novel circulating human epidermal-growth-factor-like protein expressed in neuroendocrine tumors and its relation to the gene products of dlk and pG2

    DEFF Research Database (Denmark)

    Jensen, Charlotte Harken; Krogh, Thomas N; Højrup, Peter

    1994-01-01

    The present paper describes the primary structure, glycosylation and tissue localization of fetal antigen 1 (FA1) isolated from second-trimester human amniotic fluid. FA1 is a single-chained, heterogeneous glycoprotein of 225-262 amino acid residues. FA1 has six well conserved epidermal...... extends with minor corrections to the human adrenal-specific mRNA, pG2 as well. Immunohistochemical analysis demonstrated the presence of FA1 in 10 out of 14 lung tumors containing neuroendocrine elements, and in the placental villi where FA1 was exclusively seen in stromal cells in close contact...... to the vascular structure. In the pancreas, FA1 co-localized with insulin in the insulin secretory granules of the beta cells within the islets of Langerhans. Our findings suggest that FA1 is synthesized as a membrane anchored protein and released into the circulation after enzymic cleavage, and that circulating...

  6. Simple mucin-type carbohydrates in normal and malignant human endometrium

    DEFF Research Database (Denmark)

    Ravn, V; Mandel, U; Svenstrup, B

    1995-01-01

    The simple mucin-type carbohydrate antigens, Tn, sialosyl-Tn, and T, are tumor-associated antigens of adenocarcinomas. We evaluated by immunohistochemistry the expression of Tn, sialosyl-Tn (s-Tn), T, and sialosyl-T (s-T) antigens in normal nonsecretory, early gestational, and malignant human...... and malignant endometrium, and the expression of s-T antigen was positively correlated with E2 levels in serum. Our findings suggest a hormonal influence on expression of simple mucin-type carbohydrates in human endometrium. However, the accumulation of Tn and s-Tn antigens in malignant endometrial cells seem...

  7. Heterogeneity of uroplakin localization in human normal urothelium, papilloma and papillary carcinoma

    International Nuclear Information System (INIS)

    Zupancic, Dasa; Romih, Rok

    2013-01-01

    Uroplakins are differentiation-related membrane proteins of urothelium. We compared uroplakin expression and ultrastructural localization in human normal urothelium, papilloma and papillary carcinoma. Because of high recurrence rate of these tumours, treated by transurethral resection, we investigated urothelial tumour, resection border and uninvolved urothelium. Urinary bladder samples were obtained from tumour free control subjects and patients with papilloma and papillary carcinoma. Immunohistochemical and immunoelectron labelling of uroplakins were performed. In normal human urothelium with continuous uroplakin-positive superficial cell layer uroplakins were localized to flattened mature fusiform vesicles and apical plasma membrane of umbrella cells. Diverse uroplakin expression was found in papilloma and papillary carcinoma. Three aberrant differentiation stages of urothelial cells, not found in normal urothelium, were recognized in tumours. Diverse uroplakin expression and aberrant differentiation were occasionally found in resection border and in uninvolved urothelium. We demonstrated here that uroplakin expression and localization in urothelial tumours is altered when compared to normal urothelium. In patients with papilloma and papillary carcinoma immunolabelling of uroplakins at ultrastructural level shows aberrant urothelial differentiation. It is possible that aberrant differentiation stages of urothelial cells in resection border and in uninvolved urothelium contribute to high recurrence rate

  8. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  9. Mechanical properties of the normal human cartilage-bone complex in relation to age

    DEFF Research Database (Denmark)

    Ding, Ming; Dalstra, M; Linde, F

    1998-01-01

    OBJECTIVE: This study investigates the age-related variations in the mechanical properties of the normal human tibial cartilage-bone complex and the relationships between cartilage and bone. DESIGN: A novel technique was applied to assess the mechanical properties of the cartilage and bone by mea...... that are of importance for the understanding of the etiology and pathogenesis of degenerative joint diseases, such as arthrosis....

  10. DNA crosslinking and cytotoxicity in normal and transformed human cells treated with antitumor nitrosoureas.

    OpenAIRE

    Erickson, L C; Bradley, M O; Ducore, J M; Ewig, R A; Kohn, K W

    1980-01-01

    Normal (IMR-90) and simian virus 40-transformed (VA-13) human embryo cells were treated with antitumor nitrosoureas, and the effects on cell viability and cell DNA were compared. All six nitrosoureas tested were more toxic to VA-13 cells than to IMR-90 cells as measured by decrease in cell proliferation or in colony formation. The nitrosoureas capable of generating alkylisocyanates produced a smaller difference between the cell types than did derivatives lacking this capacity. DNA damage was ...

  11. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  12. Proton MR spectroscopic features of the human liver: in-vivo application to the normal condition

    International Nuclear Information System (INIS)

    Cho, Soon Gu; Kim, Mi Young; Kim, Young Soo; Choi, Won; Shin, Seok Hwan; Ok, Chul Soo; Suh, Chang Hae

    1999-01-01

    To determine the feasibility of MR spectroscopy in the living human liver, and to evaluate the corresponding proton MR spectroscopic features. In fifteen normal volunteers with neither previous nor present liver disease, the proton MR spectroscopic findings were reviewed. Twelve subjects were male and three were female ; they were aged between 28 and 32 (mean, 30) years. MR spectroscopy involved the use of a 1.5T GE Signa Horizon system with body coil(GE Medical System, Milwaukee, U.S.A). We used STEAM (Stimulated Echo-Acquisition Mode) with 3000/30 msec of TR/TE for signal acquisition, and the prone position without respiratory interruption. Mean and standard deviation of the ratios of glutamate+glutamine/lipids, phosphomonoesters/lipids, and glycogen+glucose/lipids were calculated from the area of their peaks. The proton MR spectroscopic findings of normal human livers showed four distinctive peaks, i.e. lipids, glutamate and glutamine complex, phosphomonoesters, and glycogen and glucose complex. The mean and standard deviation of the ratios of glutamate+glutamine/lipids, phosphomonoesters/lipids, and glycogen+glucose/lipids were 0.02±0.01, 0.01±0.01, and 0.04±0.03, respectively. In living normal human livers, MR spectroscopy can be successfully applied. When applied to a liver whose condition is pathologic, the findings can be used as a standard

  13. Immortalization of normal human fibroblasts by treatment with 4-nitroquinoline 1-oxide.

    Science.gov (United States)

    Bai, L; Mihara, K; Kondo, Y; Honma, M; Namba, M

    1993-02-01

    Normal human fibroblasts (the OUMS-24 strain), derived from a 6-week-old human embryo, were transformed (into the OUMS-24F line) and immortalized by repeated treatments (59 times) with 4-nitroquinoline 1-oxide (4NQO). Treatment began during primary culture and ended at the 51st population doubling level (PDL). At the 57th PDL (146 days after the last treatment), morphologically altered, epithelial-type cells appeared, began to grow and became immortal (now past the 100th PDL). However, the control fibroblasts, which were not treated with 4NQO, senesced at the 62nd PDL. The finding that extensive, repeated treatments with 4NQO are required for the immortalization of normal human cells, indicates that multiple mutational events are involved in the immortalization of human cells in general. In other words, immortalization itself seems to be a multi-step process. Karyotypic analysis showed that many cells were hypodiploid before immortalization, but that afterwards chromosomes were distributed broadly in the diploid to tetraploid regions. The immortalized cells showed amplification and enhanced expression of c-myc. Two-dimensional electrophoretic analysis showed that the number of disappearing cellular proteins was greater than the number of the newly appearing ones after the cells became immortalized. Since the immortalized cells showed neither anchorage-independent growth nor tumorigenicity, they are useful for studying factors that can contribute to multi-step carcinogenesis in human cells. In addition, genetically matched normal (OUMS-24) and immortalized (OUMS-24F) cells will be useful for analyzing the genes related to cellular mortality and immortalization.

  14. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  15. TOTAL NUMBER, DISTRIBUTION, AND PHENOTYPE OF CELLS EXPRESSING CHONDROITIN SULPHATE PROTEOGLYCANS IN THE NORMAL HUMAN AMYGDALA

    Science.gov (United States)

    Pantazopoulos, Harry; Murray, Elisabeth A.; Berretta, Sabina

    2009-01-01

    Chondroitin sulphate proteoglycans (CSPGs) are a key structural component of the brain extracellular matrix. They are involved in critical neurodevelopmental functions and are one of the main components of pericellular aggregates known as perineuronal nets. As a step toward investigating their functional and pathophysiological roles in the human amygdala, we assessed the pattern of CSPG expression in the normal human amygdala using wisteria floribunda agglutinin (WFA) lectin-histochemistry. Total numbers of WFA-labeled elements were measured in the lateral (LN), basal (BN), accessory basal (ABN) and cortical (CO) nuclei of the amygdala from 15 normal adult human subjects. For interspecies qualitative comparison, we also investigated the pattern of WFA labeling in the amygdala of naïve rats (n=32) and rhesus monkeys (Macaca mulatta; n=6). In human amygdala, WFA lectin-histochemistry resulted in labeling of perineuronal nets and cells with clear glial morphology, while neurons did not show WFA-labeling. Total numbers of WFA-labeled glial cells showed high interindividual variability. These cells aggregated in clusters with a consistent between-subjects spatial distribution. In a subset of human subjects (n=5), dual color fluorescence using an antibody raised against glial fibrillary acidic protein (GFAP) and WFA showed that the majority (93.7%) of WFA-labeled glial cells correspond to astrocytes. In rat and monkey amygdala, WFA histochemistry labeled perineuronal nets, but not glial cells. These results suggest that astrocytes are the main cell type expressing CSPGs in the adult human amygdala. Their highly segregated distribution pattern suggests that these cells serve specialized functions within human amygdalar nuclei. PMID:18374308

  16. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  17. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  18. Quantification of Crypt and Stem Cell Evolution in the Normal and Neoplastic Human Colon

    Directory of Open Access Journals (Sweden)

    Ann-Marie Baker

    2014-08-01

    Full Text Available Human intestinal stem cell and crypt dynamics remain poorly characterized because transgenic lineage-tracing methods are impractical in humans. Here, we have circumvented this problem by quantitatively using somatic mtDNA mutations to trace clonal lineages. By analyzing clonal imprints on the walls of colonic crypts, we show that human intestinal stem cells conform to one-dimensional neutral drift dynamics with a “functional” stem cell number of five to six in both normal patients and individuals with familial adenomatous polyposis (germline APC−/+. Furthermore, we show that, in adenomatous crypts (APC−/−, there is a proportionate increase in both functional stem cell number and the loss/replacement rate. Finally, by analyzing fields of mtDNA mutant crypts, we show that a normal colon crypt divides around once every 30–40 years, and the division rate is increased in adenomas by at least an order of magnitude. These data provide in vivo quantification of human intestinal stem cell and crypt dynamics.

  19. Hypoxic regulation of cytoglobin and neuroglobin expression in human normal and tumor tissues

    Directory of Open Access Journals (Sweden)

    Emara Marwan

    2010-09-01

    Full Text Available Abstract Background Cytoglobin (Cygb and neuroglobin (Ngb are recently identified globin molecules that are expressed in vertebrate tissues. Upregulation of Cygb and Ngb under hypoxic and/or ischemic conditions in vitro and in vivo increases cell survival, suggesting possible protective roles through prevention of oxidative damage. We have previously shown that Ngb is expressed in human glioblastoma multiforme (GBM cell lines, and that expression of its transcript and protein can be significantly increased after exposure to physiologically relevant levels of hypoxia. In this study, we extended this work to determine whether Cygb is also expressed in GBM cells, and whether its expression is enhanced under hypoxic conditions. We also compared Cygb and Ngb expression in human primary tumor specimens, including brain tumors, as well as in human normal tissues. Immunoreactivity of carbonic anhydrase IX (CA IX, a hypoxia-inducible metalloenzyme that catalyzes the hydration of CO2 to bicarbonate, was used as an endogenous marker of hypoxia. Results Cygb transcript and protein were expressed in human GBM cells, and this expression was significantly increased in most cells following 48 h incubation under hypoxia. We also showed that Cygb and Ngb are expressed in both normal tissues and human primary cancers, including GBM. Among normal tissues, Cygb and Ngb expression was restricted to distinct cell types and was especially prominent in ductal cells. Additionally, certain normal organs (e.g. stomach fundus, small bowel showed distinct regional co-localization of Ngb, Cygb and CA IX. In most tumors, Ngb immunoreactivity was significantly greater than that of Cygb. In keeping with previous in vitro results, tumor regions that were positively stained for CA IX were also positive for Ngb and Cygb, suggesting that hypoxic upregulation of Ngb and Cygb also occurs in vivo. Conclusions Our finding of hypoxic up-regulation of Cygb/Ngb in GBM cell lines and human

  20. Faster DNA Repair of Ultraviolet-Induced Cyclobutane Pyrimidine Dimers and Lower Sensitivity to Apoptosis in Human Corneal Epithelial Cells than in Epidermal Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Justin D Mallet

    Full Text Available Absorption of UV rays by DNA generates the formation of mutagenic cyclobutane pyrimidine dimers (CPD and pyrimidine (6-4 pyrimidone photoproducts (6-4PP. These damages are the major cause of skin cancer because in turn, they can lead to signature UV mutations. The eye is exposed to UV light, but the cornea is orders of magnitude less prone to UV-induced cancer. In an attempt to shed light on this paradox, we compared cells of the corneal epithelium and the epidermis for UVB-induced DNA damage frequency, repair and cell death sensitivity. We found similar CPD levels but a 4-time faster UVB-induced CPD, but not 6-4PP, repair and lower UV-induced apoptosis sensitivity in corneal epithelial cells than epidermal. We then investigated levels of DDB2, a UV-induced DNA damage recognition protein mostly impacting CPD repair, XPC, essential for the repair of both CPD and 6-4PP and p53 a protein upstream of the genotoxic stress response. We found more DDB2, XPC and p53 in corneal epithelial cells than in epidermal cells. According to our results analyzing the protein stability of DDB2 and XPC, the higher level of DDB2 and XPC in corneal epithelial cells is most likely due to an increased stability of the protein. Taken together, our results show that corneal epithelial cells have a better efficiency to repair UV-induced mutagenic CPD. On the other hand, they are less prone to UV-induced apoptosis, which could be related to the fact that since the repair is more efficient in the HCEC, the need to eliminate highly damaged cells by apoptosis is reduced.

  1. Skeletal muscle phosphatidylcholine fatty acids and insulin sensitivity in normal humans.

    Science.gov (United States)

    Clore, J N; Li, J; Gill, R; Gupta, S; Spencer, R; Azzam, A; Zuelzer, W; Rizzo, W B; Blackard, W G

    1998-10-01

    The fatty acid composition of skeletal muscle membrane phospholipids (PL) is known to influence insulin responsiveness in humans. However, the contribution of the major PL of the outer (phosphatidylcholine, PC) and inner (phosphatidylethanolamine, PE) layers of the sarcolemma to insulin sensitivity is not known. Fatty acid composition of PC and PE from biopsies of vastus lateralis from 27 normal men and women were correlated with insulin sensitivity determined by the hyperinsulinemic euglycemic clamp technique at insulin infusion rates of 0.4, 1.0, and 10.0 mU . kg-1 . min-1. Significant variation in the half-maximal insulin concentration (ED50) was observed in the normal volunteers (range 24.0-146.0 microU/ml), which correlated directly with fasting plasma insulin (r = 0.75, P insulin sensitivity was observed in PE (NS). These studies suggest that the fatty acid composition of PC may be of particular importance in the relationship between fatty acids and insulin sensitivity in normal humans.

  2. Human respiratory syncytial virus load normalized by cell quantification as predictor of acute respiratory tract infection.

    Science.gov (United States)

    Gómez-Novo, Miriam; Boga, José A; Álvarez-Argüelles, Marta E; Rojo-Alba, Susana; Fernández, Ana; Menéndez, María J; de Oña, María; Melón, Santiago

    2018-05-01

    Human respiratory syncytial virus (HRSV) is a common cause of respiratory infections. The main objective is to analyze the prediction ability of viral load of HRSV normalized by cell number in respiratory symptoms. A prospective, descriptive, and analytical study was performed. From 7307 respiratory samples processed between December 2014 to April 2016, 1019 HRSV-positive samples, were included in this study. Low respiratory tract infection was present in 729 patients (71.54%). Normalized HRSV load was calculated by quantification of HRSV genome and human β-globin gene and expressed as log10 copies/1000 cells. HRSV mean loads were 4.09 ± 2.08 and 4.82 ± 2.09 log10 copies/1000 cells in the 549 pharyngeal and 470 nasopharyngeal samples, respectively (P respiratory tract infection and 4.22 ± 2.28 log10 copies/1000 cells with upper respiratory tract infection or febrile syndrome (P < 0.05). A possible cut off value to predict LRTI evolution was tentatively established. Normalization of viral load by cell number in the samples is essential to ensure an optimal virological molecular diagnosis avoiding that the quality of samples affects the results. A high viral load can be a useful marker to predict disease progression. © 2018 Wiley Periodicals, Inc.

  3. Nicotine promotes proliferation and collagen synthesis of chondrocytes isolated from normal human and osteoarthritis patients.

    Science.gov (United States)

    Ying, Xiaozhou; Cheng, Shaowen; Shen, Yue; Cheng, Xiaojie; An Rompis, Ferdinand; Wang, Wei; Lin, Zhongqin; Chen, Qingyu; Zhang, Wei; Kou, Dongquan; Peng, Lei; Tian, Xin Qiao; Lu, Chuan Zhu

    2012-01-01

    The aims of the study were to show the direct effect of nicotine with different concentrations (0, 25, 50, and 100 ng/ml) on chondrocytes isolated from normal human and osteoarthritis patients, respectively. Microscopic observation was performed during the culture with an inverted microscope. Methyl thiazolyl tetrazolium (MTT) assay method was adopted to observe the influence of nicotine on the proliferation of chondrocytes, and real-time PCR and ELISA were used to assay the mRNA and protein expression of type II collagen and aggrecan, respectively. We discovered that the OA chondrocytes were similar to fibroblasts in shape and grow slower than normal chondrocytes. The proliferation of the two kinds of chondrocytes was increased in a concentration-dependent manner and in a time-dependent manner (P<0.05). Also, we found that the mRNA level of type II collagen were upregulated under 25-100 ng/ml nicotine doses both in the two kinds of chondrocytes compared with control. The expression of protein levels of type II collagen were synthesized in line with the increase in mRNA. No effect was observed on aggrecan synthesis with any nicotine dose. We concluded that nicotine has the same effect on both chondrocytes, obtained either from osteoarthritis patients or from normal human, and the positive effect of smoking in OA may relate to the alteration in metabolism of chondrocytes.

  4. Differential Effects of Tea Extracts on Growth and Cytokine Production by Normal and Leukemic Human Leukocytes

    Directory of Open Access Journals (Sweden)

    Diana Bayer

    2012-04-01

    Full Text Available Background: Tea is one of the world’s most highly consumed beverages, second only to water. It is affordable and abundant and thus has great potential for improving health of those in both developed and developing areas. Green, oolong, and black teas differ in the extent of fermentation and types of bioactive polyphenols produced. Green tea and its major polyphenol decrease growth of some cancer cells and effect production of immune system cytokines. This study compares the effects of different types of tea extracts on viability and cytokine production by normal and leukemic human T lymphocytes. Generation of the toxic reactive oxygen species H2O2 by extracts was also examined.Methods: The Jurkat T lymphoblastic leukemia cells and mitogen-stimulated normal human peripheral blood mononuclear cells were used in this study. Cell viability was determined by (3-4,5-dimethylthiamizol-2-yl-diphenyltetrazolium bromide assay and production of interleukin-2 by Enzyme-Linked ImmunoSorbent Assay. Levels of H2O2 generated by tea extracts were determined using the xylenol-orange method.Results: We found that green, oolong, and black tea extracts differentially effect the growth and viability of T lymphoblastic leukemia cells and normal peripheral blood mononuclear cells, substantially decreasing both growth and viability of leukemic T lymphocytes and having much lesser effects on their normal counterparts. Tea extracts also had differential effects on the production of the T lymphocyte growth factor interleukin-2, significantly decreasing production by leukemic cells while having only minor effects on normal cells. All three extracts induced H2O2 generation, with green and oolong tea extracts having the greatest effect. Leukemic cells were much more susceptible to growth inhibition and killing by H2O2 than normal lymphocytes.Functional Foods in Health and Disease 2012, 2(4:72-85 Conclusions: The three tea extracts studied altered leukemic T lymphocyte

  5. Dynamic knee alignment and collateral knee laxity and its variations in normal humans

    Directory of Open Access Journals (Sweden)

    Kamal eDeep

    2015-11-01

    Full Text Available Alignment of normal, arthritic and replaced human knees is a much debated subject as is the collateral ligamentous laxity. Traditional quantitative values have been challenged. Methods used to measure these are also not without flaws. Authors review the recent literature and a novel method of measurement of these values has been included. This method includes use of computer navigation technique in clinic setting for assessment of the normal or affected knee before the surgery. Computer navigation has been known for achievement of alignment accuracy during knee surgery. Now its use in clinic setting has added to the inventory of measurement methods. Authors dispel the common myth of straight mechanical axis in normal knees and also look at quantification of amount of collateral knee laxity. Based on the scientific studies it has been shown that the mean alignment is in varus in normal knees. It changes from lying non weight bearing position to standing weight bearing position in both coronal and the sagittal planes. It also varies with gender and race. The collateral laxity is also different for males and females. Further studies are needed to define the ideal alignment and collateral laxity which the surgeon should aim for individual knees.

  6. Genetic determination of human facial morphology: links between cleft-lips and normal variation.

    Science.gov (United States)

    Boehringer, Stefan; van der Lijn, Fedde; Liu, Fan; Günther, Manuel; Sinigerova, Stella; Nowak, Stefanie; Ludwig, Kerstin U; Herberz, Ruth; Klein, Stefan; Hofman, Albert; Uitterlinden, Andre G; Niessen, Wiro J; Breteler, Monique M B; van der Lugt, Aad; Würtz, Rolf P; Nöthen, Markus M; Horsthemke, Bernhard; Wieczorek, Dagmar; Mangold, Elisabeth; Kayser, Manfred

    2011-11-01

    Recent genome-wide association studies have identified single nucleotide polymorphisms (SNPs) associated with non-syndromic cleft lip with or without cleft palate (NSCL/P), and other previous studies showed distinctly differing facial distance measurements when comparing unaffected relatives of NSCL/P patients with normal controls. Here, we test the hypothesis that genetic loci involved in NSCL/P also influence normal variation in facial morphology. We tested 11 SNPs from 10 genomic regions previously showing replicated evidence of association with NSCL/P for association with normal variation of nose width and bizygomatic distance in two cohorts from Germany (N=529) and the Netherlands (N=2497). The two most significant associations found were between nose width and SNP rs1258763 near the GREM1 gene in the German cohort (P=6 × 10(-4)), and between bizygomatic distance and SNP rs987525 at 8q24.21 near the CCDC26 gene (P=0.017) in the Dutch sample. A genetic prediction model explained 2% of phenotype variation in nose width in the German and 0.5% of bizygomatic distance variation in the Dutch cohort. Although preliminary, our data provide a first link between genetic loci involved in a pathological facial trait such as NSCL/P and variation of normal facial morphology. Moreover, we present a first approach for understanding the genetic basis of human facial appearance, a highly intriguing trait with implications on clinical practice, clinical genetics, forensic intelligence, social interactions and personal identity.

  7. Effects of hyperthermia and ionizing radiation in normal and ataxia telangiectasia human fibroblast lines

    International Nuclear Information System (INIS)

    Mitchel, R.E.J.; Chan, A.; Smith, B.P.; Child, S.D.; Paterson, M.C.

    1984-01-01

    The effects of 45 0 C hyperthermia and γ radiation have been studied in three normal human fibroblast lines (GM38, GM730, WI38) and compared to the effects in two lines derived from patients with the hereditary disease ataxia telangiectasia (AR3BI, AT5BI). All lines, both normal and γ-sensitive AT, showed a similar resistance to killing by heat alone, suggesting that the defect responsible for the increased radiation sensitivity in AT lines does not confer increased heat sensitivity. Shouldered survival curves were obtained in each case indicating the ability to accumulate sublethal heat damage. All normal and AT cell lines exhibited increased resistance to the lethal effects of heat in response to a thermal stress, indicating that the defect that causes radiosensitivity in AT cell lines does not prevent the induction of thermotolerance. It was hypothesized that in normal cells, this heat treatment inactivates the process which is already defective in AT lines, and that this process may be required for the proper rejoining of double-strand breaks produced during the repair of other radiation-induced lesions

  8. Normal development and growth of the human neurocranium and cranial base.

    Science.gov (United States)

    Friede, H

    1981-01-01

    The literature on normal development and growth of certain areas of the human head is reviewed, starting with the early induction of the desmal neurocranium. the development of the brain capsule with its dural reinforcement bands and their connection with the basicranium is discussed, as is the primordial chondrocranium, including its bone replacement. Growth of the calvaria and the three cranial fossae is also analysed. Special interest is focused on the anterior fossa, as knowledge of the growth in this area is very important for an understanding of pathogenesis and possibilities of treating premature craniosynostosis. Finally it is stressed that close observation of the effects of treatment on this pathology may increase our knowledge of normal growth.

  9. Chronic microelectrode investigations of normal human brain physiology using a hybrid depth electrode.

    Science.gov (United States)

    Howard, M A; Volkov, I O; Noh, M D; Granner, M A; Mirsky, R; Garell, P C

    1997-01-01

    Neurosurgeons have unique access to in vivo human brain tissue, and in the course of clinical treatment important scientific advances have been made that further our understanding of normal brain physiology. In the modern era, microelectrode recordings have been used to systematically investigate the cellular properties of lateral temporal cerebral cortex. The current report describes a hybrid depth electrode (HDE) recording technique that was developed to enable neurosurgeons to simultaneously investigate normal cellular physiology during chronic intracranial EEG recordings. The HDE combines microelectrode and EEG recordings sites on a single shaft. Multiple microelectrode recordings are obtained from MRI defined brain sites and single-unit activity is discriminated from these data. To date, over 60 HDEs have been placed in 20 epilepsy surgery patients. Unique physiologic data have been gathered from neurons in numerous brain regions, including amygdala, hippocampus, frontal lobe, insula and Heschl's gyrus. Functional activation studies were carried out without risking patient safety or comfort.

  10. Serial analysis of gene expression (SAGE) in normal human trabecular meshwork.

    Science.gov (United States)

    Liu, Yutao; Munro, Drew; Layfield, David; Dellinger, Andrew; Walter, Jeffrey; Peterson, Katherine; Rickman, Catherine Bowes; Allingham, R Rand; Hauser, Michael A

    2011-04-08

    To identify the genes expressed in normal human trabecular meshwork tissue, a tissue critical to the pathogenesis of glaucoma. Total RNA was extracted from human trabecular meshwork (HTM) harvested from 3 different donors. Extracted RNA was used to synthesize individual SAGE (serial analysis of gene expression) libraries using the I-SAGE Long kit from Invitrogen. Libraries were analyzed using SAGE 2000 software to extract the 17 base pair sequence tags. The extracted sequence tags were mapped to the genome using SAGE Genie map. A total of 298,834 SAGE tags were identified from all HTM libraries (96,842, 88,126, and 113,866 tags, respectively). Collectively, there were 107,325 unique tags. There were 10,329 unique tags with a minimum of 2 counts from a single library. These tags were mapped to known unique Unigene clusters. Approximately 29% of the tags (orphan tags) did not map to a known Unigene cluster. Thirteen percent of the tags mapped to at least 2 Unigene clusters. Sequence tags from many glaucoma-related genes, including myocilin, optineurin, and WD repeat domain 36, were identified. This is the first time SAGE analysis has been used to characterize the gene expression profile in normal HTM. SAGE analysis provides an unbiased sampling of gene expression of the target tissue. These data will provide new and valuable information to improve understanding of the biology of human aqueous outflow.

  11. N-isopropyl-p-iodoamphetamine receptors in normal and cancerous tissue of the human lung

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Eiko; Mishima, Michiaki; Kawakami, Kenzo; Sakai, Naoki; Sugiura, Naoharu; Kuno, Kenshi [Kyoto Univ. (Japan). Dept. of Clinical Physiology; Taniguchi, Takashi [Kyoto Pharmaceutical Univ. (Japan). Dept. of Neurobiology

    1993-04-01

    N-Isopropyl-p-iodoamphetamine (IMP) receptors in normal human lung tissue were characterized using a radioligand binding assay with iodine-125 IMP as the ligand. Saturation binding studies revealed the presence of two binding sites with dissociation constant (K[sub d]) values of 53[+-]2 and 4687[+-]124 nM and maximum binding capacity (Bmax) values of 7[+-]1 and 133[+-]27 pmol/mg protein (n=5) respectively. The IC[sub 50] values of various amines were as follows: IMP, 9x10[sup -5] M; propranolol, 5x10[sup -4] M; haloperidol, 6x10[sup -4] M; ketamine, 9x10[sup -3] M; dopamine, 1x10[sup -2] M. The IMP receptors of cancerous tissue obtained from human lung also had two binding sites with K[sub d] values of 54[+-]2 and 5277[+-]652 nM and Bmax values of 7[+-]1 and 103[+-]21 pmol/mg protein (n=3) respectively. There was no significant difference in binding parameters between normal and cancerous lung tissue. These results demonstrate the existence of IMP receptors and suggest that cancer does not affect the nature of IMP receptors in human lung tissue. (orig.).

  12. Effects of sterilizing radiation dose on the amino acid composition of normal human Ig(G)

    International Nuclear Information System (INIS)

    Kaupert, N.L.; Mariano, E.E.

    1981-01-01

    In order to verify gamma radiation effect of 60 Co, samples of Normal human Ig(G) in a) pH 7 solutions with different concentrations, and b) in liophilized state, were irradiated. In both, the quali and quantitative amino acid compositions have been studied. No changes in amino acid composition were observed, for doses up to 10 Mrad delivered to the liophilized samples. Nevertheless, when 5 mg/ml and 10 mg/ml solutions of Ig(G) were irradiated with a 2 Mrad gamma dose, both were affected. The damage appeared in greater proportion in the samples with lower concentration. Cistine was the amino acid most damaged and the loss of methionine, proline histidine, arginine, tirosine and phenilalanine, decreased in this order. The analysis of the experimental data shows that liophilized human Ig(G) can be treated with doses higher than those required to achieve sterilization, without modifying its immunologic and primary proteic structure properties. Therefore, gamma sterilization feasibility has been proved for normal human Ig(G) only in the liophilized state. (author) [es

  13. Measure of O(6)-Alkylguanine-DNA Alkyltransferase Activity in Normal Human Epidermal Keratinocytes in Culture and Effects of Bis-(2-chloroethyl)sulfide in the Activity

    National Research Council Canada - National Science Library

    Kurt, Ellen

    1999-01-01

    ...)-alkylguanine in DNA. AGT may be important in DNA repair following injury induced by bis-(2-chloroethyl)sulfide (sulfur mustard, HD), since O(sup 6)-alkylguanine is one of the HD alkylation products...

  14. Pulse wave imaging in normal, hypertensive and aneurysmal human aortas in vivo: a feasibility study

    International Nuclear Information System (INIS)

    Li, Ronny X; Luo, Jianwen; Shahmirzadi, Danial; Konofagou, Elisa E; Balaram, Sandhya K; Chaudhry, Farooq A

    2013-01-01

    Arterial stiffness is a well-established biomarker for cardiovascular risk, especially in the case of hypertension. The progressive stages of an abdominal aortic aneurysm (AAA) have also been associated with varying arterial stiffness. Pulse wave imaging (PWI) is a noninvasive, ultrasound imaging-based technique that uses the pulse wave-induced arterial wall motion to map the propagation of the pulse wave and measure the regional pulse wave velocity (PWV) as an index of arterial stiffness. In this study, the clinical feasibility of PWI was evaluated in normal, hypertensive, and aneurysmal human aortas. Radiofrequency-based speckle tracking was used to estimate the pulse wave-induced displacements in the abdominal aortic walls of normal (N = 15, mean age 32.5 ± 10.2 years), hypertensive (N = 13, mean age 60.8 ± 15.8 years), and aneurysmal (N = 5, mean age 71.6 ± 11.8 years) human subjects. Linear regression of the spatio-temporal variation of the displacement waveform in the anterior aortic wall over a single cardiac cycle yielded the slope as the PWV and the coefficient of determination r 2 as an approximate measure of the pulse wave propagation uniformity. The aortic PWV measurements in all normal, hypertensive, and AAA subjects were 6.03 ± 1.68, 6.69 ± 2.80, and 10.54 ± 6.52 m s −1 , respectively. There was no significant difference (p = 0.15) between the PWVs of the normal and hypertensive subjects while the PWVs of the AAA subjects were significantly higher (p 2 in the AAA subjects was significantly lower (p 2 ) obtained using PWI, in addition to the PWI images and spatio-temporal maps that provide qualitative visualization of the pulse wave, may potentially provide valuable information for the clinical characterization of aneurysms and other vascular pathologies that regionally alter the arterial wall mechanics. (paper)

  15. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  16. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial

    Science.gov (United States)

    Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C.; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I.; McCullough, Ann E.; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P.; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W.; Wolff, Antonio C.; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D.; Perez, Edith A.

    2016-01-01

    Background Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2–positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. Methods In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2–positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Results Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Conclusion Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. PMID:26598744

  17. Adjuvant Lapatinib and Trastuzumab for Early Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer: Results From the Randomized Phase III Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization Trial.

    Science.gov (United States)

    Piccart-Gebhart, Martine; Holmes, Eileen; Baselga, José; de Azambuja, Evandro; Dueck, Amylou C; Viale, Giuseppe; Zujewski, Jo Anne; Goldhirsch, Aron; Armour, Alison; Pritchard, Kathleen I; McCullough, Ann E; Dolci, Stella; McFadden, Eleanor; Holmes, Andrew P; Tonghua, Liu; Eidtmann, Holger; Dinh, Phuong; Di Cosimo, Serena; Harbeck, Nadia; Tjulandin, Sergei; Im, Young-Hyuck; Huang, Chiun-Sheng; Diéras, Véronique; Hillman, David W; Wolff, Antonio C; Jackisch, Christian; Lang, Istvan; Untch, Michael; Smith, Ian; Boyle, Frances; Xu, Binghe; Gomez, Henry; Suter, Thomas; Gelber, Richard D; Perez, Edith A

    2016-04-01

    Lapatinib (L) plus trastuzumab (T) improves outcomes for metastatic human epidermal growth factor 2-positive breast cancer and increases the pathologic complete response in the neoadjuvant setting, but their role as adjuvant therapy remains uncertain. In the Adjuvant Lapatinib and/or Trastuzumab Treatment Optimization trial, patients with centrally confirmed human epidermal growth factor 2-positive early breast cancer were randomly assigned to 1 year of adjuvant therapy with T, L, their sequence (T→L), or their combination (L+T). The primary end point was disease-free survival (DFS), with 850 events required for 80% power to detect a hazard ratio (HR) of 0.8 for L+T versus T. Between June 2007 and July 2011, 8,381 patients were enrolled. In 2011, due to futility to demonstrate noninferiority of L versus T, the L arm was closed, and patients free of disease were offered adjuvant T. A protocol modification required P ≤ .025 for the two remaining pairwise comparisons. At a protocol-specified analysis with a median follow-up of 4.5 years, a 16% reduction in the DFS hazard rate was observed with L+T compared with T (555 DFS events; HR, 0.84; 97.5% CI, 0.70 to 1.02; P = .048), and a 4% reduction was observed with T→L compared with T (HR, 0.96; 97.5% CI, 0.80 to 1.15; P = .61). L-treated patients experienced more diarrhea, cutaneous rash, and hepatic toxicity compared with T-treated patients. The incidence of cardiac toxicity was low in all treatment arms. Adjuvant treatment that includes L did not significantly improve DFS compared with T alone and added toxicity. One year of adjuvant T remains standard of care. © 2015 by American Society of Clinical Oncology.

  18. Abnormal X : autosome ratio, but normal X chromosome inactivation in human triploid cultures

    Directory of Open Access Journals (Sweden)

    Norwood Thomas H

    2006-07-01

    Full Text Available Abstract Background X chromosome inactivation (XCI is that aspect of mammalian dosage compensation that brings about equivalence of X-linked gene expression between females and males by inactivating one of the two X chromosomes (Xi in normal female cells, leaving them with a single active X (Xa as in male cells. In cells with more than two X's, but a diploid autosomal complement, all X's but one, Xa, are inactivated. This phenomenon is commonly thought to suggest 1 that normal development requires a ratio of one Xa per diploid autosomal set, and 2 that an early event in XCI is the marking of one X to be active, with remaining X's becoming inactivated by default. Results Triploids provide a test of these ideas because the ratio of one Xa per diploid autosomal set cannot be achieved, yet this abnormal ratio should not necessarily affect the one-Xa choice mechanism for XCI. Previous studies of XCI patterns in murine triploids support the single-Xa model, but human triploids mostly have two-Xa cells, whether they are XXX or XXY. The XCI patterns we observe in fibroblast cultures from different XXX human triploids suggest that the two-Xa pattern of XCI is selected for, and may have resulted from rare segregation errors or Xi reactivation. Conclusion The initial X inactivation pattern in human triploids, therefore, is likely to resemble the pattern that predominates in murine triploids, i.e., a single Xa, with the remaining X's inactive. Furthermore, our studies of XIST RNA accumulation and promoter methylation suggest that the basic features of XCI are normal in triploids despite the abnormal X:autosome ratio.

  19. Biological responses of progestogen metabolites in normal and cancerous human breast.

    Science.gov (United States)

    Pasqualini, Jorge R; Chetrite, Gérard S

    2010-12-01

    At present, more than 200 progestogen molecules are available, but their biological response is a function of various factors: affinity to progesterone or other receptors, their structure, the target tissues considered, biological response, experimental conditions, dose, method of administration and metabolic transformations. Metabolic transformation is of huge importance because in various biological processes the metabolic product(s) not only control the activity of the maternal hormone but also have an important activity of its own. In this regard, it was observed that the 20-dihydro derivative of the progestogen dydrogesterone (Duphaston®) is significantly more active than the parent compound in inhibiting sulfatase and 17β-hydroxysteroid dehydrogenase in human breast cancer cells. Estrone sulfatase activity is also inhibited by norelgestromin, a norgestimate metabolite. Interesting information was obtained with a similar progestogen, tibolone, which is rapidly metabolized into the active 3α/3β-hydroxy and 4-ene metabolites. All these metabolites can inhibit sulfatase and 17β-hydroxysteroid dehydrogenase and stimulate sulfotransferase in human breast cancer cells. Another attractive aspect is the metabolic transformation of progesterone itself in human breast tissues. In the normal breast progesterone is mainly converted to 4-ene derivatives, whereas in the tumor tissue it is converted mostly to 5α-pregnane derivatives. 20α-Dihydroprogesterone is found mainly in normal breast tissue and possesses antiproliferative properties as well as the ability to act as an anti-aromatase agent. Consequently, this progesterone metabolite could be involved in the control of estradiol production in the normal breast and therefore implicated in one of the multifactorial mechanisms of the breast carcinogenesis process. In conclusion, a better understanding of both natural and synthetic hormone metabolic transformations and their control could potentially provide

  20. Transcription factors GATA-4 and GATA-6 in normal and neoplastic human gastrointestinal mucosa

    Directory of Open Access Journals (Sweden)

    Mäki Markku

    2008-04-01

    Full Text Available Abstract Background Human gastrointestinal mucosa regenerates vigorously throughout life, but the factors controlling cell fate in mature mucosa are poorly understood. GATA transcription factors direct cell proliferation and differentiation in many organs, and are implicated in tumorigenesis. GATA-4 and GATA-6 are considered crucial for the formation of murine gastrointestinal mucosa, but their role in human gastrointestinal tract remains unexplored. We studied in detail the expression patterns of these two GATA factors and a GATA-6 down-stream target, Indian hedgehog (Ihh, in normal human gastrointestinal mucosa. Since these factors are considered important for proliferation and differentiation, we also explored the possible alterations in their expression in gastrointestinal neoplasias. The expression of the carcinogenesis-related protein Indian hedgehog was also investigated in comparison to GATA factors. Methods Samples of normal and neoplastic gastrointestinal tract from children and adults were subjected to RNA in situ hybridization with 33P labelled probes and immunohistochemistry, using an avidin-biotin immunoperoxidase system. The pathological tissues examined included samples of chronic and atrophic gastritis as well as adenomas and adenocarcinomas of the colon and rectum. Results GATA-4 was abundant in the differentiated epithelial cells of the proximal parts of the gastrointestinal tract but was absent from the distal parts. In contrast, GATA-6 was expressed throughout the gastrointestinal epithelium, and in the distal gut its expression was most intense at the bottom of the crypts, i.e. cells with proliferative capacity. Both factors were also present in Barrett's esophagus and metaplasia of the stomach. GATA-6 expression was reduced in colon carcinoma. Ihh expression overlapped with that of GATA-6 especially in benign gastrointestinal neoplasias. Conclusion The results suggest differential but overlapping functions for GATA-4 and

  1. Estimation of polyclonal IgG4 hybrids in normal human serum.

    Science.gov (United States)

    Young, Elizabeth; Lock, Emma; Ward, Douglas G; Cook, Alexander; Harding, Stephen; Wallis, Gregg L F

    2014-07-01

    The in vivo or in vitro formation of IgG4 hybrid molecules, wherein the immunoglobulins have exchanged half molecules, has previously been reported under experimental conditions. Here we estimate the incidence of polyclonal IgG4 hybrids in normal human serum and comment on the existence of IgG4 molecules with different immunoglobulin light chains. Polyclonal IgG4 was purified from pooled or individual donor human sera and sequentially fractionated using light-chain affinity and size exclusion chromatography. Fractions were analysed by SDS-PAGE, immunoblotting, ELISA, immunodiffusion and matrix-assisted laser-desorption mass spectrometry. Polyclonal IgG4 purified from normal serum contained IgG4κ, IgG4λ and IgG4κ/λ molecules. Size exclusion chromatography showed that IgG4 was principally present in monomeric form (150 000 MW). SDS-PAGE, immunoblotting and ELISA showed the purity of the three IgG4 samples. Immunodiffusion, light-chain sandwich ELISA and mass spectrometry demonstrated that both κ and λ light chains were present on only the IgG4κ/λ molecules. The amounts of IgG4κ/λ hybrid molecules ranged from 21 to 33% from the five sera analysed. Based on the molecular weight these molecules were formed of two IgG4 heavy chains plus one κ and one λ light chain. Polyclonal IgG (IgG4-depleted) was similarly fractionated according to light-chain specificity. No evidence of hybrid IgG κ/λ antibodies was observed. These results indicate that hybrid IgG4κ/λ antibodies compose a substantial portion of IgG4 from normal human serum. © 2014 John Wiley & Sons Ltd.

  2. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  3. Nystagmus responses in a group of normal humans during earth-horizontal axis rotation

    Science.gov (United States)

    Wall, Conrad, III; Furman, Joseph M. R.

    1989-01-01

    Horizontal eye movement responses to earth-horizontal yaw axis rotation were evaluated in 50 normal human subjects who were uniformly distributed in age (20-69 years) and each age group was then divided by gender. Subjects were rotated with eyes open in the dark, using clockwise and counter-clockwise 60 deg velocity trapezoids. The nystagmus slow component velocity is analyzed. It is shown that, despite large intersubject variability, parameters which describe earth-horizontal yaw axis responses are loosely interrelated, and some of them vary significantly with gender and age.

  4. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  5. Immunohistochemical Study of Expression of Sohlh1 and Sohlh2 in Normal Adult Human Tissues.

    Directory of Open Access Journals (Sweden)

    Xiaoli Zhang

    Full Text Available The expression pattern of Sohlh1 (spermatogenesis and oogenesis specific basic helix-loop-helix 1 and Sohlh2 in mice has been reported in previous studies. Sohlh1 and Sohlh2 are specifically expressed in spermatogonia, prespermatogonia in male mice and oocytes of primordial and primary follicles in female mice. In this report, we studied the expression pattern of Sohlh1 and Sohlh2 in human adult tissues. Immunohistochemical staining of Sohlh1 and Sohlh2 was performed in 5 samples of normal ovaries and testes, respectively. The results revealed that Sohlh genes are not only expressed in oocytes and spermatogonia, but also in granular cells, theca cells, Sertoli cells and Leydig cells, and in smooth muscles of blood vessel walls. To further investigate the expression of Sohlh genes in other adult human tissues, we collected representative normal adult tissues developed from three embryonic germ layers. Compared with the expression in mice, Sohlhs exhibited a much more extensive expression pattern in human tissues. Sohlhs were detected in testis, ovary and epithelia developed from embryonic endoderm, ectoderm and tissues developed from embryonic mesoderm. Sohlh signals were found in spermatogonia, Sertoli cells and also Leydig cells in testis, while in ovary, the expression was mainly in oocytes of primordial and primary follicles, granular cells and theca cells of secondary follicles. Compared with Sohlh2, the expression of Sohlh1 was stronger and more extensive. Our study explored the expression of Sohlh genes in human tissues and might provide insights for functional studies of Sohlh genes.

  6. An individual urinary proteome analysis in normal human beings to define the minimal sample number to represent the normal urinary proteome

    Directory of Open Access Journals (Sweden)

    Liu Xuejiao

    2012-11-01

    Full Text Available Abstract Background The urinary proteome has been widely used for biomarker discovery. A urinary proteome database from normal humans can provide a background for discovery proteomics and candidate proteins/peptides for targeted proteomics. Therefore, it is necessary to define the minimum number of individuals required for sampling to represent the normal urinary proteome. Methods In this study, inter-individual and inter-gender variations of urinary proteome were taken into consideration to achieve a representative database. An individual analysis was performed on overnight urine samples from 20 normal volunteers (10 males and 10 females by 1DLC/MS/MS. To obtain a representative result of each sample, a replicate 1DLCMS/MS analysis was performed. The minimal sample number was estimated by statistical analysis. Results For qualitative analysis, less than 5% of new proteins/peptides were identified in a male/female normal group by adding a new sample when the sample number exceeded nine. In addition, in a normal group, the percentage of newly identified proteins/peptides was less than 5% upon adding a new sample when the sample number reached 10. Furthermore, a statistical analysis indicated that urinary proteomes from normal males and females showed different patterns. For quantitative analysis, the variation of protein abundance was defined by spectrum count and western blotting methods. And then the minimal sample number for quantitative proteomic analysis was identified. Conclusions For qualitative analysis, when considering the inter-individual and inter-gender variations, the minimum sample number is 10 and requires a balanced number of males and females in order to obtain a representative normal human urinary proteome. For quantitative analysis, the minimal sample number is much greater than that for qualitative analysis and depends on the experimental methods used for quantification.

  7. Radiation-induced chromosome aberrations and cell killing in normal human fibroblasts and ataxia telangiectasia fibroblasts

    International Nuclear Information System (INIS)

    Kawata, T.; Saito, M.; Uno, T.; Ito, H.; Shigematsu, N.

    2003-01-01

    Full text: When cells are held in a non-dividing state (G0) after irradiation, an enhanced survival can be observed compared to that of immediate plating. A change of survival depending on post irradiation condition is known to be repair of potentially lethal damage (RPLD). The effects of confluent holding recovery (24-h incubation following irradiation) on chromosome aberrations in normal human fibroblasts (AG1522) and ataxia telangiectasia fibroblasts (GM02052C) were examined. A chemical-induced premature chromosome condensation (PCC) technique with fluorescent in situ hybridization (FISH) was applied to study chromosome aberrations in G2 and M-phase. Results from cell survival showed that the capacity for potentially lethal damage repair was normal in AG1522 cells but very little in GM02052C cells. The frequency of chromosome aberrations in AG1522 cells decreased when cells were allowed to repair for 24-h. Especially complex type exchanges were found to decrease markedly at high doses (4Gy and 6Gy). However, the frequency of chromosome aberrations including complex type exchanges showed little decrease in GM02052C cells. Confluent holding can effectively reduce chromosome aberrations, especially complex type exchanges in normal cells

  8. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  9. Three-dimensional counting of morphologically normal human red blood cells via digital holographic microscopy

    Science.gov (United States)

    Yi, Faliu; Moon, Inkyu; Lee, Yeon H.

    2015-01-01

    Counting morphologically normal cells in human red blood cells (RBCs) is extremely beneficial in the health care field. We propose a three-dimensional (3-D) classification method of automatically determining the morphologically normal RBCs in the phase image of multiple human RBCs that are obtained by off-axis digital holographic microscopy (DHM). The RBC holograms are first recorded by DHM, and then the phase images of multiple RBCs are reconstructed by a computational numerical algorithm. To design the classifier, the three typical RBC shapes, which are stomatocyte, discocyte, and echinocyte, are used for training and testing. Nonmain or abnormal RBC shapes different from the three normal shapes are defined as the fourth category. Ten features, including projected surface area, average phase value, mean corpuscular hemoglobin, perimeter, mean corpuscular hemoglobin surface density, circularity, mean phase of center part, sphericity coefficient, elongation, and pallor, are extracted from each RBC after segmenting the reconstructed phase images by using a watershed transform algorithm. Moreover, four additional properties, such as projected surface area, perimeter, average phase value, and elongation, are measured from the inner part of each cell, which can give significant information beyond the previous 10 features for the separation of the RBC groups; these are verified in the experiment by the statistical method of Hotelling's T-square test. We also apply the principal component analysis algorithm to reduce the dimension number of variables and establish the Gaussian mixture densities using the projected data with the first eight principal components. Consequently, the Gaussian mixtures are used to design the discriminant functions based on Bayesian decision theory. To improve the performance of the Bayes classifier and the accuracy of estimation of its error rate, the leaving-one-out technique is applied. Experimental results show that the proposed method can

  10. Human Colors-The Rainbow Garden of Pathology: What Gives Normal and Pathologic Tissues Their Color?

    Science.gov (United States)

    Piña-Oviedo, Sergio; Ortiz-Hidalgo, Carlos; Ayala, Alberto G

    2017-03-01

    - Colors are important to all living organisms because they are crucial for camouflage and protection, metabolism, sexual behavior, and communication. Human organs obviously have color, but the underlying biologic processes that dictate the specific colors of organs and tissues are not completely understood. A literature search on the determinants of color in human organs yielded scant information. - To address 2 specific questions: (1) why do human organs have color, and (2) what gives normal and pathologic tissues their distinctive colors? - Endogenous colors are the result of complex biochemical reactions that produce biologic pigments: red-brown cytochromes and porphyrins (blood, liver, spleen, kidneys, striated muscle), brown-black melanins (skin, appendages, brain nuclei), dark-brown lipochromes (aging organs), and colors that result from tissue structure (tendons, aponeurosis, muscles). Yellow-orange carotenes that deposit in lipid-rich tissues are only produced by plants and are acquired from the diet. However, there is lack of information about the cause of color in other organs, such as the gray and white matter, neuroendocrine organs, and white tissues (epithelia, soft tissues). Neoplastic tissues usually retain the color of their nonneoplastic counterpart. - Most available information on the function of pigments comes from studies in plants, microorganisms, cephalopods, and vertebrates, not humans. Biologic pigments have antioxidant and cytoprotective properties and should be considered as potential future therapies for disease and cancer. We discuss the bioproducts that may be responsible for organ coloration and invite pathologists and pathology residents to look at a "routine grossing day" with a different perspective.

  11. Potential genotoxic and cytotoxicity of emamectin benzoate in human normal liver cells.

    Science.gov (United States)

    Zhang, Zhijie; Zhao, Xinyu; Qin, Xiaosong

    2017-10-10

    Pesticide residue inducing cancer-related health problems draw people more attention recently. Emamectin benzoate (EMB) has been widely used in agriculture around the world based on its specificity targets. Although potential risk and the molecular mechanism of EMB toxicity to human liver has not been well-characterized. Unlike well-reported toxicity upon central nervous system, potential genotoxic and cytotoxicity of EMB in human liver cell was ignored and very limited. In this study, we identify genotoxicity and cytotoxicity of EMB to human normal liver cells (QSG7701 cell line) in vitro . We demonstrate that EMB inhibited the viability of QSG7701 cells and induced the DNA damage. Established assays of cytotoxicity were performed to characterize the mechanism of EMB toxicity on QSG7701 cells. Typical chromatin condensation and DNA fragmentation indicated the apoptosis of QSG7701 cells induced by EMB. And the intracellular biochemical results demonstrated that EMB-enhanced apoptosis of QSG7701 cells concurrent with generated ROS, a loss of mitochondrial membrane potential, the cytochrome-c release, up regulate the Bax/Bcl-2 and the activation of caspase-9/-3. Our results of EMB induces the death of QSG7701 cells maybe via mitochondrial-mediated intrinsic apoptotic pathways would contribute to promote the awareness of EMB as an extensive used pesticide to human being effects and reveal the underlying mechanisms of potential genotoxic.

  12. Detection of Apoptosis and Necrosis in Normal Human Lung Cells Using 1H NMR Spectroscopy

    Science.gov (United States)

    Shih, Chwen-Ming; Ko, Wun-Chang; Yang, Liang-Yo; Lin, Chien-Ju; Wu, Jui-Sheng; Lo, Tsui-Yun; Wang, Shwu-Huey; Chen, Chien-Tsu

    2005-05-01

    This study aimed to detect apoptosis and necrosis in MRC-5, a normal human lung cell line, by using noninvasive proton nuclear magnetic resonance (1H NMR). Live MRC-5 cells were processed first for 1H NMR spectroscopy; subsequently their types and the percentage of cell death were assessed on a flow cytometer. Cadmium (Cd) and mercury (Hg) induced apoptosis and necrosis in MRC-5 cells, respectively, as revealed by phosphatidylserine externalization on a flow cytometer. The spectral intensity ratio of methylene (CH2) resonance (at 1.3 ppm) to methyl (CH3) resonance (at 0.9 ppm) was directly proportional to the percentage of apoptosis and strongly and positively correlated with PI staining after Cd treatment (r2 = 0.9868, P In contrast, this ratio only increased slightly within 2-h Hg treatment, and longer Hg exposure failed to produce further increase. Following 2-h Hg exposure, the spectral intensity of choline resonance (at 3.2 ppm) was abolished, but this phenomenon was absent in Cd-induced apoptosis. These findings together demonstrate that 1H NMR is a novel tool with a quantitative potential to distinguish apoptosis from necrosis as early as the onset of cell death in normal human lung cells.

  13. Persistent Amplification of DNA Damage Signal Involved in Replicative Senescence of Normal Human Diploid Fibroblasts

    Directory of Open Access Journals (Sweden)

    Masatoshi Suzuki

    2012-01-01

    Full Text Available Foci of phosphorylated histone H2AX and ATM are the surrogate markers of DNA double strand breaks. We previously reported that the residual foci increased their size after irradiation, which amplifies DNA damage signals. Here, we addressed whether amplification of DNA damage signal is involved in replicative senescence of normal human diploid fibroblasts. Large phosphorylated H2AX foci (>1.5 μm diameter were specifically detected in presenescent cells. The frequency of cells with large foci was well correlated with that of cells positive for senescence-associated β-galactosidase staining. Hypoxic cell culture condition extended replicative life span of normal human fibroblast, and we found that the formation of large foci delayed in those cells. Our immuno-FISH analysis revealed that large foci partially localized at telomeres in senescent cells. Importantly, large foci of phosphorylated H2AX were always colocalized with phosphorylated ATM foci. Furthermore, Ser15-phosphorylated p53 showed colocalization with the large foci. Since the treatment of senescent cells with phosphoinositide 3-kinase inhibitor, wortmannin, suppressed p53 phosphorylation, it is suggested that amplification of DNA damage signaling sustains persistent activation of ATM-p53 pathway, which is essential for replicative senescence.

  14. Enhanced reactivation and mutagenesis of UV-irradiated adenovirus in normal human fibroblasts

    International Nuclear Information System (INIS)

    Bennett, C.B.; Rainbow, A.J.

    1988-01-01

    UV-enhanced reactivation (UVER) and UV-enhanced mutagenesis (UVEM) for two adenovirus temperature-sensitive mutants were examined following the infection of normal human fibroblasts. UV-irradiation of the virus alone resulted in dose-dependent increase in the UV-induced reversion frequency (RF) of viral progeny and a dose-dependent exponential decrease in progeny survival, when infecting non-irradiated cells. Analysis of the slopes of the UV-induced reversion curves suggested that 2.5 ± 0.3 and 2.4 ± 0.5 'hits' were required to produce a targeted reversion event among the viral progeny of Ad5ts36 and Ad5ts125 respectively. UV-irradiation of cells 24 h prior to infection resulted in a significant increase in progeny survival for UV-irradiated virus (UVER factor = 3.4 ± 0.8) concomitant with a significant increase in RF for UV-irradiated virus (targeted increase = 1.9 ± 0.3). The UV-induced RF per lethal hit to the virus was also significantly greater in UV-irradiated compared with non-irradiated cells. These results are consistent with the existence of a UV-inducible error-prone DNA repair mechanism in normal human cells. (author)

  15. The Fate of a Normal Human Cell Traversed by a Single Charged Particle

    Science.gov (United States)

    Fournier, C.; Zahnreich, S.; Kraft, D.; Friedrich, T.; Voss, K.-O.; Durante, M.; Ritter, S.

    2012-01-01

    The long-term “fate” of normal human cells after single hits of charged particles is one of the oldest unsolved issues in radiation protection and cellular radiobiology. Using a high-precision heavy-ion microbeam we could target normal human fibroblasts with exactly one or five carbon ions and measured the early cytogenetic damage and the late behaviour using single-cell cloning. Around 70% of the first cycle cells presented visible aberrations in mFISH after a single ion traversal, and about 5% of the cells were still able to form colonies. In one third of selected high-proliferative colonies we observed clonal (radiation-induced) aberrations. Terminal differentiation and markers of senescence (PCNA, p16) in the descendants of cells traversed by one carbon ion occurred earlier than in controls, but no evidence of radiation-induced chromosomal instability was found. We conclude that cells surviving single-ion traversal, often carrying clonal chromosome aberrations, undergo accelerated senescence but maintain chromosomal stability. PMID:22966418

  16. HSP10 selective preference for myeloid and megakaryocytic precursors in normal human bone marrow

    Directory of Open Access Journals (Sweden)

    F Cappello

    2009-06-01

    Full Text Available Heat shock proteins (HSPs constitute a heterogeneous family of proteins involved in cell homeostasis. During cell life they are involved in harmful insults, as well as in immune and inflammatory reactions. It is known that they regulate gene expression, and cell proliferation, differentiation and death. HSP60 is a mitochondrial chaperonin, highly preserved during evolution, responsible of protein folding. Its function is strictly dependent on HSP10 in both prokaryotic and eukaryotic elements. We investigated the presence and the expression of HSP60 and HSP10 in a series of 20 normal human bone marrow specimens (NHBM by the means of immunohistochemistry. NHBM showed no expression of HSP60, probably due to its being below the detectable threshold, as already demonstrated in other normal human tissues. By contrast, HSP10 showed a selective positivity for myeloid and megakaryocytic lineages. The positivity was restricted to precursor cells, while mature elements were constantly negative.We postulate that HSP10 plays a role in bone marrow cell differentiation other than being a mitochondrial co-chaperonin. The present data emphasize the role of HSP10 during cellular homeostasis and encourage further investigations in this field.

  17. Expression of Bcl-2 family proteins and spontaneous apoptosis in normal human testis.

    Science.gov (United States)

    Oldereid, N B; Angelis, P D; Wiger, R; Clausen, O P

    2001-05-01

    We investigated the frequency of spontaneous apoptosis and expression of the Bcl-2 family of proteins during normal spermatogenesis in man. Testicular tissue with both normal morphology and DNA content was obtained from necro-donors and fixed in Bouin's solution. A TdT-mediated dUTP end-labelling method (TUNEL) was used for the detection of apoptotic cells. Expression of apoptosis regulatory Bcl-2 family proteins and of p53 and p21(Waf1) was assessed by immunohistochemistry. Germ cell apoptosis was detected in all testes and was mainly seen in primary spermatocytes and spermatids and in a few spermatogonia. Bcl-2 and Bak were preferentially expressed in the compartments of spermatocytes and differentiating spermatids, while Bcl-x was preferentially expressed in spermatogonia. Bax showed a preferential expression in nuclei of round spermatids, whereas Bad was only seen in the acrosome region of various stages of spermatids. Mcl-1 staining was weak without a particular pattern, whereas expression of Bcl-w, p53 and p21(Waf1) proteins was not detected by immunohistochemistry. The results show that spontaneous apoptosis occurs in all male germ cell compartments in humans. Bcl-2 family proteins are distributed preferentially within distinct germ cell compartments suggesting a specific role for these proteins in the processes of differentiation and maturation during human spermatogenesis.

  18. Wound healing properties of ethyl acetate fraction of Moringa oleifera in normal human dermal fibroblasts

    Directory of Open Access Journals (Sweden)

    Sivapragasam Gothai

    2016-03-01

    Full Text Available Background/Aim: Wounds are the outcome of injuries to the skin that interrupt the soft tissue. Healing of a wound is a complex and long-drawn-out process of tissue repair and remodeling in response to injury. A large number of plants are used by folklore traditions for treatment of cuts, wounds and burns. Moringa oleifera is an herb used as traditional folk medicine for the treatment of various skin wounds and associated diseases. The underlying mechanisms of wound healing activity of ethyl acetate fraction of M. oleifera leaves extract are completely unknown. Methods: In the current study, ethyl acetate fraction of Moringa oleifera leaves was investigated for its efficacy on cell viability, proliferation and migration (wound closure rate in human normal dermal fibroblast cells. Results: Results revealed that lower concentration (12.5 µg/ml, 25 µg/ml, and 50 µg/ml of ethyl acetate fraction of M. oleifera leaves showed remarkable proliferative and migratory effect on normal human dermal fibroblasts. Conclusion: The present study suggested that ethyl acetate fraction of M. oleifera leaves might be a potential therapeutic agent for skin wound healing by promoting fibroblast proliferation and migration through increasing the wound closure rate corroborating its traditional use. [J Complement Med Res 2016; 5(1.000: 1-6

  19. Mechanisms of inhibition of DNA replication by ultraviolet light in normal human and xeroderma pigmentosum fibroblasts

    International Nuclear Information System (INIS)

    Kaufmann, W.K.; Cleaver, J.E.

    1981-01-01

    The inhibition of DNA replication in ultraviolet-irradiated human fibroblasts was characterized by quantitative analysis of radiation-induced alterations in the steady-state distribution of sizes of pulse-labeled, nascent DNA. Low, noncytotoxic fluences rapidly produced an inhibition of DNA synthesis in half-replicon-size replication intermediates. With time, the inhibition produced by low fluences spread progressively to include multi-replicon-size intermediates. The results indicate that ultraviolet radiation inhibits the initiation of DNA synthesis in replicons. Higher cytotoxic fluences inhibited DNA synthesis in operating replicons. Xeroderma pigmentosum fibroblasts with deficiencies in DNA excision repair exhibited an inhibition of replicon initiation after low radiation fluences, indicating the effect was not solely dependent upon operation of the nucleotidyl excision repair pathway. Owing to their inability to remove pyrimidine dimers ahead of DNA growing points, the repair-deficient cells also were more sensitive than normal cells to the ultraviolet-induced inhibition of chain elongation. Xeroderma pigmentosum cells belonging to the variant class were even more sensitive to inhibition of chain elongation despite their ability to remove pyrimidine dimers. The analysis suggested that normal and repair-deficient human fibroblasts either are able to rapidly bypass certain dimers or these dimers are not recognized by the chain elongation machinery. (author)

  20. Raman Spectroscopy of DNA Packaging in Individual Human Sperm Cells distinguishes Normal from Abnormal Cells

    Energy Technology Data Exchange (ETDEWEB)

    Huser, T; Orme, C; Hollars, C; Corzett, M; Balhorn, R

    2009-03-09

    Healthy human males produce sperm cells of which about 25-40% have abnormal head shapes. Increases in the percentage of sperm exhibiting aberrant sperm head morphologies have been correlated with male infertility, and biochemical studies of pooled sperm have suggested that sperm with abnormal shape may contain DNA that has not been properly repackaged by protamine during spermatid development. We have used micro-Raman spectroscopy to obtain Raman spectra from individual human sperm cells and examined how differences in the Raman spectra of sperm chromatin correlate with cell shape. We show that Raman spectra of individual sperm cells contain vibrational marker modes that can be used to assess the efficiency of DNA-packaging for each cell. Raman spectra obtained from sperm cells with normal shape provide evidence that DNA in these sperm is very efficiently packaged. We find, however, that the relative protein content per cell and DNA packaging efficiencies are distributed over a relatively wide range for sperm cells with both normal and abnormal shape. These findings indicate that single cell Raman spectroscopy should be a valuable tool in assessing the quality of sperm cells for in-vitro fertilization.

  1. Regulation of pigmentation by substrate elasticity in normal human melanocytes and melanotic MNT1 human melanoma cells.

    Science.gov (United States)

    Choi, Hyunjung; Kim, Mina; Ahn, Song Ih; Cho, Eun-Gyung; Lee, Tae Ryong; Shin, Jennifer H

    2014-03-01

    The elasticity of the cellular microenvironment is a key regulator of cellular physiology in many cell types. To investigate the effects of substrate stiffness on the pigmentation process, we cultured normal human melanocytes (NHM) and MNT1 melanoma cells on laminin-coated polydimethylsiloxane (PDMS) substrates of different stiffness. The dendricity of NHM and MNT1 cells was reduced as the substrate stiffness decreased, and the degree of melanosome transfer from NHM or MNT1 cells to normal human keratinocytes was decreased on softer substrates with the reduced dendricity. Gene and protein expressions of MITF, tyrosinase, TRP2, and gp100/PMEL17 exhibited a consistent decreasing trend with the decreasing stiffness. Because the stiffness sensing is mediated by focal adhesion complex through integrin receptors, we checked laminin specific integrin alpha 6 and p-FAK for MNT1 cells to observe that the substrate adhesion was weakened as the substrate stiffness decreased. Weaker adhesion on a softer substrate was accompanied by dynamic shape changes in MNT1 cells with higher speed and larger scattering. Dendritic MNT1 cells cultured on a stiffer substrate exhibited lower migration with smaller root mean squared displacement. These results demonstrate the possibility that skin pigmentation can be influenced by mechanical properties of the cellular microenvironment and can increase when the skin becomes stiff. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Comparison of cerebral metabolism of glucose in normal human and cancer patients

    International Nuclear Information System (INIS)

    Si, M.

    2007-01-01

    Full text: Objective: To determine whether the cerebral metabolism in various regions of the normal human brain differs from those of cancer patients in aging by using 18F-FDG PET instrument and SPM software. Materials and Methods We reviewed clinical information of 295 healthy normal samples so called 'normal group' (ranging 21 to 88; mean age+/-SD: 50+/-14) and 290 cancer patients called 'cancer group' (ranging 21 to 85; mean age+/-SD: 54+/-14) who were examined by a whole body GE Discovery LS PET-CT instrument in our center from Aug. 2004 to Dec. 2005.They were selected with: (i) absence of clear focal brain lesions (epilepsy, cerebrovascular diseases etc.); (ii) absence of metabolic diseases, such as hyperthyroidism, hypothyroidism and diabetes; (iii) absence of psychiatric disorders and abuse of drugs and alcohol;( iiii) cancer patients were diagnosed definitely of variable cancers except brain cancer or brain metastasis. Both groups were sub grouped into six with the interval of 10 years old starting from 21, and the gender, educational background and serum glucose are matched. All 12 subgroups were compared to the subgroup of normal 31-40 years old called 'control subgroup' (84 samples; mean age+/-SD: 37.15+/- 2.63). All samples were injected with 18F-FDG (5.55MBq/kg), 45-60 minutes later; their brains were scanned for 10 minutes. Pixel-by-pixel t-statistic analysis was applied to all brain images using the Statistical parametric mapping (SPM2). The hypometabolic areas (p < 0. 01 or p<0.001, uncorrected) were identified in the Stereotaxic coordinate human brain atlas and three dimensional localized by MNI Space utility (MSU) software. Results:1.With increasing of age interval, similar hypometabolic brain areas are detected in both 'normal group' and 'cancer group', they are mainly in the cortical structures such as bilateral prefrontal cortex (BA9), superior temporal gyrus (BA22), parietal cortex (inferior parietal lobule and precuneus(BA40), insula (BA13

  3. Near Infrared Optical Visualization of Epidermal Growth Factor Receptors Levels in COLO205 Colorectal Cell Line, Orthotopic Tumor in Mice and Human Biopsies

    Directory of Open Access Journals (Sweden)

    Philip Lazarovici

    2013-07-01

    Full Text Available In this study, we present the applicability of imaging epidermal growth factor (EGF receptor levels in preclinical models of COLO205 carcinoma cells in vitro, mice with orthotopic tumors and ex vivo colorectal tumor biopsies, using EGF-labeled with IRDye800CW (EGF-NIR. The near infrared (NIR bio-imaging of COLO205 cultures indicated specific and selective binding, reflecting EGF receptors levels. In vivo imaging of tumors in mice showed that the highest signal/background ratio between tumor and adjacent tissue was achieved 48 hours post-injection. Dissected colorectal cancer tissues from different patients demonstrated ex vivo specific imaging using the NIR bio-imaging platform of the heterogeneous distributed EGF receptors. Moreover, in the adjacent gastrointestinal tissue of the same patients, which by Western blotting was demonstrated as EGF receptor negative, no labeling with EGF-NIR probe was detected. Present results support the concept of tumor imaging by measuring EGF receptor levels using EGF-NIR probe. This platform is advantageous for EGF receptor bio-imaging of the NCI-60 recommended panel of tumor cell lines including 6–9 colorectal cell lines, since it avoids radioactive probes and is appropriate for use in the clinical setting using NIR technologies in a real-time manner.

  4. Resveratrol modulates MED28 (Magicin/EG-1) expression and inhibits epidermal growth factor (EGF)-induced migration in MDA-MB-231 human breast cancer cells.

    Science.gov (United States)

    Lee, Ming-Fen; Pan, Min-Hsiung; Chiou, Yi-Siou; Cheng, An-Chin; Huang, Han

    2011-11-09

    Resveratrol and pterostilbene exhibit diverse biological activities. MED28, a subunit of the mammalian Mediator complex for transcription, was also identified as magicin, an actin cytoskeleton Grb2-associated protein, and as endothelial-derived gene (EG-1). Several tumors exhibit aberrant MED28 expression, whereas the underlying mechanism is unclear. Triple-negative breast cancers, often expressing epidermal growth factor (EGF) receptor (EGFR), are associated with metastasis and poor survival. The objective of this study is to compare the effect of resveratrol and pterostilbene and to investigate the role of MED28 in EGFR-overexpressing MDA-MB-231 breast cancer cells. Pretreatment of resveratrol, but not pterostlbene, suppressed EGF-mediated migration and expression of MED28 and matrix metalloproteinase (MMP)-9 in MDA-MB-231 cells. Moreover, overexpression of MED28 increased migration, and the addition of EGF further enhanced migration. Our data indicate that resveratrol modulates the effect of MED28 on cellular migration, presumably through the EGFR/phosphatidylinositol 3-kinase (PI3K) signaling pathway, in breast cancer cells.

  5. Leptin and Adiponectin Modulate the Self-renewal of Normal Human Breast Epithelial Stem Cells.

    Science.gov (United States)

    Esper, Raymond M; Dame, Michael; McClintock, Shannon; Holt, Peter R; Dannenberg, Andrew J; Wicha, Max S; Brenner, Dean E

    2015-12-01

    Multiple mechanisms are likely to account for the link between obesity and increased risk of postmenopausal breast cancer. Two adipokines, leptin and adiponectin, are of particular interest due to their opposing biologic functions and associations with breast cancer risk. In the current study, we investigated the effects of leptin and adiponectin on normal breast epithelial stem cells. Levels of leptin in human adipose explant-derived conditioned media positively correlated with the size of the normal breast stem cell pool. In contrast, an inverse relationship was found for adiponectin. Moreover, a strong linear relationship was observed between the leptin/adiponectin ratio in adipose conditioned media and breast stem cell self-renewal. Consistent with these findings, exogenous leptin stimulated whereas adiponectin suppressed breast stem cell self-renewal. In addition to local in-breast effects, circulating factors, including leptin and adiponectin, may contribute to the link between obesity and breast cancer. Increased levels of leptin and reduced amounts of adiponectin were found in serum from obese compared with age-matched lean postmenopausal women. Interestingly, serum from obese women increased stem cell self-renewal by 30% compared with only 7% for lean control serum. Taken together, these data suggest a plausible explanation for the obesity-driven increase in postmenopausal breast cancer risk. Leptin and adiponectin may function as both endocrine and paracrine/juxtacrine factors to modulate the size of the normal stem cell pool. Interventions that disrupt this axis and thereby normalize breast stem cell self-renewal could reduce the risk of breast cancer. ©2015 American Association for Cancer Research.

  6. In vitro dermal and epidermal cellular response to titanium alloy implants fabricated with electron beam melting.

    Science.gov (United States)

    Springer, Jessica Collins; Harrysson, Ola L A; Marcellin-Little, Denis J; Bernacki, Susan H

    2014-10-01

    Transdermal osseointegrated prostheses (TOPs) are emerging as an alternative to socket prostheses. Electron beam melting (EBM) is a promising additive manufacturing technology for manufacture of custom, freeform titanium alloy (Ti6Al4V) implants. Skin ongrowth for infection resistance and mechanical stability are critically important to the success of TOP, which can be influenced by material composition and surface characteristics. We assessed viability and proliferation of normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF) on several Ti6Al4V surfaces: solid polished commercial, solid polished EBM, solid unpolished EBM and porous unpolished EBM. Cell proliferation was evaluated at days 2 and 7 using alamarBlue(®) and cell viability was analyzed with a fluorescence-based live-dead assay after 1 week. NHDF and NHEK were viable and proliferated on all Ti6Al4V surfaces. NHDF proliferation was highest on commercial and EBM polished surfaces. NHEK was highest on commercial polished surfaces. All EBM Ti6Al4V discs exhibited an acceptable biocompatibility profile compared to solid Ti6Al4V discs from a commercial source for dermal and epidermal cells. EBM may be considered as an option for fabrication of custom transdermal implants. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  7. Origin of nuclear buds and micronuclei in normal and folate-deprived human lymphocytes

    International Nuclear Information System (INIS)

    Lindberg, Hanna K.; Wang Xu; Jaerventaus, Hilkka; Falck, Ghita C.-M.; Norppa, Hannu; Fenech, Michael

    2007-01-01

    Micronuclei are formed from chromosomes and chromosomal fragments that lag behind in anaphase and are left outside daughter nuclei in telophase. They may also be derived from broken anaphase bridges. Nuclear buds, micronucleus-like bodies attached to the nucleus by a thin nucleoplasmic connection, have been proposed to be generated similarly to micronuclei during nuclear division or in S-phase as a stage in the extrusion of extra DNA, possibly giving rise to micronuclei. To better understand these phenomena, we have characterized the contents of 894 nuclear buds and 1392 micronuclei in normal and folate-deprived 9-day cultures of human lymphocytes using fluorescence in situ hybridization with pancentromeric and pantelomeric DNA probes. Such information has not earlier been available for human primary cells. Surprisingly, there appears to be no previous data on the occurrence of telomeres in micronuclei (or buds) of normal human cells in general. Our results suggest that nuclear buds and micronuclei have partly different mechanistic origin. Interstitial DNA without centromere or telomere label was clearly more prevalent in nuclear buds (43%) than in micronuclei (13%). DNA with only telomere label or with both centromere and telomere label was more frequent in micronuclei (62% and 22%, respectively) than in nuclear buds (44% and 10%, respectively). Folate deprivation especially increased the frequency of nuclear buds and micronuclei harboring telomeric DNA and nuclear buds harboring interstitial DNA but also buds and micronuclei with both centromeric and telomeric DNA. According to the model we propose, that micronuclei in binucleate lymphocytes primarily derive from lagging chromosomes and terminal acentric fragments during mitosis. Most nuclear buds, however, are suggested to originate from interstitial or terminal acentric fragments, possibly representing nuclear membrane entrapment of DNA that has been left in cytoplasm after nuclear division or excess DNA that

  8. Establishment of human induced pluripotent stem cell lines from normal fibroblast TIG-1.

    Science.gov (United States)

    Kumazaki, Tsutomu; Kurata, Sayaka; Matsuo, Taira; Mitsui, Youji; Takahashi, Tomoko

    2011-06-01

    Normal human cells have a replicative life span and therefore senesce. Usually, normal human cell strains are differentiated cells and reach a terminally differentiated state after a number of cell divisions. At present, definitive differences are not known between replicative senescence and terminal differentiation. TIG-1 is a human fibroblast strain established from fetal lung and has been used extensively in studies of cellular senescence, and numerous data were accumulated at the molecular level. Recently, a method for generating induced pluripotent stem cells (iPSCs) was developed. Using the method, we introduced four reprogramming genes to TIG-1 fibroblasts and succeeded in isolating colonies that had embryonic stem cell (ESC)-like morphologies. They showed alkaline phosphatase activity and expressed ESC markers, as shown by immunostaining of OCT4, SOX2, SSEA4, and TRA-1-81 as well as reverse-transcription polymerase chain reaction (RT-PCR) for OCT4 and NANOG transcripts. Thus, we succeeded in establishing iPSC clones from TIG-1. The iPSC clones could differentiate to cells originated from all three germ-cell layers, as shown by RT-PCR, for messenger RNA (mRNA) expression of α-fetoprotein (endoderm), MSX1 (mesoderm) and microtubule-associated protein 2 (ectoderm), and by immunostaining for α-fetoprotein (endoderm), α-smooth muscle actin (mesoderm), and β-III-tubulin (ectoderm). The iPSCs formed teratoma containing the structures developed from all three germ-cell layers in severe combined immune-deficiency mice. Thus, by comparing the aging process of parental TIG-1 cells and the differentiation process of iPSC-derived fibrocytes to fibroblasts, we can reveal the exact differences in processes between senescence and terminal differentiation.

  9. Signalling in the epidermis: the E2F cell cycle regulatory pathway in epidermal morphogenesis, regeneration and transformation.

    Science.gov (United States)

    Ivanova, Iordanka A; D'Souza, Sudhir J A; Dagnino, Lina

    2005-01-01

    The epidermis is the outermost layer in the skin, and it is the first line of defence against the environment. The epidermis also provides a barrier against loss of fluids and electrolytes, which is crucial for life. Essential in the maintenance of this tissue is its ability to continually self-renew and regenerate after injury. These two characteristics are critically dependent on the ability of the principal epidermal cell type, the keratinocyte, to proliferate and to respond to differentiation cues. Indeed, the epidermis is a multilayered tissue composed of keratinocyte stem cells and their differentiated progeny. Central for the control of cell proliferation is the E2F transcription factor regulatory network. This signaling network also includes cyclins, cdk, cdk inhibitors and the retinoblastoma (pRb) family of proteins. The biological importance of the E2F/pRb pathway is emphasized by the fact that a majority of human tumours exhibit alterations that disrupt the ability of pRb proteins to inhibit E2F, leading to permanent activation of the latter. Further, E2F is essential for normal epidermal regeneration after injury. Other member of the E2F signaling pathway are also involved in epidermal development and pathophysiology. Thus, whereas the pRb family of proteins is essential for epidermal morphogenesis, abnormal regulation of cyclins and E2F proteins results in tumorgenesis in this tissue. In this review, we discuss the role of each member of this important growth regulatory network in epidermal formation, homeostasis and carcinogenesis.

  10. Study of cerebral metabolism of glucose in normal human brain correlated with age

    International Nuclear Information System (INIS)

    Si, M.

    2007-01-01

    Full text: The objective was to determine whether cerebral metabolism in various regions of the brain differs with advancing age by using 18F-FDG PET instrument and SPM software. Materials and Methods We reviewed clinical information of 295 healthy normal samples who were examined by a whole body GE Discovery LS PET-CT instrument in our center from Aug. 2004 to Dec. 2005.They (with the age ranging from 21 to 88; mean age+/-SD: 49.77+/-13.51) were selected with: (i)absence of clear focal brain lesions (epilepsy.cerebrovascular diseases etc);(ii) absence of metabolic diseases, such as hyperthyroidism, hypothyroidism and diabetes;(iii) absence of psychiatric disorders and abuse of drugs and alcohol. They were sub grouped into six groups with the interval of 10 years old starting from 21, and the gender, educational background and serum glucose were matched. All subgroups were compared to the control group of 31-40 years old (84 samples; mean age+/-SD: 37.15+/-2.63). All samples were injected with 18F-FDG (5.55MBq/kg), 45-60 minutes later, their brains were scanned for 10min. Pixel-by-pixel t-statistic analysis was applied to all brain images using the Statistical parametric mapping (SPM2) .The hypometabolic areas (p < 0. 01 or p<0.001, uncorrected) were identified in the Stereotaxic coordinate human brain atlas and three-dimensional localized by MNI Space utility (MSU) software. Results:Relative hypometabolic brain areas detected are mainly in the cortical structures such as bilateral prefrontal cortex, superior temporal gyrus(BA22), parietal cortex (inferior parietal lobule and precuneus(BA40, insula(BA13)), parahippocampal gyrus and amygdala (p<0.01).It is especially apparent in the prefrontal cortex (BA9)and sensory-motor cortex(BA5, 7) (p<0.001), while basal ganglia and cerebellum remained metabolically unchanged with advancing age. Conclusions Regional cerebral metabolism of glucose shows a descent tendency with aging, especially in the prefrontal cortex (BA9)and

  11. Concentrations of AMH and inhibin-B in relation to follicular diameter in normal human small antral follicles

    DEFF Research Database (Denmark)

    Andersen, Claus Yding; Schmidt, Kirsten Tryde; Kristensen, Stine Gry

    2010-01-01

    The aim of the present study was to determine the intrafollicular concentrations of anti-Müllerian hormone (AMH), inhibin-B and steroids in normal human small antral follicles and to relate them to follicular size....

  12. Radioprotective Effect of Achillea millefolium L Against Genotoxicity Induced by Ionizing Radiation in Human Normal Lymphocytes

    Directory of Open Access Journals (Sweden)

    Somayeh Shahani

    2015-04-01

    Full Text Available The radioprotective effect of Achillea millefolium L (ACM extract was investigated against genotoxicity induced by ionizing radiation (IR in human lymphocytes. Peripheral blood samples were collected from human volunteers and incubated with the methanolic extract of ACM at different concentrations (10, 50, 100, and 200 μg/mL for 2 hours. At each dose point, the whole blood was exposed in vitro to 2.5 Gy of X-ray and then the lymphocytes were cultured with mitogenic stimulation to determine the micronuclei in cytokinesis-blocked binucleated cell. Antioxidant capacity of the extract was determined using free radical-scavenging method. The treatment of lymphocytes with the extract showed a significant decrease in the incidence of micronuclei binucleated cells, as compared with similarly irradiated lymphocytes without any extract treatment. The maximum protection and decrease in frequency of micronuclei were observed at 200 μg/mL of ACM extract which completely protected genotoxicity induced by IR in human lymphocytes. Achillea millefolium extract exhibited concentration-dependent radical-scavenging activity on 1,1-diphenyl-2-picryl hydrazyl free radicals. These data suggest that the methanolic extract of ACM may play an important role in the protection of normal tissues against genetic damage induced by IR.

  13. Transfection of normal human bronchial epithelial cells with the bcl-2 oncogene

    International Nuclear Information System (INIS)

    Kennedy, C.H.; Kenyon, K.D.; Tesfaigzi, J.

    1995-01-01

    In vitro, studies examining the transformation of virus-immortalized human bronchial epithelial (HBE) cells after exposure to chemical and physical carcinogens have contributed to our understanding of the mechanisms that underlie the development of lung cancer. Virus-immortalized HBE cells have been used because of both the limited life span of normal human bronchial epithelial (NHBE) cells in culture (approximately 30-35 population doublins) and their resistance to in vitro malignant transformation. For example, human papillomavirus (HPV)-immortalized HBE cells have been used to study the genetic changes that occur after exposure to α-particles in vitro. Although this model may prove to be useful for studying the 18% or less of bronchogenic carcinomas found to contain HPV sequences, it is not an appropriate model for studying the majority of lung epithelial malignancies in which HPV DNA is not detected. This view is supported by the fact that HPV-immortalized cell lines commonly exhibit aneuploidy. This results of this study suggest that: (1) NHBE cells can be transiently transfected with the pCMVΒ vector; and (2) the antibiotic hygromycin-resistant transfected cells

  14. Transfection of normal human bronchial epithelial cells with the bcl-2 oncogene

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, C.H.; Kenyon, K.D.; Tesfaigzi, J. [and others

    1995-12-01

    In vitro, studies examining the transformation of virus-immortalized human bronchial epithelial (HBE) cells after exposure to chemical and physical carcinogens have contributed to our understanding of the mechanisms that underlie the development of lung cancer. Virus-immortalized HBE cells have been used because of both the limited life span of normal human bronchial epithelial (NHBE) cells in culture (approximately 30-35 population doublins) and their resistance to in vitro malignant transformation. For example, human papillomavirus (HPV)-immortalized HBE cells have been used to study the genetic changes that occur after exposure to {alpha}-particles in vitro. Although this model may prove to be useful for studying the 18% or less of bronchogenic carcinomas found to contain HPV sequences, it is not an appropriate model for studying the majority of lung epithelial malignancies in which HPV DNA is not detected. This view is supported by the fact that HPV-immortalized cell lines commonly exhibit aneuploidy. This results of this study suggest that: (1) NHBE cells can be transiently transfected with the pCMV{Beta} vector; and (2) the antibiotic hygromycin-resistant transfected cells.

  15. Introduction of the yeast DNA repair gene PHR1 into normal and xeroderma pigmentosum human cells

    International Nuclear Information System (INIS)

    Whyte, D.B.

    1988-01-01

    The goal of the work described herein is to determine how UV light kills and mutates human cells. Specifically, the hypothesis to be tested states that the major cause of cell death is the cyclobutane dimer. The yeast (S. cerevisiae) enzyme photolyase provides an elegant means of dissecting the biological effects of the two lesions. Photolyase, the product of the PHR1 gene, catalyzes the visible light-dependent reversal of cyclobutane pyrimidine dimers. Introducing the gene for photolyase into human cells, which do not have a functional photoreactivation mechanism, should allow specific repair of cyclobutane pyrimidine dimers. To express the yeast DNA repair gene in human cells, the yeast PHR1 coding sequence was cloned into the mammalian expression vector pRSV4NEO-I. The resulting plasmid, pRSVPHR1, contains the coding sequence of the yeast gene, under control of transcription signals recognized by mammalian cells, and the dominant selectable gene neo. pRSVPHR1 was introduced into normal and XP SV40-transformed fibroblasts by the calcium phosphate coprecipitation technique, and G418-resistant clones were isolated. The level of PHR1 expression was determined by cytoplasmic RNA dot blots. Two clones, XP-3B and GM-20A, had high levels of expression

  16. Identification and Characterization of Plasma Cells in Normal Human Bone Marrow by High-Resolution Flow Cytometry

    NARCIS (Netherlands)

    Terstappen, Leonardus Wendelinus Mathias Marie; Johnsen, Steen; Segers-Nolten, Gezina M.J.; Loken, Michael R.

    1990-01-01

    The low frequency of plasma cells and the lack of specific cell surface markers has been a major obstacle for a detailed characterization of plasma cells in normal human bone marrow. Multiparameter flow cytometry enabled the identification of plasma cells in normal bone marrow aspirates. The plasma

  17. Isolation of a human anti-epidermal growth factor receptor Fab antibody, EG-19-11, with subnanomolar affinity from naïve immunoglobulin repertoires using a hierarchical antibody library system.

    Science.gov (United States)

    Hur, Byung-ung; Yoon, Jae-bong; Liu, Li-Kun; Cha, Sang-hoon

    2010-11-30

    Specific antibodies that possess a subnanomolar affinity are very difficult to obtain from human naïve immunoglobulin repertoires without the use of lengthy affinity optimization procedures. Here, we designed a hierarchical phage-displayed antibody library system to generate an enormous diversity of combinatorial Fab fragments (6×10(17)) and attempted to isolate high-affinity Fabs against the human epidermal growth factor receptor (EGFR). A primary antibody library, designated HuDVFab-8L, comprising 4.5×10(9) human naïve heavy chains and eight unspecified human naïve light chains was selected against the EGFR-Fc protein by biopanning, and four anti-EGFR Fab clones were isolated. Because one of the Fab clones, denoted EG-L2-11, recognized a native EGFR expressed on A431 cells, the heavy chain of the Fab was shuffled with a human naïve light chain repertoire with a diversity of 1.4×10(8) and selected a second time against the EGFR-Fc protein again. One EG-L2-11 variant, denoted EG-19-11, recognized an EGFR epitope that was almost the same as that bound by cetuximab and had a K(D) of approximately 540 pM for soluble EGFR, which is about 7-fold higher than that of the FabC225 derived from cetuximab. This variant was also internalized by A431 cells, likely via receptor-mediated endocytosis, and it efficiently inhibited EGF-mediated tyrosine phosphorylation of the EGFR. These results demonstrate that the use of our hierarchical antibody library system is advantageous in generating fully human antibodies especially with a therapeutic purpose. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Conjugation of gold nanoparticles and recombinant human endostatin modulates vascular normalization via interruption of anterior gradient 2-mediated angiogenesis.

    Science.gov (United States)

    Pan, Fan; Yang, Wende; Li, Wei; Yang, Xiao-Yan; Liu, Shuhao; Li, Xin; Zhao, Xiaoxu; Ding, Hui; Qin, Li; Pan, Yunlong

    2017-07-01

    Several studies have revealed the potential of normalizing tumor vessels in anti-angiogenic treatment. Recombinant human endostatin is an anti-angiogenic agent which has been applied in clinical tumor treatment. Our previous research indicated that gold nanoparticles could be a nanoparticle carrier for recombinant human endostatin delivery. The recombinant human endostatin-gold nanoparticle conjugates normalized vessels, which improved chemotherapy. However, the mechanism of recombinant human endostatin-gold nanoparticle-induced vascular normalization has not been explored. Anterior gradient 2 has been reported to be over-expressed in many malignant tumors and involved in tumor angiogenesis. To date, the precise efficacy of recombinant human endostatin-gold nanoparticles on anterior gradient 2-mediated angiogenesis or anterior gradient 2-related signaling cohort remained unknown. In this study, we aimed to explore whether recombinant human endostatin-gold nanoparticles could normalize vessels in metastatic colorectal cancer xenografts, and we further elucidated whether recombinant human endostatin-gold nanoparticles could interrupt anterior gradient 2-induced angiogenesis. In vivo, it was indicated that recombinant human endostatin-gold nanoparticles increased pericyte expression while inhibit vascular endothelial growth factor receptor 2 and anterior gradient 2 expression in metastatic colorectal cancer xenografts. In vitro, we uncovered that recombinant human endostatin-gold nanoparticles reduced cell migration and tube formation induced by anterior gradient 2 in human umbilical vein endothelial cells. Treatment with recombinant human endostatin-gold nanoparticles attenuated anterior gradient 2-mediated activation of MMP2, cMyc, VE-cadherin, phosphorylation of p38, and extracellular signal-regulated protein kinases 1 and 2 (ERK1/2) in human umbilical vein endothelial cells. Our findings demonstrated recombinant human endostatin-gold nanoparticles might normalize

  19. Topographical Distribution of Arsenic, Manganese, and Selenium in the Normal Human Brain

    DEFF Research Database (Denmark)

    Larsen, Niels Agersnap; Pakkenberg, H.; Damsgaard, Else

    1979-01-01

    The concentrations of arsenic, manganese and selenium per gram wet tissue weight were determined in samples from 24 areas of normal human brains from 5 persons with ages ranging from 15 to 81 years of age. The concentrations of the 3 elements were determined for each sample by means of neutron...... activation analysis with radiochemical separation. Distinct patterns of distribution were shown for each of the 3 elements. Variations between individuals were found for some but not all brain areas, resulting in coefficients of variation between individuals of about 30% for arsenic, 10% for manganese and 20......% for selenium. The results seem to indicate that arsenic is associated with the lipid phase, manganese with the dry matter and selenium with the aqueous phase of brain tissue....

  20. Expression of immunohistochemical markers for testicular carcinoma in situ by normal human fetal germ cells

    DEFF Research Database (Denmark)

    Jørgensen, N; Rajpert-De Meyts, E; Graem, N

    1995-01-01

    study. EXPERIMENTAL DESIGN: Normal human germ cells from 10 first-trimester fetuses and 76 second- and third-trimester testes were investigated for the immunohistochemical expression of the markers of testicular carcinoma in situ. The panel of markers included in the study consisted of placental......-like alkaline phosphatase, the protooncogene c-kit protein product, and the antigens for the monoclonal antibodies TRA-1-60 and M2A. The relative numbers of fetal germ cells that demonstrated positive reaction with the markers were calculated. RESULTS: The vast majority of the germ cells (75-100%) in the first......-trimester gonads were positive for placental-like alkaline phosphatase, TRA-1-60, and M2A. The c-kit protein was detected in three out of the ten first-trimester gonads. The relative number of germ cells positive for all the markers studied declined rapidly during the first part of the second trimester...

  1. Synthetic profiles of polypeptides of human oocytes and normal and abnormal preimplantation embryos.

    Science.gov (United States)

    Capmany, G; Bolton, V N

    1999-09-01

    There is considerable variation in the rate of development in vitro of individual preimplantation human embryos. The relationship between the rate of development and patterns of polypeptide synthesis in individual embryos was examined using SDS-PAGE and autoradiography. After incubation in [35S]methionine, 19 polypeptide bands were identified that change between fertilization and the morula stage. Although changes in two of the bands occurred in embryos that were developing normally and in ageing oocytes, and are thus independent of fertilization, the changes identified in the remaining 17 bands occurred only after fertilization. In embryos that were developing abnormally, as assessed by delayed cleavage, cleavage arrest or extensive fragmentation, the alteration in polypeptide synthetic profiles increased with increasing abnormality.

  2. DNA crosslinking and cytotoxicity in normal and transformed human cells treated with antitumor nitrosoureas.

    Science.gov (United States)

    Erickson, L C; Bradley, M O; Ducore, J M; Ewig, R A; Kohn, K W

    1980-01-01

    Normal (IMR-90) and simian virus 40-transformed (VA-13) human embryo cells were treated with antitumor nitrosoureas, and the effects on cell viability and cell DNA were compared. All six nitrosoureas tested were more toxic to VA-13 cells than to IMR-90 cells as measured by decrease in cell proliferation or in colony formation. The nitrosoureas capable of generating alkylisocyanates produced a smaller difference between the cell types than did derivatives lacking this capacity. DNA damage was measured by alkaline elution in cells treated with four chloroethylnitrosoureas. Whereas VA-13 cells exhibited dose-dependent interstrand crosslinking, little or none was detected in IMR-90 cells. The IMR-90 cells, however, exhibited at least as much DNA-protein crosslinking as did VA-13 cells. The results can be interpreted in terms of a possible difference in DNA repair between the cell lines. PMID:6928639

  3. Binding of digitoxin and digoxin to normal human β-lipoproteins

    International Nuclear Information System (INIS)

    Brock, A.

    1976-01-01

    The binding of digitoxin and digoxin to purified β-lipoprotein, obtained from pooled normal human serum, was studied under equilibrium conditions. Even with as high concentrations of unbound digitoxin or digoxin as 4 μmol/l, the preparations of β-lipoproteins, containing cholesterol 1.98-3.95 mmol/l, showed no signs of saturation. The binding affinity of digitoxin was about ten times as high as that of digoxin. Gel filtration chromatography, performed on native serum after addition of 3 H-digitoxin or 3 H-digoxin, showed a minor fraction of the cardiac glycosides to be associated with te protein fraction of highest molecular weight. This phenomenon disappeared after precipitation of the β-lipoproteins. In clinical relations the contribution of protein-bound digitoxin caused by the lipoprotein interaction is immaterial compared to that caused by the albumin interaction. (author)

  4. Positron emission tomography studies in the normal and abnormal ageing of human brain

    International Nuclear Information System (INIS)

    Comar, D.; Baron, J.C.

    1987-01-01

    Until recently, the investigation of the neurophysiological correlates of normal and abnormal ageing of the human brain was limited by methodological constraints, as the technics available provided only a few parameters (e.g. electroencephalograms, cerebral blood flow) monitored in superficial brain structures in a grossly regional and poorly quantitative way. Lately several non invasive techniques have been developed which allow to investigate in vivo both quantitatively and on local basis a number of previously inaccessible important aspects of brain function. Among these techniques, such as single photon emission tomography imaging of computerized electric events, nuclear magnetic resonance, positron emission tomography stands out as the most powerful and promising method since it allows the in vivo measurement of biochemical and pharmacological parameters

  5. Human Mesenchymal Stem Cell Treatment Normalizes Cortical Gene Expression after Traumatic Brain Injury.

    Science.gov (United States)

    Darkazalli, Ali; Vied, Cynthia; Badger, Crystal-Dawn; Levenson, Cathy W

    2017-01-01

    Traumatic brain injury (TBI) results in a progressive disease state with many adverse and long-term neurological consequences. Mesenchymal stem cells (MSCs) have emerged as a promising cytotherapy and have been previously shown to reduce secondary apoptosis and cognitive deficits associated with TBI. Consistent with the established literature, we observed that systemically administered human MSCs (hMSCs) accumulate with high specificity at the TBI lesion boundary zone known as the penumbra. Substantial work has been done to illuminate the mechanisms by which MSCs, and the bioactive molecules they secrete, exert their therapeutic effect. However, no such work has been published to examine the effect of MSC treatment on gene expression in the brain post-TBI. In the present study, we use high-throughput RNA sequencing (RNAseq) of cortical tissue from the TBI penumbra to assess the molecular effects of both TBI and subsequent treatment with intravenously delivered hMSCs. RNAseq revealed that expression of almost 7000 cortical genes in the penumbra were differentially regulated by TBI. Pathway analysis using the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway database revealed that TBI regulated a large number of genes belonging to pathways involved in metabolism, receptor-mediated cell signaling, neuronal plasticity, immune cell recruitment and infiltration, and neurodegenerative disease. Remarkably, hMSC treatment was found to normalize 49% of all genes disrupted by TBI, with notably robust normalization of specific pathways within the categories mentioned above, including neuroactive receptor-ligand interactions (57%), glycolysis and gluconeogenesis (81%), and Parkinson's disease (100%). These data provide evidence in support of the multi-mechanistic nature of stem cell therapy and suggest that hMSC treatment is capable of simultaneously normalizing a wide variety of important molecular pathways that are disrupted by brain injury.

  6. Digital music exposure reliably induces temporary threshold shift in normal-hearing human subjects.

    Science.gov (United States)

    Le Prell, Colleen G; Dell, Shawna; Hensley, Brittany; Hall, James W; Campbell, Kathleen C M; Antonelli, Patrick J; Green, Glenn E; Miller, James M; Guire, Kenneth

    2012-01-01

    One of the challenges for evaluating new otoprotective agents for potential benefit in human populations is the availability of an established clinical paradigm with real-world relevance. These studies were explicitly designed to develop a real-world digital music exposure that reliably induces temporary threshold shift (TTS) in normal-hearing human subjects. Thirty-three subjects participated in studies that measured effects of digital music player use on hearing. Subjects selected either rock or pop music, which was then presented at 93 to 95 (n = 10), 98 to 100 (n = 11), or 100 to 102 (n = 12) dBA in-ear exposure level for a period of 4 hr. Audiograms and distortion product otoacoustic emissions (DPOAEs) were measured before and after music exposure. Postmusic tests were initiated 15 min, 1 hr 15 min, 2 hr 15 min, and 3 hr 15 min after the exposure ended. Additional tests were conducted the following day and 1 week later. Changes in thresholds after the lowest-level exposure were difficult to distinguish from test-retest variability; however, TTS was reliably detected after higher levels of sound exposure. Changes in audiometric thresholds had a "notch" configuration, with the largest changes observed at 4 kHz (mean = 6.3 ± 3.9 dB; range = 0-14 dB). Recovery was largely complete within the first 4 hr postexposure, and all subjects showed complete recovery of both thresholds and DPOAE measures when tested 1 week postexposure. These data provide insight into the variability of TTS induced by music-player use in a healthy, normal-hearing, young adult population, with music playlist, level, and duration carefully controlled. These data confirm the likelihood of temporary changes in auditory function after digital music-player use. Such data are essential for the development of a human clinical trial protocol that provides a highly powered design for evaluating novel therapeutics in human clinical trials. Care must be taken to fully inform potential subjects in

  7. Digital music exposure reliably induces temporary threshold shift (TTS) in normal hearing human subjects

    Science.gov (United States)

    Le Prell, C. G.; Dell, S.; Hensley, B.; Hall, J. W.; Campbell, K. C. M.; Antonelli, P. J.; Green, G. E.; Miller, J. M.; Guire, K.

    2012-01-01

    Objectives One of the challenges for evaluating new otoprotective agents for potential benefit in human populations is availability of an established clinical paradigm with real world relevance. These studies were explicitly designed to develop a real-world digital music exposure that reliably induces temporary threshold shift (TTS) in normal hearing human subjects. Design Thirty-three subjects participated in studies that measured effects of digital music player use on hearing. Subjects selected either rock or pop music, which was then presented at 93–95 (n=10), 98–100 (n=11), or 100–102 (n=12) dBA in-ear exposure level for a period of four hours. Audiograms and distortion product otoacoustic emissions (DPOAEs) were measured prior to and after music exposure. Post-music tests were initiated 15 min, 1 hr 15 min, 2 hr 15 min, and 3 hr 15 min after the exposure ended. Additional tests were conducted the following day and one week later. Results Changes in thresholds after the lowest level exposure were difficult to distinguish from test-retest variability; however, TTS was reliably detected after higher levels of sound exposure. Changes in audiometric thresholds had a “notch” configuration, with the largest changes observed at 4 kHz (mean=6.3±3.9dB; range=0–13 dB). Recovery was largely complete within the first 4 hours post-exposure, and all subjects showed complete recovery of both thresholds and DPOAE measures when tested 1-week post-exposure. Conclusions These data provide insight into the variability of TTS induced by music player use in a healthy, normal-hearing, young adult population, with music playlist, level, and duration carefully controlled. These data confirm the likelihood of temporary changes in auditory function following digital music player use. Such data are essential for the development of a human clinical trial protocol that provides a highly powered design for evaluating novel therapeutics in human clinical trials. Care must be

  8. Optical redox imaging indices discriminate human breast cancer from normal tissues

    Science.gov (United States)

    Xu, He N.; Tchou, Julia; Feng, Min; Zhao, Huaqing; Li, Lin Z.

    2016-01-01

    Abstract. Our long-term goal was to investigate the potential of incorporating redox imaging technique as a breast cancer (BC) diagnosis component to increase the positive predictive value of suspicious imaging finding and to reduce unnecessary biopsies and overdiagnosis. We previously found that precancer and cancer tissues in animal models displayed abnormal mitochondrial redox state. We also revealed abnormal mitochondrial redox state in cancerous specimens from three BC patients. Here, we extend our study to include biopsies of 16 patients. Tissue aliquots were collected from both apparently normal and cancerous tissues from the affected cancer-bearing breasts shortly after surgical resection. All specimens were snap-frozen and scanned with the Chance redox scanner, i.e., the three-dimensional cryogenic NADH/Fp (reduced nicotinamide adenine dinucleotide/oxidized flavoproteins) fluorescence imager. We found both Fp and NADH in the cancerous tissues roughly tripled that in the normal tissues (predox ratio Fp/(NADH + Fp) was ∼27% higher in the cancerous tissues (predox ratio alone could predict cancer with reasonable sensitivity and specificity. Our findings suggest that the optical redox imaging technique can provide parameters independent of clinical factors for discriminating cancer from noncancer breast tissues in human patients. PMID:27896360

  9. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  10. Normality and naturalness: a comparison of the meanings of concepts used within veterinary medicine and human medicine.

    Science.gov (United States)

    Lerner, Henrik; Hofmann, Bjørn

    2011-12-01

    This article analyses the different connotations of "normality" and "being natural," bringing together the theoretical discussion from both human medicine and veterinary medicine. We show how the interpretations of the concepts in the different areas could be mutually fruitful. It appears that the conceptions of "natural" are more elaborate in veterinary medicine, and can be of value to human medicine. In particular they can nuance and correct conceptions of nature in human medicine that may be too idealistic. Correspondingly, the wide ranging conceptions of "normal" in human medicine may enrich conceptions in veterinary medicine, where the discussions seem to be sparse. We do not argue that conceptions from veterinary medicine should be used in human medicine and vice versa, but only that it could be done and that it may well be fruitful. Moreover, there are overlaps between some notions of normal and natural, and further conceptual analysis on this overlap is needed.

  11. Facilitation of tear fluid secretion by 3% diquafosol ophthalmic solution in normal human eyes.

    Science.gov (United States)

    Yokoi, Norihiko; Kato, Hiroaki; Kinoshita, Shigeru

    2014-01-01

    To evaluate the increase in tear fluid volume induced by 3% diquafosol ophthalmic solution in normal human eyes. Prospective, randomized, double-masked, comparative study. Twenty healthy adults (17 males and 3 females; mean age, 38.8 years) underwent topical instillation of 2 ophthalmic solutions, artificial tears in 1 eye and 3% diquafosol ophthalmic solution in the fellow eye, in a masked manner. The radius of curvature of the central lower tear meniscus was measured at 5, 10, 15, 30, and 60 minutes after instillation by use of reflective meniscometry, and subjects' self-evaluated symptoms of wetness and stinging using a visual analog scale. Changes after instillation in the radius of curvature from baseline (artificial tear group vs diquafosol group; mean ± standard error of the mean) were as follows: at 5 minutes, -0.008 ± 0.012 vs 0.045 ± 0.013; at 10 minutes, 0.001 ± 0.014 vs 0.057 ± 0.016; at 15 minutes, -0.012 ± 0.014 vs 0.037 ± 0.019; at 30 minutes, -0.010 ± 0.016 vs 0.030 ± 0.025; and at 60 minutes, -0.029 ± 0.012 vs -0.020 ± 0.012. The diquafosol group showed significantly greater values from 5 to 30 minutes after instillation. Of the 40 eyes, 13 showed abnormal tear film breakup time (≤5 seconds). The diquafosol group had significantly more wetness at 15 minutes after instillation than did the artificial tear group. Topical instillation of 3% diquafosol ophthalmic solution increases tear fluid on the ocular surface for up to 30 minutes in normal human eyes. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Energetic heavy ions accelerate differentiation in the descendants of irradiated normal human diploid fibroblasts

    International Nuclear Information System (INIS)

    Hamada, Nobuyuki; Hara, Takamitsu; Funayama, Tomoo; Sakashita, Tetsuya; Kobayashi, Yasuhiko

    2008-01-01

    Ionizing radiation-induced genomic instability has been demonstrated in a variety of endpoints such as delayed reproductive death, chromosome instability and mutations, which occurs in the progeny of survivors many generations after the initial insult. Dependence of these effects on the linear energy transfer (LET) of the radiation is incompletely characterized; however, our previous work has shown that delayed reductions in clonogenicity can be most pronounced at LET of 108 keV/μm. To gain insight into potential cellular mechanisms involved in LET-dependent delayed loss of clonogenicity, we investigated morphological changes in colonies arising from normal human diploid fibroblasts exposed to γ-rays or energetic carbon ions (108 keV/μm). Exposure of confluent cultures to carbon ions was 4-fold more effective at inactivating cellular clonogenic potential and produced more abortive colonies containing reduced number of cells per colony than γ-rays. Second, colonies were assessed for clonal morphotypic heterogeneity. The yield of differentiated cells was elevated in a dose- and LET-dependent fashion in clonogenic colonies, whereas differentiated cells predominated to a comparable extent irrespective of radiation type or dose in abortive colonies. The incidence of giant or multinucleated cells was also increased but much less frequent than that of differentiated cells. Collectively, our results indicate that carbon ions facilitate differentiation more effectively than γ-rays as a major response in the progeny of irradiated fibroblasts. Accelerated differentiation may account, at least in part, for dose- and LET-dependent delayed loss of clonogenicity in normal human diploid cells, and could be a defensive mechanism that minimizes further expansion of aberrant cells

  13. Low Density Lipoprotein and Non-Newtonian Oscillating Flow Biomechanical Parameters for Normal Human Aorta.

    Science.gov (United States)

    Soulis, Johannes V; Fytanidis, Dimitrios K; Lampri, Olga P; Giannoglou, George D

    2016-04-01

    The temporal variation of the hemodynamic mechanical parameters during cardiac pulse wave is considered as an important atherogenic factor. Applying non-Newtonian blood molecular viscosity simulation is crucial for hemodynamic analysis. Understanding low density lipoprotein (LDL) distribution in relation to flow parameters will possibly spot the prone to atherosclerosis aorta regions. The biomechanical parameters tested were averaged wall shear stress (AWSS), oscillatory shear index (OSI) and relative residence time (RRT) in relation to the LDL concentration. Four non-Newtonian molecular viscosity models and the Newtonian one were tested for the normal human aorta under oscillating flow. The analysis was performed via computational fluid dynamic. Tested viscosity blood flow models for the biomechanical parameters yield a consistent aorta pattern. High OSI and low AWSS develop at the concave aorta regions. This is most noticeable in downstream flow region of the left subclavian artery and at concave ascending aorta. Concave aorta regions exhibit high RRT and elevated LDL. For the concave aorta site, the peak LDL value is 35.0% higher than its entrance value. For the convex site, it is 18.0%. High LDL endothelium regions located at the aorta concave site are well predicted with high RRT. We are in favor of using the non-Newtonian power law model for analysis. It satisfactorily approximates the molecular viscosity, WSS, OSI, RRT and LDL distribution. Concave regions are mostly prone to atherosclerosis. The flow biomechanical factor RRT is a relatively useful tool for identifying the localization of the atheromatic plaques of the normal human aorta.

  14. Hair Follicle and Sebaceous Gland De Novo Regeneration With Cultured Epidermal Stem Cells and Skin-Derived Precursors.

    Science.gov (United States)

    Wang, Xiaoxiao; Wang, Xusheng; Liu, Jianjun; Cai, Ting; Guo, Ling; Wang, Shujuan; Wang, Jinmei; Cao, Yanpei; Ge, Jianfeng; Jiang, Yuyang; Tredget, Edward E; Cao, Mengjun; Wu, Yaojiong

    2016-12-01

    : Stem cell-based organ regeneration is purported to enable the replacement of impaired organs in the foreseeable future. Here, we demonstrated that a combination of cultured epidermal stem cells (Epi-SCs) derived from the epidermis and skin-derived precursors (SKPs) was capable of reconstituting functional hair follicles and sebaceous glands (SG). When Epi-SCs and SKPs were mixed in a hydrogel and implanted into an excisional wound in nude mice, the Epi-SCs formed de novo epidermis along with hair follicles, and SKPs contributed to dermal papilla in the neogenic hair follicles. Notably, a combination of culture-expanded Epi-SCs and SKPs derived from the adult human scalp were sufficient to generate hair follicles and hair. Bone morphogenetic protein 4, but not Wnts, sustained the expression of alkaline phosphatase in SKPs in vitro and the hair follicle-inductive property in vivo when SKPs were engrafted with neonatal epidermal cells into excisional wounds. In addition, Epi-SCs were capable of differentiating into sebocytes and formed de novo SGs, which excreted lipids as do normal SGs. Thus our results indicate that cultured Epi-SCs and SKPs are sufficient to generate de novo hair follicles and SGs, implying great potential to develop novel bioengineered skin substitutes with appendage genesis capacity. In postpartum humans, skin appendages lost in injury are not regenerated, despite the considerable achievement made in skin bioengineering. In this study, transplantation of a combination of culture-expanded epidermal stem cells and skin-derived progenitors from mice and adult humans led to de novo regeneration of functional hair follicles and sebaceous glands. The data provide transferable knowledge for the development of novel bioengineered skin substitutes with epidermal appendage regeneration capacity. ©AlphaMed Press.

  15. Human studies of prepulse inhibition of startle: normal subjects, patient groups, and pharmacological studies.

    Science.gov (United States)

    Braff, D L; Geyer, M A; Swerdlow, N R

    2001-07-01

    Since the mid-1970s, cross-species translational studies of prepulse inhibition (PPI) have increased at an astounding pace as the value of this neurobiologically informative measure has been optimized. PPI occurs when a relatively weak sensory event (the prepulse) is presented 30-500 ms before a strong startle-inducing stimulus, and reduces the magnitude of the startle response. In humans, PPI occurs in a robust, predictable manner when the prepulse and startling stimuli occur in either the same or different modalities (acoustic, visual, or cutaneous). This review covers three areas of interest in human PPI studies. First, we review the normal influences on PPI related to the underlying construct of sensori- (prepulse) motor (startle reflex) gating. Second, we review PPI studies in psychopathological disorders that form a family of gating disorders. Third, we review the relatively limited but interesting and rapidly expanding literature on pharmacological influences on PPI in humans. All studies identified by a computerized literature search that addressed the three topics of this review were compiled and evaluated. The principal studies were summarized in appropriate tables. The major influences on PPI as a measure of sensorimotor gating can be grouped into 11 domains. Most of these domains are similar across species, supporting the value of PPI studies in translational comparisons across species. The most prominent literature describing deficits in PPI in psychiatrically defined groups features schizophrenia-spectrum patients and their clinically unaffected relatives. These findings support the use of PPI as an endophenotype in genetic studies. Additional groups of psychopathologically disordered patients with neuropathology involving cortico-striato-pallido-pontine circuits exhibit poor gating of motor, sensory, or cognitive information and corresponding PPI deficits. These groups include patients with obsessive compulsive disorder, Tourette's syndrome

  16. Higher Leptin but Not Human Milk Macronutrient Concentration Distinguishes Normal-Weight from Obese Mothers at 1-Month Postpartum.

    Science.gov (United States)

    De Luca, Arnaud; Frasquet-Darrieux, Marine; Gaud, Marie-Agnès; Christin, Patricia; Boquien, Clair-Yves; Millet, Christine; Herviou, Manon; Darmaun, Dominique; Robins, Richard J; Ingrand, Pierre; Hankard, Régis

    2016-01-01

    Exclusively breastfed infants born to obese mothers have previously been shown to gain less weight by 1-month postpartum than infants of normal-weight mothers. Our hypothesis is that human milk composition and volume may differ between obese and normal-weight mothers. To compare human milk leptin, macronutrient concentration, and volume in obese and normal-weight mothers. Mother and infant characteristics were studied as secondary aims. This cross-sectional observational study compared 50 obese mothers matched for age, parity, ethnic origin, and educational level with 50 normal-weight mothers. Leptin, macronutrient human milk concentration, and milk volume were determined at 1 month in exclusively breastfed infants. Mother characteristics and infant growth were recorded. Human milk leptin concentration was higher in obese mothers than normal-weight mothers (4.8±2.7 vs. 2.5±1.5 ng.mL-1, pobese and normal-weight mothers in protein, lipid, carbohydrate content, and volume, nor in infant weight gain. Leptin concentration was higher in the milk of obese mothers than that of normal-weight mothers, but macronutrient concentration was not. It remains to be established whether the higher leptin content impacts on infant growth beyond the 1-month of the study period.

  17. Co-inhibition of epidermal growth factor receptor and insulin-like growth factor receptor 1 enhances radiosensitivity in human breast cancer cells

    International Nuclear Information System (INIS)

    Li, Ping; Veldwijk, Marlon R; Zhang, Qing; Li, Zhao-bin; Xu, Wen-cai; Fu, Shen

    2013-01-01

    Over-expression of epidermal growth factor receptor (EGFR) or insulin-like growth factor-1 receptor (IGF-1R) have been shown to closely correlate with radioresistance of breast cancer cells. This study aimed to investigate the impact of co-inhibition of EGFR and IGF-1R on the radiosensitivity of two breast cancer cells with different profiles of EGFR and IGF-1R expression. The MCF-7 (EGFR +/−, IGF-1R +++) and MDA-MB-468 (EGFR +++, IGF-1R +++) breast cancer cell lines were used. Radiosensitizing effects were determined by colony formation assay. Apoptosis and cell cycle distribution were measured by flow cytometry. Phospho-Akt and phospho-Erk1/2 were quantified by western blot. In vivo studies were conducted using MDA-MB-468 cells xenografted in nu/nu mice. In MDA-MB-468 cells, the inhibition of IGF-1R upregulated the p-EGFR expression. Either EGFR (AG1478) or IGF-1R inhibitor (AG1024) radiosensitized MDA-MB-468 cells. In MCF-7 cells, radiosensitivity was enhanced by AG1024, but not by AG1478. Synergistical radiosensitizing effect was observed by co-inhibition of EGFR and IGF-1R only in MDA-MB-468 cells with a DMF 10% of 1.90. The co-inhibition plus irradiation significantly induced more apoptosis and arrested the cells at G0/G1 phase in MDA-MB-468 cells. Only co-inhibition of EGFR and IGF-1R synergistically diminished the expression of p-Akt and p-Erk1/2 in MDA-MB-468 cells. In vivo studies further verified the radiosensitizing effects by co-inhibition of both pathways in a MDA-MB-468 xenograft model. Our data suggested that co-inhibition of EGFR and IGF-1R synergistically radiosensitized breast cancer cells with both EGFR and IGF-1R high expression. The approach may have an important therapeutic implication in the treatment of breast cancer patients with high expression of EGFR and IGF-1R

  18. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  19. Human BLCAP transcript: new editing events in normal and cancerous tissues.

    Science.gov (United States)

    Galeano, Federica; Leroy, Anne; Rossetti, Claudia; Gromova, Irina; Gautier, Philippe; Keegan, Liam P; Massimi, Luca; Di Rocco, Concezio; O'Connell, Mary A; Gallo, Angela

    2010-07-01

    Bladder cancer-associated protein (BLCAP) is a highly conserved protein among species, and it is considered a novel candidate tumor suppressor gene originally identified from human bladder carcinoma. However, little is known about the regulation or the function of this protein. Here, we show that the human BLCAP transcript undergoes multiple A-to-I editing events. Some of the new editing events alter the highly conserved amino terminus of the protein creating alternative protein isoforms by changing the genetically coded amino acids. We found that both ADAR1 and ADAR2-editing enzymes cooperate to edit this transcript and that different tissues displayed distinctive ratios of edited and unedited BLCAP transcripts. Moreover, we observed a general decrease in BLCAP-editing level in astrocytomas, bladder cancer and colorectal cancer when compared with the related normal tissues. The newly identified editing events, found to be downregulated in cancers, could be useful for future studies as a diagnostic tool to distinguish malignancies or epigenetic changes in different tumors.

  20. Apple Flavonoids Suppress Carcinogen-Induced DNA Damage in Normal Human Bronchial Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Vazhappilly Cijo George

    2017-01-01

    Full Text Available Scope. Human neoplastic transformation due to DNA damage poses an increasing global healthcare concern. Maintaining genomic integrity is crucial for avoiding tumor initiation and progression. The present study aimed to investigate the efficacy of an apple flavonoid fraction (AF4 against various carcinogen-induced toxicity in normal human bronchial epithelial cells and its mechanism of DNA damage response and repair processes. Methods and Results. AF4-pretreated cells were exposed to nicotine-derived nitrosamine ketones (NNK, NNK acetate (NNK-Ae, methotrexate (MTX, and cisplatin to validate cytotoxicity, total reactive oxygen species, intracellular antioxidants, DNA fragmentation, and DNA tail damage. Furthermore, phosphorylated histone (γ-H2AX and proteins involved in DNA damage (ATM/ATR, Chk1, Chk2, and p53 and repair (DNA-PKcs and Ku80 mechanisms were evaluated by immunofluorescence and western blotting, respectively. The results revealed that AF4-pretreated cells showed lower cytotoxicity, total ROS generation, and DNA fragmentation along with consequent inhibition of DNA tail moment. An increased level of γ-H2AX and DNA damage proteins was observed in carcinogen-treated cells and that was significantly (p≤0.05 inhibited in AF4-pretreated cells, in an ATR-dependent manner. AF4 pretreatment also facilitated the phosphorylation of DNA-PKcs and thus initiation of repair mechanisms. Conclusion. Apple flavonoids can protect in vitro oxidative DNA damage and facilitate repair mechanisms.

  1. Age-dependent changes of the normal human spine during adulthood.

    Science.gov (United States)

    Rühli, F J; Müntener, M; Henneberg, M

    2005-01-01

    The impact of aging on the morphology of the osseous spine is still debated. Clinical studies usually record combined aging effects, as well as age-related degenerative changes. The aim of this study was to determine the impact of (degeneration-independent) aging on the morphology of the osseous human spine during adulthood. Various osseous dimensions of human spinal landmarks at all major vertebral levels have been assessed in macroscopically normal Swiss skeletons (N = 71), with historically known sex and age at death, as well as in larger Central European skeletal samples (N = 277) with anthropologically determined individual age and sex. All measurements were correlated with individual age (or age group) by linear regression and analyzed separately for each sex. Only few osseous spinal dimensions, and only in men, correlate significantly with individual age. Generally, the significant dimensions show an increase in size during adulthood. Similar tendencies, but with significant alterations of spinal measurements in women as well, can be found in the larger samples with anthropologically determined sex and age group. Increase of certain spinal dimensions found in this study may be a reflection of an increase in the robustness of individuals with age. Because of the absence of a significant secular alteration of stature within the well-recorded sample, we exclude secular change in body dimensions as a major bias. Copyright 2005 Wiley Periodicals, Inc

  2. Cell-surface glycoproteins of human sarcomas: differential expression in normal and malignant tissues and cultured cells

    International Nuclear Information System (INIS)

    Rettig, W.F.; Garin-Chesa, P.; Beresford, H.R.; Oettgen, H.F.; Melamed, M.R.; Old, L.J.

    1988-01-01

    Normal differentiation and malignant transformation of human cells are characterized by specific changes in surface antigen phenotype. In the present study, the authors have defined six cell-surface antigens of human sarcomas and normal mesenchymal cells, by using mixed hemadsorption assays and immunochemical methods for the analysis of cultured cells and immunohistochemical staining for the analysis of normal tissues and > 200 tumor specimens. Differential patterns of F19, F24, G171, G253, S5, and Thy-1 antigen expression were found to characterize (i) subsets of cultured sarcoma cell lines, (ii) cultured fibroblasts derived from various organs, (iii) normal resting and activated mesenchymal tissues, and (iv) sarcoma and nonmesenchymal tumor tissues. These results provide a basic surface antigenic map for cultured mesenchymal cells and mesenchymal tissues and permit the classification of human sarcomas according to their antigenic phenotypes

  3. In vitro assessment of antiproliferative action selectivity of dietary isothiocyanates for tumor versus normal human cells

    Directory of Open Access Journals (Sweden)

    Konić-Ristić Aleksandra

    2016-01-01

    Full Text Available Background/Aim. Numerous epidemiological studies have shown beneficial effects of cruciferous vegetables consumption in cancer chemoprevention. Biologically active compounds of different Brassicaceae species with antitumor potential are isothiocyanates, present in the form of their precursors - glucosinolates. The aim of this study was to determine the selectivity of antiproliferative action of dietary isothiocyanates for malignant versus normal cells. Methods. Antiproliferative activity of three isothiocyanates abundant in human diet: sulforaphane, benzyl isothiocyanate (BITC and phenylethyl isothiocyanate, on human cervix carcinoma cell line - HeLa, melanoma cell line - Fem-x, and colon cancer cell line - LS 174, and on peripheral blood mononuclear cells (PBMC, with or without mitogen, were determined by MTT colorimetric assay 72 h after their continuous action. Results. All investigated isothiocyanates inhibited the proliferation of HeLa, Fem-x and LS 174 cells. On all cell lines treated, BITC was the most potent inhibitor of cell proliferation with half-maximum inhibitory concentration (IC50 values of 5.04 mmoL m-3 on HeLa cells, 2.76 mmol m-3 on Fem-x, and 14.30 mmol m-3 on LS 174 cells. Antiproliferative effects on human PBMC were with higher IC50 than on malignant cells. Indexes of selectivity, calculated as a ratio between IC50 values obtained on PBMC and malignant cells, were between 1.12 and 16.57, with the highest values obtained for the action of BITC on melanoma Fem-x cells. Conclusion. Based on its antiproliferative effects on malignant cells, as well as the selectivity of the action to malignant vs normal cells, benzyl isothiocyanate can be considered as a promising candidate in cancer chemoprevention. In general, the safety of investigated compounds, in addition to their antitumor potential, should be considered as an important criterion in cancer chemoprevention. Screening of selectivity is a plausible approach to the evaluation

  4. Human adipose tissue from normal and tumoral breast regulates the behavior of mammary epithelial cells.

    Science.gov (United States)

    Pistone Creydt, Virginia; Fletcher, Sabrina Johanna; Giudice, Jimena; Bruzzone, Ariana; Chasseing, Norma Alejandra; Gonzalez, Eduardo Gustavo; Sacca, Paula Alejandra; Calvo, Juan Carlos

    2013-02-01

    Stromal-epithelial interactions mediate both breast development and breast cancer progression. In the present work, we evaluated the effects of conditioned media (CMs) of human adipose tissue explants from normal (hATN) and tumor (hATT) breast on proliferation, adhesion, migration and metalloproteases activity on tumor (MCF-7 and IBH-7) and non-tumor (MCF-10A) human breast epithelial cell lines. Human adipose tissues were obtained from patients and the conditioned medium from hATN and hATT collected after 24 h of incubation. MCF-10A, MCF-7 and IBH-7 cells were grown and incubated with CMs and proliferation and adhesion, as well as migration ability and metalloprotease activity, of epithelial cells after exposing cell cultures to hATN- or hATT-CMs were quantified. The statistical significance between different experimental conditions was evaluated by one-way ANOVA. Tukey's post hoc tests were performed. Tumor and non-tumor breast epithelial cells significantly increased their proliferation activity after 24 h of treatment with hATT-CMs compared to control-CMs. Furthermore, cellular adhesion of these two tumor cell lines was significantly lower with hATT-CMs than with hATN-CMs. Therefore, hATT-CMs seem to induce significantly lower expression or less activity of the components involved in cellular adhesion than hATN-CMs. In addition, hATT-CMs induced pro-MMP-9 and MMP-9 activity and increased the migration of MCF-7 and IBH-7 cells compared to hATN-CMs. We conclude that the microenvironment of the tumor interacts in a dynamic way with the mutated epithelium. This evidence leads to the possibility to modify the tumor behavior/phenotype through the regulation or modification of its microenvironment. We developed a model in which we obtained CMs from adipose tissue explants completely, either from normal or tumor breast. In this way, we studied the contribution of soluble factors independently of the possible effects of direct cell contact.

  5. METHODS USED FOR THE VIRTUAL HUMAN BONES AND JOINTS RECONSTRUCTION. NORMAL AND PATHOLOGICAL HUMAN JOINTS VIRTUAL SIMULATIONS

    Directory of Open Access Journals (Sweden)

    POPA Laurentiu Dragos

    2015-06-01

    Full Text Available To understand the problems, which appear in every human joint, it is very important to know the anatomy and morphology of the human bones and the way in which the components are working together to realize a normal functionality. For this purpose was used a CAD parametric software which permits to define models with a high degree of difficulty. First, it was used a CT or MRI device to obtain the parallel sections to study each component of the bone. A 3D scanner can be used only for the outer geometry. In the second step the images were transferred to a 2D CAD software, like AutoCAD, where the outer and inner contours of the bone were approximate to polygonal lines composed by many segments. After this, the contours were transferred to a 3D CAD software, like SolidWorks, where, step by step, and section by section, was defined the virtual bone component. Additionally to the main shape can be attached other Loft, Round or Dome shapes. For some components, as vertebrae, mandible or skull bones, can be used a preliminary model obtained by parallel sections. Starting from this, the model can be defined using the main 3D curves and we can get the final virtual solid model. In some simulations, the soft components, as muscles or ligaments, were included in simulations using non-linear virtual springs. Also, sometimes were used implants or prosthetic elements. In the final of the paper, were extracted important conclusions.

  6. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal